WorldWideScience

Sample records for enzyme encoding genes

  1. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  2. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  3. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  4. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  5. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  6. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  7. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  8. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  9. Enzymes and Enzyme Activity Encoded by Nonenveloped Viruses.

    Science.gov (United States)

    Azad, Kimi; Banerjee, Manidipa; Johnson, John E

    2017-09-29

    Viruses are obligate intracellular parasites that rely on host cell machineries for their replication and survival. Although viruses tend to make optimal use of the host cell protein repertoire, they need to encode essential enzymatic or effector functions that may not be available or accessible in the host cellular milieu. The enzymes encoded by nonenveloped viruses-a group of viruses that lack any lipid coating or envelope-play vital roles in all the stages of the viral life cycle. This review summarizes the structural, biochemical, and mechanistic information available for several classes of enzymes and autocatalytic activity encoded by nonenveloped viruses. Advances in research and development of antiviral inhibitors targeting specific viral enzymes are also highlighted.

  10. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-07-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  11. Impact of haloperidol and quetiapine on the expression of genes encoding antioxidant enzymes in human neuroblastoma SH-SY5Y cells.

    Science.gov (United States)

    Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip

    2009-05-01

    Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.

  12. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  13. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  14. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-01-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

  15. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  16. Using an Inducible Promoter of a Gene Encoding Penicillium verruculosum Glucoamylase for Production of Enzyme Preparations with Enhanced Cellulase Performance.

    Directory of Open Access Journals (Sweden)

    Alexander G Bulakhov

    Full Text Available Penicillium verruculosum is an efficient producer of highly active cellulase multienzyme system. One of the approaches for enhancing cellulase performance in hydrolysis of cellulosic substrates is to enrich the reaction system with β -glucosidase and/or accessory enzymes, such as lytic polysaccharide monooxygenases (LPMO displaying a synergism with cellulases.Genes bglI, encoding β-glucosidase from Aspergillus niger (AnBGL, and eglIV, encoding LPMO (formerly endoglucanase IV from Trichoderma reesei (TrLPMO, were cloned and expressed by P. verruculosum B1-537 strain under the control of the inducible gla1 gene promoter. Content of the heterologous AnBGL in the secreted multienzyme cocktails (hBGL1, hBGL2 and hBGL3 varied from 4 to 10% of the total protein, while the content of TrLPMO in the hLPMO sample was ~3%. The glucose yields in 48-h hydrolysis of Avicel and milled aspen wood by the hBGL1, hBGL2 and hBGL3 preparations increased by up to 99 and 80%, respectively, relative to control enzyme preparations without the heterologous AnBGL (at protein loading 5 mg/g substrate for all enzyme samples. The heterologous TrLPMO in the hLPMO preparation boosted the conversion of the lignocellulosic substrate by 10-43%; however, in hydrolysis of Avicel the hLPMO sample was less effective than the control preparations. The highest product yield in hydrolysis of aspen wood was obtained when the hBGL2 and hLPMO preparations were used at the ratio 1:1.The enzyme preparations produced by recombinant P. verruculosum strains, expressing the heterologous AnBGL or TrLPMO under the control of the gla1 gene promoter in a starch-containing medium, proved to be more effective in hydrolysis of a lignocellulosic substrate than control enzyme preparations without the heterologous enzymes. The enzyme composition containing both AnBGL and TrLPMO demonstrated the highest performance in lignocellulose hydrolysis, providing a background for developing a fungal strain capable

  17. Trypanosoma cruzi has not lost its S-adenosylmethionine decarboxylase: characterization of the gene and the encoded enzyme.

    Science.gov (United States)

    Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O

    1998-01-01

    All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309

  18. Fungi unearthed: transcripts encoding lignocellulolytic and chitinolytic enzymes in forest soil.

    Directory of Open Access Journals (Sweden)

    Harald Kellner

    Full Text Available BACKGROUND: Fungi are the main organisms responsible for the degradation of biopolymers such as lignin, cellulose, hemicellulose, and chitin in forest ecosystems. Soil surveys largely target fungal diversity, paying less attention to fungal activity. METHODOLOGY/PRINCIPAL FINDINGS: Here we have focused on the organic horizon of a hardwood forest dominated by sugar maple that spreads widely across Eastern North America. The sampling site included three plots receiving normal atmospheric nitrogen deposition and three that received an extra 3 g nitrogen m(2 y(1 in form of sodium nitrate pellets since 1994, which led to increased accumulation of organic matter in the soil. Our aim was to assess, in samples taken from all six plots, transcript-level expression of fungal genes encoding lignocellulolytic and chitinolytic enzymes. For this we collected RNA from the forest soil, reverse-transcribed it, and amplified cDNAs of interest, using both published primer pairs as well as 23 newly developed ones. We thus detected transcript-level expression of 234 genes putatively encoding 26 different groups of fungal enzymes, notably major ligninolytic and diverse aromatic-oxidizing enzymes, various cellulose- and hemicellulose-degrading glycoside hydrolases and carbohydrate esterases, enzymes involved in chitin breakdown, N-acetylglucosamine metabolism, and cell wall degradation. Among the genes identified, 125 are homologous to known ascomycete genes and 105 to basidiomycete genes. Transcripts corresponding to all 26 enzyme groups were detected in both control and nitrogen-supplemented plots. CONCLUSIONS/SIGNIFICANCE: Many of these enzyme groups are known to be important in soil turnover processes, but the contribution of some is probably underestimated. Our data highlight the importance of ascomycetes, as well as basidiomycetes, in important biogeochemical cycles. In the nitrogen-supplemented plots, we have detected no transcript-level gap likely to explain

  19. Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus

    Directory of Open Access Journals (Sweden)

    Ricardo Harakava

    2005-01-01

    Full Text Available Eucalyptus ESTs libraries were screened for genes involved in lignin biosynthesis. This search was performed under the perspective of recent revisions on the monolignols biosynthetic pathway. Eucalyptus orthologues of all genes of the phenylpropanoid pathway leading to lignin biosynthesis reported in other plant species were identified. A library made with mRNAs extracted from wood was enriched for genes involved in lignin biosynthesis and allowed to infer the isoforms of each gene family that play a major role in wood lignin formation. Analysis of the wood library suggests that, besides the enzymes of the phenylpropanoids pathway, chitinases, laccases, and dirigent proteins are also important for lignification. Colocalization of several enzymes on the endoplasmic reticulum membrane, as predicted by amino acid sequence analysis, supports the existence of metabolic channeling in the phenylpropanoid pathway. This study establishes a framework for future investigations on gene expression level, protein expression and enzymatic assays, sequence polymorphisms, and genetic engineering.

  20. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  1. MUREIN-METABOLIZING ENZYMES FROM ESCHERICHIA-COLI - SEQUENCE-ANALYSIS AND CONTROLLED OVEREXPRESSION OF THE SLT GENE, WHICH ENCODES THE SOLUBLE LYTIC TRANSGLYCOSYLASE

    NARCIS (Netherlands)

    ENGEL, H; KAZEMIER, B; KECK, W

    The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or

  2. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  3. Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

    Science.gov (United States)

    Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

    2017-10-01

    Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

  4. Multigene families encode the major enzymes of antioxidant metabolism in Eucalyptus grandis L

    Directory of Open Access Journals (Sweden)

    Felipe Karam Teixeira

    2005-01-01

    Full Text Available Antioxidant metabolism protects cells from oxidative damage caused by reactive oxygen species (ROS. In plants, several enzymes act jointly to maintain redox homeostasis. Moreover, isoform diversity contributes to the fine tuning necessary for plant responses to both exogenous and endogenous signals influencing antioxidant metabolism. This study aimed to provide a comprehensive view of the major classes of antioxidant enzymes in the woody species Eucalyptus grandis. A careful survey of the FORESTs data bank revealed 36 clusters as encoding antioxidant enzymes: six clusters encoding ascorbate peroxidase (APx isozymes, three catalase (CAT proteins, three dehydroascorbate reductase (DHAR, two glutathione reductase (GR isozymes, four monodehydroascorbate reductase (MDHAR, six phospholipid hydroperoxide glutathione peroxidases (PhGPx, and 12 encoding superoxide dismutases (SOD isozymes. Phylogenetic analysis demonstrated that all clusters (identified herein grouped with previously characterized antioxidant enzymes, corroborating the analysis performed. With respect to enzymes involved in the ascorbate-glutathione cycle, both cytosolic and chloroplastic isoforms were putatively identified. These sequences were widely distributed among the different ESTs libraries indicating a broad gene expression pattern. Overall, the data indicate the importance of antioxidant metabolism in eucalyptus.

  5. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  6. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  7. The evolutionary fate of the genes encoding the purine catabolic enzymes in hominoids, birds, and reptiles.

    Science.gov (United States)

    Keebaugh, Alaine C; Thomas, James W

    2010-06-01

    Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.

  8. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  9. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

    Science.gov (United States)

    Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

    1997-01-01

    The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

  10. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  11. A Ti plasmid-encoded enzyme required for degradation of mannopine is functionally homologous to the T-region-encoded enzyme required for synthesis of this opine in crown gall tumors.

    Science.gov (United States)

    Kim, K S; Chilton, W S; Farrand, S K

    1996-06-01

    The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasmid pAtC58. NT1 or UIA5 harboring pYDH208 with an insertion mutation in mocC failed to utilize MOP as the sole carbon source. Plasmid pSa-C, which encodes only mocC, complemented this mutation in both strains. This plasmid also was sufficient to confer utilization of MOP on NT1 but not on UIA5. Computer analysis showed that MocC is related at the amino acid sequence level to members of the short-chain alcohol dehydrogenase family of oxidoreductases. Lysates prepared from Escherichia coli cells expressing mocC contained an enzymatic activity that oxidizes MOP to deoxyfructosyl glutamine (santhopine [SOP]) in the presence of NAD+. The reaction catalyzed by the MOP oxidoreductase is reversible; in the presence of NADH, the enzyme reduced SOP to MOP. The apparent Km values of the enzyme for MOP and SOP were 6.3 and 1.2 mM, respectively. Among analogs of MOP tested, only N-1-(1-deoxy-D-lyxityl)-L-glutamine and N-1-(1-deoxy-D-mannityl)-L-asparagine served as substrates for MOP oxidoreductase. These results indicate that mocC encodes an oxidoreductase that, as an oxidase, is essential for the catabolism of MOP. The reductase activity of this enzyme is precisely the reaction ascribed to its T-region-encoded homolog, Mas1, which is responsible for biosynthesis of mannopine in crown gall tumors.

  12. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  13. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  14. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  15. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  16. Mutation of a Rice Gene Encoding a Phenylalanine Biosynthetic Enzyme Results in Accumulation of Phenylalanine and Tryptophan[W

    Science.gov (United States)

    Yamada, Tetsuya; Matsuda, Fumio; Kasai, Koji; Fukuoka, Shuichi; Kitamura, Keisuke; Tozawa, Yuzuru; Miyagawa, Hisashi; Wakasa, Kyo

    2008-01-01

    Two distinct biosynthetic pathways for Phe in plants have been proposed: conversion of prephenate to Phe via phenylpyruvate or arogenate. The reactions catalyzed by prephenate dehydratase (PDT) and arogenate dehydratase (ADT) contribute to these respective pathways. The Mtr1 mutant of rice (Oryza sativa) manifests accumulation of Phe, Trp, and several phenylpropanoids, suggesting a link between the synthesis of Phe and Trp. Here, we show that the Mtr1 mutant gene (mtr1-D) encodes a form of rice PDT with a point mutation in the putative allosteric regulatory region of the protein. Transformed callus lines expressing mtr1-D exhibited all the characteristics of Mtr1 callus tissue. Biochemical analysis revealed that rice PDT possesses both PDT and ADT activities, with a preference for arogenate as substrate, suggesting that it functions primarily as an ADT. The wild-type enzyme is feedback regulated by Phe, whereas the mutant enzyme showed a reduced feedback sensitivity, resulting in Phe accumulation. In addition, these observations indicate that rice PDT is critical for regulating the size of the Phe pool in plant cells. Feeding external Phe to wild-type callus tissue and seedlings resulted in Trp accumulation, demonstrating a connection between Phe accumulation and Trp pool size. PMID:18487352

  17. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  18. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  19. Cocaine Administration and Its Withdrawal Enhance the Expression of Genes Encoding Histone-Modifying Enzymes and Histone Acetylation in the Rat Prefrontal Cortex.

    Science.gov (United States)

    Sadakierska-Chudy, Anna; Frankowska, Małgorzata; Jastrzębska, Joanna; Wydra, Karolina; Miszkiel, Joanna; Sanak, Marek; Filip, Małgorzata

    2017-07-01

    Chronic exposure to cocaine, craving, and relapse are attributed to long-lasting changes in gene expression arising through epigenetic and transcriptional mechanisms. Although several brain regions are involved in these processes, the prefrontal cortex seems to play a crucial role not only in motivation and decision-making but also in extinction and seeking behavior. In this study, we applied cocaine self-administration and extinction training procedures in rats with a yoked triad to determine differentially expressed genes in prefrontal cortex. Microarray analysis showed significant upregulation of several genes encoding histone modification enzymes during early extinction training. Subsequent real-time PCR testing of these genes following cocaine self-administration or early (third day) and late (tenth day) extinction revealed elevated levels of their transcripts. Interestingly, we found the enrichment of Brd1 messenger RNA in rats self-administering cocaine that lasted until extinction training during cocaine withdrawal with concomitant increased acetylation of H3K9 and H4K8. However, despite elevated levels of methyl- and demethyltransferase-encoded transcripts, no changes in global di- and tri-methylation of histone H3 at lysine 4, 9, 27, and 79 were observed. Surprisingly, at the end of extinction training (10 days of cocaine withdrawal), most of the analyzed genes in the rats actively and passively administering cocaine returned to the control level. Together, the alterations identified in the rat prefrontal cortex may suggest enhanced chromatin remodeling and transcriptional activity induced by early cocaine abstinence; however, to know whether they are beneficial or not for the extinction of drug-seeking behavior, further in vivo evaluation is required.

  20. Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme.

    Science.gov (United States)

    Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M

    1999-07-01

    The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.

  1. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  2. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  3. Levels of Crotonaldehyde and 4-hydroxy-(E-2-nonenal and Expression of Genes Encoding Carbonyl-Scavenging Enzyme at Critical Node During Rice Seed Aging

    Directory of Open Access Journals (Sweden)

    Fu Shenzao

    2018-05-01

    Full Text Available Abstract:: The critical node (CN is an important stage during seed aging, which is related to effective genebank conservation. Previous studies have demonstrated that proteins undergo carbonylated modification at the CN in rice, indicating oxidative damage. However, the levels of reactive carbonyl species (RCS and the associated scavenging system at the CN are largely unknown. In this study, we optimized methods for the extraction and analysis of RCS from dry rice embryos. In order to acquire seeds at the CN, rice seeds were subjected to natural conditions for 7, 9, 11 and 13 months, and the seed germination rates were reduced to 90%, 82%, 71% and 57%, respectively. We chose the stage with seed germination rate of 82% as the CN according to the rice seed vigor loss curve. The levels of crotonaldehyde and 4-hydroxy-(E-2-nonenal (HNE were significantly increased at the CN. In addition, genes encoding carbonyl-scavenging enzyme, including OsALDHs and OsAKRs, were significantly down-regulated at the CN, and reductions in the expression of OsALDH2-2, OsALDH2-5, OsALDH3-4, OsALDH7, OsAKR1 and OsAKR2 in particular could be responsible for RCS accumulation. Thus, the accumulations of crotonaldehyde and HNE and down-regulation of genes encoding carbonyl-scavenging enzyme might be related to an accelerating loss of seed viability at the CN. Key words: carbonyl-scavenging system, reactive carbonyl species, seed aging, crotonaldehyde, critical node, rice storage

  4. Bioinformatic analysis reveals high diversity of bacterial genes for laccase-like enzymes.

    Directory of Open Access Journals (Sweden)

    Luka Ausec

    Full Text Available Fungal laccases have been used in various fields ranging from processes in wood and paper industries to environmental applications. Although a few bacterial laccases have been characterized in recent years, prokaryotes have largely been neglected as a source of novel enzymes, in part due to the lack of knowledge about the diversity and distribution of laccases within Bacteria. In this work genes for laccase-like enzymes were searched for in over 2,200 complete and draft bacterial genomes and four metagenomic datasets, using the custom profile Hidden Markov Models for two- and three-domain laccases. More than 1,200 putative genes for laccase-like enzymes were retrieved from chromosomes and plasmids of diverse bacteria. In 76% of the genes, signal peptides were predicted, indicating that these bacterial laccases may be exported from the cytoplasm, which contrasts with the current belief. Moreover, several examples of putatively horizontally transferred bacterial laccase genes were described. Many metagenomic sequences encoding fragments of laccase-like enzymes could not be phylogenetically assigned, indicating considerable novelty. Laccase-like genes were also found in anaerobic bacteria, autotrophs and alkaliphiles, thus opening new hypotheses regarding their ecological functions. Bacteria identified as carrying laccase genes represent potential sources for future biotechnological applications.

  5. Sugarcane expressed sequences tags (ESTs encoding enzymes involved in lignin biosynthesis pathways

    Directory of Open Access Journals (Sweden)

    Ramos Rose Lucia Braz

    2001-01-01

    Full Text Available Lignins are phenolic polymers found in the secondary wall of plant conductive systems where they play an important role by reducing the permeability of the cell wall to water. Lignins are also responsible for the rigidity of the cell wall and are involved in mechanisms of resistance to pathogens. The metabolic routes and enzymes involved in synthesis of lignins have been largely characterized and representative genes that encode enzymes involved in these processes have been cloned from several plant species. The synthesis of lignins is liked to the general metabolism of the phenylpropanoids in plants, having enzymes (e.g. phenylalanine ammonia-lyase (PAL, cinnamate 4-hydroxylase (C4H and caffeic acid O-methyltransferase (COMT common to other processes as well as specific enzymes such as cinnamoyl-CoA reductase (CCR and cinnamyl alcohol dehydrogenase (CAD. Some maize and sorghum mutants, shown to have defective in CAD and/or COMT activity, are easier to digest because they have a reduced lignin content, something which has motivated different research groups to alter the lignin content and composition of model plants by genetic engineering try to improve, for example, the efficiency of paper pulping and digestibility. In the work reported in this paper, we have made an inventory of the sugarcane expressed sequence tag (EST coding for enzymes involved in lignin metabolism which are present in the sugarcane EST genome project (SUCEST database. Our analysis focused on the key enzymes ferulate-5-hydroxylase (F5H, caffeic acid O-methyltransferase (COMT, caffeoyl CoA O-methyltransferase (CCoAOMT, hydroxycinnamate CoA ligase (4CL, cinnamoyl-CoA reductase (CCR and cinnamyl alcohol dehydrogenase (CAD. The comparative analysis of these genes with those described in other species could be used as molecular markers for breeding as well as for the manipulation of lignin metabolism in sugarcane.

  6. Partial Gene Cloning and Enzyme Structure Modeling of Exolevanase Fragment from Bacillus subtilis

    Science.gov (United States)

    Azhar, M.; Natalia, D.; Syukur, S.; Andriani, N.; Jamsari, J.

    2018-04-01

    Inulin hydrolysis thermophilic and thermotolerant bacteria are potential sources of inulin hydrolysis enzymes. Partial gene that encodes inulin hydrolysis enzymes had been isolated from Bacillus subtilis using polymerase chain reaction (PCR) method with the DPE.slFandDPE.eR degenerative primers. The partial gene was cloned into pGEM-T Easy vector with E. coli as host cells and analyzed using BLASTx, CrustalW2, and Phyre2 programs. Size of thepartial gene had been found539 bp that encoded 179aminoacid residues of protein fragment. The sequences of protein fragment was more similar to exolevanase than exoinulinase. The protein fragment had conserved motif FSGS, and specific hits GH32 β-fructosidase. It had three residues of active site and five residues of substrate binding. The active site on the protein fragment were D (1-WLNDP-5), D (125-FRDPK-129) and E (177-WEC-179). Substrate binding on the protein fragment were ND (1-WLNDP-5), Q (18-FYQY-21), FS (60-FSGS-63) RD (125-FRDPK-129) and E (177-WEC-179).

  7. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  8. Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

    Science.gov (United States)

    Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

    2016-09-01

    Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.

  9. Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

    Directory of Open Access Journals (Sweden)

    DEWI FITRIANI

    2010-06-01

    Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

  10. Molecular evolution of nitrogen assimilatory enzymes in marine prasinophytes.

    Science.gov (United States)

    Ghoshroy, Sohini; Robertson, Deborah L

    2015-01-01

    Nitrogen assimilation is a highly regulated process requiring metabolic coordination of enzymes and pathways in the cytosol, chloroplast, and mitochondria. Previous studies of prasinophyte genomes revealed that genes encoding nitrate and ammonium transporters have a complex evolutionary history involving both vertical and horizontal transmission. Here we examine the evolutionary history of well-conserved nitrogen-assimilating enzymes to determine if a similar complex history is observed. Phylogenetic analyses suggest that genes encoding glutamine synthetase (GS) III in the prasinophytes evolved by horizontal gene transfer from a member of the heterokonts. In contrast, genes encoding GSIIE, a canonical vascular plant and green algal enzyme, were found in the Micromonas genomes but have been lost from Ostreococcus. Phylogenetic analyses placed the Micromonas GSIIs in a larger chlorophyte/vascular plant clade; a similar topology was observed for ferredoxin-dependent nitrite reductase (Fd-NiR), indicating the genes encoding GSII and Fd-NiR in these prasinophytes evolved via vertical transmission. Our results show that genes encoding the nitrogen-assimilating enzymes in Micromonas and Ostreococcus have been differentially lost and as well as recruited from different evolutionary lineages, suggesting that the regulation of nitrogen assimilation in prasinophytes will differ from other green algae.

  11. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    Science.gov (United States)

    Pyne, C; Bognar, A L

    1992-03-01

    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  12. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  13. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  14. The variability of sesquiterpenes emitted from two Zea mays cultivars is controlled by allelic variation of two terpene synthase genes encoding stereoselective multiple product enzymes.

    Science.gov (United States)

    Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg

    2004-05-01

    The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.

  15. Frequent and recent retrotransposition of orthologous genes plays a role in the evolution of sperm glycolytic enzymes

    Directory of Open Access Journals (Sweden)

    de Villena Fernando

    2010-05-01

    Full Text Available Abstract Background The central metabolic pathway of glycolysis converts glucose to pyruvate, with the net production of 2 ATP and 2 NADH per glucose molecule. Each of the ten reactions in this pathway is typically catalyzed by multiple isozymes encoded by a multigene family. Several isozymes in this pathway are expressed only during spermatogenesis, and gene targeting studies indicate that they are essential for sperm function and male fertility in mouse. At least three of the novel glycolytic isozymes are encoded by retrogenes (Pgk2, Aldoart1, and Aldoart2. Their restricted expression profile suggests that retrotransposition may play a significant role in the evolution of sperm glycolytic enzymes. Results We conducted a comprehensive genomic analysis of glycolytic enzymes in the human and mouse genomes and identified several intronless copies for all enzymes in the pathway, except Pfk. Within each gene family, a single orthologous gene was typically retrotransposed frequently and independently in both species. Several retroposed sequences maintained open reading frames (ORFs and/or provided evidence of alternatively spliced exons. We analyzed expression of sequences with ORFs and Gpi1 transcript in mouse spermatogenic cells. Conclusions Our analysis detected frequent, recent, and lineage-specific retrotransposition of orthologous glycolytic enzymes in the human and mouse genomes. Retrotransposition events are associated with LINE/LTR and genomic integration is random. We found evidence for the alternative splicing of parent genes. Many retroposed sequences have maintained ORFs, suggesting a functional role for these genes.

  16. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  17. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  18. Concerted suppression of all starch branching enzyme genes in barley produces amylose-only starch granules

    DEFF Research Database (Denmark)

    Carciofi, Massimiliano; Blennow, Per Gunnar Andreas; Jensen, Susanne Langgård

    2012-01-01

    is preferentially derived from amylose, which can be increased by suppressing amylopectin synthesis by silencing of starch branching enzymes (SBEs). However all the previous works attempting the production of high RS crops resulted in only partly increased amylose-content and/or significant yield loss. Results...... In this study we invented a new method for silencing of multiple genes. Using a chimeric RNAi hairpin we simultaneously suppressed all genes coding for starch branching enzymes (SBE I, SBE IIa, SBE IIb) in barley (Hordeum vulgare L.), resulting in production of amylose-only starch granules in the endosperm...... yield in a living organism. This was achieved by a new method of simultaneous suppression of the entire complement of genes encoding starch branching enzymes. We demonstrate that amylopectin is not essential for starch granule crystallinity and integrity. However the slower initial growth of shoots from...

  19. Assembly and multiple gene expression of thermophilic enzymes in Escherichia coli for in vitro metabolic engineering.

    Science.gov (United States)

    Ninh, Pham Huynh; Honda, Kohsuke; Sakai, Takaaki; Okano, Kenji; Ohtake, Hisao

    2015-01-01

    In vitro reconstitution of an artificial metabolic pathway is an emerging approach for the biocatalytic production of industrial chemicals. However, several enzymes have to be separately prepared (and purified) for the construction of an in vitro metabolic pathway, thereby limiting the practical applicability of this approach. In this study, genes encoding the nine thermophilic enzymes involved in a non-ATP-forming chimeric glycolytic pathway were assembled in an artificial operon and co-expressed in a single recombinant Escherichia coli strain. Gene expression levels of the thermophilic enzymes were controlled by their sequential order in the artificial operon. The specific activities of the recombinant enzymes in the cell-free extract of the multiple-gene-expression E. coli were 5.0-1,370 times higher than those in an enzyme cocktail prepared from a mixture of single-gene-expression strains, in each of which a single one of the nine thermophilic enzymes was overproduced. Heat treatment of a crude extract of the multiple-gene-expression cells led to the denaturation of indigenous proteins and one-step preparation of an in vitro synthetic pathway comprising only a limited number of thermotolerant enzymes. Coupling this in vitro pathway with other thermophilic enzymes including the H2 O-forming NADH oxidase or the malate/lactate dehydrogenase facilitated one-pot conversion of glucose to pyruvate or lactate, respectively. © 2014 Wiley Periodicals, Inc.

  20. THE CALVIN CYCLE ENZYME PHOSPHOGLYCERATE KINASE OF XANTHOBACTER-FLAVUS REQUIRED FOR AUTOTROPHIC CO2 FIXATION IS NOT ENCODED BY THE CBB OPERON

    NARCIS (Netherlands)

    MEIJER, WG

    1994-01-01

    During autotrophic growth of Xanthobacter flavus, energy derived from the oxidation of hydrogen methanol or formate is used to drive the assimilation of CO2 via the Calvin cycle. The genes encoding the Calvin cycle enzymes are organized in the cbb operon, which is expressed only during autotrophic

  1. Massive lateral transfer of genes encoding plant cell wall-degrading enzymes to the mycoparasitic fungus Trichoderma from its plant-associated hosts

    Science.gov (United States)

    Chenthamara, Komal; Zhang, Jian; Atanasova, Lea; Yang, Dongqing; Miao, Youzhi; Grujic, Marica; Pourmehdi, Shadi; Pretzer, Carina; Kopchinskiy, Alexey G.; Hundley, Hope; Wang, Mei; Aerts, Andrea; Salamov, Asaf; Lipzen, Anna; Barry, Kerrie; Grigoriev, Igor V.; Shen, Qirong; Kubicek, Christian P.

    2018-01-01

    Unlike most other fungi, molds of the genus Trichoderma (Hypocreales, Ascomycota) are aggressive parasites of other fungi and efficient decomposers of plant biomass. Although nutritional shifts are common among hypocrealean fungi, there are no examples of such broad substrate versatility as that observed in Trichoderma. A phylogenomic analysis of 23 hypocrealean fungi (including nine Trichoderma spp. and the related Escovopsis weberi) revealed that the genus Trichoderma has evolved from an ancestor with limited cellulolytic capability that fed on either fungi or arthropods. The evolutionary analysis of Trichoderma genes encoding plant cell wall-degrading carbohydrate-active enzymes and auxiliary proteins (pcwdCAZome, 122 gene families) based on a gene tree / species tree reconciliation demonstrated that the formation of the genus was accompanied by an unprecedented extent of lateral gene transfer (LGT). Nearly one-half of the genes in Trichoderma pcwdCAZome (41%) were obtained via LGT from plant-associated filamentous fungi belonging to different classes of Ascomycota, while no LGT was observed from other potential donors. In addition to the ability to feed on unrelated fungi (such as Basidiomycota), we also showed that Trichoderma is capable of endoparasitism on a broad range of Ascomycota, including extant LGT donors. This phenomenon was not observed in E. weberi and rarely in other mycoparasitic hypocrealean fungi. Thus, our study suggests that LGT is linked to the ability of Trichoderma to parasitize taxonomically related fungi (up to adelphoparasitism in strict sense). This may have allowed primarily mycotrophic Trichoderma fungi to evolve into decomposers of plant biomass. PMID:29630596

  2. Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures.

    Directory of Open Access Journals (Sweden)

    Senta Heiss-Blanquet

    Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.

  3. The association between angiotensin-converting enzyme gene polymorphism and coronary calcification - The Rotterdam Coronary Calcification Study

    NARCIS (Netherlands)

    Oei, HHS; Sayed-Tabatabaei, FA; Hofman, A; Oudkerk, M; van Duijn, CM; Witteman, JCM

    Background: An insertion/deletion (I/D) polymorphism in the gene encoding angiotensin-converting enzyme (ACE) has been associated with serum ACE levels. The association between the ACE I/D polymorphism and coronary heart disease is unclear. Electron-beam-computed tomography (EBT) is a technique to

  4. Identification of Genes Coding Aminoglycoside Modifying Enzymes in E. coli of UTI Patients in India

    Directory of Open Access Journals (Sweden)

    Abdul Rouf Mir

    2016-01-01

    Full Text Available This study is to probe the pattern of antibiotic resistance against aminoglycosides and its mechanism in E. coli obtained from patients from Chennai, India. Isolation and identification of pathogens were done on MacConkey agar. Antimicrobial sensitivity testing was done by disc diffusion test. The identification of genes encoding aminoglycoside modifying enzymes was done by Polymerase Chain Reaction (PCR. Out of 98 isolates, 71 (72.45% isolates were identified as E. coli and the remaining 27 (27.55% as other bacteria. Disc diffusion method results showed a resistance level of 72.15% for streptomycin, 73.4% for gentamicin, 63.26% for neomycin, 57.14% for tobramycin, 47.9% for netilmicin, and 8.16% for amikacin in E. coli. PCR screening showed the presence of four genes, namely, rrs, aacC2, aacA-aphD, and aphA3, in their plasmid DNA. The results point towards the novel mechanism of drug resistance in E. coli from UTI patients in India as they confirm the presence of genes encoding enzymes that cause resistance to aminoglycoside drugs. This could be an alarm for drug prescription to UTI patients.

  5. Identification of Genes Coding Aminoglycoside Modifying Enzymes in E. coli of UTI Patients in India.

    Science.gov (United States)

    Mir, Abdul Rouf; Bashir, Yasir; Dar, Firdous Ahmad; Sekhar, M

    This study is to probe the pattern of antibiotic resistance against aminoglycosides and its mechanism in E. coli obtained from patients from Chennai, India. Isolation and identification of pathogens were done on MacConkey agar. Antimicrobial sensitivity testing was done by disc diffusion test. The identification of genes encoding aminoglycoside modifying enzymes was done by Polymerase Chain Reaction (PCR). Out of 98 isolates, 71 (72.45%) isolates were identified as E. coli and the remaining 27 (27.55%) as other bacteria. Disc diffusion method results showed a resistance level of 72.15% for streptomycin, 73.4% for gentamicin, 63.26% for neomycin, 57.14% for tobramycin, 47.9% for netilmicin, and 8.16% for amikacin in E. coli. PCR screening showed the presence of four genes, namely, rrs, aacC2, aacA-aphD, and aphA3, in their plasmid DNA. The results point towards the novel mechanism of drug resistance in E. coli from UTI patients in India as they confirm the presence of genes encoding enzymes that cause resistance to aminoglycoside drugs. This could be an alarm for drug prescription to UTI patients.

  6. Distribution and biosynthesis of flavan-3-ols in Camellia sinensis seedlings and expression of genes encoding biosynthetic enzymes.

    Science.gov (United States)

    Ashihara, Hiroshi; Deng, Wei-Wei; Mullen, William; Crozier, Alan

    2010-04-01

    The distribution of phenolic compounds in young and developing leaves, stems, main and lateral roots and cotyledons of 8-week-old tea (Camellia sinensis) seedlings was investigated using HPLC-MS(2). Fourteen compounds, flavan-3-ols, chlorogenic acids, and kaempferol-O-glycosides, were identified on the basis of their retention time, absorbance spectrum, and MS fragmentation pattern. The major phenolics were (-)-epigallocatechin-3-O-gallate and (-)-epicatechin-3-O-gallate, located principally in the green parts of the seedlings. Considerable amounts of radioactivity from [ring-(14)C]phenylalanine were incorporated in (-)-epicatechin, (-)-epigallocatechin, (-)-epicatechin-3-O-gallate and (-)-epigallocatechin-3-O-gallate, by tissues of young and developing leaves and stems. Expression of genes encoding enzymes involved in flavan-3-ol biosynthesis, CHS, CHI, F3H, F3'5'H, DFR, ANS, ANR and LAR was investigated. Transcripts of all genes, except LAR, were more abundant in leaves and stems than in roots and cotyledons. No significant difference was found in the amount of transcript of LAR. These findings indicate that in tea seedlings flavan-3-ols are produced by a naringenin-chalcone-->naringenin-->dihydrokaempferol pathway. Dihydrokaempferol is a branch point in the synthesis of (-)-epigallocatechin-3-O-gallate and other flavan-3-ols which can be formed by routes beginning with either a flavonoid 3'-hydroxylase mediated conversion of the flavonol to dihydroquercetin or a flavonoid 3',5'-hydroxylase-catalysed conversion to dihydromyricetin with subsequent steps involving sequential reactions catalysed by dihydroflavanol 4-reductase, anthocyanidin synthase, anthocyanidin reductase and flavan-3-ol gallate synthase. Copyright 2010 Elsevier Ltd. All rights reserved.

  7. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  8. Gene cloning and overexpression of two conjugated polyketone reductases, novel aldo-keto reductase family enzymes, of Candida parapsilosis.

    Science.gov (United States)

    Kataoka, M; Delacruz-Hidalgo, A-R G; Akond, M A; Sakuradani, E; Kita, K; Shimizu, S

    2004-04-01

    The genes encoding two conjugated polyketone reductases (CPR-C1, CPR-C2) of Candida parapsilosis IFO 0708 were cloned and sequenced. The genes encoded a total of 304 and 307 amino acid residues for CPR-C1 and CPR-C2, respectively. The deduced amino acid sequences of the two enzymes showed high similarity to each other and to several proteins of the aldo-keto reductase (AKR) superfamily. However, several amino acid residues in putative active sites of AKRs were not conserved in CPR-C1 and CPR-C2. The two CPR genes were overexpressed in Escherichia coli. The E. coli transformant bearing the CPR-C2 gene almost stoichiometrically reduced 30 mg ketopantoyl lactone/ml to D-pantoyl lactone.

  9. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  10. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

    Science.gov (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

    2016-10-01

    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  11. Transcriptional regulation of genes encoding ABA metabolism enzymes during the fruit development and dehydration stress of pear 'Gold Nijisseiki'.

    Science.gov (United States)

    Dai, Shengjie; Li, Ping; Chen, Pei; Li, Qian; Pei, Yuelin; He, Suihuan; Sun, Yufei; Wang, Ya; Kai, Wenbin; Zhao, Bo; Liao, Yalan; Leng, Ping

    2014-09-01

    To investigate the contribution of abscisic acid (ABA) in pear 'Gold Nijisseiki' during fruit ripening and under dehydration stress, two cDNAs (PpNCED1 and PpNCED2) which encode 9-cis-epoxycarotenoid dioxygenase (NCED) (a key enzyme in ABA biosynthesis), two cDNAs (PpCYP707A1 and PpCYP707A2) which encode 8'-hydroxylase (a key enzyme in the oxidative catabolism of ABA), one cDNA (PpACS3) which encodes 1-aminocyclopropane-1-carboxylic acid (ACC), and one cDNA (PpACO1) which encodes ACC oxidase involved in ethylene biosynthesis were cloned from 'Gold Nijisseiki' fruit. In the pulp, peel and seed, expressions of PpNCED1 and PpNCED2 rose in two stages which corresponded with the increase of ABA levels. The expression of PpCYP707A1 dramatically declined after 60-90 days after full bloom (DAFB) in contrast to the changes of ABA levels during this period, while PpCYP707A2 stayed low during the whole development of fruit. Application of exogenous ABA at 100 DAFB increased the soluble sugar content and the ethylene release but significantly decreased the titratable acid and chlorophyll contents in fruits. When fruits harvested at 100 DAFB were stored in the laboratory (25 °C, 50% relative humidity), the ABA content and the expressions of PpNCED1/2 and PpCYP707A1 in the pulp, peel and seed increased significantly, while ethylene reached its highest value after the maximum peak of ABA accompanied with the expressions of PpACS3 and PpACO1. In sum the endogenous ABA may play an important role in the fruit ripening and dehydration of pear 'Gold Nijisseiki' and the ABA level was regulated mainly by the dynamics of PpNCED1, PpNCED2 and PpCYP707A1 at the transcriptional level. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  12. Gene Directed Enzyme Prodrug Therapy Using Rabbit Cytochrome P450 4B1 in Murine Colon Adenocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Joo; Kang, Joo Hyun; Lee, Tae Sup; Kim, Kyeong Min; Woo, Kwang Sun; Chung, Wee Sup; Cheon, Gi Jeong; Choi, Chang Woon; Lim, Sang Moo [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2007-07-01

    The conventional cancer therapy is chemotherapy, surgical resection and/or radiotherapy. Chemotherapy using cytotoxic drug has some problems with lack of tumor selectivity resulting in toxicity to normal tissues. To enhance the tumor selectivity of cytotoxic drug, the application of suicidal gene therapy technology was designed. Suicidal gene therapy is based on the expression in tumor cells of a gene encoding an enzyme that converts a non-toxic prodrug into a cytotoxic product. Representative suicidal genes are Herpes simplex virus type 1 thymidine kinase (HSV1- tk) and cytosine deaminase (cd). Recently, a new prodrug-converting enzyme based on rabbit cytochrome P450 4B1 gene (cyp4B1) has been reported for therapy of experimental brain tumor. This enzyme activates the prodrugs such as 4-ipomeanol (4-IM) and 2- aminoanthracene (2-AA) to highly reactive furane epoxide and unsaturated dialdehyde intermediate, respectively. DNA alkylation seems to be the main mechanism of cytotoxicity of these activated drugs. In this study, we isolated cyp4B1 cDNA from rabbit lung, transduced cyp4B1 expression vector into murine colon cancer cell, and then analyzed the cytotoxic properties of cyp4b1-activated 2-AA in cyp4B1 transduced cells to verify the cyp4B1 enzyme system for gene directed enzyme prodrug therapy.

  13. Gene Directed Enzyme Prodrug Therapy Using Rabbit Cytochrome P450 4B1 in Murine Colon Adenocarcinoma

    International Nuclear Information System (INIS)

    Kim, Sung Joo; Kang, Joo Hyun; Lee, Tae Sup; Kim, Kyeong Min; Woo, Kwang Sun; Chung, Wee Sup; Cheon, Gi Jeong; Choi, Chang Woon; Lim, Sang Moo

    2007-01-01

    The conventional cancer therapy is chemotherapy, surgical resection and/or radiotherapy. Chemotherapy using cytotoxic drug has some problems with lack of tumor selectivity resulting in toxicity to normal tissues. To enhance the tumor selectivity of cytotoxic drug, the application of suicidal gene therapy technology was designed. Suicidal gene therapy is based on the expression in tumor cells of a gene encoding an enzyme that converts a non-toxic prodrug into a cytotoxic product. Representative suicidal genes are Herpes simplex virus type 1 thymidine kinase (HSV1- tk) and cytosine deaminase (cd). Recently, a new prodrug-converting enzyme based on rabbit cytochrome P450 4B1 gene (cyp4B1) has been reported for therapy of experimental brain tumor. This enzyme activates the prodrugs such as 4-ipomeanol (4-IM) and 2- aminoanthracene (2-AA) to highly reactive furane epoxide and unsaturated dialdehyde intermediate, respectively. DNA alkylation seems to be the main mechanism of cytotoxicity of these activated drugs. In this study, we isolated cyp4B1 cDNA from rabbit lung, transduced cyp4B1 expression vector into murine colon cancer cell, and then analyzed the cytotoxic properties of cyp4b1-activated 2-AA in cyp4B1 transduced cells to verify the cyp4B1 enzyme system for gene directed enzyme prodrug therapy

  14. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  15. A young root-specific gene (ArMY2) from horseradish encoding a MYR II myrosinase with kinetic preference for the root-specific glucosinolate gluconasturtiin.

    Science.gov (United States)

    Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang

    2014-03-01

    The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them

    Science.gov (United States)

    Gray, Kevin A [San Diego, CA; Zhao, Lishan [Emeryville, CA; Cayouette, Michelle H [San Diego, CA

    2012-01-24

    The invention provides polypeptides having any cellulolytic activity, e.g., a cellulase activity, a endoglucanase, a cellobiohydrolase, a beta-glucosidase, a xylanase, a mannanse, a .beta.-xylosidase, an arabinofuranosidase, and/or an oligomerase activity, polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. In one aspect, the invention provides polypeptides having an oligomerase activity, e.g., enzymes that convert recalcitrant soluble oligomers to fermentable sugars in the saccharification of biomass. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  17. Prediction of novel archaeal enzymes from sequence-derived features

    DEFF Research Database (Denmark)

    Jensen, Lars Juhl; Skovgaard, Marie; Brunak, Søren

    2002-01-01

    The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http://www.cbs.dtu.dk/......The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http......://www.cbs.dtu.dk/services/ArchaeaFun/). The method does not make use of sequence similarity; rather, it relies on predicted protein features like cotranslational and posttranslational modifications, secondary structure, and simple physical/chemical properties....

  18. Circadian oscillation of starch branching enzyme gene expression in the sorghum endosperm

    Energy Technology Data Exchange (ETDEWEB)

    Mutisya, J.; Sun, C.; Jansson, C.

    2009-08-31

    Expression of the three SBE genes, encoding starch branching enzymes, in the sorghum endosperm exhibited a diurnal rhythm during a 24-h cycle. Remarkably, the oscillation in SBE expression was maintained in cultured spikes after a 48-h dark treatment, also when fed a continuous solution of sucrose or abscisic acid. Our findings suggest that the rhythmicity in SBE expression in the endosperm is independent of cues from the photosynthetic source and that the oscillator resides within the endosperm itself.

  19. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  20. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  1. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

    OpenAIRE

    Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

    2007-01-01

    Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

  2. NUCLEOTIDE SEQUENCING AND TRANSCRIPTIONAL MAPPING OF THE GENES ENCODING BIPHENYL DIOXYGENASE, A MULTICOM- PONENT POLYCHLORINATED-BIPHENYL-DEGRADING ENZYME IN PSEUDOMONAS STRAIN LB400

    Science.gov (United States)

    The DNA region encoding biphenyl dioxygenase, the first enzyme in the biphenyl-polychlorinated biphenyl degradation pathway of Pseudomonas species strain LB400, was sequenced. Six open reading frames were identified, four of which are homologous to the components of toluene dioxy...

  3. Diversity of Ligninolytic Enzymes and Their Genes in Strains of the Genus Ganoderma: Applicable for Biodegradation of Xenobiotic Compounds?

    Directory of Open Access Journals (Sweden)

    Giselle Torres-Farradá

    2017-05-01

    Full Text Available White-rot fungi (WRF and their ligninolytic enzymes (laccases and peroxidases are considered promising biotechnological tools to remove lignin related Persistent Organic Pollutants from industrial wastewaters and contaminated ecosystems. A high diversity of the genus Ganoderma has been reported in Cuba; in spite of this, the diversity of ligninolytic enzymes and their genes remained unexplored. In this study, 13 native WRF strains were isolated from decayed wood in urban ecosystems in Havana (Cuba. All strains were identified as Ganoderma sp. using a multiplex polymerase chain reaction (PCR-method based on ITS sequences. All Ganoderma sp. strains produced laccase enzymes at higher levels than non-specific peroxidases. Native-PAGE of extracellular enzymatic extracts revealed a high diversity of laccase isozymes patterns between the strains, suggesting the presence of different amino acid sequences in the laccase enzymes produced by these Ganoderma strains. We determined the diversity of genes encoding laccases and peroxidases using a PCR and cloning approach with basidiomycete-specific primers. Between two and five laccase genes were detected in each strain. In contrast, only one gene encoding manganese peroxidase or versatile peroxidase was detected in each strain. The translated laccases and peroxidases amino acid sequences have not been described before. Extracellular crude enzymatic extracts produced by the Ganoderma UH strains, were able to degrade model chromophoric compounds such as anthraquinone and azo dyes. These findings hold promises for the development of a practical application for the treatment of textile industry wastewaters and also for bioremediation of polluted ecosystems by well-adapted native WRF strains.

  4. Diversity of Ligninolytic Enzymes and Their Genes in Strains of the Genus Ganoderma: Applicable for Biodegradation of Xenobiotic Compounds?

    Science.gov (United States)

    Torres-Farradá, Giselle; Manzano León, Ana M.; Rineau, François; Ledo Alonso, Lucía L.; Sánchez-López, María I.; Thijs, Sofie; Colpaert, Jan; Ramos-Leal, Miguel; Guerra, Gilda; Vangronsveld, Jaco

    2017-01-01

    White-rot fungi (WRF) and their ligninolytic enzymes (laccases and peroxidases) are considered promising biotechnological tools to remove lignin related Persistent Organic Pollutants from industrial wastewaters and contaminated ecosystems. A high diversity of the genus Ganoderma has been reported in Cuba; in spite of this, the diversity of ligninolytic enzymes and their genes remained unexplored. In this study, 13 native WRF strains were isolated from decayed wood in urban ecosystems in Havana (Cuba). All strains were identified as Ganoderma sp. using a multiplex polymerase chain reaction (PCR)-method based on ITS sequences. All Ganoderma sp. strains produced laccase enzymes at higher levels than non-specific peroxidases. Native-PAGE of extracellular enzymatic extracts revealed a high diversity of laccase isozymes patterns between the strains, suggesting the presence of different amino acid sequences in the laccase enzymes produced by these Ganoderma strains. We determined the diversity of genes encoding laccases and peroxidases using a PCR and cloning approach with basidiomycete-specific primers. Between two and five laccase genes were detected in each strain. In contrast, only one gene encoding manganese peroxidase or versatile peroxidase was detected in each strain. The translated laccases and peroxidases amino acid sequences have not been described before. Extracellular crude enzymatic extracts produced by the Ganoderma UH strains, were able to degrade model chromophoric compounds such as anthraquinone and azo dyes. These findings hold promises for the development of a practical application for the treatment of textile industry wastewaters and also for bioremediation of polluted ecosystems by well-adapted native WRF strains. PMID:28588565

  5. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  6. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  7. Celluloytic enzymes, nucleic acids encoding them and methods for making and using them

    Energy Technology Data Exchange (ETDEWEB)

    Gray, Kevin A; Zhao, Lishan; Cayouette, Michelle H

    2015-11-04

    The invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  8. Celluloytic enzymes, nucleic acids encoding them and methods for making and using them

    Science.gov (United States)

    Gray, Kevin A.; Zhao, Lishan; Cayouette, Michelle H.

    2015-09-08

    The invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  9. aguA, the gene encoding an extracellular alpha-glucuronidase from Aspergillus tubingensis, is specifically induced on xylose and not on glucuronic acid.

    Science.gov (United States)

    de Vries, R P; Poulsen, C H; Madrid, S; Visser, J

    1998-01-01

    An extracellular alpha-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70 degrees C. The alpha-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and beta-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this alpha-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and alpha-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose.

  10. aguA, the Gene Encoding an Extracellular α-Glucuronidase from Aspergillus tubingensis, Is Specifically Induced on Xylose and Not on Glucuronic Acid

    Science.gov (United States)

    de Vries, Ronald P.; Poulsen, Charlotte H.; Madrid, Susan; Visser, Jaap

    1998-01-01

    An extracellular α-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70°C. The α-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and β-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this α-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and α-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose. PMID:9440512

  11. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    Directory of Open Access Journals (Sweden)

    Royah Vaezi

    2013-12-01

    Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

  12. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  13. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds.

    Science.gov (United States)

    de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap

    2002-04-15

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.

  14. Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

    Science.gov (United States)

    Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

    2009-02-27

    All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

  15. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  16. A novel gene encoding xanthan lyase of Paenibacillus alginolyticus strain XL-1

    NARCIS (Netherlands)

    Ruijssenaars, H.J.; Hartmans, S.; Verdoes, J.C.

    2000-01-01

    Xanthan-modifying enzymes are powerful tools in studying structure-function relationships of this polysaccharide. One of these modifying enzymes is xanthan lyase, which removes the terminal side chain residue of xanthan. In this paper, the cloning and sequencing of the first xanthan lyase-encoding

  17. Expression of Genes Encoding Enzymes Involved in the One Carbon Cycle in Rat Placenta is Determined by Maternal Micronutrients (Folic Acid, Vitamin B12 and Omega-3 Fatty Acids

    Directory of Open Access Journals (Sweden)

    Vinita Khot

    2014-01-01

    Full Text Available We have reported that folic acid, vitamin B12, and omega-3 fatty acids are interlinked in the one carbon cycle and have implications for fetal programming. Our earlier studies demonstrate that an imbalance in maternal micronutrients influence long chain polyunsaturated fatty acid metabolism and global methylation in rat placenta. We hypothesize that these changes are mediated through micronutrient dependent regulation of enzymes in one carbon cycle. Pregnant dams were assigned to six dietary groups with varying folic acid and vitamin B12 levels. Vitamin B12 deficient groups were supplemented with omega-3 fatty acid. Placental mRNA levels of enzymes, levels of phospholipids, and glutathione were determined. Results suggest that maternal micronutrient imbalance (excess folic acid with vitamin B12 deficiency leads to lower mRNA levels of methylene tetrahydrofolate reductase (MTHFR and methionine synthase , but higher cystathionine b-synthase (CBS and Phosphatidylethanolamine-N-methyltransferase (PEMT as compared to control. Omega-3 supplementation normalized CBS and MTHFR mRNA levels. Increased placental phosphatidylethanolamine (PE, phosphatidylcholine (PC, in the same group was also observed. Our data suggests that adverse effects of a maternal micronutrient imbalanced diet may be due to differential regulation of key genes encoding enzymes in one carbon cycle and omega-3 supplementation may ameliorate most of these changes.

  18. Phosphoribosylpyrophosphate synthetase of Escherichia coli. Properties of the purified enzyme and primary structure of the prs gene

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Harlow, Kenneth W.; King, Cheryl J.

    1986-01-01

    of ADP. The nucleotide sequence of the E. coli prs gene has been determined and the coding segment established. The deduced amino acid sequence of P-Rib-PP synthetase contained 314 amino acid residues and the molecular weight was calculated as 34,060. The initiation site of transcription was determined......Phosphoribosylpyrophosphate (P-Rib-PP) synthetase of Escherichia coli has been purified to near homogeneity from a strain harboring the prs gene, encoding P-Rib-PP synthetase, on a multicopy plasmid. Analysis of the enzyme showed that it required inorganic phosphate for activity and for stability...

  19. Antioxidant-rich leaf extract of Barringtonia racemosa significantly alters the in vitro expression of genes encoding enzymes that are involved in methylglyoxal degradation III

    Directory of Open Access Journals (Sweden)

    Kin Weng Kong

    2016-08-01

    Full Text Available Background Barringtonia racemosa is a medicinal plant belonging to the Lecythidaceae family. The water extract of B. racemosa leaf (BLE has been shown to be rich in polyphenols. Despite the diverse medicinal properties of B. racemosa, information on its major biological effects and the underlying molecular mechanisms are still lacking. Methods In this study, the effect of the antioxidant-rich BLE on gene expression in HepG2 cells was investigated using microarray analysis in order to shed more light on the molecular mechanism associated with the medicinal properties of the plant. Results Microarray analysis showed that a total of 138 genes were significantly altered in response to BLE treatment (p < 0.05 with a fold change difference of at least 1.5. SERPINE1 was the most significantly up-regulated gene at 2.8-fold while HAMP was the most significantly down-regulated gene at 6.5-fold. Ingenuity Pathways Analysis (IPA revealed that “Cancer, cell death and survival, cellular movement” was the top network affected by the BLE with a score of 44. The top five canonical pathways associated with BLE were Methylglyoxal Degradation III followed by VDR/RXR activation, TR/RXR activation, PXR/RXR activation and gluconeogenesis. The expression of genes that encode for enzymes involved in methylglyoxal degradation (ADH4, AKR1B10 and AKR1C2 and glycolytic process (ENO3, ALDOC and SLC2A1 was significantly regulated. Owing to the Warburg effect, aerobic glycolysis in cancer cells may increase the level of methylglyoxal, a cytotoxic compound. Conclusions BLE has the potential to be developed into a novel chemopreventive agent provided that the cytotoxic effects related to methylglyoxal accumulation are minimized in normal cells that rely on aerobic glycolysis for energy supply.

  20. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  1. The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.

    Science.gov (United States)

    Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval

    2012-07-30

    In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  2. Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

    Directory of Open Access Journals (Sweden)

    Hui-Yeng Y Yap

    Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

  3. Pyrosequencing the transcriptome of the greenhouse whitefly, Trialeurodes vaporariorum reveals multiple transcripts encoding insecticide targets and detoxifying enzymes

    Directory of Open Access Journals (Sweden)

    Gorman Kevin

    2011-01-01

    Full Text Available Abstract Background The whitefly Trialeurodes vaporariorum is an economically important crop pest in temperate regions that has developed resistance to most classes of insecticides. However, the molecular mechanisms underlying resistance have not been characterised and, to date, progress has been hampered by a lack of nucleotide sequence data for this species. Here, we use pyrosequencing on the Roche 454-FLX platform to produce a substantial and annotated EST dataset. This 'unigene set' will form a critical reference point for quantitation of over-expressed messages via digital transcriptomics. Results Pyrosequencing produced around a million sequencing reads that assembled into 54,748 contigs, with an average length of 965 bp, representing a dramatic expansion of existing cDNA sequences available for T. vaporariorum (only 43 entries in GenBank at the time of this publication. BLAST searching of non-redundant databases returned 20,333 significant matches and those gene families potentially encoding gene products involved in insecticide resistance were manually curated and annotated. These include, enzymes potentially involved in the detoxification of xenobiotics and those encoding the targets of the major chemical classes of insecticides. A total of 57 P450s, 17 GSTs and 27 CCEs were identified along with 30 contigs encoding the target proteins of six different insecticide classes. Conclusion Here, we have developed new transcriptomic resources for T. vaporariorum. These include a substantial and annotated EST dataset that will serve the community studying this important crop pest and will elucidate further the molecular mechanisms underlying insecticide resistance.

  4. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  5. Gene polymorphisms of desaturase enzymes of polyunsaturated fatty acid metabolism and adiponutrin and the increased risk of nonalcoholic fatty liver disease

    OpenAIRE

    Manvi Vernekar; Deepak Amarapurkar; Kalpana Joshi; Rekha Singhal

    2017-01-01

    Nonalcoholic fatty liver disease (NAFLD) is considered to be the hepatic manifestation of the metabolic syndrome (MetS). Adiponutrin gene polymorphisms have been associated with NAFLD worldwide. Polyunsaturated fatty acids (PUFAs) have been studied to have anti-inflammatory effects and plasma lipid lowering properties. PUFAs are endogenously synthesized with the help of delta-6-desaturase and delta-5-desaturase enzymes. They are encoded by FADS2 and FADS1 genes respectively. Polymorphisms in ...

  6. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  7. Comparative gene expression of intestinal metabolizing enzymes.

    Science.gov (United States)

    Shin, Ho-Chul; Kim, Hye-Ryoung; Cho, Hee-Jung; Yi, Hee; Cho, Soo-Min; Lee, Dong-Goo; Abd El-Aty, A M; Kim, Jin-Suk; Sun, Duxin; Amidon, Gordon L

    2009-11-01

    The purpose of this study was to compare the expression profiles of drug-metabolizing enzymes in the intestine of mouse, rat and human. Total RNA was isolated from the duodenum and the mRNA expression was measured using Affymetrix GeneChip oligonucleotide arrays. Detected genes from the intestine of mouse, rat and human were ca. 60% of 22690 sequences, 40% of 8739 and 47% of 12559, respectively. Total genes of metabolizing enzymes subjected in this study were 95, 33 and 68 genes in mouse, rat and human, respectively. Of phase I enzymes, the mouse exhibited abundant gene expressions for Cyp3a25, Cyp4v3, Cyp2d26, followed by Cyp2b20, Cyp2c65 and Cyp4f14, whereas, the rat showed higher expression profiles of Cyp3a9, Cyp2b19, Cyp4f1, Cyp17a1, Cyp2d18, Cyp27a1 and Cyp4f6. However, the highly expressed P450 enzymes were CYP3A4, CYP3A5, CYP4F3, CYP2C18, CYP2C9, CYP2D6, CYP3A7, CYP11B1 and CYP2B6 in the human. For phase II enzymes, glucuronosyltransferase Ugt1a6, glutathione S-transferases Gstp1, Gstm3 and Gsta2, sulfotransferase Sult1b1 and acyltransferase Dgat1 were highly expressed in the mouse. The rat revealed predominant expression of glucuronosyltransferases Ugt1a1 and Ugt1a7, sulfotransferase Sult1b1, acetyltransferase Dlat and acyltransferase Dgat1. On the other hand, in human, glucuronosyltransferases UGT2B15 and UGT2B17, glutathione S-transferases MGST3, GSTP1, GSTA2 and GSTM4, sulfotransferases ST1A3 and SULT1A2, acetyltransferases SAT1 and CRAT, and acyltransferase AGPAT2 were dominantly detected. Therefore, current data indicated substantial interspecies differences in the pattern of intestinal gene expression both for P450 enzymes and phase II drug-metabolizing enzymes. This genomic database is expected to improve our understanding of interspecies variations in estimating intestinal prehepatic clearance of oral drugs.

  8. A Ti plasmid-encoded enzyme required for degradation of mannopine is functionally homologous to the T-region-encoded enzyme required for synthesis of this opine in crown gall tumors.

    OpenAIRE

    Kim, K S; Chilton, W S; Farrand, S K

    1996-01-01

    The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasm...

  9. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  10. A site-specific endonuclease encoded by a typical archaeal intron

    DEFF Research Database (Denmark)

    Dalgaard, Jacob; Garrett, Roger Antony; Belfort, Malene

    1993-01-01

    The protein encoded by the archaeal intron in the 23S rRNA gene of the hyperthermophile Desulfurococcus mobilis is a double-strand DNase that, like group I intron homing endonucleases, is capable of cleaving an intronless allele of the gene. This enzyme, I-Dmo I, is unusual among the intron...

  11. Genome-Wide Identification, Phylogenetic and Expression Analyses of the Ubiquitin-Conjugating Enzyme Gene Family in Maize

    Science.gov (United States)

    Jue, Dengwei; Sang, Xuelian; Lu, Shengqiao; Dong, Chen; Zhao, Qiufang; Chen, Hongliang; Jia, Liqiang

    2015-01-01

    Background Ubiquitination is a post-translation modification where ubiquitin is attached to a substrate. Ubiquitin-conjugating enzymes (E2s) play a major role in the ubiquitin transfer pathway, as well as a variety of functions in plant biological processes. To date, no genome-wide characterization of this gene family has been conducted in maize (Zea mays). Methodology/Principal Findings In the present study, a total of 75 putative ZmUBC genes have been identified and located in the maize genome. Phylogenetic analysis revealed that ZmUBC proteins could be divided into 15 subfamilies, which include 13 ubiquitin-conjugating enzymes (ZmE2s) and two independent ubiquitin-conjugating enzyme variant (UEV) groups. The predicted ZmUBC genes were distributed across 10 chromosomes at different densities. In addition, analysis of exon-intron junctions and sequence motifs in each candidate gene has revealed high levels of conservation within and between phylogenetic groups. Tissue expression analysis indicated that most ZmUBC genes were expressed in at least one of the tissues, indicating that these are involved in various physiological and developmental processes in maize. Moreover, expression profile analyses of ZmUBC genes under different stress treatments (4°C, 20% PEG6000, and 200 mM NaCl) and various expression patterns indicated that these may play crucial roles in the response of plants to stress. Conclusions Genome-wide identification, chromosome organization, gene structure, evolutionary and expression analyses of ZmUBC genes have facilitated in the characterization of this gene family, as well as determined its potential involvement in growth, development, and stress responses. This study provides valuable information for better understanding the classification and putative functions of the UBC-encoding genes of maize. PMID:26606743

  12. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  13. Variation in antiviral 2',5'-oligoadenylate synthetase (2'5'AS) enzyme activity is controlled by a single-nucleotide polymorphism at a splice-acceptor site in the OAS1 gene

    DEFF Research Database (Denmark)

    Bonnevie-Nielsen, Vagn; Field, L Leigh; Lu, Shao

    2005-01-01

    It is likely that human genetic differences mediate susceptibility to viral infection and virus-triggered disorders. OAS genes encoding the antiviral enzyme 2',5'-oligoadenylate synthetase (2'5'AS) are critical components of the innate immune response to viruses. This enzyme uses adenosine......=.0044), but not spousal pairs, suggesting strong genetic control of basal activity. We next analyzed association between basal activity and 15 markers across the OAS gene cluster. Significant association was detected at multiple markers, the strongest being at an A/G single-nucleotide polymorphism...... at the exon 7 splice-acceptor site (AG or AA) of the OAS1 gene. At this unusual polymorphism, allele G had a higher gene frequency in persons with high enzyme activity than in those with low enzyme activity (0.44 vs. 0.20; P=3 x 10(-11)). Enzyme activity varied in a dose-dependent manner across the GG, GA...

  14. Differential expression of genes encoding anti-oxidant enzymes in Sydney rock oysters, Saccostrea glomerata (Gould) selected for disease resistance.

    Science.gov (United States)

    Green, Timothy J; Dixon, Tom J; Devic, Emilie; Adlard, Robert D; Barnes, Andrew C

    2009-05-01

    Sydney rock oysters (Saccostrea glomerata) selectively bred for disease resistance (R) and wild-caught control oysters (W) were exposed to a field infection of disseminating neoplasia. Cumulative mortality of W oysters (31.7%) was significantly greater than R oysters (0.0%) over the 118 days of the experiment. In an attempt to understand the biochemical and molecular pathways involved in disease resistance, differentially expressed sequence tags (ESTs) between R and W S. glomerata hemocytes were identified using the PCR technique, suppression subtractive hybridisation (SSH). Sequencing of 300 clones from two SSH libraries revealed 183 distinct sequences of which 113 shared high similarity to sequences in the public databases. Putative function could be assigned to 64 of the sequences. Expression of nine ESTs homologous to genes previously shown to be involved in bivalve immunity was further studied using quantitative reverse-transcriptase PCR (qRT-PCR). The base-line expression of an extracellular superoxide dismutase (ecSOD) and a small heat shock protein (sHsP) were significantly increased, whilst peroxiredoxin 6 (Prx6) and interferon inhibiting cytokine factor (IK) were significantly decreased in R oysters. From these results it was hypothesised that R oysters would be able to generate the anti-parasitic compound, hydrogen peroxide (H(2)O(2)) faster and to higher concentrations during respiratory burst due to the differential expression of genes for the two anti-oxidant enzymes of ecSOD and Prx6. To investigate this hypothesis, protein extracts from hemolymph were analysed for oxidative burst enzyme activity. Analysis of the cell free hemolymph proteins separated by native-polyacrylamide gel electrophoresis (PAGE) failed to detect true superoxide dismutase (SOD) activity by assaying dismutation of superoxide anion in zymograms. However, the ecSOD enzyme appears to generate hydrogen peroxide, presumably via another process, which is yet to be elucidated. This

  15. Suppression of 9-cis-epoxycarotenoid dioxygenase, which encodes a key enzyme in abscisic acid biosynthesis, alters fruit texture in transgenic tomato.

    Science.gov (United States)

    Sun, Liang; Sun, Yufei; Zhang, Mei; Wang, Ling; Ren, Jie; Cui, Mengmeng; Wang, Yanping; Ji, Kai; Li, Ping; Li, Qian; Chen, Pei; Dai, Shengjie; Duan, Chaorui; Wu, Yan; Leng, Ping

    2012-01-01

    Cell wall catabolism during fruit ripening is under complex control and is key for fruit quality and shelf life. To examine the role of abscisic acid (ABA) in tomato (Solanum lycopersicum) fruit ripening, we suppressed SlNCED1, which encodes 9-cis-epoxycarotenoid dioxygenase (NCED), a key enzyme in the biosynthesis of ABA. To suppress SlNCED1 specifically in tomato fruits, and thus avoid the pleiotropic phenotypes associated with ABA deficiency, we used an RNA interference construct driven by the fruit-specific E8 promoter. ABA accumulation and SlNCED1 transcript levels in the transgenic fruit were down-regulated to between 20% and 50% of the levels measured in the control fruit. This significant reduction in NCED activity led to a down-regulation in the transcription of genes encoding major cell wall catabolic enzymes, specifically polygalacturonase (SlPG), pectin methyl esterase (SlPME), β-galactosidase precursor mRNA (SlTBG), xyloglucan endotransglycosylase (SlXET), endo-1,4-β-cellulose (SlCels), and expansin (SlExp). This resulted in an increased accumulation of pectin during ripening. In turn, this led to a significant extension of the shelf life to 15 to 29 d compared with a shelf life of only 7 d for the control fruit and an enhancement of fruit firmness at the mature stage by 30% to 45%. In conclusion, ABA affects cell wall catabolism during tomato fruit ripening via down-regulation of the expression of major catabolic genes (SlPG, SlPME, SlTBG, SlXET, SlCels, and SlExp).

  16. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  17. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  18. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    Science.gov (United States)

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  19. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  20. Cellulose and hemicellulose-degrading enzymes in Fusarium commune transcriptome and functional characterization of three identified xylanases

    DEFF Research Database (Denmark)

    Yuhong, Huang; Busk, Peter Kamp; Lange, Lene

    2015-01-01

    in Fusarium commune. Prediction of the cellulose and hemicellulose-degrading enzymes in the F. commune transcriptome using peptide pattern recognition revealed 147 genes encoding glycoside hydrolases and six genes encoding lytic polysaccharide monooxygenases (AA9 and AA11), including all relevant cellulose...

  1. DGAT enzymes and triacylglycerol biosynthesis

    Science.gov (United States)

    Yen, Chi-Liang Eric; Stone, Scot J.; Koliwad, Suneil; Harris, Charles; Farese, Robert V.

    2008-01-01

    Triacylglycerols (triglycerides) (TGs) are the major storage molecules of metabolic energy and FAs in most living organisms. Excessive accumulation of TGs, however, is associated with human diseases, such as obesity, diabetes mellitus, and steatohepatitis. The final and the only committed step in the biosynthesis of TGs is catalyzed by acyl-CoA:diacylglycerol acyltransferase (DGAT) enzymes. The genes encoding two DGAT enzymes, DGAT1 and DGAT2, were identified in the past decade, and the use of molecular tools, including mice deficient in either enzyme, has shed light on their functions. Although DGAT enzymes are involved in TG synthesis, they have distinct protein sequences and differ in their biochemical, cellular, and physiological functions. Both enzymes may be useful as therapeutic targets for diseases. Here we review the current knowledge of DGAT enzymes, focusing on new advances since the cloning of their genes, including possible roles in human health and diseases. PMID:18757836

  2. An ethanolic extract of Artemisia dracunculus L. regulates gene expression of ubiquitin-proteasome system enzymes in skeletal muscle: potential role in the treatment of sarcopenic obesity.

    Science.gov (United States)

    Kirk-Ballard, Heather; Kilroy, Gail; Day, Britton C; Wang, Zhong Q; Ribnicky, David M; Cefalu, William T; Floyd, Z Elizabeth

    2014-01-01

    Obesity is linked to insulin resistance, a primary component of metabolic syndrome and type 2 diabetes. The problem of obesity-related insulin resistance is compounded when age-related skeletal muscle loss, called sarcopenia, occurs with obesity. Skeletal muscle loss results from elevated levels of protein degradation and prevention of obesity-related sarcopenic muscle loss will depend on strategies that target pathways involved in protein degradation. An extract from Artemisia dracunculus, termed PMI 5011, improves insulin signaling and increases skeletal muscle myofiber size in a rodent model of obesity-related insulin resistance. The aim of this study was to examine the effect of PMI 5011 on the ubiquitin-proteasome system, a central regulator of muscle protein degradation. Gastrocnemius and vastus lateralis skeletal muscle was obtained from KK-A(y) obese diabetic mice fed a control or 1% (w/w) PMI 5011-supplemented diet. Regulation of genes encoding enzymes of the ubiquitin-proteasome system was determined using real-time quantitative reverse transcriptase polymerase chain reaction. Although MuRF-1 ubiquitin ligase gene expression is consistently down-regulated in skeletal muscle, atrogin-1, Fbxo40, and Traf6 expression is differentially regulated by PMI 5011. Genes encoding other enzymes of the ubiquitin-proteasome system ranging from ubiquitin to ubiquitin-specific proteases are also regulated by PMI 5011. Additionally, expression of the gene encoding the microtubule-associated protein-1 light chain 3 (LC3), a ubiquitin-like protein pivotal to autophagy-mediated protein degradation, is down-regulated by PMI 5011 in the vastus lateralis. PMI 5011 alters the gene expression of ubiquitin-proteasome system enzymes that are essential regulators of skeletal muscle mass. This suggests that PMI 5011 has therapeutic potential in the treatment of obesity-linked sarcopenia by regulating ubiquitin-proteasome-mediated protein degradation. Copyright © 2014 Elsevier Inc

  3. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  4. DGAT enzymes and triacylglycerol biosynthesis

    OpenAIRE

    Yen, Chi-Liang Eric; Stone, Scot J.; Koliwad, Suneil; Harris, Charles; Farese, Robert V.

    2008-01-01

    Triacylglycerols (triglycerides) (TGs) are the major storage molecules of metabolic energy and FAs in most living organisms. Excessive accumulation of TGs, however, is associated with human diseases, such as obesity, diabetes mellitus, and steatohepatitis. The final and the only committed step in the biosynthesis of TGs is catalyzed by acyl-CoA:diacylglycerol acyltransferase (DGAT) enzymes. The genes encoding two DGAT enzymes, DGAT1 and DGAT2, were identified in the past decade, ...

  5. Accessory enzymes from Aspergillus involved in xylan and pectin degradation

    NARCIS (Netherlands)

    Vries, de R.P.

    1999-01-01

    The xylanolytic and pectinolytic enzyme systems from Aspergillus have been the subject of study for many years. Although the main chain cleaving enzymes and their encoding genes have been studied in detail, little information is available about most of the accessory

  6. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  7. PhAP protease from Pseudoalteromonas haloplanktis TAC125: Gene cloning, recombinant production in E. coli and enzyme characterization

    Science.gov (United States)

    de Pascale, D.; Giuliani, M.; De Santi, C.; Bergamasco, N.; Amoresano, A.; Carpentieri, A.; Parrilli, E.; Tutino, M. L.

    2010-08-01

    Cold-adapted proteases have been found to be the dominant activity throughout the cold marine environment, indicating their importance in bacterial acquisition of nitrogen-rich complex organic compounds. However, few extracellular proteases from marine organisms have been characterized so far, and the mechanisms that enable their activity in situ are still largely unknown. Aside from their ecological importance and use as model enzyme for structure/function investigations, cold-active proteolytic enzymes offer great potential for biotechnological applications. Our studies on cold adapted proteases were performed on exo-enzyme produced by the Antarctic marine bacterium Pseudoalteromonas haloplanktis TAC125. By applying a proteomic approach, we identified several proteolytic activities from its culture supernatant. PhAP protease was selected for further investigations. The encoding gene was cloned and the protein was recombinantly produced in E. coli cells. The homogeneous product was biochemically characterised and it turned out that the enzyme is a Zn-dependent aminopeptidase, with an activity dependence from assay temperature typical of psychrophilic enzymes.

  8. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  9. A gene encoding starch branching enzyme I (SBEI) in apple (Malusxdomestica, Rosaceae) and its phylogenetic relationship to Sbe genes from other angiosperms.

    Science.gov (United States)

    Han, Yuepeng; Gasic, Ksenija; Sun, Fengjie; Xu, Mingliang; Korban, Schuyler S

    2007-06-01

    An apple starch-branching enzyme SbeI gene (GenBank Accession No. DQ115404) has been isolated, cloned, and sequenced. The SbeI is a single copy gene in the apple genome, consisting of 14 exons and 13 introns, and covering 6075bp. As detected by RT-PCR, the apple SbeI is expressed at very low levels during early stages of fruit development; while, the highest levels of mRNA transcripts are observed at approximately 44 days post-pollination. Besides fruits, the apple SbeI is also expressed in buds and flowers, and very weakly in leaves. The genomic structure of SbeI in apple is strikingly similar to those reported so far in grasses (Poaceae), with exons 4 through 13 being of identical lengths in both apple and grasses. Moreover, structure similarities in exon lengths have also been detected in SbeII genes of both grasses and eudicots. These findings prompted the investigation of the evolutionary process of the Sbe gene family in angiosperms. A total of 26 Sbe sequences, representing an array of monocots and eudicots, are investigated in this study. Phylogenetic analysis has suggested that Sbe genes have duplicated into SbeI and SbeII prior to the divergence of moncots from eudicots. The SbeII gene is further duplicated into SbeIIa and SbeIIb prior to the radiation of grasses; however, it is not yet clear whether this duplication event has occurred before or after the radiation of the eudicots.

  10. Identification of Enzyme Genes Using Chemical Structure Alignments of Substrate-Product Pairs.

    Science.gov (United States)

    Moriya, Yuki; Yamada, Takuji; Okuda, Shujiro; Nakagawa, Zenichi; Kotera, Masaaki; Tokimatsu, Toshiaki; Kanehisa, Minoru; Goto, Susumu

    2016-03-28

    Although there are several databases that contain data on many metabolites and reactions in biochemical pathways, there is still a big gap in the numbers between experimentally identified enzymes and metabolites. It is supposed that many catalytic enzyme genes are still unknown. Although there are previous studies that estimate the number of candidate enzyme genes, these studies required some additional information aside from the structures of metabolites such as gene expression and order in the genome. In this study, we developed a novel method to identify a candidate enzyme gene of a reaction using the chemical structures of the substrate-product pair (reactant pair). The proposed method is based on a search for similar reactant pairs in a reference database and offers ortholog groups that possibly mediate the given reaction. We applied the proposed method to two experimentally validated reactions. As a result, we confirmed that the histidine transaminase was correctly identified. Although our method could not directly identify the asparagine oxo-acid transaminase, we successfully found the paralog gene most similar to the correct enzyme gene. We also applied our method to infer candidate enzyme genes in the mesaconate pathway. The advantage of our method lies in the prediction of possible genes for orphan enzyme reactions where any associated gene sequences are not determined yet. We believe that this approach will facilitate experimental identification of genes for orphan enzymes.

  11. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F

    1997-10-09

    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  12. Gene expression and activity of antioxidant enzymes in rice plants, cv. BRS AG, under saline stress.

    Science.gov (United States)

    Rossatto, Tatiana; do Amaral, Marcelo Nogueira; Benitez, Letícia Carvalho; Vighi, Isabel Lopes; Braga, Eugenia Jacira Bolacel; de Magalhães Júnior, Ariano Martins; Maia, Mara Andrade Colares; da Silva Pinto, Luciano

    2017-10-01

    The rice cultivar ( Oryza sativa L.) BRS AG, developed by Embrapa Clima Temperado, is the first cultivar designed for purposes other than human consumption. It may be used in ethanol production and animal feed. Different abiotic stresses negatively affect plant growth. Soil salinity is responsible for a serious reduction in productivity. Therefore, the objective of this study was to evaluate the gene expression and the activity of antioxidant enzymes (SOD, CAT, APX and GR) and identify their functions in controlling ROS levels in rice plants, cultivar BRS AG, after a saline stress period. The plants were grown in vitro with two NaCl concentrations (0 and 136 mM), collected at 10, 15 and 20 days of cultivation. The results indicated that the activity of the enzymes evaluated promotes protection against oxidative stress. Although, there was an increase of reactive oxygen species, there was no increase in MDA levels. Regarding genes encoding isoforms of antioxidant enzymes, it was observed that OsSOD3 - CU/Zn , OsSOD2 - Cu/Zn , OsSOD - Cu/Zn , OsSOD4 - Cu/Zn , OsSODCc1 - Cu/Zn , OsSOD - Fe , OsAPX1 , OsCATB and OsGR2 were the most responsive. The increase in the transcription of all genes among evaluated isoforms, except for OsAPX6 , which remained stable, contributed to the increase or the maintenance of enzyme activity. Thus, it is possible to infer that the cv. BRS AG has defense mechanisms against salt stress.

  13. Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

    Science.gov (United States)

    Kim, K S; Farrand, S K

    1996-06-01

    Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

  14. Giant virus Megavirus chilensis encodes the biosynthetic pathway for uncommon acetamido sugars.

    Science.gov (United States)

    Piacente, Francesco; De Castro, Cristina; Jeudy, Sandra; Molinaro, Antonio; Salis, Annalisa; Damonte, Gianluca; Bernardi, Cinzia; Abergel, Chantal; Tonetti, Michela G

    2014-08-29

    Giant viruses mimicking microbes, by the sizes of their particles and the heavily glycosylated fibrils surrounding their capsids, infect Acanthamoeba sp., which are ubiquitous unicellular eukaryotes. The glycans on fibrils are produced by virally encoded enzymes, organized in gene clusters. Like Mimivirus, Megavirus glycans are mainly composed of virally synthesized N-acetylglucosamine (GlcNAc). They also contain N-acetylrhamnosamine (RhaNAc), a rare sugar; the enzymes involved in its synthesis are encoded by a gene cluster specific to Megavirus close relatives. We combined activity assays on two enzymes of the pathway with mass spectrometry and NMR studies to characterize their specificities. Mg534 is a 4,6-dehydratase 5-epimerase; its three-dimensional structure suggests that it belongs to a third subfamily of inverting dehydratases. Mg535, next in the pathway, is a bifunctional 3-epimerase 4-reductase. The sequential activity of the two enzymes leads to the formation of UDP-l-RhaNAc. This study is another example of giant viruses performing their glycan synthesis using enzymes different from their cellular counterparts, raising again the question of the origin of these pathways. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  16. Matrix Metalloproteinase Enzyme Family

    Directory of Open Access Journals (Sweden)

    Ozlem Goruroglu Ozturk

    2013-04-01

    Full Text Available Matrix metalloproteinases play an important role in many biological processes such as embriogenesis, tissue remodeling, wound healing, and angiogenesis, and in some pathological conditions such as atherosclerosis, arthritis and cancer. Currently, 24 genes have been identified in humans that encode different groups of matrix metalloproteinase enzymes. This review discuss the members of the matrix metalloproteinase family and their substrate specificity, structure, function and the regulation of their enzyme activity by tissue inhibitors. [Archives Medical Review Journal 2013; 22(2.000: 209-220

  17. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  18. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  19. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  20. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

    Science.gov (United States)

    Tzagoloff, A; Shtanko, A

    1995-06-01

    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  1. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  2. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  3. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  4. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  5. Phosphoribosylpyrophosphate synthetase of Escherichia coli. Properties of the purified enzyme and primary structure of the prs gene

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Harlow, Kenneth W.; King, Cheryl J.

    1986-01-01

    Phosphoribosylpyrophosphate (P-Rib-PP) synthetase of Escherichia coli has been purified to near homogeneity from a strain harboring the prs gene, encoding P-Rib-PP synthetase, on a multicopy plasmid. Analysis of the enzyme showed that it required inorganic phosphate for activity and for stability...... the UAA translation stop codon, within a Thy-rich region following an inverted repeat sequence, indicative of an rho-independent transcription terminator....

  6. Functional analyses of multiple lichenin-degrading enzymes from the rumen bacterium Ruminococcus albus 8.

    Science.gov (United States)

    Iakiviak, Michael; Mackie, Roderick I; Cann, Isaac K O

    2011-11-01

    Ruminococcus albus 8 is a fibrolytic ruminal bacterium capable of utilization of various plant cell wall polysaccharides. A bioinformatic analysis of a partial genome sequence of R. albus revealed several putative enzymes likely to hydrolyze glucans, including lichenin, a mixed-linkage polysaccharide of glucose linked together in β-1,3 and β-1,4 glycosidic bonds. In the present study, we demonstrate the capacity of four glycoside hydrolases (GHs), derived from R. albus, to hydrolyze lichenin. Two of the genes encoded GH family 5 enzymes (Ra0453 and Ra2830), one gene encoded a GH family 16 enzyme (Ra0505), and the last gene encoded a GH family 3 enzyme (Ra1595). Each gene was expressed in Escherichia coli, and the recombinant protein was purified to near homogeneity. Upon screening on a wide range of substrates, Ra0453, Ra2830, and Ra0505 displayed different hydrolytic properties, as they released unique product profiles. The Ra1595 protein, predicted to function as a β-glucosidase, preferred cleavage of a nonreducing end glucose when linked by a β-1,3 glycosidic bond to the next glucose residue. The major product of Ra0505 hydrolysis of lichenin was predicted to be a glucotriose that was degraded only by Ra0453 to glucose and cellobiose. Most importantly, the four enzymes functioned synergistically to hydrolyze lichenin to glucose, cellobiose, and cellotriose. This lichenin-degrading enzyme mix should be of utility as an additive to feeds administered to monogastric animals, especially those high in fiber.

  7. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  8. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  9. Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

    Science.gov (United States)

    Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

    2005-01-01

    We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

  10. Angiotensin Converting Enzyme Gene Insertion/Deletion Polymorphism in Migraine Patients

    Directory of Open Access Journals (Sweden)

    Belgin Alaşehirli

    2009-12-01

    Full Text Available OBJECTIVE: The beneficial effects of angiotensin converting enzyme inhibitor drugs on migraine attack frequency have been shown. We aimed to study the relationship between the angiotensin converting enzyme gene and migraine pathophysiology. METHODS: In the present study, to assess whether the angiotensin converting enzyme insertion/deletion (I/D gene polymorphisms have an effect on migraine attacks, we studied the angiotensin converting enzyme genotypes of 102 migraine patients (35 cases of migraine with aura and 67 of migraine without aura and 75 age-and sex-matched normal volunteers. Frequency and age of onset of migraine attacks were also assessed according to angiotensin converting enzyme genotypes. RESULTS: Patients with migraine with and without aura were comparable with each other and the control group with respect to angiotensin converting enzyme genotypes (respectively; p= 0.88 and p= 0.76, p= 0.624. We could not determine a relationship between angiotensin converting enzyme genotypes and attack frequency (p= 0.125, but cases with angiotensin converting enzyme-II genotype showed a significantly younger age for onset of migraine attacks in comparison with the I/D genotype patients (p= 0.021. CONCLUSION: We believe that further angiotensin converting enzyme gene studies are warranted in younger age groups of patients with migraine and also in different populations

  11. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  12. Plant isoflavone and isoflavanone O-methyltransferase genes

    Science.gov (United States)

    Broeckling, Bettina E.; Liu, Chang-Jun; Dixon, Richard A.

    2014-08-19

    The invention provides enzymes that encode O-methyltransferases (OMTs) from Medicago truncatula that allow modification to plant (iso)flavonoid biosynthetic pathways. In certain aspects of the invention, the genes encoding these enzymes are provided. The invention therefore allows the modification of plants for isoflavonoid content. Transgenic plants comprising such enzymes are also provided, as well as methods for improving disease resistance in plants. Methods for producing food and nutraceuticals, and the resulting compositions, are also provided.

  13. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  14. Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

    Science.gov (United States)

    Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

    2015-01-01

    In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

  15. Nuclear-cytoplasmic conflict in pea (Pisum sativum L. is associated with nuclear and plastidic candidate genes encoding acetyl-CoA carboxylase subunits.

    Directory of Open Access Journals (Sweden)

    Vera S Bogdanova

    Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.

  16. Cloning, sequence determination, and expression of the genes encoding the subunits of the nickel-containing 8-hydroxy-5-deazaflavin reducing hydrogenase from Methanobacterium thermoautotrophicum ΔH

    International Nuclear Information System (INIS)

    Alex, L.A.; Reeve, J.N.; Orme-Johnson, W.H.; Walsh, C.T.

    1990-01-01

    The genes frhA (1,217 bp), frhB (845 bp), and frhG (710 bp) encoding the three known subunits, α, β, and γ, of the 8-hydroxy-5-deazaflavin (F 420 ) reducing hydrogenase (FRH) from the thermophilic methanogen Methanobacterium thermoautotrophicum ΔH have been cloned, sequenced, and shown to be tightly linked, indicative of a single transcriptional unit. The DNA sequence contains a fourth open reading frame, designated frhD (476 bp), encoding a polypeptide (δ) that does not copurify with the active enzyme. Expression of the frh gene cluster in Escherichia coli shows that four polypeptides are synthesized. When analyzed by SDS-PAGE, the proteins migrate with mobilities consistent with their calculated molecular weights. In order to understand the mechanism of H 2 oxidation by this enzyme, localization of redox cofactors (Ni, Fe/S, FAD) to specific subunits and information on their structure is needed. This has been hindered due to the refractory nature of the enzyme to denaturation methods needed in order to obtain individual subunits with cofactors intact. In this paper they discuss the possible localization of the redox cofactors as implicated from the DNA-derived protein sequences of the subunits. The amino acid sequences of the subunits of the FRH are compared with those of other Ni-containing hydrogenases, including the methyl viologen reducing hydrogenase (MVH) of M. thermoautotrophicum ΔH

  17. Correction of acid beta-galactosidase deficiency in GM1 gangliosidosis human fibroblasts by retrovirus vector-mediated gene transfer: higher efficiency of release and cross-correction by the murine enzyme.

    Science.gov (United States)

    Sena-Esteves, M; Camp, S M; Alroy, J; Breakefield, X O; Kaye, E M

    2000-03-20

    Mutations in the lysosomal acid beta-galactosidase (EC 3.2.1.23) underlie two different disorders: GM1 gangliosidosis, which involves the nervous system and visceral organs to varying extents, and Morquio's syndrome type B (Morquio B disease), which is a skeletal-connective tissue disease without any CNS symptoms. This article shows that transduction of human GM1 gangliosidosis fibroblasts with retrovirus vectors encoding the human acid beta-galactosidase cDNA leads to complete correction of the enzymatic deficiency. The newly synthesized enzyme is correctly processed and targeted to the lysosomes in transduced cells. Cross-correction experiments using retrovirus-modified cells as enzyme donors showed, however, that the human enzyme is transferred at low efficiencies. Experiments using a different retrovirus vector carrying the human cDNA confirmed this observation. Transduction of human GM1 fibroblasts and mouse NIH 3T3 cells with a retrovirus vector encoding the mouse beta-galactosidase cDNA resulted in high levels of enzymatic activity. Furthermore, the mouse enzyme was found to be transferred to human cells at high efficiency. Enzyme activity measurements in medium conditioned by genetically modified cells suggest that the human beta-galactosidase enzyme is less efficiently released to the extracellular space than its mouse counterpart. This study suggests that lysosomal enzymes, contrary to the generalized perception in the field of gene therapy, may differ significantly in their properties and provides insights for design of future gene therapy interventions in acid beta-galactosidase deficiency.

  18. The pathogenomics of McArdle disease--genes, enzymes, models, and therapeutic implications.

    Science.gov (United States)

    Nogales-Gadea, Gisela; Santalla, Alfredo; Brull, Astrid; de Luna, Noemi; Lucia, Alejandro; Pinós, Tomàs

    2015-03-01

    Numerous biomedical advances have been made since Carl and Gerty Cori discovered the enzyme phosphorylase in the 1940s and the Scottish physician Brian McArdle reported in 1951 a previously 'undescribed disorder characterized by a gross failure of the breakdown in muscle of glycogen'. Today we know that this disorder, commonly known as 'McArdle disease', is caused by inherited deficiency of the muscle isoform of glycogen phosphorylase (GP). Here we review the main aspects of the 'pathogenomics' of this disease including, among others: the spectrum of mutations in the gene (PYGM) encoding muscle GP; the interplay between the different tissue GP isoforms in cellular cultures and in patients; what can we learn from naturally occurring and recently laboratory-generated animal models of the disease; and potential therapies.

  19. Suppression of 9-cis-Epoxycarotenoid Dioxygenase, Which Encodes a Key Enzyme in Abscisic Acid Biosynthesis, Alters Fruit Texture in Transgenic Tomato1[W][OA

    Science.gov (United States)

    Sun, Liang; Sun, Yufei; Zhang, Mei; Wang, Ling; Ren, Jie; Cui, Mengmeng; Wang, Yanping; Ji, Kai; Li, Ping; Li, Qian; Chen, Pei; Dai, Shengjie; Duan, Chaorui; Wu, Yan; Leng, Ping

    2012-01-01

    Cell wall catabolism during fruit ripening is under complex control and is key for fruit quality and shelf life. To examine the role of abscisic acid (ABA) in tomato (Solanum lycopersicum) fruit ripening, we suppressed SlNCED1, which encodes 9-cis-epoxycarotenoid dioxygenase (NCED), a key enzyme in the biosynthesis of ABA. To suppress SlNCED1 specifically in tomato fruits, and thus avoid the pleiotropic phenotypes associated with ABA deficiency, we used an RNA interference construct driven by the fruit-specific E8 promoter. ABA accumulation and SlNCED1 transcript levels in the transgenic fruit were down-regulated to between 20% and 50% of the levels measured in the control fruit. This significant reduction in NCED activity led to a down-regulation in the transcription of genes encoding major cell wall catabolic enzymes, specifically polygalacturonase (SlPG), pectin methyl esterase (SlPME), β-galactosidase precursor mRNA (SlTBG), xyloglucan endotransglycosylase (SlXET), endo-1,4-β-cellulose (SlCels), and expansin (SlExp). This resulted in an increased accumulation of pectin during ripening. In turn, this led to a significant extension of the shelf life to 15 to 29 d compared with a shelf life of only 7 d for the control fruit and an enhancement of fruit firmness at the mature stage by 30% to 45%. In conclusion, ABA affects cell wall catabolism during tomato fruit ripening via down-regulation of the expression of major catabolic genes (SlPG, SlPME, SlTBG, SlXET, SlCels, and SlExp). PMID:22108525

  20. Prediction of Wild-type Enzyme Characteristics

    DEFF Research Database (Denmark)

    Geertz-Hansen, Henrik Marcus

    of biotechnology, including enzyme discovery and characterization. This work presents two articles on sequence-based discovery and functional annotation of enzymes in environmental samples, and two articles on analysis and prediction of enzyme thermostability and cofactor requirements. The first article presents...... a sequence-based approach to discovery of proteolytic enzymes in metagenomes obtained from the Polar oceans. We show that microorganisms living in these extreme environments of constant low temperature harbour genes encoding novel proteolytic enzymes with potential industrial relevance. The second article...... presents a web server for the processing and annotation of functional metagenomics sequencing data, tailored to meet the requirements of non-bioinformaticians. The third article presents analyses of the molecular determinants of enzyme thermostability, and a feature-based prediction method of the melting...

  1. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  2. Temporal changes in glycogenolytic enzyme mRNAs during myogenesis of primary porcine satellite cells

    DEFF Research Database (Denmark)

    Henckel, Poul; Theil, Peter Kappel; Sørensen, Inge Lise

    2007-01-01

    , phosphorylase kinase, phosphorylase and glycogen debranching enzyme, and no alterations of the transporter molecule GLUT4, clearly indicate that glycogenolytic enzymes of potential importance to meat quality development are regulated at the gene level during myogenesis, and are heavily involved in muscle cell...... and muscle fibre development. The genes, however, are not influenced by insulin, and the lack of response to insulin of expression of gene-encoding enzymes involved in the formation and degradation of glycogen may question the applicability of porcine cell culture systems, like the one applied, as a model...

  3. In silico characterization of 1,2-diacylglycerol cholinephosphotransferase and lysophospha-tidylcholine acyltransferase genes in Glycine max L. Merrill.

    Science.gov (United States)

    Sousa, C S; Barros, B A; Barh, D; Ghosh, P; Azevedo, V; Barros, E G; Moreira, M A

    2016-08-26

    The enzymes 1,2-diacylglycerol cholinephosphotrans-ferase (CPT) and lysophosphatidylcholine acyltransferase (LPCAT) are important in lipid metabolism in soybean seeds. Thus, understand-ing the genes that encode these enzymes may enable their modification and aid the improvement of soybean oil quality. In soybean, the genes encoding these enzymes have not been completely described; there-fore, this study aimed to identify, characterize, and analyze the in silico expression of these genes in soybean. We identified two gene models encoding CPT and two gene models encoding LPCAT, one of which presented an alternative transcript. The sequences were positioned on the physical map of soybean and the promoter regions were analyzed. Cis-elements responsible for seed-specific expression and responses to biotic and abiotic stresses were identified. Virtual expression analysis of the gene models for CPT and LPCAT indicated that these genes are expressed under different stress conditions, in somatic embryos during differentiation, in immature seeds, root tissues, and calli. Putative ami-no acid sequences revealed the presence of transmembrane domains, and analysis of the cellular localization of these enzymes revealed they are located in the endoplasmic reticulum.

  4. Functional Cloning and Expression of the Schizophyllum commune Glucuronoyl Esterase Gene and Characterization of the Recombinant Enzyme

    Science.gov (United States)

    Wong, Dominic W. S.; Chan, Victor J.; McCormack, Amanda A.; Hirsch, Ján; Biely, Peter

    2012-01-01

    The gene encoding Schizophyllum commune glucuronoyl esterase was identified in the scaffold 17 of the genome, containing two introns of 50 bp and 48 bp, with a transcript sequence of 1179 bp. The gene was synthesized and cloned into Pichia pastoris expression vector pGAPZα to achieve constitutive expression and secretion of the recombinant enzyme in soluble active form. The purified protein was 53 kD with glycosylation and had an acidic pI of 3.7. Activity analysis on several uronic acids and their derivatives suggests that the enzyme recognized only esters of 4-O-methyl-D-glucuronic acid derivatives, even with a 4-nitrophenyl aglycon but did not hydrolyze the ester of D-galacturonic acid. The kinetic values were K m 0.25 mM, V max 16.3 μM·min−1, and k cat 9.27 s−1 with 4-nitrophenyl 2-O-(methyl 4-O-methyl-α-D-glucopyranosyluronate)-β-D-xylopyranoside as the substrate. PMID:22844600

  5. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  6. Gene cloning, expression, and characterization of a new carboxylesterase from Serratia sp. SES-01: comparison with Escherichia coli BioHe enzyme.

    Science.gov (United States)

    Kwon, Min-A; Kim, Hyun Suk; Oh, Joon Young; Song, Bong Keun; Song, Jae Kwang

    2009-02-01

    The carboxylesterase-encoding gene (bioHs) of a newly isolated strain, Serratia sp. SES-01, was cloned from the genomic DNA library by detecting formation of transparent halo around the colony on LB-tributyrin agar plates. The amino acid sequence of BioHs was highly similar to the members of the BioH enzyme family involved in the biotin biosynthetic pathway; it showed the highest similarity (91%) with that of Serratia proteamaculans. To compare BioHs with other BioH enzymes, the relatively well-known bioHe gene of E. coli was cloned with PCR. After we achieved high-level expression of soluble BioHs and BioHe through the exploration of different culture conditions, the purified BioHs and BioHe enzymes were characterized in terms of specificity, activity, and stability. BioHe was generally more robust to a change in temperature and pH and an addition of organic solvents than BioHs. The two enzymes exhibited a strong preference for carboxylesterase rather than for thioesterase and were optimal at relatively low temperatures (20-40 degrees ) and alkaline pHs (7.5-9.0). The results in this study strongly suggested that both the BioHs and BioHe enzymes would be potential candidates for use as a carboxylesterase in many industrial applications.

  7. Cloning, Sequencing, and Expression of the Gene Encoding Cyclic 2,3-Diphosphoglycerate Synthetase, the Key Enzyme of Cyclic 2,3-Diphosphoglycerate Metabolism in Methanothermus fervidus

    Science.gov (United States)

    Matussek, Karl; Moritz, Patrick; Brunner, Nina; Eckerskorn, Christoph; Hensel, Reinhard

    1998-01-01

    Cyclic 2,3-diphosphoglycerate synthetase (cDPGS) catalyzes the synthesis of cyclic 2,3-diphosphoglycerate (cDPG) by formation of an intramolecular phosphoanhydride bond in 2,3-diphosphoglycerate. cDPG is known to be accumulated to high intracellular concentrations (>300 mM) as a putative thermoadapter in some hyperthermophilic methanogens. For the first time, we have purified active cDPGS from a methanogen, the hyperthermophilic archaeon Methanothermus fervidus, sequenced the coding gene, and expressed it in Escherichia coli. cDPGS purification resulted in enzyme preparations containing two isoforms differing in their electrophoretic mobility under denaturing conditions. Since both polypeptides showed the same N-terminal amino acid sequence and Southern analyses indicate the presence of only one gene coding for cDPGS in M. fervidus, the two polypeptides originate from the same gene but differ by a not yet identified modification. The native cDPGS represents a dimer with an apparent molecular mass of 112 kDa and catalyzes the reversible formation of the intramolecular phosphoanhydride bond at the expense of ATP. The enzyme shows a clear preference for the synthetic reaction: the substrate affinity and the Vmax of the synthetic reaction are a factor of 8 to 10 higher than the corresponding values for the reverse reaction. Comparison with the kinetic properties of the electrophoretically homogeneous, apparently unmodified recombinant enzyme from E. coli revealed a twofold-higher Vmax of the enzyme from M. fervidus in the synthesizing direction. PMID:9811660

  8. Cloning, sequencing, and expression of the gene encoding cyclic 2, 3-diphosphoglycerate synthetase, the key enzyme of cyclic 2, 3-diphosphoglycerate metabolism in Methanothermus fervidus.

    Science.gov (United States)

    Matussek, K; Moritz, P; Brunner, N; Eckerskorn, C; Hensel, R

    1998-11-01

    Cyclic 2,3-diphosphoglycerate synthetase (cDPGS) catalyzes the synthesis of cyclic 2,3-diphosphoglycerate (cDPG) by formation of an intramolecular phosphoanhydride bond in 2,3-diphosphoglycerate. cDPG is known to be accumulated to high intracellular concentrations (>300 mM) as a putative thermoadapter in some hyperthermophilic methanogens. For the first time, we have purified active cDPGS from a methanogen, the hyperthermophilic archaeon Methanothermus fervidus, sequenced the coding gene, and expressed it in Escherichia coli. cDPGS purification resulted in enzyme preparations containing two isoforms differing in their electrophoretic mobility under denaturing conditions. Since both polypeptides showed the same N-terminal amino acid sequence and Southern analyses indicate the presence of only one gene coding for cDPGS in M. fervidus, the two polypeptides originate from the same gene but differ by a not yet identified modification. The native cDPGS represents a dimer with an apparent molecular mass of 112 kDa and catalyzes the reversible formation of the intramolecular phosphoanhydride bond at the expense of ATP. The enzyme shows a clear preference for the synthetic reaction: the substrate affinity and the Vmax of the synthetic reaction are a factor of 8 to 10 higher than the corresponding values for the reverse reaction. Comparison with the kinetic properties of the electrophoretically homogeneous, apparently unmodified recombinant enzyme from E. coli revealed a twofold-higher Vmax of the enzyme from M. fervidus in the synthesizing direction.

  9. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  10. Anthocyanin biosynthesis in fruit tree crops: Genes and their regulation

    African Journals Online (AJOL)

    The anthocyanin biosynthesis pathway is a little complex with branches responsible for the synthesis of a variety of metabolites. In fruit tree crops, during the past decade, many structural genes encoding enzymes in the anthocyanin biosynthetic pathway and various regulatory genes encoding transcription factors that ...

  11. Carbohydrate-related enzymes of important Phytophthora plant pathogens.

    Science.gov (United States)

    Brouwer, Henk; Coutinho, Pedro M; Henrissat, Bernard; de Vries, Ronald P

    2014-11-01

    Carbohydrate-Active enZymes (CAZymes) form particularly interesting targets to study in plant pathogens. Despite the fact that many CAZymes are pathogenicity factors, oomycete CAZymes have received significantly less attention than effectors in the literature. Here we present an analysis of the CAZymes present in the Phytophthora infestans, Ph. ramorum, Ph. sojae and Pythium ultimum genomes compared to growth of these species on a range of different carbon sources. Growth on these carbon sources indicates that the size of enzyme families involved in degradation of cell-wall related substrates like cellulose, xylan and pectin is not always a good predictor of growth on these substrates. While a capacity to degrade xylan and cellulose exists the products are not fully saccharified and used as a carbon source. The Phytophthora genomes encode larger CAZyme sets when compared to Py. ultimum, and encode putative cutinases, GH12 xyloglucanases and GH10 xylanases that are missing in the Py. ultimum genome. Phytophthora spp. also encode a larger number of enzyme families and genes involved in pectin degradation. No loss or gain of complete enzyme families was found between the Phytophthora genomes, but there are some marked differences in the size of some enzyme families. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Bacillus halodurans Strain C125 Encodes and Synthesizes Enzymes from Both Known Pathways To Form dUMP Directly from Cytosine Deoxyribonucleotides

    DEFF Research Database (Denmark)

    Oehlenschlæger, Christian Berg; Løvgreen, Monika Nøhr; Reinauer, Eva

    2015-01-01

    Analysis of the genome of Bacillus halodurans strain C125 indicated that two pathways leading from a cytosine deoxyribonucleotide to dUMP, used for dTMP synthesis, were encoded by the genome of the bacterium. The genes that were responsible, the comEB gene and the dcdB gene, encoding dCMP deaminase...

  13. A maize gene encoding an NADPH binding enzyme highly homologous to isoflavone reductases is activated in response to sulfur starvation.

    Science.gov (United States)

    Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S

    1996-01-01

    we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.

  14. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

    Directory of Open Access Journals (Sweden)

    Phelan Anne

    2007-06-01

    Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

  15. Angiotensin-converting enzyme insertion/deletion gene ...

    Indian Academy of Sciences (India)

    Angiotensin-converting enzyme insertion/deletion gene polymorphism in cystic fibrosis patients. Sabrine Oueslati Sondess Hadj Fredj Hajer Siala Amina Bibi Hajer Aloulou Lamia Boughamoura Khadija Boussetta Sihem Barsaoui Taieb Messaoud. Research Note Volume 95 Issue 1 March 2016 pp 193-196 ...

  16. Angiotensin Converting Enzyme Insertion/Deletion Gene ...

    African Journals Online (AJOL)

    Angiotensin Converting Enzyme Insertion/Deletion Gene Polymorphism: An Observational Study among Diabetic Hypertensive Subjects in Malaysia. ... Methods: The pharmacological effect of ACE inhibition on mean arterial pressure (MAP) and glomerular filtration rate (GFR) were observed among a total of 62 subjects for ...

  17. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  18. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  19. Secretion Trap Tagging of Secreted and Membrane-Spanning Proteins Using Arabidopsis Gene Traps

    Science.gov (United States)

    Andrew T. Groover; Joseph R. Fontana; Juana M. Arroyo; Cristina Yordan; W. Richard McCombie; Robert A. Martienssen

    2003-01-01

    Secreted and membrane-spanning proteins play fundamental roles in plant development but pose challenges for genetic identification and characterization. We describe a "secretion trap" screen for gene trap insertions in genes encoding proteins routed through the secretory pathway. The gene trap transposon encodes a ß-glucuronidase reporter enzyme...

  20. Hypoxic regulation of the expression of genes encoded estrogen related proteins in U87 glioma cells: eff ect of IRE1 inhibition.

    Science.gov (United States)

    Minchenko, D O; Riabovol, O O; Ratushna, O O; Minchenko, O H

    2017-01-01

    The aim of the present study was to examine the effect of inhibition of endoplasmic reticulum stress signaling, mediated by IRE1 (inositol requiring enzyme 1), which is a central mediator of the unfolded protein response on the expression of genes encoded estrogen related proteins (NRIP1/RIP140, TRIM16/EBBP, ESRRA/NR3B1, FAM162A/E2IG5, PGRMC2/PMBP, and SLC39A6/LIV-1) and their hypoxic regulation in U87 glioma cells for evaluation of their possible significance in the control of glioma cells proliferation. The expression of NRIP1, EBBP, ESRRA, E2IG5, PGRMC2, and SLC39A6 genes in U87 glioma cells, transfected by empty vector pcDNA3.1 (control) and cells without IRE1 signaling enzyme function (transfected by dnIRE1) upon hypoxia, was studied by a quantitative polymerase chain reaction. Inhibition of both enzymatic activities (kinase and endoribonuclease) of IRE1 signaling enzyme function up-regulates the expression of EBBP, E2IG5, PGRMC2, and SLC39A6 genes is in U87 glioma cells in comparison with the control glioma cells, with more significant changes for E2IG5 and PGRMC2 genes. At the same time, the expression of NRIP1 and ESRRA genes is strongly down-regulated in glioma cells upon inhibition of IRE1. We also showed that hypoxia increases the expression of E2IG5, PGRMC2, and EBBP genes and decreases NRIP1 and ESRRA genes expression in control glioma cells. Furthermore, the inhibition of IRE1 in U87 glioma cells decreases the eff ect of hypoxia on the expression of E2IG5 and PGRMC2 genes, eliminates hypoxic regulation of NRIP1 gene, and enhances the sensitivity of ESRRA gene to hypoxic condition. Furthermore, the expression of SLC39A6 gene is resistant to hypoxia in both the glioma cells with and without IRE1 signaling enzyme function. Results of this investigation demonstrate that inhibition of IRE1 signaling enzyme function affects the expression of NRIP1, EBBP, ESRRA, E2IG5, PGRMC2, and SLC39A6 genes in U87 glioma cells in gene specific manner and these changes

  1. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  2. Thematic review series: glycerolipids. DGAT enzymes and triacylglycerol biosynthesis.

    Science.gov (United States)

    Yen, Chi-Liang Eric; Stone, Scot J; Koliwad, Suneil; Harris, Charles; Farese, Robert V

    2008-11-01

    Triacylglycerols (triglycerides) (TGs) are the major storage molecules of metabolic energy and FAs in most living organisms. Excessive accumulation of TGs, however, is associated with human diseases, such as obesity, diabetes mellitus, and steatohepatitis. The final and the only committed step in the biosynthesis of TGs is catalyzed by acyl-CoA:diacylglycerol acyltransferase (DGAT) enzymes. The genes encoding two DGAT enzymes, DGAT1 and DGAT2, were identified in the past decade, and the use of molecular tools, including mice deficient in either enzyme, has shed light on their functions. Although DGAT enzymes are involved in TG synthesis, they have distinct protein sequences and differ in their biochemical, cellular, and physiological functions. Both enzymes may be useful as therapeutic targets for diseases. Here we review the current knowledge of DGAT enzymes, focusing on new advances since the cloning of their genes, including possible roles in human health and diseases.

  3. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  4. Cloning and functional analysis of 9-cis-epoxycarotenoid dioxygenase (NCED) genes encoding a key enzyme during abscisic acid biosynthesis from peach and grape fruits.

    Science.gov (United States)

    Zhang, Mei; Leng, Ping; Zhang, Guanglian; Li, Xiangxin

    2009-08-15

    Ripening and senescence are generally controlled by ethylene in climacteric fruits like peaches, and the ripening process of grape, a non-climacteric fruit, may have some relationship to abscisic acid (ABA) function. In order to better understand the role of ABA in ripening and senescence of these two types of fruits, we cloned the 9-cis-epoxycarotenoid dioxygenase (NCED) gene that encodes a key enzyme in ABA biosynthesis from peaches and grapes using an RT-PCR approach. The NCED gene fragments were cloned from peaches (PpNCED1and PpNCED2, each 740bp) and grapes (VVNCED1, 741bp) using degenerate primers designed based on the conserved amino acids sequence of NCEDs in other plants. PpNCED1 showed 78.54% homology with PpNCED2, 74.90% homology with VVNCED1, and both showed high homology to NCEDs from other plants. The expression patterns of PpNCED1 and VVNCED1 were very similar. Both were highly expressed at the beginning of ripening when ABA content becomes high. The maximum ABA preceded ethylene production in peach fruit. ABA in the grape gradually increased from the beginning of ripening and reached the highest level at 20d before the harvest stage. However, ethylene remained at low levels during the entire process of fruit development, including ripening and senescence. ABA content, and ripening and softening of both types of fruits, were promoted or delayed by exogenous ABA or Fluridone (or NDGA) treatment. The roles of ABA and ethylene in the later ripening of fruit are complex. Based on results obtained in this study, we concluded that PpNCED1 and VVNCED1 initiate ABA biosynthesis at the beginning of fruit ripening, and that ABA accumulation might play a key role in the regulation of ripeness and senescence of both peach and grape fruits.

  5. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  6. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  7. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  8. Induction of the gap-pgk operon encoding glyceraldehyde-3-phosphate dehydrogenase and 3-phosphoglycerate kinase of Xanthobacter flavus requires the LysR-type transcriptional activator CbbR

    NARCIS (Netherlands)

    Meijer, W.G; van den Bergh, E.R E; Smith, L.M

    In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence

  9. Molecular diversity of tuliposide B-converting enzyme in tulip (Tulipa gesneriana): identification of the root-specific isozyme.

    Science.gov (United States)

    Nomura, Taiji; Ueno, Ayaka; Ogita, Shinjiro; Kato, Yasuo

    2017-06-01

    6-Tuliposide B (PosB) is a glucose ester accumulated in tulip (Tulipa gesneriana) as a major secondary metabolite. PosB serves as the precursor of the antimicrobial lactone tulipalin B (PaB), which is formed by PosB-converting enzyme (TCEB). The gene TgTCEB1, encoding a TCEB, is transcribed in tulip pollen but scarcely transcribed in other tissues (e.g. roots) even though those tissues show high TCEB activity. This led to the prediction of the presence of a TCEB isozyme with distinct tissue specificity. Herein, we describe the identification of the TgTCEB-R gene from roots via native enzyme purification; this gene is a paralog of TgTCEB1. Recombinant enzyme characterization verified that TgTCEB-R encodes a TCEB. Moreover, TgTCEB-R was localized in tulip plastids, as found for pollen TgTCEB1. TgTCEB-R is transcribed almost exclusively in roots, indicating a tissue preference for the transcription of TCEB isozyme genes.

  10. Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

    Science.gov (United States)

    Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

    2010-07-04

    Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

  11. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  12. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  13. An operon encoding three glycolytic enzymes in Lactobacillus delbrueckii subsp. bulgaricus: glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase and triosephosphate isomerase.

    Science.gov (United States)

    Branny, P; de la Torre, F; Garel, J R

    1998-04-01

    The structural genes gap, pgk and tpi encoding three glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinase (PGK) and triosephosphate isomerase (TPI), respectively, have been cloned and sequenced from Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus). The genes were isolated after screening genomic sublibraries with specific gap and pgk probes obtained by PCR amplification of chromosomal DNA with degenerate primers corresponding to amino acid sequences highly conserved in GAPDHs and PGKs. Nucleotide sequencing revealed that the three genes were organized in the order gap-pgk-tpi. The translation start codons of the three genes were identified by alignment of the N-terminal sequences. These genes predicted polypeptide chains of 338, 403 and 252 amino acids for GAPDH, PGK and TPI, respectively, and they were separated by 96 bp between gap and pgk, and by only 18 bp between pgk and tpi. The codon usage in gap, pgk, tpi and three other glycolytic genes from L. bulgaricus differed, noticeably from that in other chromosomal genes. The site of transcriptional initiation was located by primer extension, and a probable promoter was identified for the gap-pgk-tpi operon. Northern hybridization of total RNA with specific probes showed two transcripts, an mRNA of 1.4 kb corresponding to the gap gene, and a less abundant mRNA of 3.4 kb corresponding to the gap-pgk-tpi cluster. The absence of a visible terminator in the 3'-end of the shorter transcript and the location of this 3'-end inside the pgk gene indicated that this shorter transcript was produced by degradation of the longer one, rather than by an early termination of transcription after the gap gene.

  14. Alteration in the ultrastructural morphology of mycelial hyphae and the dynamics of transcriptional activity of lytic enzyme genes during basidiomycete morphogenesis.

    Science.gov (United States)

    Vetchinkina, Elena; Kupryashina, Maria; Gorshkov, Vladimir; Ageeva, Marina; Gogolev, Yuri; Nikitina, Valentina

    2017-04-01

    The morphogenesis of macromycetes is a complex multilevel process resulting in a set of molecular-genetic, physiological-biochemical, and morphological-ultrastructural changes in the cells. When the xylotrophic basidiomycetes Lentinus edodes, Grifola frondosa, and Ganoderma lucidum were grown on wood waste as the substrate, the ultrastructural morphology of the mycelial hyphal cell walls differed considerably between mycelium and morphostructures. As the macromycetes passed from vegetative to generative development, the expression of the tyr1, tyr2, chi1, chi2, exg1, exg2, and exg3 genes was activated. These genes encode enzymes such as tyrosinase, chitinase, and glucanase, which play essential roles in cell wall growth and morphogenesis.

  15. Genomic analysis of Bacillus subtilis lytic bacteriophage ϕNIT1 capable of obstructing natto fermentation carrying genes for the capsule-lytic soluble enzymes poly-γ-glutamate hydrolase and levanase.

    Science.gov (United States)

    Ozaki, Tatsuro; Abe, Naoki; Kimura, Keitarou; Suzuki, Atsuto; Kaneko, Jun

    2017-01-01

    Bacillus subtilis strains including the fermented soybean (natto) starter produce capsular polymers consisting of poly-γ-glutamate and levan. Capsular polymers may protect the cells from phage infection. However, bacteriophage ϕNIT1 carries a γ-PGA hydrolase gene (pghP) that help it to counteract the host cell's protection strategy. ϕNIT had a linear double stranded DNA genome of 155,631-bp with a terminal redundancy of 5,103-bp, containing a gene encoding an active levan hydrolase. These capsule-lytic enzyme genes were located in the possible foreign gene cluster regions between central core and terminal redundant regions, and were expressed at the late phase of the phage lytic cycle. All tested natto origin Spounavirinae phages carried both genes for capsule degrading enzymes similar to ϕNIT1. A comparative genomic analysis revealed the diversity among ϕNIT1 and Bacillus phages carrying pghP-like and levan-hydrolase genes, and provides novel understanding on the acquisition mechanism of these enzymatic genes.

  16. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  17. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  18. Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

    Directory of Open Access Journals (Sweden)

    Beatriz Moreno

    2016-07-01

    Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from

  19. Biochemical and Functional Studies on the Burkholderia cepacia Complex bceN Gene, Encoding a GDP-D-Mannose 4,6-Dehydratase

    Science.gov (United States)

    Pinheiro, Pedro F.; Leitão, Jorge H.

    2013-01-01

    This work reports the biochemical and functional analysis of the Burkholderia cenocepacia J2315 bceN gene, encoding a protein with GDP-D-mannose 4,6-dehydratase enzyme activity (E.C.4.2.1.47). Data presented indicate that the protein is active when in the tetrameric form, catalyzing the conversion of GDP-D-mannose into GDP-4-keto-6-deoxy-D-mannose. This sugar nucleotide is the intermediary necessary for the biosynthesis of GDP-D-rhamnose, one of the sugar residues of cepacian, the major exopolysaccharide produced by environmental and human, animal and plant pathogenic isolates of the Burkholderia cepacia complex species. Vmax and Km values of 1.5±0.2 µmol.min−1.mg−1 and 1024±123 µM, respectively, were obtained from the kinetic characterization of the B. cenocepacia J2315 BceN protein by NMR spectroscopy, at 25°C and in the presence of 1 mol MgCl2 per mol of protein. The enzyme activity was strongly inhibited by the substrate, with an estimated Ki of 2913±350 µM. The lack of a functional bceN gene in a mutant derived from B. cepacia IST408 slightly reduced cepacian production. However, in the B. multivorans ATCC17616 with bceN as the single gene in its genome with predicted GMD activity, a bceN mutant did not produce cepacian, indicating that this gene product is required for cepacian biosynthesis. PMID:23460819

  20. Biochemical and functional studies on the Burkholderia cepacia complex bceN gene, encoding a GDP-D-mannose 4,6-dehydratase.

    Directory of Open Access Journals (Sweden)

    Sílvia A Sousa

    Full Text Available This work reports the biochemical and functional analysis of the Burkholderia cenocepacia J2315 bceN gene, encoding a protein with GDP-D-mannose 4,6-dehydratase enzyme activity (E.C.4.2.1.47. Data presented indicate that the protein is active when in the tetrameric form, catalyzing the conversion of GDP-D-mannose into GDP-4-keto-6-deoxy-D-mannose. This sugar nucleotide is the intermediary necessary for the biosynthesis of GDP-D-rhamnose, one of the sugar residues of cepacian, the major exopolysaccharide produced by environmental and human, animal and plant pathogenic isolates of the Burkholderia cepacia complex species. Vmax and Km values of 1.5±0.2 µmol.min(-1.mg(-1 and 1024±123 µM, respectively, were obtained from the kinetic characterization of the B. cenocepacia J2315 BceN protein by NMR spectroscopy, at 25°C and in the presence of 1 mol MgCl2 per mol of protein. The enzyme activity was strongly inhibited by the substrate, with an estimated Ki of 2913±350 µM. The lack of a functional bceN gene in a mutant derived from B. cepacia IST408 slightly reduced cepacian production. However, in the B. multivorans ATCC17616 with bceN as the single gene in its genome with predicted GMD activity, a bceN mutant did not produce cepacian, indicating that this gene product is required for cepacian biosynthesis.

  1. Hepatic transcriptional changes in critical genes for gluconeogenesis following castration of bulls

    Directory of Open Access Journals (Sweden)

    Dilla Mareistia Fassah

    2018-04-01

    Full Text Available Objective This study was performed to understand transcriptional changes in the genes involved in gluconeogenesis and glycolysis pathways following castration of bulls. Methods Twenty Korean bulls were weaned at average 3 months of age, and castrated at 6 months. Liver tissues were collected from bulls (n = 10 and steers (n = 10 of Korean cattle, and hepatic gene expression levels were measured using quantitative real-time polymerase chain reaction. We examined hepatic transcription levels of genes encoding enzymes for irreversible reactions in both gluconeogenesis and glycolysis as well as genes encoding enzymes for the utilization of several glucogenic substrates. Correlations between hepatic gene expression and carcass characteristics were performed to understand their associations. Results Castration increased the mRNA (3.6 fold; p<0.01 and protein levels (1.4 fold; p< 0.05 of pyruvate carboxylase and mitochondrial phosphoenolpyruvate carboxykinase genes (1.7 fold; p<0.05. Hepatic mRNA levels of genes encoding the glycolysis enzymes were not changed by castration. Castration increased mRNA levels of both lactate dehydrogenase A (1.5 fold; p<0.05 and lactate dehydrogenase B (2.2 fold; p<0.01 genes for lactate utilization. Castration increased mRNA levels of glycerol kinase (2.7 fold; p<0.05 and glycerol-3-phosphate dehydrogenase 1 (1.5 fold; p<0.05 genes for glycerol utilization. Castration also increased mRNA levels of propionyl-CoA carboxylase beta (mitochondrial (3.5 fold; p<0.01 and acyl-CoA synthetase short chain family member 3 (1.3 fold; p = 0.06 genes for propionate incorporation. Conclusion Castration increases transcription levels of critical genes coding for enzymes involved in irreversible gluconeogenesis reactions from pyruvate to glucose and enzymes responsible for incorporation of glucogenic substrates including lactate, glycerol, and propionate. Hepatic gluconeogenic gene expression levels were associated with intramuscular

  2. Activation of Pseudomonas aeruginosa elastase in Pseudomonas putida by triggering dissociation of the propeptide-enzyme complex

    NARCIS (Netherlands)

    Braun, P; Bitter, W; Tommassen, J

    2000-01-01

    The propeptide of Pseudomonas aeruginosa elastase functions both as an intramolecular chaperone required for the folding of the enzyme and as an inhibitor that prevents activity of the enzyme before its secretion into the extracellular medium. Since expression of the lasB gene, which encodes

  3. Current concepts on the physiology and genetics of neurotransmitters-mediating enzyme-aromatic L-amino acid decarboxylase

    International Nuclear Information System (INIS)

    Rahman, M.K.

    1993-03-01

    Two most important neurotransmitters, dopamine and serotonin are mediated by the enzyme aromatic L-amino acid decarboxylase (AADC). Because of their importance in the regulation of neuronal functions, behaviour and emotion of higher animals, many researchers are working on this enzyme to elucidate its physiological properties, structure and genetic aspects. We have discovered this enzyme in the mammalian blood, we established sensitive assay methods for the assay of the activities of this enzyme. We have made systematic studies on this enzyme in the tissues and brains of rats, and human subjects. We have found an endogenous inhibitor of this enzyme in the monkey's blood. The amino acid sequences of human AADC has been compared to rat or bovine. A full-length cDNA clone encoding human AADC has been isolated. Very recently the structure of human AADC gene including 5'-flaking region has been characterized and the transcriptional starting point has been determined. The human AADC gene assigned to chromosome 7. Up-to-date research data have shown that AADC is encoded by a single gene. Recently two patients with AADC deficiency were reported. This paper describes the systematic up-to-date review studies on AADC. (author). 62 refs, 5 figs, 8 tabs

  4. A Biotin Biosynthesis Gene Restricted to Helicobacter

    Science.gov (United States)

    Bi, Hongkai; Zhu, Lei; Jia, Jia; Cronan, John E.

    2016-01-01

    In most bacteria the last step in synthesis of the pimelate moiety of biotin is cleavage of the ester bond of pimeloyl-acyl carrier protein (ACP) methyl ester. The paradigm cleavage enzyme is Escherichia coli BioH which together with the BioC methyltransferase allows synthesis of the pimelate moiety by a modified fatty acid biosynthetic pathway. Analyses of the extant bacterial genomes showed that bioH is absent from many bioC-containing bacteria and is replaced by other genes. Helicobacter pylori lacks a gene encoding a homologue of the known pimeloyl-ACP methyl ester cleavage enzymes suggesting that it encodes a novel enzyme that cleaves this intermediate. We isolated the H. pylori gene encoding this enzyme, bioV, by complementation of an E. coli bioH deletion strain. Purified BioV cleaved the physiological substrate, pimeloyl-ACP methyl ester to pimeloyl-ACP by use of a catalytic triad, each member of which was essential for activity. The role of BioV in biotin biosynthesis was demonstrated using a reconstituted in vitro desthiobiotin synthesis system. BioV homologues seem the sole pimeloyl-ACP methyl ester esterase present in the Helicobacter species and their occurrence only in H. pylori and close relatives provide a target for development of drugs to specifically treat Helicobacter infections. PMID:26868423

  5. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  6. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  7. Cloning and analysis of the genes encoding the type IIS restriction-modification system HphI from Haemophilus parahaemolyticus.

    Science.gov (United States)

    Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A

    1996-07-15

    The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.

  8. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  9. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    DEFF Research Database (Denmark)

    Bross, Peter; Li, Zhijie; Hansen, Jakob

    2007-01-01

    for variations in the HSPD1 and HSPE1 genes encoding the mitochondrial Hsp60/Hsp10 chaperone complex: two patients with multiple mitochondrial enzyme deficiency, 61 sudden infant death syndrome cases (MIM: #272120), and 60 patients presenting with ethylmalonic aciduria carrying non-synonymous susceptibility...... variations in the ACADS gene (MIM: *606885 and #201470). Besides previously reported variations we detected six novel variations: two in the bidirectional promoter region, and one synonymous and three non-synonymous variations in the HSPD1 coding region. One of the non-synonymous variations was polymorphic...... in patient and control samples, and the rare variations were each only found in single patients and absent in 100 control chromosomes. Functional investigation of the effects of the variations in the promoter region and the non-synonymous variations in the coding region indicated that none of them had...

  10. Hepatic transcriptional changes in critical genes for gluconeogenesis following castration of bulls

    Science.gov (United States)

    Fassah, Dilla Mareistia; Jeong, Jin Young

    2018-01-01

    Objective This study was performed to understand transcriptional changes in the genes involved in gluconeogenesis and glycolysis pathways following castration of bulls. Methods Twenty Korean bulls were weaned at average 3 months of age, and castrated at 6 months. Liver tissues were collected from bulls (n = 10) and steers (n = 10) of Korean cattle, and hepatic gene expression levels were measured using quantitative real-time polymerase chain reaction. We examined hepatic transcription levels of genes encoding enzymes for irreversible reactions in both gluconeogenesis and glycolysis as well as genes encoding enzymes for the utilization of several glucogenic substrates. Correlations between hepatic gene expression and carcass characteristics were performed to understand their associations. Results Castration increased the mRNA (3.6 fold; pgluconeogenesis reactions from pyruvate to glucose and enzymes responsible for incorporation of glucogenic substrates including lactate, glycerol, and propionate. Hepatic gluconeogenic gene expression levels were associated with intramuscular fat deposition. PMID:29502393

  11. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  12. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  13. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  14. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  15. A CHROMATIN MODIFYING ENZYME, SDG8, IS REQUIRED FOR MORPHOLOGICAL, GENE EXPRESSION, AND EPIGENETIC RESPONSES TO MECHANICAL STIMULATION

    Directory of Open Access Journals (Sweden)

    Christopher Ian Cazzonelli

    2014-10-01

    Full Text Available Thigmomorphogenesis is viewed as being a response process of acclimation to short repetitive bursts of mechanical stimulation or touch. The underlying molecular mechanisms that coordinate changes in how touch signals lead to long-term morphological changes are enigmatic. Touch responsive gene expression is rapid and transient, and no transcription factor or DNA regulatory motif has been reported that could confer a genome wide mechanical stimulus. We report here on a chromatin modifying enzyme, SDG8/ASHH2, which can regulate the expression of many touch responsive genes identified in Arabidopsis. SDG8 is required for the permissive expression of touch induced genes; and the loss of function of sdg8 perturbs the maximum levels of induction on selected touch gene targets. SDG8 is required to maintain permissive H3K4 trimethylation marks surrounding the Arabidopsis touch-inducible gene TOUCH 3 (TCH3, which encodes a calmodulin-like protein (CML12. The gene neighbouring was also slightly down regulated, revealing a new target for SDG8 mediated chromatin modification. Finally, sdg8 mutants show perturbed morphological response to wind-agitated mechanical stimuli, implicating an epigenetic memory-forming process in the acclimation response of thigmomorphogenesis.

  16. A chromatin modifying enzyme, SDG8, is involved in morphological, gene expression, and epigenetic responses to mechanical stimulation.

    Science.gov (United States)

    Cazzonelli, Christopher I; Nisar, Nazia; Roberts, Andrea C; Murray, Kevin D; Borevitz, Justin O; Pogson, Barry J

    2014-01-01

    Thigmomorphogenesis is viewed as being a response process of acclimation to short repetitive bursts of mechanical stimulation or touch. The underlying molecular mechanisms that coordinate changes in how touch signals lead to long-term morphological changes are enigmatic. Touch responsive gene expression is rapid and transient, and no transcription factor or DNA regulatory motif has been reported that could confer a genome wide mechanical stimulus. We report here on a chromatin modifying enzyme, SDG8/ASHH2, which can regulate the expression of many touch responsive genes identified in Arabidopsis. SDG8 is required for the permissive expression of touch induced genes; and the loss of function of sdg8 perturbs the maximum levels of induction on selected touch gene targets. SDG8 is required to maintain permissive H3K4 trimethylation marks surrounding the Arabidopsis touch-inducible gene TOUCH 3 (TCH3), which encodes a calmodulin-like protein (CML12). The gene neighboring was also slightly down regulated, revealing a new target for SDG8 mediated chromatin modification. Finally, sdg8 mutants show perturbed morphological response to wind-agitated mechanical stimuli, implicating an epigenetic memory-forming process in the acclimation response of thigmomorphogenesis.

  17. Identification of fungal oxaloacetate hydrolyase within the isocitrate lyase/PEP mutase enzyme superfamily using a sequence marker-based method

    NARCIS (Netherlands)

    Joosten, H.J.; Han, Y.; Niu, W.; Vervoort, J.J.M.; Dunaway-Mariano, D.; Schaap, P.J.

    2008-01-01

    Aspergillus niger produces oxalic acid through the hydrolysis of oxaloacetate, catalyzed by the cytoplasmic enzyme oxaloacetate acetylhydrolase (OAH). The A. niger genome encodes four additional open reading frames with strong sequence similarity to OAH yet only the oahA gene encodes OAH activity.

  18. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  19. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  20. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  1. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  2. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

    Science.gov (United States)

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham

    2015-01-01

    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  3. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  4. Impact of Oxidative Stress on Ascorbate Biosynthesis in Chlamydomonas via Regulation of the VTC2 Gene Encoding a GDP-l-galactose Phosphorylase*

    Science.gov (United States)

    Urzica, Eugen I.; Adler, Lital N.; Page, M. Dudley; Linster, Carole L.; Arbing, Mark A.; Casero, David; Pellegrini, Matteo; Merchant, Sabeeha S.; Clarke, Steven G.

    2012-01-01

    The l-galactose (Smirnoff-Wheeler) pathway represents the major route to l-ascorbic acid (vitamin C) biosynthesis in higher plants. Arabidopsis thaliana VTC2 and its paralogue VTC5 function as GDP-l-galactose phosphorylases converting GDP-l-galactose to l-galactose-1-P, thus catalyzing the first committed step in the biosynthesis of l-ascorbate. Here we report that the l-galactose pathway of ascorbate biosynthesis described in higher plants is conserved in green algae. The Chlamydomonas reinhardtii genome encodes all the enzymes required for vitamin C biosynthesis via the l-galactose pathway. We have characterized recombinant C. reinhardtii VTC2 as an active GDP-l-galactose phosphorylase. C. reinhardtii cells exposed to oxidative stress show increased VTC2 mRNA and l-ascorbate levels. Genes encoding enzymatic components of the ascorbate-glutathione system (e.g. ascorbate peroxidase, manganese superoxide dismutase, and dehydroascorbate reductase) are also up-regulated in response to increased oxidative stress. These results indicate that C. reinhardtii VTC2, like its plant homologs, is a highly regulated enzyme in ascorbate biosynthesis in green algae and that, together with the ascorbate recycling system, the l-galactose pathway represents the major route for providing protective levels of ascorbate in oxidatively stressed algal cells. PMID:22393048

  5. Rubisco activity and gene expression of tropical tree species under ...

    African Journals Online (AJOL)

    Young

    2013-05-15

    May 15, 2013 ... Proteomics analysis associated with gene expression of plants reveal .... Consequently, Rubisco enzyme plays a role in assi- milating into ... technique for examining gene expression encoded at the. mRNA level .... Ammonia.

  6. Cloning and Expression Analysis of MEP Pathway Enzyme-encoding Genes in Osmanthus fragrans

    Directory of Open Access Journals (Sweden)

    Chen Xu

    2016-09-01

    Full Text Available The 2-C-methyl-d-erythritol 4-phosphate (MEP pathway is responsible for the biosynthesis of many crucial secondary metabolites, such as carotenoids, monoterpenes, plastoquinone, and tocopherols. In this study, we isolated and identified 10 MEP pathway genes in the important aromatic plant sweet osmanthus (Osmanthus fragrans. Multiple sequence alignments revealed that 10 MEP pathway genes shared high identities with other reported proteins. The genes showed distinctive expression profiles in various tissues, or at different flower stages and diel time points. The qRT-PCR results demonstrated that these genes were highly expressed in inflorescences, which suggested a tissue-specific transcript pattern. Our results also showed that OfDXS1, OfDXS2, and OfHDR1 had a clear diurnal oscillation pattern. The isolation and expression analysis provides a strong foundation for further research on the MEP pathway involved in gene function and molecular evolution, and improves our understanding of the molecular mechanism underlying this pathway in plants.

  7. Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

    Science.gov (United States)

    2010-01-01

    Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

  8. Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

    Directory of Open Access Journals (Sweden)

    Mishra Mukti N

    2010-07-01

    Full Text Available Abstract Background Carbonic anhydrase (CA is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1. Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

  9. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  10. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  11. The putative endoglucanase PcGH61D from Phanerochaete chrysosporium is a metal-dependent oxidative enzyme that cleaves cellulose.

    Directory of Open Access Journals (Sweden)

    Bjørge Westereng

    Full Text Available Many fungi growing on plant biomass produce proteins currently classified as glycoside hydrolase family 61 (GH61, some of which are known to act synergistically with cellulases. In this study we show that PcGH61D, the gene product of an open reading frame in the genome of Phanerochaete chrysosporium, is an enzyme that cleaves cellulose using a metal-dependent oxidative mechanism that leads to generation of aldonic acids. The activity of this enzyme and its beneficial effect on the efficiency of classical cellulases are stimulated by the presence of electron donors. Experiments with reduced cellulose confirmed the oxidative nature of the reaction catalyzed by PcGH61D and indicated that the enzyme may be capable of penetrating into the substrate. Considering the abundance of GH61-encoding genes in fungi and genes encoding their functional bacterial homologues currently classified as carbohydrate binding modules family 33 (CBM33, this enzyme activity is likely to turn out as a major determinant of microbial biomass-degrading efficiency.

  12. Suicidal gene therapy with rabbit cytochrome P450 4B1/4-ipomeanol, 2-aminoanthracene system in glioma cell

    International Nuclear Information System (INIS)

    Jang, Su Jin; Kang, Joo Hyun; Kim, Kwang Il; Lee, Tae Sup; Lee, Yong Jin; Woo, Kwang Sun; Chung, Wee Sup; Cheon, Gi Jeong; Choi, Chang Woon; Lim, Sang Moo

    2010-01-01

    Suicidal gene therapy is based on the transduction of tumor cells with 'suicide' genes encoding for prodrugactivating enzymes that render target cells susceptible to prodrug treatment. Suicidal gene therapy results in the death of tumor with the expression of gene encoding enzyme that converts non-toxic prodrug into cytotoxic product. Cytochrome P450 4B1 (CYP4B1) activates 4- ipomeanol (4-ipo) and 2-aminoanthracene (2-AA) to cytotoxic furane epoxide and unsaturated dialdehyde intermediate. In this study, therapeutic effects of suicidal gene therapy with rabbit CYP4B1/4-ipo or CYP4B1/2-AA system

  13. Genetic and phylogenetic characterization of the type II cyclobutane pyrimidine dimer photolyases encoded by Leporipoxviruses

    International Nuclear Information System (INIS)

    Bennett, C. James; Webb, Melissa; Willer, David O.; Evans, David H.

    2003-01-01

    Shope fibroma virus and myxoma virus encode proteins predicted to be Type II photolyases. These are enzymes that catalyze light-dependent repair of cyclobutane pyrimidine dimers (CPDs). When the Shope fibroma virus S127L gene was expressed in an Escherichia coli strain lacking functional CPD repair pathways, the expressed gene protected the bacteria from 70-75% of the ultraviolet (UV) light-induced cytotoxic DNA damage. This proportion suggests that Leporipoxvirus photolyases can only repair CPDs, which typically comprise ∼70% of the damage caused by short wavelength UV light. To test whether these enzymes can protect virus genomes from UV, we exposed virus suspensions to UV-C light followed by graded exposure to filtered visible light. Viruses encoding a deletion of the putative photolyase gene were unable to photoreactivate UV damage while this treatment again eliminated 70-90% of the lethal photoproducts in wild-type viruses. Western blotting detected photolyase protein in extracts prepared from purified virions and it can be deduced that the poxvirion interior must be fluid enough to permit diffusion of this ∼50-kDa DNA-binding protein to the sites where it catalyzes photoreactivation. Photolyase promoters are difficult to categorize using bioinformatics methods, as they do not obviously resemble any of the known poxvirus promoter motifs. By fusing the SFV promoter to DNA encoding a luciferase open reading frame, the photolyase promoter was found to exhibit very weak late promoter activity. These data show that the genomes of Leporipoxviruses, similar to that of fowlpox virus, encode catalytically active photolyases. Phylogenetic studies also confirmed the monophyletic origin of poxviruses and suggest an ancient origin for these genes and perhaps poxviruses

  14. Cloning, Characterization, Controlled Overexpression, and Inactivation of the Major Tributyrin Esterase Gene of Lactococcus lactis

    NARCIS (Netherlands)

    Fernández, Leonides; Beerthuyzen, Marke M.; Brown, Julie; Siezen, Roland J.; Coolbear, Tim; Holland, Ross; Kuipers, Oscar P.

    2000-01-01

    The gene encoding the major intracellular tributyrin esterase of Lactococcus lactis was cloned using degenerate DNA probes based on 19 known N-terminal amino acid residues of the purified enzyme. The gene, named estA, was sequenced and found to encode a protein of 258 amino acid residues. The

  15. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  16. The role of carbon starvation in the induction of enzymes that degrade plant-derived carbohydrates in Aspergillus niger.

    Science.gov (United States)

    van Munster, Jolanda M; Daly, Paul; Delmas, Stéphane; Pullan, Steven T; Blythe, Martin J; Malla, Sunir; Kokolski, Matthew; Noltorp, Emelie C M; Wennberg, Kristin; Fetherston, Richard; Beniston, Richard; Yu, Xiaolan; Dupree, Paul; Archer, David B

    2014-11-01

    Fungi are an important source of enzymes for saccharification of plant polysaccharides and production of biofuels. Understanding of the regulation and induction of expression of genes encoding these enzymes is still incomplete. To explore the induction mechanism, we analysed the response of the industrially important fungus Aspergillus niger to wheat straw, with a focus on events occurring shortly after exposure to the substrate. RNA sequencing showed that the transcriptional response after 6h of exposure to wheat straw was very different from the response at 24h of exposure to the same substrate. For example, less than half of the genes encoding carbohydrate active enzymes that were induced after 24h of exposure to wheat straw, were also induced after 6h exposure. Importantly, over a third of the genes induced after 6h of exposure to wheat straw were also induced during 6h of carbon starvation, indicating that carbon starvation is probably an important factor in the early response to wheat straw. The up-regulation of the expression of a high number of genes encoding CAZymes that are active on plant-derived carbohydrates during early carbon starvation suggests that these enzymes could be involved in a scouting role during starvation, releasing inducing sugars from complex plant polysaccharides. We show, using proteomics, that carbon-starved cultures indeed release CAZymes with predicted activity on plant polysaccharides. Analysis of the enzymatic activity and the reaction products, indicates that these proteins are enzymes that can degrade various plant polysaccharides to generate both known, as well as potentially new, inducers of CAZymes. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Isolation of the opdE gene that encodes for a new hydrolase of Enterobacter sp. capable of degrading organophosphorus pesticides.

    Science.gov (United States)

    Chino-Flores, Concepción; Dantán-González, Edgar; Vázquez-Ramos, Alejandra; Tinoco-Valencia, Raunel; Díaz-Méndez, Rafael; Sánchez-Salinas, Enrique; Castrejón-Godínez, Maria Luisa; Ramos-Quintana, Fernando; Ortiz-Hernández, Maria Laura

    2012-06-01

    Microbial enzymes that can hydrolyze organophosphorus compounds have been isolated, identified and characterized from different microbial species in order to use them in biodegradation of organophosphorus compounds. We isolated a bacterial strain Cons002 from an agricultural soil bacterial consortium, which can hydrolyze methyl-parathion (MP) and other organophosphate pesticides. HPLC analysis showed that strain Cons002 is capable of degrading pesticides MP, parathion and phorate. Pulsed-field gel electrophoresis and 16S rRNA amplification were performed for strain characterization and identification, respectively, showing that the strain Cons002 is related to the genus Enterobacter sp. which has a single chromosome of 4.6 Mb and has no plasmids. Genomic library was constructed from DNA of Enterobacter sp. Cons002. A gene called opdE (Organophosphate Degradation from Enterobacter) consists of 753 bp and encodes a protein of 25 kDa, which was isolated using activity methods. This gene opdE had no similarity to any genes reported to degrade organophosphates. When kanamycin-resistance cassette was placed in the gene opdE, hydrolase activity was suppressed and Enterobacter sp. Cons002 had no growth with MP as a nutrients source.

  18. Hepatic transcriptional changes in critical genes for gluconeogenesis following castration of bulls.

    Science.gov (United States)

    Fassah, Dilla Mareistia; Jeong, Jin Young; Baik, Myunggi

    2018-04-01

    This study was performed to understand transcriptional changes in the genes involved in gluconeogenesis and glycolysis pathways following castration of bulls. Twenty Korean bulls were weaned at average 3 months of age, and castrated at 6 months. Liver tissues were collected from bulls (n = 10) and steers (n = 10) of Korean cattle, and hepatic gene expression levels were measured using quantitative real-time polymerase chain reaction. We examined hepatic transcription levels of genes encoding enzymes for irreversible reactions in both gluconeogenesis and glycolysis as well as genes encoding enzymes for the utilization of several glucogenic substrates. Correlations between hepatic gene expression and carcass characteristics were performed to understand their associations. Castration increased the mRNA (3.6 fold; pcastration. Castration increased mRNA levels of both lactate dehydrogenase A (1.5 fold; pCastration increased mRNA levels of glycerol kinase (2.7 fold; pCastration also increased mRNA levels of propionyl-CoA carboxylase beta (mitochondrial) (3.5 fold; pCastration increases transcription levels of critical genes coding for enzymes involved in irreversible gluconeogenesis reactions from pyruvate to glucose and enzymes responsible for incorporation of glucogenic substrates including lactate, glycerol, and propionate. Hepatic gluconeogenic gene expression levels were associated with intramuscular fat deposition.

  19. A function-based screen for seeking RubisCO active clones from metagenomes: novel enzymes influencing RubisCO activity.

    Science.gov (United States)

    Böhnke, Stefanie; Perner, Mirjam

    2015-03-01

    Ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) is a key enzyme of the Calvin cycle, which is responsible for most of Earth's primary production. Although research on RubisCO genes and enzymes in plants, cyanobacteria and bacteria has been ongoing for years, still little is understood about its regulation and activation in bacteria. Even more so, hardly any information exists about the function of metagenomic RubisCOs and the role of the enzymes encoded on the flanking DNA owing to the lack of available function-based screens for seeking active RubisCOs from the environment. Here we present the first solely activity-based approach for identifying RubisCO active fosmid clones from a metagenomic library. We constructed a metagenomic library from hydrothermal vent fluids and screened 1056 fosmid clones. Twelve clones exhibited RubisCO activity and the metagenomic fragments resembled genes from Thiomicrospira crunogena. One of these clones was further analyzed. It contained a 35.2 kb metagenomic insert carrying the RubisCO gene cluster and flanking DNA regions. Knockouts of twelve genes and two intergenic regions on this metagenomic fragment demonstrated that the RubisCO activity was significantly impaired and was attributed to deletions in genes encoding putative transcriptional regulators and those believed to be vital for RubisCO activation. Our new technique revealed a novel link between a poorly characterized gene and RubisCO activity. This screen opens the door to directly investigating RubisCO genes and respective enzymes from environmental samples.

  20. Cloning and expression of DNA encoding a ripening form of a polypeptide having rhamno-galacturonase activity.

    NARCIS (Netherlands)

    Musters, W.; Stam, H.; Suykerbuyk, M.E.; Visser, J.; Verbakel, J.M.

    1993-01-01

    The invention relates to isolation of an Aspergillus gene encoding rhamnogalacturonase (RG-ase) and the construction of recombinant Aspergillus strains with overexpression of RG-ase. These strains can be used for the commercial production of RG-ase. RG-ase is an important enzyme in processes

  1. Characterization of the Holliday junction resolving enzyme encoded by the Bacillus subtilis bacteriophage SPP1.

    Directory of Open Access Journals (Sweden)

    Lisa Zecchi

    Full Text Available Recombination-dependent DNA replication, which is a central component of viral replication restart, is poorly understood in Firmicutes bacteriophages. Phage SPP1 initiates unidirectional theta DNA replication from a discrete replication origin (oriL, and when replication progresses, the fork might stall by the binding of the origin binding protein G38P to the late replication origin (oriR. Replication restart is dependent on viral recombination proteins to synthesize a linear head-to-tail concatemer, which is the substrate for viral DNA packaging. To identify new functions involved in this process, uncharacterized genes from phage SPP1 were analyzed. Immediately after infection, SPP1 transcribes a number of genes involved in recombination and replication from P(E2 and P(E3 promoters. Resequencing the region corresponding to the last two hypothetical genes transcribed from the P(E2 operon (genes 44 and 45 showed that they are in fact a single gene, re-annotated here as gene 44, that encodes a single polypeptide, named gene 44 product (G44P, 27.5 kDa. G44P shares a low but significant degree of identity in its C-terminal region with virus-encoded RusA-like resolvases. The data presented here demonstrate that G44P, which is a dimer in solution, binds with high affinity but without sequence specificity to several double-stranded DNA recombination intermediates. G44P preferentially cleaves Holliday junctions, but also, with lower efficiency, replicated D-loops. It also partially complemented the loss of RecU resolvase activity in B. subtilis cells. These in vitro and in vivo data suggest a role for G44P in replication restart during the transition to concatemeric viral replication.

  2. Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

    Directory of Open Access Journals (Sweden)

    Leila ePazouki

    2015-03-01

    Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

  3. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  4. Bystander or No Bystander for Gene Directed Enzyme Prodrug Therapy

    Directory of Open Access Journals (Sweden)

    Adam V. Patterson

    2009-11-01

    Full Text Available Gene directed enzyme prodrug therapy (GDEPT of cancer aims to improve the selectivity of chemotherapy by gene transfer, thus enabling target cells to convert nontoxic prodrugs to cytotoxic drugs. A zone of cell kill around gene-modified cells due to transfer of toxic metabolites, known as the bystander effect, leads to tumour regression. Here we discuss the implications of either striving for a strong bystander effect to overcome poor gene transfer, or avoiding the bystander effect to reduce potential systemic effects, with the aid of three successful GDEPT systems. This review concentrates on bystander effects and drug development with regard to these enzyme prodrug combinations, namely herpes simplex virus thymidine kinase (HSV-TK with ganciclovir (GCV, cytosine deaminase (CD from bacteria or yeast with 5-fluorocytodine (5-FC, and bacterial nitroreductase (NfsB with 5-(azaridin-1-yl-2,4-dinitrobenzamide (CB1954, and their respective derivatives.

  5. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  6. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  7. The 380 kb pCMU01 plasmid encodes chloromethane utilization genes and redundant genes for vitamin B12- and tetrahydrofolate-dependent chloromethane metabolism in Methylobacterium extorquens CM4: a proteomic and bioinformatics study.

    Directory of Open Access Journals (Sweden)

    Sandro Roselli

    Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of

  8. Suicidal gene therapy with rabbit cytochrome P450 4B1/4-ipomeanol, 2-aminoanthracene system in glioma cell

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Su Jin; Kang, Joo Hyun; Kim, Kwang Il; Lee, Tae Sup; Lee, Yong Jin; Woo, Kwang Sun; Chung, Wee Sup; Cheon, Gi Jeong; Choi, Chang Woon; Lim, Sang Moo [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2010-10-15

    Suicidal gene therapy is based on the transduction of tumor cells with 'suicide' genes encoding for prodrugactivating enzymes that render target cells susceptible to prodrug treatment. Suicidal gene therapy results in the death of tumor with the expression of gene encoding enzyme that converts non-toxic prodrug into cytotoxic product. Cytochrome P450 4B1 (CYP4B1) activates 4- ipomeanol (4-ipo) and 2-aminoanthracene (2-AA) to cytotoxic furane epoxide and unsaturated dialdehyde intermediate. In this study, therapeutic effects of suicidal gene therapy with rabbit CYP4B1/4-ipo or CYP4B1/2-AA system

  9. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  10. Expression profiling of S. pombe acetyltransferase mutants identifies redundant pathways of gene regulation

    Directory of Open Access Journals (Sweden)

    Wright Anthony PH

    2010-01-01

    Full Text Available Abstract Background Histone acetyltransferase enzymes (HATs are implicated in regulation of transcription. HATs from different families may overlap in target and substrate specificity. Results We isolated the elp3+ gene encoding the histone acetyltransferase subunit of the Elongator complex in fission yeast and characterized the phenotype of an Δelp3 mutant. We examined genetic interactions between Δelp3 and two other HAT mutants, Δmst2 and Δgcn5 and used whole genome microarray analysis to analyze their effects on gene expression. Conclusions Comparison of phenotypes and expression profiles in single, double and triple mutants indicate that these HAT enzymes have overlapping functions. Consistent with this, overlapping specificity in histone H3 acetylation is observed. However, there is no evidence for overlap with another HAT enzyme, encoded by the essential mst1+ gene.

  11. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  12. Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

    Science.gov (United States)

    Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

    2018-04-18

    This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

  13. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  14. Identification, expression, and characterization of a novel bacterial RGI Lyase enzyme for the production of bio-functional fibers

    DEFF Research Database (Denmark)

    da Silva, Ines Isabel Cardoso Rodrigues; Larsen, Dorte Møller; Meyer, Anne S.

    2011-01-01

    A gene encoding a putative rhamnogalacturonan I (RGI) Lyase (EC 4.2.2.-) from Bacillus licheniformis (DSM13) was selected after a homology search and phylogenetic analysis and optimized with respect to codon usage. The designed gene was transformed into Pichia pastoris and the enzyme was produced...

  15. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  16. Description of electrophoretic loci and tissue specific gene ...

    African Journals Online (AJOL)

    Protein electrophoresis was used to study the distributions and tissue specificity of gene expression of enzymes encoded by 42 loci in Rhinolophus clivosus and R. landeri, the genetically most divergent of the ten species of southern African horseshoe bats. No differences in gene expression were found between R.

  17. Evaluating Functional Annotations of Enzymes Using the Gene Ontology.

    Science.gov (United States)

    Holliday, Gemma L; Davidson, Rebecca; Akiva, Eyal; Babbitt, Patricia C

    2017-01-01

    The Gene Ontology (GO) (Ashburner et al., Nat Genet 25(1):25-29, 2000) is a powerful tool in the informatics arsenal of methods for evaluating annotations in a protein dataset. From identifying the nearest well annotated homologue of a protein of interest to predicting where misannotation has occurred to knowing how confident you can be in the annotations assigned to those proteins is critical. In this chapter we explore what makes an enzyme unique and how we can use GO to infer aspects of protein function based on sequence similarity. These can range from identification of misannotation or other errors in a predicted function to accurate function prediction for an enzyme of entirely unknown function. Although GO annotation applies to any gene products, we focus here a describing our approach for hierarchical classification of enzymes in the Structure-Function Linkage Database (SFLD) (Akiva et al., Nucleic Acids Res 42(Database issue):D521-530, 2014) as a guide for informed utilisation of annotation transfer based on GO terms.

  18. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: proach@iupui.edu [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)

    2009-12-25

    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  19. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    OpenAIRE

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

  20. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  1. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  2. Discovery of new enzymes and metabolic pathways using structure and genome context

    Science.gov (United States)

    Zhao, Suwen; Kumar, Ritesh; Sakai, Ayano; Vetting, Matthew W.; Wood, B. McKay; Brown, Shoshana; Bonanno, Jeffery B.; Hillerich, Brandan S.; Seidel, Ronald D.; Babbitt, Patricia C.; Almo, Steven C.; Sweedler, Jonathan V.; Gerlt, John A.; Cronan, John E.; Jacobson, Matthew P.

    2014-01-01

    Assigning valid functions to proteins identified in genome projects is challenging, with over-prediction and database annotation errors major concerns1. We, and others2, are developing computation-guided strategies for functional discovery using “metabolite docking” to experimentally derived3 or homology-based4 three-dimensional structures. Bacterial metabolic pathways often are encoded by “genome neighborhoods” (gene clusters and/or operons), which can provide important clues for functional assignment. We recently demonstrated the synergy of docking and pathway context by “predicting” the intermediates in the glycolytic pathway in E. coli5. Metabolite docking to multiple binding proteins/enzymes in the same pathway increases the reliability of in silico predictions of substrate specificities because the pathway intermediates are structurally similar. We report that structure-guided approaches for predicting the substrate specificities of several enzymes encoded by a bacterial gene cluster allowed i) the correct prediction of the in vitro activity of a structurally characterized enzyme of unknown function (PDB 2PMQ), 2-epimerization of trans-4-hydroxy-L-proline betaine (tHyp-B) and cis-4-hydroxy-D-proline betaine (cHyp-B), and ii) the correct identification of the catabolic pathway in which Hyp-B 2-epimerase participates. The substrate-liganded pose predicted by virtual library screening (docking) was confirmed experimentally. The enzymatic activities in the predicted pathway were confirmed by in vitro assays and genetic analyses; the intermediates were identified by metabolomics; and repression of the genes encoding the pathway by high salt was established by transcriptomics, confirming the osmolyte role of tHyp-B. This study establishes the utility of structure-guide functional predictions to enable the discovery of new metabolic pathways. PMID:24056934

  3. Effects of Heat Acclimation on Photosynthesis, Antioxidant Enzyme Activities, and Gene Expression in Orchardgrass under Heat Stress

    Directory of Open Access Journals (Sweden)

    Xin Xin Zhao

    2014-09-01

    Full Text Available The present study was designed to examine the effects of heat acclimation on enzymatic activity, transcription levels, the photosynthesis processes associated with thermostability in orchardgrass (Dactylis glomerata L..The stomatal conductance (Gs, net photosynthetic rate (Pn, and transpiration rates (Tr of both heat-acclimated (HA and non-acclimated (NA plants were drastically reduced during heat treatment [using a 5-day heat stress treatment (38/30 °C ‒ day/night followed by a 3-day recovery under control conditions (25/20 °C ‒ day/night, in order to consolidate the second cycle was permitted]. Water use efficiency increased more steeply in the HA (4.9 times versus the NA (1.8 times plants, and the intercellular CO2 concentration decreased gently in NA (10.9% and HA (25.3% plants after 20 d of treatments compared to 0 days’. Furthermore, heat-acclimated plants were able to maintain significant activity levels of superoxide disumutase (SOD, catalase (CAT, guaiacol peroxidase (POD, and transcription levels of genes encoding these enzymes; in addition, HA plants displayed lower malondialdehyde content and lower electrolyte leakage than NA plants. These results suggest that maintenance of activity and transcription levels of antioxidant enzymes as well as photosynthesis are associated with variable thermostability in HA and NA plants. This likely occurs through cellular membrane stabilization and improvements in water use efficiency in the photosynthetic process during heat stress. The association between antioxidant enzyme activity and gene expression, both of which may vary with genetic variation in heat tolerance, is important to further understand the molecular mechanisms that contribute to heat tolerance.

  4. The in vitro redundant enzymes PurN and PurT are both essential for systemic infection of mice in Salmonella enterica serovar Typhimurium

    DEFF Research Database (Denmark)

    Jelsbak, Lotte; Mortensen, Mie Ina Bjerregaard; Kilstrup, Mogens

    2016-01-01

    the third step in the purine synthesis. Surprisingly the results of the current study demonstrated that single gene deletions of each of the genes encoding these enzymes caused attenuation (competitive infection index fast as the wild type...

  5. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-04-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

  6. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

  7. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  8. Multiplex PCR assay for detection of recombinant genes encoding fatty acid desaturases fused with lichenase reporter protein in GM plants.

    Science.gov (United States)

    Berdichevets, Iryna N; Shimshilashvili, Hristina R; Gerasymenko, Iryna M; Sindarovska, Yana R; Sheludko, Yuriy V; Goldenkova-Pavlova, Irina V

    2010-07-01

    Thermostable lichenase encoded by licB gene of Clostridium thermocellum can be used as a reporter protein in plant, bacterial, yeast, and mammalian cells. It has important advantages of high sensitivity and specificity in qualitative and quantitative assays. Deletion variants of LicB (e.g., LicBM3) retain its enzymatic activity and thermostability and can be expressed in translational fusion with target proteins without compromising with their properties. Fusion with the lichenase reporter is especially convenient for the heterologous expression of proteins whose analysis is difficult or compromised by host enzyme activities, as it is in case of fatty acid desaturases occurring in all groups of organisms. Recombinant desaturase-lichenase genes can be used for creating genetically modified (GM) plants with improved chill tolerance. Development of an analytical method for detection of fused desaturase-lichenase transgenes is necessary both for production of GM plants and for their certification. Here, we report a multiplex polymerase chain reaction method for detection of desA and desC desaturase genes of cyanobacteria Synechocystis sp. PCC6803 and Synechococcus vulcanus, respectively, fused to licBM3 reporter in GM plants.

  9. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  10. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  11. Effect of deletion polymorphism of angiotensin converting enzyme gene on progression of diabetic nephropathy during inhibition of angiotensin converting enzyme

    DEFF Research Database (Denmark)

    Parving, H H; Jacobsen, P; Tarnow, L

    1996-01-01

    OBJECTIVE: To evaluate the concept that an insertion/deletion polymorphism of the angiotensin converting enzyme gene predicts the therapeutic efficacy of inhibition of angiotensin converting enzyme on progression of diabetic nephropathy. DESIGN: Observational follow up study of patients with insu...

  12. Minor Threonine Dehydratase Encoded Within the Threonine Synthetic Region of Bacillus subtilis1

    Science.gov (United States)

    Vapnek, Daniel; Greer, Sheldon

    1971-01-01

    Challenging auxotrophs on metabolites that are precursors of a biosynthetic step involving a mutated enzyme has revealed a new class of suppressor mutations which act by derepressing a minor enzyme activity not normally detected in the wild-type strain. These indirect, partial suppressor mutations which allow isoleucine auxotrophs to grow on homoserine or threonine have been analyzed to determine their effect on enzymes involved in the biosynthesis of these amino acids. It has been found that one class of these suppressor mutations (sprA) leads to the derepression of homoserine kinase, homoserine dehydrogenase, and a minor threonine dehydratase that is not sufficiently active to be detected in the wild-type strain. The gene encoding this second threonine dehydratase activity has been found to be located between the structural genes for homoserine kinase and homoserine dehydrogenase. The results of these experiments indicate that plating of auxotrophs on precursors of a biosynthetic step involving mutated enzymes could prove to be a valuable method for the detection of regulatory mutants as well as a possible tool in studying the evolution of biochemical pathways. PMID:4997544

  13. Stannous Fluoride Effects on Gene Expression of Streptococcus mutans and Actinomyces viscosus.

    Science.gov (United States)

    Shi, Y; Li, R; White, D J; Biesbrock, A R

    2018-02-01

    A genome-wide transcriptional analysis was performed to elucidate the bacterial cellular response of Streptococcus mutans and Actinomyces viscosus to NaF and SnF 2 . The minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC) of SnF 2 were predetermined before microarray study. Gene expression profiling microarray experiments were carried out in the absence (control) and presence (experimental) of 10 ppm and 100 ppm Sn 2+ (in the form of SnF 2 ) and fluoride controls for 10-min exposures (4 biological replicates/treatment). These Sn 2+ levels and treatment time were chosen because they have been shown to slow bacterial growth of S. mutans (10 ppm) and A. viscosus (100 ppm) without affecting cell viability. All data generated by microarray experiments were analyzed with bioinformatics tools by applying the following criteria: 1) a q value should be ≤0.05, and 2) an absolute fold change in transcript level should be ≥1.5. Microarray results showed SnF 2 significantly inhibited several genes encoding enzymes of the galactose pathway upon a 10-min exposure versus a negative control: lacA and lacB (A and B subunits of the galactose-6-P isomerase), lacC (tagatose-6-P kinase), lacD (tagatose-1,6-bP adolase), galK (galactokinase), galT (galactose-1-phosphate uridylyltransferase), and galE (UDP-glucose 4-epimerase). A gene fruK encoding fructose-1-phosphate kinase in the fructose pathway was also significantly inhibited. Several genes encoding fructose/mannose-specific enzyme IIABC components in the phosphotransferase system (PTS) were also downregulated, as was ldh encoding lactate dehydrogenase, a key enzyme involved in lactic acid synthesis. SnF 2 downregulated the transcription of most key enzyme genes involved in the galactose pathway and also suppressed several key genes involved in the PTS, which transports sugars into the cell in the first step of glycolysis.

  14. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  15. Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption

    Science.gov (United States)

    2013-01-01

    Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

  16. The Physiological and Biochemical Mechanisms Providing the Increased Constitutive Cold Resistance in the Potato Plants, Expressing the Yeast SUC2 Gene Encoding Apoplastic Invertase

    Directory of Open Access Journals (Sweden)

    A.N. Deryabin

    2016-05-01

    Full Text Available The expression of heterologous genes in plants is an effective method to improve our understanding of plant resistance mechanisms. The purpose of this work was to investigate the involvement of cell-wall invertase and apoplastic sugars into constitutive cold resistance of potato (Solanum tuberosum L., cv. Dйsirйe plants, which expressed the yeast SUC2 gene encoding apoplastic invertase. WT-plants of a potato served as the control. The increase in the essential cell-wall invertase activity in the leaves of transformed plants indicates significant changes in the cellular carbohydrate metabolism and regulatory function of this enzyme. The activity of yeast invertase changed the composition of intracellular sugars in the leaves of the transformed potato plant. The total content of sugars (sucrose, glucose, fructose in the leaves and apoplast was higher in the transformants, in comparison by WT-plants. Our data indicate higher constitutive resistance of transformants to severe hypothermia conditions compared to WT-plants. This fact allows us to consider cell-wall invertase as a enzyme of carbohydrate metabolism playing an important regulatory role in the metabolic signaling upon forming increased plant resistance to low temperature. Thus, the potato line with the integrated SUC2 gene is a convenient tool to study the role of the apoplastic invertase and the products of its activity during growth, development and formation constitutive resistance to hypothermia.

  17. CLINICAL SIGNIFICANCE OF 5αα-REDUCTASE AND ANDROGEN RECEPTOR GENE POLYMORPHISMS IN PROSTATE CANCER

    Directory of Open Access Journals (Sweden)

    O. B. Loran

    2014-07-01

    Full Text Available The development of prostate cancer is inseparably linked with the effect of androgens on the fundamental prostatic intracellular processes,such as proliferation, apoptosis, which is realized through a number of second messengers. Major of them are the AR gene encoding androgenreceptors and the SRD5A2 gene encoding 5α-reductase enzyme. This paper deals with the study of the role of these genes in prostate cancer.  

  18. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  19. Differential Gene Expression by Lactobacillus plantarum WCFS1 in Response to Phenolic Compounds Reveals New Genes Involved in Tannin Degradation.

    Science.gov (United States)

    Reverón, Inés; Jiménez, Natalia; Curiel, José Antonio; Peñas, Elena; López de Felipe, Félix; de Las Rivas, Blanca; Muñoz, Rosario

    2017-04-01

    Lactobacillus plantarum is a lactic acid bacterium that can degrade food tannins by the successive action of tannase and gallate decarboxylase enzymes. In the L. plantarum genome, the gene encoding the catalytic subunit of gallate decarboxylase ( lpdC , or lp_2945 ) is only 6.5 kb distant from the gene encoding inducible tannase ( L. plantarum tanB [ tanB Lp ], or lp_2956 ). This genomic context suggests concomitant activity and regulation of both enzymatic activities. Reverse transcription analysis revealed that subunits B ( lpdB , or lp_0271 ) and D ( lpdD , or lp_0272 ) of the gallate decarboxylase are cotranscribed, whereas subunit C ( lpdC , or lp_2945 ) is cotranscribed with a gene encoding a transport protein ( gacP , or lp_2943 ). In contrast, the tannase gene is transcribed as a monocistronic mRNA. Investigation of knockout mutations of genes located in this chromosomal region indicated that only mutants of the gallate decarboxylase (subunits B and C), tannase, GacP transport protein, and TanR transcriptional regulator ( lp_2942 ) genes exhibited altered tannin metabolism. The expression profile of genes involved in tannin metabolism was also analyzed in these mutants in the presence of methyl gallate and gallic acid. It is noteworthy that inactivation of tanR suppresses the induction of all genes overexpressed in the presence of methyl gallate and gallic acid. This transcriptional regulator was also induced in the presence of other phenolic compounds, such as kaempferol and myricetin. This study complements the catalog of L. plantarum expression profiles responsive to phenolic compounds, which enable this bacterium to adapt to a plant food environment. IMPORTANCE Lactobacillus plantarum is a bacterial species frequently found in the fermentation of vegetables when tannins are present. L. plantarum strains degrade tannins to the less-toxic pyrogallol by the successive action of tannase and gallate decarboxylase enzymes. The genes encoding these enzymes are

  20. The Arabidopsis thaliana REDUCED EPIDERMAL FLUORESCENCE1 gene encodes an aldehyde dehydrogenase involved in ferulic acid and sinapic acid biosynthesis.

    Science.gov (United States)

    Nair, Ramesh B; Bastress, Kristen L; Ruegger, Max O; Denault, Jeff W; Chapple, Clint

    2004-02-01

    Recent research has significantly advanced our understanding of the phenylpropanoid pathway but has left in doubt the pathway by which sinapic acid is synthesized in plants. The reduced epidermal fluorescence1 (ref1) mutant of Arabidopsis thaliana accumulates only 10 to 30% of the sinapate esters found in wild-type plants. Positional cloning of the REF1 gene revealed that it encodes an aldehyde dehydrogenase, a member of a large class of NADP(+)-dependent enzymes that catalyze the oxidation of aldehydes to their corresponding carboxylic acids. Consistent with this finding, extracts of ref1 leaves exhibit low sinapaldehyde dehydrogenase activity. These data indicate that REF1 encodes a sinapaldehyde dehydrogenase required for sinapic acid and sinapate ester biosynthesis. When expressed in Escherichia coli, REF1 was found to exhibit both sinapaldehyde and coniferaldehyde dehydrogenase activity, and further phenotypic analysis of ref1 mutant plants showed that they contain less cell wall-esterified ferulic acid. These findings suggest that both ferulic acid and sinapic acid are derived, at least in part, through oxidation of coniferaldehyde and sinapaldehyde. This route is directly opposite to the traditional representation of phenylpropanoid metabolism in which hydroxycinnamic acids are instead precursors of their corresponding aldehydes.

  1. Characterization of the gene encoding serine acetyltransferase, a regulated enzyme of cysteine biosynthesis from the protist parasites Entamoeba histolytica and Entamoeba dispar. Regulation and possible function of the cysteine biosynthetic pathway in Entamoeba.

    Science.gov (United States)

    Nozaki, T; Asai, T; Sanchez, L B; Kobayashi, S; Nakazawa, M; Takeuchi, T

    1999-11-05

    The enteric protist parasites Entamoeba histolytica and Entamoeba dispar possess a cysteine biosynthetic pathway, unlike their mammalian host, and are capable of de novo production of L-cysteine. We cloned and characterized cDNAs that encode the regulated enzyme serine acetyltransferase (SAT) in this pathway from these amoebae by genetic complementation of a cysteine-auxotrophic Escherichia coli strain with the amoebic cDNA libraries. The deduced amino acid sequences of the amoebic SATs exhibited, within the most conserved region, 36-52% identities with the bacterial and plant SATs. The amoebic SATs contain a unique insertion of eight amino acids, also found in the corresponding region of a plasmid-encoded SAT from Synechococcus sp., which showed the highest overall identities to the amoebic SATs. Phylogenetic reconstruction also revealed a close kinship of the amoebic SATs with cyanobacterial SATs. Biochemical characterization of the recombinant E. histolytica SAT revealed several enzymatic features that distinguished the amoebic enzyme from the bacterial and plant enzymes: 1) inhibition by L-cysteine in a competitive manner with L-serine; 2) inhibition by L-cystine; and 3) no association with cysteine synthase. Genetically engineered amoeba strains that overproduced cysteine synthase and SAT were created. The cysteine synthase-overproducing amoebae had a higher level of cysteine synthase activity and total thiol content and revealed increased resistance to hydrogen peroxide. These results indicate that the cysteine biosynthetic pathway plays an important role in antioxidative defense of these enteric parasites.

  2. Characterization of inhibitor(s) of β-glucuronidase enzyme activity in GUS-transgenic wheat

    KAUST Repository

    Ramadan, Ahmed M Ali

    2011-06-26

    The uidA gene, encoding for β-glucuronidase (GUS), is the most frequently used reporter gene in plants. As a reporter enzyme, GUS can be assayed both qualitatively and quantitatively. In wheat, there are numerous reports of failure in detecting GUS enzyme activity in tissues of transgenic plants, while other reports have suggested presence of β-glucuronidase inhibitor(s) in wheat tissues. In the present study, we show that the β-glucuronidase enzyme activity is not only tissue-specific but also genotype-dependent. Our data demonstrate that the glucuronic acid could be the candidate inhibitor for β-glucuronidase enzyme activity in wheat leaves and roots. It should be noted that the assays to detect β-glucuronidase enzyme activity in wheat should be interpreted carefully. Based on the data of our present study, we recommend studying the chemical pathways, the unintended effects and the possible loss-of-function of any candidate transgene prior to transformation experiments. © 2011 Springer Science+Business Media B.V.

  3. Characterization of inhibitor(s) of β-glucuronidase enzyme activity in GUS-transgenic wheat

    KAUST Repository

    Ramadan, Ahmed M Ali; Eissa, Hala F.; El-Domyati, Fotouh M.; Saleh, Osama Mesilhy; Ibrahim, Nasser E.; Salama, M. I.; Mahfouz, Magdy M.; Bahieldin, Ahmed M.

    2011-01-01

    The uidA gene, encoding for β-glucuronidase (GUS), is the most frequently used reporter gene in plants. As a reporter enzyme, GUS can be assayed both qualitatively and quantitatively. In wheat, there are numerous reports of failure in detecting GUS enzyme activity in tissues of transgenic plants, while other reports have suggested presence of β-glucuronidase inhibitor(s) in wheat tissues. In the present study, we show that the β-glucuronidase enzyme activity is not only tissue-specific but also genotype-dependent. Our data demonstrate that the glucuronic acid could be the candidate inhibitor for β-glucuronidase enzyme activity in wheat leaves and roots. It should be noted that the assays to detect β-glucuronidase enzyme activity in wheat should be interpreted carefully. Based on the data of our present study, we recommend studying the chemical pathways, the unintended effects and the possible loss-of-function of any candidate transgene prior to transformation experiments. © 2011 Springer Science+Business Media B.V.

  4. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

    Science.gov (United States)

    Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

    2017-06-25

    Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

  5. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  6. Molecular cloning and expression of heteromeric ACCase subunit genes from Jatropha curcas.

    Science.gov (United States)

    Gu, Keyu; Chiam, Huihui; Tian, Dongsheng; Yin, Zhongchao

    2011-04-01

    Acetyl-CoA carboxylase (ACCase) catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA, which is the essential first step in the biosynthesis of long-chain fatty acids. ACCase exists as a multi-subunit enzyme in most prokaryotes and the chloroplasts of most plants and algae, while it is present as a multi-domain enzyme in the endoplasmic reticulum of most eukaryotes. The heteromeric ACCase of higher plants consists of four subunits: an α-subunit of carboxyltransferase (α-CT, encoded by accA gene), a biotin carboxyl carrier protein (BCCP, encoded by accB gene), a biotin carboxylase (BC, encoded by accC gene) and a β-subunit of carboxyltransferase (β-CT, encoded by accD gene). In this study, we cloned and characterized the genes accA, accB1, accC and accD that encode the subunits of heteromeric ACCase in Jatropha (Jatropha curcas), a potential biofuel plant. The full-length cDNAs of the four subunit genes were isolated from a Jatropha cDNA library and by using 5' RACE, whereas the genomic clones were obtained from a Jatropha BAC library. They encode a 771 amino acid (aa) α-CT, a 286-aa BCCP1, a 537-aa BC and a 494-aa β-CT, respectively. The single-copy accA, accB1 and accC genes are nuclear genes, while the accD gene is located in chloroplast genome. Jatropha α-CT, BCCP1, BC and β-CT show high identity to their homologues in other higher plants at amino acid level and contain all conserved domains for ACCase activity. The accA, accB1, accC and accD genes are temporally and spatially expressed in the leaves and endosperm of Jatropha plants, which are regulated by plant development and environmental factors. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  7. Methods for the Isolation of Genes Encoding Novel PHA Metabolism Enzymes from Complex Microbial Communities.

    Science.gov (United States)

    Cheng, Jiujun; Nordeste, Ricardo; Trainer, Maria A; Charles, Trevor C

    2017-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates the functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  8. Methods for the isolation of genes encoding novel PHB cycle enzymes from complex microbial communities.

    Science.gov (United States)

    Nordeste, Ricardo F; Trainer, Maria A; Charles, Trevor C

    2010-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bioplastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti allows for the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates finding functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  9. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Cloning, expression and characterization of a gene from earthworm Eisenia fetida encoding a blood-clot dissolving protein.

    Directory of Open Access Journals (Sweden)

    GangQiang Li

    Full Text Available A lumbrokinase gene encoding a blood-clot dissolving protein was cloned from earthworm (Eisenia fetida by RT-PCR amplification. The gene designated as CST1 (GenBank No. AY840996 was sequence analyzed. The cDNA consists of 888 bp with an open reading frame of 729 bp, which encodes 242 amino acid residues. Multiple sequence alignments revealed that CST1 shares similarities and conserved amino acids with other reported lumbrokinases. The amino acid sequence of CST1 exhibits structural features similar to those found in other serine proteases, including human tissue-type (tPA, urokinase (uPA, and vampire bat (DSPAα1 plasminogen activators. CST1 has a conserved catalytic triad, found in the active sites of protease enzymes, which are important residues involved in polypeptide catalysis. CST1 was expressed as inclusion bodies in Escherichia coli BL21(DE3. The molecular mass of recombinant CST1 (rCST was 25 kDa as estimated by SDS-PAGE, and further confirmed by Western Blot analysis. His-tagged rCST1 was purified and renatured using nickel-chelating resin with a recovery rate of 50% and a purity of 95%. The purified, renatured rCST1 showed fibrinolytic activity evaluated by both a fibrin plate and a blood clot lysis assay. rCST1 degraded fibrin on the fibrin plate. A significant percentage (65.7% of blood clot lysis was observed when blood clot was treated with 80 mg/mL of rCST1 in vitro. The antithrombotic activity of rCST1 was 912 units/mg calculated by comparison with the activity of a lumbrokinase standard. These findings indicate that rCST1 has potential as a potent blood-clot treatment. Therefore, the expression and purification of a single lumbrokinase represents an important improvement in the use of lumbrokinases.

  11. Two Bombyx mori acetylcholinesterase genes influence motor control and development in different ways

    Science.gov (United States)

    Among its other biological roles, acetylcholinesterase (AChE, EC 3.1.1.7), encoded by two ace genes in most insects, catalyses the breakdown of acetylcholine, thereby terminating synaptic transmission. ace1 encodes the synaptic enzyme and ace2 has other essential actions in many insect species, such...

  12. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  13. Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.

    Science.gov (United States)

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T

    2013-11-01

    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.

  14. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  15. Genetic analysis of the pelA-pelE cluster encoding the acidic and basic pectate lyases in Erwinia chrysanthemi EC16.

    Science.gov (United States)

    Barras, F; Chatterjee, A K

    1987-10-01

    In Erwinia chrysanthemi (EC16) the clustered pelA and pelE genes encode an acidic (pI 4.2) and a basic (pI 10.0) pectate lyase (Pel), respectively. The pelA gene has been isolated on a 1.2 kb restriction fragment and the direction of transcription determined. DNA hybridization analysis showed that the pelE sequence shares DNA homology with pelA but not with pelB or pelC, two genes encoding other Pel species in EC16. Since Pel A and Pel E enzymes showed little similarity in terms of catalytic properties, it is proposed that pelA and pelE are duplicates which have highly diverged.

  16. Angiotensin-I converting enzyme gene and I/D polymorphism ...

    Indian Academy of Sciences (India)

    Angiotensin-I converting enzyme gene and I/D polymorphism distribution in the Greek population and a comparison with other European populations. Sekerli Eleni Katsanidis Dimitrios Papadopoulou Vaya Makedou Areti Vavatsi Norma Gatzola Magdalini. Research Note Volume 87 Issue 1 April 2008 pp 91-93 ...

  17. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  18. Indirect Enzyme-Linked Immunosorbent Assay for Detection of Immunoglobulin G Reactive with a Recombinant Protein Expressed from the Gene Encoding the 116-Kilodalton Protein of Mycoplasma pneumoniae

    OpenAIRE

    Duffy, Michael F.; Whithear, Kevin G.; Noormohammadi, Amir H.; Markham, Philip F.; Catton, Michael; Leydon, Jennie; Browning, Glenn F.

    1999-01-01

    Serology remains the method of choice for laboratory diagnosis of Mycoplasma pneumoniae infection. Currently available serological tests employ complex cellular fractions of M. pneumoniae as antigen. To improve the specificity of M. pneumoniae diagnosis, a recombinant protein was assessed as a serodiagnostic reagent. A panel of recombinant proteins were expressed from a cloned M. pneumoniae gene that encodes a 116-kDa surface protein antigen. The recombinant proteins were assessed for reactiv...

  19. Molecular diversity of tuliposide A-converting enzyme in the tulip.

    Science.gov (United States)

    Nomura, Taiji; Tsuchigami, Aya; Ogita, Shinjiro; Kato, Yasuo

    2013-01-01

    Tuliposide A-converting enzyme (TCEA) catalyzes the conversion of 6-tuliposide A to its lactonized aglycon, tulipalin A, in the tulip (Tulipa gesneriana). The TgTCEA gene, isolated previously from petals, was transcribed in all tulip tissues but not in the bulbs despite the presence of TCEA activity, which allowed prediction of the presence of a TgTCEA isozyme gene preferentially expressed in the bulbs. Here, the TgTCEA-b gene, the TgTCEA homolog, was identified in bulbs. TgTCEA-b polypeptides showed approximately 77% identity to the petal TgTCEA. Functional characterization of the recombinant enzyme verified that TgTCEA-b encoded the TCEA. Moreover, the TgTCEA-b was found to be localized to plastids, as found for the petal TgTCEA. Transcript analysis revealed that TgTCEA-b was functionally transcribed in the bulb scales, unlike the TgTCEA gene, whose transcripts were absent there. In contrast, TgTCEA-b transcripts were in the minority in other tissues where TgTCEA transcripts were dominant, indicating a tissue preference for the transcription of those isozyme genes.

  20. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  1. Up-regulation of glutathione-related genes, enzyme activities and transport proteins in human cervical cancer cells treated with doxorubicin.

    Science.gov (United States)

    Drozd, Ewa; Krzysztoń-Russjan, Jolanta; Marczewska, Jadwiga; Drozd, Janina; Bubko, Irena; Bielak, Magda; Lubelska, Katarzyna; Wiktorska, Katarzyna; Chilmonczyk, Zdzisław; Anuszewska, Elżbieta; Gruber-Bzura, Beata

    2016-10-01

    Doxorubicin (DOX), one of the most effective anticancer drugs, acts in a variety of ways including DNA damage, enzyme inhibition and generation of reactive oxygen species. Glutathione (GSH) and glutathione-related enzymes including: glutathione peroxidase (GPX), glutathione reductase (GSR) and glutathione S-transferases (GST) may play a role in adaptive detoxification processes in response to the oxidative stress, thus contributing to drug resistance phenotype. In this study, we investigated effects of DOX treatment on expression and activity of GSH-related enzymes and multidrug resistance-associated proteins in cultured human cervical cancer cells displaying different resistance against this drug (HeLa and KB-V1). Determination of expression level of genes encoding GST isoforms and MRP proteins (GCS, GPX, GSR, GSTA1-3, GSTM1, GSTP1, ABCC1-3, MGST1-3) was performed using StellARray™ Technology. Enzymatic activities of GPX and GSR were measured using biochemical methods. Expression of MRP1 was examined by immunofluorescence microscopy. This study showed that native expression levels of GSTM1 and GSTA3 were markedly higher in KB-V1 cells (2000-fold and 200-fold) compared to HeLa cells. Resistant cells have also shown significantly elevated expression of GSTA1 and GSTA2 genes (200-fold and 50-fold) as a result of DOX treatment. In HeLa cells, exposure to DOX increased expression of all genes: GSTM1 (7-fold) and GSTA1-3 (550-fold, 150-fold and 300-fold). Exposure to DOX led to the slight increase of GCS expression as well as GPX activity in KB-V1 cells, while in HeLa cells it did not. Expression of ABCC1 (MRP1) was not increased in any of the tested cell lines. Our results indicate that expression of GSTM1 and GSTA1-3 genes is up-regulated by DOX treatment and suggest that activity of these genes may be associated with drug resistance of the tested cells. At the same time, involvement of MRP1 in DOX resistance in the given experimental conditions is unlikely

  2. Polygalacturonase from Sitophilus oryzae: Possible horizontal transfer of a pectinase gene from fungi to weevils

    Directory of Open Access Journals (Sweden)

    Zhicheng Shen

    2003-08-01

    Full Text Available Endo-polygalacturonase, one of the group of enzymes known collectively as pectinases, is widely distributed in bacteria, plants and fungi. The enzyme has also been found in several weevil species and a few other insects, such as aphids, but not in Drosophila melanogaster, Anopheles gambiae, or Caenorhabditis elegans or, as far as is known, in any more primitive animal species. What, then, is the genetic origin of the polygalacturonases in weevils? Since some weevil species harbor symbiotic microorganisms, it has been suggested, reasonably, that the symbionts' genomes of both aphids and weevils, rather than the insects' genomes, could encode polygalacturonase. We report here the cloning of a cDNA that encodes endo-polygalacturonase in the rice weevil, Sitophilus oryzae (L., and investigations based on the cloned cDNA. Our results, which include analysis of genes in antibiotic-treated rice weevils, indicate that the enzyme is, in fact, encoded by the insect genome. Given the apparent absence of the gene in much of the rest of the animal kingdom, it is therefore likely that the rice weevil polygalacturonase gene was incorporated into the weevil's genome by horizontal transfer, possibly from a fungus.

  3. Xylan utilization in human gut commensal bacteria is orchestrated by unique modular organization of polysaccharide-degrading enzymes.

    Science.gov (United States)

    Zhang, Meiling; Chekan, Jonathan R; Dodd, Dylan; Hong, Pei-Ying; Radlinski, Lauren; Revindran, Vanessa; Nair, Satish K; Mackie, Roderick I; Cann, Isaac

    2014-09-02

    Enzymes that degrade dietary and host-derived glycans represent the most abundant functional activities encoded by genes unique to the human gut microbiome. However, the biochemical activities of a vast majority of the glycan-degrading enzymes are poorly understood. Here, we use transcriptome sequencing to understand the diversity of genes expressed by the human gut bacteria Bacteroides intestinalis and Bacteroides ovatus grown in monoculture with the abundant dietary polysaccharide xylan. The most highly induced carbohydrate active genes encode a unique glycoside hydrolase (GH) family 10 endoxylanase (BiXyn10A or BACINT_04215 and BACOVA_04390) that is highly conserved in the Bacteroidetes xylan utilization system. The BiXyn10A modular architecture consists of a GH10 catalytic module disrupted by a 250 amino acid sequence of unknown function. Biochemical analysis of BiXyn10A demonstrated that such insertion sequences encode a new family of carbohydrate-binding modules (CBMs) that binds to xylose-configured oligosaccharide/polysaccharide ligands, the substrate of the BiXyn10A enzymatic activity. The crystal structures of CBM1 from BiXyn10A (1.8 Å), a cocomplex of BiXyn10A CBM1 with xylohexaose (1.14 Å), and the CBM from its homolog in the Prevotella bryantii B14 Xyn10C (1.68 Å) reveal an unanticipated mode for ligand binding. A minimal enzyme mix, composed of the gene products of four of the most highly up-regulated genes during growth on wheat arabinoxylan, depolymerizes the polysaccharide into its component sugars. The combined biochemical and biophysical studies presented here provide a framework for understanding fiber metabolism by an important group within the commensal bacterial population known to influence human health.

  4. Xylan utilization in human gut commensal bacteria is orchestrated by unique modular organization of polysaccharide-degrading enzymes

    KAUST Repository

    Zhang, Meiling

    2014-08-18

    Enzymes that degrade dietary and host-derived glycans represent the most abundant functional activities encoded by genes unique to the human gut microbiome. However, the biochemical activities of a vast majority of the glycan-degrading enzymes are poorly understood. Here, we use transcriptome sequencing to understand the diversity of genes expressed by the human gut bacteria Bacteroides intestinalis and Bacteroides ovatus grown in monoculture with the abundant dietary polysaccharide xylan. The most highly induced carbohydrate active genes encode a unique glycoside hydrolase (GH) family 10 endoxylanase (BiXyn10A or BACINT-04215 and BACOVA-04390) that is highly conserved in the Bacteroidetes xylan utilization system. The BiXyn10A modular architecture consists of a GH10 catalytic module disrupted by a 250 amino acid sequence of unknown function. Biochemical analysis of BiXyn10A demonstrated that such insertion sequences encode a new family of carbohydrate-binding modules (CBMs) that binds to xy-lose- configured oligosaccharide/polysaccharide ligands, the substrate of the BiXyn10A enzymatic activity. The crystal structures of CBM1 from BiXyn10A (1.8 Å), a cocomplex of BiXyn10A CBM1 with xylohexaose (1.14 Å), and the CBM fromits homolog in the Prevotella bryantii B 14 Xyn10C (1.68 Å) reveal an unanticipated mode for ligand binding. Aminimal enzyme mix, composed of the gene products of four of the most highly up-regulated genes during growth on wheat arabinoxylan, depolymerizes the polysaccharide into its component sugars. The combined biochemical and biophysical studies presented here provide a framework for understanding fiber metabolism by an important group within the commensal bacterial population known to influence human health.

  5. Gene discovery for enzymes involved in limonene modification or utilization by the mountain pine beetle-associated pathogen Grosmannia clavigera.

    Science.gov (United States)

    Wang, Ye; Lim, Lynette; Madilao, Lina; Lah, Ljerka; Bohlmann, Joerg; Breuil, Colette

    2014-08-01

    To successfully colonize and eventually kill pine trees, Grosmannia clavigera (Gs cryptic species), the main fungal pathogen associated with the mountain pine beetle (Dendroctonus ponderosae), has developed multiple mechanisms to overcome host tree chemical defenses, of which terpenoids are a major component. In addition to a monoterpene efflux system mediated by a recently discovered ABC transporter, Gs has genes that are highly induced by monoterpenes and that encode enzymes that modify or utilize monoterpenes [especially (+)-limonene]. We showed that pine-inhabiting Ophiostomale fungi are tolerant to monoterpenes, but only a few, including Gs, are known to utilize monoterpenes as a carbon source. Gas chromatography-mass spectrometry (GC-MS) revealed that Gs can modify (+)-limonene through various oxygenation pathways, producing carvone, p-mentha-2,8-dienol, perillyl alcohol, and isopiperitenol. It can also degrade (+)-limonene through the C-1-oxygenated pathway, producing limonene-1,2-diol as the most abundant intermediate. Transcriptome sequencing (RNA-seq) data indicated that Gs may utilize limonene 1,2-diol through beta-oxidation and then valine and tricarboxylic acid (TCA) metabolic pathways. The data also suggested that at least two gene clusters, located in genome contigs 108 and 161, were highly induced by monoterpenes and may be involved in monoterpene degradation processes. Further, gene knockouts indicated that limonene degradation required two distinct Baeyer-Villiger monooxygenases (BVMOs), an epoxide hydrolase and an enoyl coenzyme A (enoyl-CoA) hydratase. Our work provides information on enzyme-mediated limonene utilization or modification and a more comprehensive understanding of the interaction between an economically important fungal pathogen and its host's defense chemicals.

  6. A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

    Science.gov (United States)

    Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

    2014-06-01

    Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down

  7. A plant gene for photolyase: an enzyme catalyzing the repair of UV-light-induced DNA damage

    International Nuclear Information System (INIS)

    Batschauer, A.

    1993-01-01

    Photolyases are thought to be critical components of the defense of plants against damage to DNA by solar ultraviolet light, but nothing is known about their molecular or enzymatic nature. The molecular cloning of a photolyase from mustard (Sinapis alba) described here is intended to increase the knowledge about this important repair mechanism in plant species at a molecular level. The gene encodes a polypeptide of 501 amino acids with a predicted molecular mass of 57 kDa. There is a strong sequence similarity to bacterial and yeast photolyases, with a close relationship to enzymes with a deazaflavin chromophor. The plant photolyase is shown to be functional in Escherichia coli which also indicates conservation of photolyases during evolution. It is demonstrated that photolyase expression in plants is light induced, thus providing good evidence for the adaptation of plants to their environment in order to diminish the harmful effects of sunlight. (author)

  8. ModA and ModB, two ADP-ribosyltransferases encoded by bacteriophage T4: catalytic properties and mutation analysis.

    Science.gov (United States)

    Tiemann, Bernd; Depping, Reinhard; Gineikiene, Egle; Kaliniene, Laura; Nivinskas, Rimas; Rüger, Wolfgang

    2004-11-01

    Bacteriophage T4 encodes three ADP-ribosyltransferases, Alt, ModA, and ModB. These enzymes participate in the regulation of the T4 replication cycle by ADP-ribosylating a defined set of host proteins. In order to obtain a better understanding of the phage-host interactions and their consequences for regulating the T4 replication cycle, we studied cloning, overexpression, and characterization of purified ModA and ModB enzymes. Site-directed mutagenesis confirmed that amino acids, as deduced from secondary structure alignments, are indeed decisive for the activity of the enzymes, implying that the transfer reaction follows the Sn1-type reaction scheme proposed for this class of enzymes. In vitro transcription assays performed with Alt- and ModA-modified RNA polymerases demonstrated that the Alt-ribosylated polymerase enhances transcription from T4 early promoters on a T4 DNA template, whereas the transcriptional activity of ModA-modified polymerase, without the participation of T4-encoded auxiliary proteins for middle mode or late transcription, is reduced. The results presented here support the conclusion that ADP-ribosylation of RNA polymerase and of other host proteins allows initial phage-directed mRNA synthesis reactions to escape from host control. In contrast, subsequent modification of the other cellular target proteins limits transcription from phage early genes and participates in redirecting transcription to phage middle and late genes.

  9. The pbrB gene encodes a laccase required for DHN-melanin synthesis in conidia of Talaromyces (Penicillium) marneffei.

    Science.gov (United States)

    Sapmak, Ariya; Boyce, Kylie J; Andrianopoulos, Alex; Vanittanakom, Nongnuch

    2015-01-01

    Talaromyces marneffei (Basionym: Penicillium marneffei) is a significant opportunistic fungal pathogen in patients infected with human immunodeficiency virus in Southeast Asia. T. marneffei cells have been shown to become melanized in vivo. Melanins are pigment biopolymers which act as a non-specific protectant against various stressors and which play an important role during virulence in fungi. The synthesis of the two most commonly found melanins in fungi, the eumelanin DOPA-melanin and the allomelanin DHN-melanin, requires the action of laccase enzymes. The T. marneffei genome encodes a number of laccases and this study describes the characterization of one of these, pbrB, during growth and development. A strain carrying a PbrB-GFP fusion shows that pbrB is expressed at high levels during asexual development (conidiation) but not in cells growing vegetatively. The pbrB gene is required for the synthesis of DHN-melanin in conidia and when deleted results in brown pigmented conidia, in contrast to the green conidia of the wild type.

  10. Vibrio Phage KVP40 Encodes a Functional NAD+ Salvage Pathway.

    Science.gov (United States)

    Lee, Jae Yun; Li, Zhiqun; Miller, Eric S

    2017-05-01

    The genome of T4-type Vibrio bacteriophage KVP40 has five genes predicted to encode proteins of pyridine nucleotide metabolism, of which two, nadV and natV , would suffice for an NAD + salvage pathway. NadV is an apparent nicotinamide phosphoribosyltransferase (NAmPRTase), and NatV is an apparent bifunctional nicotinamide mononucleotide adenylyltransferase (NMNATase) and nicotinamide-adenine dinucleotide pyrophosphatase (Nudix hydrolase). Genes encoding the predicted salvage pathway were cloned and expressed in Escherichia coli , the proteins were purified, and their enzymatic properties were examined. KVP40 NadV NAmPRTase is active in vitro , and a clone complements a Salmonella mutant defective in both the bacterial de novo and salvage pathways. Similar to other NAmPRTases, the KVP40 enzyme displayed ATPase activity indicative of energy coupling in the reaction mechanism. The NatV NMNATase activity was measured in a coupled reaction system demonstrating NAD + biosynthesis from nicotinamide, phosphoribosyl pyrophosphate, and ATP. The NatV Nudix hydrolase domain was also shown to be active, with preferred substrates of ADP-ribose, NAD + , and NADH. Expression analysis using reverse transcription-quantitative PCR (qRT-PCR) and enzyme assays of infected Vibrio parahaemolyticus cells demonstrated nadV and natV transcription during the early and delayed-early periods of infection when other KVP40 genes of nucleotide precursor metabolism are expressed. The distribution and phylogeny of NadV and NatV proteins among several large double-stranded DNA (dsDNA) myophages, and also those from some very large siphophages, suggest broad relevance of pyridine nucleotide scavenging in virus-infected cells. NAD + biosynthesis presents another important metabolic resource control point by large, rapidly replicating dsDNA bacteriophages. IMPORTANCE T4-type bacteriophages enhance DNA precursor synthesis through reductive reactions that use NADH/NADPH as the electron donor and NAD

  11. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  12. Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

    Science.gov (United States)

    Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

    2016-01-01

    Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  13. Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

    Directory of Open Access Journals (Sweden)

    Huanqiang Zhao

    2016-08-01

    Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  14. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  15. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  16. The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

    Science.gov (United States)

    Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

    1994-05-03

    Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Mutations in the Arabidopsis Lst8 and Raptor genes encoding partners of the TOR complex, or inhibition of TOR activity decrease abscisic acid (ABA) synthesis.

    Science.gov (United States)

    Kravchenko, Alena; Citerne, Sylvie; Jéhanno, Isabelle; Bersimbaev, Rakhmetkazhi I; Veit, Bruce; Meyer, Christian; Leprince, Anne-Sophie

    2015-11-27

    The Target of Rapamycin (TOR) kinase regulates essential processes in plant growth and development by modulation of metabolism and translation in response to environmental signals. In this study, we show that abscisic acid (ABA) metabolism is also regulated by the TOR kinase. Indeed ABA hormone level strongly decreases in Lst8-1 and Raptor3g mutant lines as well as in wild-type (WT) Arabidopsis plants treated with AZD-8055, a TOR inhibitor. However the growth and germination of these lines are more sensitive to exogenous ABA. The diminished ABA hormone accumulation is correlated with lower transcript levels of ZEP, NCED3 and AAO3 biosynthetic enzymes, and higher transcript amount of the CYP707A2 gene encoding a key-enzyme in abscisic acid catabolism. These results suggest that the TOR signaling pathway is implicated in the regulation of ABA accumulation in Arabidopsis. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. The genome sequence of the commercially cultivated mushroom Agrocybe aegerita reveals a conserved repertoire of fruiting-related genes and a versatile suite of biopolymer-degrading enzymes.

    Science.gov (United States)

    Gupta, Deepak K; Rühl, Martin; Mishra, Bagdevi; Kleofas, Vanessa; Hofrichter, Martin; Herzog, Robert; Pecyna, Marek J; Sharma, Rahul; Kellner, Harald; Hennicke, Florian; Thines, Marco

    2018-01-15

    Agrocybe aegerita is an agaricomycete fungus with typical mushroom features, which is commercially cultivated for its culinary use. In nature, it is a saprotrophic or facultative pathogenic fungus causing a white-rot of hardwood in forests of warm and mild climate. The ease of cultivation and fructification on solidified media as well as its archetypal mushroom fruit body morphology render A. aegerita a well-suited model for investigating mushroom developmental biology. Here, the genome of the species is reported and analysed with respect to carbohydrate active genes and genes known to play a role during fruit body formation. In terms of fruit body development, our analyses revealed a conserved repertoire of fruiting-related genes, which corresponds well to the archetypal fruit body morphology of this mushroom. For some genes involved in fruit body formation, paralogisation was observed, but not all fruit body maturation-associated genes known from other agaricomycetes seem to be conserved in the genome sequence of A. aegerita. In terms of lytic enzymes, our analyses suggest a versatile arsenal of biopolymer-degrading enzymes that likely account for the flexible life style of this species. Regarding the amount of genes encoding CAZymes relevant for lignin degradation, A. aegerita shows more similarity to white-rot fungi than to litter decomposers, including 18 genes coding for unspecific peroxygenases and three dye-decolourising peroxidase genes expanding its lignocellulolytic machinery. The genome resource will be useful for developing strategies towards genetic manipulation of A. aegerita, which will subsequently allow functional genetics approaches to elucidate fundamentals of fruiting and vegetative growth including lignocellulolysis.

  19. Metagenomic insights into the carbohydrate-active enzymes carried by the microorganisms adhering to solid digesta in the rumen of cows.

    Directory of Open Access Journals (Sweden)

    Lingling Wang

    Full Text Available The ruminal microbial community is a unique source of enzymes that underpin the conversion of cellulosic biomass. In this study, the microbial consortia adherent on solid digesta in the rumen of Jersey cattle were subjected to an activity-based metagenomic study to explore the genetic diversity of carbohydrolytic enzymes in Jersey cows, with a particular focus on cellulases and xylanases. Pyrosequencing and bioinformatic analyses of 120 carbohydrate-active fosmids identified genes encoding 575 putative Carbohydrate-Active Enzymes (CAZymes and proteins putatively related to transcriptional regulation, transporters, and signal transduction coupled with polysaccharide degradation and metabolism. Most of these genes shared little similarity to sequences archived in databases. Genes that were predicted to encode glycoside hydrolases (GH involved in xylan and cellulose hydrolysis (e.g., GH3, 5, 9, 10, 39 and 43 were well represented. A new subfamily (S-8 of GH5 was identified from contigs assigned to Firmicutes. These subfamilies of GH5 proteins also showed significant phylum-dependent distribution. A number of polysaccharide utilization loci (PULs were found, and two of them contained genes encoding Sus-like proteins and cellulases that have not been reported in previous metagenomic studies of samples from the rumens of cows or other herbivores. Comparison with the large metagenomic datasets previously reported of other ruminant species (or cattle breeds and wallabies showed that the rumen microbiome of Jersey cows might contain differing CAZymes. Future studies are needed to further explore how host genetics and diets affect the diversity and distribution of CAZymes and utilization of plant cell wall materials.

  20. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  1. Potential of genes and gene products from Trichoderma sp. and Gliocladium sp. for the development of biological pesticides.

    Science.gov (United States)

    Lorito, M; Hayes, C K; Zoina, A; Scala, F; Del Sorbo, G; Woo, S L; Harman, G E

    1994-12-01

    Fungal cell wall degrading enzymes produced by the biocontrol fungi Trichoderma harzianum and Gliocladium virens are strong inhibitors of spore germination and hyphal elongation of a number of phytopathogenic fungi. The purified enzymes include chitinolytic enzymes with different modes of action or different substrate specificity and glucanolytic enzymes with exo-activity. A variety of synergistic interactions were found when different enzymes were combined or associated with biotic or abiotic antifungal agents. The levels of inhibition obtained by using enzyme combinations were, in some cases, comparable with commercial fungicides. Moreover, the antifungal interaction between enzymes and common fungicides allowed the reduction of the chemical doses up to 200-fold. Chitinolytic and glucanolytic enzymes from T. harzianum were able to improve substantially the antifungal ability of a biocontrol strain of Enterobacter cloacae. DNA fragments containing genes encoding for different chitinolytic enzymes were isolated from a cDNA library of T. harzianum and cloned for mechanistic studies and biocontrol purposes. Our results provide additional information on the role of lytic enzymes in processes of biocontrol and strongly suggest the use of lytic enzymes and their genes for biological control of plant diseases.

  2. Pyramiding expression of maize genes encoding phosphoenolpyruvate carboxylase (PEPC) and pyruvate orthophosphate dikinase (PPDK) synergistically improve the photosynthetic characteristics of transgenic wheat.

    Science.gov (United States)

    Zhang, HuiFang; Xu, WeiGang; Wang, HuiWei; Hu, Lin; Li, Yan; Qi, XueLi; Zhang, Lei; Li, ChunXin; Hua, Xia

    2014-09-01

    Using particle bombardment transformation, we introduced maize pepc cDNA encoding phosphoenolpyruvate carboxylase (PEPC) and ppdk cDNA encoding pyruvate orthophosphate dikinase (PPDK) into the C3 crop wheat to generate transgenic wheat lines carrying cDNA of pepc (PC lines), ppdk (PK lines) or both (PKC lines). The integration, transcription, and expression of the foreign genes were confirmed by Southern blot, Real-time quantitative reverse transcription PCR (Q-RT-PCR), and Western blot analysis. Q-RT-PCR results indicated that the average relative expression levels of pepc and ppdk in the PKC lines reached 10 and 4.6, respectively, compared to their expressions in untransformed plants (set to 1). The enzyme activities of PEPC and PPDK in the PKC lines were 4.3- and 2.1-fold higher, respectively, than in the untransformed control. The maximum daily net photosynthetic rates of the PKC, PC, and PK lines were enhanced by 26.4, 13.3, and 4.5%, respectively, whereas the diurnal accumulations of photosynthesis were 21.3, 13.9, and 6.9%, respectively, higher than in the control. The Fv/Fm of the transgenic plants decreased less than in the control under high temperature and high light conditions (2 weeks after anthesis), suggesting that the transgenic wheat transports more absorbed light energy into a photochemical reaction. The exogenous maize C4-specific pepc gene was more effective than ppdk at improving the photosynthetic performance and yield characteristics of transgenic wheat, while the two genes showed a synergistic effect when they were transformed into the same genetic background, because the PKC lines exhibited improved photosynthetic and physiological traits.

  3. topIb, a phylogenetic hallmark gene of Thaumarchaeota encodes a functional eukaryote-like topoisomerase IB.

    Science.gov (United States)

    Dahmane, Narimane; Gadelle, Danièle; Delmas, Stéphane; Criscuolo, Alexis; Eberhard, Stephan; Desnoues, Nicole; Collin, Sylvie; Zhang, Hongliang; Pommier, Yves; Forterre, Patrick; Sezonov, Guennadi

    2016-04-07

    Type IB DNA topoisomerases can eliminate torsional stresses produced during replication and transcription. These enzymes are found in all eukaryotes and a short version is present in some bacteria and viruses. Among prokaryotes, the long eukaryotic version is only observed in archaea of the phylum Thaumarchaeota. However, the activities and the roles of these topoisomerases have remained an open question. Here, we demonstrate that all available thaumarchaeal genomes contain a topoisomerase IB gene that defines a monophyletic group closely related to the eukaryotic enzymes. We show that the topIB gene is expressed in the model thaumarchaeon Nitrososphaera viennensis and we purified the recombinant enzyme from the uncultivated thaumarchaeon Candidatus Caldiarchaeum subterraneum. This enzyme is active in vitro at high temperature, making it the first thermophilic topoisomerase IB characterized so far. We have compared this archaeal type IB enzyme to its human mitochondrial and nuclear counterparts. The archaeal enzyme relaxes both negatively and positively supercoiled DNA like the eukaryotic enzymes. However, its pattern of DNA cleavage specificity is different and it is resistant to camptothecins (CPTs) and non-CPT Top1 inhibitors, LMP744 and lamellarin D. This newly described thermostable topoisomerases IB should be a promising new model for evolutionary, mechanistic and structural studies. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Expression, purification, crystallization and preliminary X-ray analysis of two arginine-biosynthetic enzymes from Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Moradian, Fatemeh; Garen, Craig; Cherney, Leonid; Cherney, Maia; James, Michael N. G.

    2006-01-01

    Two enzymes responsible for arginine biosynthesis in M. tuberculosis were expressed in Escherichia coli, then purified to homogeneity. Preliminary X-ray analysis of diffraction-quality crystals grown from each enzyme are reported. The gene products of two open reading frames from Mycobacterium tuberculosis (Mtb) have been crystallized using the sitting-drop vapour-diffusion method. Rv1652 encodes a putative N-acetyl-γ-glutamyl-phosphate reductase (MtbAGPR), while the Rv1656 gene product is annotated as ornithine carbamoyltransferase (MtbOTC). Both MtbAGPR and MtbOTC were expressed in Escherichia coli, purified to homogeneity and crystallized. Native data for each crystal were collected to resolutions of 2.15 and 2.80 Å, respectively. Preliminary X-ray data are presented for both enzymes

  5. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

    Directory of Open Access Journals (Sweden)

    Shuiyuan Cheng

    2016-03-01

    Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  6. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile.

    Science.gov (United States)

    Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang

    2016-03-08

    Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  7. Enantioselective effect of bifenthrin on antioxidant enzyme gene expression and stress protein response in PC12 cells.

    Science.gov (United States)

    Lu, Xianting

    2013-07-01

    Enantioselectivity in toxicology and the health risk of chiral xenobiotics have become frontier topics interfacing chemistry and toxicology. Our previous results showed that cis-bifenthrin (cis-BF) induced cytotoxicity and apoptosis in vitro in an enantioselective manner. However, the exact molecular mechanisms of synthetic pyrethroid-induced enantioselective apoptosis and cytotoxicity have so far received limited research attention. In the present study, the expression patterns of different genes encoding heat shock protein and antioxidant enzymes were investigated by real-time quantitative PCR in rat adrenal pheochromocytoma (PC12) cells after exposure to cis-BF and its enantiomers. The results showed that exposure to 1S-cis-BF resulted in increased transcription of HSP90, HSP70, HSP60, Cu-Zn-superoxide dismutase, Mn-superoxide dismutase, catalase and glutathione-s-transferase at a concentration of 5 µm and above, while exposure to 1R-cis-BF and rac-cis-BF exhibited these effects to lesser degrees. In addition, induction of antioxidant enzyme gene expression produced by 1S-cis-BF might occur, at least in part, through activation of p38 mitogen-activated protein kinases (MAPK) and extracellular regulated kinases, while increase in stress protein response produced by 1S-cis-BF might occur through the p38 MAPK signaling pathway. The results not only suggest that enantioselectivity should be considered in evaluating the ecotoxicological effects and health risk of chiral contaminants, but also will improve the understanding of molecular mechanism for chiral chemical-induced cytotoxicity. Copyright © 2012 John Wiley & Sons, Ltd.

  8. Resistance to β-Lactams in Neisseria ssp Due to Chromosomally Encoded Penicillin-Binding Proteins.

    Science.gov (United States)

    Zapun, André; Morlot, Cécile; Taha, Muhamed-Kheir

    2016-09-28

    Neisseria meningitidis and Neisseria gonorrhoeae are human pathogens that cause a variety of life-threatening systemic and local infections, such as meningitis or gonorrhoea. The treatment of such infection is becoming more difficult due to antibiotic resistance. The focus of this review is on the mechanism of reduced susceptibility to penicillin and other β-lactams due to the modification of chromosomally encoded penicillin-binding proteins (PBP), in particular PBP2 encoded by the penA gene. The variety of penA alleles and resulting variant PBP2 enzymes is described and the important amino acid substitutions are presented and discussed in a structural context.

  9. Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha

    NARCIS (Netherlands)

    Bruinenberg, P. G.; Evers, M.; Waterham, H. R.; Kuipers, J.; Arnberg, A. C.; AB, G.

    1989-01-01

    We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC 1.4.3.6) from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence

  10. Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

    Directory of Open Access Journals (Sweden)

    Muscariello Lidia

    2006-05-01

    Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

  11. Lead nitrate-induced development of hypercholesterolemia in rats: sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis.

    Science.gov (United States)

    Kojima, Misaki; Masui, Toshimitsu; Nemoto, Kiyomitsu; Degawa, Masakuni

    2004-12-01

    Changes in the gene expressions of hepatic enzymes responsible for cholesterol homeostasis were examined during the process of lead nitrate (LN)-induced development of hypercholesterolemia in male rats. Total cholesterol levels in the liver and serum were significantly increased at 3-72 h and 12-72 h, respectively, after LN-treatment (100 micromol/kg, i.v.). Despite the development of hypercholesterolemia, the genes for hepatic 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) and other enzymes (FPPS, farnesyl diphosphate synthase; SQS, squalene synthase; CYP51, lanosterol 14alpha-demethylase) responsible for cholesterol biosynthesis were activated at 3-24 h and 12-18 h, respectively. On the other hand, the gene expression of cholesterol 7alpha-hydroxylase (CYP7A1), a catabolic enzyme of cholesterol, was remarkably suppressed at 3-72 h. The gene expression levels of cytokines interleukin-1beta (IL-1beta) and TNF-alpha, which activate the HMGR gene and suppress the CYP7A1 gene, were significantly increased at 1-3 h and 3-24 h, respectively. Furthermore, gene activation of SREBP-2, a gene activator of several cholesterogenic enzymes, occurred before the gene activations of FPPS, SQS and CYP51. This is the first report demonstrating sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis in LN-treated male rats. The mechanisms for the altered-gene expressions of hepatic enzymes in LN-treated rats are discussed.

  12. The Aspergillus nidulans acuL gene encodes a mitochondrial carrier required for the utilization of carbon sources that are metabolized via the TCA cycle.

    Science.gov (United States)

    Flipphi, Michel; Oestreicher, Nathalie; Nicolas, Valérie; Guitton, Audrey; Vélot, Christian

    2014-07-01

    In Aspergillus nidulans, the utilization of acetate as sole carbon source requires several genes (acu). Most of them are also required for the utilization of fatty acids. This is the case for acuD and acuE, which encode the two glyoxylate cycle-specific enzymes, isocitrate lyase and malate synthase, respectively, but also for acuL that we have identified as AN7287, and characterized in this study. Deletion of acuL resulted in the same phenotype as the original acuL217 mutant. acuL encodes a 322-amino acid protein which displays all the structural features of a mitochondrial membrane carrier, and shares 60% identity with the Saccharomyces cerevisiae succinate/fumarate mitochondrial antiporter Sfc1p (also named Acr1p). Consistently, the AcuL protein was shown to localize in mitochondria, and partial cross-complementation was observed between the S. cerevisiae and A. nidulans homologues. Extensive phenotypic characterization suggested that the acuL gene is involved in the utilization of carbon sources that are catabolized via the TCA cycle, and therefore require gluconeogenesis. In addition, acuL proves to be co-regulated with acuD and acuE. Overall, our data suggest that AcuL could link the glyoxylate cycle to gluconeogenesis by exchanging cytoplasmic succinate for mitochondrial fumarate. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Molecular characterization of a fungal gene paralogue of the penicillin penDE gene of Penicillium chrysogenum

    Science.gov (United States)

    2009-01-01

    Background Penicillium chrysogenum converts isopenicillin N (IPN) into hydrophobic penicillins by means of the peroxisomal IPN acyltransferase (IAT), which is encoded by the penDE gene. In silico analysis of the P. chrysogenum genome revealed the presence of a gene, Pc13g09140, initially described as paralogue of the IAT-encoding penDE gene. We have termed this gene ial because it encodes a protein with high similarity to IAT (IAL for IAT-Like). We have conducted an investigation to characterize the ial gene and to determine the role of the IAL protein in the penicillin biosynthetic pathway. Results The IAL contains motifs characteristic of the IAT such as the processing site, but lacks the peroxisomal targeting sequence ARL. Null ial mutants and overexpressing strains indicated that IAL lacks acyltransferase (penicillin biosynthetic) and amidohydrolase (6-APA forming) activities in vivo. When the canonical ARL motif (leading to peroxisomal targeting) was added to the C-terminus of the IAL protein (IALARL) by site-directed mutagenesis, no penicillin biosynthetic activity was detected. Since the IAT is only active after an accurate self-processing of the preprotein into α and β subunits, self-processing of the IAL was tested in Escherichia coli. Overexpression experiments and SDS-PAGE analysis revealed that IAL is also self-processed in two subunits, but despite the correct processing, the enzyme remained inactive in vitro. Conclusion No activity related to the penicillin biosynthesis was detected for the IAL. Sequence comparison among the P. chrysogenum IAL, the A. nidulans IAL homologue and the IAT, revealed that the lack of enzyme activity seems to be due to an alteration of the essential Ser309 in the thioesterase active site. Homologues of the ial gene have been found in many other ascomycetes, including non-penicillin producers. Our data suggest that like in A. nidulans, the ial and penDE genes might have been formed from a single ancestral gene that became

  14. ANALYSIS OF ANGIOTENSIN CONVERTING ENZYME (ACE GENE INSERTION/DELETION(I/DPOLYMORPHISM IN MIGRAINE

    Directory of Open Access Journals (Sweden)

    Saime Sezer

    2013-03-01

    In patient groups DD genotype frequency was 35.0%, ID genotype frequency was 45.5% and II genotype frequency 19.5% (0.322. Allelic frequencies was detected 57.75% for D allele, 42.25% for I allele in patients. There were no significant differences in genotype/allele frequencies of angiotensin converting enzyme gene polymorphism between patients with migraine and controls (p=0.474. Our results show that I/D polymorphism of angiotensin converting enzyme gene is not a risk factor for migraine. [J Contemp Med 2013; 3(1.000: 7-11

  15. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  16. L-rhamnose induction of Aspergillus nidulans α-L-rhamnosidase genes is glucose repressed via a CreA-independent mechanism acting at the level of inducer uptake.

    Science.gov (United States)

    Tamayo-Ramos, Juan A; Flipphi, Michel; Pardo, Ester; Manzanares, Paloma; Orejas, Margarita

    2012-02-21

    Little is known about the structure and regulation of fungal α-L-rhamnosidase genes despite increasing interest in the biotechnological potential of the enzymes that they encode. Whilst the paradigmatic filamentous fungus Aspergillus nidulans growing on L-rhamnose produces an α-L-rhamnosidase suitable for oenological applications, at least eight genes encoding putative α-L-rhamnosidases have been found in its genome. In the current work we have identified the gene (rhaE) encoding the former activity, and characterization of its expression has revealed a novel regulatory mechanism. A shared pattern of expression has also been observed for a second α-L-rhamnosidase gene, (AN10277/rhaA). Amino acid sequence data for the oenological α-L-rhamnosidase were determined using MALDI-TOF mass spectrometry and correspond to the amino acid sequence deduced from AN7151 (rhaE). The cDNA of rhaE was expressed in Saccharomyces cerevisiae and yielded pNP-rhamnohydrolase activity. Phylogenetic analysis has revealed this eukaryotic α-L-rhamnosidase to be the first such enzyme found to be more closely related to bacterial rhamnosidases than other α-L-rhamnosidases of fungal origin. Northern analyses of diverse A. nidulans strains cultivated under different growth conditions indicate that rhaA and rhaE are induced by L-rhamnose and repressed by D-glucose as well as other carbon sources, some of which are considered to be non-repressive growth substrates. Interestingly, the transcriptional repression is independent of the wide domain carbon catabolite repressor CreA. Gene induction and glucose repression of these rha genes correlate with the uptake, or lack of it, of the inducing carbon source L-rhamnose, suggesting a prominent role for inducer exclusion in repression. The A. nidulans rhaE gene encodes an α-L-rhamnosidase phylogenetically distant to those described in filamentous fungi, and its expression is regulated by a novel CreA-independent mechanism. The identification of

  17. PIERO ontology for analysis of biochemical transformations: effective implementation of reaction information in the IUBMB enzyme list.

    Science.gov (United States)

    Kotera, Masaaki; Nishimura, Yosuke; Nakagawa, Zen-ichi; Muto, Ai; Moriya, Yuki; Okamoto, Shinobu; Kawashima, Shuichi; Katayama, Toshiaki; Tokimatsu, Toshiaki; Kanehisa, Minoru; Goto, Susumu

    2014-12-01

    Genomics is faced with the issue of many partially annotated putative enzyme-encoding genes for which activities have not yet been verified, while metabolomics is faced with the issue of many putative enzyme reactions for which full equations have not been verified. Knowledge of enzymes has been collected by IUBMB, and has been made public as the Enzyme List. To date, however, the terminology of the Enzyme List has not been assessed comprehensively by bioinformatics studies. Instead, most of the bioinformatics studies simply use the identifiers of the enzymes, i.e. the Enzyme Commission (EC) numbers. We investigated the actual usage of terminology throughout the Enzyme List, and demonstrated that the partial characteristics of reactions cannot be retrieved by simply using EC numbers. Thus, we developed a novel ontology, named PIERO, for annotating biochemical transformations as follows. First, the terminology describing enzymatic reactions was retrieved from the Enzyme List, and was grouped into those related to overall reactions and biochemical transformations. Consequently, these terms were mapped onto the actual transformations taken from enzymatic reaction equations. This ontology was linked to Gene Ontology (GO) and EC numbers, allowing the extraction of common partial reaction characteristics from given sets of orthologous genes and the elucidation of possible enzymes from the given transformations. Further future development of the PIERO ontology should enhance the Enzyme List to promote the integration of genomics and metabolomics.

  18. [Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

    Science.gov (United States)

    Fukuda, H; Hiramatsu, K

    1997-05-01

    Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

  19. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  20. Identification of the mpl gene encoding UDP-N-acetylmuramate: L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase in Escherichia coli and its role in recycling of cell wall peptidoglycan.

    Science.gov (United States)

    Mengin-Lecreulx, D; van Heijenoort, J; Park, J T

    1996-01-01

    A gene, mpl, encoding UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelat e ligase was recognized by its amino acid sequence homology with murC as the open reading frame yjfG present at 96 min on the Escherichia coli map. The existence of such an enzymatic activity was predicted from studies indicating that reutilization of the intact tripeptide L-alanyl-gamma-D-glutamyl-meso-diaminopimelate occurred and accounted for well over 30% of new cell wall synthesis. Murein tripeptide ligase activity could be demonstrated in crude extracts, and greatly increased activity was produced when the gene was cloned and expressed under control of the trc promoter. A null mutant totally lacked activity but was viable, showing that the enzyme is not essential for growth. PMID:8808921

  1. Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase

    DEFF Research Database (Denmark)

    Brinch-Pedersen, H.; Galili, G.; Sørensen, K.

    1996-01-01

    In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance...... the accumulation of the corresponding amino acids, we have generated transgenic barley plants that constitutively express mutant Escherichia coli genes encoding lysine feed-back insensitive forms of AK and DHPS. As a result, leaves of primary transformants (T0) exhibited a 14-fold increase of free lysine and an 8......, no differences were observed in the composition of total amino acids. The introduced genes were inherited in the T1 generation where enzymic activities revealed a 2.3-fold increase of AK activity and a 4.0-9.5-fold increase for DHPS. T1 seeds of DHPS transformants showed the same changes in free amino acids...

  2. Structure of the human hepatic triglyceride lipase gene

    International Nuclear Information System (INIS)

    Cai, Shengjian; Wong, D.M.; Chen, Sanhwan; Chan, L.

    1989-01-01

    The structure of the human hepatic triglyceride lipase gene was determined from multiple cosmid clones. All the exons, exon-intron junctions, and 845 bp of the 5' and 254 bp of the 3' flanking DNA were sequenced. Comparison of the exon sequences to three previously published cDNA sequences revealed differences in the sequence of the codons for residue 133, 193, 202, and 234 that may represent sequence polymorphisms. By primer extension, hepatic lipase mRNA initiates at an adenine 77 bases upstream of the translation initiation site. The hepatic lipase gene spans over 60 kb containing 9 exons and 8 introns, the latter being all located within the region encoding the mature protein. The exons are all of average size (118-234 bp). Exon 1 encodes the signal peptide, exon 4, a region that binds to the lipoprotein substrate, and exon 5, an evolutionarily highly conserved region of potential catalytic function, and exons 6 and 9 encode sequences rich in basic amino acids thought to be important in anchoring the enzyme to the endothelial surface by interacting with acidic domains of the surface glycosaminoglycans. The human lipoprotein lipase gene has been recently reported to have an identical exon-intron organization containing the analogous structural domains. The observations strongly support the common evolutionary origin of these two lipolytic enzymes

  3. Genetically engineered micro-organisms: Aromatic hydrocarbon biodegradation genes from Rhodococcus

    International Nuclear Information System (INIS)

    Kendall, K.

    1993-01-01

    DNA known to encode toluene biodegradation genes in Pseudomonas putida was used in Southern Blots to identify homologous DNA in the unrelated toluene degrading Actinomycete, Rhodococcus sp. ATCC 19070. Two strongly hybridizing EcoRI fragments of 2.3 kb and 2.7 kb respectively were cloned into E. coli. Sequence analysis of a 400 bp section of the 2.3 kb fragment demonstrated that it encodes proteins with similar amino acid sequences to the xylX and xylY genes of P. putida. These proteins are components of toluate oxygenase, the enzyme catalyzing the first step in the metabolism of benzoic acid

  4. The Cremeomycin Biosynthetic Gene Cluster Encodes a Pathway for Diazo Formation.

    Science.gov (United States)

    Waldman, Abraham J; Pechersky, Yakov; Wang, Peng; Wang, Jennifer X; Balskus, Emily P

    2015-10-12

    Diazo groups are found in a range of natural products that possess potent biological activities. Despite longstanding interest in these metabolites, diazo group biosynthesis is not well understood, in part because of difficulties in identifying specific genes linked to diazo formation. Here we describe the discovery of the gene cluster that produces the o-diazoquinone natural product cremeomycin and its heterologous expression in Streptomyces lividans. We used stable isotope feeding experiments and in vitro characterization of biosynthetic enzymes to decipher the order of events in this pathway and establish that diazo construction involves late-stage N-N bond formation. This work represents the first successful production of a diazo-containing metabolite in a heterologous host, experimentally linking a set of genes with diazo formation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  6. Gene structure and mutations of glutaryl-coenzyme A dehydrogenase: impaired association of enzyme subunits that is due to an A421V substitution causes glutaric acidemia type I in the Amish.

    Science.gov (United States)

    Biery, B J; Stein, D E; Morton, D H; Goodman, S I

    1996-11-01

    The structure of the human glutaryl coenzyme A dehydrogenase (GCD) gene was determined to contain 11 exons and to span approximately 7 kb. Fibroblast DNA from 64 unrelated glutaric acidemia type I (GA1) patients was screened for mutations by PCR amplification and analysis of SSCP. Fragments with altered electrophoretic mobility were subcloned and sequenced to detect mutations that caused GA1. This report describes the structure of the GCD gene, as well as point mutations and polymorphisms found in 7 of its 11 exons. Several mutations were found in more than one patient, but no one prevalent mutation was detected in the general population. As expected from pedigree analysis, a single mutant allele causes GA1 in the Old Order Amish of Lancaster County, Pennsylvania. Several mutations have been expressed in Escherichia coli, and all produce diminished enzyme activity. Reduced activity in GCD encoded by the A421V mutation in the Amish may be due to impaired association of enzyme subunits.

  7. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  8. AAV Gene Therapy for Alcoholism: Inhibition of Mitochondrial Aldehyde Dehydrogenase Enzyme Expression in Hepatoma Cells.

    Science.gov (United States)

    Sanchez, Anamaria C; Li, Chengwen; Andrews, Barbara; Asenjo, Juan A; Samulski, R Jude

    2017-09-01

    Most ethanol is broken down in the liver in two steps by alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH2) enzymes, which metabolize down ethanol into acetaldehyde and then acetate. Some individuals from the Asian population who carry a mutation in the aldehyde dehydrogenase gene (ALDH2*2) cannot metabolize acetaldehyde as efficiently, producing strong effects, including facial flushing, dizziness, hypotension, and palpitations. This results in an aversion to alcohol intake and protection against alcoholism. The large prevalence of this mutation in the human population strongly suggests that modulation of ALDH2 expression by genetic technologies could result in a similar phenotype. scAAV2 vectors encoding ALDH2 small hairpin RNA (shRNA) were utilized to validate this hypothesis by silencing ALDH2 gene expression in human cell lines. Human cell lines HEK-293 and HepG2 were transduced with scAAV2/shRNA, showing a reduction in ALDH2 RNA and protein expression with the two viral concentration assayed (1 × 10 4 and 1 × 10 5 vg/cell) at two different time points. In both cell lines, ALDH2 RNA levels were reduced by 90% and protein expression was inhibited by 90% and 52%, respectively, 5 days post infection. Transduced HepG2 VL17A cells (ADH+) exposed to ethanol resulted in a 50% increase in acetaldehyde levels. These results suggest that gene therapy could be a useful tool for the treatment of alcoholism by knocking down ALDH2 expression using shRNA technology delivered by AAV vectors.

  9. Metagenomic insights into the rumen microbial fibrolytic enzymes in Indian crossbred cattle fed finger millet straw.

    Science.gov (United States)

    Jose, V Lyju; Appoothy, Thulasi; More, Ravi P; Arun, A Sha

    2017-12-01

    The rumen is a unique natural habitat, exhibiting an unparalleled genetic resource of fibrolytic enzymes of microbial origin that degrade plant polysaccharides. The objectives of this study were to identify the principal plant cell wall-degrading enzymes and the taxonomic profile of rumen microbial communities that are associated with it. The cattle rumen microflora and the carbohydrate-active enzymes were functionally classified through a whole metagenomic sequencing approach. Analysis of the assembled sequences by the Carbohydrate-active enzyme analysis Toolkit identified the candidate genes encoding fibrolytic enzymes belonging to different classes of glycoside hydrolases(11,010 contigs), glycosyltransferases (6366 contigs), carbohydrate esterases (4945 contigs), carbohydrate-binding modules (1975 contigs), polysaccharide lyases (480 contigs), and auxiliary activities (115 contigs). Phylogenetic analysis of CAZyme encoding contigs revealed that a significant proportion of CAZymes were contributed by bacteria belonging to genera Prevotella, Bacteroides, Fibrobacter, Clostridium, and Ruminococcus. The results indicated that the cattle rumen microbiome and the CAZymes are highly complex, structurally similar but compositionally distinct from other ruminants. The unique characteristics of rumen microbiota and the enzymes produced by resident microbes provide opportunities to improve the feed conversion efficiency in ruminants and serve as a reservoir of industrially important enzymes for cellulosic biofuel production.

  10. Global regulators ExpA (GacA) and KdgR modulate extracellular enzyme gene expression through the RsmA-rsmB system in Erwinia carotovora subsp. carotovora.

    Science.gov (United States)

    Hyytiäinen, H; Montesano, M; Palva, E T

    2001-08-01

    The production of the main virulence determinants, the extracellular plant cell wall-degrading enzymes, and hence virulence of Erwinia carotovora subsp. carotovora is controlled by a complex regulatory network. One of the global regulators, the response regulator ExpA, a GacA homolog, is required for transcriptional activation of the extracellular enzyme genes of this soft-rot pathogen. To elucidate the mechanism of ExpA control as well as interactions with other regulatory systems, we isolated second-site transposon mutants that would suppress the enzyme-negative phenotype of an expA (gacA) mutant. Inactivation of kdgR resulted in partial restoration of extracellular enzyme production and virulence to the expA mutant, suggesting an interaction between the two regulatory pathways. This interaction was mediated by the RsmA-rsmB system. Northern analysis was used to show that the regulatory rsmB RNA was under positive control of ExpA. Conversely, the expression of rsmA encoding a global repressor was under negative control of ExpA and positive control of KdgR. This study indicates a central role for the RsmA-rsmB regulatory system during pathogenesis, integrating signals from the ExpA (GacA) and KdgR global regulators of extracellular enzyme production in E. carotovora subsp. carotovora.

  11. Ectopic expression of ubiquitin-conjugating enzyme gene from wild rice, OgUBC1, confers resistance against UV-B radiation and Botrytis infection in Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Jeon, En Hee; Pak, Jung Hun; Kim, Mi Jin; Kim, Hye Jeong; Shin, Sang Hyun; Lee, Jai Heon; Kim, Doh Hoon; Oh, Ju Sung; Oh, Boung-Jun; Jung, Ho Won; Chung, Young Soo

    2012-01-01

    Highlights: ► We isolated a novel E2 ubiquitin-conjugating enzyme from leaves of wild rice plants. ► The OgUBC1 was highly expressed in leaves treated with SA and UV-B radiation. ► The recombinant OgUBC1 has an enzymatic activity of E2 in vitro. ► The OgUBC1 could protect disruption of plant cells by UV-B radiation. ► OgUBC1 confers disease resistance and UV-B tolerance in transgenic Arabidopsis plants. -- Abstract: A previously unidentified gene encoding ubiquitin-conjugating enzyme was isolated from leaves of wild rice plant treated with wounding and microbe-associated molecular patterns. The OgUBC1 gene was composed of 148 amino acids and contained a typical active site and 21 ubiquitin thioester intermediate interaction residues and 4 E3 interaction residues. Both exogenous application of salicylic acid and UV-B irradiation triggered expression of OgUBC1 in leaves of wild rice. Recombinant OgUBC1 proteins bound to ubiquitins in vitro, proposing that the protein might act as E2 enzyme in planta. Heterologous expression of the OgUBC1 in Arabidopsis thaliana protected plants from cellular damage caused by an excess of UV-B radiation. A stable expression of chalcone synthase gene was detected in leaves of OgUBC1-expressing Arabidopsis, resulting in producing higher amounts of anthocyanin than those in wild-type Col-0 plants. Additionally, both pathogenesis-related gene1 and 5 were transcribed in the transgenic Arabidopsis in the absence of pathogen infection. The OgUBC1-expressing plants were resistant to the infection of Botrytis cinerea. Taken together, we suggested that the OgUBC1 is involved in ubiquitination process important for cellular response against biotic and abiotic stresses in plants.

  12. Ectopic expression of ubiquitin-conjugating enzyme gene from wild rice, OgUBC1, confers resistance against UV-B radiation and Botrytis infection in Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, En Hee; Pak, Jung Hun; Kim, Mi Jin; Kim, Hye Jeong [Department of Genetic Engineering, Dong-A University, Busan 604-714 (Korea, Republic of); Shin, Sang Hyun [National Crop Experiment Station, Rural Development Administration, Suwon 441-100 (Korea, Republic of); Lee, Jai Heon; Kim, Doh Hoon; Oh, Ju Sung [Department of Genetic Engineering, Dong-A University, Busan 604-714 (Korea, Republic of); Oh, Boung-Jun [BioControl Center, Jeonnam 516-942 (Korea, Republic of); Jung, Ho Won, E-mail: hwjung@dau.ac.kr [Department of Genetic Engineering, Dong-A University, Busan 604-714 (Korea, Republic of); Chung, Young Soo, E-mail: chungys@dau.ac.kr [Department of Genetic Engineering, Dong-A University, Busan 604-714 (Korea, Republic of)

    2012-10-19

    Highlights: Black-Right-Pointing-Pointer We isolated a novel E2 ubiquitin-conjugating enzyme from leaves of wild rice plants. Black-Right-Pointing-Pointer The OgUBC1 was highly expressed in leaves treated with SA and UV-B radiation. Black-Right-Pointing-Pointer The recombinant OgUBC1 has an enzymatic activity of E2 in vitro. Black-Right-Pointing-Pointer The OgUBC1 could protect disruption of plant cells by UV-B radiation. Black-Right-Pointing-Pointer OgUBC1 confers disease resistance and UV-B tolerance in transgenic Arabidopsis plants. -- Abstract: A previously unidentified gene encoding ubiquitin-conjugating enzyme was isolated from leaves of wild rice plant treated with wounding and microbe-associated molecular patterns. The OgUBC1 gene was composed of 148 amino acids and contained a typical active site and 21 ubiquitin thioester intermediate interaction residues and 4 E3 interaction residues. Both exogenous application of salicylic acid and UV-B irradiation triggered expression of OgUBC1 in leaves of wild rice. Recombinant OgUBC1 proteins bound to ubiquitins in vitro, proposing that the protein might act as E2 enzyme in planta. Heterologous expression of the OgUBC1 in Arabidopsis thaliana protected plants from cellular damage caused by an excess of UV-B radiation. A stable expression of chalcone synthase gene was detected in leaves of OgUBC1-expressing Arabidopsis, resulting in producing higher amounts of anthocyanin than those in wild-type Col-0 plants. Additionally, both pathogenesis-related gene1 and 5 were transcribed in the transgenic Arabidopsis in the absence of pathogen infection. The OgUBC1-expressing plants were resistant to the infection of Botrytis cinerea. Taken together, we suggested that the OgUBC1 is involved in ubiquitination process important for cellular response against biotic and abiotic stresses in plants.

  13. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  14. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  15. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  16. Shared origins of a key enzyme during the evolution of C4 and CAM metabolism

    Science.gov (United States)

    Christin, Pascal-Antoine; Arakaki, Monica; Osborne, Colin P.; Bräutigam, Andrea; Sage, Rowan F.; Hibberd, Julian M.; Kelly, Steven; Covshoff, Sarah; Wong, Gane Ka-Shu; Hancock, Lillian; Edwards, Erika J.

    2014-01-01

    CAM and C4 photosynthesis are two key plant adaptations that have evolved independently multiple times, and are especially prevalent in particular groups of plants, including the Caryophyllales. We investigate the origin of photosynthetic PEPC, a key enzyme of both the CAM and C4 pathways. We combine phylogenetic analyses of genes encoding PEPC with analyses of RNA sequence data of Portulaca, the only plants known to perform both CAM and C4 photosynthesis. Three distinct gene lineages encoding PEPC exist in eudicots (namely ppc-1E1, ppc-1E2 and ppc-2), one of which (ppc-1E1) was recurrently recruited for use in both CAM and C4 photosynthesis within the Caryophyllales. This gene is present in multiple copies in the cacti and relatives, including Portulaca. The PEPC involved in the CAM and C4 cycles of Portulaca are encoded by closely related yet distinct genes. The CAM-specific gene is similar to genes from related CAM taxa, suggesting that CAM has evolved before C4 in these species. The similar origin of PEPC and other genes involved in the CAM and C4 cycles highlights the shared early steps of evolutionary trajectories towards CAM and C4, which probably diverged irreversibly only during the optimization of CAM and C4 phenotypes. PMID:24638902

  17. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  18. Gene expression variability in human hepatic drug metabolizing enzymes and transporters.

    Directory of Open Access Journals (Sweden)

    Lun Yang

    Full Text Available Interindividual variability in the expression of drug-metabolizing enzymes and transporters (DMETs in human liver may contribute to interindividual differences in drug efficacy and adverse reactions. Published studies that analyzed variability in the expression of DMET genes were limited by sample sizes and the number of genes profiled. We systematically analyzed the expression of 374 DMETs from a microarray data set consisting of gene expression profiles derived from 427 human liver samples. The standard deviation of interindividual expression for DMET genes was much higher than that for non-DMET genes. The 20 DMET genes with the largest variability in the expression provided examples of the interindividual variation. Gene expression data were also analyzed using network analysis methods, which delineates the similarities of biological functionalities and regulation mechanisms for these highly variable DMET genes. Expression variability of human hepatic DMET genes may affect drug-gene interactions and disease susceptibility, with concomitant clinical implications.

  19. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  20. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  1. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  2. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  3. Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

    DEFF Research Database (Denmark)

    Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

    2018-01-01

    The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

  4. Assignment of the human UDP glucuronosyltransferase gene (UGT1A1) to chromosome region 2q37

    NARCIS (Netherlands)

    van Es, H. H.; Bout, A.; Liu, J.; Anderson, L.; Duncan, A. M.; Bosma, P.; Oude Elferink, R.; Jansen, P. L.; Chowdhury, J. R.; Schurr, E.

    1993-01-01

    UDP glucuronosyltransferases (UGTs) comprise a multigene family of drug-metabolizing enzymes. The sub-family of UGTs that conjugate bilirubin and phenolic compounds with glucuronic acid has been termed UGT1A1. In man, UGT1A1 isoforms are encoded by a single gene, UGT1A1. Protein isoforms encoded by

  5. Antisense silencing of the creA gene in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Bautista, L. F.; Aleksenko, Alexei Y.; Hentzer, Morten

    2000-01-01

    Antisense expression of a portion of the gene encoding the major carbon catabolite repressor CREA in Aspergillus nidulans resulted in a substantial increase in the levels of glucose-repressible enzymes, both endogenous and heterologous, in the presence of glucose. The derepression effect was appr...

  6. Novel mutants of Erwinia carotovora subsp. carotovora defective in the production of plant cell wall degrading enzymes generated by Mu transpososome-mediated insertion mutagenesis.

    Science.gov (United States)

    Laasik, Eve; Ojarand, Merli; Pajunen, Maria; Savilahti, Harri; Mäe, Andres

    2005-02-01

    As in Erwinia carotovora subsp. carotovora the regulation details of the main virulence factors, encoding extracellular enzymes that degrade the plant cell wall, is only rudimentally understood, we performed a genetic screen to identify novel candidate genes involved in the process. Initially, we used Mu transpososome-mediated mutagenesis approach to generate a comprehensive transposon insertion mutant library of ca. 10000 clones and screened the clones for the loss of extracellular enzyme production. Extracellular enzymes production was abolished by mutations in the chromosomal helEcc, trkAEcc yheLEcc, glsEcc, igaAEcc and cysQEcc genes. The findings reported here demonstrate that we have isolated six new representatives that belong to the pool of genes modulating the production of virulence factors in E. carotovora.

  7. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  8. Over-expression of zmarg encoding an arginase improves grain production in maize

    International Nuclear Information System (INIS)

    Hong, D.; Tian, Y.; Meng, X.; Zhang, P.

    2016-01-01

    Arginase, as one of the three key enzymes in nitrogen catabolism, the physiological role of Arg catabolism in cereal crops has not been fully clarified. Studies have shown that arginase-encoding genes play a key role in providing nitrogen to developing seedlings in many plant species.Yield is a primary trait in many crop breeding programs, which can be increased by modification of genes related to photosynthesis, nitrogen assimilation, carbon distribution, plant architecture, and transcriptional networks controlling plant development. In the present study, a maize arginase gene ZmARG was cloned and introduced into maize inbred lines by Agrobacterium tumefaciens- mediated transformation. Putative transgenic plants were confirmed by PCR, Southern blotting RT-PCR analysis. The expression of the ZmARG gene increased arginase activity in several tissues in transgenic lines. Transgenic maize plants had significantly higher ear weight and 100-seed weight as compared with wild-type control. Our results suggested that ZmARG was a potential target gene for crop yield improvement. (author)

  9. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  10. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  11. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  12. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  13. Sequence analysis and identification of the pyrKDbF operon from Lactococcus lactis including a novel gene, pyrK, involved in pyrimidine biosynthesis

    DEFF Research Database (Denmark)

    Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin

    1996-01-01

    Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...

  14. Homocysteine and coronary heart disease : the role of polymorphic genes and hemostasis

    NARCIS (Netherlands)

    Klerk, M.

    2002-01-01

    Background Homocysteine is a sulfur-containing amino acid formed during catabolism of the essential amino acid methionine. Defects in genes encoding enzymes or sub-optimal intake of B-vitamins (e.g. folate) involved in homocysteine

  15. Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

    Science.gov (United States)

    Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

    2005-01-01

    Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

  16. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  17. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  18. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  19. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

    2016-01-01

    genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

  20. L-Rhamnose induction of Aspergillus nidulans α-L-rhamnosidase genes is glucose repressed via a CreA-independent mechanism acting at the level of inducer uptake

    Directory of Open Access Journals (Sweden)

    Tamayo-Ramos Juan A

    2012-02-01

    Full Text Available Abstract Background Little is known about the structure and regulation of fungal α-L-rhamnosidase genes despite increasing interest in the biotechnological potential of the enzymes that they encode. Whilst the paradigmatic filamentous fungus Aspergillus nidulans growing on L-rhamnose produces an α-L-rhamnosidase suitable for oenological applications, at least eight genes encoding putative α-L-rhamnosidases have been found in its genome. In the current work we have identified the gene (rhaE encoding the former activity, and characterization of its expression has revealed a novel regulatory mechanism. A shared pattern of expression has also been observed for a second α-L-rhamnosidase gene, (AN10277/rhaA. Results Amino acid sequence data for the oenological α-L-rhamnosidase were determined using MALDI-TOF mass spectrometry and correspond to the amino acid sequence deduced from AN7151 (rhaE. The cDNA of rhaE was expressed in Saccharomyces cerevisiae and yielded pNP-rhamnohydrolase activity. Phylogenetic analysis has revealed this eukaryotic α-L-rhamnosidase to be the first such enzyme found to be more closely related to bacterial rhamnosidases than other α-L-rhamnosidases of fungal origin. Northern analyses of diverse A. nidulans strains cultivated under different growth conditions indicate that rhaA and rhaE are induced by L-rhamnose and repressed by D-glucose as well as other carbon sources, some of which are considered to be non-repressive growth substrates. Interestingly, the transcriptional repression is independent of the wide domain carbon catabolite repressor CreA. Gene induction and glucose repression of these rha genes correlate with the uptake, or lack of it, of the inducing carbon source L-rhamnose, suggesting a prominent role for inducer exclusion in repression. Conclusions The A. nidulans rhaE gene encodes an α-L-rhamnosidase phylogenetically distant to those described in filamentous fungi, and its expression is regulated by a

  1. Acidic-alkaline ferulic acid esterase from Chaetomium thermophilum var. dissitum: Molecular cloning and characterization of recombinant enzyme expressed in Pichia pastoris

    DEFF Research Database (Denmark)

    Dotsenko, Gleb; Tong, Xiaoxue; Pilgaard, Bo

    2016-01-01

    A novel ferulic acid esterase encoding gene CtFae, was successfully cloned from a highly esterase active strain of the thermophile ascomycetous fungus Chaetomium thermophilum var. dissitum; the gene was heterologously expressed in Pichia pastoris KM71H. The recombinant enzyme (CtFae) was purified...... to homogeneity and subsequently characterized. CtFae was active towards synthetic esters of ferulic, p-coumaric, and caffeic acids, as well as towards wide range of p-nitrophenyl substrates. Its temperature and pH optima were 55 °C and pH 6.0, respectively. Enzyme rare features were broad pH optimum, high...

  2. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  3. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  4. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  5. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  6. Cloning, expression and characterization of L-arabinose isomerase from Thermotoga neapolitana: bioconversion of D-galactose to D-tagatose using the enzyme.

    Science.gov (United States)

    Kim, Byoung-Chan; Lee, Yoon-Hee; Lee, Han-Seung; Lee, Dong-Woo; Choe, Eun-Ah; Pyun, Yu-Ryang

    2002-06-18

    Gene araA encoding an L-arabinose isomerase (AraA) from the hyperthermophile, Thermotoga neapolitana 5068 was cloned, sequenced, and expressed in Escherichia coli. The gene encoded a polypeptide of 496 residues with a calculated molecular mass of 56677 Da. The deduced amino acid sequence has 94.8% identical amino acids compared with the residues in a putative L-arabinose isomerase of Thermotoga maritima. The recombinant enzyme expressed in E. coli was purified to homogeneity by heat treatment, ion exchange chromatography and gel filtration. The thermophilic enzyme had a maximum activity of L-arabinose isomerization and D-galactose isomerization at 85 degrees C, and required divalent cations such as Co(2+) and Mn(2+) for its activity and thermostability. The apparent K(m) values of the enzyme for L-arabinose and D-galactose were 116 mM (v(max), 119 micromol min(-1) mg(-1)) and 250 mM (v(max), 14.3 micromol min(-1) mg(-1)), respectively, that were determined in the presence of both 1 mM Co(2+) and 1 mM Mn(2+). A 68% conversion of D-galactose to D-tagatose was obtained using the recombinant enzyme at the isomerization temperature of 80 degrees C.

  7. Comparison of protein coding gene contents of the fungal phyla Pezizomycotina and Saccharomycotina

    DEFF Research Database (Denmark)

    Arvas, Mikko; Kivioja, Teemu; Mitchell, Alex

    2007-01-01

    Saccharomycotina are slightly better characterised and predicted to encode mainly enzymes. The genes specific to Saccharomycotina are enriched in transcription and mitochondrion related functions. Especially mitochondrial ribosomal proteins seem to have diverged from those of Pezizomycotina. In addition, we...

  8. Drug-gene interaction between the insertion/deletion polymorphism of the angiotensin-converting enzyme gene and antihypertensive therapy

    NARCIS (Netherlands)

    Schelleman, Hedi; Klungel, Olaf H; van Duijn, Cornelia M; Witteman, Jacqueline C M; Hofman, Albert; de Boer, Anthonius; Stricker, Bruno H Ch

    BACKGROUND: Despite the availability of a variety of effective drugs, inadequate control of blood pressure is common. There are some indications that the angiotensin-converting enzyme (ACE) gene modifies the response to antihypertensive drugs, but the results have been inconclusive. OBJECTIVE: To

  9. Study on the Correlation between Gene Expression and Enzyme Activity of Seven Key Enzymes and Ginsenoside Content in Ginseng in Over Time in Ji'an, China.

    Science.gov (United States)

    Yin, Juxin; Zhang, Daihui; Zhuang, Jianjian; Huang, Yi; Mu, Ying; Lv, Shaowu

    2017-12-11

    Panax ginseng is a traditional medicine. Fresh ginseng is one of the most important industries related to ginseng development, and fresh ginseng of varying ages has different medicinal properties. Previous research has not systematically reported the correlation between changes in key enzyme activity with changes in ginsenoside content in fresh ginseng over time. In this study, for the first time, we use ginseng samples of varying ages in Ji'an and systematically reported the changes in the activity of seven key enzymes (HMGR, FPS, SS, SE, DS, CYP450, and GT). We investigated the content of ginsenoside and gene expression of these key enzymes. Ginsenoside content was measured using HPLC. HPLC, GC-MS, and LC-MS were combined to measure the enzyme activity of the key enzymes. Quantitative PCR was used in the investigation of gene expression. By analyzing the correlation between the enzyme activity and the transcription level of the key enzymes with ginsenoside content, we found that DS and GT enzyme activities are significantly correlated with the ginsenoside content in different ages of ginseng. Our findings might provide a new strategy to discriminate between ginseng of different years. Meanwhile, this research provides important information for the in-depth study of ginsenoside biosynthesis.

  10. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  11. Tools and strategies for discovering novel enzymes and metabolic pathways

    Directory of Open Access Journals (Sweden)

    John A. Gerlt

    2016-12-01

    Full Text Available The number of entries in the sequence databases continues to increase exponentially – the UniProt database is increasing with a doubling time of ∼4 years (2% increase/month. Approximately 50% of the entries have uncertain, unknown, or incorrect function annotations because these are made by automated methods based on sequence homology. If the potential in complete genome sequences is to be realized, strategies and tools must be developed to facilitate experimental assignment of functions to uncharacterized proteins discovered in genome projects. The Enzyme Function Initiative (EFI; previously supported by U54GM093342 from the National Institutes of Health, now supported by P01GM118303 developed web tools for visualizing and analyzing (1 sequence and function space in protein families (EFI-EST and (2 genome neighbourhoods in microbial and fungal genomes (EFI-GNT to assist the design of experimental strategies for discovering the in vitro activities and in vivo metabolic functions of uncharacterized enzymes. The EFI developed an experimental platform for large-scale production of the solute binding proteins (SBPs for ABC, TRAP, and TCT transport systems and their screening with a physical ligand library to identify the identities of the ligands for these transport systems. Because the genes that encode transport systems are often co-located with the genes that encode the catabolic pathways for the transported solutes, the identity of the SBP ligand together with the EFI-EST and EFI-GNT web tools can be used to discover new enzyme functions and new metabolic pathways. This approach is demonstrated with the characterization of a novel pathway for ethanolamine catabolism.

  12. Switch between life history strategies due to changes in glycolytic enzyme gene dosage in Saccharomyces cerevisiae.

    Science.gov (United States)

    Wang, Shaoxiao; Spor, Aymé; Nidelet, Thibault; Montalent, Pierre; Dillmann, Christine; de Vienne, Dominique; Sicard, Delphine

    2011-01-01

    Adaptation is the process whereby a population or species becomes better fitted to its habitat through modifications of various life history traits which can be positively or negatively correlated. The molecular factors underlying these covariations remain to be elucidated. Using Saccharomyces cerevisiae as a model system, we have investigated the effects on life history traits of varying the dosage of genes involved in the transformation of resources into energy. Changing gene dosage for each of three glycolytic enzyme genes (hexokinase 2, phosphoglucose isomerase, and fructose-1,6-bisphosphate aldolase) resulted in variation in enzyme activities, glucose consumption rate, and life history traits (growth rate, carrying capacity, and cell size). However, the range of effects depended on which enzyme was expressed differently. Most interestingly, these changes revealed a genetic trade-off between carrying capacity and cell size, supporting the discovery of two extreme life history strategies already described in yeast populations: the "ants," which have lower glycolytic gene dosage, take up glucose slowly, and have a small cell size but reach a high carrying capacity, and the "grasshoppers," which have higher glycolytic gene dosage, consume glucose more rapidly, and allocate it to a larger cell size but reach a lower carrying capacity. These results demonstrate antagonist pleiotropy for glycolytic genes and show that altered dosage of a single gene drives a switch between two life history strategies in yeast.

  13. The last step of syringyl monolignol biosynthesis in angiosperms is regulated by a novel gene encoding sinapyl alcohol dehydrogenase.

    Science.gov (United States)

    Li, L; Cheng, X F; Leshkevich, J; Umezawa, T; Harding, S A; Chiang, V L

    2001-07-01

    Cinnamyl alcohol dehydrogenase (CAD; EC 1.1.1.195) has been thought to mediate the reduction of both coniferaldehyde and sinapaldehyde into guaiacyl and syringyl monolignols in angiosperms. Here, we report the isolation of a novel aspen gene (PtSAD) encoding sinapyl alcohol dehydrogenase (SAD), which is phylogenetically distinct from aspen CAD (PtCAD). Liquid chromatography-mass spectrometry-based enzyme functional analysis and substrate level-controlled enzyme kinetics consistently demonstrated that PtSAD is sinapaldehyde specific and that PtCAD is coniferaldehyde specific. The enzymatic efficiency of PtSAD for sinapaldehyde was approximately 60 times greater than that of PtCAD. These data suggest that in addition to CAD, discrete SAD function is essential to the biosynthesis of syringyl monolignol in angiosperms. In aspen stem primary tissues, PtCAD was immunolocalized exclusively to xylem elements in which only guaiacyl lignin was deposited, whereas PtSAD was abundant in syringyl lignin-enriched phloem fiber cells. In the developing secondary stem xylem, PtCAD was most conspicuous in guaiacyl lignin-enriched vessels, but PtSAD was nearly absent from these elements and was conspicuous in fiber cells. In the context of additional protein immunolocalization and lignin histochemistry, these results suggest that the distinct CAD and SAD functions are linked spatiotemporally to the differential biosynthesis of guaiacyl and syringyl lignins in different cell types. SAD is required for the biosynthesis of syringyl lignin in angiosperms.

  14. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  15. Homeobox genes and melatonin synthesis

    DEFF Research Database (Denmark)

    Rohde, Kristian; Møller, Morten; Rath, Martin Fredensborg

    2014-01-01

    Nocturnal synthesis of melatonin in the pineal gland is controlled by a circadian rhythm in arylalkylamine N-acetyltransferase (AANAT) enzyme activity. In the rodent, Aanat gene expression displays a marked circadian rhythm; release of norepinephrine in the gland at night causes a cAMP-based indu......Nocturnal synthesis of melatonin in the pineal gland is controlled by a circadian rhythm in arylalkylamine N-acetyltransferase (AANAT) enzyme activity. In the rodent, Aanat gene expression displays a marked circadian rhythm; release of norepinephrine in the gland at night causes a c......AMP-based induction of Aanat transcription. However, additional transcriptional control mechanisms exist. Homeobox genes, which are generally known to encode transcription factors controlling developmental processes, are also expressed in the mature rodent pineal gland. Among these, the cone-rod homeobox (CRX......) transcription factor is believed to control pineal-specific Aanat expression. Based on recent advances in our understanding of Crx in the rodent pineal gland, we here suggest that homeobox genes play a role in adult pineal physiology both by ensuring pineal-specific Aanat expression and by facilitating c...

  16. Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

    Science.gov (United States)

    Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

    2009-01-01

    There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

  17. Pharmacogenetics of aldo-keto reductase 1C (AKR1C) enzymes.

    Science.gov (United States)

    Alshogran, Osama Y

    2017-10-01

    Genetic variation in metabolizing enzymes contributes to variable drug response and disease risk. Aldo-keto reductase type 1C (AKR1C) comprises a sub-family of reductase enzymes that play critical roles in the biotransformation of various drug substrates and endogenous compounds such as steroids. Several single nucleotide polymorphisms have been reported among AKR1C encoding genes, which may affect the functional expression of the enzymes. Areas covered: This review highlights and comprehensively discusses previous pharmacogenetic reports that have examined genetic variations in AKR1C and their association with disease development, drug disposition, and therapeutic outcomes. The article also provides information about the effect of AKR1C genetic variants on enzyme function in vitro. Expert opinion: The current evidence that links the effect of AKR1C gene polymorphisms to disease progression and development is inconsistent and needs further validation, despite of the tremendous knowledge available. Information about association of AKR1C genetic variants and drug efficacy, safety, and pharmacokinetics is limited, thus, future studies that advance our understanding about these relationships and their clinical relevance are needed. It is imperative to achieve consistent findings before the potential translation and adoption of AKR1C genetic variants in clinical practice.

  18. Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

    Science.gov (United States)

    Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

    1995-01-01

    Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant. PMID:7896694

  19. Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

    Science.gov (United States)

    Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

    1995-04-01

    Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant.

  20. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    International Nuclear Information System (INIS)

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  1. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

  2. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    Science.gov (United States)

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  3. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel

    2017-09-01

    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  4. Control of the synthesis and subcellular targeting of the two GDH genes products in leaves and stems of Nicotiana plumbaginifolia and Arabidopsis thaliana.

    Science.gov (United States)

    Fontaine, Jean-Xavier; Saladino, Francesca; Agrimonti, Caterina; Bedu, Magali; Tercé-Laforgue, Thérèse; Tétu, Thierry; Hirel, Bertrand; Restivo, Francesco M; Dubois, Frédéric

    2006-03-01

    Although the physiological role of the enzyme glutamate dehydrogenase which catalyses in vitro the reversible amination of 2-oxoglutarate to glutamate remains to be elucidated, it is now well established that in higher plants the enzyme preferentially occurs in the mitochondria of phloem companion cells. The Nicotiana plumbaginifolia and Arabidopis thaliana enzyme is encoded by two distinct genes encoding either an alpha- or a beta-subunit. Using antisense plants and mutants impaired in the expression of either of the two genes, we showed that in leaves and stems both the alpha- and beta-subunits are targeted to the mitochondria of the companion cells. In addition, we found in both species that there is a compensatory mechanism up-regulating the expression of the alpha-subunit in the stems when the expression of the beta-subunit is impaired in the leaves, and of the beta-subunit in the leaves when the expression of the alpha-subunit is impaired in the stems. When one of the two genes encoding glutamate dehydrogenase is ectopically expressed, the corresponding protein is targeted to the mitochondria of both leaf and stem parenchyma cells and its production is increased in the companion cells. These results are discussed in relation to the possible signalling and/or physiological function of the enzyme which appears to be coordinated in leaves and stems.

  5. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  6. Angiotensin converting enzyme (ACE) gene expression in experimentally induced liver cirrhosis in rats.

    Science.gov (United States)

    Shahid, Syed Muhammad; Fatima, Syeda Nuzhat; Mahboob, Tabassum

    2013-09-01

    Angiotensin converting enzyme (ACE) is a key player of Renin Angiotensin System (RAS), involved in conversion of active product, angiotensin-II. Alterations in RAS have been implicated in the pathophysiology of various diseases involving heart, kidney, lung and liver. This study is designed to investigate the association of ACE gene expression in induction of liver cirrhosis in rats. Total 12 male albino Wistar rats were selected and divided in two groups. Control group received 0.9% NaCl, where as Test group received thioacidamide (TAA), dissolved in 0.9%NaCl, injected intraperitoneally at a dosage of 200mg/Kg of body weight, twice a week for 12 weeks. The rats were decapitated and blood sample was collected at the end of experimental period and used for liver functions, enzyme activity, antioxidant enzymes and lipid peroxidation estimations. Genomic DNA was isolated from excised tissue determine the ACE genotypes using specific primers. The ACE gene expression in liver tissue was assessed using the quantitative RT-PCR method. The activity of ALT, total and direct bilirubin, SOD and CAT levels were significantly high (pACE gene expression after 12 weeks TAA treatment in cirrhotic rats was significantly increased (pACE gene expression. The finding of major up-regulation of ACE in the experimental rat liver provides further insight into the complexities of the RAS and its regulation in liver injury. The development of specific modulators of ACE activity and function, in future, will help determine the role of ACE and its genetic variants in the pathophysiology of liver disease.

  7. MRI Reporter Genes for Noninvasive Molecular Imaging

    Directory of Open Access Journals (Sweden)

    Caixia Yang

    2016-05-01

    Full Text Available Magnetic resonance imaging (MRI is one of the most important imaging technologies used in clinical diagnosis. Reporter genes for MRI can be applied to accurately track the delivery of cell in cell therapy, evaluate the therapy effect of gene delivery, and monitor tissue/cell-specific microenvironments. Commonly used reporter genes for MRI usually include genes encoding the enzyme (e.g., tyrosinase and β-galactosidase, the receptor on the cells (e.g., transferrin receptor, and endogenous reporter genes (e.g., ferritin reporter gene. However, low sensitivity limits the application of MRI and reporter gene-based multimodal imaging strategies are common including optical imaging and radionuclide imaging. These can significantly improve diagnostic efficiency and accelerate the development of new therapies.

  8. Metabolism of very long-chain Fatty acids: genes and pathophysiology.

    Science.gov (United States)

    Sassa, Takayuki; Kihara, Akio

    2014-02-01

    Fatty acids (FAs) are highly diverse in terms of carbon (C) chain-length and number of double bonds. FAs with C>20 are called very long-chain fatty acids (VLCFAs). VLCFAs are found not only as constituents of cellular lipids such as sphingolipids and glycerophospholipids but also as precursors of lipid mediators. Our understanding on the function of VLCFAs is growing in parallel with the identification of enzymes involved in VLCFA synthesis or degradation. A variety of inherited diseases, such as ichthyosis, macular degeneration, myopathy, mental retardation, and demyelination, are caused by mutations in the genes encoding VLCFA metabolizing enzymes. In this review, we describe mammalian VLCFAs by highlighting their tissue distribution and metabolic pathways, and we discuss responsible genes and enzymes with reference to their roles in pathophysiology.

  9. Heterologous stable expression of terpenoid biosynthetic genes using the moss Physcomitrella patens

    DEFF Research Database (Denmark)

    Bach, Søren Spanner; King, Brian Christopher; Zhan, Xin

    2014-01-01

    Heterologous and stable expression of genes encoding terpenoid biosynthetic enzymes in planta is an important tool for functional characterization and is an attractive alternative to expression in microbial hosts for biotechnological production. Despite improvements to the procedure, such as stre...

  10. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  11. Characterization of the haloacid dehalogenase from Xanthobacter autotrophicus GJ10 and sequencing of the dhlB gene

    DEFF Research Database (Denmark)

    van der Ploeg, J; Van Hall, Gerrit; Janssen, D B

    1991-01-01

    B) was cloned and could be allocated to a 6.5-kb EcoRI-BglII fragment. Part of this fragment was sequenced, and the dhlB open reading frame was identified by comparison with the N-terminal amino acid sequence of the protein. The gene was found to encode a protein of 27,433 Da that showed considerable homology...... chromatography. The enzyme was active with 2-halogenated carboxylic acids and converted only the L-isomer of 2-chloropropionic acid with inversion of configuration to produce D-lactate. The activity of the enzyme was not readily influenced by thiol reagents. The gene encoding the haloacid dehalogenase (dhl...... (60.5 and 61.0% similarity) with the two other haloacid dehalogenases sequenced to date but not with the haloalkane dehalogenase from X. autotrophicus GJ10....

  12. [Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

    Science.gov (United States)

    Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

    2008-01-01

    The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

  13. Gene content and organization of a 281-kbp contig from the genome of the extremely thermophilic archaeon, Sulfolobus solfataricus P2

    NARCIS (Netherlands)

    Charlebois, R.; Confalonieri, F.; Curtis, B.; Doolittle, W.F.; Duguet, M.; Erauso, G.; Faguy, D.; Gaasterland, T.; Garrett, R.A.; Gordon, P.; Kozera, C.; Medina, N.; Oost, van der J.; Peng, X.; Ragan, M.; She, Q.; Singh, R.K.

    2000-01-01

    The sequence of a 281-kbp contig from the crenarchaeote Sulfolobus solfataricus P2 was determined and analysed. Notable features in this region include 29 ribosomal protein genes, 12 tRNA genes (four of which contain archaeal-type introns), operons encoding enzymes of histidine biosynthesis,

  14. Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

    DEFF Research Database (Denmark)

    Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata

    2000-01-01

    The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...

  15. A gene encoding an abscisic acid biosynthetic enzyme (LsNCED4) collocates with the high temperature germination locus Htg6.1 in lettuce (Lactuca sp.).

    Science.gov (United States)

    Argyris, Jason; Truco, María José; Ochoa, Oswaldo; McHale, Leah; Dahal, Peetambar; Van Deynze, Allen; Michelmore, Richard W; Bradford, Kent J

    2011-01-01

    Thermoinhibition, or failure of seeds to germinate when imbibed at warm temperatures, can be a significant problem in lettuce (Lactuca sativa L.) production. The reliability of stand establishment would be improved by increasing the ability of lettuce seeds to germinate at high temperatures. Genes encoding germination- or dormancy-related proteins were mapped in a recombinant inbred line population derived from a cross between L. sativa cv. Salinas and L. serriola accession UC96US23. This revealed several candidate genes that are located in the genomic regions containing quantitative trait loci (QTLs) associated with temperature and light requirements for germination. In particular, LsNCED4, a temperature-regulated gene in the biosynthetic pathway for abscisic acid (ABA), a germination inhibitor, mapped to the center of a previously detected QTL for high temperature germination (Htg6.1) from UC96US23. Three sets of sister BC(3)S(2) near-isogenic lines (NILs) that were homozygous for the UC96US23 allele of LsNCED4 at Htg6.1 were developed by backcrossing to cv. Salinas and marker-assisted selection followed by selfing. The maximum temperature for germination of NIL seed lots with the UC96US23 allele at LsNCED4 was increased by 2-3°C when compared with sister NIL seed lots lacking the introgression. In addition, the expression of LsNCED4 was two- to threefold lower in the former NIL lines as compared to expression in the latter. Together, these data strongly implicate LsNCED4 as the candidate gene responsible for the Htg6.1 phenotype and indicate that decreased ABA biosynthesis at high imbibition temperatures is a major factor responsible for the increased germination thermotolerance of UC96US23 seeds.

  16. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    NARCIS (Netherlands)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

    2008-01-01

    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  17. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2016-01-01

    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  18. Mutation for nonsyndromic mental retardation in the trans-2-enoyl-CoA reductase TER gene involved in fatty acid elongation impairs the enzyme activity and stability, leading to change in sphingolipid profile.

    Science.gov (United States)

    Abe, Kensuke; Ohno, Yusuke; Sassa, Takayuki; Taguchi, Ryo; Çalışkan, Minal; Ober, Carole; Kihara, Akio

    2013-12-20

    Very long-chain fatty acids (VLCFAs, chain length >C20) exist in tissues throughout the body and are synthesized by repetition of the fatty acid (FA) elongation cycle composed of four successive enzymatic reactions. In mammals, the TER gene is the only gene encoding trans-2-enoyl-CoA reductase, which catalyzes the fourth reaction in the FA elongation cycle. The TER P182L mutation is the pathogenic mutation for nonsyndromic mental retardation. This mutation substitutes a leucine for a proline residue at amino acid 182 in the TER enzyme. Currently, the mechanism by which the TER P182L mutation causes nonsyndromic mental retardation is unknown. To understand the effect of this mutation on the TER enzyme and VLCFA synthesis, we have biochemically characterized the TER P182L mutant enzyme using yeast and mammalian cells transfected with the TER P182L mutant gene and analyzed the FA elongation cycle in the B-lymphoblastoid cell line with the homozygous TER P182L mutation (TER(P182L/P182L) B-lymphoblastoid cell line). We have found that TER P182L mutant enzyme exhibits reduced trans-2-enoyl-CoA reductase activity and protein stability, thereby impairing VLCFA synthesis and, in turn, altering the sphingolipid profile (i.e. decreased level of C24 sphingomyelin and C24 ceramide) in the TER(P182L/P182L) B-lymphoblastoid cell line. We have also found that in addition to the TER enzyme-catalyzed fourth reaction, the third reaction in the FA elongation cycle is affected by the TER P182L mutation. These findings provide new insight into the biochemical defects associated with this genetic mutation.

  19. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  20. A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast

    DEFF Research Database (Denmark)

    Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.

    2007-01-01

    and related yeasts have two different genes/enzymes to apparently 'distinguish' between the two reactions in a single cell. It is likely that upon duplication similar to 200 million years ago, a specialized Uga1p evolved into a 'novel' transaminase enzyme with broader substrate specificity.......In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...... to characterize the substrate specificity and kinetic parameters of the four enzymes. It was found that the cofactor pyridoxal 5'-phosphate is needed for enzymatic activity and alpha-ketoglutarate, and not pyruvate, as the amino group acceptor. SkPyd4p preferentially uses BAL as the amino group donor (V...

  1. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  2. Tumor targeted gene therapy

    International Nuclear Information System (INIS)

    Kang, Joo Hyun

    2006-01-01

    Knowledge of molecular mechanisms governing malignant transformation brings new opportunities for therapeutic intervention against cancer using novel approaches. One of them is gene therapy based on the transfer of genetic material to an organism with the aim of correcting a disease. The application of gene therapy to the cancer treatment had led to the development of new experimental approaches such as suicidal gene therapy, inhibition of oncogenes and restoration of tumor-suppressor genes. Suicidal gene therapy is based on the expression in tumor cells of a gene encoding an enzyme that converts a prodrug into a toxic product. Representative suicidal genes are Herpes simplex virus type 1 thymidine kinase (HSV1-tk) and cytosine deaminase (CD). Especially, physicians and scientists of nuclear medicine field take an interest in suicidal gene therapy because they can monitor the location and magnitude, and duration of expression of HSV1-tk and CD by PET scanner

  3. Intestinal PTGS2 mRNA Levels, PTGS2 Gene Polymorphisms, and Colorectal Carcinogenesis

    DEFF Research Database (Denmark)

    Vogel, Lotte K.; Saebo, Mona; Hoyer, Helle

    2014-01-01

    Background & Aims: Inflammation is a major risk factor for development of colorectal cancer (CRC). Prostaglandin synthase cyclooxygenase-2 (COX-2) encoded by the PTGS2 gene is the rate limiting enzyme in prostaglandin synthesis and therefore plays a distinct role as regulator of inflammation...

  4. Draft genome sequence of Actinotignum schaalii DSM 15541T: Genetic insights into the lifestyle, cell fitness and virulence.

    Directory of Open Access Journals (Sweden)

    Atteyet F Yassin

    Full Text Available The permanent draft genome sequence of Actinotignum schaalii DSM 15541T is presented. The annotated genome includes 2,130,987 bp, with 1777 protein-coding and 58 rRNA-coding genes. Genome sequence analysis revealed absence of genes encoding for: components of the PTS systems, enzymes of the TCA cycle, glyoxylate shunt and gluconeogensis. Genomic data revealed that A. schaalii is able to oxidize carbohydrates via glycolysis, the nonoxidative pentose phosphate and the Entner-Doudoroff pathways. Besides, the genome harbors genes encoding for enzymes involved in the conversion of pyruvate to lactate, acetate and ethanol, which are found to be the end products of carbohydrate fermentation. The genome contained the gene encoding Type I fatty acid synthase required for de novo FAS biosynthesis. The plsY and plsX genes encoding the acyltransferases necessary for phosphatidic acid biosynthesis were absent from the genome. The genome harbors genes encoding enzymes responsible for isoprene biosynthesis via the mevalonate (MVA pathway. Genes encoding enzymes that confer resistance to reactive oxygen species (ROS were identified. In addition, A. schaalii harbors genes that protect the genome against viral infections. These include restriction-modification (RM systems, type II toxin-antitoxin (TA, CRISPR-Cas and abortive infection system. A. schaalii genome also encodes several virulence factors that contribute to adhesion and internalization of this pathogen such as the tad genes encoding proteins required for pili assembly, the nanI gene encoding exo-alpha-sialidase, genes encoding heat shock proteins and genes encoding type VII secretion system. These features are consistent with anaerobic and pathogenic lifestyles. Finally, resistance to ciprofloxacin occurs by mutation in chromosomal genes that encode the subunits of DNA-gyrase (GyrA and topisomerase IV (ParC enzymes, while resistant to metronidazole was due to the frxA gene, which encodes NADPH

  5. Bioinformatic evaluation of L-arginine catabolic pathways in 24 cyanobacteria and transcriptional analysis of genes encoding enzymes of L-arginine catabolism in the cyanobacterium Synechocystis sp. PCC 6803

    Directory of Open Access Journals (Sweden)

    Pistorius Elfriede K

    2007-11-01

    cyanobacterial genomes revealed that five different L-arginine-degrading pathways are present in the investigated cyanobacterial species. In Synechocystis sp. PCC 6803 an L-arginine deiminase pathway and an L-arginine oxidase/dehydrogenase pathway represent the major pathways, while the L-arginine decarboxylase pathway most likely only functions in polyamine biosynthesis. The transcripts encoding the enzymes of the two major pathways were constitutively expressed with the exception of the transcript for the carbamate kinase, which was substantially up-regulated in cells grown with L-arginine.

  6. Cloning and characterization of the Yarrowia lipolytica squalene synthase (SQS1) gene and functional complementation of the Saccharomyces cerevisiae erg9 mutation

    NARCIS (Netherlands)

    Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.

    2000-01-01

    The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were

  7. Alteration in expression of defence genes in Pisum sativum after exposure to supplementary ultraviolet-B radiation

    International Nuclear Information System (INIS)

    Strid, A.

    1993-01-01

    Alterations in the amounts of mRNA for different types of defence genes after exposure of peas to supplementary ultraviolet-B radiation are demonstrated. The expression of the genes which encode the chalcone synthase of the flavonoid biosynthetic pathway and glutathione reductase was induced, while a decrease was found for the chloroplastic radical-scavenging enzyme, superoxide dismutase. (author)

  8. Gene expression for peroxisome-associated enzymes in hepatocellular carcinomas induced by ciprofibrate, a hypolipidemic compound

    International Nuclear Information System (INIS)

    Rao, M.S.; Nemali, M.R.; Reddy, J.K.

    1986-01-01

    Administration of hypolipidemic compounds leads to marked proliferation of peroxisomes and peroxisome-associated enzymes (PAE) in the livers of rodents and non-rodent species. The increase peroxisome-associated enzymes such as fatty acid β-oxidation system and catalase is shown to be due to an increase in the levels of mRNA. In this experiment they have examined hepatocellular carcinomas (HCC), induced in male F-344 rats by ciprofibrate (0.025%, w/w for 60 weeks), for gene expression of PAE. Total RNA was purified from HCC as well as from control and ciprofibrate (0.025% for 2 weeks) fed rat livers. Northern blot analysis was performed using [32/sub p/]cDNA probes for albumin, fatty acetyl-CoA oxidase, enoyl-CoA hydratase 3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme and catalase. mRNA levels in HCC for albumin, fatty acid β-oxidation enzymes and catalase were comparable with those levels observed in the livers of rats given ciprofibrate for 2 weeks. In control livers the mRNAs for β-oxidation enzymes were low. Albumin mRNA levels in all the 3 groups were comparable. Additional studies are necessary to determine whether the increased level of mRNAs for the β-oxidation enzymes in HCC is due to the effect of ciprofibrate or to the gene amplification

  9. Regulation of hydantoin-hydrolyzing enzyme expression in Agrobacterium tumefaciens strain RU-AE01.

    Science.gov (United States)

    Jiwaji, Meesbah; Dorrington, Rosemary Ann

    2009-10-01

    Optically pure D-: amino acids, like D-: hydroxyphenylglycine, are used in the semi-synthetic production of pharmaceuticals. They are synthesized industrially via the biocatalytic hydrolysis of p-hydroxyphenylhydantoin using enzymes derived from Agrobacterium tumefaciens strains. The reaction proceeds via a three-step pathway: (a) the ring-opening cleavage of the hydantoin ring by a D-: hydantoinase (encoded by hyuH), (b) conversion of the resultant D-: N-carbamylamino acid to the corresponding amino acid by a D-: N-carbamoylase (encoded by hyuC), and (c) chemical or enzymatic racemization of the un-reacted hydantoin substrate. While the structure and biochemical properties of these enzymes are well understood, little is known about their origin, their function, and their regulation in the native host. We investigated the mechanisms involved in the regulation of expression of the hydantoinase and N-carbamoylase enzyme activity in A. tumefaciens strain RU-AE01. We present evidence for a complex regulatory network that responds to the growth status of the cells, the presence of inducer, and nitrogen catabolite repression. Deletion analysis and site-directed mutagenesis were used to identify regulatory elements involved in transcriptional regulation of hyuH and hyuC expression. Finally, a comparison between the hyu gene clusters in several Agrobacterium strains provides insight into the function of D-: selective hydantoin-hydrolyzing enzyme systems in Agrobacterium species.

  10. The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

    Science.gov (United States)

    Santiago, Margarita; Gardner, Richard C

    2015-07-01

    Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

  11. Oxalate-metabolising genes of the white-rot fungus Dichomitus squalens are differentially induced on wood and at high proton concentration.

    Directory of Open Access Journals (Sweden)

    Miia R Mäkelä

    Full Text Available Oxalic acid is a prevalent fungal metabolite with versatile roles in growth and nutrition, including degradation of plant biomass. However, the toxicity of oxalic acid makes regulation of its intra- and extracellular concentration crucial. To increase the knowledge of fungal oxalate metabolism, a transcriptional level study on oxalate-catabolising genes was performed with an effective lignin-degrading white-rot fungus Dichomitus squalens, which has demonstrated particular abilities in production and degradation of oxalic acid. The expression of oxalic-acid decomposing oxalate decarboxylase (ODC and formic-acid decomposing formate dehydrogenase (FDH encoding genes was followed during the growth of D. squalens on its natural spruce wood substrate. The effect of high proton concentration on the regulation of the oxalate-catabolising genes was determined after addition of organic acid (oxalic acid and inorganic acid (hydrochloric acid to the liquid cultures of D. squalens. In order to evaluate the co-expression of oxalate-catabolising and manganese peroxidase (MnP encoding genes, the expression of one MnP encoding gene, mnp1, of D. squalens was also surveyed in the solid state and liquid cultures. Sequential action of ODC and FDH encoding genes was detected in the studied cultivations. The odc1, fdh2 and fdh3 genes of D. squalens showed constitutive expression, whereas ODC2 and FHD1 most likely are the main responsible enzymes for detoxification of high concentrations of oxalic and formic acids. The results also confirmed the central role of ODC1 when D. squalens grows on coniferous wood. Phylogenetic analysis revealed that fungal ODCs have evolved from at least two gene copies whereas FDHs have a single ancestral gene. As a conclusion, the multiplicity of oxalate-catabolising genes and their differential regulation on wood and in acid-amended cultures of D. squalens point to divergent physiological roles for the corresponding enzymes.

  12. Coordination of gene expression of arachidonic and docosahexaenoic acid cascade enzymes during human brain development and aging.

    Science.gov (United States)

    Ryan, Veronica H; Primiani, Christopher T; Rao, Jagadeesh S; Ahn, Kwangmi; Rapoport, Stanley I; Blanchard, Helene

    2014-01-01

    The polyunsaturated arachidonic and docosahexaenoic acids (AA and DHA) participate in cell membrane synthesis during neurodevelopment, neuroplasticity, and neurotransmission throughout life. Each is metabolized via coupled enzymatic reactions within separate but interacting metabolic cascades. AA and DHA pathway genes are coordinately expressed and underlie cascade interactions during human brain development and aging. The BrainCloud database for human non-pathological prefrontal cortex gene expression was used to quantify postnatal age changes in mRNA expression of 34 genes involved in AA and DHA metabolism. Expression patterns were split into Development (0 to 20 years) and Aging (21 to 78 years) intervals. Expression of genes for cytosolic phospholipases A2 (cPLA2), cyclooxygenases (COX)-1 and -2, and other AA cascade enzymes, correlated closely with age during Development, less so during Aging. Expression of DHA cascade enzymes was less inter-correlated in each period, but often changed in the opposite direction to expression of AA cascade genes. Except for the PLA2G4A (cPLA2 IVA) and PTGS2 (COX-2) genes at 1q25, highly inter-correlated genes were at distant chromosomal loci. Coordinated age-related gene expression during the brain Development and Aging intervals likely underlies coupled changes in enzymes of the AA and DHA cascades and largely occur through distant transcriptional regulation. Healthy brain aging does not show upregulation of PLA2G4 or PTGS2 expression, which was found in Alzheimer's disease.

  13. Coordination of gene expression of arachidonic and docosahexaenoic acid cascade enzymes during human brain development and aging.

    Directory of Open Access Journals (Sweden)

    Veronica H Ryan

    Full Text Available The polyunsaturated arachidonic and docosahexaenoic acids (AA and DHA participate in cell membrane synthesis during neurodevelopment, neuroplasticity, and neurotransmission throughout life. Each is metabolized via coupled enzymatic reactions within separate but interacting metabolic cascades.AA and DHA pathway genes are coordinately expressed and underlie cascade interactions during human brain development and aging.The BrainCloud database for human non-pathological prefrontal cortex gene expression was used to quantify postnatal age changes in mRNA expression of 34 genes involved in AA and DHA metabolism.Expression patterns were split into Development (0 to 20 years and Aging (21 to 78 years intervals. Expression of genes for cytosolic phospholipases A2 (cPLA2, cyclooxygenases (COX-1 and -2, and other AA cascade enzymes, correlated closely with age during Development, less so during Aging. Expression of DHA cascade enzymes was less inter-correlated in each period, but often changed in the opposite direction to expression of AA cascade genes. Except for the PLA2G4A (cPLA2 IVA and PTGS2 (COX-2 genes at 1q25, highly inter-correlated genes were at distant chromosomal loci.Coordinated age-related gene expression during the brain Development and Aging intervals likely underlies coupled changes in enzymes of the AA and DHA cascades and largely occur through distant transcriptional regulation. Healthy brain aging does not show upregulation of PLA2G4 or PTGS2 expression, which was found in Alzheimer's disease.

  14. Development and validation of a microarray for the investigation of the CAZymes encoded by the human gut microbiome.

    Directory of Open Access Journals (Sweden)

    Abdessamad El Kaoutari

    Full Text Available Distal gut bacteria play a pivotal role in the digestion of dietary polysaccharides by producing a large number of carbohydrate-active enzymes (CAZymes that the host otherwise does not produce. We report here the design of a custom microarray that we used to spot non-redundant DNA probes for more than 6,500 genes encoding glycoside hydrolases and lyases selected from 174 reference genomes from distal gut bacteria. The custom microarray was tested and validated by the hybridization of bacterial DNA extracted from the stool samples of lean, obese and anorexic individuals. Our results suggest that a microarray-based study can detect genes from low-abundance bacteria better than metagenomic-based studies. A striking example was the finding that a gene encoding a GH6-family cellulase was present in all subjects examined, whereas metagenomic studies have consistently failed to detect this gene in both human and animal gut microbiomes. In addition, an examination of eight stool samples allowed the identification of a corresponding CAZome core containing 46 families of glycoside hydrolases and polysaccharide lyases, which suggests the functional stability of the gut microbiota despite large taxonomical variations between individuals.

  15. Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

    DEFF Research Database (Denmark)

    Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata

    2000-01-01

    The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...... amino acid substitutions. To verify that the gene was expressed in M. hominis, a polyclonal antibody was produced and tested against whole cell protein from 15 strains. The enzyme was expressed in all strains investigated as a 36-kDa protein. All strains except type strain PG21(T) showed reaction...

  16. Cloning and expression of synthetic genes encoding angiotensin-I converting enzyme (ACE)-inhibitory bioactive peptides in Bifidobacterium pseudocatenulatum.

    Science.gov (United States)

    Losurdo, Luca; Quintieri, Laura; Caputo, Leonardo; Gallerani, Raffaele; Mayo, Baltasar; De Leo, Francesca

    2013-03-01

    A wide range of biopeptides potentially able to lower blood pressure through inhibition of the angiotensin-I converting enzyme (ACE) is produced in fermented foods by proteolytic starter cultures. This work applies a procedure based on recombinant DNA technologies for the synthesis and expression of three ACE-inhibitory peptides using a probiotic cell factory. ACE-inhibitory genes and their pro-active precursors were designed, synthesized by PCR, and cloned in Escherichia coli; after which, they were cloned into the pAM1 E. coli-bifidobacteria shuttle vector. After E. coli transformation, constructs carrying the six recombinant clones were electrotransferred into the Bifidobacterium pseudocatenulatum M115 probiotic strain. Interestingly, five of the six constructs proved to be stable. Their expression was confirmed by reverse transcription PCR. Furthermore, transformed strains displayed ACE-inhibitory activity linearly correlated to increasing amounts of cell-free cellular lysates. In particular, 50 μg of lysates from constructs pAM1-Pro-BP3 and pAM1-BP2 showed a 50% higher ACE-inhibitory activity than that of the controls. As a comparison, addition of 50 ng of Pro-BP1 and Pro-BP3 synthetic peptides to 50 μg of cell-free extracts of B. pseudocatenulatum M115 wild-type strain showed an average of 67% of ACE inhibition; this allowed estimating the amount of the peptides produced by the transformants. Engineering of bifidobacteria for the production of biopeptides is envisioned as a promising cell factory model system. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  17. Enzymatic characterization and gene identification of aconitate isomerase, an enzyme involved in assimilation of trans-aconitic acid, from Pseudomonas sp. WU-0701.

    Science.gov (United States)

    Yuhara, Kahori; Yonehara, Hiromi; Hattori, Takasumi; Kobayashi, Keiichi; Kirimura, Kohtaro

    2015-11-01

    trans-Aconitic acid is an unsaturated organic acid that is present in some plants such as soybean and wheat; however, it remains unclear how trans-aconitic acid is degraded and/or assimilated by living cells in nature. From soil, we isolated Pseudomonas sp. WU-0701 assimilating trans-aconitic acid as a sole carbon source. In the cell-free extract of Pseudomonas sp. WU-0701, aconitate isomerase (AI; EC 5.3.3.7) activity was detected. Therefore, it seems likely that strain Pseudomonas sp. WU-0701 converts trans-aconitic acid to cis-aconitic acid with AI, and assimilates this via the tricarboxylic acid cycle. For the characterization of AI from Pseudomonas sp. WU-0701, we performed purification, determination of enzymatic properties and gene identification of AI. The molecular mass of AI purified from cell-free extract was estimated to be ~ 25 kDa by both SDS/PAGE and gel filtration analyses, indicating that AI is a monomeric enzyme. The optimal pH and temperature of purified AI for the reaction were 6.0 °C and 37 °C, respectively. The gene ais encoding AI was cloned on the basis of the N-terminal amino acid sequence of the protein, and Southern blot analysis revealed that only one copy of ais is located on the bacterial genome. The gene ais contains an ORF of 786 bp, encoding a polypeptide of 262 amino acids, including the N-terminal 22 amino acids as a putative periplasm-targeting signal peptide. It is noteworthy that the amino acid sequence of AI shows 90% and 74% identity with molybdenum ABC transporter substrate-binding proteins of Pseudomonas psychrotolerans and Xanthomonas albilineans, respectively. This is the first report on purification to homogeneity, characterization and gene identification of AI. The nucleotide sequence of ais described in this article is available in the DDBJ/EMBL/GenBank nucleotide sequence databases under the Accession No. LC010980. © 2015 FEBS.

  18. Using "Pseudomonas Putida xylE" Gene to Teach Molecular Cloning Techniques for Undergraduates

    Science.gov (United States)

    Dong, Xu; Xin, Yi; Ye, Li; Ma, Yufang

    2009-01-01

    We have developed and implemented a serial experiment in molecular cloning laboratory course for undergraduate students majored in biotechnology. "Pseudomonas putida xylE" gene, encoding catechol 2, 3-dioxygenase, was manipulated to learn molecular biology techniques. The integration of cloning, expression, and enzyme assay gave students…

  19. Cloning, characterization, and expression of the dapE gene of Escherichia coli.

    OpenAIRE

    Bouvier, J; Richaud, C; Higgins, W; Bögler, O; Stragier, P

    1992-01-01

    The dapE gene of Escherichia coli encodes N-succinyl-L-diaminopimelic acid desuccinylase, an enzyme that catalyzes the synthesis of LL-diaminopimelic acid, one of the last steps in the diaminopimelic acid-lysine pathway. The dapE gene region was previously purified from a lambda bacteriophage transducing the neighboring purC gene (J. Parker, J. Bacteriol. 157:712-717, 1984). Various subcloning steps led to the identification of a 2.3-kb fragment that complemented several dapE mutants and allo...

  20. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  1. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

    OpenAIRE

    Hahn, F M; Baker, J A; Poulter, C D

    1996-01-01

    Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

  2. Novel enzymic hydrolytic dehalogenation of a chlorinated aromatic

    International Nuclear Information System (INIS)

    Scholten, J.D.; Chang, Kaihsuan; Dunaway-Mariano, D.; Babbitt, P.C.; Charest, H.; Sylvestre, M.

    1991-01-01

    Microbial enzyme systems may be used in the biodegradation of persistent environmental pollutants. The three polypeptide components of one such system, the 4-chlorobenzoate dehalogenase system, have been isolated, and the chemical steps of the 4-hydroxybenzoate-forming reaction that they catalyze have been identified. The genes contained within a 4.5-filobase Pseudomonas sp. strain CBS3 chromosomal DNA fragment that encode dehalogenase activity were selectively expressed in transformed Escherichia coli. Oligonucleotide sequencing revealed a stretch of homology between the 57-kilodalton (kD) polypeptide and several magnesium adenosine triphosphate (MgATP)-cleaving enzymes that allowed MgATP and coenzyme A (CoA) to be identified as the dehalogenase cosubstrate and cofactor, respectively. The dehalogenase activity arises from two components, a 4-chlorobenzoate:CoA ligase-dehalogenase (an αβ dimer of the 57- and 30-kD polypeptides) and a thioesterase (the 16-kD polypeptide)

  3. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  4. Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

    International Nuclear Information System (INIS)

    Chisholm, G.E.; Summers, W.C.

    1986-01-01

    The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

  5. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

    NARCIS (Netherlands)

    Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

    2002-01-01

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

  6. Protease of Stenotrophomonas sp. from Indonesian fermented food: gene cloning and analysis

    Directory of Open Access Journals (Sweden)

    Frans Kurnia

    2018-02-01

    Full Text Available Screening of proteolytic and fibrinolytic bacteria from Indonesian soy bean based fermented food Oncom revealed several potential isolates. Based on 16s rDNA gene analysis, one particular isolate with the highest proteolytic and fibrinolytic activity was identified as Stenotrophomonas sp. The protease gene was amplified to generate a 1749 bp Polymerase Chain Reaction product and BLAST analysis, revealed 90% homology with gene encoding protease enzyme from Stenotrophomonas maltophilia. The putative amino acid sequence indicated a serine protease enzyme with typical amino acid aspartate, histidine and serine in the catalytic triad. The gene was translated into a pre-pro-protein consisted of cleavage site on its N terminal and Pre-Peptidase Cterminal domain. Cloning of the protease gene in pET22b with Escherichia coli BL21 DE3 as the host showed that the gene was expressed as insoluble protein fraction. This is the first report for analysis of protease gene from food origin Stenotrophomonas sp.

  7. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  8. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  9. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta

    2010-04-01

    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  10. Mutations in B3GALT6, which Encodes a Glycosaminoglycan Linker Region Enzyme, Cause a Spectrum of Skeletal and Connective Tissue Disorders

    OpenAIRE

    Nakajima, Masahiro; Mizumoto, Shuji; Miyake, Noriko; Kogawa, Ryo; Iida, Aritoshi; Ito, Hironori; Kitoh, Hiroshi; Hirayama, Aya; Mitsubuchi, Hiroshi; Miyazaki, Osamu; Kosaki, Rika; Horikawa, Reiko; Lai, Angeline; Mendoza-Londono, Roberto; Dupuis, Lucie

    2013-01-01

    Proteoglycans (PGs) are a major component of the extracellular matrix in many tissues and function as structural and regulatory molecules. PGs are composed of core proteins and glycosaminoglycan (GAG) side chains. The biosynthesis of GAGs starts with the linker region that consists of four sugar residues and is followed by repeating disaccharide units. By exome sequencing, we found that B3GALT6 encoding an enzyme involved in the biosynthesis of the GAG linker region is responsible for a sever...

  11. Elucidation of a carotenoid biosynthesis gene cluster encoding a novel enzyme, 2,2'-beta-hydroxylase, from Brevundimonas sp. strain SD212 and combinatorial biosynthesis of new or rare xanthophylls.

    Science.gov (United States)

    Nishida, Yasuhiro; Adachi, Kyoko; Kasai, Hiroaki; Shizuri, Yoshikazu; Shindo, Kazutoshi; Sawabe, Akiyoshi; Komemushi, Sadao; Miki, Wataru; Misawa, Norihiko

    2005-08-01

    A carotenoid biosynthesis gene cluster mediating the production of 2-hydroxyastaxanthin was isolated from the marine bacterium Brevundimonas sp. strain SD212 by using a common crtI sequence as the probe DNA. A sequence analysis revealed this cluster to contain 12 open reading frames (ORFs), including the 7 known genes, crtW, crtY, crtI, crtB, crtE, idi, and crtZ. The individual ORFs were functionally analyzed by complementation studies using Escherichia coli that accumulated various carotenoid precursors due to the presence of other bacterial crt genes. In addition to functionally identifying the known crt genes, we found that one (ORF11, named crtG) coded for a novel enzyme, carotenoid 2,2'-beta-hydroxylase, which showed intriguingly partial homology with animal sterol-C5-desaturase. When this crtG gene was introduced into E. coli accumulating zeaxanthin and canthaxanthin, the resulting transformants produced their 2-hydroxylated and 2,2'-dihydroxylated products which were structurally novel or rare xanthophylls, as determined by their nuclear magnetic resonance and high-performance liquid chromatography/photodiode array detector/atmospheric pressure chemical ionization mass spectrometry spectral data. The new carotenoid produced was suggested to have a strong inhibitory effect on lipid peroxidation.

  12. The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

    Science.gov (United States)

    Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

    2017-03-01

    The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

  13. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

    Science.gov (United States)

    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

    2016-06-01

    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

  14. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

    Science.gov (United States)

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

    2003-08-01

    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  15. The restriction-modification genes of Escherichia coli K-12 may not be selfish: they do not resist loss and are readily replaced by alleles conferring different specificities.

    Science.gov (United States)

    O'Neill, M; Chen, A; Murray, N E

    1997-12-23

    Type II restriction and modification (R-M) genes have been described as selfish because they have been shown to impose selection for the maintenance of the plasmid that encodes them. In our experiments, the type I R-M system EcoKI does not behave in the same way. The genes specifying EcoKI are, however, normally residents of the chromosome and therefore our analyses were extended to monitor the deletion of chromosomal genes rather than loss of plasmid vector. If EcoKI were to behave in the same way as the plasmid-encoded type II R-M systems, the loss of the relevant chromosomal genes by mutation or recombination should lead to cell death because the cell would become deficient in modification enzyme and the bacterial chromosome would be vulnerable to the restriction endonuclease. Our data contradict this prediction; they reveal that functional type I R-M genes in the chromosome are readily replaced by mutant alleles and by alleles encoding a type I R-M system of different specificity. The acquisition of allelic genes conferring a new sequence specificity, but not the loss of the resident genes, is dependent on the product of an unlinked gene, one predicted [Prakash-Cheng, A., Chung, S. S. & Ryu, J. (1993) Mol. Gen. Genet. 241, 491-496] to be relevant to control of expression of the genes that encode EcoKI. Our evidence suggests that not all R-M systems are evolving as "selfish" units; rather, the diversity and distribution of the family of type I enzymes we have investigated require an alternative selective pressure.

  16. Parasitization by Scleroderma guani influences expression of superoxide dismutase genes in Tenebrio molitor

    Science.gov (United States)

    Superoxide dismutase (SOD) is an antioxidant enzyme involved in detoxifying reactive oxygen species. In this study, we identified genes encoding the extracellular and intracellular copper-zinc SODs (ecCuZnSOD and icCuZnSOD) and a manganese SOD (MnSOD) in the yellow mealworm beetle, Tenebrio molitor....

  17. The Networks of Genes Encoding Palmitoylated Proteins in Axonal and Synaptic Compartments Are Affected in PPT1 Overexpressing Neuronal-Like Cells

    Directory of Open Access Journals (Sweden)

    Francesco Pezzini

    2017-08-01

    Full Text Available CLN1 disease (OMIM #256730 is an early childhood ceroid-lipofuscinosis associated with mutated CLN1, whose product Palmitoyl-Protein Thioesterase 1 (PPT1 is a lysosomal enzyme involved in the removal of palmitate residues from S-acylated proteins. In neurons, PPT1 expression is also linked to synaptic compartments. The aim of this study was to unravel molecular signatures connected to CLN1. We utilized SH-SY5Y neuroblastoma cells overexpressing wild type CLN1 (SH-p.wtCLN1 and five selected CLN1 patients’ mutations. The cellular distribution of wtPPT1 was consistent with regular processing of endogenous protein, partially detected inside Lysosomal Associated Membrane Protein 2 (LAMP2 positive vesicles, while the mutants displayed more diffuse cytoplasmic pattern. Transcriptomic profiling revealed 802 differentially expressed genes (DEGs in SH-p.wtCLN1 (as compared to empty-vector transfected cells, whereas the number of DEGs detected in the two mutants (p.L222P and p.M57Nfs*45 was significantly lower. Bioinformatic scrutiny linked DEGs with neurite formation and neuronal transmission. Specifically, neuritogenesis and proliferation of neuronal processes were predicted to be hampered in the wtCLN1 overexpressing cell line, and these findings were corroborated by morphological investigations. Palmitoylation survey identified 113 palmitoylated protein-encoding genes in SH-p.wtCLN1, including 25 ones simultaneously assigned to axonal growth and synaptic compartments. A remarkable decrease in the expression of palmitoylated proteins, functionally related to axonal elongation (GAP43, CRMP1 and NEFM and of the synaptic marker SNAP25, specifically in SH-p.wtCLN1 cells was confirmed by immunoblotting. Subsequent, bioinformatic network survey of DEGs assigned to the synaptic annotations linked 81 DEGs, including 23 ones encoding for palmitoylated proteins. Results obtained in this experimental setting outlined two affected functional modules (connected to

  18. The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

    Science.gov (United States)

    Shukla, Avi; Chatterjee, Anirvan

    2018-01-01

    Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

  19. Histone Acetylation Modifications Affect Tissue-Dependent Expression of Poplar Homologs of C4 Photosynthetic Enzyme Genes

    Directory of Open Access Journals (Sweden)

    Yuan Li

    2017-06-01

    Full Text Available Histone modifications play important roles in regulating the expression of C4 photosynthetic genes. Given that all enzymes required for the C4 photosynthesis pathway are present in C3 plants, it has been hypothesized that this expression regulatory mechanism has been conserved. However, the relationship between histone modification and the expression of homologs of C4 photosynthetic enzyme genes has not been well determined in C3 plants. In the present study, we cloned nine hybrid poplar (Populus simonii × Populus nigra homologs of maize (Zea mays C4 photosynthetic enzyme genes, carbonic anhydrase (CA, pyruvate orthophosphate dikinase (PPDK, phosphoenolpyruvate carboxykinase (PCK, and phosphoenolpyruvate carboxylase (PEPC, and investigated the correlation between the expression levels of these genes and the levels of promoter histone acetylation modifications in four vegetative tissues. We found that poplar homologs of C4 homologous genes had tissue-dependent expression patterns that were mostly well-correlated with the level of histone acetylation modification (H3K9ac and H4K5ac determined by chromatin immunoprecipitation assays. Treatment with the histone deacetylase inhibitor trichostatin A further confirmed the role of histone acetylation in the regulation of the nine target genes. Collectively, these results suggest that both H3K9ac and H4K5ac positively regulate the tissue-dependent expression pattern of the PsnCAs, PsnPPDKs, PsnPCKs, and PsnPEPCs genes and that this regulatory mechanism seems to be conserved among the C3 and C4 species. Our findings provide new insight that will aid efforts to modify the expression pattern of these homologs of C4 genes to engineer C4 plants from C3 plants.

  20. Integration of Genome Scale Metabolic Networks and Gene Regulation of Metabolic Enzymes With Physiologically Based Pharmacokinetics.

    Science.gov (United States)

    Maldonado, Elaina M; Leoncikas, Vytautas; Fisher, Ciarán P; Moore, J Bernadette; Plant, Nick J; Kierzek, Andrzej M

    2017-11-01

    The scope of physiologically based pharmacokinetic (PBPK) modeling can be expanded by assimilation of the mechanistic models of intracellular processes from systems biology field. The genome scale metabolic networks (GSMNs) represent a whole set of metabolic enzymes expressed in human tissues. Dynamic models of the gene regulation of key drug metabolism enzymes are available. Here, we introduce GSMNs and review ongoing work on integration of PBPK, GSMNs, and metabolic gene regulation. We demonstrate example models. © 2017 The Authors CPT: Pharmacometrics & Systems Pharmacology published by Wiley Periodicals, Inc. on behalf of American Society for Clinical Pharmacology and Therapeutics.

  1. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  2. End-to-end gene fusions and their impact on the production of multifunctional biomass degrading enzymes

    International Nuclear Information System (INIS)

    Rizk, Mazen; Antranikian, Garabed; Elleuche, Skander

    2012-01-01

    Highlights: ► Multifunctional enzymes offer an interesting approach for biomass degradation. ► Size and conformation of separate constructs play a role in the effectiveness of chimeras. ► A connecting linker allows for maximal flexibility and increased thermostability. ► Genes with functional similarities are the best choice for fusion candidates. -- Abstract: The reduction of fossil fuels, coupled with its increase in price, has made the search for alternative energy resources more plausible. One of the topics gaining fast interest is the utilization of lignocellulose, the main component of plants. Its primary constituents, cellulose and hemicellulose, can be degraded by a series of enzymes present in microorganisms, into simple sugars, later used for bioethanol production. Thermophilic bacteria have proven to be an interesting source of enzymes required for hydrolysis since they can withstand high and denaturing temperatures, which are usually required for processes involving biomass degradation. However, the cost associated with the whole enzymatic process is staggering. A solution for cost effective and highly active production is through the construction of multifunctional enzyme complexes harboring the function of more than one enzyme needed for the hydrolysis process. There are various strategies for the degradation of complex biomass ranging from the regulation of the enzymes involved, to cellulosomes, and proteins harboring more than one enzymatic activity. In this review, the construction of multifunctional biomass degrading enzymes through end-to-end gene fusions, and its impact on production and activity by choosing the enzymes and linkers is assessed.

  3. The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

    NARCIS (Netherlands)

    Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

    2015-01-01

    The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

  4. Characterization of Sugar Contents and Sucrose Metabolizing Enzymes in Developing Leaves of Hevea brasiliensis

    Directory of Open Access Journals (Sweden)

    Jinheng Zhu

    2018-02-01

    Full Text Available Sucrose-metabolizing enzymes in plant leaves have hitherto been investigated mainly in temperate plants, and rarely conducted in tandem with gene expression and sugar analysis. Here, we investigated the sugar content, gene expression, and the activity of sucrose-metabolizing enzymes in the leaves of Hevea brasiliensis, a tropical tree widely cultivated for natural rubber. Sucrose, fructose and glucose were the major sugars detected in Hevea leaves at four developmental stages (I to IV, with starch and quebrachitol as minor saccharides. Fructose and glucose contents increased until stage III, but decreased strongly at stage IV (mature leaves. On the other hand, sucrose increased continuously throughout leaf development. Activities of all sucrose-cleaving enzymes decreased markedly at maturation, consistent with transcript decline for most of their encoding genes. Activity of sucrose phosphate synthase (SPS was low in spite of its high transcript levels at maturation. Hence, the high sucrose content in mature leaves was not due to increased sucrose-synthesizing activity, but more to the decline in sucrose cleavage. Gene expression and activities of sucrose-metabolizing enzymes in Hevea leaves showed striking differences compared with other plants. Unlike in most other species where vacuolar invertase predominates in sucrose cleavage in developing leaves, cytoplasmic invertase and sucrose synthase (cleavage direction also featured prominently in Hevea. Whereas SPS is normally responsible for sucrose synthesis in plant leaves, sucrose synthase (synthesis direction was comparable or higher than that of SPS in Hevea leaves. Mature Hevea leaves had an unusually high sucrose:starch ratio of about 11, the highest reported to date in plants.

  5. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  6. The ubiquitous presence of exopolygalacturonase in maize suggests a fundamental cellular function for this enzyme.

    Science.gov (United States)

    Dubald, M; Barakate, A; Mandaron, P; Mache, R

    1993-11-01

    Exopolygalacturonase (exoPG) is a pectin-degrading enzyme abundant in maize pollen. Using immunochemistry and in situ hybridization it is shown that in addition to its presence in pollen, exoPG is also present in sporophytic tissues, such as the tapetum and mesophyll cells. The enzyme is located in the cytoplasm of pollen and of some mesophyll cells. In other mesophyll cells, the tapetum and the pollen tube, exoPG is located in the cell wall. The measurement of enzyme activity shows that exoPG is ubiquitous in the vegetative organs. These results suggest a general function for exoPG in cell wall edification or degradation. ExoPG is encoded by a closely related multigene family. The regulation of the expression of one of the exoPG genes was analyzed in transgenic tobacco. Reporter GUS activity was detected in anthers, seeds and stems but not in leaves or roots of transgenic plants. This strongly suggests that the ubiquitous presence of exoPG in maize is the result of the expression of different exoPG genes.

  7. Cloning and Characterization of an Alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    Science.gov (United States)

    Bernhardsdotter, Eva C. M. J.; Pusey, Marc L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular a-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  8. CLONING AND SEQUENCING OF THE GENE FOR A LACTOCOCCAL ENDOPEPTIDASE, AN ENZYME WITH SEQUENCE SIMILARITY TO MAMMALIAN ENKEPHALINASE

    NARCIS (Netherlands)

    Mierau, Igor; Tan, Paris S.T.; Haandrikman, Alfred J.; Kok, Jan; Leenhouts, Kees J.; Konings, Wil N.; Venema, Gerard

    The gene specifying an endopeptidase of Lactococcus lactis, named pepO, was cloned from a genomic library of L. lactis subsp. cremoris P8-247 in lambdaEMBL3 and was subsequently sequenced. pepO is probably the last gene of an operon encoding the binding-protein-dependent oligopeptide transport

  9. Characterization and expression of the maize β-carbonic anhydrase gene repeat regions.

    Science.gov (United States)

    Tems, Ursula; Burnell, James N

    2010-12-01

    In maize, carbonic anhydrase (CA; EC 4.2.1.1) catalyzes the first reaction of the C(4) photosynthetic pathway; it catalyzes the hydration of CO(2) to bicarbonate and provides an inorganic carbon source for the primary carboxylation reaction catalyzed by phosphoenolpyruvate (PEP) carboxylase. The β-CA isozymes from maize, as well as other agronomically important NADP-malic enzyme (NADP-ME) type C(4) crops, have remained relatively uncharacterized but differ significantly from the β-CAs of other C(4) monocot species primarily due to transcript length and the presence of repeat sequences. This research confirmed earlier findings of repeat sequences in maize CA transcripts, and demonstrated that the gene encoding these transcripts is also composed of repeat sequences. One of the maize CA genes was sequenced and found to encode two domains, with distinct groups of exons corresponding to the repeat regions of the transcript. We have also shown that expression of a single repeat region of the CA transcript produced active enzyme that associated as a dimer and was composed primarily of α-helices, consistent with that observed for other plant CAs. As the presence of repeat regions in the CA gene is unique to NADP-ME type C(4) monocot species, the implications of these findings in the context of the evolution of the location and function of this C(4) pathway enzyme are strongly suggestive of CA gene duplication resulting in an evolutionary advantage and a higher photosynthetic efficiency. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  10. Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

    Science.gov (United States)

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

    2013-01-01

    Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

  11. The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

    Science.gov (United States)

    Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

    2017-03-01

    The characterization of mutants with altered leaf shape and pigmentation has previously al