WorldWideScience

Sample records for ephx1 complete nucleotide

  1. Polymorphisms of vitamin K-related genes (EPHX1 and VKORC1L1) and stable warfarin doses.

    Science.gov (United States)

    Chung, Jee-Eun; Lee, Kyung Eun; Chang, Byung Chul; Gwak, Hye Sun

    2018-01-30

    The aim of this study was to investigate the possible effects of EPHX1 and VKORC1L1 polymorphisms on variability of responses to warfarin. Sixteen single nucleotide polymorphisms (SNPs) in 201 patients with stable warfarin doses were analyzed including genes of VKORC1, CYP2C9, CYP4F2, GGCX, EPHX1 and VKORC1L1. Univariate analysis was conducted for the association of genotypes with stable warfarin doses. Multiple linear regression analysis was used to investigate factors that independently affected the inter-individual variability of warfarin dose requirements. The rs4072879 of VKORC1L1 (A>G) was significantly associated with stable warfarin doses; wild homozygote carriers (AA) required significantly lower stable warfarin doses than those with the variant G allele (5.02±1.56 vs. 5.96±2.01mg; p=0.001). Multivariate analysis showed that EPHX1 rs1877724 and VKORC1L1 rs4072879 accounted for 1.5% and 1.3% of the warfarin dose variability. Adding EPHX1 and VKORC1L1 SNPs to the base model including non-genetic variables (operation age, body weight and the therapy of ACEI or ARB) and genetic variables (VKORC1 rs9934438, CYP2C9 rs1057910, and CYP4F2 rs2108622) gave a number needed to genotype of 34. This study showed that polymorphisms of EPHX1 and VKORC1L1 could be determinants of stable warfarin doses. Copyright © 2017. Published by Elsevier B.V.

  2. EPHX1 polymorphisms, COPD and asthma in 47,000 individuals and in meta-analysis

    DEFF Research Database (Denmark)

    Lee, J; Nordestgaard, B G; Dahl, Morten

    2011-01-01

    ,970 controls. The OR for spirometry-defined COPD or COPD hospitalisation did not differ from 1.0 for any of the EPHX1 genotypes or phenotypes overall, or in smokers or nonsmokers separately (p-value for trend 0.18-0.91). Likewise, EPHX1 genotypes or phenotypes did not associate with risk of asthma (p...

  3. Polymorphisms in xenobiotic metabolizing genes (EPHX1, NQO1 and PON1) in lymphoma susceptibility: a case control study

    International Nuclear Information System (INIS)

    Conesa-Zamora, Pablo; Vicente, Vicente; Pérez-Guillermo, Miguel; Ruiz-Cosano, Javier; Torres-Moreno, Daniel; Español, Ignacio; Gutiérrez-Meca, María D; Trujillo-Santos, Javier; Pérez-Ceballos, Elena; González-Conejero, Rocío; Corral, Javier

    2013-01-01

    The interplay between genetic susceptibility and carcinogenic exposure is important in the development of haematopoietic malignancies. EPHX1, NQO1 and PON1 are three genes encoding proteins directly involved in the detoxification of potential carcinogens. We have studied the prevalence of three functional polymorphisms affecting these genes rs1051740 EPHX1, rs1800566 NQO1 and rs662 PON1 in 215 patients with lymphoma and 214 healthy controls. Genotype frequencies for EPHX and NQO1 polymorphisms did not show any correlation with disease. In contrast, the GG genotype in the PON1 polymorphism was found to be strongly associated with the disease (15.3% vs. 4.7%; OR = 3.7 CI (95%): 1.8-7.7; p < 0.001). According to the pathological diagnosis this association was related to follicular (p = 0.004) and diffuse large B-cell (p = 0.016) lymphomas. Despite the fact that further confirmation is needed, this study shows that the PON1 GG genotype in rs662 polymorphism could be a risk factor for B-cell lymphomas

  4. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  5. Complete nucleotide sequence and organization of the mitogenome ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-02-01

    Feb 1, 2010 ... In this study, the complete mitochondrial genome (mitogenome) of E. autonoe was .... skew” was calculated for the PCGs between two strands and the ..... codon stem and 7 bp in the anticodon loop, but also con- tained a ...

  6. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  7. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  8. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  9. Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

    Directory of Open Access Journals (Sweden)

    Ji-Sun Park

    2015-01-01

    Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

  10. Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

    Science.gov (United States)

    Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

    2010-12-01

    Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

  11. Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

    Science.gov (United States)

    The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

  12. The complete nucleotide sequence of Alternanthera mosaic virus infecting Portulaca grandiflora represents a new strain distinct from phlox isolates.

    Science.gov (United States)

    Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G

    2011-04-01

    A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.

  13. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

    Science.gov (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

    2005-05-01

    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  14. Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

    Science.gov (United States)

    Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

    2012-07-01

    Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

  15. Genetic variation in genes for the xenobiotic-metabolizing enzymes CYP1A1, EPHX1, GSTM1, GSTT1 and GSTP1 and susceptibility to colorectal cancer in Lynch syndrome

    Science.gov (United States)

    Pande, Mala; Amos, Christopher I.; Osterwisch, Daniel R.; Chen, Jinyun; Lynch, Patrick M.; Broaddus, Russell; Frazier, Marsha L.

    2011-01-01

    Individuals with Lynch syndrome are predisposed to cancer due to an inherited DNA mismatch repair gene mutation. However, there is significant variability observed in disease expression, likely due to the influence of other environmental, lifestyle, or genetic factors. Polymorphisms in genes encoding xenobiotic-metabolizing enzymes may modify cancer risk by influencing the metabolism and clearance of potential carcinogens from the body. In this retrospective analysis, we examined key candidate gene polymorphisms in CYP1A1, EPHX1, GSTT1, GSTM1, and GSTP1 as modifiers of age at onset of colorectal cancer among 257 individuals with Lynch syndrome. We found that subjects heterozygous for CYP1A1 I462V (c.1384A>G) developed colorectal cancer 4 years earlier than those with the homozygous wild-type genotype (median ages 39 and 43 years, respectively; log-rank test P = 0.018). Furthermore, being heterozygous for the CYP1A1 polymorphisms, I462V and Msp1 (g.6235T>C), was associated with an increased risk for developing colorectal cancer [adjusted hazard ratio for AG relative to AA = 1.78, 95% CI = 1.16–2.74, P = 0.008; and hazard ratio for TC relative to TT = 1.53, 95% CI = 1.06–2.22, P = 0.02]. Since homozygous variants for both CYP1A1 polymorphisms were rare, risk estimates were imprecise. None of the other gene polymorphisms examined were associated with an earlier onset age for colorectal cancer. Our results suggest that the I462V and Msp1 polymorphisms in CYP1A1 may be an additional susceptibility factor for disease expression in Lynch syndrome since they modify the age of colorectal cancer onset by up to 4 years. PMID:18768509

  16. Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus.

    Science.gov (United States)

    Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H

    2008-01-01

    During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

  17. The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11

    International Nuclear Information System (INIS)

    Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre

    2003-01-01

    The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome

  18. Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

    Science.gov (United States)

    Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

    2010-09-01

    The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  19. Complete nucleotide sequences of a new bipartite begomovirus from Malvastrum sp. plants with bright yellow mosaic symptoms in South Texas.

    Science.gov (United States)

    Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel

    2016-06-01

    Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.

  20. Complete nucleotide sequence of Bacillus subtilis (natto) bacteriophage PM1, a phage associated with disruption of food production.

    Science.gov (United States)

    Umene, Kenichi; Shiraishi, Atsushi

    2013-06-01

    "Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.

  1. The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

    2009-01-01

    The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

  2. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    Science.gov (United States)

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was

  3. Complete nucleotide sequence and analysis of two conjugative broad host range plasmids from a marine microbial biofilm.

    Directory of Open Access Journals (Sweden)

    Peter Norberg

    Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.

  4. Complete nucleotide sequence of the self-transmissible TOL plasmid pD2RT provides new insight into arrangement of toluene catabolic plasmids

    DEFF Research Database (Denmark)

    Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili

    2013-01-01

    In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...

  5. Complete nucleotide sequence and genome analysis of bacteriophage BFK20 — A lytic phage of the industrial producer Brevibacterium flavum

    Czech Academy of Sciences Publication Activity Database

    Bukovska, G.; Klucar, L.; Vlček, Čestmír; Adamovic, J.; Turna, J.; Timko, J.

    2006-01-01

    Roč. 348, č. 1 (2006), s. 57-71 ISSN 0042-6822 Grant - others:Slovenská akademie věd(SK) VEGA2/5068/25; Science and Technology Assistance Agency(SK) APVT-51-025004 Institutional research plan: CEZ:AV0Z50520514 Keywords : Bacteriophage * Complete genome sequence * Sequence analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.525, year: 2006

  6. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

    2008-04-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

  7. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

    2008-01-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

  8. Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

    Science.gov (United States)

    Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

    2012-10-01

    To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

  9. Complete nucleotide sequence of pGA45, a 140,698-bp incFIIY plasmid encoding blaIMI-3-mediated carbapenem resistance, from river sediment

    Directory of Open Access Journals (Sweden)

    Bingjun eDang

    2016-02-01

    Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.

  10. The complete nucleotide sequences of the 5 genetically distinct plastid genomes of Oenothera, subsection Oenothera: II. A microevolutionary view using bioinformatics and formal genetic data.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg

    2008-09-01

    A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.

  11. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses.

    Science.gov (United States)

    Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen

    2013-01-01

    The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).

  12. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

    Directory of Open Access Journals (Sweden)

    Elizabeth N. Krueger

    2013-07-01

    Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.

  13. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  14. Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

    Science.gov (United States)

    Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

    2014-11-01

    In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

  15. Complete nucleotide sequence of CTX-M-15-plasmids from clinical Escherichia coli isolates: insertional events of transposons and insertion sequences.

    Directory of Open Access Journals (Sweden)

    Annemieke Smet

    Full Text Available BACKGROUND: CTX-M-producing Escherichia coli strains are regarded as major global pathogens. METHODOLOGY/PRINCIPAL FINDINGS: The nucleotide sequence of three plasmids (pEC_B24: 73801-bp; pEC_L8: 118525-bp and pEC_L46: 144871-bp from Escherichia coli isolates obtained from patients with urinary tract infections and one plasmid (pEC_Bactec: 92970-bp from an Escherichia coli strain isolated from the joint of a horse with arthritis were determined. Plasmid pEC_Bactec belongs to the IncI1 group and carries two resistance genes: bla(TEM-1 and bla(CTX-M-15. It shares more than 90% homology with a previously published bla(CTX-M-plasmid from E. coli of human origin. Plasmid pEC_B24 belongs to the IncFII group whereas plasmids pEC_L8 and pEC_L46 represent a fusion of two replicons of type FII and FIA. On the pEC_B24 backbone, two resistance genes, bla(TEM-1 and bla(CTX-M-15, were found. Six resistance genes, bla(TEM-1, bla(CTX-M-15, bla(OXA-1, aac6'-lb-cr, tetA and catB4, were detected on the pEC_L8 backbone. The same antimicrobial drug resistance genes, with the exception of tetA, were also identified on the pEC_L46 backbone. Genome analysis of all 4 plasmids studied provides evidence of a seemingly frequent transposition event of the bla(CTX-M-15-ISEcp1 element. This element seems to have a preferred insertion site at the tnpA gene of a bla(TEM-carrying Tn3-like transposon, the latter itself being inserted by a transposition event. The IS26-composite transposon, which contains the bla(OXA-1, aac6'-lb-cr and catB4 genes, was inserted into plasmids pEC_L8 and pEC_L46 by homologous recombination rather than a transposition event. Results obtained for pEC_L46 indicated that IS26 also plays an important role in structural rearrangements of the plasmid backbone and seems to facilitate the mobilisation of fragments from other plasmids. CONCLUSIONS: Collectively, these data suggests that IS26 together with ISEcp1 could play a critical role in the evolution of

  16. Complete nucleotide sequence of Sida golden mosaic Florida virus and phylogenetic relationships with other begomoviruses infecting malvaceous weeds in the Caribbean.

    Science.gov (United States)

    Fiallo-Olivé, Elvira; Martínez-Zubiaur, Yamila; Moriones, Enrique; Navas-Castillo, Jesús

    2010-09-01

    The complete genome sequence of two isolates of the bipartite begomovirus (genus Begomovirus, family Geminiviridae) Sida golden mosaic Florida virus (SiGMFV) is presented. We propose that both isolates, found infecting Malvastrum coromandelianum (family Malvaceae) in Cuba, belong to a new strain of SiGMFV. Phylogenetic analysis showed that SiGMFV DNA-A is located in a monophyletic cluster that includes begomoviruses infecting malvaceous weeds from the Caribbean.

  17. Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects.

    Science.gov (United States)

    Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2008-04-30

    The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.

  18. Characterization of the Complete Nucleotide Sequences of IncA/C2 Plasmids Carrying In809-Like Integrons from Enterobacteriaceae Isolates of Wildlife Origin.

    Science.gov (United States)

    Papagiannitsis, Costas C; Kutilova, Iva; Medvecky, Matej; Hrabak, Jaroslav; Dolejska, Monika

    2017-09-01

    A total of 18 Enterobacteriaceae (17 from gulls and 1 from a clinical sample) collected from Australia, carrying IncA/C plasmids with the IMP-encoding In809-like integrons, were studied. Seven plasmids, being representatives of different origins, plasmid sizes, replicon combinations, and resistance genes, were completely sequenced. Plasmid pEc158, identified in a clinical Escherichia coli ST752 isolate, showed extensive similarity to type 2 IncA/C 2 plasmids. pEc158 carried none of the bla CMY-2 -like region or ARI-B and ARI-A regions, while it contained a hybrid transposon structure. The six remaining plasmids, which were of wildlife origin, were highly similar to each other and probably were fusion derivatives of type 1 and type 2 A/C 2 plasmids. The latter plasmids contained an ARI-B region and hybrid transposon structures. In all plasmids, hybrid transposon structures containing In809-like integrons were inserted 3,434 bp downstream of the rhs2 start codon. In all cases, the one outermost 38-bp inverted repeat (IR) of the transposon was associated with the Tn 1696 tnp module, while the other outermost 38-bp IR of the transposon was associated with either a Tn 6317 -like module or a Tn 21 mer module. However, the internal structure of the transposon and the resistance genes were different in each plasmid. These findings indicated that, for the specific periods of time and settings, different IncA/C 2 plasmid types carrying In809-like elements circulated among isolates of wildlife and clinical origins. Additionally, they provided the basis for speculations regarding the reshuffling of IncA/C 2 plasmids with In809-like integrons and confirmed the rapid evolution of IncA/C 2 plasmid lineages. Copyright © 2017 American Society for Microbiology.

  19. Analysis of complete nucleotide sequences of Angolan hepatitis B virus isolates reveals the existence of a separate lineage within genotype E.

    Directory of Open Access Journals (Sweden)

    Barbara V Lago

    Full Text Available Hepatitis B virus genotype E (HBV/E is highly prevalent in Western Africa. In this work, 30 HBV/E isolates from HBsAg positive Angolans (staff and visitors of a private hospital in Luanda were genetically characterized: 16 of them were completely sequenced and the pre-S/S sequences of the remaining 14 were determined. A high proportion (12/30, 40% of subjects tested positive for both HBsAg and anti-HBs markers. Deduced amino acid sequences revealed the existence of specific substitutions and deletions in the B- and T-cell epitopes of the surface antigen (pre-S1- and pre-S2 regions of the virus isolates derived from 8/12 individuals with concurrent HBsAg/anti-HBs. Phylogenetic analysis performed with 231 HBV/E full-length sequences, including 16 from this study, showed that all isolates from Angola, Namibia and the Democratic Republic of Congo (n = 28 clustered in a separate lineage, divergent from the HBV/E isolates from nine other African countries, namely Cameroon, Central African Republic, Côte d'Ivoire, Ghana, Guinea, Madagascar, Niger, Nigeria and Sudan, with a Bayesian posterior probability of 1. Five specific mutations, namely small S protein T57I, polymerase Q177H, G245W and M612L, and X protein V30L, were observed in 79-96% of the isolates of the separate lineage, compared to a frequency of 0-12% among the other HBV/E African isolates.

  20. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  1. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  2. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  3. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  4. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A

    2016-01-01

    Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

  5. Complete nucleotide sequence and gene rearrangement of the ...

    Indian Academy of Sciences (India)

    3Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, People's Republic of China ... of these rearrangements involve tRNA genes, ND5 gene and ... ncbi.nlm.nih.gov/projects/Sequin/download/seq_win_download.

  6. Complete nucleotide sequence and gene rearrangement of the ...

    Indian Academy of Sciences (India)

    mt) genome of the round-tongued floating frog, Occidozyga martensii was determined. Although, the base composition and codon usage of O. martensii conformed to the typical vertebrate patterns, this mt genome contained 23 tRNAs (a ...

  7. Complete nucleotide sequence and organization of the mitogenome ...

    African Journals Online (AJOL)

    ... genes (PCGs) consistently supported a close relationship between Bombycoidea and Geometroidea among six available lepidopteran superfamilies (Tortricoidea, Pyraloidea, Papilionoidea, Bombycoidea, Geometroidea and Noctuoidea). Among the true butterflies (Pieridae, Nymphalidae, Lycaenidae and Papilionidae), ...

  8. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  9. Antinociceptive effect of purine nucleotides.

    Science.gov (United States)

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

    1996-10-01

    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  10. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  11. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  12. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  13. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  14. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    Science.gov (United States)

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  15. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  16. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  17. The effect of exhaustive exercise on the concentration of purine nucleotides and their metabolites in erythrocytes

    OpenAIRE

    E Skotnicka; I Baranowska-Bosiacka; W Dudzińska; M Suska; R Nowak; K Krupecki; AJ Hłyńczak

    2008-01-01

    In this study we tried to obtain a complete overview of purine nucleotide metabolism in erythrocytes before and during an incremental, intermittent exhaustive exercise bout protocol for sportsmen (high-performance rowers) and untrained, healthy, active volunteers. Erythrocyte levels of the main nucleotides (ATP, ADP, AMP, GTP, GDP, GMP, IMP, NAD and NADP ), nucleosides (Ado, Guo, Ino) and the base Hyp were measured using the HPLC method. The parameters that can be deducted from their concent...

  18. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  19. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  20. A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

    Science.gov (United States)

    Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

    2012-01-01

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

  1. A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

    Science.gov (United States)

    Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

    2012-02-03

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

  2. The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.

    Directory of Open Access Journals (Sweden)

    Fang Lü

    Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.

  3. Complete nucleotide sequences and virion particle association of two satellite RNAs of panicum mosaic virus.

    Science.gov (United States)

    Pyle, Jesse D; Monis, Judit; Scholthof, Karen-Beth

    2017-08-15

    Over six decades ago, panicum mosaic virus (PMV) was identified as the first viral pathogen of cultivated switchgrass (Panicum virgatum). Subsequently, PMV was demonstrated to support the replication of both a satellite RNA virus (SPMV) and satellite RNA (satRNA) agents during natural infections of host grasses. In this study, we report the isolation and full-length sequences of two PMV satRNAs identified in 1988 from St. Augustinegrass (Stenotaphrum secundatum) and centipedegrass (Eremochloa ophiuroides) hosts. Each of these satellites have sequence relatedness at their 5'- and 3'-ends. In addition, satC has a region of ∼100 nt complementary to the 3'-end of the PMV genome. These agents are associated with purified virions of SPMV infections. Additionally, satS and satC RNAs contain conserved in-frame open reading frames in the complementary-sense sequences that could potentially generate 6.6- and 7.9-kDa proteins, respectively. In protoplasts and plants satS is infectious, when co-inoculated with the PMV RNA alone or PMV+SPMV RNAs, and negatively affects their accumulation. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  5. Bacterial nucleotide-based second messengers.

    Science.gov (United States)

    Pesavento, Christina; Hengge, Regine

    2009-04-01

    In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

  6. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  7. Nucleotide Manipulatives to Illustrate the Central Dogma

    OpenAIRE

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  8. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  9. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

  10. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  11. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  12. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    International Nuclear Information System (INIS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

  13. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.

    2013-01-01

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin

  14. Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

    African Journals Online (AJOL)

    PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

  15. Completely continuous and weakly completely continuous abstract ...

    Indian Academy of Sciences (India)

    An algebra A is called right completely continuous (right weakly completely continuous) ... Moreover, some applications of these results in group algebras are .... A linear subspace S(G) of L1(G) is said to be a Segal algebra, if it satisfies the.

  16. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  17. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  18. Reversal of Proximal Renal Tubular Dysfunction after Nucleotide Analogue Withdrawal in Chronic Hepatitis B

    Directory of Open Access Journals (Sweden)

    Abhasnee Sobhonslidsuk

    2017-01-01

    Full Text Available Aims. Proximal renal tubular dysfunction (PRTD is an infrequent complication after nucleotide analogue therapy. We evaluated the outcomes of PRTD and nephrotoxicity after nucleotide analogue withdrawal in chronic hepatitis B (CHB. Methods. A longitudinal follow-up study was performed in patients with PRTD after nucleotide analogue discontinuation. Serum and urine were collected at baseline and every 3 months for one year. The fractional excretion of phosphate (PO4, uric acid (UA, and potassium and tubular maximal reabsorption rate of PO4 to glomerular filtration rate (TmPO4/GFR were calculated. Renal losses were defined based on the criteria of substance losses. Subclinical PRTD and overt PRTD were diagnosed when 2 and ≥3 criteria were identified. Results. Eight subclinical and eight overt PRTD patients were enrolled. After nucleotide analogue withdrawal, there were overall improvements in GFR, serum PO4, and UA. Renal loss of PO4, UA, protein, and β2-microglobulin reduced over time. At one year, complete reversal of PRTD was seen in 13 patients (81.2%. Improvements in PRTD were seen in all but one patient. Conclusion. One year after nucleotide analogue withdrawal, PRTD was resolved in most patients. Changes in TmPO4/GFR, urinary protein, and β2-microglobulin indicate that urinary biomarkers may represent an early sign of PRTD recovery.

  19. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  20. Complete genome sequence of pronghorn virus, a pestivirus

    Science.gov (United States)

    The complete genome sequence of Pronghorn virus, a member of the Pestivirus genus of the Flaviviridae, was determined. The virus, originally isolated from a pronghorn antelope, had a genome of 12,287 nucleotides with a single open reading frame of 11,694 bases encoding 3898 amino acids....

  1. High pressure {sup 31}P NMR spectroscopy on guanine nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Spoerner, Michael; Karl, Matthias; Lopes, Pedro; Hoering, Marcus; Loeffel, Karoline; Nuehs, Andrea; Adelsberger, Joseph; Kremer, Werner; Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@ur.de [University of Regensburg, Centre of Magnetic Resonance in Chemistry and Biomedicine, Institute of Biophysics and Physical Biochemistry (Germany)

    2017-01-15

    The {sup 31}P NMR pressure response of guanine nucleotides bound to proteins has been studied in the past for characterizing the pressure perturbation of conformational equilibria. The pressure response of the {sup 31}P NMR chemical shifts of the phosphate groups of GMP, GDP, and GTP as well as the commonly used GTP analogs GppNHp, GppCH{sub 2}p and GTPγS was measured in the absence and presence of Mg{sup 2+}-ions within a pressure range up to 200 MPa. The pressure dependence of chemical shifts is clearly non-linear. For all nucleotides a negative first order pressure coefficient B{sub 1} was determined indicating an upfield shift of the resonances with pressure. With exception of the α-phosphate group of Mg{sup 2+}·GMP and Mg{sup 2+}·GppNHp the second order pressure coefficients are positive. To describe the data of Mg{sup 2+}·GppCH{sub 2}p and GTPγS a Taylor expansion of 3rd order is required. For distinguishing pH effects from pressure effects a complete pH titration set is presented for GMP, as well as GDP and GTP in absence and presence of Mg{sup 2+} ions using indirect referencing to DSS under identical experimental conditions. By a comparison between high pressure {sup 31}P NMR data on free Mg{sup 2+}-GDP and Mg{sup 2+}-GDP in complex with the proto-oncogene Ras we demonstrate that pressure induced changes in chemical shift are clearly different between both forms.

  2. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  3. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  4. Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism

    International Nuclear Information System (INIS)

    Welin, Martin; Nordlund, Paer

    2010-01-01

    Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.

  5. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Enhanced activity of the purine nucleotide cycle of the exercising muscle in patients with hyperthyroidism.

    Science.gov (United States)

    Fukui, H; Taniguchi , S; Ueta, Y; Yoshida, A; Ohtahara, A; Hisatome, I; Shigemasa, C

    2001-05-01

    Myopathy frequently develops in patients with hyperthyroidism, but its precise mechanism is not clearly understood. In this study we focused on the purine nucleotide cycle, which contributes to ATP balance in skeletal muscles. To investigate purine metabolism in muscles, we measured metabolites related to the purine nucleotide cycle using the semiischemic forearm test. We examined the following four groups: patients with untreated thyrotoxic Graves' disease (untreated group), patients with Graves' disease treated with methimazole (treated group), patients in remission (remission group), and healthy volunteers (control group). To trace the glycolytic process, we measured glycolytic metabolites (lactate and pyruvate) as well as purine metabolites (ammonia and hypoxanthine). In the untreated group, the levels of lactate, pyruvate, and ammonia released were remarkably higher than those in the control group. Hypoxanthine release also increased in the untreated group, but the difference among the patient groups was not statistically significant. The accelerated purine catabolism did not improve after 3 months of treatment with methimazole, but it was completely normalized in the remission group. This indicated that long-term maintenance of thyroid function was necessary for purine catabolism to recover. We presume that an unbalanced ATP supply or conversion of muscle fiber type may account for the acceleration of the purine nucleotide cycle under thyrotoxicosis. Such acceleration of the purine nucleotide cycle is thought to be in part a protective mechanism against a rapid collapse of the ATP energy balance in exercising muscles of patients with hyperthyroidism.

  7. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  8. Latino College Completion: Hawaii

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  9. Latino College Completion: Pennsylvania

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  10. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  11. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  12. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  13. Completeness, supervenience and ontology

    International Nuclear Information System (INIS)

    Maudlin, Tim W E

    2007-01-01

    In 1935, Einstein, Podolsky and Rosen raised the issue of the completeness of the quantum description of a physical system. What they had in mind is whether or not the quantum description is informationally complete, in that all physical features of a system can be recovered from it. In a collapse theory such as the theory of Ghirardi, Rimini and Weber, the quantum wavefunction is informationally complete, and this has often been taken to suggest that according to that theory the wavefunction is all there is. If we distinguish the ontological completeness of a description from its informational completeness, we can see that the best interpretations of the GRW theory must postulate more physical ontology than just the wavefunction

  14. Completeness, supervenience and ontology

    Energy Technology Data Exchange (ETDEWEB)

    Maudlin, Tim W E [Department of Philosophy, Rutgers University, 26 Nichol Avenue, New Brunswick, NJ 08901-1411 (United States)

    2007-03-23

    In 1935, Einstein, Podolsky and Rosen raised the issue of the completeness of the quantum description of a physical system. What they had in mind is whether or not the quantum description is informationally complete, in that all physical features of a system can be recovered from it. In a collapse theory such as the theory of Ghirardi, Rimini and Weber, the quantum wavefunction is informationally complete, and this has often been taken to suggest that according to that theory the wavefunction is all there is. If we distinguish the ontological completeness of a description from its informational completeness, we can see that the best interpretations of the GRW theory must postulate more physical ontology than just the wavefunction.

  15. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    1CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow ... used to characterize and identify the cultivars; however, it is often difficult and even .... complete deletion of the missing/gap sites from all the sequences (table 2).

  16. Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase

    International Nuclear Information System (INIS)

    Aalto, T.K.; Raivio, K.O.

    1990-01-01

    Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage

  17. Ras conformational switching: simulating nucleotide-dependent conformational transitions with accelerated molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Barry J Grant

    2009-03-01

    Full Text Available Ras mediates signaling pathways controlling cell proliferation and development by cycling between GTP- and GDP-bound active and inactive conformational states. Understanding the complete reaction path of this conformational change and its intermediary structures is critical to understanding Ras signaling. We characterize nucleotide-dependent conformational transition using multiple-barrier-crossing accelerated molecular dynamics (aMD simulations. These transitions, achieved for the first time for wild-type Ras, are impossible to observe with classical molecular dynamics (cMD simulations due to the large energetic barrier between end states. Mapping the reaction path onto a conformer plot describing the distribution of the crystallographic structures enabled identification of highly populated intermediate structures. These structures have unique switch orientations (residues 25-40 and 57-75 intermediate between GTP and GDP states, or distinct loop3 (46-49, loop7 (105-110, and alpha5 C-terminus (159-166 conformations distal from the nucleotide-binding site. In addition, these barrier-crossing trajectories predict novel nucleotide-dependent correlated motions, including correlations of alpha2 (residues 66-74 with alpha3-loop7 (93-110, loop2 (26-37 with loop10 (145-151, and loop3 (46-49 with alpha5 (152-167. The interconversion between newly identified Ras conformations revealed by this study advances our mechanistic understanding of Ras function. In addition, the pattern of correlated motions provides new evidence for a dynamic linkage between the nucleotide-binding site and the membrane interacting C-terminus critical for the signaling function of Ras. Furthermore, normal mode analysis indicates that the dominant collective motion that occurs during nucleotide-dependent conformational exchange, and captured in aMD (but absent in cMD simulations, is a low-frequency motion intrinsic to the structure.

  18. Nucleotide excision repair in differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail: l.mullenders@lumc.nl

    2007-01-03

    Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.

  19. Complete Ureteral Avulsion

    Directory of Open Access Journals (Sweden)

    V. Gupta

    2005-01-01

    Full Text Available Complete avulsion of the ureter is one of the most serious complications of ureteroscopy. It requires open or laparoscopic intervention for repair. This case report emphasizes its management and presents recommendations for prevention in current urological practice.

  20. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  1. The possible role of human milk nucleotides as sleep inducers.

    Science.gov (United States)

    Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen

    2009-02-01

    Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.

  2. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  3. Completeness of Lyapunov Abstraction

    DEFF Research Database (Denmark)

    Wisniewski, Rafal; Sloth, Christoffer

    2013-01-01

    the vector field, which allows the generation of a complete abstraction. To compute the functions that define the subdivision of the state space in an algorithm, we formulate a sum of squares optimization problem. This optimization problem finds the best subdivisioning functions, with respect to the ability......This paper addresses the generation of complete abstractions of polynomial dynamical systems by timed automata. For the proposed abstraction, the state space is divided into cells by sublevel sets of functions. We identify a relation between these functions and their directional derivatives along...

  4. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  5. Construction completion report

    International Nuclear Information System (INIS)

    1990-01-01

    This Construction Completion Report documents the major construction projects at the Waste Isolation Pilot Plant (WIPP) site and related information on contracts, schedules, and other areas which affected construction. This report is not intended to be an exhaustive detailed analysis of construction, but is a general overview and summary of the WIPP construction. 10 refs., 29 figs

  6. Complete Rerouting Protection

    DEFF Research Database (Denmark)

    Stidsen, Thomas K.; Kjærulff, Peter

    2005-01-01

    In this paper we present a new protection method: Complete Rerouting. This is the most capacity e cient protection method for circuit switched networks and it is, to the best of our knowledge, the first time it has been described. We implement a column generation algorithm and test the performance...

  7. Complete French Teach Yourself

    CERN Document Server

    Graham, Gaelle

    2010-01-01

    The best-selling complete course for a fun and effective way to learn French. This ISBN is for the paperback book. The corresponding audio support (ISBN: 9781444100068) is also available. The book and audio support can also be purchased as a pack (ISBN: 9781444100051).

  8. Completeness of Lyapunov Abstraction

    Directory of Open Access Journals (Sweden)

    Rafael Wisniewski

    2013-08-01

    Full Text Available In this work, we continue our study on discrete abstractions of dynamical systems. To this end, we use a family of partitioning functions to generate an abstraction. The intersection of sub-level sets of the partitioning functions defines cells, which are regarded as discrete objects. The union of cells makes up the state space of the dynamical systems. Our construction gives rise to a combinatorial object - a timed automaton. We examine sound and complete abstractions. An abstraction is said to be sound when the flow of the time automata covers the flow lines of the dynamical systems. If the dynamics of the dynamical system and the time automaton are equivalent, the abstraction is complete. The commonly accepted paradigm for partitioning functions is that they ought to be transversal to the studied vector field. We show that there is no complete partitioning with transversal functions, even for particular dynamical systems whose critical sets are isolated critical points. Therefore, we allow the directional derivative along the vector field to be non-positive in this work. This considerably complicates the abstraction technique. For understanding dynamical systems, it is vital to study stable and unstable manifolds and their intersections. These objects appear naturally in this work. Indeed, we show that for an abstraction to be complete, the set of critical points of an abstraction function shall contain either the stable or unstable manifold of the dynamical system.

  9. Dual completion method

    Energy Technology Data Exchange (ETDEWEB)

    Mamedov, N Ya; Kadymova, K S; Dzhafarov, Sh T

    1963-10-28

    One type of dual completion method utilizes a single tubing string. Through the use of the proper tubing equipment, the fluid from the low-productive upper formation is lifted by utilizing the surplus energy of a submerged pump, which handles the production from the lower stratum.

  10. A complete woman

    Indian Academy of Sciences (India)

    Lawrence

    treated me like a son in the way he encouraged my education, while my mother ... cine gives me a lot of satisfaction when I see my patients getting cured. Teaching ... thing in life as a complete woman in different roles – daughter, wife, mother ...

  11. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze; Gehring, Christoph A

    2013-01-01

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs

  12. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  13. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  14. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A

    2011-01-01

    assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

  15. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    Science.gov (United States)

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Detection of DNA nucleotides on pretreated boron doped diamond electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica

    2011-07-01

    The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

  17. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  18. Free amino acids and 5'-nucleotides in Finnish forest mushrooms.

    Science.gov (United States)

    Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo

    2018-05-01

    Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Complete Genome Sequence of a Putative Densovirus of the Asian Citrus Psyllid, Diaphorina citri.

    Science.gov (United States)

    Nigg, Jared C; Nouri, Shahideh; Falk, Bryce W

    2016-07-28

    Here, we report the complete genome sequence of a putative densovirus of the Asian citrus psyllid, Diaphorina citri Diaphorina citri densovirus (DcDNV) was originally identified through metagenomics, and here, we obtained the complete nucleotide sequence using PCR-based approaches. Phylogenetic analysis places DcDNV between viruses of the Ambidensovirus and Iteradensovirus genera. Copyright © 2016 Nigg et al.

  20. Complete Genome Sequence of a Putative Densovirus of the Asian Citrus Psyllid, Diaphorina citri

    OpenAIRE

    Nigg, Jared C.; Nouri, Shahideh; Falk, Bryce W.

    2016-01-01

    Here, we report the complete genome sequence of a putative densovirus of the Asian citrus psyllid, Diaphorina citri. Diaphorina citri densovirus (DcDNV) was originally identified through metagenomics, and here, we obtained the complete nucleotide sequence using PCR-based approaches. Phylogenetic analysis places DcDNV between viruses of the Ambidensovirus and Iteradensovirus genera.

  1. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  2. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  3. The complete cosmicomics

    CERN Document Server

    Calvino, Italo

    2014-01-01

    The definitive edition of Calvino’s cosmicomics, bringing together all of these enchanting stories—including some never before translated—in one volume for the first time. In Italo Calvino’s cosmicomics, primordial beings cavort on the nearby surface of the moon, play marbles with atoms, and bear ecstatic witness to Earth’s first dawn. Exploring natural phenomena and the origins of the universe, these beloved tales relate complex scientific concepts to our common sensory, emotional, human world. Now, The Complete Cosmicomics brings together all of the cosmicomic stories for the first time. Containing works previously published in Cosmicomics, t zero, and Numbers in the Dark, this single volume also includes seven previously uncollected stories, four of which have never been published in translation in the United States. This “complete and definitive collection” (Evening Standard) reconfirms the cosmicomics as a crowning literary achievement and makes them available to new generations of reader...

  4. CMS Is Finally Completed

    CERN Multimedia

    2008-01-01

    Yet another step in the completion of the Large Hadron Collider was taken yesterday morning, as the final element of the Compact Muon Solenoid was lowered nearly 100 meters bellow ground. After more than eight years of work at the world's most powerful particle accelerator, scientists hope that they will be able to start initial experiments with the LHC until the end of this year.

  5. LEAR construction completed

    CERN Multimedia

    CERN PhotoLab

    1982-01-01

    In July 1982, LEAR construction was completed, the individual systems had been dry-tested. On 16 July, the first 50 MeV (309 MeV/c) protons from Linac 1 were injected and circulated. On 11 October, the first antiprotons from the AA, decelerated in the PS to 609 MeV/c, were injected. Also in 1982, acceleration, deceleration and stochastic cooling were successfully tested. See 9007366 for a more detailed description. See also 8201061, 8204131, 8309026.

  6. SHIVA laser: nearing completion

    International Nuclear Information System (INIS)

    Glaze, J.A.; Godwin, R.O.

    1977-01-01

    Construction of the Shiva laser system is nearing completion. This laser will be operating in fall 1977 and will produce over 20 terawatts of focusable power in a subnanosecond pulse. Fusion experiments will begin early in 1978. It is anticipated that thermonuclear energy release equal to one percent that of the incident light energy will be achieved with sub-millimeter deuterium-tritium targets. From other experiments densities in excess of a thousand times that of liquid are also expected

  7. SCT Barrel Assembly Complete

    CERN Multimedia

    L. Batchelor

    As reported in the April 2005 issue of the ATLAS eNews, the first of the four Semiconductor Tracker (SCT) barrels, complete with modules and services, arrived safely at CERN in January of 2005. In the months since January, the other three completed barrels arrived as well, and integration of the four barrels into the entire barrel assembly commenced at CERN, in the SR1 building on the ATLAS experimental site, in July. Assembly was completed on schedule in September, with the addition of the innermost layer to the 4-barrel assembly. Work is now underway to seal the barrel thermal enclosure. This is necessary in order to enclose the silicon tracker in a nitrogen atmosphere and provide it with faraday-cage protection, and is a delicate and complicated task: 352 silicon module powertapes, 352 readout-fibre bundles, and over 400 Detector Control System sensors must be carefully sealed into the thermal enclosure bulkhead. The team is currently verifying the integrity of the low mass cooling system, which must be d...

  8. Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

    International Nuclear Information System (INIS)

    Edenbrandt, C.M.; Murphy, S.

    1990-01-01

    Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation

  9. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-04-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

  10. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    OpenAIRE

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

  11. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

  12. Complete pancreas traumatic transsection

    Directory of Open Access Journals (Sweden)

    H. Hodžić

    2005-02-01

    Full Text Available This report presents a case of a twenty-year old male with complete pancreas breakdown in the middle of its corpus, which was caused by a strong abdomen compression, with injuries of the spleen, the firstjejunumcurve,mesocolon transversum, left kidney, and appereance of retroperitoneal haemathoma. Surgical treatment started 70 minutes after the injury. The treatment consisted of left pancreatectomy with previous spleenectomy, haemostasis of ruptured mesocolon transversum blood vessels, left kidney exploration, suturing of the firstjejunumcurvelession and double abdomen drainage. Posttraumatic pancreatitis which appeared on the second postoperative day and prolonged drain secretion were successfully solved by conservative treatment.

  13. Complete rerouting protection

    DEFF Research Database (Denmark)

    Stidsen, Thomas K.; Kjærulff, Peter

    2006-01-01

    Protection of communication against network failures is becoming increasingly important and in this paper we present the most capacity efficient protection method possible, the complete rerouting protection method, when requiring that all communication should be restored in case of a single link...... network failure. We present a linear programming model of the protection method and a column generation algorithm. For 6 real world networks, the minimal restoration overbuild network capacity is between 13% and 78%. We further study the importance of the density of the network, derive analytical bounds...

  14. Completion of treatment planning

    International Nuclear Information System (INIS)

    Lief, Eugene

    2008-01-01

    The outline of the lecture included the following topics: entering prescription; plan printout; print and transfer DDR; segment BEV; export to R and V; physician approval; and second check. Considerable attention, analysis and discussion. The summary is as follows: Treatment planning completion is a very responsible process which requires maximum attention; Should be independently checked by the planner, physicist, radiation oncologist and a therapist; Should not be done in a last minute rush; Proper communication between team members; Properly set procedure should prevent propagation of an error by one individual to the treatment: the error should be caught by somebody else. (P.A.)

  15. TestComplete cookbook

    CERN Document Server

    Alpaev, Gennadiy

    2013-01-01

    A practical cookbook, with a perfect package of simple, medium, and advanced recipes targeted at basic programmers as well as expert software testers, who will learn to create, manage, and run automated tests. It is packed with problem-solving recipes that are supported by simple examples.If you are a software tester or a programmer who is involved with testing automation using TestComplete, this book is ideal for you! You will be introduced to the very basics of using the tool, as well as polish any previously gained knowledge in using the tool. If you are already aware of programming basics,

  16. Complete atrioventricular canal.

    Science.gov (United States)

    Calabrò, Raffaele; Limongelli, Giuseppe

    2006-04-05

    Complete atrioventricular canal (CAVC), also referred to as complete atrioventricular septal defect, is characterised by an ostium primum atrial septal defect, a common atrioventricular valve and a variable deficiency of the ventricular septum inflow. CAVC is an uncommon congenital heart disease, accounting for about 3% of cardiac malformations. Atrioventricular canal occurs in two out of every 10,000 live births. Both sexes are equally affected and a striking association with Down syndrome was found. Depending on the morphology of the superior leaflet of the common atrioventricular valve, 3 types of CAVC have been delineated (type A, B and C, according to Rastelli's classification). CAVC results in a significant interatrial and interventricular systemic-to-pulmonary shunt, thus inducing right ventricular pressure and volume overload and pulmonary hypertension. It becomes symptomatic in infancy due to congestive heart failure and failure to thrive. Diagnosis of CAVC might be suspected from electrocardiographic and chest X-ray findings. Echocardiography confirms it and gives anatomical details. Over time, pulmonary hypertension becomes irreversible, thus precluding the surgical therapy. This is the reason why cardiac catheterisation is not mandatory in infants (less than 6 months) but is indicated in older patients if irreversible pulmonary hypertension is suspected. Medical treatment (digitalis, diuretics, vasodilators) plays a role only as a bridge toward surgery, usually performed between the 3rd and 6th month of life.

  17. Complete atrioventricular canal

    Directory of Open Access Journals (Sweden)

    Limongelli Giuseppe

    2006-04-01

    Full Text Available Abstract Complete atrioventricular canal (CAVC, also referred to as complete atrioventricular septal defect, is characterised by an ostium primum atrial septal defect, a common atrioventricular valve and a variable deficiency of the ventricular septum inflow. CAVC is an uncommon congenital heart disease, accounting for about 3% of cardiac malformations. Atrioventricular canal occurs in two out of every 10,000 live births. Both sexes are equally affected and a striking association with Down syndrome was found. Depending on the morphology of the superior leaflet of the common atrioventricular valve, 3 types of CAVC have been delineated (type A, B and C, according to Rastelli's classification. CAVC results in a significant interatrial and interventricular systemic-to-pulmonary shunt, thus inducing right ventricular pressure and volume overload and pulmonary hypertension. It becomes symptomatic in infancy due to congestive heart failure and failure to thrive. Diagnosis of CAVC might be suspected from electrocardiographic and chest X-ray findings. Echocardiography confirms it and gives anatomical details. Over time, pulmonary hypertension becomes irreversible, thus precluding the surgical therapy. This is the reason why cardiac catheterisation is not mandatory in infants (less than 6 months but is indicated in older patients if irreversible pulmonary hypertension is suspected. Medical treatment (digitalis, diuretics, vasodilators plays a role only as a bridge toward surgery, usually performed between the 3rd and 6th month of life.

  18. Barnett shale completions

    Energy Technology Data Exchange (ETDEWEB)

    Schein, G. [BJ Services, Dallas, TX (United States)

    2006-07-01

    Fractured shales yield oil and gas in various basins across the United States. A map indicating these fractured shale source-reservoir systems in the United States was presented along with the numerous similarities and differences that exist among these systems. Hydrocarbons in the organic rich black shale come from the bacterial decomposition of organic matter, primary thermogenic decomposition of organic matter or secondary thermogenic cracking of oil. The shale may be the reservoir or other horizons may be the primary or secondary reservoir. The reservoir has induced micro fractures or tectonic fractures. This paper described the well completions in the Barnett Shale in north Texas with reference to major players, reservoir properties, mineralogy, fluid sensitivity, previous treatments, design criteria and production examples. The Barnett Shale is an organic, black shale with thickness ranging from 100 to 1000 feet. The total organic carbon (TOC) averages 4.5 per cent. The unit has undergone high rate frac treatments. A review of the vertical wells in the Barnett Shale was presented along with the fracture treatment schedule and technology changes. A discussion of refracturing opportunities and proppant settling and transport revealed that additional proppant increases fluid recovery and enhances production. Compatible scale inhibitors and biocides can be beneficial. Horizontal completions in the Barnett Shale have shown better results than vertical wells, as demonstrated in a production comparison of 3 major horizontal wells in the basin. tabs., figs.

  19. Actinides and rare earths complexation with adenosine phosphate nucleotides

    International Nuclear Information System (INIS)

    Mostapha, Sarah

    2013-01-01

    Organophosphorus compounds are important molecules in both nuclear industry and living systems fields. Indeed, several extractants of organophosphorus compounds (such as TBP, HDEHP) are used in the nuclear fuel cycle reprocessing and in the biological field. For instance, the nucleotides are organophosphates which play a very important role in various metabolic processes. Although the literature on the interactions of actinides with inorganic phosphate is abundant, published studies with organophosphate compounds are generally limited to macroscopic and / or physiological approaches. The objective of this thesis is to study the structure of several organophosphorus compounds with actinides to reach a better understanding and develop new specific buildings blocks. The family of the chosen molecules for this procedure consists of three adenine nucleotides mono, bi and triphosphate (AMP, adenosine monophosphate - ADP, adenosine diphosphate - ATP, adenosine triphosphate) and an amino-alkylphosphate (AEP O-phosphoryl-ethanolamine). Complexes synthesis was conducted in aqueous and weakly acidic medium (2.8-4) for several lanthanides (III) (Lu, Yb, Eu) and actinides (U (VI), Th (IV) and Am (III)). Several analytical and spectroscopic techniques have been used to describe the organization of the synthesized complexes: spectrometric analysis performed by FTIR and NMR were used to identify the functional groups involved in the complexation, analysis by ESI-MS and pH-metric titration were used to determine the solution speciation and EXAFS analyzes were performed on Mars beamline of the SOLEIL synchrotron, have described the local cation environment, for both solution and solid compounds. Some theoretical approaches of DFT were conducted to identify stable structures in purpose of completing the experimental studies. All solid complexes (AMP, ADP, ATP and AEP) have polynuclear structures, while soluble ATP complexes are mononuclear. For all synthesized complexes, it has been

  20. GOGOL: ACADEMIC AND COMPLETE

    Directory of Open Access Journals (Sweden)

    Yuri V. Mann

    2016-12-01

    Full Text Available The ever-increasing international interest to Gogol explains the necessity of publishing a new edition of his works. The present Complete Collection of Gogol’s Works and Letters is an academic edition prepared and published by the A. M. Gorky Institute of World Literature of the Russian Academy of Sciences. It draws on rich experience of studying and publishing Gogol’s heritage in Russia but at the same time questions and underscores Gogol’s relevance for the modern reader and his place in the world culture of our time. It intends to fill in the gaps left by the previous scholarly tradition that failed to recognize some of Gogol’s texts as part of his heritage. Such are, for example, dedicatory descriptions in books and business notes. The present edition accounts not only for the completeness of texts but also for their place within the body of Gogol’s work, as part of his life-long creative process. By counterpoising different editions, it attempts to trace down the dynamics of Gogol’s creative thought while at the same time underscores the autonomy and relevance of each period in his career. For example, this collection publishes two different versions (editions of the same work: while the most recent version has become canonical at the expense of the preceding one, the latter still preserves its meaning and historical relevance. The present edition has the advantage over its predecessors since it has an actual, physical opportunity to erase the gaps, e.g. to publish the hitherto unpublished texts. However, the editors realize that new, hitherto unknown gaps may appear and the present edition will become, in its turn, outdated. At this point, there will be a necessity in the new edition.

  1. Substitution of Active Site Tyrosines with Tryptophan Alters the Free Energy for Nucleotide Flipping by Human Alkyladenine DNA Glycosylase†

    Science.gov (United States)

    Hendershot, Jenna M.; Wolfe, Abigail E.; O'Brien, Patrick J.

    2011-01-01

    Human alkyladenine DNA glycosylase (AAG) locates and excises a wide variety of structurally diverse alkylated and oxidized purine lesions from DNA to initiate the base excision repair pathway. Recognition of a base lesion requires flipping of the damaged nucleotide into a relatively open active site pocket between two conserved tyrosine residues, Y127 and Y159. We have mutated each of these amino acids to tryptophan and measured the kinetic effects on the nucleotide flipping and base excision steps. The Y127W and Y159W mutant proteins have robust glycosylase activity toward DNA containing 1,N6-ethenoadenine (εA), within 4-fold of that of the wildtype enzyme, raising the possibility that tryptophan fluorescence could be used to probe the DNA binding and nucleotide flipping steps. Stopped-flow fluorescence was used to compare the time-dependent changes in tryptophan fluorescence and εA fluorescence. For both mutants, the tryptophan fluorescence exhibited two-step binding with essentially identical rate constants as were observed for the εA fluorescence changes. These results provide evidence that AAG forms an initial recognition complex in which the active site pocket is perturbed and the stacking of the damaged base is disrupted. Upon complete nucleotide flipping, there is further quenching of the tryptophan fluorescence with coincident quenching of the εA fluorescence. Although these mutations do not have large effects on the rate constant for excision of εA, there are dramatic effects on the rate constants for nucleotide flipping that result in 40 to 100-fold decreases in the flipping equilibrium relative to wildtype. Most of this effect is due to an increased rate of unflipping, but surprisingly the Y159W mutation causes a 5-fold increase in the rate constant for flipping. The large effect on the equilibrium for nucleotide flipping explains the greater deleterious effects that these mutations have on the glycosylase activity toward base lesions that are in

  2. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  3. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  4. Complete nucleotide sequence of the Coturnix chinensis (blue-breasted quail) mitochondrial genome and a phylogenetic analysis with related species.

    Science.gov (United States)

    Nishibori, M; Tsudzuki, M; Hayashi, T; Yamamoto, Y; Yasue, H

    2002-01-01

    Coturnix chinensis (blue-breasted quail) has been classically grouped in Galliformes Phasianidae Coturnix, based on morphologic features and biochemical evidence. Since the blue-breasted quail has the smallest body size among the species of Galliformes, in addition to a short generation time and an excellent reproductive performance, it is a possible model fowl for breeding and physiological studies of the Coturnix japonica (Japanese quail) and Gallus gallus domesticus (chicken), which are classified in the same family as blue-breasted quail. However, since its phylogenetic position in the family Phasianidae has not been determined conclusively, the sequence of the entire blue-breasted quail mitochondria (mt) genome was obtained to provide genetic information for phylogenetic analysis in the present study. The blue-breasted quail mtDNA was found to be a circular DNA of 16,687 base pairs (bp) with the same genomic structure as the mtDNAs of Japanese quail and chicken, though it is smaller than Japanese quail and chicken mtDNAs by 10 bp and 88 bp, respectively. The sequence identity of all mitochondrial genes, including those for 12S and 16S ribosomal RNAs, between blue-breasted quail and Japanese quail ranged from 84.5% to 93.5%; between blue-breasted quail and chicken, sequence identity ranged from 78.0% to 89.6%. In order to obtain information on the phylogenetic position of blue-breasted quail in Galliformes Phasianidae, the 2,184 bp sequence comprising NADH dehydrogenase subunit 2 and cytochrome b genes available for eight species in Galliformes [Japanese quail, chicken, Gallus varius (green junglefowl), Bambusicola thoracica (Chinese bamboo partridge), Pavo cristatus (Indian peafowl), Perdix perdix (gray partridge), Phasianus colchicus (ring-neck pheasant), and Tympanchus phasianellus (sharp-tailed grouse)] together with that of Aythya americana (redhead) were examined using a maximum likelihood (ML) method. The ML analyses on the first/second codon positions, the third codon positions, and amino acid sequence consistently demonstrated that blue-breasted quail and Japanese quail are in the same phylogenetic cluster.

  5. COMPLETE NUCLEOTIDE SEQUENCE OF SPHEROIDIN GENES OF CALLIPTAMUS ITALICUS ENTOMOPOXVIRUS(CIEPV) AND GOMPHOCERUS SIBIRICUS ENTOMOPOXVIRUS(GSEPV)

    Institute of Scientific and Technical Information of China (English)

    Yong-danLi; Li-yingWang; Xi-wuGao; Chao-yangZhao; Zhao-fengTian

    2004-01-01

    The spheroidin genes of Calliptamus italicus entomopoxvirus (CiEPV) and Gomphocerus sibiricus entomopoxvirus (GsEPV) were obtained by PCR,and the fragments were cloned, sequenced and analyzed. The CiEPV and GsEPV spheroidin genes respectively harbored ORFs of 2 922 bps and 2 967 bps that were capable of coding polypeptides of 109.2 and 111.1 kDa. Computer analysis indicated that CiEPV and GsEPV spheroidins shared less than 20% amino acid identities with lepidopteran AmEPV and coleopteran AcEPV spheroidins, but more than 80% amino acid identities with orthopteran OaEPV, MsEPV and AaEPV spheroidins. The CiEPV and GsEPV spheroidins respectively contained 19 and 21 cysteine residues that were particularly abundant at the C-termini, as is the case with those of the other orthopteran EPV spheroidins. The numbers and locations of the cysteine residues of the spheroidins were most similar to those of the spheroidins of EPVs that are virulent on the same insect orders. The promoter regions of the two spheroidin genes were highly conserved (99%) among the orthopteran EPVs and also contained the typical very A+T rich and TAAATG signal mediating transcription of poxvirus late genes. We also sequenced an incomplete ORF downstream of the pheroidin gene of CiEPV and GsEPV. The ORF was in the opposite direction to the spheroidin gene and was homologous to MSV072 putative protein of MsEPV.

  6. Complete nucleotide sequence of the Oenothera elata plastid chromosome, representing plastome I of the five distinguishable euoenothera plastomes.

    Science.gov (United States)

    Hupfer, H; Swiatek, M; Hornung, S; Herrmann, R G; Maier, R M; Chiu, W L; Sears, B

    2000-05-01

    We describe the 159,443-bp [corrected] sequence of the plastid chromosome of Oenothera elata (evening primrose). The Oe. elata plastid chromosome represents type I of the five genetically distinguishable basic plastomes found in the subsection Euoenothera. The genus Oenothera provides an ideal system in which to address fundamental questions regarding the functional integration of the compartmentalised genetic system characteristic of the eukaryotic cell. Its highly developed taxonomy and genetics, together with a favourable combination of features in its genetic structure (interspecific fertility, stable heterozygous progeny, biparental transmission of organelles, and the phenomenon of complex heterozygosity), allow facile exchanges of nuclei, plastids and mitochondria, as well as individual chromosome pairs, between species. The resulting hybrids or cybrids are usually viable and fertile, but can display various forms of developmental disturbance.

  7. Biosynthesis of a hypermodified nucleotide in Saccharomyces carlsbergensis 17S and HeLa-cell 18S ribosomal ribonucleic acid.

    Science.gov (United States)

    Brand, R C; Klootwijk, J; Planta, R J; Maden, B E

    1978-01-01

    The biosynthesis of a hypermodified nucleotide, similar to or identical with 3-(3-amino-3-carboxypropyl)-1-methylpseudouridine monophosphate, present in Saccharomyces carlsbergensis 17S and HeLa-cell 18S rRNA, was investigated with respect to the sequence of reactions required for synthesis and their timing in ribosome maturation. In both yeast and HeLa cells methylation precedes attachment of the 3-amino-3-carboxypropyl group. In yeast the methylated precursor nucleotide was tentatively characterized as 1-methylpseudouridine. This precursor nucleotide was demonstrated in both 37S and most of the cytoplasmic 18S pre-rRNA (rRNA precursor) molecules. The synthesis of the hypermodified nucleotide is completed just before the final cleavage of 18S pre-rRNA to give 17S rRNA, so that the final addition of the 3-amino-3-carboxypropyl group is a cytoplasmic event. Comparable experiments with HeLa cells indicated that formation of 1-methylpseudouridine occurs at the level of 45S RNA and addition of the 3-amino-3-carboxypropyl group occurs in the cytoplasm on newly synthesized 18S RNA.

  8. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  9. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  10. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

  11. Involvement of cyclic nucleotides in locust flight muscle metabolism

    NARCIS (Netherlands)

    Worm, R.A.A.

    1980-01-01

    1. Flight had no significant effect on the levels of c-AMP of c-GMP in the flight muscles of Locusta migratoria. 2. Injections of 0.01 or 0.1 corpus cardiacum equivalents into the abdominal cavity did not elicit any effect on cyclic nucleotide levels either. 3. Injection of A23187 resulted in

  12. Analysis of single nucleotide polymorphisms in case-control studies.

    Science.gov (United States)

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  13. Subpicosecond Dynamics in Nucleotides Measured by Spontaneous Raman Spectroscopy

    NARCIS (Netherlands)

    Terpstra, P.A.; Terpstra, P.A.; Otto, Cornelis; Greve, Jan

    1997-01-01

    The band widths in Raman spectra are sensitive to dynamics active on a time scale from 0.1 to 10 ps. The band widths of nucleotide vibrations and their dependence on temperature, concentration, and structure are reported. From the experimental band widths and second moments, it is derived that the

  14. Nucleotide excision repair II: From yeast to mammals

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

  15. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  16. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  17. DNA Nucleotides Detection via capacitance properties of Graphene

    Science.gov (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  18. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...

  19. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  20. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  1. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Nucleotides are low molecular weight biological compounds, which are ... nutrition and disease aspects of crustaceans (Overton and Bland 1981 .... additives on growth and disease resistance. Effects of ... metabolically active cells during stressful conditions ... in humans supplemented with Uracyl, which resulted in optimal ...

  2. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

    2015-09-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

  3. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

    2015-01-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

  4. One bacterial cell, one complete genome.

    Directory of Open Access Journals (Sweden)

    Tanja Woyke

    2010-04-01

    Full Text Available While the bulk of the finished microbial genomes sequenced to date are derived from cultured bacterial and archaeal representatives, the vast majority of microorganisms elude current culturing attempts, severely limiting the ability to recover complete or even partial genomes from these environmental species. Single cell genomics is a novel culture-independent approach, which enables access to the genetic material of an individual cell. No single cell genome has to our knowledge been closed and finished to date. Here we report the completed genome from an uncultured single cell of Candidatus Sulcia muelleri DMIN. Digital PCR on single symbiont cells isolated from the bacteriome of the green sharpshooter Draeculacephala minerva bacteriome allowed us to assess that this bacteria is polyploid with genome copies ranging from approximately 200-900 per cell, making it a most suitable target for single cell finishing efforts. For single cell shotgun sequencing, an individual Sulcia cell was isolated and whole genome amplified by multiple displacement amplification (MDA. Sanger-based finishing methods allowed us to close the genome. To verify the correctness of our single cell genome and exclude MDA-derived artifacts, we independently shotgun sequenced and assembled the Sulcia genome from pooled bacteriomes using a metagenomic approach, yielding a nearly identical genome. Four variations we detected appear to be genuine biological differences between the two samples. Comparison of the single cell genome with bacteriome metagenomic sequence data detected two single nucleotide polymorphisms (SNPs, indicating extremely low genetic diversity within a Sulcia population. This study demonstrates the power of single cell genomics to generate a complete, high quality, non-composite reference genome within an environmental sample, which can be used for population genetic analyzes.

  5. One Bacterial Cell, One Complete Genome

    Energy Technology Data Exchange (ETDEWEB)

    Woyke, Tanja; Tighe, Damon; Mavrommatis, Konstantinos; Clum, Alicia; Copeland, Alex; Schackwitz, Wendy; Lapidus, Alla; Wu, Dongying; McCutcheon, John P.; McDonald, Bradon R.; Moran, Nancy A.; Bristow, James; Cheng, Jan-Fang

    2010-04-26

    While the bulk of the finished microbial genomes sequenced to date are derived from cultured bacterial and archaeal representatives, the vast majority of microorganisms elude current culturing attempts, severely limiting the ability to recover complete or even partial genomes from these environmental species. Single cell genomics is a novel culture-independent approach, which enables access to the genetic material of an individual cell. No single cell genome has to our knowledge been closed and finished to date. Here we report the completed genome from an uncultured single cell of Candidatus Sulcia muelleri DMIN. Digital PCR on single symbiont cells isolated from the bacteriome of the green sharpshooter Draeculacephala minerva bacteriome allowed us to assess that this bacteria is polyploid with genome copies ranging from approximately 200?900 per cell, making it a most suitable target for single cell finishing efforts. For single cell shotgun sequencing, an individual Sulcia cell was isolated and whole genome amplified by multiple displacement amplification (MDA). Sanger-based finishing methods allowed us to close the genome. To verify the correctness of our single cell genome and exclude MDA-derived artifacts, we independently shotgun sequenced and assembled the Sulcia genome from pooled bacteriomes using a metagenomic approach, yielding a nearly identical genome. Four variations we detected appear to be genuine biological differences between the two samples. Comparison of the single cell genome with bacteriome metagenomic sequence data detected two single nucleotide polymorphisms (SNPs), indicating extremely low genetic diversity within a Sulcia population. This study demonstrates the power of single cell genomics to generate a complete, high quality, non-composite reference genome within an environmental sample, which can be used for population genetic analyzes.

  6. Nucleotide sequence analyses of genomic RNAs of peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

    NARCIS (Netherlands)

    Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.

    2005-01-01

    The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that

  7. Nucleotide Sequence and Analysis of an orotate transporter-containing plasmid isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410

    DEFF Research Database (Denmark)

    Defoor, Els Marie Celine; Martinussen, Jan

    A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...

  8. Inhibitory effect of extracellular purine nucleotide and nucleoside concentrations on T cell proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Weiler, Monica [Department of Medicine III and Transfusion Medicine, University Hospital Grosshadern, Ludwig-Maximilians-University, Munich (Germany); Schmetzer, Helga [Helmholtz Center Munich (Germany); German Research Center for Environmental Health, Munich (Germany); Braeu, Marion; Buhmann, Raymund [Helmholtz Center Munich (Germany); German Research Center for Environmental Health, Munich (Germany); Department of Medicine III and Transfusion Medicine, University Hospital Grosshadern, Ludwig-Maximilians-University, Munich (Germany)

    2016-11-15

    The release of nucleic acids and derivatives after tissue-injury may affect cellular immune-response. We studied the impact of extracellular ribo-, desoxyribonucleotides and nucleosides on T-cell immunity. Peripheral-blood-mononuclear-cells (PBMCs) or isolated CD3{sup +}T-cells obtained from 6 healthy donors were stimulated via CD3/CD28 Dynabeads or dendritic cells (DCs) in the presence or absence of pyrimidine-, purine-nucleotides and -nucleosides (range 2–200 µM). Addition of deoxy-, guanosine-triphosphate (dGTP, GTP) and guanosine resulted concentration dependent in a complete, adenosine-triphosphate (ATP) in a partial inhibition of the induced T-cell-proliferation. Deoxyadenosine-triphosphate (dATP), adenosine and the pyrimidine-ribo- and -deoxyribonucleotides displayed no inhibitory capacity. Inhibitory effects of dGTP and GTP, but not of guanosine and ATP were culture-media-dependent and could be almost abrogated by use of the serum-free lymphocyte-culture-media X-Vivo15 instead of RPMI1640 with standard-supplementation. In contrast to RPMI1640, X-Vivo15 resulted in a significant down-regulation of the cell-surface-located ectonucleotidases CD39 (Ecto-Apyrase) and CD73 (Ecto-5′-Nucleotidase), critical for the extracellular nucleotides-hydrolysis to nucleosides, explaining the loss of inhibition mediated by dGTP and GTP, but not Guanosine. In line with previous findings ATP was found to exert immunosuppressive effects on T-cell-proliferation. Purine-nucleotides, dGTP and GTP displayed a higher inhibitory capacity, but seem to be strictly dependent on the microenvironmental conditions modulating the responsiveness of the respective T-lymphocytes. Further evaluation of experimental and respective clinical settings should anticipate these findings.

  9. Inhibitory effect of extracellular purine nucleotide and nucleoside concentrations on T cell proliferation

    International Nuclear Information System (INIS)

    Weiler, Monica; Schmetzer, Helga; Braeu, Marion; Buhmann, Raymund

    2016-01-01

    The release of nucleic acids and derivatives after tissue-injury may affect cellular immune-response. We studied the impact of extracellular ribo-, desoxyribonucleotides and nucleosides on T-cell immunity. Peripheral-blood-mononuclear-cells (PBMCs) or isolated CD3 + T-cells obtained from 6 healthy donors were stimulated via CD3/CD28 Dynabeads or dendritic cells (DCs) in the presence or absence of pyrimidine-, purine-nucleotides and -nucleosides (range 2–200 µM). Addition of deoxy-, guanosine-triphosphate (dGTP, GTP) and guanosine resulted concentration dependent in a complete, adenosine-triphosphate (ATP) in a partial inhibition of the induced T-cell-proliferation. Deoxyadenosine-triphosphate (dATP), adenosine and the pyrimidine-ribo- and -deoxyribonucleotides displayed no inhibitory capacity. Inhibitory effects of dGTP and GTP, but not of guanosine and ATP were culture-media-dependent and could be almost abrogated by use of the serum-free lymphocyte-culture-media X-Vivo15 instead of RPMI1640 with standard-supplementation. In contrast to RPMI1640, X-Vivo15 resulted in a significant down-regulation of the cell-surface-located ectonucleotidases CD39 (Ecto-Apyrase) and CD73 (Ecto-5′-Nucleotidase), critical for the extracellular nucleotides-hydrolysis to nucleosides, explaining the loss of inhibition mediated by dGTP and GTP, but not Guanosine. In line with previous findings ATP was found to exert immunosuppressive effects on T-cell-proliferation. Purine-nucleotides, dGTP and GTP displayed a higher inhibitory capacity, but seem to be strictly dependent on the microenvironmental conditions modulating the responsiveness of the respective T-lymphocytes. Further evaluation of experimental and respective clinical settings should anticipate these findings.

  10. Normalization of Complete Genome Characteristics: Application to Evolution from Primitive Organisms to Homo sapiens.

    Science.gov (United States)

    Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji

    2015-04-01

    Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.

  11. Complete Genome Sequence of the Halophilic Methylotrophic Methanogen Archaeon Methanohalophilus portucalensis Strain FDF-1T

    KAUST Repository

    L’Haridon, Stéphane

    2018-01-17

    We report here the complete genome sequence (2.08 Mb) of Methanohalophilus portucalensis strain FDF-1T, a halophilic methylotrophic methanogen isolated from the sediment of a saltern in Figeria da Foz, Portugal. The average nucleotide identity and DNA-DNA hybridization analyses show that Methanohalophilus mahii, M. halophilus, and M. portucalensis are three different species within the Methanosarcinaceae family.

  12. Complete genome sequence of a divergent strain of lettuce chlorosis virus from Periwinkle in China

    Science.gov (United States)

    A novel strain of Lettuce chlorosis virus (LCV) was identified from periwinkle in China (PW) with foliar interveinal chlorosis and plant dwarfing. Complete nucleotide (nt) sequences of genomic RNA1 and RNA2 of the virus are 8,602 nt and 8,456 nt, respectively. The genomic organization of LCV-PW rese...

  13. Structure of Salmonella typhimurium OMP Synthase in a Complete Substrate Complex

    DEFF Research Database (Denmark)

    Grubmeyer, Charles; Hansen, Michael Riis; Fedorov, Alexander A.

    2012-01-01

    Dimeric Salmonella typhimurium orotate phosphoribosyltransferase (OMP synthase, EC 2.4.2.10), a key enzyme in de novo pyrimidine nucleotide synthesis, has been cocrystallized in a complete substrate E·MgPRPP·orotate complex and the structure determined to 2.2 Å resolution. This structure resem...

  14. Complete Genome Sequences of Mycobacteriophages Clautastrophe, Kingsolomon, Krypton555, and Nicholas

    OpenAIRE

    Chung, Hui-Min; D’Elia, Tom; Ross, Joseph F.; Alvarado, Samuel M.; Brantley, Molly-Catherine; Bricker, Lydia P.; Butler, Courtney R.; Crist, Carson; Dane, Julia M.; Farran, Brett W.; Hobbs, Sierra; Lapak, Michelle; Lovell, Conner; Ludergnani, Nicholas; McMullen, Allison

    2017-01-01

    ABSTRACT We report here the complete genome sequences of four subcluster L3 mycobacteriophages newly isolated from soil samples, using Mycobacterium smegmatis mc2155 as the host. Comparative genomic analyses with four previously described subcluster L3 phages reveal strong nucleotide similarity and gene conservation, with several large insertions/deletions near their right genome ends.

  15. Complete Genome Sequences of Mycobacteriophages Clautastrophe, Kingsolomon, Krypton555, and Nicholas

    Science.gov (United States)

    Chung, Hui-Min; D’Elia, Tom; Ross, Joseph F.; Alvarado, Samuel M.; Brantley, Molly-Catherine; Bricker, Lydia P.; Butler, Courtney R.; Crist, Carson; Dane, Julia M.; Farran, Brett W.; Hobbs, Sierra; Lapak, Michelle; Lovell, Conner; McMullen, Allison; Mirza, Sohail A.; Thrift, Noah; Vaughan, Donald P.; Worley, Grace; Ejikemeuwa, Amara; Zaw, May; Albritton, Claude F.; Bertrand, Sarah C.; Chaudhry, Shanzay S.; Cheema, Vzair A.; Do, Camilla; Do, Michael L.; Duong, Huyen M.; El-Desoky, Dalia H.; Green, Kelsey M.; Lee, Rhea N.; Thornton, Lauren A.; Vu, James M.; Zahra, Mah Noor; Stoner, Ty H.; Garlena, Rebecca A.; Jacobs-Sera, Deborah; Russell, Daniel A.

    2017-01-01

    ABSTRACT We report here the complete genome sequences of four subcluster L3 mycobacteriophages newly isolated from soil samples, using Mycobacterium smegmatis mc2155 as the host. Comparative genomic analyses with four previously described subcluster L3 phages reveal strong nucleotide similarity and gene conservation, with several large insertions/deletions near their right genome ends. PMID:29122864

  16. Complete genome sequence of Paris mosaic necrosis virus, a distinct member of the genus Potyvirus

    Science.gov (United States)

    The complete genomic sequence of a novel potyvirus was determined from Paris polyphylla var. yunnanensis. Its genomic RNA consists of 9,660 nucleotides (nt) excluding the 3’-terminal poly (A) tail, containing a single open reading frame (ORF) encoding a large polyprotein. The virus shares 52.1-69.7%...

  17. Complete Genome Sequence of the Halophilic Methylotrophic Methanogen Archaeon Methanohalophilus portucalensis Strain FDF-1T

    KAUST Repository

    L’ Haridon, Sté phane; Corre, Erwan; Guan, Yue; Vinu, Manikandan; La Cono, Violetta; Yakimov, Michail; Stingl, Ulrich; Toffin, Laurent; Jebbar, Mohamed

    2018-01-01

    We report here the complete genome sequence (2.08 Mb) of Methanohalophilus portucalensis strain FDF-1T, a halophilic methylotrophic methanogen isolated from the sediment of a saltern in Figeria da Foz, Portugal. The average nucleotide identity and DNA-DNA hybridization analyses show that Methanohalophilus mahii, M. halophilus, and M. portucalensis are three different species within the Methanosarcinaceae family.

  18. First Complete Genome Sequence of Suakwa aphid-borne yellows virus from East Timor

    Science.gov (United States)

    Maina, Solomon; Edwards, Owain R.; de Almeida, Luis; Ximenes, Abel

    2016-01-01

    We present here the first complete genomic RNA sequence of the polerovirus Suakwa aphid-borne yellows virus (SABYV), from East Timor. The isolate sequenced came from a virus-infected pumpkin plant. The East Timorese genome had a nucleotide identity of 86.5% with the only other SABYV genome available, which is from Taiwan. PMID:27469955

  19. Complete genome sequence of a recent panzootic virulent Newcastle disease virus from Pakistan

    Science.gov (United States)

    Complete genome sequence of a new strain of Newcastle disease virus (NDV) (chicken/Pak/Lahore-611/2013) is reported. The strain was isolated from a vaccinated chicken flock in Pakistan in 2013 and has panzootic features. The genome is 15192 nucleotides in length and is classified as sub-genotype V...

  20. Concatenated image completion via tensor augmentation and completion

    OpenAIRE

    Bengua, Johann A.; Tuan, Hoang D.; Phien, Ho N.; Do, Minh N.

    2016-01-01

    This paper proposes a novel framework called concatenated image completion via tensor augmentation and completion (ICTAC), which recovers missing entries of color images with high accuracy. Typical images are second- or third-order tensors (2D/3D) depending if they are grayscale or color, hence tensor completion algorithms are ideal for their recovery. The proposed framework performs image completion by concatenating copies of a single image that has missing entries into a third-order tensor,...

  1. Preparation of protected nucleotides usable in oligonucleotide synthesis

    International Nuclear Information System (INIS)

    Debiard, Jean-Pascal

    1983-01-01

    After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

  2. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  3. p-topological Cauchy completions

    Directory of Open Access Journals (Sweden)

    J. Wig

    1999-01-01

    Full Text Available The duality between “regular” and “topological” as convergence space properties extends in a natural way to the more general properties “p-regular” and “p-topological.” Since earlier papers have investigated regular, p-regular, and topological Cauchy completions, we hereby initiate a study of p-topological Cauchy completions. A p-topological Cauchy space has a p-topological completion if and only if it is “cushioned,” meaning that each equivalence class of nonconvergent Cauchy filters contains a smallest filter. For a Cauchy space allowing a p-topological completion, it is shown that a certain class of Reed completions preserve the p-topological property, including the Wyler and Kowalsky completions, which are, respectively, the finest and the coarsest p-topological completions. However, not all p-topological completions are Reed completions. Several extension theorems for p-topological completions are obtained. The most interesting of these states that any Cauchy-continuous map between Cauchy spaces allowing p-topological and p′-topological completions, respectively, can always be extended to a θ-continuous map between any p-topological completion of the first space and any p′-topological completion of the second.

  4. Lack of nucleotide variability in a beetle pest with extreme inbreeding.

    Science.gov (United States)

    Andreev, D; Breilid, H; Kirkendall, L; Brun, L O; ffrench-Constant, R H

    1998-05-01

    The coffee berry borer beetle Hypothenemus hampei (Ferrari) (Curculionidae: Scolytinae) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an unusual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occurring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation in nuclear and mitochondrial genomes of this beetle worldwide. Here we show that two nuclear loci (Resistance to dieldrin and ITS2) are completely invariant, whereas some variability is maintained at a mitochondrial locus (COI), probably corresponding to a higher mutation rate in the mitochondrial genome. Phylogenetic analysis of the mitochondrial data shows only two clades of beetle haplotypes outside of Kenya, the proposed origin of the species. These data confirm that inbreeding greatly reduces nucleotide variation and suggest the recent global spread of only two inbreeding lines of this bark beetle.

  5. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  6. Posttransfusional changes of 2,3-diphosphoglycerate and nucleotides in CPD-SAGM-preserved erythrocytes.

    Science.gov (United States)

    Matthes, G; Strunk, S; Siems, W; Grune, T

    1993-06-01

    Posttransfusional changes of preserved red blood cells can influence the oxygen equilibrium curve which is mainly affected by the concentration of erythrocyte 2,3-diphosphoglycerate (DPG). The regeneration kinetics of DPG and nucleotides (ATP, ADP, AMP, GTP, GDP) was determined over a period of 0-48 h in surgically treated patients following transfusion of DPG-depleted packed red cells stored for 14 days in CPD-SAGM. 3 h after transfusion the DPG levels raised up to 40% of the patients' prior DPG concentrations. Complete regeneration of the DPG concentrations occurred 36-48 h after transfusion. Changes in the nucleotide pattern indicate, after a temporary decrease of ATP and GTP levels (after 10-30 min) and an activation phase (after 3-12 h), the full regeneration of these parameters 24-48 h after transfusion. The regeneration kinetics of DPG should be taken into consideration for transfusions with blood units stored for more than 14 days, especially in patients with reduced compensatory mechanisms (coronary and cerebral scleroses, pacemaker, etc.) and large transfusion volumes.

  7. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  8. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  9. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  10. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

    2007-01-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  11. Novel Radioligands for Cyclic Nucleotide Phosphodiesterase Imaging with Positron Emission Tomography: An Update on Developments Since 2012

    Directory of Open Access Journals (Sweden)

    Susann Schröder

    2016-05-01

    Full Text Available Cyclic nucleotide phosphodiesterases (PDEs are a class of intracellular enzymes that inactivate the secondary messenger molecules, cyclic adenosine monophosphate (cAMP and cyclic guanosine monophosphate (cGMP. Thus, PDEs regulate the signaling cascades mediated by these cyclic nucleotides and affect fundamental intracellular processes. Pharmacological inhibition of PDE activity is a promising strategy for treatment of several diseases. However, the role of the different PDEs in related pathologies is not completely clarified yet. PDE-specific radioligands enable non-invasive visualization and quantification of these enzymes by positron emission tomography (PET in vivo and provide an important translational tool for elucidation of the relationship between altered expression of PDEs and pathophysiological effects as well as (pre-clinical evaluation of novel PDE inhibitors developed as therapeutics. Herein we present an overview of novel PDE radioligands for PET published since 2012.

  12. Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

    International Nuclear Information System (INIS)

    Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

    1987-01-01

    Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

  13. Structure completion for facade layouts

    KAUST Repository

    Fan, Lubin; Musialski, Przemyslaw; Liu, Ligang; Wonka, Peter

    2014-01-01

    completion with large missing parts is an ill-posed problem. Therefore, we combine two sources of information to derive our solution: the observed shapes and a database of complete layouts. The problem is also very difficult, because shape positions

  14. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    Science.gov (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  16. Scambio, a novel guanine nucleotide exchange factor for Rho

    Directory of Open Access Journals (Sweden)

    Groffen John

    2004-04-01

    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  17. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  18. The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.

    Science.gov (United States)

    Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun

    2016-07-01

    The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

  19. Complexes of Escherichia coli adenylate kinase and nucleotides: 1H NMR studies of the nucleotide sites in solution

    International Nuclear Information System (INIS)

    Vetter, I.R.; Reinstein, J.; Roesch, P.

    1990-01-01

    One- and two-dimensional nuclear magnetic resonance (NMR) studies, in particular substrate-protein nuclear Overhauser effect (NOESY) measurements, as well as nucleotide and P 1 ,P 5 -bis-(5'-adenosyl) pentaphosphate (AP 5 A) titrations and studies of the temperature-dependent unfolding of the tertiary structure of Escherichia coli adenylate kinase (AK EC ) were performed. These experiments and comparison with the same type of experiments performed with the porcine enzyme led them to the following conclusions: (1) at pH 8 and concentrations of approximately 2.5-3 mM, AK EC is partially unfolded at 318 K; (2) ATP·Mg 2+ binds to the ATP site with a dissociation constant of approximately 40 μM under the assumption that ATP binds to one nucleotide site only; (3) AP 5 A·Mg 2+ binds to both nucleotide sites and thus simulates the active complex; (4) the ATP·Mg 2+ adenine in the AK EC ·AP 5 A·Mg 2+ complex is located close to His 134 and Phe 19 ; (5) the AK EC G-loop with bound ATP·Mg 2+ is structurally highly homologous to the loop region in the oncogene product p21 with bound GTP·Mg 2+

  20. AVP-stimulated nucleotide secretion in perfused mouse medullary thick ascending limb and cortical collecting duct

    DEFF Research Database (Denmark)

    Odgaard, Elvin V. P.; Prætorius, Helle; Leipziger, Jens Georg

    2009-01-01

    is stimulated remain elusive. Here, we investigate the phenomenon of nucleotide secretion in intact, perfused mouse medullary thick ascending limb (mTAL) and cortical collecting duct (CCD). The nucleotide secretion was monitored by a biosensor adapted to register nucleotides in the tubular outflow...

  1. DivStat: a user-friendly tool for single nucleotide polymorphism analysis of genomic diversity.

    Directory of Open Access Journals (Sweden)

    Inês Soares

    Full Text Available Recent developments have led to an enormous increase of publicly available large genomic data, including complete genomes. The 1000 Genomes Project was a major contributor, releasing the results of sequencing a large number of individual genomes, and allowing for a myriad of large scale studies on human genetic variation. However, the tools currently available are insufficient when the goal concerns some analyses of data sets encompassing more than hundreds of base pairs and when considering haplotype sequences of single nucleotide polymorphisms (SNPs. Here, we present a new and potent tool to deal with large data sets allowing the computation of a variety of summary statistics of population genetic data, increasing the speed of data analysis.

  2. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  3. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Completeness theorems in transport theory

    International Nuclear Information System (INIS)

    Zweifel, P.F.

    1984-01-01

    Ever since K. M.; Case's famous 1960 paper, transport theorists have been studying the questions of full- and half-range completeness for various transport type equations. The purpose of this note is to try to define exactly what is meant by completeness as it is needed, and used, in solving transport equations and to discuss some of the various techniques which have been, or might be, used to verify completeness. Attention is restricted to the question of full-range completeness. As a paradigm the generalized form of the transport equation first introduced by Beals is adopted

  5. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  6. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  7. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  8. ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

    Science.gov (United States)

    Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

    2012-09-08

    The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  9. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Directory of Open Access Journals (Sweden)

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  10. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Science.gov (United States)

    2012-01-01

    Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

  11. Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

    Science.gov (United States)

    E, Chao; Duan, Baogen; Yu, Jin

    2017-04-20

    Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

  12. Latino College Completion: New York

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  13. Latino College Completion: United States

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  14. Latino College Completion: South Dakota

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  15. Latino College Completion: North Dakota

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  16. Latino College Completion: New Mexico

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  17. Structure completion for facade layouts

    KAUST Repository

    Fan, Lubin

    2014-11-18

    (Figure Presented) We present a method to complete missing structures in facade layouts. Starting from an abstraction of the partially observed layout as a set of shapes, we can propose one or multiple possible completed layouts. Structure completion with large missing parts is an ill-posed problem. Therefore, we combine two sources of information to derive our solution: the observed shapes and a database of complete layouts. The problem is also very difficult, because shape positions and attributes have to be estimated jointly. Our proposed solution is to break the problem into two components: a statistical model to evaluate layouts and a planning algorithm to generate candidate layouts. This ensures that the completed result is consistent with the observation and the layouts in the database.

  18. Complexity of Products of Some Complete and Complete Bipartite Graphs

    Directory of Open Access Journals (Sweden)

    S. N. Daoud

    2013-01-01

    Full Text Available The number of spanning trees in graphs (networks is an important invariant; it is also an important measure of reliability of a network. In this paper, we derive simple formulas of the complexity, number of spanning trees, of products of some complete and complete bipartite graphs such as cartesian product, normal product, composition product, tensor product, and symmetric product, using linear algebra and matrix analysis techniques.

  19. Kinetic mechanism and nucleotide specificity of NADH peroxidase

    International Nuclear Information System (INIS)

    Stoll, V.S.; Blanchard, J.S.

    1988-01-01

    NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between [ 14 C]NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols

  20. Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy

    Directory of Open Access Journals (Sweden)

    Stylianos Michalakis

    2018-03-01

    Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.

  1. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A.

    2017-10-04

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  2. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A; Turek, Ilona S.

    2017-01-01

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  3. Modification of synthesis nucleotides [γ-32P] ATP

    International Nuclear Information System (INIS)

    Wira Y Rahman; Endang Sarmini; Herlina; Triyanto; Hambali; Abdul Mutalib; Santi Nurbaiti

    2013-01-01

    In molecular biology, radionuclides in the form of radiolabeled compounds have been widely used as deoxyribonucleic acid (DNA) / ribonucleic acid (RNA) tracer in order to explore a wide range of physiological and pathological processes. One of such compounds is [γ- 32 P]-adenosine triphosphate {[γ- 32 P]-ATP} [γ- 32 P]-ATP which has been widely used in the biotechnology research. In order to support the biotechnology research in Indonesia in this project, [γ- 32 P]- ATP had been synthesized by enzymatic reactions with modifying the method of synthesis using the precursor DL-glyceraldehyde 3-phosphate, nucleotides Adenosine Diphosphate (ADP) and H 3 32 PO 4 and enzymes glyceraldehyde 3-phosphate dehydrogenase, 3-phosphoroglyceric phosphokinase and lactate dehydrogenase. The purification of the synthesized [γ- 32 P]-ATP, by using DEAE Sephadex column chromatography. The synthesis and purification process that had been performed were able in producing of [γ- 32 P]-ATP with radioactivity of 1,175 mCi and radiochemical purity of 99,49%.. Having successfully prepared the [γ- 32 P]-ATP and application, in the near future the Radioisotopes and Radiopharmaceuticals Centre is expected to be able in providing the above-mentioned radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  4. Nucleobases, nucleosides, and nucleotides: versatile biomolecules for generating functional nanomaterials.

    Science.gov (United States)

    Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2018-02-21

    The incorporation of biomolecules into nanomaterials generates functional nanosystems with novel and advanced properties, presenting great potential for applications in various fields. Nucleobases, nucleosides and nucleotides, as building blocks of nucleic acids and biological coenzymes, constitute necessary components of the foundation of life. In recent years, as versatile biomolecules for the construction or regulation of functional nanomaterials, they have stimulated interest in researchers, due to their unique properties such as structural diversity, multiplex binding sites, self-assembly ability, stability, biocompatibility, and chirality. In this review, strategies for the synthesis of nanomaterials and the regulation of their morphologies and functions using nucleobases, nucleosides, and nucleotides as building blocks, templates or modulators are summarized alongside selected applications. The diverse applications range from sensing, bioimaging, and drug delivery to mimicking light-harvesting antenna, the construction of logic gates, and beyond. Furthermore, some perspectives and challenges in this emerging field are proposed. This review is directed toward the broader scientific community interested in biomolecule-based functional nanomaterials.

  5. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    International Nuclear Information System (INIS)

    Kincaid, R.L.; Manganiello, V.C.

    1988-01-01

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  6. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  7. Trend of Complete Hydatidiform Mole

    Directory of Open Access Journals (Sweden)

    K Thapa

    2010-03-01

    Full Text Available INTRODUCTION: Complete Hydatidiform mole is one of the most frequent abnormal pregnancies. This review studies the trend of complete mole in Paropakar Maternity and Women's hospital and clinical ability to detect it. METHODS: This is a retrospective study of 504 cases of complete hydatidiform mole recorded at Paropakar maternity and women's hospital, Kathmandu, during 2058-2065 B.S. Medical records were reviewed and incidence, clinical presentation and method of diagnosis were studied. RESULTS: During the study period, there were 13,9117 births and 504 complete moles, 12 partial moles, 48 persistent gestational tumours, six choriocarcinoma and four invasive moles recorded in the hospital. The incidence of complete mole was one per 276 births. It was prevalent among women younger than 29 years (80% and among the primigravidae (36.7%. More than 90% women presented in the first half of their pregnancy and vaginal bleeding was the main complaint (68.3%. Suction evacuation, dilation and evacuation followed by sharp curettage and abdominal hysterectomy were performed in 80.6%, 17.6% and 1.2% of the women respectively. Persistent mole and choriocarcinoma developed in 9.5% and 0.4% respectively. CONCLUSIONS: Complete mole has the highest incidence. It affects mostly younger women and presents with vaginal bleeding most of the time, usually in the first half of their pregnancy. Keywords: complete hydatidiform mole, gestational trophoblastic disease, persistent gestational tumours.

  8. Large Hadron Collider nears completion

    CERN Multimedia

    2008-01-01

    Installation of the final component of the Large Hadron Collider particle accelerator is under way along the Franco-Swiss border near Geneva, Switzerland. When completed this summer, the LHC will be the world's largest and most complex scientific instrument.

  9. Complete Blood Count (For Parents)

    Science.gov (United States)

    ... Kids Deal With Injections and Blood Tests Blood Culture Anemia Blood Test: Basic Metabolic Panel (BMP) Blood Test: Hemoglobin Basic Blood Chemistry Tests Word! Complete Blood Count (CBC) Medical Tests and Procedures ( ...

  10. Monitoring Completed Navigation Projects Program

    National Research Council Canada - National Science Library

    Bottin, Jr., Robert R

    2001-01-01

    ... (MCNP) Program. The program was formerly known as the Monitoring Completed Coastal Projects Program, but was modified in the late 1990s to include all navigation projects, inland as well as coastal...

  11. Complete colonic duplication in children.

    Science.gov (United States)

    Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh

    2012-01-01

    Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.

  12. Interaction between nucleotide binding sites on chloroplast coupling factor 1 during ATP hydrolysis

    Energy Technology Data Exchange (ETDEWEB)

    Leckband, D.; Hammes, G.G.

    1987-04-21

    The initial hydrolysis of radioactively-labelled CaATP by chloroplast coupling factor 1 was studied with the quenched-flow method. The time course of hydrolysis can be described as a first-order conversion of the enzyme to an active form followed by steady-state formation of product. The rate constant for the first-order process is independent of substrate concentration but increased hyperbolically to a limiting value of 0.43 s/sup -1/ with increasing concentrations of free Ca/sup 2 +/. A mechanism involving a Ca/sup 2 +/-triggered conversion to an active form of the enzyme is consistent with the data. The steady-state rate varied sigmoidally with the CaATP concentration. Initial exchange of tightly bound ADP is complex: approx. 50% of the bound nucleotide is lost within 30 s, with complete exchange requiring several minutes. The first-order rate constant characterizing the rapid phase of the reaction increases hyperbolically to a limiting value of 0.26 s/sup -1/ as the concentration of CaATP is increased, indicating that the binding of CaATP to the enzyme promotes the exchange process. Modification of the quenched-flow apparatus permitted measurement of the rate of nucleotide exchange during steady-state catalysis. The value of the first-order rate constant characterizing this process is similar to the catalytic rate constant determined under identical conditions. When MgATP is tightly bound to the enzyme, none of the kinetic properties of the enzyme described above were significantly changes. The results obtained suggest a mechanism in which two sites on the enzyme participate in catalysis. Several possible mechanisms consistent with the data are discussed.

  13. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei

    2015-01-01

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  14. Radicals of DNA and DNA nucleotides generated by ionising radiation

    International Nuclear Information System (INIS)

    Przybytniak, G.

    2004-01-01

    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  15. Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

    Science.gov (United States)

    Berti, Lorenzo; Burley, Glenn A.

    2008-02-01

    Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

  16. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry

    2006-01-01

    ) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following......Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling...... exercise with heat stress, the core and muscle temperatures peaked at 39.5±0.2 and 40.2±0.2°C to be ~ 1°C higher (Pheat stress trial (P

  17. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  18. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...

  19. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze

    2013-09-03

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  20. Inferring influenza global transmission networks without complete phylogenetic information.

    Science.gov (United States)

    Aris-Brosou, Stéphane

    2014-03-01

    Influenza is one of the most severe respiratory infections affecting humans throughout the world, yet the dynamics of its global transmission network are still contentious. Here, I describe a novel combination of phylogenetics, time series, and graph theory to analyze 14.25 years of data stratified in space and in time, focusing on the main target of the human immune response, the hemagglutinin gene. While bypassing the complete phylogenetic inference of huge data sets, the method still extracts information suggesting that waves of genetic or of nucleotide diversity circulate continuously around the globe for subtypes that undergo sustained transmission over several seasons, such as H3N2 and pandemic H1N1/09, while diversity of prepandemic H1N1 viruses had until 2009 a noncontinuous transmission pattern consistent with a source/sink model. Irrespective of the shift in the structure of H1N1 diversity circulation with the emergence of the pandemic H1N1/09 strain, US prevalence peaks during the winter months when genetic diversity is at its lowest. This suggests that a dominant strain is generally responsible for epidemics and that monitoring genetic and/or nucleotide diversity in real time could provide public health agencies with an indirect estimate of prevalence.

  1. The fate of completed intentions.

    Science.gov (United States)

    Anderson, Francis T; Einstein, Gilles O

    2017-04-01

    The goal of this research was to determine whether and how people deactivate prospective memory (PM) intentions after they have been completed. One view proposes that PM intentions can be deactivated after completion, such that they no longer come to mind and interfere with current tasks. Another view is that now irrelevant completed PM intentions exhibit persisting activation, and continue to be retrieved. In Experiment 1, participants were given a PM intention embedded within the ongoing task during Phase 1, after which participants were told either that the PM task had been completed or suspended until later. During Phase 2, participants were instructed to perform only the ongoing task and were periodically prompted to report their thoughts. Critically, the PM targets from Phase 1 reappeared in Phase 2. All of our measures, including thoughts reported about the PM task, supported the existence of persisting activation. In Experiment 2, we varied conditions that were expected to mitigate persisting activation. Despite our best attempts to promote deactivation, we found evidence for the persistence of spontaneous retrieval in all groups after intentions were completed. The theoretical and practical implications of this potential dark side to spontaneous retrieval are discussed.

  2. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    Science.gov (United States)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  3. Complete Normal Ordering 1: Foundations

    CERN Document Server

    Ellis, John; Skliros, Dimitri P.

    2016-01-01

    We introduce a new prescription for quantising scalar field theories perturbatively around a true minimum of the full quantum effective action, which is to `complete normal order' the bare action of interest. When the true vacuum of the theory is located at zero field value, the key property of this prescription is the automatic cancellation, to any finite order in perturbation theory, of all tadpole and, more generally, all `cephalopod' Feynman diagrams. The latter are connected diagrams that can be disconnected into two pieces by cutting one internal vertex, with either one or both pieces free from external lines. In addition, this procedure of `complete normal ordering' (which is an extension of the standard field theory definition of normal ordering) reduces by a substantial factor the number of Feynman diagrams to be calculated at any given loop order. We illustrate explicitly the complete normal ordering procedure and the cancellation of cephalopod diagrams in scalar field theories with non-derivative i...

  4. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  5. Identification of Single Nucleotide Polymorphisms and analysis of Linkage Disequilibrium in sunflower elite inbred lines using the candidate gene approach

    Directory of Open Access Journals (Sweden)

    Heinz Ruth A

    2008-01-01

    Full Text Available Abstract Background Association analysis is a powerful tool to identify gene loci that may contribute to phenotypic variation. This includes the estimation of nucleotide diversity, the assessment of linkage disequilibrium structure (LD and the evaluation of selection processes. Trait mapping by allele association requires a high-density map, which could be obtained by the addition of Single Nucleotide Polymorphisms (SNPs and short insertion and/or deletions (indels to SSR and AFLP genetic maps. Nucleotide diversity analysis of randomly selected candidate regions is a promising approach for the success of association analysis and fine mapping in the sunflower genome. Moreover, knowledge of the distance over which LD persists, in agronomically meaningful sunflower accessions, is important to establish the density of markers and the experimental design for association analysis. Results A set of 28 candidate genes related to biotic and abiotic stresses were studied in 19 sunflower inbred lines. A total of 14,348 bp of sequence alignment was analyzed per individual. In average, 1 SNP was found per 69 nucleotides and 38 indels were identified in the complete data set. The mean nucleotide polymorphism was moderate (θ = 0.0056, as expected for inbred materials. The number of haplotypes per region ranged from 1 to 9 (mean = 3.54 ± 1.88. Model-based population structure analysis allowed detection of admixed individuals within the set of accessions examined. Two putative gene pools were identified (G1 and G2, with a large proportion of the inbred lines being assigned to one of them (G1. Consistent with the absence of population sub-structuring, LD for G1 decayed more rapidly (r2 = 0.48 at 643 bp; trend line, pooled data than the LD trend line for the entire set of 19 individuals (r2 = 0.64 for the same distance. Conclusion Knowledge about the patterns of diversity and the genetic relationships between breeding materials could be an invaluable aid in crop

  6. The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

    International Nuclear Information System (INIS)

    Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori

    1977-01-01

    In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

  7. Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.

    Science.gov (United States)

    Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela

    2013-07-01

    Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.

  8. Structural Completeness in Fuzzy Logics

    Czech Academy of Sciences Publication Activity Database

    Cintula, Petr; Metcalfe, G.

    2009-01-01

    Roč. 50, č. 2 (2009), s. 153-183 ISSN 0029-4527 R&D Projects: GA MŠk(CZ) 1M0545 Institutional research plan: CEZ:AV0Z10300504 Keywords : structral logics * fuzzy logics * structural completeness * admissible rules * primitive variety * residuated lattices Subject RIV: BA - General Mathematics

  9. Quantum space and quantum completeness

    Science.gov (United States)

    Jurić, Tajron

    2018-05-01

    Motivated by the question whether quantum gravity can "smear out" the classical singularity we analyze a certain quantum space and its quantum-mechanical completeness. Classical singularity is understood as a geodesic incompleteness, while quantum completeness requires a unique unitary time evolution for test fields propagating on an underlying background. Here the crucial point is that quantum completeness renders the Hamiltonian (or spatial part of the wave operator) to be essentially self-adjoint in order to generate a unique time evolution. We examine a model of quantum space which consists of a noncommutative BTZ black hole probed by a test scalar field. We show that the quantum gravity (noncommutative) effect is to enlarge the domain of BTZ parameters for which the relevant wave operator is essentially self-adjoint. This means that the corresponding quantum space is quantum complete for a larger range of BTZ parameters rendering the conclusion that in the quantum space one observes the effect of "smearing out" the singularity.

  10. Program Costs and Student Completion

    Science.gov (United States)

    Manning, Terri M.; Crosta, Peter M.

    2014-01-01

    Community colleges are under pressure to increase completion rates, prepare students for the workplace, and contain costs. Colleges need to know the financial implications of what are often perceived as routine decisions: course scheduling, program offerings, and the provision of support services. This chapter presents a methodology for estimating…

  11. Completely integrable operator evolutionary equations

    International Nuclear Information System (INIS)

    Chudnovsky, D.V.

    1979-01-01

    The authors present natural generalizations of classical completely integrable equations where the functions are replaced by arbitrary operators. Among these equations are the non-linear Schroedinger, the Korteweg-de Vries, and the modified KdV equations. The Lax representation and the Baecklund transformations are presented. (Auth.)

  12. Globals of Completely Regular Monoids

    Institute of Scientific and Technical Information of China (English)

    Wu Qian-qian; Gan Ai-ping; Du Xian-kun

    2015-01-01

    An element of a semigroup S is called irreducible if it cannot be expressed as a product of two elements in S both distinct from itself. In this paper we show that the class C of all completely regular monoids with irreducible identity elements satisfies the strong isomorphism property and so it is globally determined.

  13. Complete nitrification by Nitrospira bacteria

    DEFF Research Database (Denmark)

    Daims, Holger; Lebedeva, Elena V.; Pjevac, Petra

    2015-01-01

    Nitrification, the oxidation of ammonia via nitrite to nitrate, has always been considered to be a two-step process catalysed by chemolithoautotrophic microorganisms oxidizing either ammonia or nitrite. No known nitrifier carries out both steps, although complete nitrification should be energetic...

  14. The Completeness Theorem of Godel

    Indian Academy of Sciences (India)

    GENERAL I ARTICLE. The Completeness Theorem of Godel. 2. Henkin's Proof for First Order Logic. S M Srivastava is with the. Indian Statistical,. Institute, Calcutta. He received his PhD from the Indian Statistical. Institute in 1980. His research interests are in descriptive set theory. I Part 1. An Introduction to Math- ematical ...

  15. Spring valve for well completion

    Energy Technology Data Exchange (ETDEWEB)

    Gorbatov, P T

    1966-07-22

    A spring-loaded valve for well completion consists of a housing with a spring-loaded closing element. In order to protect the closing element from corrosion which might lower the pressure drop, the closing element is made in the form of a piston. It is tightly connected with sealing elements. The housing has orifices, overlapping the piston in the initial position.

  16. Largest particle detector nearing completion

    CERN Multimedia

    2006-01-01

    "Construction of another part of the Large Hadron Collider (LHC), the worl's largest particle accelerator at CERN in Switzerland, is nearing completion. The Compact Muon Solenoid (CMS) is oner of the LHC project's four large particle detectors. (1/2 page)

  17. YB0 SERVICES INSTALLATION COMPLETED

    CERN Document Server

    The beauty of the completed YB0 was briefly visible at P5 as preparations continue for Tracker installation. A tremendous effort, lasting 7 months and involving more than 100 workers on the busiest days, resulted in 5700 electrical cables, 780 optical cables with 65k fibre channels, and 550 pipes laid on YB0 for HB, EB and Tracker.

  18. Complete coding sequence of the human raf oncogene and the corresponding structure of the c-raf-1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Bonner, T I; Oppermann, H; Seeburg, P; Kerby, S B; Gunnell, M A; Young, A C; Rapp, U R

    1986-01-24

    The complete 648 amino acid sequence of the human raf oncogene was deduced from the 2977 nucleotide sequence of a fetal liver cDNA. The cDNA has been used to obtain clones which extend the human c-raf-1 locus by an additional 18.9 kb at the 5' end and contain all the remaining coding exons.

  19. Complete Genome Sequences of Four Avian Paramyxoviruses of Serotype 10 Isolated from Rockhopper Penguins on the Falkland Islands

    OpenAIRE

    Goraichuk, Iryna V.; Dimitrov, Kiril M.; Sharma, Poonam; Miller, Patti J.; Swayne, David E.; Suarez, David L.; Afonso, Claudio L.

    2017-01-01

    ABSTRACT The first complete genome sequences of four avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from rockhopper penguins on the Falkland Islands, sampled in 2007. All four genomes are 15,456 nucleotides in length, and phylogenetic analyses show them to be closely related.

  20. Complete Genome Sequences of Four Avian Paramyxoviruses of Serotype 10 Isolated from Rockhopper Penguins on the Falkland Islands

    Science.gov (United States)

    Goraichuk, Iryna V.; Dimitrov, Kiril M.; Sharma, Poonam; Miller, Patti J.; Swayne, David E.; Suarez, David L.

    2017-01-01

    ABSTRACT The first complete genome sequences of four avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from rockhopper penguins on the Falkland Islands, sampled in 2007. All four genomes are 15,456 nucleotides in length, and phylogenetic analyses show them to be closely related. PMID:28572332

  1. First Complete Genome Sequence of Papaya ringspot virus-W Isolated from a Gourd in the United States.

    Science.gov (United States)

    Ali, Akhtar

    2017-01-12

    In the United States, the Papaya ringspot virus was first reported from papaya in Florida in 1949. Here, we determined the first complete genome sequence (10,302 nucleotides) of a Papaya ringspot virus-W isolate, which was collected from a commercial field of gourd in Tulsa, OK. Copyright © 2017 Ali.

  2. Complete Genome Sequence of the Gamma-Aminobutyric Acid-Producing Strain Streptococcus thermophilus APC151.

    Science.gov (United States)

    Linares, Daniel M; Arboleya, Silvia; Ross, R Paul; Stanton, Catherine

    2017-04-27

    Here is presented the whole-genome sequence of Streptococcus thermophilus APC151, isolated from a marine fish. This bacterium produces gamma-aminobutyric acid (GABA) in high yields and is biotechnologically suitable to produce naturally GABA-enriched biofunctional yogurt. Its complete genome comprises 2,097 genes and 1,839,134 nucleotides, with an average G+C content of 39.1%. Copyright © 2017 Linares et al.

  3. A complete analysis of HA and NA genes of influenza A viruses.

    LENUS (Irish Health Repository)

    Shi, Weifeng

    2010-12-01

    More and more nucleotide sequences of type A influenza virus are available in public databases. Although these sequences have been the focus of many molecular epidemiological and phylogenetic analyses, most studies only deal with a few representative sequences. In this paper, we present a complete analysis of all Haemagglutinin (HA) and Neuraminidase (NA) gene sequences available to allow large scale analyses of the evolution and epidemiology of type A influenza.

  4. Complete mitochondrial genome and phylogeny of Pleistocene mammoth Mammuthus primigenius.

    Directory of Open Access Journals (Sweden)

    Evgeny I Rogaev

    2006-03-01

    Full Text Available Phylogenetic relationships between the extinct woolly mammoth (Mammuthus primigenius, and the Asian (Elephas maximus and African savanna (Loxodonta africana elephants remain unresolved. Here, we report the sequence of the complete mitochondrial genome (16,842 base pairs of a woolly mammoth extracted from permafrost-preserved remains from the Pleistocene epoch--the oldest mitochondrial genome sequence determined to date. We demonstrate that well-preserved mitochondrial genome fragments, as long as approximately 1,600-1700 base pairs, can be retrieved from pre-Holocene remains of an extinct species. Phylogenetic reconstruction of the Elephantinae clade suggests that M. primigenius and E. maximus are sister species that diverged soon after their common ancestor split from the L. africana lineage. Low nucleotide diversity found between independently determined mitochondrial genomic sequences of woolly mammoths separated geographically and in time suggests that north-eastern Siberia was occupied by a relatively homogeneous population of M. primigenius throughout the late Pleistocene.

  5. The complete mitochondrial genome of Ambastaia sidthimunki (Cypriniformes: Cobitidae).

    Science.gov (United States)

    Yu, Peng; Wei, Min; Yang, Qichao; Yang, Yingming; Wan, Quan

    2016-09-01

    Ambastaia sidthimunki is a beautiful small-sized fish and it was categorized as Endangered B2ab (iii,v) in the IUCN Red List. In this study, we reported the complete mitochondrial genome of the A. sidthimunki. The mitochondrial genome sequence was a circular molecule with 16,574 bp in length, and it contained 2 ribosomal RNA genes, 22 transfer RNA genes, 13 protein-coding genes, an L-strand replication origin (OL) and a control region (D-loop). The nucleotide acid composition of the entire mitogenome was 26.94% for C, 15.55% for G, 31.84% for A and 25.67% for T, with an AT content of 57.51%. This research contributes new molecular data for the conservation of this Endangered species.

  6. The complete chloroplast genomes of Cannabis sativa and Humulus lupulus.

    Science.gov (United States)

    Vergara, Daniela; White, Kristin H; Keepers, Kyle G; Kane, Nolan C

    2016-09-01

    Cannabis and Humulus are sister genera comprising the entirety of the Cannabaceae sensu stricto, including C. sativa L. (marijuana, hemp), and H. lupulus L. (hops) as two economically important crops. These two plants have been used by humans for many purposes including as a fiber, food, medicine, or inebriant in the case of C. sativa, and as a flavoring component in beer brewing in the case of H. lupulus. In this study, we report the complete chloroplast genomes for two distinct hemp varieties of C. sativa, Italian "Carmagnola" and Russian "Dagestani", and one Czech variety of H. lupulus "Saazer". Both C. sativa genomes are 153 871 bp in length, while the H. lupulus genome is 153 751 bp. The genomes from the two C. sativa varieties differ in 16 single nucleotide polymorphisms (SNPs), while the H. lupulus genome differs in 1722 SNPs from both C. sativa cultivars.

  7. The complete mitochondrial genome of Zebrias quagga (Pleuronectiformes: Soleidae).

    Science.gov (United States)

    Li, Dong-He; Shi, Wei; Miao, Xian-Guang; Kong, Xiao-Yu

    2016-01-01

    Zebrias quagga (Soleoidei, Soleidae) is a sort of small and medium-sized commercial flatfish, characterized by both eyes on the right side of the body and with a dark brown short tentacle on each eye. In this paper, the complete mitogenome sequence of Z. quagga was first determined, which is 17,045 bp in length and contains 13 protein-coding genes, two rRNA genes, 22 tRNA genes, as well as a control region (CR) and a L-strand replication origin (OL). Gene contents, locations, and orders are identical to those of typical teleostean mtDNA. The nucleotide composition of the whole mitogenome is 28.8%, 29.3%, 15.8%, and 26.1% for A, C, G, and T, respectively, with a slight bias of A+T content (54.9%). This result is expected to contribute to a better understanding the phylogenetic study of Soleidae and Pleuronectiformes.

  8. The complete chloroplast genome of Sinopodophyllum hexandrum Ying (Berberidaceae).

    Science.gov (United States)

    Meng, Lihua; Liu, Ruijuan; Chen, Jianbing; Ding, Chenxu

    2017-05-01

    The complete nucleotide sequence of the Sinopodophyllum hexandrum Ying chloroplast genome (cpDNA) was determined based on next-generation sequencing technologies in this study. The genome was 157 203 bp in length, containing a pair of inverted repeat (IRa and IRb) regions of 25 960 bp, which were separated by a large single-copy (LSC) region of 87 065 bp and a small single-copy (SSC) region of 18 218 bp, respectively. The cpDNA contained 148 genes, including 96 protein-coding genes, 8 ribosomal RNA genes, and 44 tRNA genes. In these genes, eight harbored a single intron, and two (ycf3 and clpP) contained a couple of introns. The cpDNA AT content of S. hexandrum cpDNA is 61.5%.

  9. Complete mitochondrial genome of the spadenose shark (Scoliodon macrorhynchos).

    Science.gov (United States)

    Chen, Xiao; Peng, Xin; Zhang, Peng; Yang, Shenyun; Liu, Min

    2014-04-01

    We firstly presented the complete mitogenome of the spadenose shark Scoliodon macrorhynchos (Carcharhinidae, Carcharhiniformes). The mitogenome is 16,693 bp long and contains 13 protein-coding genes, two rRNAs, 22 tRNAs and one control region, a typical vertebrate arrangement. The codon usage bias was different between the H-strand and L-strand encoded protein genes. All tRNA genes have the typical cloverleaf secondary structure excepting tRNA-Ser2, in which the dihydrouridine (DHU) arm is replaced by a simple loop with 12 unpaired nucleotides. A termination associated sequence and three conserved sequence blocks (CSB I-III) were identified in the control region, which were considered associating with the replication and transcription of mitogenome.

  10. Complete spacelike immersions with topology

    International Nuclear Information System (INIS)

    Harris, S.G.

    1988-01-01

    A fairly large class of Lorentz manifolds is defined, called WH normal manifolds, which are approximately those for which timelike infinity is a single point. It is shown that, in such a space, an immersed spacelike hypersurface which is complete must, if it is self-intersecting, not achronal or proper, satisfy strong topological conditions; in particular, if the immersion is injective in the fundamental group, then the hypersurface must be closed, embedded and achronal (i.e. a partial Cauchy surface). WH normal spaces include products of any Riemannian manifold with Minkowski 1-space; in such space, a complete immersed spacelike hypersurface must be immersed as a covering space for the Riemannian factor. (author)

  11. Completeness in Hybrid Type Theory

    DEFF Research Database (Denmark)

    Areces, Carlos; Blackburn, Patrick Rowan; Huertas, Antonia

    2014-01-01

    We show that basic hybridization (adding nominals and @ operators) makes it possible to give straightforward Henkin-style completeness proofs even when the modal logic being hybridized is higher-order. The key ideas are to add nominals as expressions of type t, and to extend to arbitrary types th......-style intensional models; we build, as simply as we can, hybrid logicover Henkin’s logic...

  12. [Anterior guidance in complete dentures].

    Science.gov (United States)

    Dubreuil, J; Trevelo, A

    1990-01-01

    Although the anterior guidance in complete dentures is not really a guide, the arrangement of the anterior maxillary and mandibular prosthetic teeth, defines a propulsive line called the virtual anterior guidance, a part from the cinematic criterias. The influence of this guide on cuspal movement is superior, in all mandibular points, to the influence of the condylar pathway. If this line is not respected, the practitioner may have to do excessive grindings during occlusal adjustments.

  13. Efficient Completion of Weighted Automata

    Directory of Open Access Journals (Sweden)

    Johannes Waldmann

    2016-09-01

    Full Text Available We consider directed graphs with edge labels from a semiring. We present an algorithm that allows efficient execution of queries for existence and weights of paths, and allows updates of the graph: adding nodes and edges, and changing weights of existing edges. We apply this method in the construction of matchbound certificates for automatically proving termination of string rewriting. We re-implement the decomposition/completion algorithm of Endrullis et al. (2006 in our framework, and achieve comparable performance.

  14. Complete normal ordering 1: Foundations

    Directory of Open Access Journals (Sweden)

    John Ellis

    2016-08-01

    Full Text Available We introduce a new prescription for quantising scalar field theories (in generic spacetime dimension and background perturbatively around a true minimum of the full quantum effective action, which is to ‘complete normal order’ the bare action of interest. When the true vacuum of the theory is located at zero field value, the key property of this prescription is the automatic cancellation, to any finite order in perturbation theory, of all tadpole and, more generally, all ‘cephalopod’ Feynman diagrams. The latter are connected diagrams that can be disconnected into two pieces by cutting one internal vertex, with either one or both pieces free from external lines. In addition, this procedure of ‘complete normal ordering’ (which is an extension of the standard field theory definition of normal ordering reduces by a substantial factor the number of Feynman diagrams to be calculated at any given loop order. We illustrate explicitly the complete normal ordering procedure and the cancellation of cephalopod diagrams in scalar field theories with non-derivative interactions, and by using a point splitting ‘trick’ we extend this result to theories with derivative interactions, such as those appearing as non-linear σ-models in the world-sheet formulation of string theory. We focus here on theories with trivial vacua, generalising the discussion to non-trivial vacua in a follow-up paper.

  15. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  16. Implication of SUMO E3 ligases in nucleotide excision repair.

    Science.gov (United States)

    Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji

    2015-08-01

    Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.

  17. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  18. Myristoylated α subunits of guanine nucleotide-binding regulatory proteins

    International Nuclear Information System (INIS)

    Buss, J.E.; Mumby, S.M.; Casey, P.J.; Gilman, A.G.; Sefton, B.M.

    1987-01-01

    Antisera directed against specific subunits of guanine nucleotide-binding regulatory proteins (G proteins) were used to immunoprecipitate these polypeptides from metabolically labeled cells. This technique detects, in extracts of a human astrocytoma cell line, the α subunits of G/sub s/ (stimulatory) (α 45 and α 52 ), a 41-kDa subunit of G/sub i/ (inhibitory) (α 41 ), a 40-kDa protein (α 40 ), and the 36-kDa β subunit. No protein that comigrated with the α subunit of G 0 (unknown function) (α 39 ) was detected. In cells grown in the presence of [ 3 H]myristic acid, α 41 and α 40 contained 3 H label, while the β subunit did not. Chemical analysis of lipids attached covalently to purified α 41 and α 39 from bovine brain also revealed myristic acid. Similar analysis of brain G protein β and γ subunits and of G/sub t/ (Transducin) subunits (α, β, and γ) failed to reveal fatty acids. The fatty acid associated with α 41 , α 40 , and α 39 was stable to treatment with base, suggesting that the lipid is linked to the polypeptide via an amide bond. These GTP binding proteins are thus identified as members of a select group of proteins that contains myristic acid covalently attached to the peptide backbone. Myristate may play an important role in stabilizing interactions of G proteins with phospholipid or with membrane-bound proteins

  19. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  20. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts

    International Nuclear Information System (INIS)

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo

    2016-01-01

    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X 3 , an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp

  1. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Shisheng Li

    2012-09-01

    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  2. Adenine nucleotide translocator transports haem precursors into mitochondria.

    Directory of Open Access Journals (Sweden)

    Motoki Azuma

    2008-08-01

    Full Text Available Haem is a prosthetic group for haem proteins, which play an essential role in oxygen transport, respiration, signal transduction, and detoxification. In haem biosynthesis, the haem precursor protoporphyrin IX (PP IX must be accumulated into the mitochondrial matrix across the inner membrane, but its mechanism is largely unclear. Here we show that adenine nucleotide translocator (ANT, the inner membrane transporter, contributes to haem biosynthesis by facilitating mitochondrial accumulation of its precursors. We identified that haem and PP IX specifically bind to ANT. Mitochondrial uptake of PP IX was inhibited by ADP, a known substrate of ANT. Conversely, ADP uptake into mitochondria was competitively inhibited by haem and its precursors, suggesting that haem-related porphyrins are accumulated into mitochondria via ANT. Furthermore, disruption of the ANT genes in yeast resulted in a reduction of haem biosynthesis by blocking the translocation of haem precursors into the matrix. Our results represent a new model that ANT plays a crucial role in haem biosynthesis by facilitating accumulation of its precursors into the mitochondrial matrix.

  3. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  4. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan

    2012-11-01

    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  5. Domestication rewired gene expression and nucleotide diversity patterns in tomato.

    Science.gov (United States)

    Sauvage, Christopher; Rau, Andrea; Aichholz, Charlotte; Chadoeuf, Joël; Sarah, Gautier; Ruiz, Manuel; Santoni, Sylvain; Causse, Mathilde; David, Jacques; Glémin, Sylvain

    2017-08-01

    Plant domestication has led to considerable phenotypic modifications from wild species to modern varieties. However, although changes in key traits have been well documented, less is known about the underlying molecular mechanisms, such as the reduction of molecular diversity or global gene co-expression patterns. In this study, we used a combination of gene expression and population genetics in wild and crop tomato to decipher the footprints of domestication. We found a set of 1729 differentially expressed genes (DEG) between the two genetic groups, belonging to 17 clusters of co-expressed DEG, suggesting that domestication affected not only individual genes but also regulatory networks. Five co-expression clusters were enriched in functional terms involving carbohydrate metabolism or epigenetic regulation of gene expression. We detected differences in nucleotide diversity between the crop and wild groups specific to DEG. Our study provides an extensive profiling of the rewiring of gene co-expression induced by the domestication syndrome in one of the main crop species. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  6. Nucleotide diversity and linkage disequilibrium in five Lolium perenne genes with putative role in shoot branching

    DEFF Research Database (Denmark)

    Brazauskas, Gintaras; Pašakinskienė, Izolda; Asp, Torben

    2010-01-01

    Knowledge on nucleotide diversity and linkage disequilibrium (LD) patterns is prerequisite for association analyses. However, little is known about the nucleotide diversity in the evolutionary important ryegrass shoot morphology genes. Five candidate genes, LpIAA1, LpRUB1, LpBRI1, LpSHOOT1 and Lp...

  7. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  8. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  9. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  10. Juvenile eye growth, when completed?

    DEFF Research Database (Denmark)

    Fledelius, Hans C; Christensen, Anders S; Fledelius, Christian

    2014-01-01

    PURPOSE: To test Sorsby's classical statement of axial eye growth as completed at the age of 13 years, with a view also to differentiating between basic eye growth and juvenile elongation associated with eventual refractive change towards myopia. METHODS: (i) A total of 160 healthy eyes close...... about age 13 as general limit found support from the cross-sectional data, which suggested stable emmetropic eye size from about 11-12 years, with an average apparently outgrown male emmetropic value of 23.5 mm versus females' 22.9 mm. The longitudinal data, however, showed emmetropic growth also beyond...

  11. Projective modules and complete intersections

    CERN Document Server

    Mandal, Satya

    1997-01-01

    In these notes on "Projective Modules and Complete Intersections" an account on the recent developments in research on this subject is presented. The author's preference for the technique of Patching isotopic isomorphisms due to Quillen, formalized by Plumsted, over the techniques of elementary matrices is evident here. The treatment of Basic Element theory here incorporates Plumstead's idea of the "generalized dimension functions". These notes are highly selfcontained and should be accessible to any graduate student in commutative algebra or algebraic geometry. They include fully self-contained presentations of the theorems of Ferrand-Szpiro, Cowsik-Nori and the techniques of Lindel.

  12. Preparation, characterization and in vitro evaluation of a new nucleotide analogue prodrug cyclodextrin inclusion complexes.

    Science.gov (United States)

    Diab, Roudayna; Jordheim, Lars P; Degobert, Ghania; Peyrottes, Suzanne; Périgaud, Christian; Dumontet, Charles; Fessi, Hatem

    2009-01-01

    Bis(tbutyl-S-acyl-2-thioethyl)-cytidine monophosophate is a new cytotoxic mononucleotide prodrug which have been developed to reverse the cellular resistance to nucleoside analogues. Unfortunately, its in vivo utilisation was hampered by its poor water solubility, raising the need of a molecular vector capable to mask its physicochemical characteristics although without affecting its cytotoxic activity. Hydroxypropyl-beta-cyclodextrin was used to prepare the prodrug inclusion complexes, allowing it to be solubilized in water and hence to be used for in vitro and in vivo experiments. A molar ratio of the cyclodextrin: prodrug of 3 was sufficient to obtain complete solubilization of the prodrug. The inclusion complex was characterized by differential scanning calorimetry, which revealed the disappearance of the melting peak of the prodrug suggesting the formation of inclusion complex. Proton Nuclear Magnetic Resonance spectroscopy provided a definitive proof of the inclusion complex formation, which was evidenced by the large chemical shift displacements observed for protons located in the interior of the hydrophobic cyclodextrin cavity. The complex retained its cytotoxic activity as shown by in vitro cell survival assays on murine leukemia cells. These results provided a basis for potential therapeutic applications of co-formulation of this new nucleotide analogue with hydroxypropyl-beta-CD in cancer therapy.

  13. The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

    Science.gov (United States)

    Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

    1992-12-01

    The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

  14. Bayesian pedigree inference with small numbers of single nucleotide polymorphisms via a factor-graph representation.

    Science.gov (United States)

    Anderson, Eric C; Ng, Thomas C

    2016-02-01

    We develop a computational framework for addressing pedigree inference problems using small numbers (80-400) of single nucleotide polymorphisms (SNPs). Our approach relaxes the assumptions, which are commonly made, that sampling is complete with respect to the pedigree and that there is no genotyping error. It relies on representing the inferred pedigree as a factor graph and invoking the Sum-Product algorithm to compute and store quantities that allow the joint probability of the data to be rapidly computed under a large class of rearrangements of the pedigree structure. This allows efficient MCMC sampling over the space of pedigrees, and, hence, Bayesian inference of pedigree structure. In this paper we restrict ourselves to inference of pedigrees without loops using SNPs assumed to be unlinked. We present the methodology in general for multigenerational inference, and we illustrate the method by applying it to the inference of full sibling groups in a large sample (n=1157) of Chinook salmon typed at 95 SNPs. The results show that our method provides a better point estimate and estimate of uncertainty than the currently best-available maximum-likelihood sibling reconstruction method. Extensions of this work to more complex scenarios are briefly discussed. Published by Elsevier Inc.

  15. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  16. The nucleotide sequence of a Polish isolate of Tomato torrado virus.

    Science.gov (United States)

    Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk

    2008-12-01

    A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

  17. Completion of the TRT Barrel

    CERN Multimedia

    Gagnon, P

    On February 3, the US-TRT team proudly completed the installation of the 96th barrel TRT module on its support structure in the SR building at CERN. This happy event came after many years of R&D initiated in the nineties by the TA1 team at CERN, followed by the construction of the modules in three American institutes (Duke, Hampton and Indiana Universities) from 1996 to 2003. In total, the 96 barrel modules contain 52544 kapton straws, each 4 mm in diameter and strung with a 30 micron gold-plated tungsten wire. Each wire was manually inserted, a feat in itself! The inner layer modules contain 329 straws, the middle layer modules have 520 straws and the outer layer, 793 straws. Thirty- two modules of each type form a full layer. Their special geometry was designed such as to leave no dead region. On average, a particle will cross 36 straws. Kirill Egorov, Chuck Mahlon and John Callahan inserted the last module in the Barrel Support Structure. After completion in the US, all modules were transferred...

  18. LHCf completes its first run

    CERN Multimedia

    CERN Bulletin

    2010-01-01

    LHCf, one of the three smaller experiments at the LHC, has completed its first run. The detectors were removed last week and the analysis of data is continuing. The first results will be ready by the end of the year.   One of the two LHCf detectors during the removal operations inside the LHC tunnel. LHCf is made up of two independent detectors located in the tunnel 140 m either side of the ATLAS collision point. The experiment studies the secondary particles created during the head-on collisions in the LHC because they are similar to those created in a cosmic ray shower produced when a cosmic particle hits the Earth’s atmosphere. The focus of the experiment is to compare the various shower models used to estimate the primary energy of ultra-high-energy cosmic rays. The energy of proton-proton collisions at the LHC will be equivalent to a cosmic ray of 1017eV hitting the atmosphere, very close to the highest energies observed in the sky. “We have now completed the fir...

  19. Complete family of separability criteria

    International Nuclear Information System (INIS)

    Doherty, Andrew C.; Spedalieri, Federico M.; Parrilo, Pablo A.

    2004-01-01

    We introduce a family of separability criteria that are based on the existence of extensions of a bipartite quantum state ρ to a larger number of parties satisfying certain symmetry properties. It can be easily shown that all separable states have the required extensions, so the nonexistence of such an extension for a particular state implies that the state is entangled. One of the main advantages of this approach is that searching for the extension can be cast as a convex optimization problem known as a semidefinite program. Whenever an extension does not exist, the dual optimization constructs an explicit entanglement witness for the particular state. These separability tests can be ordered in a hierarchical structure whose first step corresponds to the well-known positive partial transpose (Peres-Horodecki) criterion, and each test in the hierarchy is at least as powerful as the preceding one. This hierarchy is complete, in the sense that any entangled state is guaranteed to fail a test at some finite point in the hierarchy, thus showing it is entangled. The entanglement witnesses corresponding to each step of the hierarchy have well-defined and very interesting algebraic properties that, in turn, allow for a characterization of the interior of the set of positive maps. Coupled with some recent results on the computational complexity of the separability problem, which has been shown to be NP hard, this hierarchy of tests gives a complete and also computationally and theoretically appealing characterization of mixed bipartite entangled states

  20. SPS completes LS1 activities

    CERN Multimedia

    Katarina Anthony

    2014-01-01

    On 27 June, the SPS closed its doors to the LS1 engineers, bringing to an end almost 17 months of activities. The machine now enters the hardware-testing phase in preparation for an October restart.   Photo 1: The SPS transfer tunnel, TT10, reinforced with steal beams. Having completed their LS1 activities right on schedule (to the day!), the SPS team is now preparing the machine for its restart. Over the next eight weeks, hardware tests of the SPS dipole and quadrupole power converters will be underway, led by the TE-EPC (Electrical Power Converters) team. "OP start-up test activities will also be running in parallel, utilising the off hours when EPC is not using the machine," says David McFarlane, the SPS technical coordinator from the Engineering Department. "The primary beam testing phase will start at the beginning of September, once hardware tests and DSO safety tests have been completed." It has been a long journey to this point, with several major...

  1. AEgIS installation completed

    CERN Multimedia

    Katarina Anthony

    2012-01-01

    Gravity. Despite first being described over three centuries ago, it remains one of the least understood of the fundamental forces explored by physicists. At CERN’s recently completed AEgIS experiment, a team has set out to examine the effect of gravity on an as-yet-uncharted realm: antimatter.   The complete AEgIS set-up. Located in the AD hall, the AEgIS experiment plans to  make the first direct measurement of Earth’s gravitation effect on antimatter. By sending a beam of antihydrogen atoms through very thin gratings, the experiment will be able to measure how far the antihydrogen atoms fall and in how much time – giving the AEgIS team a measurement of the gravitational coupling. “By the end of 2012, we had finished by putting all the elements of the experiment together,” explains Michael Doser, AEgIS Spokesperson. “Now we have to show that they can all work together and, unfortunately, we will have no antiproton beams fo...

  2. Complete mitogenomes of two Puntius in Taiwan: P. semifasciolatus and P. snyderi (Cypriniformes: Cyprinidae).

    Science.gov (United States)

    Jang-Liaw, Nian-Hong; Chang, Chia-Hao; Tsai, Chi-Li

    2013-06-01

    We sequenced the complete mitochondrial genome of two spotted barbs native to Taiwan: Puntius semifasciolatus and Puntius snyderi. The complete mitochondrial genomes are 16,594 and 16,578 bp in size, respectively. Both of them contain 37 genes coding for 13 proteins, 2 rRNAs, 22 tRNAs, and 1 control region. They share the same gene arrangement pattern that was identical with most vertebrates. Nucleotide sequence divergence (K2P distance) between the two whole mitochondrial genomes was 7.63%. These two spotted barbs show very close relationship based on the comparison of the characters of their mitochondrial genomes.

  3. Complete genetic characterization of a Brazilian dengue virus type 3 strain isolated from a fatal outcome

    Directory of Open Access Journals (Sweden)

    Marize Pereira Miagostovich

    2006-05-01

    Full Text Available We have determined the complete nucleotide and the deduced amino acid sequences of Brazilian dengue virus type 3 (DENV-3 from a dengue case with fatal outcome, which occurred during an epidemic in the state of Rio de Janeiro, Brazil, in 2002. This constitutes the first complete genetic characterization of a Brazilian DENV-3 strain since its introduction into the country in 2001. DENV-3 was responsible for the most severe dengue epidemic in the state, based on the highest number of reported cases and on the severity of clinical manifestations and deaths reported.

  4. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

    Science.gov (United States)

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

    2013-07-01

    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.

  5. Is quantum theory predictably complete?

    Energy Technology Data Exchange (ETDEWEB)

    Kupczynski, M [Department of Mathematics and Statistics, University of Ottawa, 585 King-Edward Avenue, Ottawa, Ontario K1N 6N5 (Canada); Departement de l' Informatique, UQO, Case postale 1250, succursale Hull, Gatineau, Quebec J8X 3X 7 (Canada)], E-mail: mkupczyn@uottawa.ca

    2009-07-15

    Quantum theory (QT) provides statistical predictions for various physical phenomena. To verify these predictions a considerable amount of data has been accumulated in the 'measurements' performed on the ensembles of identically prepared physical systems or in the repeated 'measurements' on some trapped 'individual physical systems'. The outcomes of these measurements are, in general, some numerical time series registered by some macroscopic instruments. The various empirical probability distributions extracted from these time series were shown to be consistent with the probabilistic predictions of QT. More than 70 years ago the claim was made that QT provided the most complete description of 'individual' physical systems and outcomes of the measurements performed on 'individual' physical systems were obtained in an intrinsically random way. Spin polarization correlation experiments (SPCEs), performed to test the validity of Bell inequalities, clearly demonstrated the existence of strong long-range correlations and confirmed that the beams hitting far away detectors somehow preserve the memory of their common source which would be destroyed if the individual counts of far away detectors were purely random. Since the probabilities describe the random experiments and are not the attributes of the 'individual' physical systems, the claim that QT provides a complete description of 'individual' physical systems seems not only unjustified but also misleading and counter productive. In this paper, we point out that we even do not know whether QT is predictably complete because it has not been tested carefully enough. Namely, it was not proven that the time series of existing experimental data did not contain some stochastic fine structures that could have been averaged out by describing them in terms of the empirical probability distributions. In this paper, we advocate various statistical tests that

  6. Association of single nucleotide polymorphisms with radiation-induced esophagitis

    International Nuclear Information System (INIS)

    Zhang Li; Wang Lvhua; Yang Ming; Ji Wei; Zhao Lujun; Yang Weizhi; Zhou Zongmei; Ou Guangfei; Lin Dongxin

    2008-01-01

    Objective: To evaluate the relationship between single nucleotide polymorphism(SNP) of candidate genes and radiation-induced esophagitis (RIE) in patients with lung cancer. Methods: Between Jan. 2004 and Aug. 2006, 170 patients with pathologically diagnosed lung cancer were enrolled in this study. The total target dose was 45-70 Gy (median 60 Gy). One hundred and thirty-two patients were treated with three-dimensional conformal radiotherapy(3DCRT) and 38 with two-dimensional radiotherapy(2DRT). Forty-one patients received radiotherapy alone, 78 received sequential chemoradiotherapy and 51 received concurrent chemoradiotherapy. Thirty-seven SNPs in 20 DNA repair genes were analyzed by using PCR- based restricted fragment length polymorphism (RFLP). These genes were apoptosis and inflammatory cytokine genes including ATM, ERCC1, XRCC3, XRCCI, XPD, XPC, XPG, NBS1, STK15, ZNF350, ADPRT, TP53, FAS, FASL, CYP2D6*4, CASPASE8, COX2,TGF-β, CD14 and ACE. The endpoint was grade ≥2 R I E. Results: Forty of the 170 patients developed grade ≥2 R I E, including 36 in grade 2 and 4 in grade 3. Univariate analysis revealed that radiation technique and concurrent chemoradiotherapy were statistically significant relatives to the incidence of R I E (P=0.032, 0.049), and both of them had the trend associating with the esophagitis (P=0.072, 0.094). An increased incidence of esophagitis was observed associating with the TGF-β 1 -509T and XPD 751Lys/Lys genotypes (χ 2 =5.65, P=0.017; χ 2 =3.84, P=0.048) in multivariate analysis. Conclusions: Genetic polymorphisms in TGF-β 1 gene and XPD gene have a significant association with radiation-induced esophagitis. (authors)

  7. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  8. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  9. Deregulation of ocular nucleotide homeostasis in patients with diabetic retinopathy.

    Science.gov (United States)

    Loukovaara, Sirpa; Sandholm, Jouko; Aalto, Kristiina; Liukkonen, Janne; Jalkanen, Sirpa; Yegutkin, Gennady G

    2017-02-01

    Clear signaling roles for ATP and adenosine have been established in all tissues, including the eye. The magnitude of signaling responses is governed by networks of enzymes; however, little is known about the regulatory mechanisms of purinergic signaling in the eye. By employing thin-layer chromatographic assays with 3 H-labeled substrates, this study aimed to evaluate the role of nucleotide homeostasis in the pathogenesis of vitreoretinal diseases in humans. We have identified soluble enzymes ecto-5'-nucleotidase/CD73, adenylate kinase-1, and nucleoside diphosphate kinase in the vitreous fluid that control active cycling between pro-inflammatory ATP and anti-inflammatory adenosine. Strikingly, patients with proliferative form of diabetic retinopathy (DR) had higher adenylate kinase activity and ATP concentration, when compared to non-proliferative DR eyes and non-diabetic controls operated for rhegmatogenous retinal detachment, macular hole, and pucker. The non-parametric correlation analysis revealed positive correlations between intravitreal adenylate kinase and concentrations of ATP, ADP, and other angiogenic (angiopoietins-1 and -2), profibrotic (transforming growth factor-β1), and proteolytic (matrix metalloproteinase-9) factors but not erythropoietin and VEGF. Immunohistochemical staining of postmortem human retina additionally revealed selective expression of ecto-5'-nucleotidase/CD73 on the rod-and-cone-containing photoreceptor cells. Collectively, these findings provide novel insights into the regulatory mechanisms that influence purinergic signaling in diseased eye and open up new possibilities in the development of enzyme-targeted therapeutic approaches for prevention and treatment of DR. Ecto-5'-nucleotidase/CD73 and adenylate kinase-1 circulate in human vitreous fluid. Adenylate kinase activity is high in diabetic eyes with proliferative retinopathy. Diabetic eyes display higher intravitreal ATP/ADP ratio than non-diabetic controls. Soluble adenylate

  10. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus

    Science.gov (United States)

    2012-01-01

    Background The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. Method This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Result Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. Conclusion The molecular typing method presented is one tool that could be incorporated into the forensic

  11. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus.

    Science.gov (United States)

    Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline

    2012-05-17

    The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough

  12. DAQ INSTALLATION IN USC COMPLETED

    CERN Multimedia

    A. Racz

    After one year of work at P5 in the underground control rooms (USC55-S1&S2), the DAQ installation in USC55 is completed. The first half of 2006 was dedicated to the DAQ infrastructures installation (private cable trays, rack equipment for a very dense cabling, connection to services i.e. water, power, network). The second half has been spent to install the custom made electronics (FRLs and FMMs) and place all the inter-rack cables/fibers connecting all sub-systems to central DAQ (more details are given in the internal pages). The installation has been carried out by DAQ group members, coming from the hardware and software side as well. The pictures show the very nice team spirit !

  13. A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

    Science.gov (United States)

    Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

    2013-07-01

    The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

  14. Dopa-responsive dystonia: functional analysis of single nucleotide substitutions within the 5' untranslated GCH1 region.

    Directory of Open Access Journals (Sweden)

    Ioanna A Armata

    Full Text Available BACKGROUND: Mutations in the GCH1 gene are associated with childhood onset, dopa-responsive dystonia (DRD. Correct diagnosis of DRD is crucial, given the potential for complete recovery once treated with L-dopa. The majority of DRD associated mutations lie within the coding region of the GCH1 gene, but three additional single nucleotide sequence substitutions have been reported within the 5' untranslated (5'UTR region of the mRNA. The biologic significance of these 5'UTR GCH1 sequence substitutions has not been analyzed. METHODOLOGY/PRINCIPAL FINDINGS: Luciferase reporter assays, quantitative real time PCR and RNA decay assays, combined with bioinformatics, revealed a pathogenic 5'UTR GCH1 substitution. The +142C>T single nucleotide 5'UTR substitution that segregates with affected status in DRD patients, substantially attenuates translation without altering RNA expression levels or stability. The +142C>T substitution disrupts translation most likely by creating an upstream initiation start codon (uAUG and an upstream open reading frame (uORF. CONCLUSIONS/SIGNIFICANCE: This is the first GCH1 regulatory substitution reported to act at a post-transcriptional level, increasing the list of genetic diseases caused by abnormal translation and reaffirming the importance of investigating potential regulatory substitutions in genetic diseases.

  15. Role of novel and rare nucleotide substitutions of the β-globin gene

    Directory of Open Access Journals (Sweden)

    Margherita Vinciguerra

    2012-11-01

    Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序,旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段:1)血液及血红蛋白数据;2)珠蛋白基因分子分析以及家族遗传研究(如有可能)。 自2003年以来,我们已对这类病例进行DNA序列分析:传统的分子方法无法给出完整的诊断响应,尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。

  16. Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity

    Directory of Open Access Journals (Sweden)

    Tobias Fromme

    2018-02-01

    Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase

  17. The complete mitochondrial genome of the Chinese hook snout carp Opsariichthys bidens (Actinopterygii: Cypriniformes) and an alternative pattern of mitogenomic evolution in vertebrate

    DEFF Research Database (Denmark)

    Wang, Xuzhen; Wang, Jun; He, Shunping

    2007-01-01

    The complete mitochondrial genome sequence of the Chinese hook snout carp, Opsariichthys bidens, was newly determined using the long and accurate polymerase chain reaction method. The 16,611-nucleotide mitogenome contains 13 protein-coding genes, two rRNA genes (12S, 16S), 22 tRNA genes, and a no......The complete mitochondrial genome sequence of the Chinese hook snout carp, Opsariichthys bidens, was newly determined using the long and accurate polymerase chain reaction method. The 16,611-nucleotide mitogenome contains 13 protein-coding genes, two rRNA genes (12S, 16S), 22 tRNA genes...

  18. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  19. Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

    Science.gov (United States)

    Schechinger, Linda Sue

    I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

  20. Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

    Science.gov (United States)

    Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

    2008-01-01

    The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

  1. Subnanomole detection and quantitation of high specific activity 32P-nucleotides

    International Nuclear Information System (INIS)

    Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.

    1991-01-01

    Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution

  2. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

    Science.gov (United States)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

    2017-09-01

    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  3. ATLAS Magnet System Nearing Completion

    CERN Document Server

    ten Kate, H H J

    2008-01-01

    The ATLAS Detector at the Large Hadron Collider at CERN is equipped with a superconducting magnet system that consists of a Barrel Toroid, two End-Cap Toroids and a Central Solenoid. The four magnets generate the magnetic field for the muon- and inner tracking detectors, respectively. After 10 years of construction in industry, integration and on-surface tests at CERN, the magnets are now in the underground cavern where they undergo the ultimate test before data taking in the detector can start during the course of next year. The system with outer dimensions of 25 m length and 22 m diameter is based on using conduction cooled aluminum stabilized NbTi conductors operating at 4.6 K and 20.5 kA maximum coil current with peak magnetic fields in the windings of 4.1 T and a system stored magnetic energy of 1.6 GJ. The Barrel Toroid and Central Solenoid were already successfully charged after installation to full current in autumn 2006. This year the system is completed with two End Cap Toroids. The ultimate test of...

  4. A complete history of everything

    Science.gov (United States)

    Lanclos, Kyle; Deich, William T. S.

    2012-09-01

    This paper discusses Lick Observatory's local solution for retaining a complete history of everything. Leveraging our existing deployment of a publish/subscribe communications model that is used to broadcast the state of all systems at Lick Observatory, a monitoring daemon runs on a dedicated server that subscribes to and records all published messages. Our success with this system is a testament to the power of simple, straightforward approaches to complex problems. The solution itself is written in Python, and the initial version required about a week of development time; the data are stored in PostgreSQL database tables using a distinctly simple schema. Over time, we addressed scaling issues as the data set grew, which involved reworking the PostgreSQL database schema on the back-end. We also duplicate the data in flat files to enable recovery or migration of the data from one server to another. This paper will cover both the initial design as well as the solutions to the subsequent deployment issues, the trade-offs that motivated those choices, and the integration of this history database with existing client applications.

  5. Self Completeness of Einstein Gravity

    CERN Document Server

    Dvali, Gia

    2010-01-01

    We argue, that in Einsteinian gravity the Planck length is the shortest length of nature, and any attempt of resolving trans-Planckian physics bounces back to macroscopic distances due to black hole formation. In Einstein gravity trans-Planckian propagating quantum degrees of freedom cannot exist, instead they are equivalent to the classical black holes that are fully described by lighter infra-red degrees of freedom and give exponentially-soft contribution into the virtual processes. Based on this property we argue that pure-Einstein (super)gravity and its high-dimensional generalizations are self-complete in deep-UV, but not in standard Wilsonian sense. We suggest that certain strong-coupling limit of string theory is built-in in pure Einstein gravity, whereas the role of weakly-coupled string theory limit is to consistently couple gravity to other particle species, with their number being set by the inverse string coupling. We also discuss some speculative ideas generalizing the notion of non-Wilsonian sel...

  6. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    Science.gov (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  7. Chinese Islam: A Complete Concert

    Directory of Open Access Journals (Sweden)

    Zvi Ben-Dor Benite

    2017-06-01

    Full Text Available Matthew S. Erie, China and Islam: The Prophet, the Party, and Law. Cambridge University Press, 2016. 472 pp. $140 (cloth/e-book. Jonathan Lipman, ed., Islamic Thought in China: Sino-Muslim Intellectual Evolution from the 17th to the 20th Century. Edinburgh University Press, 2016. 288 pp. £70 (cloth; e-book. Roberta Tontini, Muslim Sanzijing: Shifts and Continuities in the Definition of Islam in China. Brill, 2016. 238 pp. $125 (cloth. Why study a Chinese “minority” and its history? The task of scholars of Chinese Islam since the 1990s has been twofold: on the one hand, we have wanted to study Islam in China in its Chinese social and cultural context, as opposed to imagining it as a single separate entity, and to show that its history is relevant and meaningful for Chinese history in general. One could almost say that this goal was achieved a while ago. The next task has been to make the study of Chinese Islam and its history meaningful and useful for the greater community of scholars of Islam in general. It seems to me that with the books reviewed here, and with others in the making, we are getting close to reaching this target. In 1910, Marshall Broomhall’s Islam in China declared that Chinese Islam was a “neglected problem.” These books show that it is no longer neglected, and no longer a “problem”; rather, it is an exciting topic. Indeed, a complete, even if not harmonious, concert.

  8. Completely quantized collapse and consequences

    International Nuclear Information System (INIS)

    Pearle, Philip

    2005-01-01

    Promotion of quantum theory from a theory of measurement to a theory of reality requires an unambiguous specification of the ensemble of realizable states (and each state's probability of realization). Although not yet achieved within the framework of standard quantum theory, it has been achieved within the framework of the continuous spontaneous localization (CSL) wave-function collapse model. In CSL, a classical random field w(x,t) interacts with quantum particles. The state vector corresponding to each w(x,t) is a realizable state. In this paper, I consider a previously presented model, which is predictively equivalent to CSL. In this completely quantized collapse (CQC) model, the classical random field is quantized. It is represented by the operator W(x,t) which satisfies [W(x,t),W(x ' ,t ' )]=0. The ensemble of realizable states is described by a single state vector, the 'ensemble vector'. Each superposed state which comprises the ensemble vector at time t is the direct product of an eigenstate of W(x,t ' ), for all x and for 0≤t ' ≤t, and the CSL state corresponding to that eigenvalue. These states never interfere (they satisfy a superselection rule at any time), they only branch, so the ensemble vector may be considered to be, as Schroedinger put it, a 'catalog' of the realizable states. In this context, many different interpretations (e.g., many worlds, environmental decoherence, consistent histories, modal interpretation) may be satisfactorily applied. Using this description, a long-standing problem is resolved, where the energy comes from the particles gain due to the narrowing of their wave packets by the collapse mechanism. It is shown how to define the energy of the random field and its energy of interaction with particles so that total energy is conserved for the ensemble of realizable states. As a by-product, since the random-field energy spectrum is unbounded, its canonical conjugate, a self-adjoint time operator, can be discussed. Finally, CSL

  9. Unraveling the cellular context of cyclic nucleotide signaling proteins by chemical proteomics

    NARCIS (Netherlands)

    Corradini, E.

    2015-01-01

    Understanding the molecular mechanisms which regulate signal transduction is fundamental to the development of therapeutic molecules for the treatment of several diseases. In particular, signaling proteins, such as cyclic nucleotide dependent enzymes are the orchestrators of many tissue functions.

  10. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  11. Study on the change of cyclic nucleotide in mice with yang vacuity disease

    International Nuclear Information System (INIS)

    Zhu Xinhua; Shen Ling; Wang Shuguang

    2002-01-01

    To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide

  12. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  13. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    International Nuclear Information System (INIS)

    Boulias, C.; Moscarello, M.A.

    1989-01-01

    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides

  14. Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

    Science.gov (United States)

    Hendershot, Jenna M.; O'Brien, Patrick J.

    2014-01-01

    Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

  15. Biochemistry of an olfactory purinergic system: dephosphorylation of excitatory nucleotides and uptake of adenosine

    Energy Technology Data Exchange (ETDEWEB)

    Trapido-Rosenthal, H G; Carr, W E; Gleeson, R A

    1987-10-01

    The olfactory organ of the spiny lobster, Panulirus argus, is composed of chemosensory sensilla containing the dendrites of primary chemosensory neurons. Receptors on these dendrites are activated by the nucleotides AMP, ADP, and ATP but not by the nucleoside adenosine. It is shown here that the lobster chemosensory sensilla contain enzymes that dephosphorylate excitatory nucleotides and an uptake system that internalizes the nonexcitatory dephosphorylated product adenosine. The uptake of (/sup 3/H)-adenosine is saturable with increasing concentration, linear with time for up to 3 h, sodium dependent, insensitive to moderate pH changes and has a Km of 7.1 microM and a Vmax of 5.2 fmol/sensillum/min (573 fmol/micrograms of protein/min). Double-label experiments show that sensilla dephosphorylate nucleotides extracellularly; /sup 3/H from adenine-labeled AMP or ATP is internalized, whereas 32P from phosphate-labeled nucleotides is not. The dephosphorylation of AMP is very rapid; /sup 3/H from AMP is internalized at the same rate as /sup 3/H from adenosine. Sensillar 5'-ectonucleotidase activity is inhibited by ADP and the ADP analog alpha, beta-methylene ADP. Collectively, these results indicate that the enzymes and the uptake system whereby chemosensory sensilla of the lobster inactivate excitatory nucleotides and clear adenosine from extracellular spaces are very similar to those present in the internal tissues of vertebrates, where nucleotides have many neuroactive effects.

  16. Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides

    Science.gov (United States)

    Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.

    1978-01-01

    Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436

  17. GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.

    Science.gov (United States)

    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

    2010-11-19

    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

  18. Skipping of exon 27 in C3 gene compromises TED domain and results in complete human C3 deficiency.

    Science.gov (United States)

    da Silva, Karina Ribeiro; Fraga, Tatiana Rodrigues; Lucatelli, Juliana Faggion; Grumach, Anete Sevciovic; Isaac, Lourdes

    2016-05-01

    Primary deficiency of complement C3 is rare and usually associated with increased susceptibility to bacterial infections. In this work, we investigated the molecular basis of complete C3 deficiency in a Brazilian 9-year old female patient with a family history of consanguinity. Hemolytic assays revealed complete lack of complement-mediated hemolytic activity in the patient's serum. While levels of the complement regulatory proteins Factor I, Factor H and Factor B were normal in the patient's and family members' sera, complement C3 levels were undetectable in the patient's serum and were reduced by at least 50% in the sera of the patient's parents and brother. Additionally, no C3 could be observed in the patient's plasma and cell culture supernatants by Western blot. We also observed that patient's skin fibroblasts stimulated with Escherichia coli LPS were unable to secrete C3, which might be accumulated within the cells before being intracellularly degraded. Sequencing analysis of the patient's C3 cDNA revealed a genetic mutation responsible for the complete skipping of exon 27, resulting in the loss of 99 nucleotides (3450-3549) located in the TED domain. Sequencing of the intronic region between the exons 26 and 27 of the C3 gene (nucleotides 6690313-6690961) showed a nucleotide exchange (T→C) at position 6690626 located in a splicing donor site, resulting in the complete skipping of exon 27 in the C3 mRNA. Copyright © 2016. Published by Elsevier GmbH.

  19. Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

    Science.gov (United States)

    Sánchez-Navarro, J A; Pallás, V

    1997-01-01

    The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

  20. Single nucleotide polymorphisms of Helicobacter pylori dupA that lead to premature stop codons.

    Science.gov (United States)

    Moura, Sílvia B; Costa, Rafaella F A; Anacleto, Charles; Rocha, Gifone A; Rocha, Andreia M C; Queiroz, Dulciene M M

    2012-06-01

     The detection of the putative disease-specific Helicobacter pylori marker duodenal ulcer promoting gene A (dupA) is currently based on PCR detection of jhp0917 and jhp0918 that form the gene. However, mutations that lead to premature stop codons that split off the dupA leading to truncated products cannot be evaluated by PCR. We directly sequence the complete dupA of 75 dupA-positive strains of H. pylori isolated from patients with gastritis (n = 26), duodenal ulcer (n = 29), and gastric carcinoma (n = 20), to search for frame-shifting mutations that lead to stop codon. Thirty-four strains had single nucleotide mutations in dupA that lead to premature stop codon creating smaller products than the predicted 1839 bp product and, for this reason, were considered as dupA-negative. Intact dupA was more frequently observed in strains isolated from duodenal ulcer patients (65.5%) than in patients with gastritis only (46.2%) or with gastric carcinoma (50%). In logistic analysis, the presence of the intact dupA independently associated with duodenal ulcer (OR = 5.06; 95% CI = 1.22-20.96, p = .02).  We propose the primer walking methodology as a simple technique to sequence the gene. When we considered as dupA-positive only those strains that carry dupA gene without premature stop codons, the gene was associated with duodenal ulcer and, therefore, can be used as a marker for this disease in our population. © 2012 Blackwell Publishing Ltd.

  1. Nucleotide Excision Repair and Vitamin D--Relevance for Skin Cancer Therapy.

    Science.gov (United States)

    Pawlowska, Elzbieta; Wysokinski, Daniel; Blasiak, Janusz

    2016-04-06

    Ultraviolet (UV) radiation is involved in almost all skin cancer cases, but on the other hand, it stimulates the production of pre-vitamin D3, whose active metabolite, 1,25-dihydroxyvitamin D3 (1,25VD3), plays important physiological functions on binding with its receptor (vitamin D receptor, VDR). UV-induced DNA damages in the form of cyclobutane pyrimidine dimers or (6-4)-pyrimidine-pyrimidone photoproducts are frequently found in skin cancer and its precursors. Therefore, removing these lesions is essential for the prevention of skin cancer. As UV-induced DNA damages are repaired by nucleotide excision repair (NER), the interaction of 1,25VD3 with NER components can be important for skin cancer transformation. Several studies show that 1,25VD3 protects DNA against damage induced by UV, but the exact mechanism of this protection is not completely clear. 1,25VD3 was also shown to affect cell cycle regulation and apoptosis in several signaling pathways, so it can be considered as a potential modulator of the cellular DNA damage response, which is crucial for mutagenesis and cancer transformation. 1,25VD3 was shown to affect DNA repair and potentially NER through decreasing nitrosylation of DNA repair enzymes by NO overproduction by UV, but other mechanisms of the interaction between 1,25VD3 and NER machinery also are suggested. Therefore, the array of NER gene functioning could be analyzed and an appropriate amount of 1.25VD3 could be recommended to decrease UV-induced DNA damage important for skin cancer transformation.

  2. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa

    2017-05-01

    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  3. Monitoring Ras Interactions with the Nucleotide Exchange Factor Son of Sevenless (Sos) Using Site-specific NMR Reporter Signals and Intrinsic Fluorescence*

    Science.gov (United States)

    Vo, Uybach; Vajpai, Navratna; Flavell, Liz; Bobby, Romel; Breeze, Alexander L.; Embrey, Kevin J.; Golovanov, Alexander P.

    2016-01-01

    The activity of Ras is controlled by the interconversion between GTP- and GDP-bound forms partly regulated by the binding of the guanine nucleotide exchange factor Son of Sevenless (Sos). The details of Sos binding, leading to nucleotide exchange and subsequent dissociation of the complex, are not completely understood. Here, we used uniformly 15N-labeled Ras as well as [13C]methyl-Met,Ile-labeled Sos for observing site-specific details of Ras-Sos interactions in solution. Binding of various forms of Ras (loaded with GDP and mimics of GTP or nucleotide-free) at the allosteric and catalytic sites of Sos was comprehensively characterized by monitoring signal perturbations in the NMR spectra. The overall affinity of binding between these protein variants as well as their selected functional mutants was also investigated using intrinsic fluorescence. The data support a positive feedback activation of Sos by Ras·GTP with Ras·GTP binding as a substrate for the catalytic site of activated Sos more weakly than Ras·GDP, suggesting that Sos should actively promote unidirectional GDP → GTP exchange on Ras in preference of passive homonucleotide exchange. Ras·GDP weakly binds to the catalytic but not to the allosteric site of Sos. This confirms that Ras·GDP cannot properly activate Sos at the allosteric site. The novel site-specific assay described may be useful for design of drugs aimed at perturbing Ras-Sos interactions. PMID:26565026

  4. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    Science.gov (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

  5. The complete mitochondrial genome of Sesarmops sinensis reveals gene rearrangements and phylogenetic relationships in Brachyura.

    Science.gov (United States)

    Tang, Bo-Ping; Xin, Zhao-Zhe; Liu, Yu; Zhang, Dai-Zhen; Wang, Zheng-Fei; Zhang, Hua-Bin; Chai, Xin-Yue; Zhou, Chun-Lin; Liu, Qiu-Ning

    2017-01-01

    Mitochondrial genome (mitogenome) is very important to understand molecular evolution and phylogenetics. Herein, in this study, the complete mitogenome of Sesarmops sinensis was reported. The mitogenome was 15,905 bp in size, and contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (CR). The AT skew and the GC skew are both negative in the mitogenomes of S. sinensis. The nucleotide composition of the S. sinensis mitogenome was also biased toward A + T nucleotides (75.7%). All tRNA genes displayed a typical mitochondrial tRNA cloverleaf structure, except for the trnS1 gene, which lacked a dihydroxyuridine arm. S. sinensis exhibits a novel rearrangement compared with the Pancrustacean ground pattern and other Brachyura species. Based on the 13 PCGs, the phylogenetic analysis showed that S. sinensis and Sesarma neglectum were clustered on one branch with high nodal support values, indicating that S. sinensis and S. neglectum have a sister group relationship. The group (S. sinensis + S. neglectum) was sister to (Parasesarmops tripectinis + Metopaulias depressus), suggesting that S. sinensis belongs to Grapsoidea, Sesarmidae. Phylogenetic trees based on amino acid sequences and nucleotide sequences of mitochondrial 13 PCGs using BI and ML respectively indicate that section Eubrachyura consists of four groups clearly. The resulting phylogeny supports the establishment of a separate subsection Potamoida. These four groups correspond to four subsections of Raninoida, Heterotremata, Potamoida, and Thoracotremata.

  6. Inhibition of nucleotide excision repair by fludarabine in normal lymphocytes in vitro, measured by the alkaline single cell gel electrophoresis (comet) assay

    Energy Technology Data Exchange (ETDEWEB)

    Yamauchi, Takahiro; Kawai, Yasukazu; Ueda, Takanori [Fukui Medical Univ., Matsuoka (Japan)

    2002-05-01

    Alkylating agents or platinum analogues initiate several excision repair mechanisms, which involve incision of the DNA strand, excision of the damaged nucleotide, gap filling by DNA resynthesis, and rejoining by ligation. The previous study described that nucleotide excision repair permitted incorporation of fludarabine nucleoside (F-area-A) into the repair patch, thereby inhibiting the DNA resynthesis. In the present study, to clarify the repair kinetics in view of the inhibition by F-ara-A, normal lymphocytes were stimulated to undergo nucleotide excision repair by ultraviolet C (UV) irradiation in the presence or absence of F-ara-A. The repair kinetics were determined as DNA single strand breaks resulting from the incision and the rejoining using the alkaline single cell gel electrophoresis (comet) assay. DNA resynthesis was evaluated in terms of the uptake of tritiated thymidine into DNA. The lymphocytes initiated the incision step maximally at 1 h, and completed the rejoining process within 4 h after UV exposure. UV also initiated thymidine uptake, which increased time-dependently and reached a plateau at 4 h. A 2-h pre-incubation with F-ara-A inhibited the repair in a concentration-dependent manner, with the maximal inhibition by 5 {mu}M. This inhibitory effect was demonstrated by the reduction of the thymidine uptake and by the inhibition of the rejoining. A DNA polymerase inhibitor, aphidicolin, and a ribonucleotide reductase inhibitor, hydroxyurea, were not so inhibitory to the repair process as F-ara-A at equimolar concentrations. The present findings suggest that inhibition of nucleotide excision repair may represent a novel therapeutic strategy against cancer, especially in the context of resistant cells with an increased repair capacity. (author)

  7. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric

    2009-03-01

    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  8. Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.

    Science.gov (United States)

    Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric

    2017-12-01

    Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.

  9. Complete Genome Sequence of a Virulent Newcastle Disease Virus Strain Isolated from a Clinically Healthy Duck (Anas platyrhynchos domesticus) in Pakistan

    Science.gov (United States)

    Wajid, Abdul; Rehmani, Shafqat F.; Wasim, Muhammad; Basharat, Asma; Bibi, Tasra; Arif, Saima; Dimitrov, Kiril M.

    2016-01-01

    Here, we report the complete genome sequence of a virulent Newcastle disease virus (vNDV) strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying ducks (Anas platyrhynchos domesticus) from the province of Punjab, Pakistan. The virus has a genome length of 15,192 nucleotides and is classified as member of subgenotype VIIi, class II. PMID:27469959

  10. Complete Genome Sequence of a Virulent Newcastle Disease Virus Strain Isolated from a Clinically Healthy Duck (Anas platyrhynchos domesticus) in Pakistan

    OpenAIRE

    Wajid, Abdul; Rehmani, Shafqat F.; Wasim, Muhammad; Basharat, Asma; Bibi, Tasra; Arif, Saima; Dimitrov, Kiril M.; Afonso, Claudio L.

    2016-01-01

    Here, we report the complete genome sequence of a virulent Newcastle disease virus (vNDV) strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying ducks (Anas platyrhynchos domesticus) from the province of Punjab, Pakistan. The virus has a genome length of 15,192 nucleotides and is classified as member of subgenotype VIIi, class II.

  11. Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands

    NARCIS (Netherlands)

    Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal A; Gröne, Andrea; Kik, Marja J L

    2017-01-01

    Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

  12. Complete genome sequence of frog virus 3, isolated from a strawberry poison frog (Oophaga pumilio) imported from nicaragua into the Netherlands

    NARCIS (Netherlands)

    Saucedo, Bernardo; Hughes, Joseph; Beurden, van Steven J.; Suárez, Nicolás M.; Haenen, Olga L.M.; Voorbergen-Laarman, Michal; Gröne, Andrea; Kika, Marja J.L.

    2017-01-01

    Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

  13. Complete genome sequence of the biofilm-forming Curtobacterium sp. strain BH-2-1-1, isolated from lettuce (Lactuca sativa) originating from a conventional field in Norway.

    Science.gov (United States)

    Dees, Merete Wiken; Brurberg, May Bente; Lysøe, Erik

    2016-12-01

    Here, we present the 3,795,952 bp complete genome sequence of the biofilm-forming Curtobacterium sp. strain BH-2-1-1, isolated from conventionally grown lettuce ( Lactuca sativa ) from a field in Vestfold, Norway. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession CP017580.

  14. Complete Genome Sequence of the Largest Known Flavi-Like Virus, Diaphorina citri flavi-like virus, a Novel Virus of the Asian Citrus Psyllid, Diaphorina citri

    OpenAIRE

    Matsumura, Emilyn E.; Nerva, Luca; Nigg, Jared C.; Falk, Bryce W.; Nouri, Shahideh

    2016-01-01

    A novel flavi-like virus tentatively named Diaphorina citri flavi-like virus (DcFLV) was identified in field populations of Diaphorina citri through small RNA and transcriptome sequencing followed by reverse transcription (RT)-PCR. We report here the complete nucleotide sequence and genome organization of DcFLV, the largest flavi-like virus identified to date.

  15. [Sequencing and analysis of the complete genome of a rabies virus isolate from Sika deer].

    Science.gov (United States)

    Zhao, Yun-Jiao; Guo, Li; Huang, Ying; Zhang, Li-Shi; Qian, Ai-Dong

    2008-05-01

    One DRV strain was isolated from Sika Deer brain and sequenced. Nine overlapped gene fragments were amplified by RT-PCR through 3'-RACE and 5'-RACE method, and the complete DRV genome sequence was assembled. The length of the complete genome is 11863bp. The DRV genome organization was similar to other rabies viruses which were composed of five genes and the initiation sites and termination sites were highly conservative. There were mutated amino acids in important antigen sites of nucleoprotein and glycoprotein. The nucleotide and amino acid homologies of gene N, P, M, G, L in strains with completed genomie sequencing were compared. Compared with N gene sequence of other typical rabies viruses, a phylogenetic tree was established . These results indicated that DRV belonged to gene type 1. The highest homology compared with Chinese vaccine strain 3aG was 94%, and the lowest was 71% compared with WCBV. These findings provided theoretical reference for further research in rabies virus.

  16. The Complete Mitochondrial Genome of the Pink Stem Borer, Sesamia inferens, in Comparison with Four Other Noctuid Moths

    OpenAIRE

    Chai, Huan-Na; Du, Yu-Zhou

    2012-01-01

    The complete 15,413-bp mitochondrial genome (mitogenome) of Sesamia inferens (Walker) (Lepidoptera: Noctuidae) was sequenced and compared with those of four other noctuid moths. All of the mitogenomes analyzed displayed similar characteristics with respect to gene content, genome organization, nucleotide comparison, and codon usages. Twelve-one protein-coding genes (PCGs) utilized the standard ATN, but the cox1 gene used CGA as the initiation codon; &...

  17. Completed sequence and corrected annotation of the genome of maize Iranian mosaic virus.

    Science.gov (United States)

    Ghorbani, Abozar; Izadpanah, Keramatollah; Dietzgen, Ralf G

    2018-03-01

    Maize Iranian mosaic virus (MIMV) is a negative-sense single-stranded RNA virus that is classified in the genus Nucleorhabdovirus, family Rhabdoviridae. The MIMV genome contains six open reading frames (ORFs) that encode in 3΄ to 5΄ order the nucleocapsid protein (N), phosphoprotein (P), putative movement protein (P3), matrix protein (M), glycoprotein (G) and RNA-dependent RNA polymerase (L). In this study, we determined the first complete genome sequence of MIMV using Illumina RNA-Seq and 3'/5' RACE. MIMV genome ('Fars' isolate) is 12,426 nucleotides in length. Unexpectedly, the predicted N gene ORF of this isolate and of four other Iranian isolates is 143 nucleotides shorter than that of the MIMV coding-complete reference isolate 'Shiraz 1' (Genbank NC_011542), possibly due to a minor error in the previous sequence. Genetic variability among the N, P, P3 and G ORFs of Iranian MIMV isolates was limited, but highest in the G gene ORF. Phylogenetic analysis of complete nucleorhabdovirus genomes demonstrated a close evolutionary relationship between MIMV, maize mosaic virus and taro vein chlorosis virus.

  18. Non-pathological complete paternal uniparental isodisomy of chromosome 2 revealed in a maternity testing case.

    Science.gov (United States)

    Chen, Man; Jiang, Jian; Li, Chen; Ren, He; Chen, Wei; Liu, Zhiyong; Cheng, Feng; Zhao, Jing; Chen, Tong; Chen, Chuguang; Yan, Jiangwei

    2018-05-25

    We present a duo paternity test case to assess the biological relationship between a woman and her female child. After analyzing 57 autosomal and 19 X-chromosomal short tandem repeat loci, mother-daughter exclusions were discovered at four loci, which were all located on chromosome 2. Further testing of whole-genome single nucleotide polymorphisms confirmed that the daughter had complete uniparental disomy (UPD) of chromosome 2. This study presents a cautionary case demonstrating that hasty decisions of parentage exclusion should not be made when genetic markers on the same chromosome do not conform to Mendel's laws due to UPD.

  19. Determination of the complete nucleotide sequence of a lupine potyvirus isolate from the Czech Republic reveals that it belongs to a new member of the genus Potyvirus

    Czech Academy of Sciences Publication Activity Database

    Sarkisova, Tatiana; Petrzik, Karel

    2011-01-01

    Roč. 156, č. 1 (2011), s. 167-169 ISSN 0304-8608 R&D Projects: GA MZe QH71145 Institutional research plan: CEZ:AV0Z50510513 Keywords : plants * virus * motif Subject RIV: EE - Microbiology, Virology Impact factor: 2.111, year: 2011

  20. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 islated from bacteria of the wheat rhizosphere

    OpenAIRE

    Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van, L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.

    2002-01-01

    The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily extensible. We present a genome annotation system for prokaryote genomes, which is well tested and readily adaptable to different tasks. The modular system was developed using an object-oriented approac...

  1. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 islated from bacteria of the wheat rhizosphere

    NARCIS (Netherlands)

    Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.; Elsas, van J.D.

    2002-01-01

    The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily

  2. The complete nucleotide sequence of the Barley yellow dwarf virus-RMV genome reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

    Science.gov (United States)

    The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All ...

  3. The complete genome sequence of the Atlantic salmon paramyxovirus (ASPV)

    International Nuclear Information System (INIS)

    Nylund, Stian; Karlsen, Marius; Nylund, Are

    2008-01-01

    The complete RNA genome of the Atlantic salmon paramyxovirus (ASPV), isolated from Atlantic salmon suffering from proliferative gill inflammation (PGI), has been determined. The genome is 16,965 nucleotides in length and consists of six nonoverlapping genes in the order 3'- N - P/C/V - M - F - HN - L -5', coding for the nucleocapsid, phospho-, matrix, fusion, hemagglutinin-neuraminidase and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and trinucleotide intergenic regions similar to those of other Paramyxoviridae. The ASPV P-gene expression strategy is like that of the respiro- and morbilliviruses, which express the phosphoprotein from the primary transcript, and edit a portion of the mRNA to encode the accessory proteins V and W. It also encodes the C-protein by ribosomal choice of translation initiation. Pairwise comparisons of amino acid identities, and phylogenetic analysis of deduced ASPV protein sequences with homologous sequences from other Paramyxoviridae, show that ASPV has an affinity for the genus Respirovirus, but may represent a new genus within the subfamily Paramyxovirinae

  4. The complete mitochondrial genome of the rice moth, Corcyra cephalonica.

    Science.gov (United States)

    Wu, Yu-Peng; Li, Jie; Zhao, Jin-Liang; Su, Tian-Juan; Luo, A-Rong; Fan, Ren-Jun; Chen, Ming-Chang; Wu, Chun-Sheng; Zhu, Chao-Dong

    2012-01-01

    The complete mitochondrial genome (mitogenome) of the rice moth, Corcyra cephalonica Stainton (Lepidoptera: Pyralidae) was determined as a circular molecular of 15,273 bp in size. The mitogenome composition (37 genes) and gene order are the same as the other lepidopterans. Nucleotide composition of the C. cephalonica mitogenome is highly A+T biased (80.43%) like other insects. Twelve protein-coding genes start with a typical ATN codon, with the exception of coxl gene, which uses CGA as the initial codon. Nine protein-coding genes have the common stop codon TAA, and the nad2, cox1, cox2, and nad4 have single T as the incomplete stop codon. 22 tRNA genes demonstrated cloverleaf secondary structure. The mitogenome has several large intergenic spacer regions, the spacer1 between trnQ gene and nad2 gene, which is common in Lepidoptera. The spacer 3 between trnE and trnF includes microsatellite-like repeat regions (AT)18 and (TTAT)(3). The spacer 4 (16 bp) between trnS2 gene and nad1 gene has a motif ATACTAT; another species, Sesamia inferens encodes ATCATAT at the same position, while other lepidopteran insects encode a similar ATACTAA motif. The spacer 6 is A+T rich region, include motif ATAGA and a 20-bp poly(T) stretch and two microsatellite (AT)(9), (AT)(8) elements.

  5. The complete plastid genome of Bunge's pine Pinus bungeana (Pinaceae).

    Science.gov (United States)

    Li, Zhong-Hu; Zhu, Juan; Yang, Yi-Xin; Yang, Jie; He, Jing-Wen; Zhao, Gui-Fang

    2016-07-01

    The complete nucleotide sequence of Bunge's pine Pinus bungeana Zucc. ex Endl. chloroplast genome (cp DNA) was determined in this study. The cpDNA was 117 861 bp in length, containing a pair of 475 bp inverted repeat regions (IRa and IRb), which were separated by large and small single copy regions (LSC and SSC) of 65 373 and 51 538 bp, respectively. The cpDNA contained 111 genes, including 71 protein-coding genes (71 PCG species), 4 ribosomal RNA genes (4 rRNA species) and 36 tRNA genes (32 tRNA species). In these genes, 13 harbored a single intron and 1 (ycf3) contained a couple of introns. The overall AT content of Bunge's pine cpDNA is 61.2%, while the corresponding values of the LSC, SSC and IR regions are 61.9%, 60.2% and 62.5%, respectively. A phylogenetic reconstruction based on the maximum parsimony analysis suggested that all the sampled Pinus species clustered a monophyletic clade and have a high bootstrap support, and the cpDNA of P. bungeana is closely related to that of congeneric P. gerardiana.

  6. Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides

    International Nuclear Information System (INIS)

    Amborski, Andrew N.; Johnson, Philip E.

    2008-01-01

    We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules

  7. Single-Nucleotide Variations in Cardiac Arrhythmias: Prospects for Genomics and Proteomics Based Biomarker Discovery and Diagnostics

    Directory of Open Access Journals (Sweden)

    Ayman Abunimer

    2014-03-01

    Full Text Available Cardiovascular diseases are a large contributor to causes of early death in developed countries. Some of these conditions, such as sudden cardiac death and atrial fibrillation, stem from arrhythmias—a spectrum of conditions with abnormal electrical activity in the heart. Genome-wide association studies can identify single nucleotide variations (SNVs that may predispose individuals to developing acquired forms of arrhythmias. Through manual curation of published genome-wide association studies, we have collected a comprehensive list of 75 SNVs associated with cardiac arrhythmias. Ten of the SNVs result in amino acid changes and can be used in proteomic-based detection methods. In an effort to identify additional non-synonymous mutations that affect the proteome, we analyzed the post-translational modification S-nitrosylation, which is known to affect cardiac arrhythmias. We identified loss of seven known S-nitrosylation sites due to non-synonymous single nucleotide variations (nsSNVs. For predicted nitrosylation sites we found 1429 proteins where the sites are modified due to nsSNV. Analysis of the predicted S-nitrosylation dataset for over- or under-representation (compared to the complete human proteome of pathways and functional elements shows significant statistical over-representation of the blood coagulation pathway. Gene Ontology (GO analysis displays statistically over-represented terms related to muscle contraction, receptor activity, motor activity, cystoskeleton components, and microtubule activity. Through the genomic and proteomic context of SNVs and S-nitrosylation sites presented in this study, researchers can look for variation that can predispose individuals to cardiac arrhythmias. Such attempts to elucidate mechanisms of arrhythmia thereby add yet another useful parameter in predicting susceptibility for cardiac diseases.

  8. The complete branchial fistula: A case report.

    Science.gov (United States)

    Shekhar, C; Kumar, R; Kumar, R; Mishra, S K; Roy, M; Bhavana, K

    2005-10-01

    The incomplete branchial fistula is not an uncommon congenital anomaly of branchial apparatus but a complete one is rare. Here we report a case of complete congenital branchial fistula with an internal opening near the tonsillar fossa.

  9. The complete branchial fistula: A case report

    OpenAIRE

    Shekhar, C.; Kumar, R.; Kumar, R.; Mishra, S. K.; Roy, M.; Bhavana, K.

    2005-01-01

    The incomplete branchial fistula is not an uncommon congenital anomaly of branchial apparatus but a complete one is rare. Here we report a case of complete congenital branchial fistula with an internal opening near the tonsillar fossa.

  10. Complete albinism in a Podarcis muralis newborn

    Directory of Open Access Journals (Sweden)

    Filippo Spadola

    2007-01-01

    Full Text Available The authors describe a case of complete albinism in a Podarcis muralis newborn, from Chieti (Abruzzo, central Italy in September 2004. This is the first complete albinism case in a Podarcis spp. In the world.

  11. Jacobi fields of completely integrable Hamiltonian systems

    International Nuclear Information System (INIS)

    Giachetta, G.; Mangiarotti, L.; Sardanashvily, G.

    2003-01-01

    We show that Jacobi fields of a completely integrable Hamiltonian system of m degrees of freedom make up an extended completely integrable system of 2m degrees of freedom, where m additional first integrals characterize a relative motion

  12. Completion of a Dislocated Metric Space

    Directory of Open Access Journals (Sweden)

    P. Sumati Kumari

    2015-01-01

    Full Text Available We provide a construction for the completion of a dislocated metric space (abbreviated d-metric space; we also prove that the completion of the metric associated with a d-metric coincides with the metric associated with the completion of the d-metric.

  13. Isaac Newton and Student College Completion

    Science.gov (United States)

    Tinto, Vincent

    2013-01-01

    Success in college is built upon classroom success, but success in the classroom does not in itself ensure college completion. Completion arises from success in a sequence of classes one after another over time. It does so most frequently when students are presented with coherent course pathways to degree completion, are able to gain degree credit…

  14. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    Science.gov (United States)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

    2015-11-01

    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  15. Optimization time synthesis of nucleotide labelled [γ-32P]-ATP

    International Nuclear Information System (INIS)

    Rahman, Wira Y; Sarmini, Endang; Herlina; Lubis, Hotman; Triyanto; Hambali

    2013-01-01

    Adenosine triphosphate-labelled with γ- 32 P([γ- 32 p]-ATP) has been widely used in the biotechnology research, usually as a tracer to study aspects of physiological and pathological processes. In order to support biotechnology research in Indonesia, a process for production of [γ- 32 P]-ATP with enzymatic reaction was used as precursors DL-glyceraldehydde 3-phosphate, Adenosine Diphosphate (ADP) and H 3 32 PO 4 , and enzyme glyceraldehid 3-phosphate dehydrogenase, 3-phosphoglyceryc phosphokinase and lactate dehydrogenase. Optimization of incubation time labeled nucleotide synthesis process is performed to find the optimum conditions, in terms of the most advantageous time in the synthesis process. With the success of the synthesis and optimization is done incubation time of synthesis labeled nucleotide, the result suggested can be used for producing [γ- 32 P] -ATP to support the provision of radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  16. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  17. The Fanconi anaemia components UBE2T and FANCM are functionally linked to nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Ian R Kelsall

    Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.

  18. De novo synthesis of purine nucleotides in different fiber types of rat skeletal muscle

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.; Hood, D.A.; Terjung, R.L.

    1986-01-01

    The contribution of de novo purine nucleotide synthesis to nucleotide metabolism in skeletal muscles is not known. The authors have determined rates of de novo synthesis in soleus (slow-twitch red), red gastrocnemius (fast-twitch red), and white gastrocnemius (fast-twitch white) using the perfused rat hindquarter. 14 C glycine incorporation into ATP was linear after 1 and 2 hours of perfusion with 0.2 mM added glycine. The intracellular (I) and extracellular (E) specific activity of 14 C glycine was determined by HPLC of phenylisothiocyanate derivatives of neutralized PCA extracts. The rates of de novo synthesis when expressed relative to muscle ATP content show slow and fast-twitch red muscles to be similar and about twice as great as fast-twitch white muscles. This could represent a greater turnover of the adenine nucleotide pool in more oxidative red muscle types

  19. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  20. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  1. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  2. The complete genome sequence of a virus associated with cotton blue disease, cotton leafroll dwarf virus, confirms that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban

    2010-11-01

    Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.

  3. Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

    Directory of Open Access Journals (Sweden)

    Elaine C Thomas

    Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

  4. Guanine nucleotide regulation of α1-adrenergic receptors of muscle and kidney eptihelial cells

    International Nuclear Information System (INIS)

    Terman, B.I.; Hughes, R.J.; Slivka, S.R.; Insel, P.A.

    1986-01-01

    The authors have examined the effect of guanine nucleotides on the interaction of adrenergic agents with α 1 -adrenergic receptors of two cell lines, the Madin-Darby Canine Kidney (MDCK) and BC3H-1 muscle cells. While gaunylylimidodiphosphoate (Gpp(NH)p) had no effect on the affinity or the total number of [ -3 H]prazosin binding sites in membranes prepared from these cells, the nucleotide decreased the apparent affinity of the agonist epinephrine in competing for [ 3 H]prazosin binding sites in both cell types. The EC 50 of Gpp(NH)p was ∼100 μM, and a maximal effect was seen at 500 μM. In contrast, 100 μM Gpp(NH)p yielding maximal shifts in binding of epinephrine to β-adrenergic receptors in BC3H-1 cell membranes. Guanine nucleotides were significantly more effective than adenine nucleotides in shifting agonist affinity for the α 1 -receptor and Mg ++ was required to observe a maximal effect. α 1 -receptor agonists activated phosphatidylinositol (PI) hydrolysis in both cell types, but have no direct effect on membrane adenylate cyclase activity. In intact BC3H-1 cells, α 1 -agonists inhibited β-adrenergic cAMP production, an effect which appears in preliminary studies not to result from enhanced phosphodieterase activity. These results show that agonist binding to α 1 -adrenergic receptors in mammalian kidney and muscle cells is regulated by guanine nucleotides. This regulation and inturn transmembrane signalling (PI hydrolysis) by these receptors appear to involve a guanine nucleotide binding (G) protein, which may be different than G/sub s/ and G/sub i/

  5. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  6. Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine

    International Nuclear Information System (INIS)

    Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.

    1986-01-01

    14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state

  7. De novo synthesis of adenine nucleotides in different skeletal muscle fiber types

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.B.; Hood, D.A.; Terjung, R.L.

    1988-01-01

    Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the [1-14C]glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis

  8. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

    Directory of Open Access Journals (Sweden)

    Andy Hesketh

    2017-07-01

    Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.

  9. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    Science.gov (United States)

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  10. Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-09-12

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-01-01

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

  12. Adenylate Nucleotides and 2,3-Biphosphoglycerate Concentration in Erythrocytes of Growing Wielkopolska Stallions

    OpenAIRE

    M. Suska; E. Skotnicka; W. Dudzińska; W. Orowicz; M. Brzezinska

    2006-01-01

    The aim of this study was to examine the relationships between the concentrations of adenylate nucleotides (ATP, ADP, AMP), total nucleotide pool (TAN), adenylate energy charge (AEC) and 2,3-biphosphoglycerate (2,3-BPG) in the erythrocytes of young horses in the period of their rapid growth and development. The studies were conducted on 10 young Wielkopolska breed stallions for two years; Group A: 1-month-old, Group B: 3-month-old, Group C: 6-month-old, Group D: 1-year-old, and Group E: 2-yea...

  13. NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS

    Directory of Open Access Journals (Sweden)

    Lakshya Veer Singh

    2013-06-01

    Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.

  14. Hydrolytic and alcoholytic dephosphorylation of nucleotides by acid phosphatase in the presence of ethanol.

    Science.gov (United States)

    Tomaszewski, M; Buchowicz, J

    1971-08-01

    The effect of ethanol on the activity of acid phosphatase from wheat germ was studied, by using ribonucleoside monophosphates as the enzyme substrates. The nucleotides were effectively degraded to the corresponding nucleosides in the presence of ethanol at all concentrations tested, including a 96% (v/v) solution. However, the nucleotide dephosphorylation was accompanied by the liberation of orthophosphate only when the concentration of ethanol in the assay mixture did not exceed 15%. No inorganic phosphate was liberated when ethanol was present at higher concentrations. Instead, monoethyl phosphate was formed in quantities expected for orthophosphate. The results are explained in terms of phosphatase-catalysed alcoholysis.

  15. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

    Science.gov (United States)

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

    2017-04-18

    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  16. Molecular Characterization of Five Potyviruses Infecting Korean Sweet Potatoes Based on Analyses of Complete Genome Sequences

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak

    2015-12-01

    Full Text Available Sweet potatoes (Ipomea batatas L. are grown extensively, in tropical and temperate regions, and are important food crops worldwide. In Korea, potyviruses, including Sweet potato feathery mottle virus (SPFMV, Sweet potato virus C (SPVC, Sweet potato virus G (SPVG, Sweet potato virus 2 (SPV2, and Sweet potato latent virus (SPLV, have been detected in sweet potato fields at a high (~95% incidence. In the present work, complete genome sequences of 18 isolates, representing the five potyviruses mentioned above, were compared with previously reported genome sequences. The complete genomes consisted of 10,081 to 10,830 nucleotides, excluding the poly-A tails. Their genomic organizations were typical of the Potyvirus genus, including one target open reading frame coding for a putative polyprotein. Based on phylogenetic analyses and sequence comparisons, the Korean SPFMV isolates belonged to the strains RC and O with >98% nucleotide sequence identity. Korean SPVC isolates had 99% identity to the Japanese isolate SPVC-Bungo and 70% identity to the SPFMV isolates. The Korean SPVG isolates showed 99% identity to the three previously reported SPVG isolates. Korean SPV2 isolates had 97% identity to the SPV2 GWB-2 isolate from the USA. Korean SPLV isolates had a relatively low (88% nucleotide sequence identity with the Taiwanese SPLV-TW isolates, and they were phylogenetically distantly related to SPFMV isolates. Recombination analysis revealed that possible recombination events occurred in the P1, HC-Pro and NIa-NIb regions of SPFMV and SPLV isolates and these regions were identified as hotspots for recombination in the sweet potato potyviruses.

  17. Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

    Science.gov (United States)

    Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

    2016-06-01

    As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

  18. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed

    2009-11-01

    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  19. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    Science.gov (United States)

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  20. Complete Genomic Sequence of Border Disease Virus, a Pestivirus from Sheep

    Science.gov (United States)

    Becher, Paul; Orlich, Michaela; Thiel, Heinz-Jürgen

    1998-01-01

    The genus Pestivirus of the family Flaviviridae comprises three established species, namely, bovine viral diarrhea virus (BVDV), classical swine fever virus (CSFV), and border disease virus from sheep (BDV). In this study, we report the first complete nucleotide sequence of BDV, that of strain X818. The genome is 12,333 nucleotides long and contains one long open reading frame encoding 3,895 amino acids. The 5′ noncoding region (NCR) of BDV X818 consists of 372 nucleotides and is thus similar in length to the 5′ NCR reported for other pestiviruses. The 3′ NCR of X818 is 273 nucleotides long and thereby at least 32 nucleotides longer than the 3′ NCR of pestiviruses analyzed thus far. Within the 3′ NCR of BDV X818, the sequence motif TATTTATTTA was identified at four locations. The same repeat was found at two or three locations within the 3′ NCR of different CSFV isolates but was absent in the 3′ NCR of BVDV. Analysis of five additional BDV strains showed that the 3′ NCR sequences are highly conserved within this species. Comparison of the deduced amino acid sequence of X818 with the ones of other pestiviruses allowed the prediction of polyprotein cleavage sites which were conserved with regard to the structural proteins. It has been reported for two BVDV strains that cleavage at the nonstructural (NS) protein sites 3/4A, 4A/4B, 4B/5A, and 5A/5B is mediated by the NS3 serine protease and for each site a conserved leucine was found at the P1 position followed by either serine or alanine at P1′ (N. Tautz, K. Elbers, D. Stoll, G. Meyers, and H.-J. Thiel, J. Virol. 71:5415–5422, 1997; J. Xu, E. Mendez, P. R. Caron, C. Lin, M. A. Murcko, M. S. Collett, and C. M. Rice, J. Virol. 71:5312–5322). Interestingly, P1′ of the predicted NS5A/5B cleavage site of BDV is represented by an asparagine residue. Transient expression studies demonstrated that this unusual NS5A/5B processing site is efficiently cleaved by the NS3 serine protease of BDV. PMID

  1. Complete genome sequence of a novel Plum pox virus strain W isolate determined by 454 pyrosequencing.

    Science.gov (United States)

    Sheveleva, Anna; Kudryavtseva, Anna; Speranskaya, Anna; Belenikin, Maxim; Melnikova, Natalia; Chirkov, Sergei

    2013-10-01

    The near-complete (99.7 %) genome sequence of a novel Russian Plum pox virus (PPV) isolate Pk, belonging to the strain Winona (W), has been determined by 454 pyrosequencing with the exception of the thirty-one 5'-terminal nucleotides. This region was amplified using 5'RACE kit and sequenced by the Sanger method. Genomic RNA released from immunocaptured PPV particles was employed for generation of cDNA library using TransPlex Whole transcriptome amplification kit (WTA2, Sigma-Aldrich). The entire Pk genome has identity level of 92.8-94.5 % when compared to the complete nucleotide sequences of other PPV-W isolates (W3174, LV-141pl, LV-145bt, and UKR 44189), confirming a high degree of variability within the PPV-W strain. The isolates Pk and LV-141pl are most closely related. The Pk has been found in a wild plum (Prunus domestica) in a new region of Russia indicating widespread dissemination of the PPV-W strain in the European part of the former USSR.

  2. Complete sequence of Fig fleck-associated virus, a novel member of the family Tymoviridae.

    Science.gov (United States)

    Elbeaino, Toufic; Digiaro, Michele; Martelli, Giovanni P

    2011-11-01

    The complete nucleotide sequence and the genome organization were determined of a novel virus, tentatively named Fig fleck-associated virus (FFkaV). The viral genome is a positive-sense, single-stranded RNA 7046 nucleotides in size excluding the 3'-terminal poly(A) tract, and comprising two open reading frames. ORF1 encodes a polypeptide of 2161 amino acids (p240), which contains the signatures of replication-associated proteins and the coat protein cistron (p24) at its 3' end. ORF2 codes for a 461 amino acid protein (p50) identified as a putative movement proteins (MP). In phylogenetic trees constructed with sequences of the putative polymerase and CP proteins FFkaV consistently groups with members of the genus Maculavirus, family Tymoviridae. However, the genome organization diverges from that of the two completely sequenced maculaviruses, Grapevine fleck virus (GFkV) and Bombix mori Macula-like virus (BmMLV), as it exhibits a structure resembling that of Maize rayado fino virus (MRFV), the type species of the genus Marafivirus and of Olive latent virus 3 (OLV-3), an unclassified virus in the family Tymoviridae. FFkaV was found in field-grown figs from six Mediterranean countries with an incidence ranging from 15% to 25%. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Road Signs for UV-Completion

    CERN Document Server

    Dvali, Gia; Gomez, Cesar

    2012-01-01

    We confront the concepts of Wilsonian UV-completion versus self-completion by Classicalization in theories with derivatively-coupled scalars. We observe that the information about the UV-completion road is encoded in the sign of the derivative terms. We note that the sign of the derivative couplings for which there is no consistent Wilsonian UV-completion is the one that allows for consistent classicalons. This is an indication that for such a sign the vertex must be treated as fundamental and the theory self-protects against potential inconsistencies, such as superluminality, via self-completion by classicalization. Applying this reasoning to the UV-completion of the Standard Model, we see that the information about the Higgs versus classicalization is encoded in the sign of the scattering amplitude of longitudinal W-bosons. Negative sign excludes Higgs or any other weakly-coupled Wilsonian physics.

  4. Nominal completion for rewrite systems with binders

    OpenAIRE

    Fernández, Maribel; Rubio Gimeno, Alberto

    2012-01-01

    We design a completion procedure for nominal rewriting systems, based on a generalisation of the recursive path ordering to take into account alpha equivalence. Nominal rewriting generalises first-order rewriting by providing support for the specification of binding operators. Completion of rewriting systems with binders is a notably difficult problem; the completion procedure presented in this paper is the first to deal with binders in rewrite rules. Peer Reviewed

  5. Tensor Completion Algorithms in Big Data Analytics

    OpenAIRE

    Song, Qingquan; Ge, Hancheng; Caverlee, James; Hu, Xia

    2017-01-01

    Tensor completion is a problem of filling the missing or unobserved entries of partially observed tensors. Due to the multidimensional character of tensors in describing complex datasets, tensor completion algorithms and their applications have received wide attention and achievement in areas like data mining, computer vision, signal processing, and neuroscience. In this survey, we provide a modern overview of recent advances in tensor completion algorithms from the perspective of big data an...

  6. Efficient Low Rank Tensor Ring Completion

    OpenAIRE

    Wang, Wenqi; Aggarwal, Vaneet; Aeron, Shuchin

    2017-01-01

    Using the matrix product state (MPS) representation of the recently proposed tensor ring decompositions, in this paper we propose a tensor completion algorithm, which is an alternating minimization algorithm that alternates over the factors in the MPS representation. This development is motivated in part by the success of matrix completion algorithms that alternate over the (low-rank) factors. In this paper, we propose a spectral initialization for the tensor ring completion algorithm and ana...

  7. Improving professional IT doctorate completion rates

    Directory of Open Access Journals (Sweden)

    Oliver Kisalay Burmeister

    2015-08-01

    Full Text Available Professional doctorates in Information Technology (IT have been a relatively recent phenomenon, giving IT professionals career management choices not previously available to them. However, successful completion rates are the lowest of all disciplines. Completed doctorates rate in quality equivalent to PhDs, and retention has been identified as a major obstacle to completion. This qualitative study, involving 44 semi-structured interviews with students, supervisors and institutional support personnel, investigated the obstacles. Amongst the strategies discovered to improve completion rates were retention, student engagement with supervisors, feedback on progress, student engagement in the course, and student involvement in institutional communities of practice.

  8. On characterizations of quasi-metric completeness

    Energy Technology Data Exchange (ETDEWEB)

    Dag, H.; Romaguera, S.; Tirado, P.

    2017-07-01

    Hu proved in [4] that a metric space (X, d) is complete if and only if for any closed subspace C of (X, d), every Banach contraction on C has fixed point. Since then several authors have investigated the problem of characterizing the metric completeness by means of fixed point theorems. Recently this problem has been studied in the more general context of quasi-metric spaces for different notions of completeness. Here we present a characterization of a kind of completeness for quasi-metric spaces by means of a quasi-metric versions of Hu’s theorem. (Author)

  9. Nucleotide composition of the Zika virus RNA genome and its codon usage

    NARCIS (Netherlands)

    van Hemert, Formijn; Berkhout, Ben

    2016-01-01

    RNA viruses have genomes with a distinct nucleotide composition and codon usage. We present the global characteristics of the RNA genome of Zika virus (ZIKV), an emerging pathogen within the Flavivirus genus. ZIKV was first isolated in 1947 in Uganda, caused a widespread epidemic in South and

  10. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  11. Building the library of RNA 3D nucleotide conformations using the clustering approach

    Directory of Open Access Journals (Sweden)

    Zok Tomasz

    2015-09-01

    Full Text Available An increasing number of known RNA 3D structures contributes to the recognition of various RNA families and identification of their features. These tasks are based on an analysis of RNA conformations conducted at different levels of detail. On the other hand, the knowledge of native nucleotide conformations is crucial for structure prediction and understanding of RNA folding. However, this knowledge is stored in structural databases in a rather distributed form. Therefore, only automated methods for sampling the space of RNA structures can reveal plausible conformational representatives useful for further analysis. Here, we present a machine learning-based approach to inspect the dataset of RNA three-dimensional structures and to create a library of nucleotide conformers. A median neural gas algorithm is applied to cluster nucleotide structures upon their trigonometric description. The clustering procedure is two-stage: (i backbone- and (ii ribose-driven. We show the resulting library that contains RNA nucleotide representatives over the entire data, and we evaluate its quality by computing normal distribution measures and average RMSD between data points as well as the prototype within each cluster.

  12. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  13. Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

  14. Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam; Gehring, Christoph A; Berkowitz, Gerald A.

    2012-01-01

    , including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a

  15. 2′-O-methyl nucleotide modified DNA substrates influence the ...

    Indian Academy of Sciences (India)

    2014-07-18

    Jul 18, 2014 ... 1. Introduction. Due to the development of novel nucleotide derivatives, ..... which is located in a spiral ring made of 152-157 bases before α6. ..... 8 126–. 130. Majlessi M, Nelson NC and Becker MM 1998 Advantages of 2'-O-.

  16. Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik

    2003-01-01

    The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...

  17. Factor 11 single-nucleotide variants in women with heavy menstrual bleeding

    NARCIS (Netherlands)

    Wiewel-Verschueren, Sophie; Mulder, Andre B.; Meijer, Karina; Mulder, Rene

    2017-01-01

    In a previous study it was shown that lower factor XI (FXI) levels in women with heavy menstrual bleeding (HMB). Our aim was to determine the single-nucleotide variants (SNVs) in the F11 gene in women with HMB. In addition, an extensive literature search was performed to determine the clinical

  18. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    DEFF Research Database (Denmark)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

  19. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    Science.gov (United States)

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  20. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  1. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  2. Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions.

    Science.gov (United States)

    Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka

    2014-01-01

    Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.

  3. SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair

    DEFF Research Database (Denmark)

    Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin

    2015-01-01

    XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...

  4. Grinding up Wheat: a Massive Loss of Nucleotide Diversity Since Domestication

    DEFF Research Database (Denmark)

    Haudry, Anabelle; Cenci, Alberto; Ravel, Catherine

    2007-01-01

    Several demographic and selective events occurred during the domestication of wheat from the allotetraploid wild emmer (Triticum turgidum ssp. dicoccoides). Cultivated wheat has since been affected by other historical events. We analyzed nucleotide diversity at 21 loci in a sample of 101 individu...

  5. A fluorimetric readout reporting the kinetics of nucleotide-induced human ribonucleotide reductase oligomerization.

    Science.gov (United States)

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon

    2014-11-24

    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    International Nuclear Information System (INIS)

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.

    1988-01-01

    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity [ 3 H]fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity [ 3 H]fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils

  7. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  8. Targeted Metabolic Engineering Guided by Computational Analysis of Single-Nucleotide Polymorphisms (SNPs)

    DEFF Research Database (Denmark)

    Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas

    2013-01-01

    The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...

  9. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  10. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    Science.gov (United States)

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  11. Slow spontaneous [Ca2+]i oscillations reflect nucleotide release from renal epithelia

    DEFF Research Database (Denmark)

    Geyti, Christine Stride; Odgaard, Elvin V. P.; Overgaard, Morten Thaarup

    2008-01-01

    Renal epithelia can be provoked mechanically to release nucleotides, which subsequently increases the intracellular Ca(2+) concentration [Ca(2+)](i) through activation of purinergic (P2) receptors. Cultured cells often show spontaneous [Ca(2+)](i) oscillations, a feature suggested to involve nucl...

  12. Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: gustgarb@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica

    2013-12-01

    Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)

  13. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2007-01-01

    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  14. Determination of the Nucleic Acid Adducts Structure at the Nucleoside/Nucleotide Level by NMR Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Pohl, Radek

    2015-01-01

    Roč. 28, č. 2 (2015), s. 155-165 ISSN 0893-228X R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2015

  15. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    NARCIS (Netherlands)

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

    2017-01-01

    Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.

  16. Synthesis of Benzene and Pyridine 2-C-Methyl-C-ribonucleosides and -nucleotides

    Czech Academy of Sciences Publication Activity Database

    Tokarenko, Anna; Poštová Slavětínská, Lenka; Klepetářová, Blanka; Hocek, Michal

    2015-01-01

    Roč. 2015, č. 36 (2015), s. 7962-7983 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * glycosides * antiviral agents * cross - coupling Subject RIV: CC - Organic Chemistry Impact factor: 3.068, year: 2015

  17. Synthesis of Substituted Benzyl Homo-C-Ribonucleosides and -Nucleotides as Carba-Analogues of Phosphoribosylanthranilate

    Czech Academy of Sciences Publication Activity Database

    Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal

    -, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012

  18. Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays

    Science.gov (United States)

    Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse

    2013-11-01

    Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.

  19. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

    NARCIS (Netherlands)

    Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.

    2017-01-01

    PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

  20. Oligodeoxynucleotides containing 2'-amino-LNA nucleotides as constrained morpholino phosphoramidate and phosphorodiamidate monomers

    DEFF Research Database (Denmark)

    Kristensen, Kim Vejlegaard; Paul, Sibasish; Kosbar, Tamer

    2017-01-01

    Incorporation in a 2'→5' direction of a phosphorodiamidite 2'-amino-LNA-T nucleotide as the morpholino phosphoramidate and N,N-dimethylamino phosphorodiamidate monomers into six oligonucleotides is reported. Thermal denaturation studies showed that the novel 2'-amino-LNA-based morpholino monomers...

  1. Dietary nucleotide supplementation raises erythrocyte 2, 3-diphosphoglycerate concentration in neonatal rats.

    Science.gov (United States)

    Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M

    1999-03-01

    The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.

  2. Synthesis of Hydrazone-Modified Nucleotides and Their Polymerase Incorporation onto DNA for Redox Labeling

    Czech Academy of Sciences Publication Activity Database

    Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal

    2012-01-01

    Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry

  3. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)

    2017-03-02

    Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...

  4. On the biased nucleotide composition of the human coronavirus RNA genome

    NARCIS (Netherlands)

    Berkhout, Ben; van Hemert, Formijn

    2015-01-01

    We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and

  5. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    International Nuclear Information System (INIS)

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.

    1987-01-01

    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced 125 I-[Tyr 1 ]somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate [Gpp(NH)p]>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg 2+ . When pancreatic acini were treated with 1 μg/ml pertussis toxin for 4 h, subsequent 125 I-[Tyr 1 ]somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor

  6. Dynamic interaction of TTDA with TFIIH is stabilized by nucleotide excision repair in living cells.

    NARCIS (Netherlands)

    G. Giglia-Mari (Giuseppina); C. Miquel (Catherine); A.F. Theil (Arjan); P.O. Mari (Pierre-Olivier); D. Hoogstraten (Deborah); J.M.Y. Ng (Jessica); C. Dinant (Christoffel); J.H.J. Hoeijmakers (Jan); W. Vermeulen (Wim)

    2006-01-01

    textabstractTranscription/repair factor IIH (TFIIH) is essential for RNA polymerase II transcription and nucleotide excision repair (NER). This multi-subunit complex consists of ten polypeptides, including the recently identified small 8-kDa trichothiodystrophy group A (TTDA)/ hTFB5 protein.

  7. Nucleotide variation in ATHK1 region of Arabidopsis thaliana and its ...

    African Journals Online (AJOL)

    The ATHK1 gene in Arabidopsis encodes a putative histidine kinase that is transcriptionally upregulated in response to changes in external osmolarity. In this work, we investigated the nucleotide variability of the ATHK1 gene in a sample of 32 core Arabidopsis accessions originating from different ecoclimatic regions and ...

  8. The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.

    Science.gov (United States)

    Woolfitt, A R; Kellett, G L; Hoggett, J G

    1988-01-29

    The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.

  9. Completely integrable operator evolution equations. II

    International Nuclear Information System (INIS)

    Chudnovsky, D.V.

    1979-01-01

    The author continues the investigation of operator classical completely integrable systems. The main attention is devoted to the stationary operator non-linear Schroedinger equation. It is shown that this equation can be used for separation of variables for a large class of completely integrable equations. (Auth.)

  10. 14 CFR 413.13 - Complete application.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Complete application. 413.13 Section 413.13 Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION LICENSING LICENSE APPLICATION PROCEDURES § 413.13 Complete application. The FAA's acceptance of an...

  11. The Magnets Puzzle is NP-Complete

    DEFF Research Database (Denmark)

    Kölker, Jonas

    2012-01-01

    In a Magnets puzzle, one must pack magnets in a box subjet to polarity and numeric constraints. We show that solvability of Magnets instances is NP-complete.......In a Magnets puzzle, one must pack magnets in a box subjet to polarity and numeric constraints. We show that solvability of Magnets instances is NP-complete....

  12. Rank 2 fusion rings are complete intersections

    DEFF Research Database (Denmark)

    Andersen, Troels Bak

    We give a non-constructive proof that fusion rings attached to a simple complex Lie algebra of rank 2 are complete intersections.......We give a non-constructive proof that fusion rings attached to a simple complex Lie algebra of rank 2 are complete intersections....

  13. Non-detectable levels of 6-thioguanine nucleotides and 6-methylmercaptopurine in a patient treated with azathioprine: a case report

    Science.gov (United States)

    Wong, D R; den Dulk, M O; Derijks, L J J; Gemmeke, E H K M; Hooymans, P M

    2007-01-01

    Introduction: Azathioprine (AZA) is a thiopurine prodrug clinically used for immunosuppression in the treatment of auto-immune inflammatory diseases and in regimens of organ transplantations. The pharmacological action of AZA is based on the formation of 6-mercaptopurine (6-MP), which is metabolised into a variety of active thiopurine-nucleotide metabolites. We report the case of a 55 year old woman (bodyweight 30 kg) with chronic pancreatitis, weight loss, and progressive elevation of liver transaminases and serum amylase. Case description: The woman was treated with prednisolone (30 mg 1 dd; tapered 5 mg each week) and AZA (75 mg 1 dd; 5 weeks later 150 mg 1 dd). Despite good patient-compliance verified during hospital-stay, none of the active metabolites of AZA, 6-thioguanine-nucleotides (6TGN) and 6-methylmercaptopurine ribonucleotides (6MMPR), were detected in erythrocytes. After two months of treatment clinical improvement was achieved, but no normalisation of laboratory parameters. Subsequently, AZA was switched to 6-MP 75 mg 1 dd, and allopurinol 100 mg 1 dd was added. After one week the 6TGN level was 616 pmol/ 8 × 108 red blood cells (RBC), the 6MMPR level was 1319 pmol/ 8 × 108 RBC. Two weeks later the 6TGN level was 1163 pmol/ 8 × 108 RBC and the 6MMPR level 10015 pmol/ 8 × 108 RBC. These 6TGN and 6MMPR levels were higher than the upper limits of the therapeutic ranges (500 pmol/ 8 × 108 RBC and 5700 pmol/ 8 × 108 RBC, respectively). Therefore, treatment with 6-MP was discontinued. A week later the 6TGN and 6MMPR levels decreased to 686 pmol/ 8 × 108 RBC and 4027 pmol/ 8 × 108 RBC, respectively. Genotyping of the enzym thiopurine S-methyl transferase (TPMT) revealed a wild-type TPMT (*1/*1) genotype. Discussion: To our knowledge this is the first report of a patient who was not able to form detectable active thiopurine metabolites on the treatment with AZA. AZA is normally rapidly and almost completely converted to 6-MP and methylnitroimidazole

  14. Mochovce Unit 3 and 4 Completion

    International Nuclear Information System (INIS)

    Aquilanti, G.

    2007-01-01

    Purpose of the Feasibility Study was to define in detail all technical, economic, financial, legal and authorization aspects of Mochovce NPP Unit 3 and 4 completion in order to provide Slovenske Elektrarne, a. s. (SE) and ENEL Top Management with all the necessary information for a final decision on Mochovce Unit 3 and 4. Feasibility study has started in January 2006. SE had the commitment to complete the Feasibility Study within 12 months from Closing of SE acquisition (April 2007). In order not to delay completion of Mochovce Unit 3 and 4, SE has decided to perform, in parallel to the Feasibility study, also all design and permitting activities which are required for the completion of Plant. This has involved anticipation of expenses for approximately 700 MSKK (or approx. 20 MEuro). SE was able to announce the positive decision about completion on Mochovce NPP Unit 3 and 4, two months in advance of the deadline.

  15. Improving horizontal completions on heterogeneous tight shales

    Energy Technology Data Exchange (ETDEWEB)

    Suarez-Rivera, Roberto; Deenadayalu, Chaitanya; Chertov, Maxim; Novalo Hartanto, Ricardo; Gathogo, Patrick [Schlumberger (United States); Kunjir, Rahul [University of Utah (United States)

    2011-07-01

    Evaluation of the two formation characteristics conducive to economic well production is important when tight shale formation characterization and completion design are being considered. This paper presents the basic understanding required to improve the efficiency of horizontal completions in oil and gas producing shales. Guidelines are defined for effective perforation and fracturing to improve the efficiency and sustainability of horizontal completions using extensive laboratory characterization of mechanical properties on core, core/log integration and continuous mapping of these properties by logging-while-drilling (LWD) methods. The objective is to improve completion design efficiency. This is accomplished by suitable selection of perforation intervals based on an understanding of the relevant physical processes and rock characterization. Conditions at two reservoir regions, the near-wellbore and the far-wellbore, are outlined and are essential to completion design. From the study, it can be concluded that tight shales are strongly anisotropic and cannot be approximated using isotropic models.

  16. Completions in sand and fractured shale

    Energy Technology Data Exchange (ETDEWEB)

    da Fonseca, C F

    1968-01-01

    The development in the Candeias-Macui area depends little on well completion. The results obtained show that the practice adopted for stimulating fractured shale is not yet defined. It is necessary to improve hole quality, to undertake the research that will prove which prospective intervals are productive, to determine the possible origin of formation damage, and then to select the most suitable stimulation technique. With this, it will be possible to study the technology of ideal completion to be used on new wells in relation to a chosen type of stimulation and future workovers. From the discussion of general completion problems in RPBA, it is concluded that there is an immediate need for training engineers in the specialties of completion, workover and well stimulation. It is also concluded that the meaning of completion must be clarified, so that sectors of responsibility may be defined in order to determine when and how each sector enters into well operations.

  17. DNA incorporation of 6-thioguanine nucleotides during maintenance therapy of childhood acute lymphoblastic leukaemia and non-Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hedeland, Rikke L; Hvidt, Kristian; Nersting, Jacob

    2010-01-01

    To explore the DNA incorporation of 6-thioguanine nucleotide levels (DNA-6TGN) during 6-mercaptopurine (6MP) therapy of childhood acute lymphoblastic leukaemia (ALL) and non-Hodgkin lymphoma (NHL) and its relation to erythrocyte levels of their metabolites: 6-thioguanine-nucleotides (E-6TGN...

  18. Simulation of the coupling between nucleotide binding and transmembrane domains in the ABC transporter BtuCD

    DEFF Research Database (Denmark)

    Sonne, Jacob; Kandt, C.; Peters, Günther H.j.

    2007-01-01

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B12 importer BtuCD using perturbed elastic network calculations and biased molecular...

  19. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    Science.gov (United States)

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  20. Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

    Science.gov (United States)

    Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

    2013-07-01

    Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Monitoring Ras Interactions with the Nucleotide Exchange Factor Son of Sevenless (Sos) Using Site-specific NMR Reporter Signals and Intrinsic Fluorescence.

    Science.gov (United States)

    Vo, Uybach; Vajpai, Navratna; Flavell, Liz; Bobby, Romel; Breeze, Alexander L; Embrey, Kevin J; Golovanov, Alexander P

    2016-01-22

    The activity of Ras is controlled by the interconversion between GTP- and GDP-bound forms partly regulated by the binding of the guanine nucleotide exchange factor Son of Sevenless (Sos). The details of Sos binding, leading to nucleotide exchange and subsequent dissociation of the complex, are not completely understood. Here, we used uniformly (15)N-labeled Ras as well as [(13)C]methyl-Met,Ile-labeled Sos for observing site-specific details of Ras-Sos interactions in solution. Binding of various forms of Ras (loaded with GDP and mimics of GTP or nucleotide-free) at the allosteric and catalytic sites of Sos was comprehensively characterized by monitoring signal perturbations in the NMR spectra. The overall affinity of binding between these protein variants as well as their selected functional mutants was also investigated using intrinsic fluorescence. The data support a positive feedback activation of Sos by Ras·GTP with Ras·GTP binding as a substrate for the catalytic site of activated Sos more weakly than Ras·GDP, suggesting that Sos should actively promote unidirectional GDP → GTP exchange on Ras in preference of passive homonucleotide exchange. Ras·GDP weakly binds to the catalytic but not to the allosteric site of Sos. This confirms that Ras·GDP cannot properly activate Sos at the allosteric site. The novel site-specific assay described may be useful for design of drugs aimed at perturbing Ras-Sos interactions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit.

    Science.gov (United States)

    Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun

    2016-10-01

    The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.

  3. Regulation of formyl peptide receptor binding to rabbit neutrophil plasma membranes. Use of monovalent cations, guanine nucleotides, and bacterial toxins to discriminate among different states of the receptor

    International Nuclear Information System (INIS)

    Feltner, D.E.; Marasco, W.A.

    1989-01-01

    The regulation by monovalent cations, guanine nucleotides, and bacterial toxins of [3H]FMLP binding to rabbit neutrophil plasma membranes was studied by using dissociation techniques to identify regulatory effects on separate receptor states. Under conditions of low receptor occupancy (1 nM [3H]FMLP) and in both Na+ and K+ buffers, dissociation is heterogenous, displaying two distinct, statistically significant off rates. [3H]FMLP binding was enhanced by substituting other monovalent cations for Na+. In particular, enhanced binding in the presence of K+ relative to Na+ was caused by additional binding to both rapidly and slowly dissociating receptors. Three receptor dissociation rates, two of which appear to correspond to the two affinity states detected in equilibrium binding studies, were defined by specific GTP and pertussis toxin (PT) treatments. Neither GTP, nor PT or cholera toxins (CT) had an effect on the rate of dissociation of [3H]FMLP from the rapidly dissociating form of the receptor. Both 100 microM GTP and PT treatments increased the percentage of rapidly dissociating receptors, correspondingly decreasing the percentage of slowly dissociating receptors. The observed changes in the rapidly and slowly dissociating receptors after GTP, PT, and CT treatments were caused by an absolute decrease in the amount of binding to the slowly dissociating receptors. However, complete inhibition of slowly dissociating receptor binding by GTP, PT, or both was never observed. Both GTP and PT treatments, but not CT treatment, increased by two-fold the rate of dissociation of 1 nM [3H]FMLP from the slowly dissociating form of the receptor, resulting in a third dissociation rate. Thus, slowly dissociating receptors comprise two different receptor states, a G protein-associated guanine nucleotide and PT-sensitive state and a guanine nucleotide-insensitive state

  4. Guanine nucleotide-dependent, pertussis toxin-insensitive, stimulation of inositol phosphate formation by carbachol in a membrane preparation from astrocytoma cells

    International Nuclear Information System (INIS)

    Hepler, J.R.; Harden, T.K.

    1986-01-01

    Formation of the inositol phosphates (InsP), InsP 3 , InsP 2 , and InsP 1 was increased in a concentration dependent manner (K/sub 0.5/ ∼ 5 μM) by GTPΣS in washed membranes prepared from 3 H-inositol-prelabelled 1321N1 human astrocytoma cells. Both GTPγS and GppNHp stimulated InsP formation by 2-3 fold over control; GTP and GDP were much less efficacious and GMP had no effect. Although the muscarinic cholinergic receptor agonist carbachol had no effect in the absence of guanine nucleotide, in the presence of 10 μM GTPγS, carbachol stimulated (K/sub 0.5/ ∼ 10 μ M) the formation of InsP above the level achieved with GTPγS alone. The effect of carbachol was completely blocked by atropine. The order of potency for a series of nucleotides for stimulation of InsP formation in the presence of 500 μM carbachol was GTPγS > GppNHp > GTP = GDP. Pertussis toxin, at concentrations that fully ADP-ribosylate and functionally inactivate G/sub i/, had no effect on InsP formation in the presence of GTPγS or GTPγS plus carbachol. Histamine and bradykinin also stimulated InsP formation in the presence of GTPγS in washed membranes from 1321N1 cells. These data are consistent with the idea that a guanine nucleotide regulatory protein that is not G/sub i/ is involved in receptor-mediated stimulation of InsP formation in 1321N1 human astrocytoma cells

  5. Matrix completion by deep matrix factorization.

    Science.gov (United States)

    Fan, Jicong; Cheng, Jieyu

    2018-02-01

    Conventional methods of matrix completion are linear methods that are not effective in handling data of nonlinear structures. Recently a few researchers attempted to incorporate nonlinear techniques into matrix completion but there still exists considerable limitations. In this paper, a novel method called deep matrix factorization (DMF) is proposed for nonlinear matrix completion. Different from conventional matrix completion methods that are based on linear latent variable models, DMF is on the basis of a nonlinear latent variable model. DMF is formulated as a deep-structure neural network, in which the inputs are the low-dimensional unknown latent variables and the outputs are the partially observed variables. In DMF, the inputs and the parameters of the multilayer neural network are simultaneously optimized to minimize the reconstruction errors for the observed entries. Then the missing entries can be readily recovered by propagating the latent variables to the output layer. DMF is compared with state-of-the-art methods of linear and nonlinear matrix completion in the tasks of toy matrix completion, image inpainting and collaborative filtering. The experimental results verify that DMF is able to provide higher matrix completion accuracy than existing methods do and DMF is applicable to large matrices. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Development and Applications of a High Throughput Genotyping Tool for Polyploid Crops: Single Nucleotide Polymorphism (SNP Array

    Directory of Open Access Journals (Sweden)

    Qian You

    2018-02-01

    Full Text Available Polypoid species play significant roles in agriculture and food production. Many crop species are polyploid, such as potato, wheat, strawberry, and sugarcane. Genotyping has been a daunting task for genetic studies of polyploid crops, which lags far behind the diploid crop species. Single nucleotide polymorphism (SNP array is considered to be one of, high-throughput, relatively cost-efficient and automated genotyping approaches. However, there are significant challenges for SNP identification in complex, polyploid genomes, which has seriously slowed SNP discovery and array development in polyploid species. Ploidy is a significant factor impacting SNP qualities and validation rates of SNP markers in SNP arrays, which has been proven to be a very important tool for genetic studies and molecular breeding. In this review, we (1 discussed the pros and cons of SNP array in general for high throughput genotyping, (2 presented the challenges of and solutions to SNP calling in polyploid species, (3 summarized the SNP selection criteria and considerations of SNP array design for polyploid species, (4 illustrated SNP array applications in several different polyploid crop species, then (5 discussed challenges, available software, and their accuracy comparisons for genotype calling based on SNP array data in polyploids, and finally (6 provided a series of SNP array design and genotype calling recommendations. This review presents a complete overview of SNP array development and applications in polypoid crops, which will benefit the research in molecular breeding and genetics of crops with complex genomes.

  7. De novo Genome Assembly and Single Nucleotide Variations for Soybean Mosaic Virus Using Soybean Seed Transcriptome Data

    Directory of Open Access Journals (Sweden)

    Yeonhwa Jo

    2017-10-01

    Full Text Available Soybean is the most important legume crop in the world. Several diseases in soybean lead to serious yield losses in major soybean-producing countries. Moreover, soybean can be infected by diverse viruses. Recently, we carried out a large-scale screening to identify viruses infecting soybean using available soybean transcriptome data. Of the screened transcriptomes, a soybean transcriptome for soybean seed development analysis contains several virus-associated sequences. In this study, we identified five viruses, including soybean mosaic virus (SMV, infecting soybean by de novo transcriptome assembly followed by blast search. We assembled a nearly complete consensus genome sequence of SMV China using transcriptome data. Based on phylogenetic analysis, the consensus genome sequence of SMV China was closely related to SMV isolates from South Korea. We examined single nucleotide variations (SNVs for SMVs in the soybean seed transcriptome revealing 780 SNVs, which were evenly distributed on the SMV genome. Four SNVs, C-U, U-C, A-G, and G-A, were frequently identified. This result demonstrated the quasispecies variation of the SMV genome. Taken together, this study carried out bioinformatics analyses to identify viruses using soybean transcriptome data. In addition, we demonstrated the application of soybean transcriptome data for virus genome assembly and SNV analysis.

  8. The nucleotide sequence and a first generation gene transfer vector of species B human adenovirus serotype 3.

    Science.gov (United States)

    Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio

    2005-12-20

    Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.

  9. Highlights from the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength or FAMuSS Study

    Directory of Open Access Journals (Sweden)

    Linda S. Pescatello

    2013-01-01

    Full Text Available The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT. The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years, healthy men (42% and women (58% that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity.

  10. Integrated Association Rules Complete Hiding Algorithms

    Directory of Open Access Journals (Sweden)

    Mohamed Refaat Abdellah

    2017-01-01

    Full Text Available This paper presents database security approach for complete hiding of sensitive association rules by using six novel algorithms. These algorithms utilize three new weights to reduce the needed database modifications and support complete hiding, as well as they reduce the knowledge distortion and the data distortions. Complete weighted hiding algorithms enhance the hiding failure by 100%; these algorithms have the advantage of performing only a single scan for the database to gather the required information to form the hiding process. These proposed algorithms are built within the database structure which enables the sanitized database to be generated on run time as needed.

  11. [Complete atrioventricular block in Duchenne muscular dystrophy].

    Science.gov (United States)

    Kuru, Satoshi; Tanahashi, Tamotsu; Matsumoto, Shinjirou; Kitamura, Tetsuya; Konagaya, Masaaki

    2012-01-01

    We report a case of complete atrioventricular (AV) block in a 40-year-old patient with Duchenne muscular dystrophy (DMD). While he was bed-ridden and required mechanical ventilation, his cardiac involvement was mild. He had the deletion of exon 45-52 in the dystrophin gene. He underwent transient complete AV block and came to require pacemaker implantation due to recurrence of complete AV block ten days after the first attack. Electrophysiological study revealed mild prolonged AH and HV interval. Although DMD patients with AV block have been rarely reported so far, attention should be paid to AV block for patients who prolonged their lives.

  12. Oracle Goldengate 11g complete cookbook

    CERN Document Server

    Gupta, Ankur

    2013-01-01

    Oracle Goldengate 11g Complete Cookbook follows the Cookbook style. Each recipe provides step by step instructions with various examples and scripts. This book provides the necessary information to successfully complete most of the possible administration tasks.Oracle Goldengate 11g Complete Cookbook is aimed at Database Administrators, Architects, and Middleware Administrators who are keen to know more about Oracle Goldengate. Whether you are handling Goldengate environments on a day-to-day basis, or using it just for migration, this book provides the necessary information required to success

  13. Complete cumulative index (1963-1983)

    International Nuclear Information System (INIS)

    1983-01-01

    This complete cumulative index covers all regular and special issues and supplements published by Atomic Energy Review (AER) during its lifetime (1963-1983). The complete cumulative index consists of six Indexes: the Index of Abstracts, the Subject Index, the Title Index, the Author Index, the Country Index and the Table of Elements Index. The complete cumulative index supersedes the Cumulative Indexes for Volumes 1-7: 1963-1969 (1970), and for Volumes 1-10: 1963-1972 (1972); this Index also finalizes Atomic Energy Review, the publication of which has recently been terminated by the IAEA

  14. Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene

    Directory of Open Access Journals (Sweden)

    Yang Ming

    2012-07-01

    Full Text Available Abstract Background MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD within this gene in Chinese indigenous breeds and Western commercial breeds. Results A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb in Western commercial breeds. The significant positive Tajima’D, and Fu and Li’s D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Conclusions Chinese and Western breeds have

  15. Phylogeny of caecilian amphibians (Gymnophiona) based on complete mitochondrial genomes and nuclear RAG1.

    Science.gov (United States)

    San Mauro, Diego; Gower, David J; Oommen, Oommen V; Wilkinson, Mark; Zardoya, Rafael

    2004-11-01

    We determined the complete nucleotide sequence of the mitochondrial (mt) genome of five individual caecilians (Amphibia: Gymnophiona) representing five of the six recognized families: Rhinatrema bivittatum (Rhinatrematidae), Ichthyophis glutinosus (Ichthyophiidae), Uraeotyphlus cf. oxyurus (Uraeotyphlidae), Scolecomorphus vittatus (Scolecomorphidae), and Gegeneophis ramaswamii (Caeciliidae). The organization and size of these newly determined mitogenomes are similar to those previously reported for the caecilian Typhlonectes natans (Typhlonectidae), and for other vertebrates. Nucleotide sequences of the nuclear RAG1 gene were also determined for these six species of caecilians, and the salamander Mertensiella luschani atifi. RAG1 (both at the amino acid and nucleotide level) shows slower rates of evolution than almost all mt protein-coding genes (at the amino acid level). The new mt and nuclear sequences were compared with data for other amphibians and subjected to separate and combined phylogenetic analyses (Maximum Parsimony, Minimum Evolution, Maximum Likelihood, and Bayesian Inference). All analyses strongly support the monophyly of the three amphibian Orders. The Batrachia hypothesis (Gymnophiona, (Anura, Caudata) receives moderate or good support depending on the method of analysis. Within Gymnophiona, the optimal tree (Rhinatrema, (Ichthyophis, Uraeotyphlus), (Scolecomorphus, (Gegeneophis Typhlonectes) agrees with the most recent morphological and molecular studies. The sister group relationship between Rhinatrematidae and all other caecilians, that between Ichthyophiidae and Uraeotyphlidae, and the monophyly of the higher caecilians Scolecomorphidae+Caeciliidae+Typhlonectidae, are strongly supported, whereas the relationships among the higher caecilians are less unambiguously resolved. Analysis of RAG1 is affected by a spurious local rooting problem and associated low support that is ameliorated when outgroups are excluded. Comparisons of trees using the

  16. Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

    Science.gov (United States)

    Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

    2004-01-01

    The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

  17. Capturing the benefits of complete streets.

    Science.gov (United States)

    2015-12-01

    Anecdotal information indicates that private investment and property value increases are associated : with featured Complete Streets projects. However, to date, little research has been done to confirm : these benefits. Much of the relevant literatur...

  18. Three siblings with complete androgen insensitivity syndrome

    African Journals Online (AJOL)

    2013-01-13

    Jan 13, 2013 ... male reference range. A diagnosis of complete androgen insensitivity syndrome was made, based on this clinical ... Laboratory test. Value Normal ..... scenario, incomplete resistance may lead to virilisation during puberty.24, ...

  19. Non-completion and informed consent.

    Science.gov (United States)

    Wertheimer, Alan

    2014-02-01

    There is a good deal of biomedical research that does not produce scientifically useful data because it fails to recruit a sufficient number of subjects. This fact is typically not disclosed to prospective subjects. In general, the guidance about consent concerns the information required to make intelligent self-interested decisions and ignores some of the information required for intelligent altruistic decisions. Bioethics has worried about the 'therapeutic misconception', but has ignored the 'completion misconception'. This article argues that, other things being equal, prospective subjects should be informed about the possibility of non-completion as part of the standard consent process if (1) it is or should be anticipatable that there is a non-trivial possibility of non-completion and (2) that information is likely to be relevant to a prospective subject's decision to consent. The article then considers several objections to the argument, including the objection that disclosing non-completion information would make recruitment even more difficult.

  20. Structural Completeness in The War is Over

    DEFF Research Database (Denmark)

    Nielsen, Jakob Isak

    2010-01-01

    This article argues that Nina Mimica's The War is Over achieves structural completeness on the basis of a number of choices regarding its visual style: shot scale, shot length, editing style and camera movement.  ar Udgivelsesdato: Autumn...

  1. Unsteady Stokes equations: Some complete general solutions

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    homogeneous unsteady Stokes equations are examined. A necessary and sufficient condition for a divergence-free vector to represent the velocity field of a possible unsteady Stokes flow in the absence of body forces is derived. Keywords. Complete ...

  2. Network Completion for Static Gene Expression Data

    Directory of Open Access Journals (Sweden)

    Natsu Nakajima

    2014-01-01

    Full Text Available We tackle the problem of completing and inferring genetic networks under stationary conditions from static data, where network completion is to make the minimum amount of modifications to an initial network so that the completed network is most consistent with the expression data in which addition of edges and deletion of edges are basic modification operations. For this problem, we present a new method for network completion using dynamic programming and least-squares fitting. This method can find an optimal solution in polynomial time if the maximum indegree of the network is bounded by a constant. We evaluate the effectiveness of our method through computational experiments using synthetic data. Furthermore, we demonstrate that our proposed method can distinguish the differences between two types of genetic networks under stationary conditions from lung cancer and normal gene expression data.

  3. On the Completeness of Quantum Mechanics

    OpenAIRE

    Kupczynski, Marian

    2002-01-01

    Quantum cryptography, quantum computer project, space-time quantization program and recent computer experiments reported by Accardi and his collaborators show the importance and actuality of the discussion of the completeness of quantum mechanics (QM) started by Einstein more than 70 years ago. Many years ago we pointed out that the violation of Bell's inequalities is neither a proof of completeness of QM nor an indication of the violation of Einsteinian causality. We also indicated how and i...

  4. Data transfer using complete bipartite graph

    Science.gov (United States)

    Chandrasekaran, V. M.; Praba, B.; Manimaran, A.; Kailash, G.

    2017-11-01

    Information exchange extent is an estimation of the amount of information sent between two focuses on a framework in a given time period. It is an extremely significant perception in present world. There are many ways of message passing in the present situations. Some of them are through encryption, decryption, by using complete bipartite graph. In this paper, we recommend a method for communication using messages through encryption of a complete bipartite graph.

  5. A first experience with digital complete overdentures

    OpenAIRE

    Bajunaid, Salwa Omar

    2016-01-01

    The development of computer-aided design/computer-aided manufacturing systems for dentistry in the 1980s resulted in the successful fabrication of crowns, fixed dental prostheses, and superstructures for both natural teeth and dental implants. Today, this technology is available for constructing digitally designed and milled, completely removable dental prostheses. The procedure uses clinical and laboratory protocols that allow fabrication of completely removable prostheses within two clinica...

  6. BSN completion barriers, challenges, incentives, and strategies.

    Science.gov (United States)

    Duffy, Marie T; Friesen, Mary Ann; Speroni, Karen Gabel; Swengros, Diane; Shanks, Laura A; Waiter, Pamela A; Sheridan, Michael J

    2014-04-01

    The objectives of this study were to explore RN perceptions regarding barriers/challenges and incentives/supports for BSN completion and identify recommendations to increase RN BSN completion. The Institute of Medicine's 2011 The Future of Nursing report recommended the proportion of RNs with a BSN increase to 80% by 2020. This qualitative study included 41 RNs who participated in 1 of 6 focus groups based on their BSN completion status. Primary themes were sacrifices, barriers/challenges, incentives/supports, value, how to begin, and pressure. Primary BSN completion barriers/challenges were work-life balance and economic issues. Incentives/supports identified were financial compensation, assistance from employer and academic institution, and encouragement from family. Institutional strategies recommended for increasing BSN completion rates were improved access to education and financial support facilitated by collaboration between hospitals and academic institutions. Exploring RN barriers/challenges and incentives/supports for BSN completion can lead to implementation of institutional strategies, such as tuition reimbursement and academic collaboration.

  7. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  8. Effects of preservation methods on amino acids and 5'-nucleotides of Agaricus bisporus mushrooms.

    Science.gov (United States)

    Liu, Ying; Huang, Fan; Yang, Hong; Ibrahim, S A; Wang, Yan-Feng; Huang, Wen

    2014-04-15

    In this study, the proximate composition, free amino acids content and 5'-nucleotides in frozen, canned and salted Agaricus bisporus (A. bisporus) were investigated. We found that the three kinds of A. bisporus products were good sources of protein, with amount varying in the ranges of 16.54-24.35g/100g (dry weight). Freezing, canning and salting process, followed by 6months of storage led to a significant reduction in free amino acids, especially tyrosine, alanine, glutamine and cysteine. There were medium levels of MSG-like amino acids in frozen A. bisporus and canned A. bisporus, and low levels of MSG-like amino acids in salted A. bisporus. The mount of flavor 5'-nucleotides in frozen A. bisporus was higher than that of canned and salted A. bisporus. The present study thus suggests that freezing is beneficial for the preservation of A. bisporus. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis

    Directory of Open Access Journals (Sweden)

    Suravajhala P

    2017-06-01

    Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS

  10. Effect of ionizing radiation on calcium and cyclic nucleotides metabolism in rats of different age

    International Nuclear Information System (INIS)

    Efimova, N.I.; Libenson, S.V.

    1982-01-01

    Some features of mechanism of calcium homeostasis and cyclic nucleotide exchange breakage in case of acute radiation injury of rats of various age were studied. It is established that calcium level in blood in nonpuberal animals, calcium and cAMP excretion with urine are minimal and reach maximum at puberal age. cGMP excretion with urine and concentrational levels of cAMP and cGMP in blood do not change with age. It is shown that calcium excretion with urine decreases adaptively in conditions of acute radiation injury in rats of all age groups. Maximal shifts in cAMP/cGMP ratio were noted in nonpuberal animals, whereas maximal adaptive-compensatory abilities in the regulation system of calcium homeostasis and cyclic nucleotides are typical to adolescent puberal animals

  11. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    Science.gov (United States)

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  12. Role of Metal Oxides in Chemical Evolution: Interaction of Ribose Nucleotides with Alumina

    Science.gov (United States)

    Arora, Avnish Kumar; Kamaluddin

    2009-03-01

    Interaction of ribonucleotides—namely, 5‧-AMP, 5‧-GMP, 5‧-CMP, and 5‧-UMP—with acidic, neutral, and basic alumina has been studied. Purine nucleotides showed higher adsorption on alumina in comparison with pyrimidine nucleotides under acidic conditions. Adsorption data obtained followed Langmuir adsorption isotherm, and Xm and KL values were calculated. On the basis of infrared spectral studies of ribonucleotides, alumina, and ribonucleotide-alumina adducts, we propose that the nitrogen base and phosphate moiety of the ribonucleotides interact with the positive charge surface of alumina. Results of the present study may indicate the importance of alumina in concentrating organic molecules from dilute aqueous solutions in primeval seas in the course of chemical evolution on Earth.

  13. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  14. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  15. The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

    Science.gov (United States)

    Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

    2002-06-05

    The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

  16. Lack of nucleotide variability in a beetle pest with extreme inbreeding

    OpenAIRE

    Andreev, D.; Breilid, H.; Kirkendall, L.; Brun, Luc-Olivier; French-Constant, R.H.

    1998-01-01

    The coffee berry borer beetle #Hypothenemus hampei$ (Ferrari) (#Curculionidae$ : #Scolytinae$) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an usual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occuring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation i...

  17. Non-nucleotide Agonists Triggering P2X7 Receptor Activation and Pore Formation

    Directory of Open Access Journals (Sweden)

    Francesco Di Virgilio

    2018-02-01

    Full Text Available The P2X7 receptor (P2X7R is a ligand-gated plasma membrane ion channel belonging to the P2X receptor subfamily activated by extracellular nucleotides. General consensus holds that the physiological (and maybe the only agonist is ATP. However, scattered evidence generated over the last several years suggests that ATP might not be the only agonist, especially at inflammatory sites. Solid data show that NAD+ covalently modifies the P2X7R of mouse T lymphocytes, thus lowering the ATP threshold for activation. Other structurally unrelated agents have been reported to activate the P2X7R via a poorly understood mechanism of action: (a the antibiotic polymyxin B, possibly a positive allosteric P2X7R modulator, (b the bactericidal peptide LL-37, (c the amyloidogenic β peptide, and (d serum amyloid A. Some agents, such as Alu-RNA, have been suggested to activate the P2X7R acting on the intracellular N- or C-terminal domains. Mode of P2X7R activation by these non-nucleotide ligands is as yet unknown; however, these observations raise the intriguing question of how these different non-nucleotide ligands may co-operate with ATP at inflammatory or tumor sites. New information obtained from the cloning and characterization of the P2X7R from exotic mammalian species (e.g., giant panda and data from recent patch-clamp studies are strongly accelerating our understanding of P2X7R mode of operation, and may provide hints to the mechanism of activation of P2X7R by non-nucleotide ligands.

  18. Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

    Energy Technology Data Exchange (ETDEWEB)

    Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.

    2016-12-21

    Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.

  19. Calcium-dependent, cyclic nucleotide-independent steroidogenesis in the bovine placenta.

    OpenAIRE

    Shemesh, M; Hansel, W; Strauss, J F

    1984-01-01

    Dispersed bovine placental cells (fetal cotyledon and maternal caruncle) were shown to synthesize progesterone. To determine if their steroidogenic activity could be modulated by a cyclic nucleotide-mediated process, we added luteinizing hormone, 8-bromoadenosine 3',5'-monophosphate, 8-bromoguanosine 3',5'-monophosphate, adenosine, or cholera toxin to dispersed cells from placentomes of 100-283 days gestational age and examined progesterone synthesis during 3-to 16-hr incubation periods. Net ...

  20. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.