WorldWideScience

Sample records for energy-filtering transmission electron

  1. Addressing preservation of elastic contrast in energy-filtered transmission electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Brown, H.G.; D' Alfonso, A.J.; Forbes, B.D.; Allen, L.J., E-mail: lja@unimelb.edu.au

    2016-01-15

    Energy-filtered transmission electron microscopy (EFTEM) images with resolutions of the order of an Ångström can be obtained using modern microscopes corrected for chromatic aberration. However, the delocalized nature of the transition potentials for atomic ionization often confounds direct interpretation of EFTEM images, leading to what is known as “preservation of elastic contrast”. In this paper we demonstrate how more interpretable images might be obtained by scanning with a focused coherent probe and incoherently averaging the energy-filtered images over probe position. We dub this new imaging technique energy-filtered imaging scanning transmission electron microscopy (EFISTEM). We develop a theoretical framework for EFISTEM and show that it is in fact equivalent to precession EFTEM, where the plane wave illumination is precessed through a range of tilts spanning the same range of angles as the probe forming aperture in EFISTEM. It is demonstrated that EFISTEM delivers similar results to scanning transmission electron microscopy with an electron energy-loss spectrometer but has the advantage that it is immune to coherent aberrations and spatial incoherence of the probe and is also more resilient to scan distortions. - Highlights: • Interpretation of EFTEM images is complicated by preservation of elastic contrast. • More direct images obtained by scanning with a focused coherent probe and averaging. • This is equivalent to precession EFTEM through the solid angle defined by the probe. • Also yields similar results to energy-loss scanning transmission electron microscopy. • Scanning approach immune to probe aberrations and resilient to scan distortions.

  2. Nanoscale Energy-Filtered Scanning Confocal Electron Microscopy Using a Double-Aberration-Corrected Transmission Electron Microscope

    International Nuclear Information System (INIS)

    Wang Peng; Behan, Gavin; Kirkland, Angus I.; Nellist, Peter D.; Takeguchi, Masaki; Hashimoto, Ayako; Mitsuishi, Kazutaka; Shimojo, Masayuki

    2010-01-01

    We demonstrate that a transmission electron microscope fitted with two spherical-aberration correctors can be operated as an energy-filtered scanning confocal electron microscope. A method for establishing this mode is described and initial results showing 3D chemical mapping with nanoscale sensitivity to height and thickness changes in a carbon film are presented. Importantly, uncorrected chromatic aberration does not limit the depth resolution of this technique and moreover performs an energy-filtering role, which is explained in terms of a combined depth and energy-loss response function.

  3. Principle of energy-filtering transmission electron microscopy and its applications

    International Nuclear Information System (INIS)

    Kurata, Hiroki

    1997-01-01

    Energy-filtering transmission electron microscopy (EFTEM) is widely used to make images and diffraction patterns more quantitative by removing the inelastic background, and to perform elemental and chemical mapping at high spatial resolution. The principal factors restricting the spatial resolution in elemental maps are discussed. The relativistic effect on inelastic scattering cross-section, which becomes significant for high-voltage EFTEM analysis, is also discussed in relation to the detection efficiency of core-loss signals. (author)

  4. Elemental distribution imaging by energy-filtering transmission electron microscopy (EFTEM) and its applications

    International Nuclear Information System (INIS)

    Kurata, Hiroki

    1996-01-01

    EFTEM is new microscopy with the object of visualizing high resolution quantitative elemental distribution. The measurement principles and the present state of EFTEM studies are explained by the examples of measurement of the elemental distributions. EFTEM is a combination of the transmission electron microscope with the electron energy loss spectroscopy (EFLS). EFTEM method sets the slit in the specific energy field and put the electron passing the slit back in the microscopic image. The qualitative elemental analysis is obtained by observing the position of the absorption end of core electronic excitation spectrum and the quantitative one by determining the core electronic excitation strength of the specific atom depend on filtering with energy selector slit. The binding state and the local structure in the neighborhood of excited atom is determined by the fine structure of absorption end. By the chemical mapping method, the distribution image of chemical binding state is visualized by the imaging chemical map obtained by filtering the specific peak strength of fine structure with the narrow energy selector slit. The fine powder of lead chromate (PbCrO 4 ) covered with silica glass was shown as a typical example of the elemental distribution image of core electronic excitation spectrum. The quantitative analysis method of elemental distribution image is explained. The possibility of single atom analysis at nanometer was shown by the example of nanotube observed by EFTEM. (S.Y.)

  5. Study of the nanostructure of Gum Metal using energy-filtered transmission electron microscopy

    International Nuclear Information System (INIS)

    Yano, T.; Murakami, Y.; Shindo, D.; Kuramoto, S.

    2009-01-01

    The nanostructure of Gum Metal, which has many anomalous mechanical properties, was investigated using transmission electron microscopy with energy filtering. A precise analysis of the weak diffuse electron scattering that was observed in the electron diffraction patterns of the Gum Metal specimen revealed that Gum Metal contains a substantial amount of the nanometer-sized ω phase. The morphology of the ω phase appeared to have a correlation with the faulting in the {2 1 1} planes, which are one of the characteristic lattice imperfections of the Gum Metal specimen. It is likely that the nanometer-sized ω phase may be a type of obstacle related to the restriction of the dislocation movement, which has been a significant problem in research on Gum Metal

  6. Elemental mapping in achromatic atomic-resolution energy-filtered transmission electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Forbes, B.D. [School of Physics, University of Melbourne, Parkville, VIC 3010 (Australia); Houben, L. [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons and Peter Gruenberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany); Mayer, J. [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons and Peter Gruenberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany); Central Facility for Electron Microscopy, RWTH Aachen University, D-52074 Aachen (Germany); Dunin-Borkowski, R.E. [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons and Peter Gruenberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany); Allen, L.J., E-mail: lja@unimelb.edu.au [School of Physics, University of Melbourne, Parkville, VIC 3010 (Australia)

    2014-12-15

    We present atomic-resolution energy-filtered transmission electron microscopy (EFTEM) images obtained with the chromatic-aberration-corrected FEI Titan PICO at the Ernst-Ruska Centre, Jülich, Germany. We find qualitative agreement between experiment and simulation for the background-subtracted EFTEM images of the Ti–L{sub 2,3} and O–K edges for a specimen of SrTiO{sub 3} oriented down the [110] zone axis. The simulations utilize the transition potential formulation for inelastic scattering, which permits a detailed investigation of contributions to the EFTEM image. We find that energy-filtered images of the Ti–L{sub 2,3} and O–K edges are lattice images and that the background-subtracted core-loss maps may not be directly interpretable as elemental maps. Simulations show that this is a result of preservation of elastic contrast, whereby the qualitative details of the image are determined primarily by elastic, coherent scattering. We show that this effect places a constraint on the range of specimen thicknesses which could theoretically yield directly useful elemental maps. In general, interpretation of EFTEM images is ideally accompanied by detailed simulations. - Highlights: • Achromatic atomic-resolution EFTEM images were obtained for STO 〈110〉. • Simulations were in qualitative agreement with Ti–L{sub 2,3} and O–K edge maps. • The experimental EFTEM maps are not directly interpretable as elemental maps. • Image intensities are strongly determined by preservation of elastic contrast. • Interpretation of EFTEM images is ideally accompanied by detailed simulations.

  7. The examination of calcium ion implanted alumina with energy filtered transmission electron microscopy

    International Nuclear Information System (INIS)

    Hunt, E.M.; Hampikian, J.M.

    1997-01-01

    Ion implantation can be used to alter in the optical response of insulators through the formation of embedded nano-sized particles. Single crystal alumina has been implanted at ambient temperature with 50 keV Ca + to a fluence of 5 x 10 16 ions/cm 2 . Ion channeling, Knoop microhardness measurements, and transmission electron microscopy (TEM) indicate that the alumina surface layer was amorphized by the implant. TEM also revealed nano-sized crystals ∼7--8 nm in diameter. These nanocrystals are randomly oriented, and exhibit a face-centered cubic structure (FCC) with a lattice parameter of 0.409 nm ± 0.002 nm. The similarity between this crystallography and that of pure aluminum suggests that they are metallic aluminum nanocrystals with a slightly dilated lattice parameter, possibly due to the incorporation of a small amount of calcium. Energy-filtered transmission electron microscopy (EFTEM) provides an avenue by which to confirm the metallic nature of the aluminum involved in the nanocrystals. EFTEM has confirmed that the aluminum present in the particles is metallic in nature, that the particles are oxygen deficient in comparison with the matrix material and that the particles are deficient in calcium, and therefore not likely to be calcia. The particles thus appear to be FCC Al (possibly alloyed with a few percent Ca) with a lattice parameter of 0.409nm. A similar result was obtained for yttrium ion implantation into alumina

  8. Minerals and aligned collagen fibrils in tilapia fish scales: structural analysis using dark-field and energy-filtered transmission electron microscopy and electron tomography.

    Science.gov (United States)

    Okuda, Mitsuhiro; Ogawa, Nobuhiro; Takeguchi, Masaki; Hashimoto, Ayako; Tagaya, Motohiro; Chen, Song; Hanagata, Nobutaka; Ikoma, Toshiyuki

    2011-10-01

    The mineralized structure of aligned collagen fibrils in a tilapia fish scale was investigated using transmission electron microscopy (TEM) techniques after a thin sample was prepared using aqueous techniques. Electron diffraction and electron energy loss spectroscopy data indicated that a mineralized internal layer consisting of aligned collagen fibrils contains hydroxyapatite crystals. Bright-field imaging, dark-field imaging, and energy-filtered TEM showed that the hydroxyapatite was mainly distributed in the hole zones of the aligned collagen fibrils structure, while needle-like materials composed of calcium compounds including hydroxyapatite existed in the mineralized internal layer. Dark-field imaging and three-dimensional observation using electron tomography revealed that hydroxyapatite and needle-like materials were mainly found in the matrix between the collagen fibrils. It was observed that hydroxyapatite and needle-like materials were preferentially distributed on the surface of the hole zones in the aligned collagen fibrils structure and in the matrix between the collagen fibrils in the mineralized internal layer of the scale.

  9. A bias-tunable electron-spin filter based on a two-dimensional electron gas modulated by ferromagnetic-Schottky metal stripes

    Energy Technology Data Exchange (ETDEWEB)

    Lu Jianduo, E-mail: l_j316@163.co [Hubei Province Key Laboratory of Systems Science in Metallurgical Process, Wuhan University of Science and Technology, Wuhan 430081 (China); Li Yunbao; Yun Meijuan [Hubei Province Key Laboratory of Systems Science in Metallurgical Process, Wuhan University of Science and Technology, Wuhan 430081 (China); Zheng Wei [Key Laboratory of Dynamic Geodesy, Institute of Geodesy and Geophysics, Chinese Academy of Sciences, Wuhan 430077 (China)

    2011-03-28

    We investigate the effect of the bias in an electron-spin filter based on a two-dimensional electron gas modulated by ferromagnetic-Schottky metal stripes. The numerical results show that the electron transmission and the conductance as well as the spin polarization are strongly dependent on the bias applied to the device. - Research highlights: We propose a bias-tunable electron-spin filter. The transmission and the conductance depend on the bias and the electron energy. The spin polarization depends on the bias and the electron energy. The results are helpful for making new types of bias-tunable spin filters.

  10. Energy-filtered environmental transmission electron microscopy for the assessment of solid-gas reactions at elevated temperature: NiO/YSZ-H2 as a case study

    DEFF Research Database (Denmark)

    Jeangros, Q.; Hansen, Thomas Willum; Wagner, Jakob Birkedal

    2016-01-01

    A novel approach, which is based on the analysis of sequences of images recorded using energy-filtered transmission electron microscopy and can be used to assess the reaction of a solid with a gas at elevated temperature, is illustrated for the reduction of a NiO/ceramic solid oxide fuel cell ano...

  11. Transmission Electron Microscopy Physics of Image Formation

    CERN Document Server

    Kohl, Helmut

    2008-01-01

    Transmission Electron Microscopy: Physics of Image Formation presents the theory of image and contrast formation, and the analytical modes in transmission electron microscopy. The principles of particle and wave optics of electrons are described. Electron-specimen interactions are discussed for evaluating the theory of scattering and phase contrast. Also discussed are the kinematical and dynamical theories of electron diffraction and their applications for crystal-structure analysis and imaging of lattices and their defects. X-ray microanalysis and electron energy-loss spectroscopy are treated as analytical methods. Specimen damage and contamination by electron irradiation limits the resolution for biological and some inorganic specimens. This fifth edition includes discussion of recent progress, especially in the area of aberration correction and energy filtering; moreover, the topics introduced in the fourth edition have been updated. Transmission Electron Microscopy: Physics of Image Formation is written f...

  12. 3D analysis of the morphology and spatial distribution of nitrogen in nitrogen-doped carbon nanotubes by energy-filtered transmission electron microscopy tomography.

    Science.gov (United States)

    Florea, Ileana; Ersen, Ovidiu; Arenal, Raul; Ihiawakrim, Dris; Messaoudi, Cédric; Chizari, Kambiz; Janowska, Izabela; Pham-Huu, Cuong

    2012-06-13

    We present here the application of the energy-filtered transmission electron microscopy (EFTEM) in the tomographic mode to determine the precise 3D distribution of nitrogen within nitrogen-doped carbon nanotubes (N-CNTs). Several tilt series of energy-filtered images were acquired on the K ionization edges of carbon and nitrogen on a multiwalled N-CNT containing a high amount of nitrogen. Two tilt series of carbon and nitrogen 2D maps were then calculated from the corresponding energy-filtered images by using a proper extraction procedure of the chemical signals. Applying iterative reconstruction algorithms provided two spatially correlated C and N elemental-selective volumes, which were then simultaneously analyzed with the shape-sensitive reconstruction deduced from Zero-Loss recordings. With respect to the previous findings, crucial information obtained by analyzing the 3D chemical maps was that, among the two different kind of arches formed in these nanotubes (transversal or rounded ones depending on their morphology), the transversal arches contain more nitrogen than do the round ones. In addition, a detailed analysis of the shape-sensitive volume allowed the observation of an unexpected change in morphology along the tube axis: close to the round arches (with less N), the tube is roughly cylindrical, whereas near the transversal ones (with more N), its shape changes to a prism. This relatively new technique is very powerful in the material science because it combines the ability of the classical electron tomography to solve 3D structures and the chemical selectivity of the EFTEM imaging.

  13. Recent progress in energy-filtered high energy X-ray photoemission electron microscopy using a Wien filter type energy analyzer

    International Nuclear Information System (INIS)

    Niimi, H.; Tsutsumi, T.; Matsudaira, H.; Kawasaki, T.; Suzuki, S.; Chun, W.-J.; Kato, M.; Kitajima, Y.; Iwasawa, Y.; Asakura, K.

    2004-01-01

    Energy-filtered X-ray photoemission electron microscopy (EXPEEM) is a microscopy technique which has the potential to provide surface chemical mapping during surface chemical processes on the nanometer scale. We studied the possibilities of EXPEEM using a Wien filter type energy analyzer in the high energy X-ray region above 1000 eV. We have successfully observed the EXPEEM images of Au islands on a Ta sheet using Au 3d 5/2 and Ta 3d 5/2 photoelectron peaks which were excited by 2380 eV X-rays emitted from an undulator (BL2A) at Photon Factory. Our recent efforts to improve the sensitivity of the Wien filter energy analyzer will also be discussed

  14. Monochromated scanning transmission electron microscopy

    International Nuclear Information System (INIS)

    Rechberger, W.; Kothleitner, G.; Hofer, F.

    2006-01-01

    Full text: Electron energy-loss spectroscopy (EELS) has developed into an established technique for chemical and structural analysis of thin specimens in the (scanning) transmission electron microscope (S)TEM. The energy resolution in EELS is largely limited by the stability of the high voltage supply, by the resolution of the spectrometer and by the energy spread of the source. To overcome this limitation a Wien filter monochromator was recently introduced with commercially available STEMs, offering the advantage to better resolve EELS fine structures, which contain valuable bonding information. The method of atomic resolution Z-contrast imaging within an STEM, utilizing a high-angle annular dark-field (HAADF) detector can perfectly complement the excellent energy resolution, since EELS spectra can be collected simultaneously. In combination with a monochromator microscope not only high spatial resolution images can be recorded but also high energy resolution EELS spectra are attainable. In this work we investigated the STEM performance of a 200 kV monochromated Tecnai F20 with a high resolution Gatan Imaging Filter (HR-GIF). (author)

  15. Energy-Filtered Tunnel Transistor: A New Device Concept Toward Extremely-Low Energy Consumption Electronics

    Science.gov (United States)

    2015-12-17

    other provision of law , no person shall be subject to any penalty for failing to comply with a collection of information if it does not display a...excellent agreement with experimental findings. The energy filtering has been applied to single-electron transport and clear Coulomb staircases and... Coulomb oscillations have been demonstrated at room temperature. A new architecture of energy-filtered cold electron transistors has been designed and

  16. Low-energy electron transmission through high aspect ratio Al O nanocapillaries

    DEFF Research Database (Denmark)

    Milosavljević, A.R.; Jureta, J.; Víkor, G.

    2009-01-01

    Electron transmission through insulating AlO nanocapillaries of different diameters (40 and 270 nm) and 15 μm length has been investigated for low-energy electrons (2-120 V). The total intensity of transmitted current weakly depends on the incident electron energy and tilt angle defined with resp......Electron transmission through insulating AlO nanocapillaries of different diameters (40 and 270 nm) and 15 μm length has been investigated for low-energy electrons (2-120 V). The total intensity of transmitted current weakly depends on the incident electron energy and tilt angle defined...

  17. Elemental mapping in scanning transmission electron microscopy

    International Nuclear Information System (INIS)

    Allen, L J; D'Alfonso, A J; Lugg, N R; Findlay, S D; LeBeau, J M; Stemmer, S

    2010-01-01

    We discuss atomic resolution chemical mapping in scanning transmission electron microscopy (STEM) based on core-loss electron energy loss spectroscopy (EELS) and also on energy dispersive X-ray (EDX) imaging. Chemical mapping using EELS can yield counterintuitive results which, however, can be understood using first principles calculations. Experimental chemical maps based on EDX bear out the thesis that such maps are always likely to be directly interpretable. This can be explained in terms of the local nature of the effective optical potential for ionization under those imaging conditions. This is followed by an excursion into the complementary technique of elemental mapping using energy-filtered transmission electron microscopy (EFTEM) in a conventional transmission electron microscope. We will then consider the widely used technique of Z-contrast or high-angle annular dark field (HAADF) imaging, which is based on phonon excitation, where it has recently been shown that intensity variations can be placed on an absolute scale by normalizing the measured intensities to the incident beam. Results, showing excellent agreement between theory and experiment to within a few percent, are shown for Z-contrast imaging from a sample of PbWO 4 .

  18. Energy-filtered real- and k-space secondary and energy-loss electron imaging with Dual Emission Electron spectro-Microscope: Cs/Mo(110)

    Energy Technology Data Exchange (ETDEWEB)

    Grzelakowski, Krzysztof P., E-mail: k.grzelakowski@opticon-nanotechnology.com

    2016-05-15

    Since its introduction the importance of complementary k{sub ||}-space (LEED) and real space (LEEM) information in the investigation of surface science phenomena has been widely demonstrated over the last five decades. In this paper we report the application of a novel kind of electron spectromicroscope Dual Emission Electron spectroMicroscope (DEEM) with two independent electron optical channels for reciprocal and real space quasi-simultaneous imaging in investigation of a Cs covered Mo(110) single crystal by using the 800 eV electron beam from an “in-lens” electron gun system developed for the sample illumination. With the DEEM spectromicroscope it is possible to observe dynamic, irreversible processes at surfaces in the energy-filtered real space and in the corresponding energy-filtered k{sub ǁ}-space quasi-simultaneously in two independent imaging columns. The novel concept of the high energy electron beam sample illumination in the cathode lens based microscopes allows chemically selective imaging and analysis under laboratory conditions. - Highlights: • A novel concept of the electron sample illumination with “in-lens” e- gun is realized. • Quasi-simultaneous energy selective observation of the real- and k-space in EELS mode. • Observation of the energy filtered Auger electron diffraction at Cs atoms on Mo(110). • Energy-loss, Auger and secondary electron momentum microscopy is realized.

  19. Evaluation of secondary electron filter for removing contaminant electrons from high-energy 6 MV x-ray beam

    International Nuclear Information System (INIS)

    Kumagai, Kozo

    1988-01-01

    When using high energy X-rays, the dose increases at the skin surface and build-up region of beam contamination of secondary electrons coming out from the inner surface of the lineac head. At our radiotherapy department, many cases of external otitis from severe skin reactions, particularly resulting from whole brain irradiation of primary and metastatic brain tumors with a 6 MV X-ray lineac, have been encountered. An investigation was made of the physical aspects of a 6 MV X-ray beam using three electron filters, lead lucite, lead glass and lucite to remove secondary electrons. Transparent materials for filters should be preferable for locating the light field. The following results were obtained: 1) For removing secondary electrons, a lead lucite filter was found best. 2) The lead lucite filter proved most effective for removing secondary electrons from the area of treatment. It reduced the dose of irradiation to the skin surface and build-up region, and furthermore improved the depth dose relative to that without filters. 3) From a clinical standpoint, skin reactions such as external otitis remarkably decreased using a lead lucite filter. 4) It thus appears necessary to use a high energy X-ray with newly designed filters to reduce beam contamination of secondary electrons. (author)

  20. Development of a secondary electron energy analyzer for a transmission electron microscope.

    Science.gov (United States)

    Magara, Hideyuki; Tomita, Takeshi; Kondo, Yukihito; Sato, Takafumi; Akase, Zentaro; Shindo, Daisuke

    2018-04-01

    A secondary electron (SE) energy analyzer was developed for a transmission electron microscope. The analyzer comprises a microchannel plate (MCP) for detecting electrons, a coil for collecting SEs emitted from the specimen, a tube for reducing the number of backscattered electrons incident on the MCP, and a retarding mesh for selecting the energy of SEs incident on the MCP. The detection of the SEs associated with charging phenomena around a charged specimen was attempted by performing electron holography and SE spectroscopy using the energy analyzer. The results suggest that it is possible to obtain the energy spectra of SEs using the analyzer and the charging states of a specimen by electron holography simultaneously.

  1. Visualization of phase evolution in model organic photovoltaic structures via energy-filtered transmission electron microscopy.

    Science.gov (United States)

    Herzing, Andrew A; Ro, Hyun Wook; Soles, Christopher L; DeLongchamp, Dean M

    2013-09-24

    The morphology of the active layer in an organic photovoltaic bulk-heterojunction device is controlled by the extent and nature of phase separation during processing. We have studied the effects of fullerene crystallinity during heat treatment in model structures consisting of a layer of poly(3-hexylthiophene) (P3HT) sandwiched between two layers of [6,6]-phenyl-C61-butyric acid methyl ester (PCBM). Utilizing a combination of focused ion-beam milling and energy-filtered transmission electron microscopy, we monitored the local changes in phase distribution as a function of annealing time at 140 °C. In both cases, dissolution of PCBM within the surrounding P3HT was directly visualized and quantitatively described. In the absence of crystalline PCBM, the overall phase distribution remained stable after intermediate annealing times up to 60 s, whereas microscale PCBM aggregates were observed after annealing for 300 s. Aggregate growth proceeded vertically from the substrate interface via uptake of PCBM from the surrounding region, resulting in a large PCBM-depleted region in their vicinity. When precrystallized PCBM was present, amorphous PCBM was observed to segregate from the intermediate P3HT layer and ripen the crystalline PCBM underneath, owing to the far lower solubility of crystalline PCBM within P3HT. This process occurred rapidly, with segregation already evident after annealing for 10 s and with uptake of nearly all of the amorphous PCBM by the crystalline layer after 60 s. No microscale aggregates were observed in the precrystallized system, even after annealing for 300 s.

  2. Design of electron wave filters in monolayer graphene by tunable transmission gap

    OpenAIRE

    Chen, Xi; Tao, Jia-Wei

    2009-01-01

    We have investigated the transmission in monolayer graphene barrier at nonzero angle of incidence. Taking the influence of parallel wave vector into account, the transmission as the function of incidence energy has a gap due to the evanescent waves in two cases of Klein tunneling and classical motion. The modulation of the transmission gap by the incidence angle, the height, and width of potential barrier may lead to potential applications in graphene-based electronic devices.

  3. Achromatic elemental mapping beyond the nanoscale in the transmission electron microscope.

    Science.gov (United States)

    Urban, K W; Mayer, J; Jinschek, J R; Neish, M J; Lugg, N R; Allen, L J

    2013-05-03

    Newly developed achromatic electron optics allows the use of wide energy windows and makes feasible energy-filtered transmission electron microscopy (EFTEM) at atomic resolution. In this Letter we present EFTEM images formed using electrons that have undergone a silicon L(2,3) core-shell energy loss, exhibiting a resolution in EFTEM of 1.35 Å. This permits elemental mapping beyond the nanoscale provided that quantum mechanical calculations from first principles are done in tandem with the experiment to understand the physical information encoded in the images.

  4. Nanoporous metal film: An energy-dependent transmission device for electron waves

    International Nuclear Information System (INIS)

    Grech, S.; Degiovanni, A.; Lapena, L.; Morin, R.

    2011-01-01

    We measure electron transmission through free-standing ultrathin nanoporous gold films, using the coherent electron beam emitted by sharp field emission tips in a low energy electron projection microscope setup. Transmission coefficient versus electron wavelength plots show periodic oscillations between 75 and 850 eV. These oscillations result from the energy dependence of interference between paths through the gold and paths through the nanometer-sized pores of the film. We reveal that these films constitute high transmittance quantum devices acting on electron waves through a wavelength-dependent complex transmittance defined by the porosity and the thickness of the film.

  5. Analog Electronic Filters Theory, Design and Synthesis

    CERN Document Server

    Dimopoulos, Hercules G

    2012-01-01

    Filters are essential subsystems in a huge variety of electronic systems. Filter applications are innumerable; they are used for noise reduction, demodulation, signal detection, multiplexing, sampling, sound and speech processing, transmission line equalization and image processing, to name just a few. In practice, no electronic system can exist without filters. They can be found in everything from power supplies to mobile phones and hard disk drives and from loudspeakers and MP3 players to home cinema systems and broadband Internet connections. This textbook introduces basic concepts and methods and the associated mathematical and computational tools employed in electronic filter theory, synthesis and design.  This book can be used as an integral part of undergraduate courses on analog electronic filters. Includes numerous, solved examples, applied examples and exercises for each chapter. Includes detailed coverage of active and passive filters in an independent but correlated manner. Emphasizes real filter...

  6. Energy filtering transmission electron microscopy immunocytochemistry and antigen retrieval of surface layer proteins from Tannerella forsythensis using microwave or autoclave heating with citraconic anhydride

    Science.gov (United States)

    2012-01-01

    Tannerella forsythensis (Bacteroides forsythus), an anaerobic Gram-negative species of bacteria that plays a role in the progression of periodontal disease, has a unique bacterial protein profile. It is characterized by two unique protein bands with molecular weights of more than 200 kDa. It also is known to have a typical surface layer (S-layer) consisting of regularly arrayed subunits outside the outer membrane. We examined the relationship between high molecular weight proteins and the S-layer using electron microscopic immunolabeling with chemical fixation and an antigen retrieval procedure consisting of heating in a microwave oven or autoclave with citraconic anhydride. Immunogold particles were localized clearly at the outermost cell surface. We also used energy-filtering transmission electron microscopy (EFTEM) to visualize 3, 3′-diaminobenzidine tetrahydrochloride (DAB) reaction products after microwave antigen retrieval with 1% citraconic anhydride. The three-window method for electron spectroscopic images (ESI) of nitrogen by the EFTEM reflected the presence of moieties demonstrated by the DAB reaction with horseradish peroxidase (HRP)-conjugated secondary antibodies instead of immunogold particles. The mapping patterns of net nitrogen were restricted to the outermost cell surface. PMID:22984898

  7. Energy-filtered cold electron transport at room temperature.

    Science.gov (United States)

    Bhadrachalam, Pradeep; Subramanian, Ramkumar; Ray, Vishva; Ma, Liang-Chieh; Wang, Weichao; Kim, Jiyoung; Cho, Kyeongjae; Koh, Seong Jin

    2014-09-10

    Fermi-Dirac electron thermal excitation is an intrinsic phenomenon that limits functionality of various electron systems. Efforts to manipulate electron thermal excitation have been successful when the entire system is cooled to cryogenic temperatures, typically distribution corresponds to an effective electron temperature of ~45 K, can be transported throughout device components without external cooling. This is accomplished using a discrete level of a quantum well, which filters out thermally excited electrons and permits only energy-suppressed electrons to participate in electron transport. The quantum well (~2 nm of Cr2O3) is formed between source (Cr) and tunnelling barrier (SiO2) in a double-barrier-tunnelling-junction structure having a quantum dot as the central island. Cold electron transport is detected from extremely narrow differential conductance peaks in electron tunnelling through CdSe quantum dots, with full widths at half maximum of only ~15 mV at room temperature.

  8. Plasma response to electron energy filter in large volume plasma device

    International Nuclear Information System (INIS)

    Sanyasi, A. K.; Awasthi, L. M.; Mattoo, S. K.; Srivastava, P. K.; Singh, S. K.; Singh, R.; Kaw, P. K.

    2013-01-01

    An electron energy filter (EEF) is embedded in the Large Volume Plasma Device plasma for carrying out studies on excitation of plasma turbulence by a gradient in electron temperature (ETG) described in the paper of Mattoo et al. [S. K. Mattoo et al., Phys. Rev. Lett. 108, 255007 (2012)]. In this paper, we report results on the response of the plasma to the EEF. It is shown that inhomogeneity in the magnetic field of the EEF switches on several physical phenomena resulting in plasma regions with different characteristics, including a plasma region free from energetic electrons, suitable for the study of ETG turbulence. Specifically, we report that localized structures of plasma density, potential, electron temperature, and plasma turbulence are excited in the EEF plasma. It is shown that structures of electron temperature and potential are created due to energy dependence of the electron transport in the filter region. On the other hand, although structure of plasma density has origin in the particle transport but two distinct steps of the density structure emerge from dominance of collisionality in the source-EEF region and of the Bohm diffusion in the EEF-target region. It is argued and experimental evidence is provided for existence of drift like flute Rayleigh-Taylor in the EEF plasma

  9. eV-TEM: Transmission electron microscopy in a low energy cathode lens instrument

    Energy Technology Data Exchange (ETDEWEB)

    Geelen, Daniël, E-mail: geelen@physics.leidenuniv.nl [Huygens-Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Leiden University, P.O. Box 9504, 2300 RA Leiden (Netherlands); Thete, Aniket [Huygens-Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Leiden University, P.O. Box 9504, 2300 RA Leiden (Netherlands); Schaff, Oliver; Kaiser, Alexander [SPECS GmbH, Voltastrasse 5, D-13355 Berlin (Germany); Molen, Sense Jan van der [Huygens-Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Leiden University, P.O. Box 9504, 2300 RA Leiden (Netherlands); Tromp, Rudolf [IBM T.J. Watson Research Center, 1101 Kitchawan Road, P.O. Box 218, Yorktown Heights, NY 10598 (United States)

    2015-12-15

    We are developing a transmission electron microscope that operates at extremely low electron energies, 0–40 eV. We call this technique eV-TEM. Its feasibility is based on the fact that at very low electron energies the number of energy loss pathways decreases. Hence, the electron inelastic mean free path increases dramatically. eV-TEM will enable us to study elastic and inelastic interactions of electrons with thin samples. With the recent development of aberration correction in cathode lens instruments, a spatial resolution of a few nm appears within range, even for these very low electron energies. Such resolution will be highly relevant to study biological samples such as proteins and cell membranes. The low electron energies minimize adverse effects due to radiation damage. - Highlights: • We present a new way of performing low energy transmission electron microscopy in an aberration corrected LEEM/PEEM instrument. • We show a proof of principle where we measure transmitted electrons through a suspended graphene monolayer with a preliminary setup. • We present an improved setup design that provides better control of the incident electron beam.

  10. Solid-state nanopores of controlled geometry fabricated in a transmission electron microscope

    Science.gov (United States)

    Qian, Hui; Egerton, Ray F.

    2017-11-01

    Energy-filtered transmission electron microscopy and electron tomography were applied to in situ studies of the formation, shape, and diameter of nanopores formed in a silicon nitride membrane in a transmission electron microscope. The nanopore geometry was observed in three dimensions by electron tomography. Drilling conditions, such as probe current, beam convergence angle, and probe position, affect the formation rate and the geometry of the pores. With a beam convergence semi-angle of α = 22 mrad, a conical shaped nanopore is formed but at α = 45 mrad, double-cone (hourglass-shaped) nanopores were produced. Nanopores with an effective diameter between 10 nm and 1.8 nm were fabricated by controlling the drilling time.

  11. Low-energy electron transmission and secondary-electron emission experiments on crystalline and molten long-chain alkanes

    International Nuclear Information System (INIS)

    Ueno, N.; Sugita, K.; Seki, K.; Inokuchi, H.

    1986-01-01

    This paper describes the results of low-energy electron transmission and secondary-electron emission experiments on thin films of long-chain alkanes deposited on metal substrates. The spectral changes due to crystal-melt phase transition were measured in situ in both experiments. The ground-state energy V 0 of the quasifree electron in crystalline state was determined to be 0.5 +- 0.1 eV. The value of V 0 for the molten state was found to be negative. Further, in the crystalline state evidence is found for a direct correspondence between the transmission maxima and the high value of the density of states in the conduction bands

  12. Extraction of topographic and material contrasts on surfaces from SEM images obtained by energy filtering detection with low-energy primary electrons

    International Nuclear Information System (INIS)

    Nagoshi, Masayasu; Aoyama, Tomohiro; Sato, Kaoru

    2013-01-01

    Secondary electron microscope (SEM) images have been obtained for practical materials using low primary electron energies and an in-lens type annular detector with changing negative bias voltage supplied to a grid placed in front of the detector. The kinetic-energy distribution of the detected electrons was evaluated by the gradient of the bias-energy dependence of the brightness of the images. This is divided into mainly two parts at about 500 V, high and low brightness in the low- and high-energy regions, respectively and shows difference among the surface regions having different composition and topography. The combination of the negative grid bias and the pixel-by-pixel image subtraction provides the band-pass filtered images and extracts the material and topographic information of the specimen surfaces. -- Highlights: ► Scanning electron (SE) images contain many kind of information on material surfaces. ► We investigate energy-filtered SE images for practical materials. ► The brightness of the images is divided into two parts by the bias voltage. ► Topographic and material contrasts are extracted by subtracting the filtered images.

  13. Electron energy loss spectroscopy microanalysis and imaging in the transmission electron microscope: example of biological applications

    International Nuclear Information System (INIS)

    Diociaiuti, Marco

    2005-01-01

    This paper reports original results obtained in our laboratory over the past few years in the application of both electron energy loss spectroscopy (EELS) and electron spectroscopy imaging (ESI) to biological samples, performed in two transmission electron microscopes (TEM) equipped with high-resolution electron filters and spectrometers: a Gatan model 607 single magnetic sector double focusing EEL serial spectrometer attached to a Philips 430 TEM and a Zeiss EM902 Energy Filtering TEM. The primary interest was on the possibility offered by the combined application of these spectroscopic techniques with those offered by the TEM. In particular, the electron beam focusing available in a TEM allowed us to perform EELS and ESI on very small sample volumes, where high-resolution imaging and electron diffraction techniques can provide important structural information. I show that ESI was able to improve TEM performance, due to the reduced chromatic aberration and the possibility of avoiding the sample staining procedure. Finally, the analysis of the oscillating extended energy loss fine structure (EXELFS) beyond the ionization edges characterizing the EELS spectra allowed me, in a manner very similar to the extended X-ray absorption fine structure (EXAFS) analysis of the X-ray absorption spectra, to obtain short-range structural information for such light elements of biological interest as O or Fe. The Philips EM430 (250-300 keV) TEM was used to perform EELS microanalysis on Ca, P, O, Fe, Al and Si. The assessment of the detection limits of this method was obtained working with well-characterized samples containing Ca and P, and mimicking the actual cellular matrix. I applied EELS microanalysis to Ca detection in bone tissue during the mineralization process and to P detection in the cellular membrane of erythrocytes treated with an anti-tumoral drug, demonstrating that the cellular membrane is a drug target. I applied EELS microanalysis and selected area electron

  14. Effect of beryllium filter purity on x-ray emission measurements

    Science.gov (United States)

    McGarry, M. B.; Franz, P.; Den Hartog, D. J.; Goetz, J. A.

    2014-12-01

    Beryllium foils of the purity grade typically specified for use as filters in soft x-ray (SXR) diagnostics may contain sufficient heavy element impurities to distort the energy transmission response of the filter. Electron microprobe analysis of the foils used in the Madison Symmetric Torus (MST) SXR tomography diagnostic revealed an impurity content of ˜0.3% fractional abundance by weight, comprised primarily of iron, zirconium, chromium, and nickel. These impurities lower the peak filter transmission in the energy range of the detector and alter the shape of the transmission curve. As a result, foil impurities introduce errors in any general measurement where radiation is being filtered. For example, neglecting the effect of impurities on filter transmission leads to large systematic errors (50%) in the electron temperature measured using the SXR double-filter technique on MST.

  15. Effect of beryllium filter purity on x-ray emission measurements

    International Nuclear Information System (INIS)

    McGarry, M B; Hartog, D J Den; Goetz, J A; Franz, P

    2014-01-01

    Beryllium foils of the purity grade typically specified for use as filters in soft x-ray (SXR) diagnostics may contain sufficient heavy element impurities to distort the energy transmission response of the filter. Electron microprobe analysis of the foils used in the Madison Symmetric Torus (MST) SXR tomography diagnostic revealed an impurity content of ∼0.3% fractional abundance by weight, comprised primarily of iron, zirconium, chromium, and nickel. These impurities lower the peak filter transmission in the energy range of the detector and alter the shape of the transmission curve. As a result, foil impurities introduce errors in any general measurement where radiation is being filtered. For example, neglecting the effect of impurities on filter transmission leads to large systematic errors (50%) in the electron temperature measured using the SXR double-filter technique on MST. (paper)

  16. Electron beam dynamics in an ultrafast transmission electron microscope with Wehnelt electrode.

    Science.gov (United States)

    Bücker, K; Picher, M; Crégut, O; LaGrange, T; Reed, B W; Park, S T; Masiel, D J; Banhart, F

    2016-12-01

    High temporal resolution transmission electron microscopy techniques have shown significant progress in recent years. Using photoelectron pulses induced by ultrashort laser pulses on the cathode, these methods can probe ultrafast materials processes and have revealed numerous dynamic phenomena at the nanoscale. Most recently, the technique has been implemented in standard thermionic electron microscopes that provide a flexible platform for studying material's dynamics over a wide range of spatial and temporal scales. In this study, the electron pulses in such an ultrafast transmission electron microscope are characterized in detail. The microscope is based on a thermionic gun with a Wehnelt electrode and is operated in a stroboscopic photoelectron mode. It is shown that the Wehnelt bias has a decisive influence on the temporal and energy spread of the picosecond electron pulses. Depending on the shape of the cathode and the cathode-Wehnelt distance, different emission patterns with different pulse parameters are obtained. The energy spread of the pulses is determined by space charge and Boersch effects, given by the number of electrons in a pulse. However, filtering effects due to the chromatic aberrations of the Wehnelt electrode allow the extraction of pulses with narrow energy spreads. The temporal spread is governed by electron trajectories of different length and in different electrostatic potentials. High temporal resolution is obtained by excluding shank emission from the cathode and aberration-induced halos in the emission pattern. By varying the cathode-Wehnelt gap, the Wehnelt bias, and the number of photoelectrons in a pulse, tradeoffs between energy and temporal resolution as well as beam intensity can be made as needed for experiments. Based on the characterization of the electron pulses, the optimal conditions for the operation of ultrafast TEMs with thermionic gun assembly are elaborated. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Time-resolved magnetic imaging in an aberration-corrected, energy-filtered photoemission electron microscope

    International Nuclear Information System (INIS)

    Nickel, F.; Gottlob, D.M.; Krug, I.P.; Doganay, H.; Cramm, S.; Kaiser, A.M.; Lin, G.; Makarov, D.; Schmidt, O.G.

    2013-01-01

    We report on the implementation and usage of a synchrotron-based time-resolving operation mode in an aberration-corrected, energy-filtered photoemission electron microscope. The setup consists of a new type of sample holder, which enables fast magnetization reversal of the sample by sub-ns pulses of up to 10 mT. Within the sample holder current pulses are generated by a fast avalanche photo diode and transformed into magnetic fields by means of a microstrip line. For more efficient use of the synchrotron time structure, we developed an electrostatic deflection gating mechanism capable of beam blanking within a few nanoseconds. This allows us to operate the setup in the hybrid bunch mode of the storage ring facility, selecting one or several bright singular light pulses which are temporally well-separated from the normal high-intensity multibunch pulse pattern. - Highlights: • A new time-resolving operation mode in photoemission electron microscopy is shown. • Our setup works within an energy-filtered, aberration-corrected PEEM. • A new gating system for bunch selection using synchrotron radiation is developed. • An alternative magnetic excitation system is developed. • First tr-imaging using an energy-filtered, aberration-corrected PEEM is shown

  18. Design of Chebychev’s Low Pass Filters Using Nonuniform Transmission Lines

    Directory of Open Access Journals (Sweden)

    Said Attamimi

    2016-03-01

    Full Text Available Transmission lines are utilized in many applications to convey energy as well as information. Nonuniform transmission lines (NTLs are obtained through variation of the characteristic quantities along the axial direction. Such NTLs can be used to design network elements, like matching circuits, delay equalizers, filters, VLSI interconnections, etc. In this work, NTLs were analyzed with a numerical method based on the implementation of method of moment. In order to approximate the voltage and current distribution along the transmission line, a sum of basis functions with unknown amplitudes was introduced. As basis function, a constant function was used. In this work, we observed several cases such as lossless and lossy uniform transmission lines with matching and arbitrary load. These cases verified the algorithm developed in this work. The second example consists of nonuniform transmission lines in the form of abruptly changing transmission lines. This structure was used to design a Chebychev’s low pass filter. The calculated reflection and transmission factors of the filters showed some coincidences with the measurements.

  19. Transmission electron microscopy of bulk specimens over 10 µm in thickness

    Energy Technology Data Exchange (ETDEWEB)

    Sadamatsu, Sunao, E-mail: sadamatsu@mech.kagoshima-u.ac.jp [Department of Mechanical Engineering, Kagoshima University, Korimoto, Kagoshima 890-0065 (Japan); Tanaka, Masaki; Higashida, Kenji [Department of Materials Science and Engineering, Kyushu University, Nishi-ku, Fukuoka 819-0395 (Japan); Matsumura, Syo [Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Nishi-ku, Fukuoka 819-0395 (Japan); Ultramicroscopy Research Center, Kyushu University, Nishi-ku, Fukuoka 819-0395 (Japan)

    2016-03-15

    We succeeded the observation of microstructures in bulk-sized specimens of over 10 µm in thickness by employing a technique that combines transmission electron microscopy (TEM) with energy-filtered imaging based on electron energy-loss spectroscopy (EELS). This method is unique in that it incorporates the inelastically scattered electrons into the imaging process. Using this technique, bright and sharp images of dislocations in crystalline silicon specimens as thick as 10 µm were obtained. A calibration curve to determine foil thickness of such a thick specimen was also derived. This method simply extends the observable thickness range in TEM. If combined with tilt series of observation over a significant range of angle, it will disclose three dimensional nanostructures in a µm-order block of a specimen, promoting our understanding of the controlling mechanisms behind various bulky material properties. - Highlights: • We developed a method which enables thick specimens to be observed using EF-TEM. • The effects of energy filter width and position on images were determined. • We suggested a method to determine the thickness of a thick film sample. • We achieved observation of microstructures in specimens with a thickness of 10 µm.

  20. Tunable electronic transmission gaps in a graphene superlattice

    International Nuclear Information System (INIS)

    Lu Weitao; Wang Shunjin; Li Wen; Wang Yonglong; Jiang Hua

    2012-01-01

    The transmission in graphene superlattices with adjustable barrier height is investigated using transfer-matrix method. It is found that one could control the angular range of transmission by changing the ratio of incidence energy and barrier height. The transmission as a function of incidence energy has more than one gaps, due to the appearance of evanescent waves in different barriers. Accordingly, more than one conductivity minimums are induced. The transmission gaps could be controlled by adjusting the incidence angle, the barrier height, and the barrier number, which gives the possibility to construct an energy-dependent wavevector filter.

  1. Electron beam dynamics in an ultrafast transmission electron microscope with Wehnelt electrode

    Energy Technology Data Exchange (ETDEWEB)

    Bücker, K.; Picher, M.; Crégut, O. [Institut de Physique et Chimie des Matériaux de Strasbourg, UMR 7504 CNRS, Université de Strasbourg, 23 rue du Loess, 67034 Strasbourg (France); LaGrange, T. [Interdisciplinary Centre for Electron Microscopy, École Polytechnique Fédérale de Lausanne, 1015 Lausanne (Switzerland); Reed, B.W.; Park, S.T.; Masiel, D.J. [Integrated Dynamic Electron Solutions, Inc., 5653 Stoneridge Drive 117, Pleasanton, CA 94588 (United States); Banhart, F., E-mail: florian.banhart@ipcms.unistra.fr [Institut de Physique et Chimie des Matériaux de Strasbourg, UMR 7504 CNRS, Université de Strasbourg, 23 rue du Loess, 67034 Strasbourg (France)

    2016-12-15

    High temporal resolution transmission electron microscopy techniques have shown significant progress in recent years. Using photoelectron pulses induced by ultrashort laser pulses on the cathode, these methods can probe ultrafast materials processes and have revealed numerous dynamic phenomena at the nanoscale. Most recently, the technique has been implemented in standard thermionic electron microscopes that provide a flexible platform for studying material's dynamics over a wide range of spatial and temporal scales. In this study, the electron pulses in such an ultrafast transmission electron microscope are characterized in detail. The microscope is based on a thermionic gun with a Wehnelt electrode and is operated in a stroboscopic photoelectron mode. It is shown that the Wehnelt bias has a decisive influence on the temporal and energy spread of the picosecond electron pulses. Depending on the shape of the cathode and the cathode-Wehnelt distance, different emission patterns with different pulse parameters are obtained. The energy spread of the pulses is determined by space charge and Boersch effects, given by the number of electrons in a pulse. However, filtering effects due to the chromatic aberrations of the Wehnelt electrode allow the extraction of pulses with narrow energy spreads. The temporal spread is governed by electron trajectories of different length and in different electrostatic potentials. High temporal resolution is obtained by excluding shank emission from the cathode and aberration-induced halos in the emission pattern. By varying the cathode-Wehnelt gap, the Wehnelt bias, and the number of photoelectrons in a pulse, tradeoffs between energy and temporal resolution as well as beam intensity can be made as needed for experiments. Based on the characterization of the electron pulses, the optimal conditions for the operation of ultrafast TEMs with thermionic gun assembly are elaborated. - Highlights: • A detailed characterization of electron

  2. Bragg reflection transmission filters for variable resolution monochromators

    International Nuclear Information System (INIS)

    Chapman, D.

    1989-01-01

    There are various methods for improving the angular and spectral resolution of monochromator and analyzer systems. The novel system described here, though limited to higher x-ray energies (>20keV), is based on a dynamical effect occurring on the transmitted beam with a thin perfect crystal plate set in the Bragg reflection case. In the case of Bragg reflection from a perfect crystal, the incident beam is rapidly attenuated as it penetrates the crystal in the range of reflection. This extinction length is of the order of microns. The attenuation length, which determines the amount of normal transmission through the plate is generally much longer. Thus, in the range of the Bragg reflection the attenuation of the transmitted beam can change by several orders of magnitude with a small change in energy or angle. This thin crystal plate cuts a notch in the transmitted beam with a width equal to its Darwin width, thus acting as a transmission filter. When used in a non-dispersive mode with other monochromator crystals, the filter when set at the Bragg angle will reflect the entire Darwin width of the incident beam and transmit the wings of the incident beam distribution. When the element is offset in angle by some fraction of the Darwin width, the filter becomes useful in adjusting the angular width of the transmitted beam and removing a wing. Used in pairs with a symmetric offset, the filters can be used to continuously adjust the intrinsic angular divergence of the beam with good wing reduction. Instances where such filters may be useful are in improving the angular resolution of a small angle scattering camera. These filters may be added to a Bonse-Hart camera with one pair on the incident beam to reduce the intrinsic beam divergence and a second pair on the analyzer arm to improve the analyzer resolution. 2 refs., 3 Figs

  3. PSpice for filters and transmission lines

    CERN Document Server

    Tobin, Paul

    2007-01-01

    In this book, PSpice for Filters and Transmission Lines, we examine a range of active and passive filters where each design is simulated using the latest Cadence Orcad V10.5 PSpice capture software. These filters cannot match the very high order digital signal processing (DSP) filters considered in PSpice for Digital Signal Processing, but nevertheless these filters have many uses. The active filters considered were designed using Butterworth and Chebychev approximation loss functions rather than using the 'cookbook approach' so that the final design will meet a given specification in an exact

  4. Measurements of local chemistry and structure in Ni(O)-YSZ composites during reduction using energy-filtered environmental TEM

    DEFF Research Database (Denmark)

    Jeangros, Quentin; Hansen, Thomas Willum; Wagner, Jakob Birkedal

    2014-01-01

    Energy-filtered transmission electron microscopy images are acquired during the reduction of a NiO-YSZ composite in H-2 up to 600 degrees C. Temperature-resolved quantitative information about both chemistry and structure is extracted with nm spatial resolution from the data, paving the way...

  5. Three-dimensional distributions of elements in biological samples by energy-filtered electron tomography

    Energy Technology Data Exchange (ETDEWEB)

    Leapman, R.D.; Kocsis, E.; Zhang, G.; Talbot, T.L.; Laquerriere, P

    2004-07-15

    By combining electron tomography with energy-filtered electron microscopy, we have shown the feasibility of determining the three-dimensional distributions of phosphorus in biological specimens. Thin sections of the nematode, Caenorhabditis elegans were prepared by high-pressure freezing, freeze-substitution and plastic embedding. Images were recorded at energy losses above and below the phosphorus L{sub 2,3} edge using a post-column imaging filter operating at a beam energy of 120 keV. The unstained specimens exhibited minimal contrast in bright-field images. After it was determined that the specimen was sufficiently thin to allow two-window ratio imaging of phosphorus, pairs of pre-edge and post-edge images were acquired in series over a tilt range of {+-}55 deg. at 5 deg. increments for two orthogonal tilt axes. The projected phosphorus distributions were aligned using the pre-edge images that contained inelastic contrast from colloidal gold particles deposited on the specimen surface. A reconstruction and surface rendering of the phosphorus distribution clearly revealed features 15-20 nm in diameter, which were identified as ribosomes distributed along the stacked membranes of endoplasmic reticulum and in the cytoplasm. The sensitivity of the technique was estimated at <35 phosphorus atoms per voxel based on the known total ribosomal phosphorus content of approximately 7000 atoms. Although a high electron dose of approximately 10{sup 7} e/nm{sup 2} was required to record two-axis tilt series, specimens were sufficiently stable to allow image alignment and tomographic reconstruction.

  6. The neutron transmission of single crystal MgO filters

    International Nuclear Information System (INIS)

    Carpenter, J.M.; Hilleke, R.O.

    1989-01-01

    We have measured and analyzed the wavelength dependence of the transmission probability of a beam of neutrons passing through a single crystal MgO filter at 77 K. The 12.7 cm filter transmits 70% or more of the incident beam at wavelengths greater than about 1.8 A. At shorter wavelengths the transmission probability drops sharply, with 50% transmission occurring at about 1.2 A, and 1% transmission for the range 0.1-0.4 A. We have determined that cooling the filter to 77 K improves the transmission of >1 A neutrons, while further cooling to 25 K shows little additional improvement, and no improvement for short wavelengths. We have identified the wavelengths of the sharp dips in the transmission found in this region caused by Bragg scattering in MgO. We also show how these peaks may be used to calibrate the wavelength scale of time-of-flight measurements taken on instruments using similar filters. (orig.)

  7. Energy-filtered environmental transmission electron microscopy for the assessment of solid–gas reactions at elevated temperature: NiO/YSZ–H{sub 2} as a case study

    Energy Technology Data Exchange (ETDEWEB)

    Jeangros, Q. [Interdisciplinary Centre for Electron Microscopy, Ecole Polytechnique Fédérale de Lausanne, Lausanne (Switzerland); Photovoltaics and Thin Film Electronics Laboratory, Ecole Polytechnique Fédérale de Lausanne, Neuchâtel (Switzerland); Hansen, T.W.; Wagner, J.B. [Center for Electron Nanoscopy, Technical University of Denmark, Lyngby (Denmark); Dunin-Borkowski, R.E. [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons and Peter Grünberg Institute, Jülich Research Centre, Jülich (Germany); Hébert, C. [Interdisciplinary Centre for Electron Microscopy, Ecole Polytechnique Fédérale de Lausanne, Lausanne (Switzerland); Van herle, J. [Fuelmat Group, Ecole Polytechnique Fédérale de Lausanne, Sion (Switzerland); Hessler-Wyser, A. [Interdisciplinary Centre for Electron Microscopy, Ecole Polytechnique Fédérale de Lausanne, Lausanne (Switzerland); Photovoltaics and Thin Film Electronics Laboratory, Ecole Polytechnique Fédérale de Lausanne, Neuchâtel (Switzerland)

    2016-10-15

    A novel approach, which is based on the analysis of sequences of images recorded using energy-filtered transmission electron microscopy and can be used to assess the reaction of a solid with a gas at elevated temperature, is illustrated for the reduction of a NiO/ceramic solid oxide fuel cell anode in 1.3 mbar of H{sub 2}. Three-window elemental maps and jump-ratio images of the O K edge and total inelastic mean free path images are recorded as a function of temperature and used to provide local and quantitative information about the reaction kinetics and the volume changes that result from the reaction. Under certain assumptions, the speed of progression of the reaction front in all three dimensions is obtained, thereby providing a three-dimensional understanding of the reaction. - Highlights: • EFTEM is used to assess solid–gas reactions at elevated temperatures. • This novel approach provides local, quantitative chemical and structural data. • A 3D insight into how the reaction proceeds is obtained under certain assumptions. • Reaction mechanisms and their link to microstructure can be established.

  8. Transmission of electrons through Al2O3 nanocapillaries

    DEFF Research Database (Denmark)

    Milosavljević, A.R.; Jureta, J.J.; Víkor, Gy.

    2012-01-01

    We investigate transmission of low-energy electrons (250 eV) through insulating AlO nanocapillaries (270 nm diameter and 15 μm length). Kinetic energy distribution of electrons transmitted through the nanocapillaries in the straightforward direction, time dependence of the transmission rate both...

  9. Simulation calculation for the energy deposition profile and the transmission fraction of intense pulsed electron beam at various incident angles

    International Nuclear Information System (INIS)

    Yang Hailiang; Qiu Aici; Zhang Jiasheng; Huang Jianjun; Sun Jianfeng

    2002-01-01

    The incident angles have a heavy effect on the intense pulsed electron beam energy deposition profile, energy deposition fraction and beam current transmission fraction in material. The author presents electron beam energy deposition profile and energy deposition fraction versus electron energy (0.5-2.0 MeV), at various incident angles for three aluminum targets of various thickness via theoretical calculation. The intense pulsed electron beam current transmission fractions versus electron energy (0.4-1.4 MeV) at various incident angles for three thickness of carbon targets were also theoretically calculated. The calculation results indicate that the deposition energy in unit mass of material surface layer increase with the rise of electron beam incident angle, and electron beam with low incident angle (closer to normal incident angle) penetrates deeper into the target material. The electron beams deposit more energy in unit mass of material surface layer at 60 degree-70 degree incident angle

  10. Theoretical study of the transmission of low-energy (0-10 eV) electrons through thin-film organic molecular solids: benzene

    International Nuclear Information System (INIS)

    Goulet, T.; Jay-Gerin, J.-P.

    1986-01-01

    A theoretical study of the transmission of low-energy (0 to 10 eV) electrons incident from vacuum through thin-film organic molecular solids deposited on a cold metal substrate is presented and developed for the specific case of solid benzene. In essence, using a semiclassical description of electron transport in solids with an energy-independent scattering mean free path and assuming an isotropic electron scattering, the behavior of a penetrating electron in the film is simulated when a large number of scattering events are present. The good agreement between the calculated electron transmission spectra and those obtained experimentally indicates that our study provides a realistic description of the electron transport in the film, and accounts for the influence of the various electron-molecule scattering processes upon the energy dependence of the transmitted current. In particular, we show that the excitonic subionization energy losses are at the origin of the main structures of the observed electron transmission spectra. It is also shown that our study can successfully be used to estimate the probabilities of the various electron scattering processes which occur in the film, as well as the electron mean free path (l). For solid benzene, l is about 8 A in the considered electron energy range. (author)

  11. Electron magnetic chiral dichroism in CrO2 thin films using monochromatic probe illumination in a transmission electron microscope

    International Nuclear Information System (INIS)

    Loukya, B.; Zhang, X.; Gupta, A.; Datta, R.

    2012-01-01

    Electron magnetic chiral dichroism (EMCD) has been studied in CrO 2 thin films (with (100) and (110) growth orientations on TiO 2 substrates) using a gun monochromator in an aberration corrected transmission electron microscope operating at 300 kV. Excellent signal-to-noise ratio is obtained at spatial resolution ∼10 nm using a monochromatic probe as compared to conventional parallel illumination, large area convergent beam electron diffraction and scanning transmission electron microscopy techniques of EMCD. Relatively rapid exposure using mono probe illumination enables collection of EMCD spectra in total of 8–9 min in energy filtered imaging mode for a given Cr L 2,3 energy scan (energy range ∼35 eV). We compared the EMCD signal obtained by extracting the Cr L 2,3 spectra under three beam diffraction geometry of two different reciprocal vectors (namely g=110 and 200) and found that the g=200 vector enables acquisition of excellent EMCD signal from relatively thicker specimen area due to the associated larger extinction distance. Orbital to spin moment ratio has been calculated using EMCD sum rules for 3d elements and dichroic spectral features associated with CrO 2 are compared and discussed with XMCD theoretical spectra. - Highlights: ► Electron magnetic circular dichroism (EMCD) of CrO 2 thin film with two different orientations. ► Improved EMCD signal with Gun monochromator illumination. ► Improved EMCD signal with higher g vector.

  12. Sub-nanometre resolution imaging of polymer-fullerene photovoltaic blends using energy-filtered scanning electron microscopy.

    Science.gov (United States)

    Masters, Robert C; Pearson, Andrew J; Glen, Tom S; Sasam, Fabian-Cyril; Li, Letian; Dapor, Maurizio; Donald, Athene M; Lidzey, David G; Rodenburg, Cornelia

    2015-04-24

    The resolution capability of the scanning electron microscope has increased immensely in recent years, and is now within the sub-nanometre range, at least for inorganic materials. An equivalent advance has not yet been achieved for imaging the morphologies of nanostructured organic materials, such as organic photovoltaic blends. Here we show that energy-selective secondary electron detection can be used to obtain high-contrast, material-specific images of an organic photovoltaic blend. We also find that we can differentiate mixed phases from pure material phases in our data. The lateral resolution demonstrated is twice that previously reported from secondary electron imaging. Our results suggest that our energy-filtered scanning electron microscopy approach will be able to make major inroads into the understanding of complex, nano-structured organic materials.

  13. Sub-nanometre resolution imaging of polymer–fullerene photovoltaic blends using energy-filtered scanning electron microscopy

    Science.gov (United States)

    Masters, Robert C.; Pearson, Andrew J.; Glen, Tom S.; Sasam, Fabian-Cyril; Li, Letian; Dapor, Maurizio; Donald, Athene M.; Lidzey, David G.; Rodenburg, Cornelia

    2015-01-01

    The resolution capability of the scanning electron microscope has increased immensely in recent years, and is now within the sub-nanometre range, at least for inorganic materials. An equivalent advance has not yet been achieved for imaging the morphologies of nanostructured organic materials, such as organic photovoltaic blends. Here we show that energy-selective secondary electron detection can be used to obtain high-contrast, material-specific images of an organic photovoltaic blend. We also find that we can differentiate mixed phases from pure material phases in our data. The lateral resolution demonstrated is twice that previously reported from secondary electron imaging. Our results suggest that our energy-filtered scanning electron microscopy approach will be able to make major inroads into the understanding of complex, nano-structured organic materials. PMID:25906738

  14. Design of a transmission electron positron microscope

    International Nuclear Information System (INIS)

    Doyama, Masao; Inoue, M.; Kogure, Y.; Hayashi, Y.; Yoshii, T.; Kurihara, T.; Tsuno, K.

    2003-01-01

    This paper reports the plans and design of positron-electron microscopes being built at KEK (High Energy Accelerator Research Organization), Tsukuba, Japan. A used electron microscope is altered. The kinetic energies of positrons produced by accelerators or by nuclear decays are not a unique value but show a spread over in a wide range. Positron beam is guided to a transmission electron microscope (JEM100SX). Positrons are moderated by a tungsten foil, are accelerated and are focused on a nickel sheet. The monochromatic focused beam is injected into an electron microscope. The focusing and aberration of positrons are the same as electrons in a magnetic system which are used in commercial electron microscopes. Imaging plates are used to record positron images for the transmission electron microscope. (author)

  15. Performance of large electron energy filter in large volume plasma device

    International Nuclear Information System (INIS)

    Singh, S. K.; Srivastava, P. K.; Awasthi, L. M.; Mattoo, S. K.; Sanyasi, A. K.; Kaw, P. K.; Singh, R.

    2014-01-01

    This paper describes an in-house designed large Electron Energy Filter (EEF) utilized in the Large Volume Plasma Device (LVPD) [S. K. Mattoo, V. P. Anita, L. M. Awasthi, and G. Ravi, Rev. Sci. Instrum. 72, 3864 (2001)] to secure objectives of (a) removing the presence of remnant primary ionizing energetic electrons and the non-thermal electrons, (b) introducing a radial gradient in plasma electron temperature without greatly affecting the radial profile of plasma density, and (c) providing a control on the scale length of gradient in electron temperature. A set of 19 independent coils of EEF make a variable aspect ratio, rectangular solenoid producing a magnetic field (B x ) of 100 G along its axis and transverse to the ambient axial field (B z ∼ 6.2 G) of LVPD, when all its coils are used. Outside the EEF, magnetic field reduces rapidly to 1 G at a distance of 20 cm from the center of the solenoid on either side of target and source plasma. The EEF divides LVPD plasma into three distinct regions of source, EEF and target plasma. We report that the target plasma (n e ∼ 2 × 10 11  cm −3 and T e ∼ 2 eV) has no detectable energetic electrons and the radial gradients in its electron temperature can be established with scale length between 50 and 600 cm by controlling EEF magnetic field. Our observations reveal that the role of the EEF magnetic field is manifested by the energy dependence of transverse electron transport and enhanced transport caused by the plasma turbulence in the EEF plasma

  16. Electron energy-loss spectrometry at the frontier of spatial and energy resolution

    International Nuclear Information System (INIS)

    Hofer, F.; Grogger, W.; Kothleitner, G.

    2004-01-01

    Full text: Electron energy-loss spectroscopy (EELS) in the transmission electron microscope (TEM) is now used routinely as a means of measuring chemical and structural properties of very small regions of a thin specimen. The power of this technique depends significantly on two parameters: its spatial resolution and the energy resolution available in the spectrum and in the energy-filtered TEM (EFTEM) image. The cold field emission source and the Schottky emitter have made an energy resolution below 1 eV possible and it is now feasible to obtain data with a spatial resolution close to atomic dimensions, given the right instrumentation and specimen. EFTEM allows to record elemental maps at sub-nanometre resolution, being mainly limited by chromatic and spherical aberration of the objective lens and by delocalization of inelastic scattering. Recently the possibility of correcting spherical and even chromatic aberrations of electron lenses has become a practical reality thus improving the point resolution of the TEM to below 0.1 nm. The other limiting factor for EFTEM resolution is delocalization. However, recent measurements show that resolution values in the range of 1 nm and below can be achieved, even for energy-losses of only a few eV. In terms of energy-resolution, EELS and EFTEM compare less favourably with other spectroscopies. For common TEMs, the overall energy-resolution is mainly determined by the energy width of the electron source, typically between 0.5 and 1.5 eV. For comparison, synchrotron x-ray sources and beam line spectrometers, provide a resolution well below 0.1 eV for absorption spectroscopy. During the early sixties, the energy spread of an electron beam could be reduced by incorporating an energy-filter into the illumination system, but the system lacked spatial resolution. Later developments combined high energy resolution in the range of 0.1 eV with improved spatial resolution. Recently, FEI introduced a new high resolution EELS system based

  17. Energy-weighted dynamical scattering simulations of electron diffraction modalities in the scanning electron microscope.

    Science.gov (United States)

    Pascal, Elena; Singh, Saransh; Callahan, Patrick G; Hourahine, Ben; Trager-Cowan, Carol; Graef, Marc De

    2018-04-01

    Transmission Kikuchi diffraction (TKD) has been gaining momentum as a high resolution alternative to electron back-scattered diffraction (EBSD), adding to the existing electron diffraction modalities in the scanning electron microscope (SEM). The image simulation of any of these measurement techniques requires an energy dependent diffraction model for which, in turn, knowledge of electron energies and diffraction distances distributions is required. We identify the sample-detector geometry and the effect of inelastic events on the diffracting electron beam as the important factors to be considered when predicting these distributions. However, tractable models taking into account inelastic scattering explicitly are lacking. In this study, we expand the Monte Carlo (MC) energy-weighting dynamical simulations models used for EBSD [1] and ECP [2] to the TKD case. We show that the foil thickness in TKD can be used as a means of energy filtering and compare band sharpness in the different modalities. The current model is shown to correctly predict TKD patterns and, through the dictionary indexing approach, to produce higher quality indexed TKD maps than conventional Hough transform approach, especially close to grain boundaries. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Narrow electron injector for ballistic electron spectroscopy

    International Nuclear Information System (INIS)

    Kast, M.; Pacher, C.; Strasser, G.; Gornik, E.

    2001-01-01

    A three-terminal hot electron transistor is used to measure the normal energy distribution of ballistic electrons generated by an electron injector utilizing an improved injector design. A triple barrier resonant tunneling diode with a rectangular transmission function acts as a narrow (1 meV) energy filter. An asymmetric energy distribution with its maximum on the high-energy side with a full width at half maximum of ΔE inj =10 meV is derived. [copyright] 2001 American Institute of Physics

  19. Extraction of topographic and material contrasts on surfaces from SEM images obtained by energy filtering detection with low-energy primary electrons.

    Science.gov (United States)

    Nagoshi, Masayasu; Aoyama, Tomohiro; Sato, Kaoru

    2013-01-01

    Secondary electron microscope (SEM) images have been obtained for practical materials using low primary electron energies and an in-lens type annular detector with changing negative bias voltage supplied to a grid placed in front of the detector. The kinetic-energy distribution of the detected electrons was evaluated by the gradient of the bias-energy dependence of the brightness of the images. This is divided into mainly two parts at about 500 V, high and low brightness in the low- and high-energy regions, respectively and shows difference among the surface regions having different composition and topography. The combination of the negative grid bias and the pixel-by-pixel image subtraction provides the band-pass filtered images and extracts the material and topographic information of the specimen surfaces. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Conceptual design and simulation investigation of an electronic cooling device powered by hot electrons

    International Nuclear Information System (INIS)

    Su, Guozhen; Zhang, Yanchao; Cai, Ling; Su, Shanhe; Chen, Jincan

    2015-01-01

    Most electronic cooling devices are powered by an external bias applied between the cold and the hot reservoirs. Here we propose a new concept of electronic cooling, in which cooling is achieved by using a reservoir of hot electrons as the power source. The cooling device incorporates two energy filters with the Lorentzian transmission function to respectively select low- and high-energy electrons for transport. Based on the proposed model, we analyze the performances of the device varying with the resonant levels and half widths of two energy filters and establish the optimal configuration of the cooling device. It is believed that such a novel device may be practically used in some nano-energy fields. - Highlights: • A new electronic cooling device powered by hot electrons is proposed. • Two energy filters are employed to select the electrons for transport. • The effects of the resonant levels and half widths of two filters are discussed. • The maximum cooling power and coefficient of performance are calculated. • The optimal configuration of the cooling device is determined.

  1. Transmission electron microscope studies of extraterrestrial materials

    Science.gov (United States)

    Keller, Lindsay P.

    1995-01-01

    Transmission Electron Microscopy, X-Ray spectrometry and electron-energy-loss spectroscopy are used to analyse carbon in interplanetary dust particles. Optical micrographs are shown depicting cross sections of the dust particles embedded in sulphur. Selected-area electron diffraction patterns are shown. Transmission Electron Microscope specimens of lunar soil were prepared using two methods: ion-milling and ultramicrotomy. A combination of high resolution TEM imaging and electron diffraction is used to characterize the opaque assemblages. The opaque assemblages analyzed in this study are dominated by ilmenite with lesser rutile and spinel exsolutions, and traces of Fe metal.

  2. Simulation of loss electron in vacuum magnetically insulated transmission lines

    International Nuclear Information System (INIS)

    Zhang Pengfei; Li Yongdong; Liu Chunliang; Wang Hongguang; Guo Fan; Yang Hailiang; Qiu Aici; Su Zhaofeng; Sun Jianfeng; Sun Jiang; Gao Yi

    2011-01-01

    In the beginning of magnetic insulated period, loss electron in coaxial vacuum magnetically insulated transmission line (MITL) strikes anode and the bremsstrahlung photons are generated in the mean time. Based on the self-limited flow model, velocity in direction of energy transport, energy spectrum and angular distribution of loss electron are simulated by PIC code, energy spectrum of bremsstrahlung photons as well calculated though Monte Carlo method. Computational results show that the velocity of loss electron is less than 2.998 x 108 m/s, the angular excursion of electron is not much in a board extent of energy spectrum. These results show an indirect diagnosis of vacuum insulted transmission line working status based on loss electron bremsstrahlung. (authors)

  3. Kalman filter estimation of RLC parameters for UMP transmission line

    Directory of Open Access Journals (Sweden)

    Mohd Amin Siti Nur Aishah

    2018-01-01

    Full Text Available This paper present the development of Kalman filter that allows evaluation in the estimation of resistance (R, inductance (L, and capacitance (C values for Universiti Malaysia Pahang (UMP short transmission line. To overcome the weaknesses of existing system such as power losses in the transmission line, Kalman Filter can be a better solution to estimate the parameters. The aim of this paper is to estimate RLC values by using Kalman filter that in the end can increase the system efficiency in UMP. In this research, matlab simulink model is developed to analyse the UMP short transmission line by considering different noise conditions to reprint certain unknown parameters which are difficult to predict. The data is then used for comparison purposes between calculated and estimated values. The results have illustrated that the Kalman Filter estimate accurately the RLC parameters with less error. The comparison of accuracy between Kalman Filter and Least Square method is also presented to evaluate their performances.

  4. Soft x-ray transmission measurements on thin films used for XMM CCD-filters

    Science.gov (United States)

    Stephan, K.-H.; Reppin, C.; Maier, H. J.; Frischke, D.; Fuchs, D.; Müller, P.

    1997-02-01

    We have been developing optical filters for ESA's X-ray astronomy project XMM (X-ray Multi Mirror Mission). Specific CCDs will be used as detectors in the focal plane on board the observatory (1). Since these detectors are sensitive from the X-ray to the near infrared spectral range, X-ray observations require optical filters, which combine a high transparency for photon energies in the soft X-ray region and a high opacity for ultraviolet and visible radiation as well. With respect to the mission goal in orbit three types of flight model filters are designed having different spectral transmittance functions. We report on one of these types, a so-called "thick" filter, which has been realized within the EQM (Electrical Qualification Model)-phase of the project. The filter features a cut-off in the extreme ultraviolet spectral range and suppresses radiation below ˜10 eV photon energy by more than 8 orders of magnitude. It has an effective aperture of 73 mm without any support structure. A 0.35 μm thick polypropylene carrier foil is coated with metallic films of Al and Sn. We describe transmission measurements in the soft X-ray photon energy range to determine the thickness of the individual layers and present the optical performance data of the filter.

  5. On the Progress of Scanning Transmission Electron Microscopy (STEM) Imaging in a Scanning Electron Microscope.

    Science.gov (United States)

    Sun, Cheng; Müller, Erich; Meffert, Matthias; Gerthsen, Dagmar

    2018-04-01

    Transmission electron microscopy (TEM) with low-energy electrons has been recognized as an important addition to the family of electron microscopies as it may avoid knock-on damage and increase the contrast of weakly scattering objects. Scanning electron microscopes (SEMs) are well suited for low-energy electron microscopy with maximum electron energies of 30 keV, but they are mainly used for topography imaging of bulk samples. Implementation of a scanning transmission electron microscopy (STEM) detector and a charge-coupled-device camera for the acquisition of on-axis transmission electron diffraction (TED) patterns, in combination with recent resolution improvements, make SEMs highly interesting for structure analysis of some electron-transparent specimens which are traditionally investigated by TEM. A new aspect is correlative SEM, STEM, and TED imaging from the same specimen region in a SEM which leads to a wealth of information. Simultaneous image acquisition gives information on surface topography, inner structure including crystal defects and qualitative material contrast. Lattice-fringe resolution is obtained in bright-field STEM imaging. The benefits of correlative SEM/STEM/TED imaging in a SEM are exemplified by structure analyses from representative sample classes such as nanoparticulates and bulk materials.

  6. Electron Energy Resolution of the ATLAS TILECAL Modules with Flat Filter Method (July 2002 test beam)

    CERN Document Server

    Kulchitskii, Yu A; Vinogradov, V B

    2005-01-01

    The constructed ATLAS detector at the LHC will have the great physics discovery potential, in particular in the detection of a heavy Higgs boson. Calorimeters will play a crucial role in it. It is necessary to have confidence that the calorimeters will perform as expected. With the aim of understanding of performance of the ATLAS Tile hadronic calorimeter to electrons 12\\% of modules have been exposed in electron beams with various energies by three possible ways: cell-scan at $\\theta =20^o$ at the centers of the front face cells, $\\eta$-scan and tilerow scan at $\\theta = 90^o$ for the module side cells. We have extracted the electron energy resolutions of the $EBM-$ (ANL-44), $EBM+$ (IFA-42) and $BM$ (JINR-55) Modules of the ATLAS Tile Calorimeter at energies E = 10, 20, 50, 100 and 180 GeV and $\\theta = 20^o$ and $90^o $ and $\\eta$ scan from the July 2002 testbeam run data using the flat filter method of the PMT signal reconstruction. We have determined the statistical and constant terms for the electron en...

  7. Electron Energy Resolution of the ATLAS TILECAL Modules with Fit Filter Method (July 2002 test beam)

    CERN Document Server

    Kulchitskii, Yu A; Vinogradov, V B

    2006-01-01

    The constructed ATLAS detector at the LHC will have the great physics discovery potential, in particular in the detection of a heavy Higgs boson. Calorimeters will play a crucial role in it. It is necessary to have confidence that the calorimeters will perform as expected. With the aim of understanding of performance of the ATLAS Tile hadronic calorimeter to electrons 12\\% of modules have been exposed in electron beams with various energies by three possible ways: cell-scan at $\\theta =20^o$ at the centers of the front face cells, $\\eta$-scan and tilerow scan at $\\theta = 90^o$ for the module side cells. We have extracted the electron energy resolutions of the $EBM-$ (ANL-44), $EBM+$ (IFA-42) and $BM$ (JINR-55) Modules of the ATLAS Tile Calorimeter at energies E = 10, 20, 50, 100 and 180 GeV and $\\theta = 20^o$ and $90^o $ and $\\eta$ scan from the July 2002 testbeam run data using the fit filter method of the PMT signal reconstruction. We have determined the statistical and constant terms for the electron ene...

  8. Structural defects in multiferroic BiMnO3 studied by transmission electron microscopy and electron energy-loss spectroscopy

    International Nuclear Information System (INIS)

    Yang, H.; Chi, Z. H.; Yao, L. D.; Zhang, W.; Li, F. Y.; Jin, C. Q.; Yu, R. C.

    2006-01-01

    The multiferroic material BiMnO 3 synthesized under high pressure has been systematically studied by transmission electron microscopy and electron energy-loss spectroscopy, and some important structural defects are revealed in this multiferroic material. The frequently observed defects are characterized to be Σ3(111) twin boundaries, Ruddlesden-Popper [Acta Crystallogr. 11, 54 (1958)] antiphase boundaries, and a p p superdislocations connected with a small segment of Ruddlesden-Popper defect. These defects are present initially in the as-synthesized sample. In addition, we find that ordered voids (oxygen vacancies) are easily introduced into the multiferroic BiMnO 3 by electron-beam irradiation

  9. Effects of lattice fluctuations on electronic transmission in metal/conjugated-oligomer/metal structures

    International Nuclear Information System (INIS)

    Yu, Z.G.; Smith, D.L.; Saxena, A.; Bishop, A.R.

    1997-01-01

    The electronic transmission across metal/conjugated-oligomer/metal structures in the presence of lattice fluctuations is studied for short oligomer chains. The lattice fluctuations are approximated by static white noise disorder. Resonant transmission occurs when the energy of an incoming electron coincides with a discrete electronic level of the oligomer. The corresponding transmission peak diminishes in intensity with increasing disorder strength. Because of disorder there is an enhancement of the electronic transmission for energies that lie within the electronic gap of the oligomer. If fluctuations are sufficiently strong, a transmission peak within the gap is found at the midgap energy E=0 for degenerate conjugated oligomers (e.g., trans-polyacetylene) and E≠0 for AB-type degenerate oligomers. These results can be interpreted in terms of soliton-antisoliton states created by lattice fluctuations. copyright 1997 The American Physical Society

  10. The multilayered structure of ultrathin amorphous carbon films synthesized by filtered cathodic vacuum arc deposition

    KAUST Repository

    Wang, Na; Komvopoulos, Kyriakos

    2013-01-01

    The structure of ultrathin amorphous carbon (a-C) films synthesized by filtered cathodic vacuum arc (FCVA) deposition was investigated by high-resolution transmission electron microscopy, electron energy loss spectroscopy, and x-ray photoelectron

  11. Coherence in electron energy loss spectrometry

    International Nuclear Information System (INIS)

    Schattschneider, P.; Werner, W.S.M.

    2005-01-01

    Coherence effects in electron energy loss spectrometry (EELS) and in energy filtering are largely neglected although they occur frequently due to Bragg scattering in crystals. We discuss how coherence in the inelastically scattered wave field can be described by the mixed dynamic form factor (MDFF), and how it relates to the density matrix of the scattered electrons. Among the many aspects of 'inelastic coherence' are filtered high-resolution images, dipole-forbidden transitions, coherence in plasma excitations, errors in chemical microanalysis, coherent double plasmons, and circular dichroism

  12. Reconstruction of electrons with the Gaussian-sum filter in the CMS tracker at the LHC

    International Nuclear Information System (INIS)

    Adam, W; Fruehwirth, R; Strandlie, A; Todorov, T

    2005-01-01

    The bremsstrahlung energy loss distribution of electrons propagating in matter is highly non-Gaussian. Because the Kalman filter relies solely on Gaussian probability density functions, it is not necessarily the optimal reconstruction algorithm for electron tracks. A Gaussian-sum filter (GSF) algorithm for electron reconstruction in the CMS tracker has therefore been developed and implemented. The basic idea is to model the bremsstrahlung energy loss distribution by a Gaussian mixture rather than by a single Gaussian. It is shown that the GSF is able to improve the momentum resolution of electrons compared to the standard Kalman filter. The momentum resolution and the quality of the error estimate are studied both with a fast simulation, modelling the radiative energy loss in a simplified detector, and the full CMS tracker simulation. (research note from collaboration)

  13. Reconstruction of Electrons with the Gaussian-Sum Filter in the CMS Tracker at the LHC

    CERN Document Server

    Adam, Wolfgang; Strandlie, Are; Todor, T

    2005-01-01

    The bremsstrahlung energy loss distribution of electrons propagating in matter is highly non-Gaussian. Because the Kalman filter relies solely on Gaussian probability density functions, it is not necessarily the optimal reconstruction algorithm for electron tracks. A Gaussian-sum filter (GSF) algorithm for electron reconstruction in the CMS tracker has therefore been developed and implemented. The basic idea is to model the bremsstrahlung energy loss distribution by a Gaussian mixture rather than by a single Gaussian. It is shown that the GSF is able to improve the momentum resolution of electrons compared to the standard Kalman filter. The momentum resolution and the quality of he error estimate are studied both with a fast simulation, modelling the radiative energy loss in a simplified detector, and the full CMS tracker simulation.

  14. Transmission electron microscopy physics of image formation and microanalysis

    CERN Document Server

    Reimer, Ludwig

    1993-01-01

    "Transmission Electron Microscopy" presents the theory of image and contrastformation, and the analytical modes in transmission electron microscopy Theprinciples of particle and wave optics of electrons are described Electron-specimen interactions are discussed for evaluating the theory of scattering and phase contrast Also analysed are the kinetical and dynamical theories of electron diffraction and their applications for crystal-structure determination and imaging of lattices and their defects X-ray microanalysis and electron energy-loss spectroscopy are treated as analytical methods The third edition includes a brief discussionof Schottky emission guns, some clarification of minor details, and references to the recent literature

  15. Study of single-electron excitations by electron microscopy

    International Nuclear Information System (INIS)

    Craven, A.J.; Gibson, J.M.; Howie, A.; Spalding, D.R.

    1978-01-01

    The inelastic scattering of fast electrons by the excitation of L-shell electrons at a stacking fault in silicon has been studied with a scanning transmission electron microscope. It was found that the bright-field stacking fault contrast is preserved in the filtered L-shell-loss signal at 100 eV. This result is discussed in terms of the delocalization of the excitation mechanism. It is concluded that localization effects will typically become significant only for energy transfers greater than 1 keV from a fast electron of energy 80 keV. (author)

  16. Energy-filtered TEM imaging and EELS study of ODS particles and argon-filled cavities in ferritic-martensitic steels.

    Science.gov (United States)

    Klimiankou, M; Lindau, R; Möslang, A

    2005-01-01

    Oxide-dispersion-strengthened (ODS) ferritic-martensitic steels with yttrium oxide (Y(2)O(3)) have been produced by mechanical alloying and hot isostatic pressing for use as advanced material in fusion power reactors. Argon gas, usually widely used as inert gas during mechanical alloying, was surprisingly detected in the nanodispersion-strengthened materials. Energy-filtered transmission electron microscopy (EFTEM) and electron energy loss spectroscopy (EELS) led to the following results: (i) chemical composition of ODS particles, (ii) voids with typical diameters of 1-6 nm are formed in the matrix, (iii) these voids are filled with Ar gas, and (iv) the high-density nanosized ODS particles serve as trapping centers for the Ar bubbles. The Ar L(3,2) energy loss edge at 245 eV as well as the absorption features of the ODS particle elements were identified in the EELS spectrum. The energy resolution in the EEL spectrum of about 1.0 eV allows to identify the electronic structure of the ODS particles.

  17. Parallel power electronics filters in three-phase four-wire systems principle, control and design

    CERN Document Server

    Wong, Man-Chung; Lam, Chi-Seng

    2016-01-01

    This book describes parallel power electronic filters for 3-phase 4-wire systems, focusing on the control, design and system operation. It presents the basics of power-electronics techniques applied in power systems as well as the advanced techniques in controlling, implementing and designing parallel power electronics converters. The power-quality compensation has been achieved using active filters and hybrid filters, and circuit models, control principles and operational practice problems have been verified by principle study, simulation and experimental results. The state-of-the-art research findings were mainly developed by a team at the University of Macau. Offering background information and related novel techniques, this book is a valuable resource for electrical engineers and researchers wanting to work on energy saving using power-quality compensators or renewable energy power electronics systems. .

  18. Beta-spectrometer with magnetic filter of mini orange type

    International Nuclear Information System (INIS)

    Gorozhankin, V.M.; Gromov, K.Ya.; Kalinnikov, V.G.; Sereeter, Z.; Fominykh, V.I.; Malikov, Sh.R.; Yuldashev, M.B.

    1997-01-01

    At the ISOL facility YASNAPP-2 a β-spectrometer with a magnetic filter of the miniorange type is constructed to measure γ-ray internal conversion coefficients. The magnetic filter of the mini orange type is an assemblage of permanent magnets creating a toroidal magnetic field perpendicular to the electron trajectories from the source to the Si(Li) detector. The chosen profile of the permanent magnets allowed electron registration in the defined energy energy interval with some transmission increase. There are two sets of permanent magnets of the different thickness. Varying the type and number of permanent magnets one can set the detected electron energy intervals in a 50-2500 keV range. The efficiency of the spectrometer was investigated for different assemblages of the mini orange magnet. The facility can be used for the e-γ coincidence investigation. (A.A.D.)

  19. Validities of three multislice algorithms for quantitative low-energy transmission electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Ming, W.Q.; Chen, J.H., E-mail: jhchen123@hnu.edu.cn

    2013-11-15

    Three different types of multislice algorithms, namely the conventional multislice (CMS) algorithm, the propagator-corrected multislice (PCMS) algorithm and the fully-corrected multislice (FCMS) algorithm, have been evaluated in comparison with respect to the accelerating voltages in transmission electron microscopy. Detailed numerical calculations have been performed to test their validities. The results show that the three algorithms are equivalent for accelerating voltage above 100 kV. However, below 100 kV, the CMS algorithm will introduce significant errors, not only for higher-order Laue zone (HOLZ) reflections but also for zero-order Laue zone (ZOLZ) reflections. The differences between the PCMS and FCMS algorithms are negligible and mainly appear in HOLZ reflections. Nonetheless, when the accelerating voltage is further lowered to 20 kV or below, the PCMS algorithm will also yield results deviating from the FCMS results. The present study demonstrates that the propagation of the electron wave from one slice to the next slice is actually cross-correlated with the crystal potential in a complex manner, such that when the accelerating voltage is lowered to 10 kV, the accuracy of the algorithms is dependent of the scattering power of the specimen. - Highlights: • Three multislice algorithms for low-energy transmission electron microscopy are evaluated. • The propagator-corrected algorithm is a good alternative for voltages down to 20 kV. • Below 20 kV, a fully-corrected algorithm has to be employed for quantitative simulations.

  20. Validities of three multislice algorithms for quantitative low-energy transmission electron microscopy

    International Nuclear Information System (INIS)

    Ming, W.Q.; Chen, J.H.

    2013-01-01

    Three different types of multislice algorithms, namely the conventional multislice (CMS) algorithm, the propagator-corrected multislice (PCMS) algorithm and the fully-corrected multislice (FCMS) algorithm, have been evaluated in comparison with respect to the accelerating voltages in transmission electron microscopy. Detailed numerical calculations have been performed to test their validities. The results show that the three algorithms are equivalent for accelerating voltage above 100 kV. However, below 100 kV, the CMS algorithm will introduce significant errors, not only for higher-order Laue zone (HOLZ) reflections but also for zero-order Laue zone (ZOLZ) reflections. The differences between the PCMS and FCMS algorithms are negligible and mainly appear in HOLZ reflections. Nonetheless, when the accelerating voltage is further lowered to 20 kV or below, the PCMS algorithm will also yield results deviating from the FCMS results. The present study demonstrates that the propagation of the electron wave from one slice to the next slice is actually cross-correlated with the crystal potential in a complex manner, such that when the accelerating voltage is lowered to 10 kV, the accuracy of the algorithms is dependent of the scattering power of the specimen. - Highlights: • Three multislice algorithms for low-energy transmission electron microscopy are evaluated. • The propagator-corrected algorithm is a good alternative for voltages down to 20 kV. • Below 20 kV, a fully-corrected algorithm has to be employed for quantitative simulations

  1. Characterisation of nano-structured titanium and aluminium nitride coatings by indentation, transmission electron microscopy and electron energy loss spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Girleanu, M., E-mail: maria.girleanu@uha.fr [Mecanique, Materiaux et Procedes de Fabrication, LPMT (EA CNRS 4365), Universite de Haute Alsace, 61 rue Albert Camus, F-68093 Mulhouse (France); Pac, M.-J.; Louis, P. [Mecanique, Materiaux et Procedes de Fabrication, LPMT (EA CNRS 4365), Universite de Haute Alsace, 61 rue Albert Camus, F-68093 Mulhouse (France); Ersen, O.; Werckmann, J. [Departement Structures et Interfaces, IPCMS (UMR CNRS 7504), Universite de Strasbourg, 23 rue du Loess, F-67087 Strasbourg (France); Rousselot, C. [Departement Micro Nano Sciences et Systemes, FEMTO-ST (UMR CNRS 6174), Universite de Franche-Comte, BP 71427, F-25211 Montbeliard (France); Tuilier, M.-H. [Mecanique, Materiaux et Procedes de Fabrication, LPMT (EA CNRS 4365), Universite de Haute Alsace, 61 rue Albert Camus, F-68093 Mulhouse (France)

    2011-07-01

    Titanium and aluminium nitride Ti{sub 1-x}Al{sub x}N films deposited by radiofrequency magnetron reactive sputtering onto steel substrate are examined by transmission electron microscopy over all the range of composition (x = 0, 0.5, 0.68, 0.86, 1). The deposition parameters are optimised in order to grow nitride films with low stress over all the composition range. Transmission electron microscopy cross-section images of Vickers indentation prints performed on that set of coatings show the evolution of their damage behaviour as increasing x Al content. Cubic Ti-rich nitrides consist of small grains clustered in rather large columns sliding along each other during indentation. Hexagonal Al-rich films grow in thinner columns which can be bent under the Vickers tip. Indentation tests carried out on TiN and AlN films are simulated using finite element modelling. Particular aspects of shear stresses and displacements in the coating/substrate are investigated. The growth mode and the nanostructure of two typical films, TiN and Ti{sub 0.14}Al{sub 0.86}N, are studied in detail by combining transmission electron microscopy cross-sections and plan views. Electron energy loss spectrum taken across Ti{sub 0.14}Al{sub 0.86}N film suggests that a part of nitrogen atoms is in cubic-like local environment though the lattice symmetry of Al-rich coatings is hexagonal. The poorly crystallised domains containing Ti and N atoms in cubic-like environment are obviously located in grain boundaries and afford protection of the coating against cracking.

  2. Characterisation of nano-structured titanium and aluminium nitride coatings by indentation, transmission electron microscopy and electron energy loss spectroscopy

    International Nuclear Information System (INIS)

    Girleanu, M.; Pac, M.-J.; Louis, P.; Ersen, O.; Werckmann, J.; Rousselot, C.; Tuilier, M.-H.

    2011-01-01

    Titanium and aluminium nitride Ti 1-x Al x N films deposited by radiofrequency magnetron reactive sputtering onto steel substrate are examined by transmission electron microscopy over all the range of composition (x = 0, 0.5, 0.68, 0.86, 1). The deposition parameters are optimised in order to grow nitride films with low stress over all the composition range. Transmission electron microscopy cross-section images of Vickers indentation prints performed on that set of coatings show the evolution of their damage behaviour as increasing x Al content. Cubic Ti-rich nitrides consist of small grains clustered in rather large columns sliding along each other during indentation. Hexagonal Al-rich films grow in thinner columns which can be bent under the Vickers tip. Indentation tests carried out on TiN and AlN films are simulated using finite element modelling. Particular aspects of shear stresses and displacements in the coating/substrate are investigated. The growth mode and the nanostructure of two typical films, TiN and Ti 0.14 Al 0.86 N, are studied in detail by combining transmission electron microscopy cross-sections and plan views. Electron energy loss spectrum taken across Ti 0.14 Al 0.86 N film suggests that a part of nitrogen atoms is in cubic-like local environment though the lattice symmetry of Al-rich coatings is hexagonal. The poorly crystallised domains containing Ti and N atoms in cubic-like environment are obviously located in grain boundaries and afford protection of the coating against cracking.

  3. Transmission electron microscopy physics of image formation and microanalysis

    CERN Document Server

    Reimer, Ludwig

    1997-01-01

    Transmission Electron Microscopy presents the theory of image and contrast formation, and the analytical modes in transmission electron microscopy. The principles of particle and wave optics of electrons are described. Electron-specimen interactions are discussed for evaluating the theory of scattering and phase contrast. Also discussed are the kinematical and dynamical theories of electron diffraction and their applications for crystal-structure analysis and imaging of lattices and their defects. X-ray micronanalysis and electron energy-loss spectroscopy are treated as analytical methods. Specimen damage and contamination by electron irradiation limits the resolution for biological and some inorganic specimens. This fourth edition includes discussion of recent progress, especially in the area of Schottky emission guns, convergent-beam electron diffraction, electron tomography, holography and the high resolution of crystal lattices.

  4. Multi-band transmission color filters for multi-color white LEDs based visible light communication

    Science.gov (United States)

    Wang, Qixia; Zhu, Zhendong; Gu, Huarong; Chen, Mengzhu; Tan, Qiaofeng

    2017-11-01

    Light-emitting diodes (LEDs) based visible light communication (VLC) can provide license-free bands, high data rates, and high security levels, which is a promising technique that will be extensively applied in future. Multi-band transmission color filters with enough peak transmittance and suitable bandwidth play a pivotal role for boosting signal-noise-ratio in VLC systems. In this paper, multi-band transmission color filters with bandwidth of dozens nanometers are designed by a simple analytical method. Experiment results of one-dimensional (1D) and two-dimensional (2D) tri-band color filters demonstrate the effectiveness of the multi-band transmission color filters and the corresponding analytical method.

  5. Photonic Color Filters Integrated with Organic Solar Cells for Energy Harvesting

    KAUST Repository

    Park, Hui Joon

    2011-09-27

    Color filters are indispensable in most color display applications. In most cases, they are chemical pigment-based filters, which produce a particular color by absorbing its complementary color, and the absorbed energy is totally wasted. If the absorbed and wasted energy can be utilized, e.g., to generate electricity, innovative energy-efficient electronic media could be envisioned. Here we show photonic nanostructures incorporated with photovoltaics capable of producing desirable colors in the visible band and utilize the absorbed light to simultaneously generate electrical powers. In contrast to the traditional colorant-based filters, these devices offer great advantages for electro-optic applications. © 2011 American Chemical Society.

  6. High-transmission excited-state Faraday anomalous dispersion optical filter edge filter based on a Halbach cylinder magnetic-field configuration.

    Science.gov (United States)

    Rudolf, Andreas; Walther, Thomas

    2012-11-01

    We report on the realization of an excited-state Faraday anomalous dispersion optical filter (ESFADOF) edge filter based on the 5P(3/2)→8D(5/2) transition in rubidium. A maximum transmission of 81% has been achieved. This high transmission is only possible by utilizing a special configuration of magnetic fields taken from accelerator physics to provide a strong homogeneous magnetic field of approximately 6000 G across the vapor cell. The two resulting steep transmission edges are separated by more than 13 GHz, enabling its application in remote sensing.

  7. An Automated Energy Detection Algorithm Based on Morphological Filter Processing with a Modified Watershed Transform

    Science.gov (United States)

    2018-01-01

    ARL-TR-8270 ● JAN 2018 US Army Research Laboratory An Automated Energy Detection Algorithm Based on Morphological Filter...Automated Energy Detection Algorithm Based on Morphological Filter Processing with a Modified Watershed Transform by Kwok F Tom Sensors and Electron...1 October 2016–30 September 2017 4. TITLE AND SUBTITLE An Automated Energy Detection Algorithm Based on Morphological Filter Processing with a

  8. In situ observation of electron beam-induced phase transformation of CaCO3 to CaO via ELNES at low electron beam energies.

    Science.gov (United States)

    Golla-Schindler, Ute; Benner, Gerd; Orchowski, Alexander; Kaiser, Ute

    2014-06-01

    It is demonstrated that energy-filtered transmission electron microscope enables following of in situ changes of the Ca-L2,3 edge which can originate from variations in both local symmetry and bond lengths. Low accelerating voltages of 20 and 40 kV slow down radiation damage effects and enable study of the start and finish of phase transformations. We observed electron beam-induced phase transformation of single crystalline calcite (CaCO3) to polycrystalline calcium oxide (CaO) which occurs in different stages. The coordination of Ca in calcite is close to an octahedral one streched along the direction. Changes during phase transformation to an octahedral coordination of Ca in CaO go along with a bond length increase by 5 pm, where oxygen is preserved as a binding partner. Electron loss near-edge structure of the Ca-L2,3 edge show four separated peaks, which all shift toward lower energies during phase transformation at the same time the energy level splitting increases. We suggest that these changes can be mainly addressed to the change of the bond length on the order of picometers. An important pre-condition for such studies is stability of the energy drift in the range of meV over at least 1 h, which is achieved with the sub-Ångström low-voltage transmission electron microscope I prototype microscope.

  9. Energy Efficient In-network RFID Data Filtering Scheme in Wireless Sensor Networks

    Science.gov (United States)

    Bashir, Ali Kashif; Lim, Se-Jung; Hussain, Chauhdary Sajjad; Park, Myong-Soon

    2011-01-01

    RFID (Radio frequency identification) and wireless sensor networks are backbone technologies for pervasive environments. In integration of RFID and WSN, RFID data uses WSN protocols for multi-hop communications. Energy is a critical issue in WSNs; however, RFID data contains a lot of duplication. These duplications can be eliminated at the base station, but unnecessary transmissions of duplicate data within the network still occurs, which consumes nodes’ energy and affects network lifetime. In this paper, we propose an in-network RFID data filtering scheme that efficiently eliminates the duplicate data. For this we use a clustering mechanism where cluster heads eliminate duplicate data and forward filtered data towards the base station. Simulation results prove that our approach saves considerable amounts of energy in terms of communication and computational cost, compared to existing filtering schemes. PMID:22163999

  10. Energy Efficient In-network RFID Data Filtering Scheme in Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    Myong-Soon Park

    2011-07-01

    Full Text Available RFID (Radio frequency identification and wireless sensor networks are backbone technologies for pervasive environments. In integration of RFID and WSN, RFID data uses WSN protocols for multi-hop communications. Energy is a critical issue in WSNs; however, RFID data contains a lot of duplication. These duplications can be eliminated at the base station, but unnecessary transmissions of duplicate data within the network still occurs, which consumes nodes’ energy and affects network lifetime. In this paper, we propose an in-network RFID data filtering scheme that efficiently eliminates the duplicate data. For this we use a clustering mechanism where cluster heads eliminate duplicate data and forward filtered data towards the base station. Simulation results prove that our approach saves considerable amounts of energy in terms of communication and computational cost, compared to existing filtering schemes.

  11. Energy-Efficient Distributed Filtering in Sensor Networks: A Unified Switched System Approach.

    Science.gov (United States)

    Zhang, Dan; Shi, Peng; Zhang, Wen-An; Yu, Li

    2016-04-21

    This paper is concerned with the energy-efficient distributed filtering in sensor networks, and a unified switched system approach is proposed to achieve this goal. For the system under study, the measurement is first sampled under nonuniform sampling periods, then the local measurement elements are selected and quantized for transmission. Then, the transmission rate is further reduced to save constrained power in sensors. Based on the switched system approach, a unified model is presented to capture the nonuniform sampling, the measurement size reduction, the transmission rate reduction, the signal quantization, and the measurement missing phenomena. Sufficient conditions are obtained such that the filtering error system is exponentially stable in the mean-square sense with a prescribed H∞ performance level. Both simulation and experiment studies are given to show the effectiveness of the proposed new design technique.

  12. Determination of the total neutron cross section using average energy shift method for filtered neutron beam

    Directory of Open Access Journals (Sweden)

    О. О. Gritzay

    2016-12-01

    Full Text Available Development of the technique for determination of the total neutron cross sections from the measurements of sample transmission by filtered neutrons, scattered on hydrogen is described. One of the methods of the transmission determination TH52Cr from the measurements of 52Cr sample, using average energy shift method for filtered neutron beam is presented. Using two methods of the experimental data processing, one of which is presented in this paper (another in [1], there is presented a set of transmissions, obtained for different samples and for different measurement angles. Two methods are fundamentally different; therefore, we can consider the obtained processing results, using these methods as independent. In future, obtained set of transmissions is planned to be used for determination of the parameters E0, Гn and R/ of the resonance 52Cr at the energy of 50 keV.

  13. Depth sectioning using electron energy loss spectroscopy

    International Nuclear Information System (INIS)

    D'Alfonso, A J; Findlay, S D; Allen, L J; Cosgriff, E C; Kirkland, A I; Nellist, P D; Oxley, M P

    2008-01-01

    The continued development of electron probe aberration correctors for scanning transmission electron microscopy has enabled finer electron probes, allowing atomic resolution column-by-column electron energy loss spectroscopy. Finer electron probes have also led to a decrease in the probe depth of focus, facilitating optical slicing or depth sectioning of samples. The inclusion of post specimen aberration corrected image forming lenses allows for scanning confocal electron microscopy with further improved depth resolution and selectivity. We show that in both scanning transmission electron microscopy and scanning confocal electron microscopy geometries, by performing a three dimensional raster scan through a specimen and detecting electrons scattered with a characteristic energy loss, it will be possible to determine the location of isolated impurities embedded within the bulk.

  14. 160 Gb/s Raman-assisted notch-filtered XPM wavelength conversion and transmission

    DEFF Research Database (Denmark)

    Galili, Michael; Oxenløwe, Leif Katsuo; Mulvad, Hans Christian Hansen

    2007-01-01

    In-line wavelength conversion of 160 Gb/s data by Raman-assisted notch-filtered XPM is demonstrated for 130 km total transmission. The improvement in system performance from applying Raman gain during conversion is shown.......In-line wavelength conversion of 160 Gb/s data by Raman-assisted notch-filtered XPM is demonstrated for 130 km total transmission. The improvement in system performance from applying Raman gain during conversion is shown....

  15. Interaction of electrons with light metal hydrides in the transmission electron microscope.

    Science.gov (United States)

    Wang, Yongming; Wakasugi, Takenobu; Isobe, Shigehito; Hashimoto, Naoyuki; Ohnuki, Somei

    2014-12-01

    Transmission electron microscope (TEM) observation of light metal hydrides is complicated by the instability of these materials under electron irradiation. In this study, the electron kinetic energy dependences of the interactions of incident electrons with lithium, sodium and magnesium hydrides, as well as the constituting element effect on the interactions, were theoretically discussed, and electron irradiation damage to these hydrides was examined using in situ TEM. The results indicate that high incident electron kinetic energy helps alleviate the irradiation damage resulting from inelastic or elastic scattering of the incident electrons in the TEM. Therefore, observations and characterizations of these materials would benefit from increased, instead decreased, TEM operating voltage. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Advances in imaging and electron physics the scanning transmission electron microscope

    CERN Document Server

    Hawkes, Peter W

    2009-01-01

    Advances in Imaging and Electron Physics merges two long-running serials--Advances in Electronics and Electron Physics and Advances in Optical and Electron Microscopy. This series features extended articles on the physics of electron devices (especially semiconductor devices), particle optics at high and low energies, microlithography, image science and digital image processing, electromagnetic wave propagation, electron microscopy, and the computing methods used in all these domains.  This particular volume presents several timely articles on the scanning transmission electron microscope. Updated with contributions from leading international scholars and industry experts Discusses hot topic areas and presents current and future research trends Provides an invaluable reference and guide for physicists, engineers and mathematicians.

  17. Development of wave length-dispersive soft x-ray emission spectrometers for transmission electron microscopes - an introduction of valence electron spectroscopy for transmission electron microscopy

    International Nuclear Information System (INIS)

    Terauchi, Masami; Koike, Masato; Fukushima, Kurio; Kimura, Atsushi

    2010-01-01

    Two types of wavelength-dispersive soft X-ray spectrometers, a high-dispersion type and a conventional one, for transmission electron microscopes were constructed. Those spectrometers were used to study the electronic states of valence electrons (bonding electrons). Both spectrometers extended the acceptable energy regions to higher than 2000 eV. The best energy resolution of 0.08 eV was obtained for an Al L-emission spectrum by using the high-dispersion type spectrometer. By using the spectrometer, C K-emission of carbon allotropes, Cu L-emission of Cu 1-x Zn x alloys and Pt M-emission spectra were presented. The FWHM value of 12 eV was obtained for the Pt Mα-emission peak. The performance of the conventional one was also presented for ZnS and a section specimen of a multilayer device. W-M and Si-K emissions were clearly resolved. Soft X-ray emission spectroscopy based on transmission electron microscopy (TEM) has an advantage for obtaining spectra from a single crystalline specimen with a defined crystal setting. As an example of anisotropic soft X-ray emission, C K-emission spectra of single crystalline graphite with different crystal settings were presented. From the spectra, density of states of π- and σ-bondings were separately derived. These results demonstrated a method to analyse the electronic states of valence electrons of materials in the nanometre scale based on TEM. (author)

  18. 3D spectrum imaging of multi-wall carbon nanotube coupled π-surface modes utilising electron energy-loss spectra acquired using a STEM/Enfina system

    International Nuclear Information System (INIS)

    Seepujak, A.; Bangert, U.; Gutierrez-Sosa, A.; Harvey, A.J.; Blank, V.D.; Kulnitskiy, B.A.; Batov, D.V.

    2005-01-01

    Numerous studies have utilised electron energy-loss (EEL) spectra acquired in the plasmon (2-10 eV) regime in order to probe delocalised π-electronic states of multi-wall carbon nanotubes (MWCNTs). Interpretation of electron energy loss (EEL) spectra of MWCNTs in the 2-10 eV regime. Carbon (accepted for publication); Blank et al. J. Appl. Phys. 91 (2002) 1657). In the present contribution, EEL spectra were acquired from a 2D raster defined on a bottle-shaped MWCNT, using a Gatan UHV Enfina system attached to a dedicated scanning transmission electron microscope (STEM). The technique utilised to isolate and sequentially filter each of the volume and surface resonances is described in detail. Utilising a scale for the intensity of a filtered mode enables one to 'see' the distribution of each resonance in the raster. This enables striking 3D resonance-filtered spectrum images (SIs) of π-collective modes to be observed. Red-shift of the lower energy split π-surface resonance provides explicit evidence of π-surface mode coupling predicted for thin graphitic films (Lucas et al. Phys. Rev. B 49 (1994) 2888). Resonance-filtered SIs are also compared to non-filtered SIs with suppressed surface contributions, acquired utilising a displaced collector aperture. The present filtering technique is seen to isolate surface contributions more effectively, and without the significant loss of statistics, associated with the displaced collector aperture mode. Isolation of collective modes utilising 3D resonance-filtered spectrum imaging, demonstrates a valuable method for 'pinpointing' the location of discrete modes in irregularly shaped nanostructures

  19. New developments in transmission electron microscopy for nanotechnology

    International Nuclear Information System (INIS)

    Wang, Z.L.

    2003-01-01

    High-resolution transmission electron microscopy (HRTEM) is one of the most powerful tools used for characterizing nanomaterials, and it is indispensable for nanotechnology. This paper reviews some of the most recent developments in electron microscopy techniques for characterizing nanomaterials. The review covers the following areas: in-situ microscopy for studying dynamic shape transformation of nanocrystals; in-situ nanoscale property measurements on the mechanical, electrical and field emission properties of nanotubes/nanowires; environmental microscopy for direct observation of surface reactions; aberration-free angstrom-resolution imaging of light elements (such as oxygen and lithium); high-angle annular-dark-field scanning transmission electron microscopy (STEM); imaging of atom clusters with atomic resolution chemical information; electron holography of magnetic materials; and high-spatial resolution electron energy-loss spectroscopy (EELS) for nanoscale electronic and chemical analysis. It is demonstrated that the picometer-scale science provided by HRTEM is the foundation of nanometer-scale technology. (Abstract Copyright [2003], Wiley Periodicals, Inc.)

  20. High-energy electron diffraction and microscopy

    CERN Document Server

    Peng, L M; Whelan, M J

    2011-01-01

    This book provides a comprehensive introduction to high energy electron diffraction and elastic and inelastic scattering of high energy electrons, with particular emphasis on applications to modern electron microscopy. Starting from a survey of fundamental phenomena, the authors introduce the most important concepts underlying modern understanding of high energy electron diffraction. Dynamical diffraction in transmission (THEED) and reflection (RHEED) geometries is treated using ageneral matrix theory, where computer programs and worked examples are provided to illustrate the concepts and to f

  1. Visualizing aquatic bacteria by light and transmission electron microscopy.

    Science.gov (United States)

    Silva, Thiago P; Noyma, Natália P; Duque, Thabata L A; Gamalier, Juliana P; Vidal, Luciana O; Lobão, Lúcia M; Chiarini-Garcia, Hélio; Roland, Fábio; Melo, Rossana C N

    2014-01-01

    The understanding of the functional role of aquatic bacteria in microbial food webs is largely dependent on methods applied to the direct visualization and enumeration of these organisms. While the ultrastructure of aquatic bacteria is still poorly known, routine observation of aquatic bacteria by light microscopy requires staining with fluorochromes, followed by filtration and direct counting on filter surfaces. Here, we used a new strategy to visualize and enumerate aquatic bacteria by light microscopy. By spinning water samples from varied tropical ecosystems in a cytocentrifuge, we found that bacteria firmly adhere to regular slides, can be stained by fluorochoromes with no background formation and fast enumerated. Significant correlations were found between the cytocentrifugation and filter-based methods. Moreover, preparations through cytocentrifugation were more adequate for bacterial viability evaluation than filter-based preparations. Transmission electron microscopic analyses revealed a morphological diversity of bacteria with different internal and external structures, such as large variation in the cell envelope and capsule thickness, and presence or not of thylakoid membranes. Our results demonstrate that aquatic bacteria represent an ultrastructurally diverse population and open avenues for easy handling/quantification and better visualization of bacteria by light microscopy without the need of filter membranes.

  2. Free electron lasers for transmission of energy in space

    Science.gov (United States)

    Segall, S. B.; Hiddleston, H. R.; Catella, G. C.

    1981-01-01

    A one-dimensional resonant-particle model of a free electron laser (FEL) is used to calculate laser gain and conversion efficiency of electron energy to photon energy. The optical beam profile for a resonant optical cavity is included in the model as an axial variation of laser intensity. The electron beam profile is matched to the optical beam profile and modeled as an axial variation of current density. Effective energy spread due to beam emittance is included. Accelerators appropriate for a space-based FEL oscillator are reviewed. Constraints on the concentric optical resonator and on systems required for space operation are described. An example is given of a space-based FEL that would produce 1.7 MW of average output power at 0.5 micrometer wavelength with over 50% conversion efficiency of electrical energy to laser energy. It would utilize a 10 m-long amplifier centered in a 200 m-long optical cavity. A 3-amp, 65 meV electrostatic accelerator would provide the electron beam and recover the beam after it passes through the amplifier. Three to five shuttle flights would be needed to place the laser in orbit.

  3. Power electronics for renewable energy systems

    DEFF Research Database (Denmark)

    Iov, Florin; Blaabjerg, Frede

    2009-01-01

    sources from the conventional, fossil (and short term) based energy sources to renewable energy resources. Another is to use high efficient power electronics in power generation, power transmission/distribution and end-user application. This paper discuss some of the most emerging renewable energy sources......, wind energy and photovoltaics, which by means of power electronics are changing from being minor energy sources to be acting as important power sources in the energy system....

  4. Fabrication of nanostructured transmissive optical devices on ITO-glass with UV1116 photoresist using high-energy electron beam lithography

    Science.gov (United States)

    Williams, Calum; Bartholomew, Richard; Rughoobur, Girish; Gordon, George S. D.; Flewitt, Andrew J.; Wilkinson, Timothy D.

    2016-12-01

    High-energy electron beam lithography for patterning nanostructures on insulating substrates can be challenging. For high resolution, conventional resists require large exposure doses and for reasonable throughput, using typical beam currents leads to charge dissipation problems. Here, we use UV1116 photoresist (Dow Chemical Company), designed for photolithographic technologies, with a relatively low area dose at a standard operating current (80 kV, 40-50 μC cm-2, 1 nAs-1) to pattern over large areas on commercially coated ITO-glass cover slips. The minimum linewidth fabricated was ˜33 nm with 80 nm spacing; for isolated structures, ˜45 nm structural width with 50 nm separation. Due to the low beam dose, and nA current, throughput is high. This work highlights the use of UV1116 photoresist as an alternative to conventional e-beam resists on insulating substrates. To evaluate suitability, we fabricate a range of transmissive optical devices, that could find application for customized wire-grid polarisers and spectral filters for imaging, which operate based on the excitation of surface plasmon polaritons in nanosized geometries, with arrays encompassing areas ˜0.25 cm2.

  5. Multiphoton electronic-spin generation and transmission spectroscopy in n-type GaAs

    Energy Technology Data Exchange (ETDEWEB)

    Idrish Miah, M., E-mail: m.miah@griffith.edu.a [Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)

    2011-01-17

    Multiphoton electronic-spin generation in semiconductors was investigated using differential transmission spectroscopy. The generation of the electronic spins in the semiconductor samples were achieved by multiphoton pumping with circularly polarized light beam and was probed by the spin-resolved transmission of the samples. The electronic spin-polarization of conduction band was estimated and was found to depend on the delay of the probe beam, temperature as well as on the multiphoton pumping energy. The temperature dependence showed a decrease of the spin-polarization with increasing temperature. The electronic spin-polarization was found to depolarize rapidly for multiphoton pumping energy larger than the energy gap of the split-off band to the conduction band. The results were compared with those obtained in one-photon pumping, which shows that an enhancement of the electronic spin-polarization was achieved in multiphoton pumping. The findings resulting from this investigation might have potential applications in opto-spintronics, where the generation of highly polarized electronic spins is required.

  6. Multiphoton electronic-spin generation and transmission spectroscopy in n-type GaAs

    International Nuclear Information System (INIS)

    Idrish Miah, M.

    2011-01-01

    Multiphoton electronic-spin generation in semiconductors was investigated using differential transmission spectroscopy. The generation of the electronic spins in the semiconductor samples were achieved by multiphoton pumping with circularly polarized light beam and was probed by the spin-resolved transmission of the samples. The electronic spin-polarization of conduction band was estimated and was found to depend on the delay of the probe beam, temperature as well as on the multiphoton pumping energy. The temperature dependence showed a decrease of the spin-polarization with increasing temperature. The electronic spin-polarization was found to depolarize rapidly for multiphoton pumping energy larger than the energy gap of the split-off band to the conduction band. The results were compared with those obtained in one-photon pumping, which shows that an enhancement of the electronic spin-polarization was achieved in multiphoton pumping. The findings resulting from this investigation might have potential applications in opto-spintronics, where the generation of highly polarized electronic spins is required.

  7. Imaging spin filter for electrons based on specular reflection from iridium (001)

    Energy Technology Data Exchange (ETDEWEB)

    Kutnyakhov, D.; Lushchyk, P. [Johannes Gutenberg-Universität, Institut für Physik, 55099 Mainz (Germany); Fognini, A.; Perriard, D. [Laboratorium für Festkörperphysik, ETH Zürich, 8093 Zürich (Switzerland); Kolbe, M.; Medjanik, K.; Fedchenko, E.; Nepijko, S.A.; Elmers, H.J. [Johannes Gutenberg-Universität, Institut für Physik, 55099 Mainz (Germany); Salvatella, G.; Stieger, C.; Gort, R.; Bähler, T.; Michlmayer, T.; Acremann, Y.; Vaterlaus, A. [Laboratorium für Festkörperphysik, ETH Zürich, 8093 Zürich (Switzerland); Giebels, F.; Gollisch, H.; Feder, R. [Universität Duisburg-Essen, Theoretische Festkörperphysik, 47057 Duisburg (Germany); Tusche, C. [Max Planck-Institut für Mikrostrukturphysik, 06120 Halle (Germany); and others

    2013-07-15

    As Stern–Gerlach type spin filters do not work with electrons, spin analysis of electron beams is accomplished by spin-dependent scattering processes based on spin–orbit or exchange interaction. Existing polarimeters are single-channel devices characterized by an inherently low figure of merit (FoM) of typically 10{sup −4}–10{sup −3}. This single-channel approach is not compatible with parallel imaging microscopes and also not with modern electron spectrometers that acquire a certain energy and angular interval simultaneously. We present a novel type of polarimeter that can transport a full image by making use of k-parallel conservation in low-energy electron diffraction. We studied specular reflection from Ir (001) because this spin-filter crystal provides a high analyzing power combined with a “lifetime” in UHV of a full day. One good working point is centered at 39 eV scattering energy with a broad maximum of 5 eV usable width. A second one at about 10 eV shows a narrower profile but much higher FoM. A relativistic layer-KKR SPLEED calculation shows good agreement with measurements. - Highlights: • Novel type of spin polarimeter can transport a full image by making use of k{sup →}{sub ||} conservation in LEED. • When combined with a hemispherical analyzer, it acquires a certain energy and angular interval simultaneously. • Ir (001) based spin-filter provides a high analyzing power combined with a “lifetime” in UHV of a full day. • Parallel spin detection improves spin polarimeter efficiency by orders of magnitude. • A relativistic layer-KKR SPLEED calculation shows good agreement with measurements.

  8. Experimental and simulational study of the operation conditions for a high transmission mass filter

    International Nuclear Information System (INIS)

    Ayesh, A. I.; Lassesson, A.; Brown, S. A.; Dunbar, A. D. F.; Kaufmann, M.; Partridge, J. G.; Reichel, R.; Lith, J. van

    2007-01-01

    The operation conditions of a double pulsed field mass filter were studied using both experiment and simulation. The mass filter consists of two pairs of parallel plates and operates on the time-of-flight principle. The study showed that the ions' beam deflection angle is a critical factor in optimizing the mass filter transmission efficiency. This angle is dependent on the accelerating voltage, ion mass, and horizontal velocity of the ions. The optimum operating conditions for the mass filter were found and used to study the mass distribution of palladium ions produced by a magnetron sputtering source. The study shows that this mass filter is suitable for technological applications because of its high transmission and wide mass range

  9. Transmission of broad W/Rh and W/Al (target/filter) x-ray beams operated at 25-49 kVp through common shielding materials.

    Science.gov (United States)

    Li, Xinhua; Zhang, Da; Liu, Bob

    2012-07-01

    To provide transmission data for broad 25-39 kVp (kilovolt peak) W/Rh and 25-49 kVp W/Al (target/filter, W-tungsten, Rh-rhodium, and Al-aluminum) x-ray beams through common shielding materials, such as lead, concrete, gypsum wallboard, wood, steel, and plate glass. The unfiltered W-target x-ray spectra measured on a Selenia Dimensions system (Hologic Inc., Bedford, MA) set at 20-49 kVp were, respectively, filtered using 50-μm Rh and 700-μm Al, and were subsequently used for Monte Carlo calculations. The transmission of broad x-ray beams through shielding materials was simulated using Geant4 low energy electromagnetic physics package with photon- and electron-processes above 250 eV, including photoelectric effect, Compton scattering, and Rayleigh scattering. The calculated transmission data were fitted using Archer equation with a robust fitting algorithm. The transmission of broad x-ray beams through the above-mentioned shielding materials was calculated down to about 10(-5) for 25-39 kVp W/Rh and 25-49 kVp W/Al. The fitted results of α, β, and γ in Archer equation were provided. The α values of kVp ≥ 40 were approximately consistent with those of NCRP Report No. 147. These data provide inputs for the shielding designs of x-ray imaging facilities with W-anode x-ray beams, such as from Selenia Dimensions.

  10. Microwave energy transmission

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, Hiroshi [Kyoto Univ. (Japan)

    1989-03-05

    Laying stress on the technological problems and effect on the environment of microwave energy transmission, recent scientific and engineering problems and related subjects are described. Because no fuel is required for the solar power generation, the power generation system can not be considered as an expensive one when the unit cost of energy is taken into consideration. Some of the important technological problems in the microwave energy transmission are accurate microwave beam control technology to receiving stations and improvement in the efficiency of transmission system. Microwave energy beam has effects on living bodies, communication, and plasma atmosphere of the earth. Microwave energy transmission using a space flyer unit is scheduled. Its objective is the development of microwave wireless transmission technology and the study of the correlation between high power microwave and ionosphere plasma. Experiments on such a small scale application as a microwave driven space ship to bring results seem also important. 12 refs., 13 figs.

  11. Neutron Transmission of Single-crystal Sapphire Filters

    Science.gov (United States)

    Adib, M.; Kilany, M.; Habib, N.; Fathallah, M.

    2005-05-01

    An additive formula is given that permits the calculation of the nuclear capture, thermal diffuse and Bragg scattering cross-sections as a function of sapphire temperature and crystal parameters. We have developed a computer program that allows calculations of the thermal neutron transmission for the sapphire rhombohedral structure and its equivalent trigonal structure. The calculated total cross-section values and effective attenuation coefficient for single-crystalline sapphire at different temperatures are compared with measured values. Overall agreement is indicated between the formula and experimental data. We discuss the use of sapphire single crystal as a thermal neutron filter in terms of the optimum cystal thickness, mosaic spread, temperature, cutting plane and tuning for efficient transmission of thermal-reactor neutrons.

  12. Oxidation mechanism of nickel particles studied in an environmental transmission electron microscope

    DEFF Research Database (Denmark)

    Jeangros, Q.; Hansen, Thomas Willum; Wagner, Jakob Birkedal

    2014-01-01

    The oxidation of nickel particles was studied in situ in an environmental transmission electron microscope in 3.2 mbar of O2 between ambient temperature and 600°C. Several different transmission electron microscopy imaging techniques, electron diffraction and electron energy-loss spectroscopy were...... diffusion of Ni2+ along NiO grain boundaries, self-diffusion of Ni2+ ions and vacancies, growth of NiO grains and nucleation of voids at Ni/NiO interfaces. We also observed the formation of transverse cracks in a growing NiO film in situ in the electron microscope....

  13. Broadband transmission masks, gratings and filters for extreme ultraviolet and soft X-ray lithography

    International Nuclear Information System (INIS)

    Brose, S.; Danylyuk, S.; Juschkin, L.; Dittberner, C.; Bergmann, K.; Moers, J.; Panaitov, G.; Trellenkamp, St.; Loosen, P.; Grützmacher, D.

    2012-01-01

    Lithography and patterning on a nanometre scale with extreme ultraviolet (EUV) and soft X-ray radiation allow creation of high resolution, high density patterns independent of a substrate type. To realize the full potential of this method, especially for EUV proximity printing and interference lithography, a reliable technology for manufacturing of the transmission masks and gratings should be available. In this paper we present a development of broadband amplitude transmission masks and gratings for extreme ultraviolet and soft X-ray lithography based on free-standing niobium membranes. In comparison with a standard silicon nitride based technology the transmission masks demonstrate high contrast not only for in-band EUV (13.5 nm) radiation but also for wavelengths below Si L-absorption edge (12.4 nm). The masks and filters with free standing areas up to 1000 × 1000 μm 2 and 100 nm to 300 nm membrane thicknesses are shown. Electron beam structuring of an absorber layer with dense line and dot patterns with sub-50 nm structures is demonstrated. Diffractive and filtering properties of obtained structures are examined with EUV radiation from a gas discharge plasma source. - Highlights: ► Broadband transmission masks for EUV proximity and interference lithography. ► Technology for free standing niobium membranes with areas up to 1 mm 2 . ► High density patterns with periods of 100 nm and structure sizes below 40 nm. ► Measured diffraction efficiency at 11 nm is in agreement with the theory. ► Produced masks can be effectively used with wavelengths between 6 nm and 17 nm.

  14. Design and construction of electronic filters

    International Nuclear Information System (INIS)

    Becerril Z, E.R.; Moreno P, C.; Salinas B, E.

    1979-01-01

    The design and construction of very low frequencies electronic filters which will be used for carrying out analysis of pile noise at Mexico's Nuclear Center Triga Mark III Reactor, in order to realize measurements of its parameters is presented. NIM norms and active filters with lineal integrated circuits were used: a. Band pass filter from 10 to 500 hertz, band width 50. b. Low pass filter from 0.001 to 10 hertz in 3 steps. c. Kalman Bucy filter, an analogical simulation of this filter was undertaken, obtained from a mathematical model of a Zero power experimental reactor, with the purpose to establish a control searching. (author)

  15. Ultrathin metal-semiconductor-metal resonator for angle invariant visible band transmission filters

    International Nuclear Information System (INIS)

    Lee, Kyu-Tae; Seo, Sungyong; Yong Lee, Jae; Jay Guo, L.

    2014-01-01

    We present transmission visible wavelength filters based on strong interference behaviors in an ultrathin semiconductor material between two metal layers. The proposed devices were fabricated on 2 cm × 2 cm glass substrate, and the transmission characteristics show good agreement with the design. Due to a significantly reduced light propagation phase change associated with the ultrathin semiconductor layer and the compensation in phase shift of light reflecting from the metal surface, the filters show an angle insensitive performance up to ±70°, thus, addressing one of the key challenges facing the previously reported photonic and plasmonic color filters. This principle, described in this paper, can have potential for diverse applications ranging from color display devices to the image sensors.

  16. Measurement of suprathermal electron confinement by cyclotron transmission

    International Nuclear Information System (INIS)

    Kirkwood, R.; Hutchinson, I.H.; Luckhardt, S.C.; Porkolab, M.; Squire, J.P.

    1990-01-01

    The confinement time of suprathermal electrons is determined experimentally from the distribution function determined via wave transmission measurements. Measurements of the lowest moment of the distribution perpendicular to the B field as a function of the parallel electron momentum as well as the global input power allow the suprathermal electron confinement time (τ se ) to be calculated during lower-hybrid and inductive current drive. Finite particle confinement is found to be the dominant energy loss term for the suprathermals and improves with plasma current and density

  17. Development of spin-polarized transmission electron microscope

    International Nuclear Information System (INIS)

    Kuwahara, M; Saitoh, K; Tanaka, N; Takeda, Y; Ujihara, T; Asano, H; Nakanishi, T

    2011-01-01

    In order to study spin related phenomena in nano-size materials, spin-polarized electron source (PES) has been employed for the incident beam in transmission electron microscope (TEM). The PES has been designed and constructed with optimizing for spin-polarized TEM. The illuminating system of TEM is also designed to focus the spin-polarized electron beam emitted from a semiconductor photocathode with a negative electron affinity (NEA) surface. The beam energy is set to below 40 keV which is lower energy type as a TEM, because the spin interaction with condensed matters is very small corresponding with a Coulomb interaction. The polarized electron gun has realized in an extra high vacuum (XHV) condition and high field gradient of 4 MV/m on a surface of photocathode. Furthermore, it demonstrated that 40-keV polarized electron beam was operated with a sub-milli second pulse mode by using the backside excitation type photocathode. This high performance PES will make it possible to observe dynamically a magnetic field images with high contrast and highspeed temporal imaging in TEM.

  18. Instruments for radiation measurement in biosciences. Series 3. radioluminography. 11. Application of imaging plate in transmission electron microscopy

    International Nuclear Information System (INIS)

    Oikawa, Tetsuo

    1999-01-01

    Properties and application of the imaging plate (IP) in transmission electron microscopy (TEM) are reviewed. TEM has the resolution level of around 0.2 nm, which enables direct observation of molecules and atoms. In TEM, there are such recording systems as photographic film, TV camera, slow-scan CCD camera and IP. IP, to the electron beam, has the higher sensitivity than the film and has the broad dynamic range. Linearity between the input beam intensity and output signal is good, which makes it possible to record the image even with the small electron dose. Signal/noise ratio and detective quantum efficiency are important factors for precise image analysis. Fading phenomenon is a defect of IP, which weakens the signal output as time passing. For instance of application, IP is used for imaging of AgBr crystal fragile to strong electron beam required for the film. IP is necessary for quantitative analysis of TEM images and for the recently developed energy-filter TEM. (K.H.)

  19. Neutron transmission of single-crystal sapphire filters

    International Nuclear Information System (INIS)

    Adib, M.; Kilany, M.; Habib, N.; Fathallah, M.

    2005-01-01

    An additive formula is given that permits the calculation of the nuclear capture, thermal diffuse and Bragg scattering cross-sections as a function of sapphire temperature and crystal parameters. We have developed a computer program that allows calculations of the thermal neutron transmission for the sapphire rhombohedral structure and its equivalent trigonal structure. The calculated total cross-section values and effective attenuation coefficient for single-crystalline sapphire at different temperatures are compared with measured values. Overall agreement is indicated between the formula fits and experimental data. We discuss the use of sapphire single crystal as a thermal neutron filter in terms of the optimum crystal thickness, mosaic spread, temperature, cutting plane and tuning for efficient transmission of thermal-reactor neutrons. (author)

  20. Neutron transmission of single-crystal sapphire filters

    International Nuclear Information System (INIS)

    Adib, M.; Kilany, M.; Habib, N.; Fathallah, M.

    2004-01-01

    A simple additive formula is given that permits the calculation of the nuclear capture, thermal diffuse and Bragg scattering cross-sections as a function of sapphire temperature and crystal parameters. We have developed a computer program that allows calculations of the thermal neutron transmission for the sapphire rhombohedral structure and its equivalent trigonal structure. The calculated total cross-section values and effective attenuation coefficient for mono-crystalline sapphire at different temperatures are compared with measured values. Overall agreement is indicated between the formula fits and experimental data. We discuss the use of sapphire single-crystal as a thermal neutron filter in terms of the optimum crystal thickness, mosaic spread, temperature, cutting plane and tuning for efficient transmission of thermal-reactor neutrons

  1. Aberration-corrected scanning transmission electron microscopy of semiconductors

    International Nuclear Information System (INIS)

    Krivanek, O L; Dellby, N; Murfitt, M F

    2011-01-01

    The scanning transmission electron microscope (STEM) has been able to image individual heavy atoms in a light matrix for some time. It is now able to do much more: it can resolve individual atoms as light as boron in monolayer materials; image atomic columns as light as hydrogen, identify the chemical type of individual isolated atoms from the intensity of their annular dark field (ADF) image and by electron energy loss spectroscopy (EELS); and map elemental composition at atomic resolution by EELS and energy-dispersive X-ray spectroscopy (EDXS). It can even map electronic states, also by EELS, at atomic resolution. The instrumentation developments that have made this level of performance possible are reviewed, and examples of applications to semiconductors and oxides are shown.

  2. Automated electronic filter design

    CERN Document Server

    Banerjee, Amal

    2017-01-01

    This book describes a novel, efficient and powerful scheme for designing and evaluating the performance characteristics of any electronic filter designed with predefined specifications. The author explains techniques that enable readers to eliminate complicated manual, and thus error-prone and time-consuming, steps of traditional design techniques. The presentation includes demonstration of efficient automation, using an ANSI C language program, which accepts any filter design specification (e.g. Chebyschev low-pass filter, cut-off frequency, pass-band ripple etc.) as input and generates as output a SPICE(Simulation Program with Integrated Circuit Emphasis) format netlist. Readers then can use this netlist to run simulations with any version of the popular SPICE simulator, increasing accuracy of the final results, without violating any of the key principles of the traditional design scheme.

  3. Advantages of a monochromated transmission electron microscope for solid state physics

    International Nuclear Information System (INIS)

    Grogger, W.; Kothleitner, G.; Hofer, F.

    2006-01-01

    Full text: The characterization of nanostructured devices and functional materials at a nanometer scale is paramount for the understanding of their physical and chemical properties. Transmission electron microscopy (TEM) plays a central role, especially in terms of structural and chemical analysis on a nearly atomic scale. In particular, electron energy-loss spectrometry (EELS) can obtain information not only about the chemical composition of a thin sample, but also about chemical bonding and electronic structure (ionization edge fine structures) and optical properties (through valence loss EELS). Recent instrumental advances like monochromators for the electron gun in the TEM have made it possible to reduce the energy resolution to 0.15 eV at an acceleration voltage of 200 kV. Another strong point of the method lies in the combination with a fine electron probe (0.2 nm) which allows to record EELS spectra with high energy resolution and spatial resolution in the range of 1 nm. The improved energy resolution opens new possibilities for studying detailed electronic structure and bonding effects in solids such as transmission metal oxides. The experimental results will be compared with x-ray absorption spectroscopy and band structure calculations. A better energy-resolution is particularly important for measurements in the low loss region of the EELS spectrum which provides the information about the band gap and the dielectric function. We will highlight the potential of the method for studying metallic nanoparticles and semiconducting devices. Additionally, the influence of the intrinsic effects like core-hole and excited lifetime broadening and delocalization of the inelastically scattered electrons will be discussed. (author)

  4. High resolution Transmission Electron Microscopy characterization of a milled oxide dispersion strengthened steel powder

    Energy Technology Data Exchange (ETDEWEB)

    Loyer-Prost, M., E-mail: marie.loyer-prost@cea.fr [DEN-Service de Recherches de Métallurgie Physique, CEA, Université Paris-Saclay, F-91191, Gif-sur-Yvette (France); Merot, J.-S. [Laboratoire d’Etudes des Microstructures – UMR 104, CNRS/ONERA, BP72-29, Avenue de la Division Leclerc, 92 322, Châtillon (France); Ribis, J. [DEN-Service de Recherches de Métallurgie Appliquée, CEA, Université Paris-Saclay, F-91191, Gif-sur-Yvette (France); Le Bouar, Y. [Laboratoire d’Etudes des Microstructures – UMR 104, CNRS/ONERA, BP72-29, Avenue de la Division Leclerc, 92 322, Châtillon (France); Chaffron, L. [DEN-Service de Recherches de Métallurgie Appliquée, CEA, Université Paris-Saclay, F-91191, Gif-sur-Yvette (France); Legendre, F. [DEN-Service de la Corrosion et du Comportement des Matériaux dans leur Environnement, CEA, Université Paris-Saclay, F-91191, Gif-sur-Yvette (France)

    2016-10-15

    Oxide Dispersion Strengthened (ODS) steels are promising materials for generation IV fuel claddings as their dense nano-oxide dispersion provides good creep and irradiation resistance. Even if they have been studied for years, the formation mechanism of these nano-oxides is still unclear. Here we report for the first time a High Resolution Transmission Electron Microscopy and Energy Filtered Transmission Electron Microscopy characterization of an ODS milled powder. It provides clear evidence of the presence of small crystalline nanoclusters (NCs) enriched in titanium directly after milling. Small NCs (<5 nm) have a crystalline structure and seem partly coherent with the matrix. They have an interplanar spacing close to the (011) {sub bcc} iron structure. They coexist with larger crystalline spherical precipitates of 15–20 nm in size. Their crystalline structure may be metastable as they are not consistent with any Y-Ti-O or Ti-O structure. Such detailed observations in the as-milled grain powder confirm a mechanism of Y, Ti, O dissolution in the ferritic matrix followed by a NC precipitation during the mechanical alloying process of ODS materials. - Highlights: • We observed an ODS ball-milled powder by high resolution transmission microscopy. • The ODS ball-milled powder exhibits a lamellar microstructure. • Small crystalline nanoclusters were detected in the milled ODS powder. • The nanoclusters in the ODS milled powder are enriched in titanium. • Larger NCs of 15–20 nm in size are, at least, partly coherent with the matrix.

  5. Transmission Line Series Compensation for Wind Energy Transmission

    International Nuclear Information System (INIS)

    Palanichamy, C; Wong, Y C

    2015-01-01

    Wind energy has demonstrated to be a clean, copious and absolutely renewable source of energy, and the large penetration of it into the power grid indicates that wind energy is considered an effective means of power generation, Transmission of wind energy from remote locations to load centers necessitates long transmission lines. Series compensation is a proven and economical transmission solution to address system power transfer strength, grid stability, and voltage profile issues of long transmission lines. In this paper, a programmable approach to determine the capacitive reactance of series capacitor and optimum location for its placement to achieve maximum power transfer gas been presented. The respective program with sample solutions has been provided for real-time applications. (paper)

  6. Multistage linear electron acceleration using pulsed transmission lines

    International Nuclear Information System (INIS)

    Miller, R.B.; Prestwich, K.R.; Poukey, J.W.; Epstein, B.G.; Freeman, J.R.; Sharpe, A.W.; Tucker, W.K.; Shope, S.L.

    1981-01-01

    A four-stage linear electron accelerator is described which uses pulsed radial transmission lines as the basic accelerating units. An annular electron beam produced by a foilless diode is guided through the accelerator by a strong axial magnetic field. Synchronous firing of the injector and the acccelerating modules is accomplished with self-breaking oil switches. The device has accelerated beam currents of 25 kA to kinetic energies of 9 MV, with 90% current transport efficiency. The average accelerating gradient is 3 MV/m

  7. A filter technique for optimising the photon energy response of a silicon pin diode dosemeter

    International Nuclear Information System (INIS)

    Olsher, R.H.; Eisen, Y.

    1996-01-01

    Unless they are energy compensated, silicon PIN diodes used in electronic pocket dosemeters, have significant over-response below 200 keV. Siemens is using three diodes in parallel with individual filters to produce excellent energy and angular response. An algorithm based on the photon spectrum of a single diode could be used to flatten the energy response. The commercial practice is to use a single diode with a simple filter to flatten the energy response, despite the mediocre low energy photon. The filter technique with an opening has been used for energy compensating GM detectors and proportional counters and a new variation of it has been investigated which compensates the energy response of a silicon PIN diode and maintains an extended low energy response. It uses a composite filter of two or more materials with several openings whose individual area is in the range of 15% to 25% of the diode's active area. One opening is centred over the diode's active area and others are located at the periphery of the active area to preserve a good polar response to ±45 o . Monte Carlo radiation transport methods were used to simulate the coupled electron-photon transport through a Hamamatsu S2506-01 diode and to determine the energy response of the diode for a variety of filters. In current mode, the resultant dosemeter energy response relative to air dose was within -15% and +30% for 0 o incidence over the energy range from 15 keV to 1 MeV. In pulse mode, the resultant dosemeter energy response was within -25% and +50% for 0 o incidence over the energy range from 30 keV to 10 MeV. For ±45 o incidence, the energy response was within -25% and +40% from 40 keV to 10 MeV. Theoretical viability of the filter technique has been shown in this work (Author)

  8. Communication: Investigation of the electron momentum density distribution of nanodiamonds by electron energy-loss spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Zhenbao; Yang, Bing; Lin, Yangming; Su, Dangsheng, E-mail: dssu@imr.ac.cn [Shenyang National Laboratory of Materials Science, Institute of Metal Research, Chinese Academy of Sciences, Wenhua Road 72, Shenyang 110016 (China)

    2015-12-07

    The electron momentum distribution of detonation nanodiamonds (DND) was investigated by recording electron energy-loss spectra at large momentum transfer in the transmission electron microscope (TEM), which is known as electron Compton scattering from solid (ECOSS). Compton profile of diamond film obtained by ECOSS was found in good agreement with prior photon experimental measurement and theoretical calculation that for bulk diamond. Compared to the diamond film, the valence Compton profile of DND was found to be narrower, which indicates a more delocalization of the ground-state charge density for the latter. Combining with other TEM characterizations such as high-resolution transmission electron spectroscopy, diffraction, and energy dispersive X-ray spectroscopy measurements, ECOSS was shown to be a great potential technique to study ground-state electronic properties of nanomaterials.

  9. Reconstruction and visualization of nanoparticle composites by transmission electron tomography

    Energy Technology Data Exchange (ETDEWEB)

    Wang, X.Y. [National Institute for Nanotechnology, 11421 Saskatchewan Drive, Edmonton, Canada T6H 2M9 (Canada); Department of Physics, University of Alberta, Edmonton, Canada T6G 2G7 (Canada); Lockwood, R. [National Institute for Nanotechnology, 11421 Saskatchewan Drive, Edmonton, Canada T6H 2M9 (Canada); Malac, M., E-mail: marek.malac@nrc-cnrc.gc.ca [National Institute for Nanotechnology, 11421 Saskatchewan Drive, Edmonton, Canada T6H 2M9 (Canada); Department of Physics, University of Alberta, Edmonton, Canada T6G 2G7 (Canada); Furukawa, H. [SYSTEM IN FRONTIER INC., 2-8-3, Shinsuzuharu bldg. 4F, Akebono-cho, Tachikawa-shi, Tokyo 190-0012 (Japan); Li, P.; Meldrum, A. [National Institute for Nanotechnology, 11421 Saskatchewan Drive, Edmonton, Canada T6H 2M9 (Canada)

    2012-02-15

    This paper examines the limits of transmission electron tomography reconstruction methods for a nanocomposite object composed of many closely packed nanoparticles. Two commonly used reconstruction methods in TEM tomography were examined and compared, and the sources of various artefacts were explored. Common visualization methods were investigated, and the resulting 'interpretation artefacts' ( i.e., deviations from 'actual' particle sizes and shapes arising from the visualization) were determined. Setting a known or estimated nanoparticle volume fraction as a criterion for thresholding does not in fact give a good visualization. Unexpected effects associated with common built-in image filtering methods were also found. Ultimately, this work set out to establish the common problems and pitfalls associated with electron beam tomographic reconstruction and visualization of samples consisting of closely spaced nanoparticles. -- Highlights: Black-Right-Pointing-Pointer Electron tomography limits were explored by both experiment and simulation. Black-Right-Pointing-Pointer Reliable quantitative volumetry using electron tomography is not presently feasible. Black-Right-Pointing-Pointer Volume rendering appears to be better choice for visualization of composite samples.

  10. Energy and angular distribution of electrons after transmission of thick layers

    International Nuclear Information System (INIS)

    Kreyling, H.

    1975-01-01

    In this work, the behaviour of electrons going through material-layers is studied. For a layer-thickness where the theories of multiple-scattering are no longer valid, a Monte-Carlo-method is presented for the calculation of energy distributions as a function of scattering-angle. Plastic-scintillator-material (NE 102 A produced by Nuclear Enterprises Ltd.) was bombarded by electrons with energies between 0.5 and 2.0 MeV and the energy-distributions of the electrons, scatterd in the layer, were measured as a function of the scattering-angle. With the aid of the Monte-Carlo-method developed in this paper, energy distributions were calculated as a function of scattering-angle for the two absorber materials aluminium (single-element material) and NE 102 A (chemical compound of C, N, H, O). (orig./WL) [de

  11. Electron microscopy of nanostructured semiconductor materials

    International Nuclear Information System (INIS)

    Neumann, Wolfgang

    2003-01-01

    For various material systems of low dimensions, including multilayers, islands, and quantum dots, the potential applicability of transmission electron microscopy (TEM) is demonstrated. Conventional TEM is applied to elucidate size, shape, and arrangement of nanostructures, whereas high-resolution imaging is used for visualizing their atomic structure. In addition, microchemical peculiarities of the nanoscopic objects are investigated by analytical TEM techniques (energy-filtered TEM, energy-dispersive X-ray spectroscopy)

  12. Quantitative investigation of precipitate growth during ageing of Al-(Mg,Si) alloys by energy-filtered electron diffraction

    DEFF Research Database (Denmark)

    Wollgarten, M.; Chang, C. S. T.; Duchstein, Linus Daniel Leonhard

    2011-01-01

    Besides other application fields, light-weight Al-(Mg, Si) (6XXX series) alloys are of substantial importance in automotive industries where they are used for the production of car body panels. The material gains its strength by precipitation of metastable Mg-Si-based phases. Though the general...... accepted that the early stages of precipitate growth are important for the understanding of this peculiar behaviour. During these stages, electron diffraction patterns of Al-(Mg, Si) alloys show diffuse features (Figure 1 (a) and (b)) which can be traced back to originate from β'' Mg5Si6 precipitates [5......-7]. In this paper, we use energy-filtered electron diffraction to determine dimensions of the β'' Mg5Si6 precipitates along their a, b and c-axes as a function of ageing time and alloy composition. In our contribution, we first derive that there is an optimal zone axis - - from the view point of practicability. We...

  13. Pair distribution functions of carbonaceous solids, determined using energy filtered diffraction

    International Nuclear Information System (INIS)

    Petersen, T.C.; McCulloch, D.G.

    2002-01-01

    Full text: The structures of various carbonaceous solids were investigated using energy filtered diffraction patterns collected in two dimensions using a Gatan Imaging Filter (GIF). In order to reduce multiple scattering and eliminate inelastic scattering effects, the diffraction patterns were filtered using an energy -selecting slit around the zero-loss peak. Software has been developed for the extraction of radially averaged pair distributions functions from the diffraction data. This entails finding the position of the un-scattered beam, radially averaging the two dimensional intensity distributions, calibrating the resulting one dimensional intensity profiles and finally normalising the data to obtain structure factors. Techniques for improving and assessing data quality, pertaining to the methodology used here, have also been explored. Structure factors and radial distribution functions generated using this analysis will be discussed and, for the commercial V25 glassy carbon samples, compared to previous, work of one of the authors'. In order to answer questions regarding multiple scattering effects and structural homogeneity of the samples, neutron scattering was performed on the Medium Resolution Powder Diffractometer (MRPD), at the Australian Nuclear Science and Technology's (ANSTO) facility. A critical comparison of the neutron scattering and electron diffraction generated structure factors will be presented. Copyright (2002) Australian Society for Electron Microscopy Inc

  14. Characterization of a quadrant diamond transmission X-ray detector including a precise determination of the mean electron-hole pair creation energy.

    Science.gov (United States)

    Keister, Jeffrey W; Cibik, Levent; Schreiber, Swenja; Krumrey, Michael

    2018-03-01

    Precise monitoring of the incoming photon flux is crucial for many experiments using synchrotron radiation. For photon energies above a few keV, thin semiconductor photodiodes can be operated in transmission for this purpose. Diamond is a particularly attractive material as a result of its low absorption. The responsivity of a state-of-the art diamond quadrant transmission detector has been determined, with relative uncertainties below 1% by direct calibration against an electrical substitution radiometer. From these data and the measured transmittance, the thickness of the involved layers as well as the mean electron-hole pair creation energy were determined, the latter with an unprecedented relative uncertainty of 1%. The linearity and X-ray scattering properties of the device are also described.

  15. Sensitivity of self-powered detector probes to electron and gamma-ray fields

    International Nuclear Information System (INIS)

    Lone, M.A.; Wong, P.Y.

    1995-01-01

    A self-powered detector (SPD) is a simple, passive device that consists of a coaxial probe with a metallic outer sleeve, a mineral oxide insulating layer, and a metallic inner core. SPD's are used in nuclear reactors to monitor neutron and gamma fields. Responses of SPD's to electrons and γ-rays of various energies were investigated with Monte Carlo simulations. Transmission filters were studied for the design of threshold SPD probes used for online monitoring of the energy spectrum of high-power industrial electron accelerator beams. Filters were also investigated for the enhancement of γ-ray sensitivity of an SPD placed in a mixed electron and γ-ray field. (author). 30 refs., 1 tab., 8 figs

  16. Sensitivity of self-powered detector probes to electron and gamma-ray fields

    Energy Technology Data Exchange (ETDEWEB)

    Lone, M A; Wong, P Y [Atomic Energy of Canada Ltd., Chalk River, ON (Canada)

    1996-12-31

    A self-powered detector (SPD) is a simple, passive device that consists of a coaxial probe with a metallic outer sleeve, a mineral oxide insulating layer, and a metallic inner core. SPD`s are used in nuclear reactors to monitor neutron and gamma fields. Responses of SPD`s to electrons and {gamma}-rays of various energies were investigated with Monte Carlo simulations. Transmission filters were studied for the design of threshold SPD probes used for online monitoring of the energy spectrum of high-power industrial electron accelerator beams. Filters were also investigated for the enhancement of {gamma}-ray sensitivity of an SPD placed in a mixed electron and {gamma}-ray field. (author). 30 refs., 1 tab., 8 figs.

  17. Nanostructured PLD-grown gadolinia doped ceria: Chemical and structural characterization by transmission electron microscopy techniques

    DEFF Research Database (Denmark)

    Rodrigo, Katarzyna Agnieszka; Wang, Hsiang-Jen; Heiroth, Sebastian

    2011-01-01

    The morphology as well as the spatially resolved elemental and chemical characterization of 10 mol% gadolinia doped ceria (CGO10) structures prepared by pulsed laser deposition (PLD) technique are investigated by scanning transmission electron microscopy accompanied with electron energy loss spec......, indicate apparent variation of the ceria valence state across and along the film. No element segregation to the grain boundaries is detected. These results are discussed in the context of solid oxide fuel cell applications.......The morphology as well as the spatially resolved elemental and chemical characterization of 10 mol% gadolinia doped ceria (CGO10) structures prepared by pulsed laser deposition (PLD) technique are investigated by scanning transmission electron microscopy accompanied with electron energy loss...... spectroscopy and energy dispersive X-ray spectroscopy. A dense, columnar and structurally inhomogeneous CGO10 film, i.e. exhibiting grain size refinement across the film thickness, is obtained in the deposition process. The cerium M4,5 edges, used to monitor the local electronic structure of the grains...

  18. The Astro-E/XRS Blocking Filter Calibration

    Science.gov (United States)

    Audley, Michael D.; Arnaud, Keith A.; Gendreau, Keith C.; Boyce, Kevin R.; Fleetwood, Charles M.; Kelley, Richard L.; Keski-Kuha, Ritva A.; Porter, F. Scott; Stahle, Caroline K.; Szymkowiak, Andrew E.

    1999-01-01

    We describe the transmission calibration of the Astro-E XRS blocking filters. The XRS instrument has five aluminized polyimide blocking filters. These filters are located at thermal stages ranging from 200 K to 60 mK. They are each about 1000 A thick. XRS will have high energy resolution which will enable it to see some of the extended fine structure around the oxygen and aluminum K edges of these filters. Thus, we are conducting a high spectral resolution calibration of the filters near these energies to resolve out extended flue structure and absorption lines.

  19. A perfect spin filtering device through Mach-Zehnder interferometry in a GaAs/AlGaAs electron gas

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, Alexander; Medina, Ernesto [Centro de Fisica, Instituto Venezolano de Investigaciones CientIficas, Apartado 21874, Caracas 1020-A (Venezuela, Bolivarian Republic of); BolIvar, Nelson [Departamento de Fisica, Universidad Central de Venezuela, Caracas (Venezuela, Bolivarian Republic of); Berche, Bertrand [Statistical Physics Group, P2M, Institut Jean Lamour, Nancy Universite, BP70239, F-54506 Vandoeuvre les Nancy (France)

    2010-03-24

    A spin filtering device based on quantum spin interference is addressed, for use with a two-dimensional GaAs/AlGaAs electron gas that has both Rashba and Dresselhaus spin-orbit (SO) couplings and an applied external magnetic field. We propose an experimentally feasible electronic Mach-Zehnder interferometer and derive a map, in parameter space, that determines perfect spin filtering conditions. We find two broad spin filtering regimes: one where filtering is achieved in the original incoming quantization basis, that takes advantage of the purely non-Abelian nature of the spin rotations; and another where one needs a tilted preferential axis in order to observe the polarized output spinor. Both solutions apply for arbitrary incoming electron polarization and energy, and are only limited in output amplitude by the randomness of the incoming spinor state. Including a full account of the beam splitter and mirror effects on spin yields solutions only for the tilted basis, but encompasses a broad range of filtering conditions.

  20. A perfect spin filtering device through Mach-Zehnder interferometry in a GaAs/AlGaAs electron gas

    International Nuclear Information System (INIS)

    Lopez, Alexander; Medina, Ernesto; BolIvar, Nelson; Berche, Bertrand

    2010-01-01

    A spin filtering device based on quantum spin interference is addressed, for use with a two-dimensional GaAs/AlGaAs electron gas that has both Rashba and Dresselhaus spin-orbit (SO) couplings and an applied external magnetic field. We propose an experimentally feasible electronic Mach-Zehnder interferometer and derive a map, in parameter space, that determines perfect spin filtering conditions. We find two broad spin filtering regimes: one where filtering is achieved in the original incoming quantization basis, that takes advantage of the purely non-Abelian nature of the spin rotations; and another where one needs a tilted preferential axis in order to observe the polarized output spinor. Both solutions apply for arbitrary incoming electron polarization and energy, and are only limited in output amplitude by the randomness of the incoming spinor state. Including a full account of the beam splitter and mirror effects on spin yields solutions only for the tilted basis, but encompasses a broad range of filtering conditions.

  1. A perfect spin filtering device through Mach-Zehnder interferometry in a GaAs/AlGaAs electron gas

    Science.gov (United States)

    López, Alexander; Medina, Ernesto; Bolívar, Nelson; Berche, Bertrand

    2010-03-01

    A spin filtering device based on quantum spin interference is addressed, for use with a two-dimensional GaAs/AlGaAs electron gas that has both Rashba and Dresselhaus spin-orbit (SO) couplings and an applied external magnetic field. We propose an experimentally feasible electronic Mach-Zehnder interferometer and derive a map, in parameter space, that determines perfect spin filtering conditions. We find two broad spin filtering regimes: one where filtering is achieved in the original incoming quantization basis, that takes advantage of the purely non-Abelian nature of the spin rotations; and another where one needs a tilted preferential axis in order to observe the polarized output spinor. Both solutions apply for arbitrary incoming electron polarization and energy, and are only limited in output amplitude by the randomness of the incoming spinor state. Including a full account of the beam splitter and mirror effects on spin yields solutions only for the tilted basis, but encompasses a broad range of filtering conditions.

  2. Calibration of a two-color soft x-ray diagnostic for electron temperature measurement

    Energy Technology Data Exchange (ETDEWEB)

    Reusch, L. M., E-mail: lmmcguire@wisc.edu; Den Hartog, D. J.; Goetz, J.; McGarry, M. B. [University of Wisconsin - Madison, Madison, Wisconsin 53703 (United States); Franz, P. [Consorzio RFX, Padova (Italy); Stephens, H. D. [University of Wisconsin - Madison, Madison, Wisconsin 53703 (United States); Pierce College Fort Steilacoom, Lakewood, Washington 98498 (United States)

    2016-11-15

    The two-color soft x-ray (SXR) tomography diagnostic on the Madison Symmetric Torus is capable of making electron temperature measurements via the double-filter technique; however, there has been a 15% systematic discrepancy between the SXR double-filter (SXR{sub DF}) temperature and Thomson scattering (TS) temperature. Here we discuss calibration of the Be filters used in the SXR{sub DF} measurement using empirical measurements of the transmission function versus energy at the BESSY II electron storage ring, electron microprobe analysis of filter contaminants, and measurement of the effective density. The calibration does not account for the TS and SXR{sub DF} discrepancy, and evidence from experiments indicates that this discrepancy is due to physics missing from the SXR{sub DF} analysis rather than instrumentation effects.

  3. Fifty years old, and still going strong: Transmission electron optical studies of materials

    International Nuclear Information System (INIS)

    Brown, L.M.

    2008-01-01

    Highlights in the history of transmission electron microscopy and scanning transmission electron microscopy include the introduction of diffraction contrast, resolution of periodic lattices by phase contrast and incoherent imaging via the high-angle annular dark-field detector. Convergent-beam electron diffraction and analytical electron microscopy, especially the application of energy-dispersive X-ray and electron energy-loss spectrometry, have provided structural and chemical information in addition to strain contrast from lattice defects. From the outset, novel specimen stages and improvements to aid the operator enhanced the electron-optical engineering provided by the instrument makers. The spatial resolution achieved was mainly determined by the way the instrument was used, and not by the basic resolution limit set by the electron optics. However, the application of computer controlled correction of spherical (and higher order) aberration has resulted in a new generation of instruments capable of sub-Angstrom point-to-point resolution. This improved performance, combined with electron energy-loss spectrometry, promises genuine three-dimensional determination of atomic and electronic structure: an indispensable weapon in the battle to fabricate and control useful nanostructures. The uncertainty principle now fundamentally restricts some of the observations one can make, but much more technical development over the next decades must occur before one can say that the techniques of electron-optical imaging of material structure have reached their fundamental limitations. One can expect remarkable progress over the next few years

  4. Transmission of high-power electron beams through small apertures

    International Nuclear Information System (INIS)

    Tschalär, C.; Alarcon, R.; Balascuta, S.; Benson, S.V.; Bertozzi, W.; Boyce, J.R.; Cowan, R.; Douglas, D.; Evtushenko, P.; Fisher, P.; Ihloff, E.; Kalantarians, N.; Kelleher, A.; Legg, R.; Milner, R.G.; Neil, G.R.; Ou, L.; Schmookler, B.; Tennant, C.; Williams, G.P.

    2013-01-01

    Tests were performed to pass a 100 MeV, 430 kWatt c.w. electron beam from the energy-recovery linac at the Jefferson Laboratory's FEL facility through a set of small apertures in a 127 mm long aluminum block. Beam transmission losses of 3 p.p.m. through a 2 mm diameter aperture were maintained during a 7 h continuous run

  5. Transmission electron microscopy study of ion energy deposition in gold: evidence for a spike threshold

    International Nuclear Information System (INIS)

    Ruault, M.O.; Bernas, H.; Chaumont, J.

    1978-01-01

    Nine different atomic species, from K to Yb, were implanted into gold at energies ranging from 20 to 150 keV. The nature and depth-distribution of the resultant defect clusters were studied by transmission electron microscopy techniques as well as a modification of the '2 1/2-D' stereo technique developed by Mitchell and Bell. The effect of implanted ion dose and sample purity were determined. The cluster depth distributions are in overall agreement with the damage distributions deduced from the energy deposition calculations of Winterbon, Sigmund, and Sanders. The nature of the defect clusters is found to depend on the mass and energy of the incoming ion, in agreement with our previously reported work. These results are suggested to provide evidence for the decisive influence of the deposited energy density on the nature of visible damage. We conclude that it is possible to distinguish between cascade and 'spike' effects, the latter setting in when the average energy per atom in the cascade is approximately 2 eV/atom. All results (obtained -at low doses on pure samples- for a variety of ion species in Au, Al, Cu, W, Mo and Ni) may be related to each other in this way

  6. Transmission electron microscopy of carbon-coated and iron-doped titania nanoparticles

    KAUST Repository

    Anjum, Dalaver H.

    2016-08-02

    We present a study on the properties of iron (Fe)-doped and carbon (C)-coated titania (TiO2) nanoparticles (NPs) which has been compiled by using x-ray diffraction (XRD), transmission electron microscopy (TEM), and x-ray photoelectron spectroscopy (XPS). These TiO2 NPs were prepared by using the flame synthesis method. This method allows the simultaneous C coating and Fe doping of TiO2 NPs. XRD investigations revealed that the phase of the prepared NPs was anatase TiO2. Conventional TEM analysis showed that the average size of the TiO2 NPs was about 65 nm and that the NPs were uniformly coated with the element C. Furthermore, from the x-ray energy dispersive spectrometry analysis, it was found that about 8 at.% Fe was present in the synthesized samples. High-resolution TEM (HRTEM) revealed the graphitized carbon structure of the layer surrounding the prepared TiO2 NPs. HRTEM analysis further revealed that the NPs possessed the crystalline structure of anatase titania. Energy-filtered TEM (EFTEM) analysis showed the C coating and Fe doping of the NPs. The ratio of L3 and L2 peaks for the Ti-L23 and Fe-L23 edges present in the core loss electron energy loss spectroscopy (EELS) revealed a +4 oxidation state for the Ti and a +3 oxidation state for the Fe. These EELS results were further confirmed with XPS analysis. The electronic properties of the samples were investigated by applying Kramers-Kronig analysis to the low-loss EELS spectra acquired from the prepared NPs. The presented results showed that the band gap energy of the TiO2 NPs decreased from an original value of 3.2 eV to about 2.2 eV, which is quite close to the ideal band gap energy of 1.65 eV for photocatalysis semiconductors. The observed decrease in band gap energy of the TiO2 NPs was attributed to the presence of Fe atoms at the lattice sites of the anatase TiO2 lattice. In short, C-coated and Fe-doped TiO2 NPs were synthesized with a rather cost-effective and comparatively easily scalable method. The

  7. The calibration of spectrometers for Auger electron and X-ray photoelectron spectrometers part II - the determination of the electron spectrometer transmission function and the detector sensitivity energy dependencies

    International Nuclear Information System (INIS)

    Smith, G.C.; Seah, M.P.

    1991-01-01

    For the use of published general or theoretical sensitivity factors in quantitative AES and XPS the energy dependence of both the spectrometer transmission function and the detector sensitivity must be known. Here we develop simple procedures which allow these dependencies to be determined experimentally. Detailed measurements for a modified VG Scientific ESCALAB II, the metrology spectrometer, operated in both the constant ΔE/E and constant ΔE modes, are presented and compared with theoretical estimates. It is shown that an exceptionally detailed electron-optical calculation, involving proprietary information, would be required to match the accuracy of the experimental procedures developed. Removal of the spectrometer transmission function and the detector sensitivity terms allows the measured spectrum to be converted to the true electron emission spectrum irrespective of the mode of operation. This provides the first step to the provision of reference samples to calibrate the transmission functions and detector sensitivities of all instruments so that they, in turn, may produce true electron emission spectra. This is vital if (i) all instruments are to give consistent results, (ii) theoretical terms are to be used in quantifying either AES or XPS and (iii) reference data banks are to be established for AES or XPS

  8. Electron beam selectively seals porous metal filters

    Science.gov (United States)

    Snyder, J. A.; Tulisiak, G.

    1968-01-01

    Electron beam welding selectively seals the outer surfaces of porous metal filters and impedances used in fluid flow systems. The outer surface can be sealed by melting a thin outer layer of the porous material with an electron beam so that the melted material fills all surface pores.

  9. Power Electronics Control of Wind Energy in Distributed Power System

    DEFF Research Database (Denmark)

    Iov, Florin; Ciobotaru, Mihai; Blaabjerg, Frede

    2008-01-01

    is to change the electrical power production sources from the conventional, fossil (and short term) based energy sources to renewable energy resources. The other is to use high efficient power electronics in power generation, power transmission/distribution and end-user application. This paper discuss the most...... emerging renewable energy sources, wind energy, which by means of power electronics are changing from being a minor energy source to be acting as an important power source in the energy system. Power electronics is the enabling technology and the presentation will cover the development in wind turbine...... technology from kW to MW, discuss which power electronic solutions are most feasible and used today....

  10. Technical note: optimization for improved tube-loading efficiency in the dual-energy computed tomography coupled with balanced filter method.

    Science.gov (United States)

    Saito, Masatoshi

    2010-08-01

    This article describes the spectral optimization of dual-energy computed tomography using balanced filters (bf-DECT) to reduce the tube loadings and dose by dedicating to the acquisition of electron density information, which is essential for treatment planning in radiotherapy. For the spectral optimization of bf-DECT, the author calculated the beam-hardening error and air kerma required to achieve a desired noise level in an electron density image of a 50-cm-diameter cylindrical water phantom. The calculation enables the selection of beam parameters such as tube voltage, balanced filter material, and its thickness. The optimal combination of tube voltages was 80 kV/140 kV in conjunction with Tb/Hf and Bi/Mo filter pairs; this combination agrees with that obtained in a previous study [M. Saito, "Spectral optimization for measuring electron density by the dual-energy computed tomography coupled with balanced filter method," Med. Phys. 36, 3631-3642 (2009)], although the thicknesses of the filters that yielded a minimum tube output were slightly different from those obtained in the previous study. The resultant tube loading of a low-energy scan of the present bf-DECT significantly decreased from 57.5 to 4.5 times that of a high-energy scan for conventional DECT. Furthermore, the air kerma of bf-DECT could be reduced to less than that of conventional DECT, while obtaining the same figure of merit for the measurement of electron density and effective atomic number. The tube-loading and dose efficiencies of bf-DECT were considerably improved by sacrificing the quality of the noise level in the images of effective atomic number.

  11. New electronic filtering technique in digital subtraction angiography

    Energy Technology Data Exchange (ETDEWEB)

    Stacul, F; Pozzi-Mucelli, R; Predonzan, F; Magnaldi, S; Godina, G

    1986-01-01

    The authors report their experience with a new electronic filtering technique in digital subtraction angiography (DSA). The principles of the technique are reported and the advantages in comparison with conventional filters are stressed (accurate and fast placement without fluoroscopic exposure). The system provided excellent results in about 900 DSA examinations.

  12. Electron transmission through a periodically driven graphene magnetic barrier

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, R., E-mail: rbiswas.pkc@gmail.com [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Maiti, S. [Ajodhya Hills G.S.A.T High School, Ajodhya, Purulia, West Bengal – 723152 (India); Mukhopadhyay, S. [Purulia Zilla School, Dulmi Nadiha, Purulia, West Bengal – 723102 (India); Sinha, C. [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Department of Theoretical Physics, Indian Association for the Cultivation of Science, Jadavpur – 700032 (India)

    2017-05-10

    Electronic transport through graphene magnetic barriers is studied theoretically in presence of an external time harmonic scalar potential in the framework of non-perturbative Landau–Floquet Formalism. The oscillating field mostly suppresses the transmission for rectangular magnetic barrier structure and exhibits the Fano resonance for multiphoton processes due to the presence of bound state inside the barrier. While, for a pair of delta function barriers of larger separation, the oscillating potential suppresses the usual Fabry–Perot oscillations in the transmission and a new type of asymmetric Fano resonance is noted for smaller separation, occurring due to extended states between the barriers. - Highlights: • Tunnelling of the Dirac Fermions through oscillating pure magnetic barriers is reported for the first time. • The high energy transmission through a graphene magnetic barrier is suppressed by the application of time periodic modulation. • Suppression of the Fabry Perot transmission is noted due to the application of an external time harmonic potential. • Two kinds of the Fano resonances are noted in transmission through a pair of modulated δ-function magnetic barriers.

  13. Trends in Power Electronics and Control of Renewable Energy Systems

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Iov, Florin; Kerekes, Tamas

    2010-01-01

    term) based energy sources to renewable energy sources. Another is to use high efficient power electronics in power generation, power transmission/distribution and end-user application. This paper discuss trends of the most emerging renewable energy sources, wind energy and photovoltaics, which...... by means of power electronics are changing the future electrical infrastructure but also contributes steadily more to non-carbon based electricity production. Most focus is on the power electronics technologies used. In the case of photovoltaics transformer-less systems are discussed as they have...

  14. First experimental proof for aberration correction in XPEEM: Resolution, transmission enhancement, and limitation by space charge effects

    International Nuclear Information System (INIS)

    Schmidt, Th.; Sala, A.; Marchetto, H.; Umbach, E.; Freund, H.-J.

    2013-01-01

    The positive effect of double aberration correction in x-ray induced Photoelectron Emission Microscopy (XPEEM) has been successfully demonstrated for both, the lateral resolution and the transmission, using the Au 4f XPS peak for element specific imaging at a kinetic energy of 113 eV. The lateral resolution is improved by a factor of four, compared to a non-corrected system, whereas the transmission is enhanced by a factor of 5 at a moderate resolution of 80 nm. With an optimized system setting, a lateral resolution of 18 nm could be achieved, which is up to now the best value reported for energy filtered XPEEM imaging. However, the absolute resolution does not yet reach the theoretical limit of 2 nm, which is due to space charge limitation. This occurs along the entire optical axis up to the contrast aperture. In XPEEM the pulsed time structure of the exciting soft x-ray light source causes a short and highly intense electron pulse, which results in an image blurring. In contrast, the imaging with elastically reflected electrons in the low energy electron microscopy (LEEM) mode yields a resolution clearly below 5 nm. Technical solutions to reduce the space charge effect in an aberration-corrected spectro-microscope are discussed. - Highlights: ► First successful double aberration correction in XPEEM. ► Improvement of resolution and transmission by aberration correction. ► Lateral resolution of 18 nm in energy filtered XPEEM is the best up to now reported value. ► First investigation of space charge effects in aberrations corrected PEEM

  15. Tailoring of electron flow current in magnetically insulated transmission lines

    Directory of Open Access Journals (Sweden)

    J. P. Martin

    2009-03-01

    Full Text Available It is desirable to optimize (minimizing both the inductance and electron flow the magnetically insulated vacuum sections of low impedance pulsed-power drivers. The goal of low inductance is understandable from basic efficiency arguments. The goal of low electron flow results from two observations: (1 flowing electrons generally do not deliver energy to (or even reach most loads, and thus constitute a loss mechanism; (2 energetic electrons deposited in a small area can cause anode damage and anode plasma formation. Low inductance and low electron flow are competing goals; an optimized system requires a balance of the two. While magnetically insulated systems are generally forgiving, there are times when optimization is crucial. For example, in large pulsed-power drivers used to energize high energy density physics loads, the electron flow as a fraction of total current is small, but that flow often reaches the anode in relatively small regions. If the anode temperature becomes high enough to desorb gas, the resulting plasma initiates a gap closure process that can impact system performance. Magnetic-pressure driven (z pinches and material equation of state loads behave like a fixed inductor for much of the drive pulse. It is clear that neither fixed gap nor constant-impedance transmission lines are optimal for driving inductive loads. This work shows a technique for developing the optimal impedance profile for the magnetically insulated section of a high-current driver. Particle-in-cell calculations are used to validate the impedance profiles developed in a radial disk magnetically insulated transmission line geometry. The input parameters are the spacing and location of the minimum gap, the effective load inductance, and the desired electron flow profile. The radial electron flow profiles from these simulations are in good agreement with theoretical predictions when driven at relatively high voltage (i.e., V≥2  MV.

  16. Contrast of HOLZ lines in energy-filtered convergent-beam electron diffraction patterns from silicon

    International Nuclear Information System (INIS)

    Lehmpfuhl, G.; Krahl, D.; Uchida, Y.

    1995-01-01

    Higher-order Laue-zone (HOLZ) lines were investigated in convergent-beam electron diffraction patterns from silicon near the low-indexed zone axes [100], [110] and [111]. The visibility of these lines depends on the effective structure potentials of the reflections from the first Laue zone depending on their Debye-Waller factor. The contrast of the HOLZ lines is strongly reduced by inelastically scattered electrons. They can be excluded by an imaging Ω filter for energy losses above 2 eV. The diffraction patterns were compared with many-beam calculations. Without absorption, an excellent agreement could be achieved for the [111] and [100] zone axes, while the simulation of the [110] zone-axis pattern needed a calculation with absorption. The reason for this observation is explained in the Bloch-wave picture. Calculations with absorption, however, lead to artefacts in the intensity distribution of the [100] HOLZ pattern. In order to obtain agreement with the experiment, the Debye-Waller factor had to be modified in different ways for the different zone axes. This corresponds to a strong anisotropy of the Debye-Waller factor. To confirm this observation, the temperature dependence of the itensity distributions of the HOLZ patterns was investigated between 50 and 680 K. At room temperature, the parameter D in the Debye-Waller factor exp(-Ds 2 ) was determined as 0.13, 0.26 and 0.55 A 2 for the zone axes [100], [111] and [110], respectively. The reliability of the conclusions is discussed. (orig.)

  17. Microstructural differences between two Zr(C,N) coatings revealed by analytical transmission electron microscopy

    International Nuclear Information System (INIS)

    Dörfel, Ilona; Rooch, Heidemarie; Österle, Werner

    2012-01-01

    The microstructures of two samples of a Zr(C,N) coating on steel, which unexpectedly differed in their tribological properties, were investigated by analytical transmission electron microscopy. The samples were produced by a cathodic arc evaporation process in two commercial coating devices under similar coating conditions with the exception of the number of Zr targets. The source of the differing tribological properties of the samples was detected by analytical transmission electron microscopy (TEM) methods energy-dispersive X-ray spectroscopy (EDX), energy filtering TEM (EFTEM), electron diffraction, high resolution electron microscopy, and high angel annular dark field. The TEM preparation and the results of the TEM investigations are shown in detail. The origin of the unexpected behavior was determined to be a nano-scale multilayer structure that existed only in the tribologically superior specimen. EDX and EFTEM investigations indicated enrichment in oxygen at the interface between coating and steel substrate in the tribologically inferior sample. Findings of the microstructural configuration were obtained by taking a closer look at the structure and comparing the results of the several analytical TEM techniques. This allows the allocation of the concentration fluctuations in N, C, and Zr to the two thickness fractions of the nano multilayers and a local correlation of the identified minority phase Zr 3 (C,N) 4 to the higher N content in the narrower type of the multilayer fraction of the sample with the excellent tribological properties. The minority phase Zr 3 (C,N) 4 is randomly distributed in the sample with the defective tribological properties. Coating conditions are not topic of this work, but after discussion of the TEM results, the fact that one of the coating devices worked with one Zr target and the other one with two, could be identified as cause for the formation of the nano multilayer structure in the sample with the superior tribological

  18. Atmospheric Transmission Measurements Using IR Lasers, Fourier Transform Spectroscopy, and Gas-Filter Correlation Techniques

    National Research Council Canada - National Science Library

    Dowling, J

    1977-01-01

    ... and a gas filter correlation spectrometer. Results obtained from three concurrent experiments used to generate a data base appropriate to high resolution transmission model validation are displayed...

  19. Characterization of nanomaterials with transmission electron microscopy

    KAUST Repository

    Anjum, Dalaver H.

    2016-08-01

    The field of nanotechnology is about research and development on materials whose at least one dimension is in the range of 1 to 100 nanometers. In recent years, the research activity for developing nano-materials has grown exponentially owing to the fact that they offer better solutions to the challenges faced by various fields such as energy, food, and environment. In this paper, the importance of transmission electron microscopy (TEM) based techniques is demonstrated for investigating the properties of nano-materials. Specifically the nano-materials that are investigated in this report include gold nano-particles (Au-NPs), silver atom-clusters (Ag-ACs), tantalum single-atoms (Ta-SAs), carbon materials functionalized with iron cobalt (Fe-Co) NPs and titania (TiO2) NPs, and platinum loaded Ceria (Pt-CeO2) Nano composite. TEM techniques that are employed to investigate nano-materials include aberration corrected bright-field TEM (BF-TEM), high-angle dark-field scanning TEM (HAADF-STEM), electron energy-loss spectroscopy (EELS), and BF-TEM electron tomography (ET). With the help presented of results in this report, it is proved herein that as many TEM techniques as available in a given instrument are essential for a comprehensive nano-scale analysis of nanomaterials.

  20. Frame Filtering and Skipping for Point Cloud Data Video Transmission

    Directory of Open Access Journals (Sweden)

    Carlos Moreno

    2017-01-01

    Full Text Available Sensors for collecting 3D spatial data from the real world are becoming more important. They are a prime research area topic and have applications in consumer markets, such as medical, entertainment, and robotics. However, a primary concern with collecting this data is the vast amount of information being generated, and thus, needing to be processed before being transmitted. To address the issue, we propose the use of filtering methods and frame skipping. To collect the 3D spatial data, called point clouds, we used the Microsoft Kinect sensor. In addition, we utilized the Point Cloud Library to process and filter the data being generated by the Kinect. Two different computers were used: a client which collects, filters, and transmits the point clouds; and a server that receives and visualizes the point clouds. The client is also checking for similarity in consecutive frames, skipping those that reach a similarity threshold. In order to compare the filtering methods and test the effectiveness of the frame skipping technique, quality of service (QoS metrics such as frame rate and percentage of filter were introduced. These metrics indicate how well a certain combination of filtering method and frame skipping accomplishes the goal of transmitting point clouds from one location to another. We found that the pass through filter in conjunction with frame skipping provides the best relative QoS. However, results also show that there is still too much data for a satisfactory QoS. For a real-time system to provide reasonable end-to-end quality, dynamic compression and progressive transmission need to be utilized.

  1. Angle-resolved electron energy loss spectroscopy in hexagonal boron nitride

    Science.gov (United States)

    Fossard, Frédéric; Sponza, Lorenzo; Schué, Léonard; Attaccalite, Claudio; Ducastelle, François; Barjon, Julien; Loiseau, Annick

    2017-09-01

    Electron energy loss spectra were measured on hexagonal boron nitride single crystals employing an electron energy loss spectroscopic setup composed of an electron microscope equipped with a monochromator and an in-column filter. This setup provides high-quality energy-loss spectra and allows also for the imaging of energy-filtered diffraction patterns. These two acquisition modes provide complementary pieces of information, offering a global view of excitations in reciprocal space. As an example of the capabilities of the method we show how easily the core loss spectra at the K edges of boron and nitrogen can be measured and imaged. Low losses associated with interband and/or plasmon excitations are also measured. This energy range allows us to illustrate that our method provides results whose quality is comparable to that obtained from nonresonant x-ray inelastic scattering but with advantageous specificities such as an enhanced sensitivity at low q and a much greater simplicity and versatility that make it well adapted to the study of two-dimensional materials and related heterostructures. Finally, by comparing theoretical calculations to our measures, we are able to relate the range of applicability of ab initio calculations to the anisotropy of the sample and assess the level of approximation required for a proper simulation of our acquisition method.

  2. Digital Filter Performance for the ATLAS Level-1 Calorimeter Trigger

    CERN Document Server

    Hadley, D R; The ATLAS collaboration

    2010-01-01

    The ATLAS Level-1 Calorimeter Trigger is a hardware-based system designed to identify high-pT jets, electron/photon and tau candidates, and to measure total and missing ET in the ATLAS Liquid Argon and Tile calorimeters. It is a pipelined processor system, with a new set of inputs being evaluated every 25ns. The overall trigger decision has a latency budget of 2µs, including all transmission delays. The calorimeter trigger uses about 7200 reduced granularity analogue signals, which are first digitized at the 40 MHz LHC bunch-crossing frequency, before being passed to a digital Finite Impulse Response (FIR) filter. Due to latency and chip real-estate constraints, only a simple 5-element filter with limited precision can be used. Nevertheless this filter achieves a significant reduction in noise, along with improving the bunch-crossing assignment and energy resolution for small signals. The context in which digital filters are used for the ATLAS Level-1 Calorimeter Trigger will be presented, before describing ...

  3. Enhancement of thermoelectric properties by energy filtering: Theoretical potential and experimental reality in nanostructured ZnSb

    Energy Technology Data Exchange (ETDEWEB)

    Berland, Kristian [Centre for Materials Science and Nanotechnology (SMN), University of Oslo, P.O.B. 1126 Blindern, NO-0318 Oslo (Norway); Song, Xin [Department of Physics, University of Oslo, P.O.B. 1048 Blindern, NO-0316 Oslo (Norway); Carvalho, Patricia A. [SINTEF Materials and Chemistry, Forskningsveien 1, NO-0314 Oslo (Norway); Persson, Clas; Finstad, Terje G. [Centre for Materials Science and Nanotechnology (SMN), University of Oslo, P.O.B. 1126 Blindern, NO-0318 Oslo (Norway); Department of Physics, University of Oslo, P.O.B. 1048 Blindern, NO-0316 Oslo (Norway); Løvvik, Ole Martin [Department of Physics, University of Oslo, P.O.B. 1048 Blindern, NO-0316 Oslo (Norway); SINTEF Materials and Chemistry, Forskningsveien 1, NO-0314 Oslo (Norway)

    2016-03-28

    Energy filtering has been suggested by many authors as a means to improve thermoelectric properties. The idea is to filter away low-energy charge carriers in order to increase Seebeck coefficient without compromising electronic conductivity. This concept was investigated in the present paper for a specific material (ZnSb) by a combination of first-principles atomic-scale calculations, Boltzmann transport theory, and experimental studies of the same system. The potential of filtering in this material was first quantified, and it was as an example found that the power factor could be enhanced by an order of magnitude when the filter barrier height was 0.5 eV. Measured values of the Hall carrier concentration in bulk ZnSb were then used to calibrate the transport calculations, and nanostructured ZnSb with average grain size around 70 nm was processed to achieve filtering as suggested previously in the literature. Various scattering mechanisms were employed in the transport calculations and compared with the measured transport properties in nanostructured ZnSb as a function of temperature. Reasonable correspondence between theory and experiment could be achieved when a combination of constant lifetime scattering and energy filtering with a 0.25 eV barrier was employed. However, the difference between bulk and nanostructured samples was not sufficient to justify the introduction of an energy filtering mechanism. The reasons for this and possibilities to achieve filtering were discussed in the paper.

  4. Comparison of cryogenic low-pass filters

    Science.gov (United States)

    Thalmann, M.; Pernau, H.-F.; Strunk, C.; Scheer, E.; Pietsch, T.

    2017-11-01

    Low-temperature electronic transport measurements with high energy resolution require both effective low-pass filtering of high-frequency input noise and an optimized thermalization of the electronic system of the experiment. In recent years, elaborate filter designs have been developed for cryogenic low-level measurements, driven by the growing interest in fundamental quantum-physical phenomena at energy scales corresponding to temperatures in the few millikelvin regime. However, a single filter concept is often insufficient to thermalize the electronic system to the cryogenic bath and eliminate spurious high frequency noise. Moreover, the available concepts often provide inadequate filtering to operate at temperatures below 10 mK, which are routinely available now in dilution cryogenic systems. Herein we provide a comprehensive analysis of commonly used filter types, introduce a novel compact filter type based on ferrite compounds optimized for the frequency range above 20 GHz, and develop an improved filtering scheme providing adaptable broad-band low-pass characteristic for cryogenic low-level and quantum measurement applications at temperatures down to few millikelvin.

  5. Comparison of cryogenic low-pass filters.

    Science.gov (United States)

    Thalmann, M; Pernau, H-F; Strunk, C; Scheer, E; Pietsch, T

    2017-11-01

    Low-temperature electronic transport measurements with high energy resolution require both effective low-pass filtering of high-frequency input noise and an optimized thermalization of the electronic system of the experiment. In recent years, elaborate filter designs have been developed for cryogenic low-level measurements, driven by the growing interest in fundamental quantum-physical phenomena at energy scales corresponding to temperatures in the few millikelvin regime. However, a single filter concept is often insufficient to thermalize the electronic system to the cryogenic bath and eliminate spurious high frequency noise. Moreover, the available concepts often provide inadequate filtering to operate at temperatures below 10 mK, which are routinely available now in dilution cryogenic systems. Herein we provide a comprehensive analysis of commonly used filter types, introduce a novel compact filter type based on ferrite compounds optimized for the frequency range above 20 GHz, and develop an improved filtering scheme providing adaptable broad-band low-pass characteristic for cryogenic low-level and quantum measurement applications at temperatures down to few millikelvin.

  6. Optimization of Beam Transmission of PAL-PNF Electron Linac

    Energy Technology Data Exchange (ETDEWEB)

    Shin, S. G.; Kim, S. K.; Kim, E. A. [Pohang University of Science and Technology, Pohang (Korea, Republic of)

    2012-05-15

    The PNF (Pohang Neutron Facility) electron Linac is providing converted neutrons and photons from electron beams to users for nuclear physics experiments and high energy gamma-ray exposures. This linac is capable of producing 100 MeV electron beams with a beam current of pulsed 100 mA. The pulse length is 2 {mu}s and the pulse repetition rate is typically 30 Hz. This linac consists of two SLAC-type S-band accelerating columns and the thermionic RF gun. They are powered by one klystron and the matching pulse modulator. The electron beams emitted from the RF gun are bunched as they pass through the alpha magnet and are injected into the accelerating column thereafter. In this paper, we discuss procedures and results of the beam transmission optimization with technical details of the accelerator system. We also briefly discuss the future upgrade plan to obtain short-pulse or electron beams for neutron TOF experiments by adopting a triode type thermionic DC electron gun

  7. Electronic transport through EuO spin-filter tunnel junctions

    KAUST Repository

    Jutong, Nuttachai; Eckern, Ulrich; Rungger, Ivan; Sanvito, Stefano; Schuster, Cosima; Schwingenschlö gl, Udo

    2012-01-01

    . For epitaxial EuO on Cu, a symmetry filtering is observed, with the Δ1 states dominating the transmission. This leads to a transport gap larger than the fundamental EuO band gap. Importantly, the high spin polarization of the current is preserved up to large

  8. Wireless energy transmission to supplement energy harvesters in sensor network applications

    Energy Technology Data Exchange (ETDEWEB)

    Farinholt, Kevin M [Los Alamos National Laboratory; Taylor, Stuart G [Los Alamos National Laboratory; Park, Gyuhae [Los Alamos National Laboratory; Farrar, Charles R [Los Alamos National Laboratory

    2010-01-01

    In this paper we present a method for coupling wireless energy transmission with traditional energy harvesting techniques in order to power sensor nodes for structural health monitoring applications. The goal of this study is to develop a system that can be permanently embedded within civil structures without the need for on-board power sources. Wireless energy transmission is included to supplement energy harvesting techniques that rely on ambient or environmental, energy sources. This approach combines several transducer types that harvest ambient energy with wireless transmission sources, providing a robust solution that does not rely on a single energy source. Experimental results from laboratory and field experiments are presented to address duty cycle limitations of conventional energy harvesting techniques, and the advantages gained by incorporating a wireless energy transmission subsystem. Methods of increasing the efficiency, energy storage medium, target applications and the integrated use of energy harvesting sources with wireless energy transmission will be discussed.

  9. Surface sterilization by low energy electron beams

    International Nuclear Information System (INIS)

    Sekiguchi, Masayuki; Tabei, Masae

    1989-01-01

    The germicidal effectiveness of low energy electron beams (175 KV) against bacterial cells was investigated. The dry spores of Bacillus pumilus ATCC 27142 and Bacillus globigii ATCC 9372 inoculated on carrier materials and irradiated by gamma rays showed the exponential type of survival curves whereas they showed sigmoidal ones when exposed to low energy electron beams. When similarly irradiated, the wet spores inoculated on membrane filter showed the same survival curves as the dry spores inoculated on carrier materials. The wet vegetative cells of Escherichia coli ATCC 25922 showed exponential curves when exposed to gamma and electron beam irradiation. Low energy electron beams in air showed little differences from nitrogen stream in their germicidal effectiveness against dry spores of B. pumilus. The D values of B. pumilus spores inoculated on metal plates decreased as the amounts of backscattering electrons from the plates increased. There was adequate correlation between the D value (linear region of survival curve), average D value (6D/6) and 1% survival dose and backscattering factor. Depth dose profile and backscatterig dose of low energy electron beams were measured by radiochromic dye film dosimeter (RCD). These figures were not always in accord with the observed germicidal effectiveness against B. pumilus spores because of varying thickness of RCD and spores inoculated on carrier material. The dry spores were very thin and this thinness was useful in evaluating the behavior of low energy electrons. (author)

  10. Design and fabrication of broadband rugate filter

    International Nuclear Information System (INIS)

    Zhang Jun-Chao; Fang Ming; Shao Yu-Chuan; Jin Yun-Xia; He Hong-Bo

    2012-01-01

    The design and the deposition of a rugate filter for broadband applications are discussed. The bandwidth is extended by increasing the rugate period continuously with depth. The width and the smoothness of the reflection band with the distribution of the periods are investigated. The improvement of the steepness of the stopband edges and the suppression of the side lobes in the transmission zone are realized by adding two apodized rugate structures with fixed periods at the external broadband rugate filter interfaces. The rapidly alternating deposition technology is used to fabricate a rugate filter sample. The measured transmission spectrum with a reflection bandwidth of approximately 505 nm is close to that of the designed broadband rugate filter except a transmittance peak in the stopband. Based on the analysis of the cross-sectional scanning electron microscopic image of the sample, it is found that the transmission peak is most likely to be caused by the instability of the deposition rate. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

  11. Magnetic collimation and metal foil filtering for electron range and fluence modulation

    International Nuclear Information System (INIS)

    Phaisangittisakul, N.; D'Souza, W.D.; Ma Lijun

    2004-01-01

    We investigated the use of magnetically collimated electron beams together with metal filters for electron fluence and range modulation. A longitudinal magnetic field collimation method was developed to reduce skin dose and to improve the electron beam penumbra. Thin metal foils were used to adjust the energies of magnetically collimated electrons. The effects for different types of foils such as Al, Be, Cu, Pb, and Ti were studied using Monte Carlo calculations. An empirical pencil beam dose calculation model was developed to calculate electron dose distributions under magnetic collimation and foil modulation. An optimization method was developed to produce conformal dose distributions for simulated targets such as a horseshoe-shaped target. Our results show that it is possible to produce an electron depth dose enhancement peak using similar techniques of producing a spread-out Bragg peak. In conclusion, our study demonstrates new aspects of using magnetic collimation and foil filtration for producing fluence and range modulated electron dose distributions

  12. Valley polarization due to trigonal warping on tunneling electrons in graphene

    International Nuclear Information System (INIS)

    Pereira Jr, J M; Peeters, F M; Costa Filho, R N; Farias, G A

    2009-01-01

    The effect of trigonal warping on the transmission of electrons tunneling through potential barriers in graphene is investigated. We present calculations of the transmission coefficient for single and double barriers as a function of energy, incidence angle and barrier heights. The results show remarkable valley-dependent directional effects for barriers oriented parallel to the armchair or parallel to the zigzag direction. These results indicate that electrostatic gates can be used as valley filters in graphene-based devices.

  13. A vector Wiener filter for dual-radionuclide imaging

    International Nuclear Information System (INIS)

    Links, J.M.; Prince, J.L.; Gupta, S.N.

    1996-01-01

    The routine use of a single radionuclide for patient imaging in nuclear medicine can be complemented by studies employing two tracers to examine two different processes in a single organ, most frequently by simultaneous imaging of both radionuclides in two different energy windows. In addition, simultaneous transmission/emission imaging with dual-radionuclides has been described, with one radionuclide used for the transmission study and a second for the emission study. There is thus currently considerable interest in dual-radionuclide imaging. A major problem with all dual-radionuclide imaging is the crosstalk between the two radionuclides. Such crosstalk frequently occurs, because scattered radiation from the higher energy radionuclide is detected in the lower energy window, and because the lower energy radionuclide may have higher energy emissions which are detected in the higher energy window. The authors have previously described the use of Fourier-based restoration filtering in single photon emission computed tomography (SPECT) and positron emission tomography (PET) to improve quantitative accuracy by designing a Wiener or other Fourier filter to partially restore the loss of contrast due to scatter and finite spatial resolution effects. The authors describe here the derivation and initial validation of an extension of such filtering for dual-radionuclide imaging that simultaneously (1) improves contrast in each radionuclide's direct image, (2) reduces image noise, and (3) reduces the crosstalk contribution from the other radionuclide. This filter is based on a vector version of the Wiener filter, which is shown to be superior [in the minimum mean square error (MMSE) sense] to the sequential application of separate crosstalk and restoration filters

  14. A new aberration-corrected, energy-filtered LEEM/PEEM instrument. I. Principles and design

    International Nuclear Information System (INIS)

    Tromp, R.M.; Hannon, J.B.; Ellis, A.W.; Wan, W.; Berghaus, A.; Schaff, O.

    2010-01-01

    We describe a new design for an aberration-corrected low energy electron microscope (LEEM) and photo electron emission microscope (PEEM), equipped with an in-line electron energy filter. The chromatic and spherical aberrations of the objective lens are corrected with an electrostatic electron mirror that provides independent control over the chromatic and spherical aberration coefficients C c and C 3 , as well as the mirror focal length, to match and correct the aberrations of the objective lens. For LEEM (PEEM) the theoretical resolution is calculated to be ∼1.5 nm (∼4 nm). Unlike previous designs, this instrument makes use of two magnetic prism arrays to guide the electron beam from the sample to the electron mirror, removing chromatic dispersion in front of the mirror by symmetry. The aberration correction optics was retrofitted to an uncorrected instrument with a base resolution of 4.1 nm in LEEM. Initial results in LEEM show an improvement in resolution to ∼2 nm.

  15. Front Surface Tandem Filters using Sapphire (Al2O3) Substrates for Spectral Control in thermophotovoltaic Energy Conversion Systems

    International Nuclear Information System (INIS)

    T Rahmlow, Jr.; J Lazo-Wasem; E Gratrix; P Fourspring; D DePoy

    2005-01-01

    Front surface filters provide an effective means of improving thermophotovoltaic (TPV) system efficiency through spectral control of incident radiant energy. A front surface filter reflects the below band gap photons that can not be converted by the TPV cell back towards the high temperature radiator and allows convertible above band gap photons to pass through the filter into the TPV cell for conversion to electricity. The best spectral control efficiency to date has been demonstrated by front surface, tandem filters that combine an interference filter and an InPAs layer (plasma filter) in series. The InPAs material is a highly doped, epitaxially grown layer on an InP substrate. These tandem filter designs have been fabricated with energy and angle weighted spectral efficiencies of 76% for TPV cells with a 2.08(micro)m (0.6eV) band gap [1]. An alternative to the InPAs layer on an InP substrate is an Al 2 O 3 (sapphire) substrate. The use of Al 2 O 3 may increase transmission of above band gap photons, increase the mechanical strength of the tandem filter, and lower the cost of the tandem filter, all at the expense of lower spectral efficiency. This study presents design and fabrication results for front surface tandem filters that use an Al 2 O 3 substrate for 2.08(micro)m band gap TPV cells

  16. Progress and new advances in simulating electron microscopy datasets using MULTEM

    Energy Technology Data Exchange (ETDEWEB)

    Lobato, I., E-mail: Ivan.Lobato@uantwerpen.be; Van Aert, S.; Verbeeck, J.

    2016-09-15

    A new version of the open source program MULTEM is presented here. It includes a graphical user interface, tapering truncation of the atomic potential, CPU multithreading functionality, single/double precision calculations, scanning transmission electron microscopy (STEM) simulations using experimental detector sensitivities, imaging STEM (ISTEM) simulations, energy filtered transmission electron microscopy (EFTEM) simulations, STEM electron energy loss spectroscopy (EELS) simulations along with other improvements in the algorithms. We also present a mixed channeling approach for the calculation of inelastic excitations, which allows one to considerably speed up time consuming EFTEM/STEM-EELS calculations. - Highlights: • We present a new version of the CPU/GPU open source program MULTEM. • A cross-platform graphical user interface is developed. • We include inelastic excitations for EFTEM/STEM-EELS calculations. • We add CPU multithreading functionality and single/double precision calculations.

  17. Progress and new advances in simulating electron microscopy datasets using MULTEM

    International Nuclear Information System (INIS)

    Lobato, I.; Van Aert, S.; Verbeeck, J.

    2016-01-01

    A new version of the open source program MULTEM is presented here. It includes a graphical user interface, tapering truncation of the atomic potential, CPU multithreading functionality, single/double precision calculations, scanning transmission electron microscopy (STEM) simulations using experimental detector sensitivities, imaging STEM (ISTEM) simulations, energy filtered transmission electron microscopy (EFTEM) simulations, STEM electron energy loss spectroscopy (EELS) simulations along with other improvements in the algorithms. We also present a mixed channeling approach for the calculation of inelastic excitations, which allows one to considerably speed up time consuming EFTEM/STEM-EELS calculations. - Highlights: • We present a new version of the CPU/GPU open source program MULTEM. • A cross-platform graphical user interface is developed. • We include inelastic excitations for EFTEM/STEM-EELS calculations. • We add CPU multithreading functionality and single/double precision calculations.

  18. Low energy electron transport in furfural

    Science.gov (United States)

    Lozano, Ana I.; Krupa, Kateryna; Ferreira da Silva, Filipe; Limão-Vieira, Paulo; Blanco, Francisco; Muñoz, Antonio; Jones, Darryl B.; Brunger, Michael J.; García, Gustavo

    2017-09-01

    We report on an initial investigation into the transport of electrons through a gas cell containing 1 mTorr of gaseous furfural. Results from our Monte Carlo simulation are implicitly checked against those from a corresponding electron transmission measurement. To enable this simulation a self-consistent cross section data base was constructed. This data base is benchmarked through new total cross section measurements which are also described here. In addition, again to facilitate the simulation, our preferred energy loss distribution function is presented and discussed.

  19. Non-linear and signal energy optimal asymptotic filter design

    Directory of Open Access Journals (Sweden)

    Josef Hrusak

    2003-10-01

    Full Text Available The paper studies some connections between the main results of the well known Wiener-Kalman-Bucy stochastic approach to filtering problems based mainly on the linear stochastic estimation theory and emphasizing the optimality aspects of the achieved results and the classical deterministic frequency domain linear filters such as Chebyshev, Butterworth, Bessel, etc. A new non-stochastic but not necessarily deterministic (possibly non-linear alternative approach called asymptotic filtering based mainly on the concepts of signal power, signal energy and a system equivalence relation plays an important role in the presentation. Filtering error invariance and convergence aspects are emphasized in the approach. It is shown that introducing the signal power as the quantitative measure of energy dissipation makes it possible to achieve reasonable results from the optimality point of view as well. The property of structural energy dissipativeness is one of the most important and fundamental features of resulting filters. Therefore, it is natural to call them asymptotic filters. The notion of the asymptotic filter is carried in the paper as a proper tool in order to unify stochastic and non-stochastic, linear and nonlinear approaches to signal filtering.

  20. High energy-resolution electron energy-loss spectroscopy study of the dielectric properties of bulk and nanoparticle LaB6 in the near-infrared region

    International Nuclear Information System (INIS)

    Sato, Yohei; Terauchi, Masami; Mukai, Masaki; Kaneyama, Toshikatsu; Adachi, Kenji

    2011-01-01

    The dielectric properties of LaB 6 crystals and the plasmonic behavior of LaB 6 nanoparticles, which have been applied to solar heat-shielding filters, were studied by high energy-resolution electron energy-loss spectroscopy (HR-EELS). An EELS spectrum of a LaB 6 crystal showed a peak at 2.0 eV, which was attributed to volume plasmon excitation of carrier electrons. EELS spectra of single LaB 6 nanoparticles showed peaks at 1.1-1.4 eV depending on the dielectric effect from the substrates. The peaks were assigned to dipole oscillation excitations. These peak energies almost coincided with the peak energy of optical absorption of a heat-shielding filter with LaB 6 nanoparticles. On the other hand, those energies were a smaller than a dipole oscillation energy predicted using the dielectric function of bulk LaB 6 crystal. It is suggested that the lower energy than expected is due to an excitation at 1.2 eV, which was observed for oxidized LaB 6 area. -- Highlights: → The dielectric properties of LaB 6 nanoparticles applied to solar heat-shielding filters were studied by HR-EELS. → Plasmon peak energies of the LaB 6 nanoparticles were almost equal to optical absorption energy of a heat-shielding filter. → From this result, near-infrared optical absorption of the filter is due to the surface dipole mode of the nanoparticles.

  1. Electron microscope studies on nuclear track filters

    International Nuclear Information System (INIS)

    Roell, I.; Siegmon, W.

    1982-01-01

    Nuclear track filters became more and more important in various fields of application. The filtration process can be described by a set of suitable parameters. For some applications it may be necessary to know the structure of the surface and the pores themselves. In most cases the etching process yields surfaces and pore geometries that are quite different from ideal planes and cylinders. In the presented work the production of different filter types will be described. The resulting surfaces and pore structures have been investigated by means of a scanning electron microscope. (author)

  2. Electronic transport through EuO spin-filter tunnel junctions

    KAUST Repository

    Jutong, Nuttachai

    2012-11-12

    Epitaxial spin-filter tunnel junctions based on the ferromagnetic semiconductor europium monoxide (EuO) are investigated by means of density functional theory. In particular, we focus on the spin transport properties of Cu(100)/EuO(100)/Cu(100) junctions. The dependence of the transmission coefficient and the current-voltage curves on the interface spacing and EuO thickness is explained in terms of the EuO density of states and the complex band structure. Furthermore, we also discuss the relation between the spin transport properties and the Cu-EuO interface geometry. The level alignment of the junction is sensitively affected by the interface spacing, since this determines the charge transfer between EuO and the Cu electrodes. Our calculations indicate that EuO epitaxially grown on Cu can act as a perfect spin filter, with a spin polarization of the current close to 100%, and with both the Eu-5d conduction-band and the Eu-4f valence-band states contributing to the coherent transport. For epitaxial EuO on Cu, a symmetry filtering is observed, with the Δ1 states dominating the transmission. This leads to a transport gap larger than the fundamental EuO band gap. Importantly, the high spin polarization of the current is preserved up to large bias voltages.

  3. Microanalysis by spectroscopy of transmitted electron energy losses

    International Nuclear Information System (INIS)

    Colliex, C.; Trebbia, P.

    1978-01-01

    Among the various signals which, in a transmission electron microscope, result from the interactions between the primary beam of well defined energy E 0 and the sample, the spectrum of the energy distribution of the electrons transmitted contains useful informations on the chemical and physical properties of the sample. Consequently the adaptation of an energy dispersive system on an electron microscope enables new fields of research to be investigated, particularly a localised chemical analysis technique with a space resolution scale equal to that of the electron microscope. It is this second aspect that we suggest describing in particular here. Already, this technique appears to be indispensable in the problems arising from the analysis of very small quantities of matter: detection limits in the order of 10 -19 to 10 -20 g (around 100 to 1000 atoms) would seem to be resonably possible [fr

  4. Design and engineering of IZO/Ag/glass solar filters for low-emissivity window performance

    Science.gov (United States)

    Hernandez-Mainet, Luis C.; Aguilar, Miguel A.; Tamargo, Maria C.; Falcony, Ciro

    2017-10-01

    The electricity consumption in houses and commercial buildings generates about 18% of greenhouse gas emission. A critical issue of building energy consumption is heat and cooling loss through the window. Low-emissivity windows control thermal radiation through glass without decreasing the intensity of visible light. They are made up of optical filter coatings grown on a flat glass surface. Solar filters based on Ag/IZO multilayer films are grown and simulated on glass substrate. The targeted structure designs are grown by a sputtering system and characterized by scanning electron microscopy and x-ray diffraction techniques. To accurately simulate transmission spectrum, silver (Ag) and IZO optical constants were estimated by fitting ellipsometric data at different thicknesses. Transmission spectrum shows a good agreement among experiment and simulation. In addition, optical constant curves strongly show layer thickness dependence in both materials. In particular, the ultrathin Ag layer displays a percolation threshold in the vicinity of 15 nm, which leads to surface plasmon resonance with absorption at about 450 nm. These types of optical filter coatings would have potential applications as low-emission windows.

  5. Interpretation of monoclinic hafnia valence electron energy-loss spectra by time-dependent density functional theory

    Science.gov (United States)

    Hung, L.; Guedj, C.; Bernier, N.; Blaise, P.; Olevano, V.; Sottile, F.

    2016-04-01

    We present the valence electron energy-loss spectrum and the dielectric function of monoclinic hafnia (m -HfO2) obtained from time-dependent density-functional theory (TDDFT) predictions and compared to energy-filtered spectroscopic imaging measurements in a high-resolution transmission-electron microscope. Fermi's golden rule density-functional theory (DFT) calculations can capture the qualitative features of the energy-loss spectrum, but we find that TDDFT, which accounts for local-field effects, provides nearly quantitative agreement with experiment. Using the DFT density of states and TDDFT dielectric functions, we characterize the excitations that result in the m -HfO2 energy-loss spectrum. The sole plasmon occurs between 13 and 16 eV, although the peaks ˜28 and above 40 eV are also due to collective excitations. We furthermore elaborate on the first-principles techniques used, their accuracy, and remaining discrepancies among spectra. More specifically, we assess the influence of Hf semicore electrons (5 p and 4 f ) on the energy-loss spectrum, and find that the inclusion of transitions from the 4 f band damps the energy-loss intensity in the region above 13 eV. We study the impact of many-body effects in a DFT framework using the adiabatic local-density approximation (ALDA) exchange-correlation kernel, as well as from a many-body perspective using "scissors operators" matched to an ab initio G W calculation to account for self-energy corrections. These results demonstrate some cancellation of errors between self-energy and excitonic effects, even for excitations from the Hf 4 f shell. We also simulate the dispersion with increasing momentum transfer for plasmon and collective excitation peaks.

  6. A novel low energy electron microscope for DNA sequencing and surface analysis

    Energy Technology Data Exchange (ETDEWEB)

    Mankos, M., E-mail: marian@electronoptica.com [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); Shadman, K. [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); Persson, H.H.J. [Stanford Genome Technology Center, Stanford University School of Medicine, 855 California Avenue, Palo Alto, CA 94304 (United States); N’Diaye, A.T. [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); NCEM, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Schmid, A.K. [NCEM, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Davis, R.W. [Stanford Genome Technology Center, Stanford University School of Medicine, 855 California Avenue, Palo Alto, CA 94304 (United States)

    2014-10-15

    Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of

  7. Quantitative transmission electron microscopy at atomic resolution

    International Nuclear Information System (INIS)

    Allen, L J; D'Alfonso, A J; Forbes, B D; Findlay, S D; LeBeau, J M; Stemmer, S

    2012-01-01

    In scanning transmission electron microscopy (STEM) it is possible to operate the microscope in bright-field mode under conditions which, by the quantum mechanical principle of reciprocity, are equivalent to those in conventional transmission electron microscopy (CTEM). The results of such an experiment will be presented which are in excellent quantitative agreement with theory for specimens up to 25 nm thick. This is at variance with the large contrast mismatch (typically between two and five) noted in equivalent CTEM experiments. The implications of this will be discussed.

  8. Electronic properties of Mn-phthalocyanine–C60 bulk heterojunctions: Combining photoemission and electron energy-loss spectroscopy

    International Nuclear Information System (INIS)

    Roth, Friedrich; Herzig, Melanie; Knupfer, Martin; Lupulescu, Cosmin; Darlatt, Erik; Gottwald, Alexander; Eberhardt, Wolfgang

    2015-01-01

    The electronic properties of co-evaporated mixtures (blends) of manganese phthalocyanine and the fullerene C 60 (MnPc:C 60 ) have been studied as a function of the concentration of the two constituents using two supplementary electron spectroscopic methods, photoemission spectroscopy (PES) and electron energy-loss spectroscopy (EELS) in transmission. Our PES measurements provide a detailed picture of the electronic structure measured with different excitation energies as well as different mixing ratios between MnPc and C 60 . Besides a relative energy shift, the occupied electronic states of the two materials remain essentially unchanged. The observed energy level alignment is different compared to that of the related CuPc:C 60 bulk heterojunction. Moreover, the results from our EELS investigations show that, despite the rather small interface interaction, the MnPc related electronic excitation spectrum changes significantly by admixing C 60 to MnPc thin films

  9. Characterizing high energy spectra of NIF ignition Hohlraums using a differentially filtered high energy multipinhole x-ray imager.

    Science.gov (United States)

    Park, Hye-Sook; Dewald, E D; Glenzer, S; Kalantar, D H; Kilkenny, J D; MacGowan, B J; Maddox, B R; Milovich, J L; Prasad, R R; Remington, B A; Robey, H F; Thomas, C A

    2010-10-01

    Understanding hot electron distributions generated inside Hohlraums is important to the national ignition campaign for controlling implosion symmetry and sources of preheat. While direct imaging of hot electrons is difficult, their spatial distribution and spectrum can be deduced by detecting high energy x-rays generated as they interact with target materials. We used an array of 18 pinholes with four independent filter combinations to image entire Hohlraums with a magnification of 0.87× during the Hohlraum energetics campaign on NIF. Comparing our results with Hohlraum simulations indicates that the characteristic 10-40 keV hot electrons are mainly generated from backscattered laser-plasma interactions rather than from Hohlraum hydrodynamics.

  10. Transmission electron microscopy of bone

    NARCIS (Netherlands)

    Everts, Vincent; Niehof, Anneke; Tigchelaar-Gutter, Wikky; Beertsen, Wouter

    2012-01-01

    This chapter describes procedures to process mineralized tissues obtained from different sources for transmission electron microscopy (TEM). Methods for fixation, resin embedding, staining of semi-thin sections and ultrathin sections are presented. In addition, attention will be paid to processing

  11. Transmission Electron Microscopy of Minerals and Rocks

    Science.gov (United States)

    McLaren, Alex C.

    1991-04-01

    Of the many techniques that have been applied to the study of crystal defects, none has contributed more to our understanding of their nature and influence on the physical and chemical properties of crystalline materials than transmission electron microscopy (TEM). TEM is now used extensively by an increasing number of earth scientists for direct observation of defect microstructures in minerals and rocks. Transmission Electron Microscopy of Rocks and Minerals is an introduction to the principles of the technique and is the only book to date on the subject written specifically for geologists and mineralogists. The first part of the book deals with the essential physics of the transmission electron microscope and presents the basic theoretical background required for the interpretation of images and electron diffraction patterns. The final chapters are concerned with specific applications of TEM in mineralogy and deal with such topics as planar defects, intergrowths, radiation-induced defects, dislocations and deformation-induced microstructures. The examples cover a wide range of rock-forming minerals from crustal rocks to those in the lower mantle, and also take into account the role of defects in important mineralogical and geological processes.

  12. Laboratory design for high-performance electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    O' Keefe, Michael A.; Turner, John H.; Hetherington, Crispin J.D.; Cullis, A.G.; Carragher, Bridget; Jenkins, Ron; Milgrim, Julie; Milligan,Ronald A.; Potter, Clinton S.; Allard, Lawrence F.; Blom, Douglas A.; Degenhardt, Lynn; Sides, William H.

    2004-04-23

    Proliferation of electron microscopes with field emission guns, imaging filters and hardware spherical aberration correctors (giving higher spatial and energy resolution) has resulted in the need to construct special laboratories. As resolutions improve, transmission electron microscopes (TEMs) and scanning transmission electron microscopes (STEMs) become more sensitive to ambient conditions. State-of-the-art electron microscopes require state-of-the-art environments, and this means careful design and implementation of microscope sites, from the microscope room to the building that surrounds it. Laboratories have been constructed to house high-sensitive instruments with resolutions ranging down to sub-Angstrom levels; we present the various design philosophies used for some of these laboratories and our experiences with them. Four facilities are described: the National Center for Electron Microscopy OAM Laboratory at LBNL; the FEGTEM Facility at the University of Sheffield; the Center for Integrative Molecular Biosciences at TSRI; and the Advanced Microscopy Laboratory at ORNL.

  13. Magnetically insulated transmission line used for relativistic electron beam injection into SPAC-VI

    International Nuclear Information System (INIS)

    Tsuzuki, Tetsuya; Narihara, Kazumichi; Tomita, Yukihiro; Mohri, Akihiro.

    1980-10-01

    For the purpose to inject the electron beam with energy of about 1.5 MeV and current of about 100 kA into the SPAC-6 (torus device), a magnetically insulated transmission line was designed and constructed. The motion of electrons in the line was theoretically analyzed. The requirements for the design of the transmission line were as follows-: (a) condition of magnetic insulation, (b) suppression against reverse gas flow from the beam source to the torus, (c) care to minimize the influence of strong torus magnetic field, (d) reduction of inductance and (e) safety engineering measures, e.g., separation valve in the MITL between the beam source and the SPAC-6. The transmission line of 2.4 m long was designed and constructed. The wave forms of electric potential and current were measured. The transmission efficiency of current along the axis and the efficiency as a function of current at the end of the line were also measured. The reason of the loss of current is discussed. (J.P.N.)

  14. Improving signal to noise in labeled biological specimens using energy-filtered TEM of sections with a drift correction strategy and a direct detection device.

    Science.gov (United States)

    Ramachandra, Ranjan; Bouwer, James C; Mackey, Mason R; Bushong, Eric; Peltier, Steven T; Xuong, Nguyen-Huu; Ellisman, Mark H

    2014-06-01

    Energy filtered transmission electron microscopy techniques are regularly used to build elemental maps of spatially distributed nanoparticles in materials and biological specimens. When working with thick biological sections, electron energy loss spectroscopy techniques involving core-loss electrons often require exposures exceeding several minutes to provide sufficient signal to noise. Image quality with these long exposures is often compromised by specimen drift, which results in blurring and reduced resolution. To mitigate drift artifacts, a series of short exposure images can be acquired, aligned, and merged to form a single image. For samples where the target elements have extremely low signal yields, the use of charge coupled device (CCD)-based detectors for this purpose can be problematic. At short acquisition times, the images produced by CCDs can be noisy and may contain fixed pattern artifacts that impact subsequent correlative alignment. Here we report on the use of direct electron detection devices (DDD's) to increase the signal to noise as compared with CCD's. A 3× improvement in signal is reported with a DDD versus a comparably formatted CCD, with equivalent dose on each detector. With the fast rolling-readout design of the DDD, the duty cycle provides a major benefit, as there is no dead time between successive frames.

  15. Power electronics - key technology for renewable energy systems

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Iov, Florin; Kerekes, Tamas

    2011-01-01

    sources to renewable energy sources. Another is to use high efficient power electronics in power generation, power transmission/distribution and end-user application. This paper discuss trends of the most emerging renewable energy sources, wind energy and photovoltaics, which by means of power electronics...... as efficient as possible. Further, the emerging climate changes is arguing to find sustainable future solutions. Of many options, two major technologies will play important roles to solve parts of those future problems. One is to change the electrical power production from conventional, fossil based energy......The electrical energy consumption continues to grow and more applications are based on electricity. We can expect that more 60% of all energy consumption will be converted and used as electricity. Therefore, it is a demand that production, distribution and use of electrical energy are done...

  16. Electron energy loss spectroscopy of gold nanoparticles on graphene

    International Nuclear Information System (INIS)

    DeJarnette, Drew; Roper, D. Keith

    2014-01-01

    Plasmon excitation decay by absorption, scattering, and hot electron transfer has been distinguished from effects induced by incident photons for gold nanoparticles on graphene monolayer using electron energy loss spectroscopy (EELS). Gold nano-ellipses were evaporated onto lithographed graphene, which was transferred onto a silicon nitride transmission electron microscopy grid. Plasmon decay from lithographed nanoparticles measured with EELS was compared in the absence and presence of the graphene monolayer. Measured decay values compared favorably with estimated radiative and non-radiative contributions to decay in the absence of graphene. Graphene significantly enhanced low-energy plasmon decay, increasing mode width 38%, but did not affect higher energy plasmon or dark mode decay. This decay beyond expected radiative and non-radiative mechanisms was attributed to hot electron transfer, and had quantum efficiency of 20%, consistent with previous reports

  17. The Development of a Hibachi Window for Electron Beam Transmission in a KrF Laser

    International Nuclear Information System (INIS)

    Gentile, C.A.; Parsells, R.; Butler, J.E.; Sethian, J.D.; Ciebiera, L.; Hegeler, F.; Jun, C.; Langish, S.; Myers, M.

    2003-01-01

    In support of Inertial Fusion Energy (IFE), a 150 (micro)m thick silicon (Si) wafer coated on one side with a 1.2 (micro)m nanocrystalline diamond foil is being fabricated as an electron beam transmission (hibachi) window for use in KrF lasers. The hibachi window separates the lasing medium from the electron beam source while allowing the electron beam to pass through. The hibachi window must be capable of withstanding the challenging environment presented in the lasing chamber, which include: fluorine gas, delta pressure >2 atm at 5 Hz, and a high heat flux due to the transmission of electrons passing through the foil. Tests at NRL/Electra and at PPPL have shown that a device employing these novel components in the stated configuration provide for a robust hibachi window with structural integrity

  18. Selected Energy Epitaxial Deposition and Low Energy Electron Microscopy of AlN, GaN and SiC Thin Films

    National Research Council Canada - National Science Library

    Davis, R

    1999-01-01

    The homoepitaxial growth of GaN(0001) layers was studied in situ and in real time using the low-energy electron microscope and ex situ using atomic force microscopy and transmission electron microscopy...

  19. A Study on the Thermal Neutron Filter for the Irradiation of Electronic Materials at HANARO

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Seong Woo; Kim, Sung Ryul; Park, Seung Jae; Shin, Yoon Taeg; Cho, Man Soon; Cho, Kee Nam [KAERI, Daejeon (Korea, Republic of)

    2016-05-15

    The representative example is a technique of making the semiconductor with the transmutation using the pure Si. This NTD (Neutron Transmutation Doping) Si is used as a high-quality semiconductor because it has a uniform resistance. Likewise, the electronic materials are being investigated to improve the performance of material using the neutron irradiation method. The mechanism for reaction between the electronic materials and the neutrons depends on the energy of the neutron. Capturing reaction by thermal neutrons causes the transmutation and a lot of defects are made by fast neutrons. The study for the effect by such neutron energy is necessary to understand the performance improvement of the irradiated electronic materials. The thermal neutron filter was investigated to be used for the irradiation of electronic materials at HANARO. IP irradiation hole was selected and the irradiation device was designed. The analysis was conducted considering four candidate materials.

  20. Light-Induced Reduction of Cuprous Oxide in an Environmental Transmission Electron Microscope

    DEFF Research Database (Denmark)

    Cavalca, Filippo Carlo; Laursen, Anders Bo; Wagner, Jakob Birkedal

    2013-01-01

    Photocatalysts for solar fuel production are subject to intensive investigation as they constitute one viable route for solar energy harvesting. Cuprous oxide (Cu2O) is a working photocatalyst for hydrogen evolution but it photocorrodes upon light illumination in an aqueous environment....... Environmental transmission electron microscopy (ETEM) makes it possible to obtain insight into the local structure, composition and reactivity of catalysts in their working environment, which is of fundamental interest for sustainable energy research and is essential for further material optimization. Herein...

  1. Energy response and compensation filters for pips detector

    International Nuclear Information System (INIS)

    Wang Lin; Ye Zhiyao; Dong Binjiang

    2007-01-01

    This paper introduces the analysis of energy response and the choice of proper compensation filters for PIPS detector. With PRESTA-CG program, filters conformed to the national standard of PRC were picked out by calculation. Then the chosen filters were tested through experiments. Good agreement was obtained between measured results and calculated values by Monte Carlo method. (authors)

  2. Preparation and characterization of morph-genetic aluminum nitride/carbon composites from filter paper

    International Nuclear Information System (INIS)

    Wang Wei; Xue Tao; Jin Zhihao; Qiao Guanjun

    2008-01-01

    Morph-genetic aluminum nitride/carbon composites with cablelike structure were prepared from filter paper template through the surface sol-gel process and carbothermal nitridation reaction. The resulting materials have a hierarchical structure originating from the morphology of cellulose paper. The aluminum nitride/carbon composites have the core-shell microstructure, the core is graphitic carbon, and the shell is aluminum nitride nanocoating formed by carbothermal nitridation reduction of alumina with the interfacial carbon in nitrogen atmosphere. Scanning electron microscopy, energy dispersive X-ray spectroscopy, X-ray diffraction, and transmission electron microscope were employed to characterize the structural morphology and phase compositions of the final products

  3. Elemental process of amorphization induced by electron irradiation in Si

    International Nuclear Information System (INIS)

    Yamasaki, Jun; Takeda, Seiji; Tsuda, Kenji

    2002-01-01

    We recently found that amorphization is induced in Si by electron irradiation. Examining the amorphization systematically, we have established the diagram of steady states under electron irradiation, either amorphous Si (a-Si) or crystalline Si (c-Si) as a function of incident electron energy, electron dose, and irradiation temperature. Utilizing transmission electron microscopy, electron energy filtered diffraction and electron energy-loss spectroscopy, we have characterized the atomic structure, the electronic structure, and the thermal stability of a-Si induced by electron irradiation. Based on the experimental data, we have also concluded that the amorphization is caused by the accumulation of not point defects but small cascade damages. Analyzing the change in the intensity of halo diffraction rings during amorphization, we have clarified that the smallest cascade damage that contributes to amorphization includes only about four Si atoms. This presumably supports the amorphization mechanism that four self-interstitial atoms form the quasistable structure I4 in c-Si and it becomes an amorphous embryo

  4. Transmission electron microscopy of amyloid fibrils.

    Science.gov (United States)

    Gras, Sally L; Waddington, Lynne J; Goldie, Kenneth N

    2011-01-01

    Transmission Electron Microscopy of negatively stained and cryo-prepared specimens allows amyloid fibrils to be visualised at high resolution in a dried or a hydrated state, and is an essential method for characterising the morphology of fibrils and pre-fibrillar species. We outline the key steps involved in the preparation and observation of samples using negative staining and cryo-electron preservation. We also discuss methods to measure fibril characteristics, such as fibril width, from electron micrographs.

  5. Interaction between single gold atom and the graphene edge: A study via aberration-corrected transmission electron microscopy

    KAUST Repository

    Wang, Hongtao

    2012-01-01

    Interaction between single noble metal atoms and graphene edges has been investigated via aberration-corrected and monochromated transmission electron microscopy. A collective motion of the Au atom and the nearby carbon atoms is observed in transition between energy-favorable configurations. Most trapping and detrapping processes are assisted by the dangling carbon atoms, which are more susceptible to knock-on displacements by electron irradiation. Thermal energy is lower than the activation barriers in transition among different energy-favorable configurations, which suggests electron-beam irradiation can be an efficient way of engineering the graphene edge with metal atoms. © 2012 The Royal Society of Chemistry.

  6. Energy deposition model for low-energy electrons (10-10 000 eV) in air

    International Nuclear Information System (INIS)

    Roldan, A.; Perez, J.M.; Williart, A.; Blanco, F.; Garcia, G.

    2004-01-01

    An energy deposition model for electrons in air that can be useful in microdosimetric applications is presented in this study. The model is based on a Monte Carlo simulation of the single electron scattering processes that can take place with the molecular constituents of the air in the energy range 10-10 000 eV. The input parameters for this procedure have been the electron scattering cross sections, both differential and integral. These parameters were calculated using a model potential method which describes the electron scattering with the molecular constituent of air. The reliability of the calculated integral cross section values has been evaluated by comparison with direct total electron scattering cross-section measurements performed by us in a transmission beam experiment. Experimental energy loss spectra for electrons in air have been used as probability distribution functions to define the electron energy loss in single collision events. The resulting model has been applied to simulate the electron transport through a gas cell containing air at different pressures and the results have been compared with those observed in the experiments. Finally, as an example of its applicability to dosimetric issues, the energy deposition of 10 000 eV by means of successive collisions in a free air chamber has been simulated

  7. Band rejection filter for measurement of electron cyclotron emission during electron cyclotron heating

    International Nuclear Information System (INIS)

    Iwase, Makoto; Ohkubo, Kunizo; Kubo, Shin; Idei, Hiroshi.

    1996-05-01

    For the measurement of electron cyclotron emission from the high temperature plasma, a band rejection filter in the range of 40-60 GHz is designed to reject the 53.2 GHz signal with large amplitude from the gyrotron for the purpose of plasma electron heating. The filter developed with ten sets of three quarters-wavelength coupled by TE 111 mode of tunable resonant cavity has rejection of 50 dB and 3 dB bandwidth of 500 MHz. The modified model of Tschebysheff type for the prediction of rejection is proposed. It is confirmed that the measured rejection as a function of frequency agrees well with the experimental results for small coupling hole, and also clarified that the rejection ratio increases for the large coupling hole. (author)

  8. Reducing LTE Uplink Transmission Energy by Allocating Resources

    DEFF Research Database (Denmark)

    Lauridsen, Mads; Jensen, Anders Riis; Mogensen, Preben

    2011-01-01

    The effect of physical resource block (PRB) allocation on an LTE modem's transmit power and total modem energy consumption is examined. In this paper the uplink resource blocks are scheduled in either a Frequency Division Multiple Access (FDMA) or Time Division Multiple Access (TDMA) manner......, to determine if low transmission power & long transmission time or high transmission power & short transmission time is most energy efficient. It is important to minimize the LTE modem's energy consumption caused by uplink transmission because it affects phone battery time, and because researchers rarely focus...

  9. Electronic and structural properties of B i2S e3:Cu

    Science.gov (United States)

    Sobczak, Kamil; Strak, Pawel; Kempisty, Pawel; Wolos, Agnieszka; Hruban, Andrzej; Materna, Andrzej; Borysiuk, Jolanta

    2018-04-01

    Electronic and structural properties of B i2S e3 and its extension to copper doped B i2S e3:Cu were studied using combined ab initio simulations and transmission electron microscopy based techniques, including electron energy loss spectroscopy, energy filtered transmission electron microscopy, and energy dispersive x-ray spectroscopy. The stability of the mixed phases was investigated for substitutional and intercalation changes of basic B i2S e3 structure. Four systems were compared: B i2S e3 , structures obtaining by Cu intercalation of the van der Waals gap, by substitution of Bi by Cu in quintuple layers, and C u2Se . The structures were identified and their electronic properties were obtained. Transmission electron microscopy measurements of B i2S e3 and the B i2S e3:Cu system identified the first structure as uniform and the second as composite, consisting of a nonuniform lower-Cu-content matrix and randomly distributed high-Cu-concentration precipitates. Critical comparison of the ab initio and experimental data identified the matrix as having a B i2S e3 dominant part with randomly distributed Cu-intercalated regions having 1Cu-B i2S e3 structure. The precipitates were determined to have 3Cu-B i2S e3 structure.

  10. Scanning transmission proton microscopy tomography of reconstruction cells from simulated data

    International Nuclear Information System (INIS)

    Zhang Conghua; Li Min; Hou Qing

    2011-01-01

    For scanning transmission proton microscopy tomography, to compare cell images of the proton stopping power and relative electron density, two cell phantoms are designed and simulated by code FLUKA. The cell images are reconstructed by the filtered back projection algorithm, and compared with their tomography imaging. The images of stopping power and relative electron density slightly vary with proton energies, but the internal images are of clear with high resolution. The organic glass image of relative electron density reveals the resolution power of proton tomography. Also, the simulation results reflect effects of the boundary enhancement, the weak artifacts, and the internal structure border extension by multiple scattering. So using proton tomography to analyze internal structure of a cell is a superior. (authors)

  11. Transmission Electron Microscope Measures Lattice Parameters

    Science.gov (United States)

    Pike, William T.

    1996-01-01

    Convergent-beam microdiffraction (CBM) in thermionic-emission transmission electron microscope (TEM) is technique for measuring lattice parameters of nanometer-sized specimens of crystalline materials. Lattice parameters determined by use of CBM accurate to within few parts in thousand. Technique developed especially for use in quantifying lattice parameters, and thus strains, in epitaxial mismatched-crystal-lattice multilayer structures in multiple-quantum-well and other advanced semiconductor electronic devices. Ability to determine strains in indivdual layers contributes to understanding of novel electronic behaviors of devices.

  12. A new aberration-corrected, energy-filtered LEEM/PEEM instrument II. Operation and results

    International Nuclear Information System (INIS)

    Tromp, R.M.; Hannon, J.B.; Wan, W.; Berghaus, A.; Schaff, O.

    2013-01-01

    In Part I we described a new design for an aberration-corrected Low Energy Electron Microscope (LEEM) and Photo Electron Emission Microscope (PEEM) equipped with an in-line electron energy filter. The chromatic and spherical aberrations of the objective lens are corrected with an electrostatic electron mirror that provides independent control of the chromatic and spherical aberration coefficients C c and C 3 , as well as the mirror focal length. In this Part II we discuss details of microscope operation, how the microscope is set up in a systematic fashion, and we present typical results. - Highlights: ► The C c and C 3 aberrations of a LEEM/PEEM instrument are corrected with an electrostatic electron mirror. ► The mirror provides independent control over C c , C 3 and focal length in close agreement with theory. ► A detailed alignment procedure for the corrected microscope is given. ► Novel methods to measure C c and C 3 of the objective lens and the mirror are presented. ► We demonstrate a record spatial resolution of 2 nm

  13. Photon harvesting, coloring and polarizing in photovoltaic cell integrated color filters: efficient energy routing strategies for power-saving displays.

    Science.gov (United States)

    Wen, Long; Chen, Qin; Song, Shichao; Yu, Yan; Jin, Lin; Hu, Xin

    2015-07-03

    We describe the integral electro-optical strategies that combine the functionalities of photovoltaic (PV) electricity generation and color filtering as well as polarizing to realize more efficient energy routing in display technology. Unlike the conventional pigment-based filters and polarizers, which absorb substantial amounts of unwanted spectral components and dissipate them in the form of heat, we propose converting the energy of those photons into electricity by constructing PV cell-integrated color filters based on a selectively transmitting aluminum (Al) rear electrode perforated with nanoholes (NHs). Combining with a dielectric-metal-dielectric (DMD) front electrode, the devices were optimized to enable efficient cavity-enhanced photon recycling in the PV functional layers. We perform a comprehensive theoretical and numerical analysis to explore the extraordinary optical transmission (EOT) through the Al NHs and identify basic design rules for achieving structural coloring or polarizing in our PV color filters. We show that the addition of thin photoactive polymer layers on the symmetrically configured Al NH electrode narrows the bandwidth of the EOT-assisted high-pass light filtering due to the strongly damped anti-symmetric coupling of the surface modes excited on the front and rear surface of the Al NHs, which facilitates the whole visible coloring with relatively high purity for the devices. By engineering the cut-off characteristics of the plasmonic waveguide mode supported by the circular or ellipsoidal Al NHs, beyond the photon recycling capacity, PV color filters and PV polarizing color filters that allow polarization-insensitive and strong polarization-anisotropic color filtering were demonstrated. The findings presented here may shed some light on expanding the utilization of PV electricity generation across new-generation energy-saving electrical display devices.

  14. Surface plasmon modes of a single silver nanorod: An electron energy loss study

    DEFF Research Database (Denmark)

    Nicoletti, Olivia; Wubs, Martijn; Mortensen, N. Asger

    2011-01-01

    We present an electron energy loss study using energy filtered TEM of spatially resolved surface plasmon excitations on a silver nanorod of aspect ratio 14.2 resting on a 30 nm thick silicon nitride membrane. Our results show that the excitation is quantized as resonant modes whose intensity maxima...

  15. Secondary Electron Emission Materials for Transmission Dynodes in Novel Photomultipliers: A Review

    Directory of Open Access Journals (Sweden)

    Shu Xia Tao

    2016-12-01

    Full Text Available Secondary electron emission materials are reviewed with the aim of providing guidelines for the future development of novel transmission dynodes. Materials with reflection secondary electron yield higher than three and transmission secondary electron yield higher than one are tabulated for easy reference. Generations of transmission dynodes are listed in the order of the invention time with a special focus on the most recent atomic-layer-deposition synthesized transmission dynodes. Based on the knowledge gained from the survey of secondary election emission materials with high secondary electron yield, an outlook of possible improvements upon the state-of-the-art transmission dynodes is provided.

  16. A Novel Low Energy Electron Microscope for DNA Sequencing and Surface Analysis

    Science.gov (United States)

    Mankos, M.; Shadman, K.; Persson, H.H.J.; N’Diaye, A.T.; Schmid, A.K.; Davis, R.W.

    2014-01-01

    Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of

  17. A novel low energy electron microscope for DNA sequencing and surface analysis.

    Science.gov (United States)

    Mankos, M; Shadman, K; Persson, H H J; N'Diaye, A T; Schmid, A K; Davis, R W

    2014-10-01

    Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of

  18. Fibonacci quasiregular graphene-based superlattices: Quasiperiodicity and its effects on the transmission, transport and electronic structure properties

    Energy Technology Data Exchange (ETDEWEB)

    García-Cervantes, H.; Madrigal-Melchor, J.; Martínez-Orozco, J.C.; Rodríguez-Vargas, I., E-mail: isaac@fisica.uaz.edu.mx

    2015-12-01

    We study the transmission, transport and electronic structure properties of aperiodic Fibonacci monolayer graphene-based structures (AFGBSs). The transfer matrix method has been implemented to obtain the transmittance, linear-regime conductance and electronic structure. In particular, we have studied two types of aperiodic graphene-based structures: (1) electrostatic AFGBSs (EAFGBSs), structures formed with electrostatic potentials, and (2) substrate AFGBSs (SAFGBSs), obtained alternating substrates that can open and non-open, such as SiC and SiO{sub 2}, an energy bandgap on graphene. We have found that the transmission properties can be modulated readily by changing the main parameters of the systems: well and barrier widths, energy and angle of incident electrons and the degree of aperiodicity. In the case of the linear-regime conductance turns out that it diminishes various orders of magnitude increasing the barrier width for SAFGBSs. On the contrary, Klein tunneling sustains the conductance in EAFGBSs. Calculating the electronic structure or miniband-structure formation and its fragmentation we establish a direct connection between the conductance peaks and the opening, closure and degeneration of energy minibands for both EAFGSLs and SAFGSLs.

  19. Dose-rate-dependent damage of cerium dioxide in the scanning transmission electron microscope.

    Science.gov (United States)

    Johnston-Peck, Aaron C; DuChene, Joseph S; Roberts, Alan D; Wei, Wei David; Herzing, Andrew A

    2016-11-01

    Beam damage caused by energetic electrons in the transmission electron microscope is a fundamental constraint limiting the collection of artifact-free information. Through understanding the influence of the electron beam, experimental routines may be adjusted to improve the data collection process. Investigations of CeO 2 indicate that there is not a critical dose required for the accumulation of electron beam damage. Instead, measurements using annular dark field scanning transmission electron microscopy and electron energy loss spectroscopy demonstrate that the onset of measurable damage occurs when a critical dose rate is exceeded. The mechanism behind this phenomenon is that oxygen vacancies created by exposure to a 300keV electron beam are actively annihilated as the sample re-oxidizes in the microscope environment. As a result, only when the rate of vacancy creation exceeds the recovery rate will beam damage begin to accumulate. This observation suggests that dose-intensive experiments can be accomplished without disrupting the native structure of the sample when executed using dose rates below the appropriate threshold. Furthermore, the presence of an encapsulating carbonaceous layer inhibits processes that cause beam damage, markedly increasing the dose rate threshold for the accumulation of damage. Published by Elsevier B.V.

  20. Cathodoluminescence in the scanning transmission electron microscope

    Energy Technology Data Exchange (ETDEWEB)

    Kociak, M., E-mail: mathieu.kociak@u-psud.fr [Laboratoire de Physique des Solides, Université Paris-SudParis-Sud, CNRS-UMR 8502, Orsay 91405 (France); Zagonel, L.F. [“Gleb Wataghin” Institute of Physics University of Campinas - UNICAMP, 13083-859 Campinas, São Paulo (Brazil)

    2017-05-15

    Cathodoluminescence (CL) is a powerful tool for the investigation of optical properties of materials. In recent years, its combination with scanning transmission electron microscopy (STEM) has demonstrated great success in unveiling new physics in the field of plasmonics and quantum emitters. Most of these results were not imaginable even twenty years ago, due to conceptual and technical limitations. The purpose of this review is to present the recent advances that broke these limitations, and the new possibilities offered by the modern STEM-CL technique. We first introduce the different STEM-CL operating modes and the technical specificities in STEM-CL instrumentation. Two main classes of optical excitations, namely the coherent one (typically plasmons) and the incoherent one (typically light emission from quantum emitters) are investigated with STEM-CL. For these two main classes, we describe both the physics of light production under electron beam irradiation and the physical basis for interpreting STEM-CL experiments. We then compare STEM-CL with its better known sister techniques: scanning electron microscope CL, photoluminescence, and electron energy-loss spectroscopy. We finish by comprehensively reviewing recent STEM-CL applications. - Highlights: • Reviews the field of STEM-CL. • Introduces the technical requirements and challenges for STEM-CL. • Introduces the different types of excitations probed by STEM-CL. • Gives comprehensive overview of the last fifteenth years in the field.

  1. Designing organic spin filters in the coherent tunneling regime.

    Science.gov (United States)

    Herrmann, Carmen; Solomon, Gemma C; Ratner, Mark A

    2011-06-14

    Spin filters, that is, systems which preferentially transport electrons of a certain spin orientation, are an important element for spintronic schemes and in chemical and biological instances of spin-selective electronic communication. We study the relation between molecular structure and spin filtering functionality employing a theoretical analysis of both model and stable organic radicals based on substituted benzene, which are bound to gold electrodes, with a combination of density functional theory and the Landauer-Imry-Büttiker approach. We compare the spatial distribution of the spin density and of the frontier central subsystem molecular orbitals, and local contributions to the transmission. Our results suggest that the delocalization of the singly occupied molecular orbital and of the spin density onto the benzene ring connected to the electrodes, is a good, although not the sole indicator of spin filtering functionality. The stable radicals under study do not effectively act as spin filters, while the model phenoxy-based radicals are effective due to their much larger spin delocalization. These conclusions may also be of interest for electron transfer experiments in electron donor-bridge-acceptor complexes.

  2. A background subtraction routine for enhancing energy-filtered plasmon images of MgAl2O4 implanted with Al+ and Mg+ ions

    International Nuclear Information System (INIS)

    Evans, N.D.; Kenik, E.A.; Bentley, J.; Zinkle, S.J.

    1995-01-01

    MgAl 2 O 4 , a candidate fusion reactor material, was irradiated with Al + or Mg + ions; electron energy-loss spectra and energy-filtered plasmon images showed that metallic Al colloids are present in the ion-irradiated regions. This paper shows the subtraction of the spinel plasmon component in images using 15-eV-loss electrons in some detail

  3. Transmission environmental scanning electron microscope with scintillation gaseous detection device

    International Nuclear Information System (INIS)

    Danilatos, Gerasimos; Kollia, Mary; Dracopoulos, Vassileios

    2015-01-01

    A transmission environmental scanning electron microscope with use of a scintillation gaseous detection device has been implemented. This corresponds to a transmission scanning electron microscope but with addition of a gaseous environment acting both as environmental and detection medium. A commercial type of low vacuum machine has been employed together with appropriate modifications to the detection configuration. This involves controlled screening of various emitted signals in conjunction with a scintillation gaseous detection device already provided with the machine for regular surface imaging. Dark field and bright field imaging has been obtained along with other detection conditions. With a progressive series of modifications and tests, the theory and practice of a novel type of microscopy is briefly shown now ushering further significant improvements and developments in electron microscopy as a whole. - Highlights: • Novel scanning transmission electron microscopy (STEM) with an environmental scanning electron microscope (ESEM) called TESEM. • Use of the gaseous detection device (GDD) in scintillation mode that allows high resolution bright and dark field imaging in the TESEM. • Novel approach towards a unification of both vacuum and environmental conditions in both bulk/surface and transmission mode of electron microscopy

  4. Ion kinetic energy distribution in a pulsed vacuum arc with a straight magnetic filter

    International Nuclear Information System (INIS)

    Giuliani, L; Grondona, D; Kelly, H; Minotti, F

    2008-01-01

    In vacuum arcs of interest for film deposition the ion kinetic energy is of importance because it influences the coating properties. In this kind of discharge, the ions come out from the cathode spots with a high kinetic energy (20-150 eV). In the present work, we present measurements of vacuum arc ion energy distributions in a pulsed vacuum arc with a straight magnetic filter. A retarding field analyser (RFA) was used to perform the measurements that were carried out with a variable magnetic field strength (of the order of 10 mT). Since the interpretation of the results obtained from the RFA lies in the knowledge of the plasma and floating potential values, we have employed also Langmuir probes for determining those quantities. The obtained results for the ion kinetic energy are similar to those reported by other authors, but they were also found to be independent of the magnetic field strength. The electron temperature was also found to be independent of the magnetic field strength and of the axial position along the filter, indicating the absence of collisions.

  5. Ultrafast transmission electron microscopy using a laser-driven field emitter: Femtosecond resolution with a high coherence electron beam

    Energy Technology Data Exchange (ETDEWEB)

    Feist, Armin; Bach, Nora; Rubiano da Silva, Nara; Danz, Thomas; Möller, Marcel; Priebe, Katharina E.; Domröse, Till; Gatzmann, J. Gregor; Rost, Stefan; Schauss, Jakob; Strauch, Stefanie; Bormann, Reiner; Sivis, Murat; Schäfer, Sascha, E-mail: sascha.schaefer@phys.uni-goettingen.de; Ropers, Claus, E-mail: claus.ropers@uni-goettingen.de

    2017-05-15

    We present the development of the first ultrafast transmission electron microscope (UTEM) driven by localized photoemission from a field emitter cathode. We describe the implementation of the instrument, the photoemitter concept and the quantitative electron beam parameters achieved. Establishing a new source for ultrafast TEM, the Göttingen UTEM employs nano-localized linear photoemission from a Schottky emitter, which enables operation with freely tunable temporal structure, from continuous wave to femtosecond pulsed mode. Using this emission mechanism, we achieve record pulse properties in ultrafast electron microscopy of 9 Å focused beam diameter, 200 fs pulse duration and 0.6 eV energy width. We illustrate the possibility to conduct ultrafast imaging, diffraction, holography and spectroscopy with this instrument and also discuss opportunities to harness quantum coherent interactions between intense laser fields and free-electron beams. - Highlights: • First implementation of an ultrafast TEM employing a nanoscale photocathode. • Localized single photon-photoemission from nanoscopic field emitter yields low emittance ultrashort electron pulses. • Electron pulses focused down to ~9 Å, with a duration of 200 fs and an energy width of 0.6 eV are demonstrated. • Quantitative characterization of ultrafast electron gun emittance and brightness. • A range of applications of high coherence ultrashort electron pulses is shown.

  6. A theoretical study on the performances of thermoelectric heat engine and refrigerator with two-dimensional electron reservoirs

    International Nuclear Information System (INIS)

    Luo, Xiaoguang; Long, Kailin; Wang, Jun; Qiu, Teng; He, Jizhou; Liu, Nian

    2014-01-01

    Theoretical thermoelectric nanophysics models of low-dimensional electronic heat engine and refrigerator devices, comprising two-dimensional hot and cold reservoirs and an interconnecting filtered electron transport mechanism have been established. The models were used to numerically simulate and evaluate the thermoelectric performance and energy conversion efficiencies of these low-dimensional devices, based on three different types of electron transport momentum-dependent filters, referred to herein as k x , k y , and k r filters. Assuming the Fermi-Dirac distribution of electrons, expressions for key thermoelectric performance parameters were derived for the resonant transport processes, in which the transmission of electrons has been approximated as a Lorentzian resonance function. Optimizations were carried out and the corresponding optimized design parameters have been determined, including but not limited to the universal theoretical upper bound of the efficiency at maximum power for heat engines, and the maximum coefficient of performance for refrigerators. From the results, it was determined that k r filter delivers the best thermoelectric performance, followed by the k x filter, and then the k y filter. For refrigerators with any one of three filters, an optimum range for the full width at half maximum of the transport resonance was found to be B T.

  7. Determination of tungsten target parameters for transmission X-ray tube: A simulation study using Geant4

    Energy Technology Data Exchange (ETDEWEB)

    Nasseri, Mohammad M. [School of Plasma Physics and Nuclear Fusion, Institute of Nuclear Science and Technology (AEOI), Tehran (Iran, Islamic Republic of)

    2016-06-15

    Transmission X-ray tubes based on carbon nanotube have attracted significant attention recently. In most of these tubes, tungsten is used as the target material. In this article, the well-known simulator Geant4 was used to obtain some of the tungsten target parameters. The optimal thickness for maximum production of usable X-rays when the target is exposed to electron beams of different energies was obtained. The linear variation of optimal thickness of the target for different electron energies was also obtained. The data obtained in this study can be used to design X-ray tubes. A beryllium window was considered for the X-ray tube. The X-ray energy spectra at the moment of production and after passing through the target and window for different electron energies in the 30-110 keV range were also obtained. The results obtained show that with a specific thickness, the target material itself can act as filter, which enables generation of X-rays with a limited energy.

  8. Optimization of power output and study of electron beam energy spread in a Free Electron Laser oscillator

    International Nuclear Information System (INIS)

    Abramovich, A.; Pinhasi, Y.; Yahalom, A.; Bar-Lev, D.; Efimov, S.; Gover, A.

    2001-01-01

    Design of a multi-stage depressed collector for efficient operation of a Free Electron Laser (FEL) oscillator requires knowledge of the electron beam energy distribution. This knowledge is necessary to determine the voltages of the depressed collector electrodes that optimize the collection efficiency and overall energy conversion efficiency of the FEL. The energy spread in the electron beam is due to interaction in the wiggler region, as electrons enter the interaction region at different phases relative to the EM wave. This interaction can be simulated well by a three-dimensional simulation code such as FEL3D. The main adjustable parameters that determine the electron beam energy spread after interaction are the e-beam current, the initial beam energy, and the quality factor of the resonator out-coupling coefficient. Using FEL3D, we study the influence of these parameters on the available radiation power and on the electron beam energy distribution at the undulator exit. Simulations performed for I=1.5 A, E=1.4 MeV, L=20% (Internal loss factor) showed that the highest radiated output power and smallest energy spread are attained for an output coupler transmission coefficient T m congruent with 30%

  9. Transmission electron microscopy study for investigating high-temperature reliability of Ti10W90-based and Ta-based diffusion barriers up to 600 C

    International Nuclear Information System (INIS)

    Budhiman, Nando; Schuermann, Ulrich; Kienle, Lorenz; Jensen, Bjoern; Chemnitz, Steffen; Wagner, Bernhard

    2016-01-01

    Abstractauthoren Transmission electron microscopy (TEM) analysis, including energy dispersive X-ray (EDX) (elemental mapping, line, and point measurements) and energy filtered TEM (EFTEM) methods, is applied to investigate the high temperature reliability, especially material diffusion, of two types of diffusion barriers: titanium-tungsten-based (Ti 10 W 90 -based) and tantalum-based (Ta-based), with nickel (Ni) layer on top. Both barriers were deposited as a form of stacked layers on sili-con (Si) wafers using the physical vapor deposition (PVD) technique. TEM analysis is performed on both barriers before and after annealing (at 600 C for 24 h inside a vacuum chamber). No diffusion of material into the Si substrate as observed. Additionally, only diffusion between the Ni and adjoining Ti 10 W 90 layers, and between Ni and adjoining Ta layers in the Ti 10 W 90 -based and Ta-based barriers, respectively, are observed due to annealing. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  10. Angularly-selective transmission imaging in a scanning electron microscope.

    Science.gov (United States)

    Holm, Jason; Keller, Robert R

    2016-08-01

    This work presents recent advances in transmission scanning electron microscopy (t-SEM) imaging control capabilities. A modular aperture system and a cantilever-style sample holder that enable comprehensive angular selectivity of forward-scattered electrons are described. When combined with a commercially available solid-state transmission detector having only basic bright-field and dark-field imaging capabilities, the advances described here enable numerous transmission imaging modes. Several examples are provided that demonstrate how contrast arising from diffraction to mass-thickness can be obtained. Unanticipated image contrast at some imaging conditions is also observed and addressed. Published by Elsevier B.V.

  11. Electronic transmission through p-n and n-p-n junctions of graphene

    Energy Technology Data Exchange (ETDEWEB)

    Setare, M R [Department of Science of Bijar, University of Kurdistan, Bijar (Iran, Islamic Republic of); Jahani, D, E-mail: rezakord@ipm.co, E-mail: Dariush110@gmail.co [Department of Physics, Razi University, Kermanshah (Iran, Islamic Republic of)

    2010-06-23

    In this paper, we first evaluate the electronic transmission of Dirac fermions into a p-n junction of gapped graphene and show that the final result depends on the sign of the refractive index, n. We also, by considering the appropriate wavefunctions in the region of the electrostatic potential, show that both transmission and the reflection probability turn out to be positive and less than unity instead of the negative transmission and higher than unity reflection coefficient commonly referred to as the Klein paradox. We then obtain the transmission probability corresponding to a special p-n junction for which there exists a region in which the low energy excitations of graphene acquire a finite mass and, interestingly, find that in this case the transmission is independent of the index of refraction, in contrast with the corresponding result for gapped graphene. We then discuss the validity of the solutions reported in some of the papers cited in this work which, considering the Buettiker formula, turn out to lead to the wrong results for conductivity.

  12. Characterization of a direct detection device imaging camera for transmission electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Milazzo, Anna-Clare, E-mail: amilazzo@ncmir.ucsd.edu [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Moldovan, Grigore [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Lanman, Jason [Department of Molecular Biology, The Scripps Research Institute, La Jolla, CA 92037 (United States); Jin, Liang; Bouwer, James C. [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Klienfelder, Stuart [University of California at Irvine, Irvine, CA 92697 (United States); Peltier, Steven T.; Ellisman, Mark H. [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Kirkland, Angus I. [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Xuong, Nguyen-Huu [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States)

    2010-06-15

    The complete characterization of a novel direct detection device (DDD) camera for transmission electron microscopy is reported, for the first time at primary electron energies of 120 and 200 keV. Unlike a standard charge coupled device (CCD) camera, this device does not require a scintillator. The DDD transfers signal up to 65 lines/mm providing the basis for a high-performance platform for a new generation of wide field-of-view high-resolution cameras. An image of a thin section of virus particles is presented to illustrate the substantially improved performance of this sensor over current indirectly coupled CCD cameras.

  13. Characterization of a direct detection device imaging camera for transmission electron microscopy

    International Nuclear Information System (INIS)

    Milazzo, Anna-Clare; Moldovan, Grigore; Lanman, Jason; Jin, Liang; Bouwer, James C.; Klienfelder, Stuart; Peltier, Steven T.; Ellisman, Mark H.; Kirkland, Angus I.; Xuong, Nguyen-Huu

    2010-01-01

    The complete characterization of a novel direct detection device (DDD) camera for transmission electron microscopy is reported, for the first time at primary electron energies of 120 and 200 keV. Unlike a standard charge coupled device (CCD) camera, this device does not require a scintillator. The DDD transfers signal up to 65 lines/mm providing the basis for a high-performance platform for a new generation of wide field-of-view high-resolution cameras. An image of a thin section of virus particles is presented to illustrate the substantially improved performance of this sensor over current indirectly coupled CCD cameras.

  14. Inexpensive read-out for coincident electron spectroscopy with a transmission electron microscope at nanometer scale using micro channel plates and multistrip anodes

    International Nuclear Information System (INIS)

    Hollander, R.W.; Bom, V.R.; Van Eijk, C.W.E.; Faber, J.S.; Hoevers, H.; Kruit, P.

    1994-01-01

    The elemental composition of a sample at nanometer scale is determined by measurement of the characteristic energy of Auger electrons, emitted in coincidence with incoming primary electrons from a microbeam in a scanning transmission electron microscope (STEM). Single electrons are detected with position sensitive detectors, consisting of MicroChannel Plates (MCP) and MultiStrip Anodes (MSA), one for the energy of the Auger electrons (Auger-detector) and one for the energy loss of primary electrons (EELS-detector). The MSAs are sensed with LeCroy 2735DC preamplifiers. The fast readout is based on LeCroy's PCOS III system. On the detection of a coincidence (Event) energy data of Auger and EELS are combined with timing data to an Event word. Event words are stored in list mode in a VME memory module. Blocks of Event words are scanned by transputers in VME and two-dimensional energy histograms are filled using the timing information to obtain a maximal true/accidental ratio. The resulting histograms are stored on disk of a PC-386, which also controls data taking. The system is designed to handle 10 5 Events per second, 90% of which are accidental. In the histograms the ''true'' to ''accidental'' ratio will be 5. The dead time is 15%. ((orig.))

  15. Molecular surface mesh generation by filtering electron density map.

    Science.gov (United States)

    Giard, Joachim; Macq, Benoît

    2010-01-01

    Bioinformatics applied to macromolecules are now widely spread and in continuous expansion. In this context, representing external molecular surface such as the Van der Waals Surface or the Solvent Excluded Surface can be useful for several applications. We propose a fast and parameterizable algorithm giving good visual quality meshes representing molecular surfaces. It is obtained by isosurfacing a filtered electron density map. The density map is the result of the maximum of Gaussian functions placed around atom centers. This map is filtered by an ideal low-pass filter applied on the Fourier Transform of the density map. Applying the marching cubes algorithm on the inverse transform provides a mesh representation of the molecular surface.

  16. Molecular Surface Mesh Generation by Filtering Electron Density Map

    Directory of Open Access Journals (Sweden)

    Joachim Giard

    2010-01-01

    Full Text Available Bioinformatics applied to macromolecules are now widely spread and in continuous expansion. In this context, representing external molecular surface such as the Van der Waals Surface or the Solvent Excluded Surface can be useful for several applications. We propose a fast and parameterizable algorithm giving good visual quality meshes representing molecular surfaces. It is obtained by isosurfacing a filtered electron density map. The density map is the result of the maximum of Gaussian functions placed around atom centers. This map is filtered by an ideal low-pass filter applied on the Fourier Transform of the density map. Applying the marching cubes algorithm on the inverse transform provides a mesh representation of the molecular surface.

  17. Low energy electron scattering from fuels

    International Nuclear Information System (INIS)

    Lopes, M. Cristina A.; Silva, Daniel G.M.; Coelho, Rafael F.; Duque, Humberto V.; Santos, Rodrigo R. dos; Ribeiro, Thiago M.

    2011-01-01

    Full text. Accurate and precise values of absolute total cross section (TCS) represent important information in many scientific and technological applications. In our case, for example, we are motivated to provide such information for electron-fuel collision processes which are specifically relevant to modeling spark ignition in alcohol-fuelled internal combustion engines. Many electron scattering TCS measurements are presently available for a diverse range of atomic and molecular targets. However, lack of data for important bio-molecular targets still remains. Disagreements between the available TCS data for the alcohols have prompted several studies of electron scattering collision of slow electrons with these molecules which are currently important in applications as bio- fuels. This relevance, which has attracted much attention, has been one of the subjects of a recent collaboration between experimental and theoretical groups in the USA and Brazil. Recently this collaboration reported first measurements and calculations of differential cross sections for elastic low-energy (rotationally unresolved) electron scattering by several primary alcohols. In this work we address methanol and ethanol TCSs at low energy range and report additional studies of resonant structure in ethanol using the detection of metastable states produced by electron impact excitation with high energy resolution. We have recently constructed a TCS apparatus in our laboratory at Universidade Federal de Juiz de Fora, Brazil, based on the well-known linear transmission technique. The experimental setup is based on the measurement of the attenuation of a collimated electron beam through a gas cell containing the atoms or molecules to be studied at a given pressure. It consists essentially of an electron gun, a gas cell and an electron energy analyzer composed of an array of decelerating electrostatic lenses, a cylindrical dispersive 127o analyzer and a Faraday cup. To our knowledge, there exist

  18. Low energy electron scattering from fuels

    Energy Technology Data Exchange (ETDEWEB)

    Lopes, M. Cristina A.; Silva, Daniel G.M.; Coelho, Rafael F.; Duque, Humberto V.; Santos, Rodrigo R. dos; Ribeiro, Thiago M. [Universidade Federal de Juiz de Fora (UFJF), MG (Brazil). Dept. de Fisica; Yates, Brent; Hong, Ling; Khakoo, Murtadha A. [California State University at Fullerton, CA (US). Physics Department; Bettega, Marcio H.F. [Universidade Federal do Parana (UFPR), Curitiba, PR (Brazil). Dept. de Fisica; Costa, Romarly F. da [Universidade Federal do ABC (UFABC), Santo Andre, SP (Brazil). Centro de Ciencias Naturais e Humanas; Lima, Marco A.P. [Laboratorio Nacional de Ciencia e Tecnologia do Bioetanol (CTBE/CNPEM), Campinas, SP (Brazil)

    2011-07-01

    Full text. Accurate and precise values of absolute total cross section (TCS) represent important information in many scientific and technological applications. In our case, for example, we are motivated to provide such information for electron-fuel collision processes which are specifically relevant to modeling spark ignition in alcohol-fuelled internal combustion engines. Many electron scattering TCS measurements are presently available for a diverse range of atomic and molecular targets. However, lack of data for important bio-molecular targets still remains. Disagreements between the available TCS data for the alcohols have prompted several studies of electron scattering collision of slow electrons with these molecules which are currently important in applications as bio- fuels. This relevance, which has attracted much attention, has been one of the subjects of a recent collaboration between experimental and theoretical groups in the USA and Brazil. Recently this collaboration reported first measurements and calculations of differential cross sections for elastic low-energy (rotationally unresolved) electron scattering by several primary alcohols. In this work we address methanol and ethanol TCSs at low energy range and report additional studies of resonant structure in ethanol using the detection of metastable states produced by electron impact excitation with high energy resolution. We have recently constructed a TCS apparatus in our laboratory at Universidade Federal de Juiz de Fora, Brazil, based on the well-known linear transmission technique. The experimental setup is based on the measurement of the attenuation of a collimated electron beam through a gas cell containing the atoms or molecules to be studied at a given pressure. It consists essentially of an electron gun, a gas cell and an electron energy analyzer composed of an array of decelerating electrostatic lenses, a cylindrical dispersive 127o analyzer and a Faraday cup. To our knowledge, there exist

  19. Design and implementation of a fs-resolved transmission electron microscope based on thermionic gun technology

    Energy Technology Data Exchange (ETDEWEB)

    Piazza, L., E-mail: luca.piazza@epfl.ch [Laboratory for Ultrafast Microscopy and Electron Scattering (LUMES), ICMP, Ecole Polytechnique Fédérale de Lausanne, CH-1015 Lausanne (Switzerland); Masiel, D.J. [Integrated Dynamic Electron Solutions, Inc., 455 Bolero Drive, Danville, CA 94526 (United States); LaGrange, T.; Reed, B.W. [Condensed Matter and Materials Division Physical and Life Sciences Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States); Barwick, B. [Department of Physics, Trinity College, 300 Summit St., Hartford, CT 06106 (United States); Carbone, Fabrizio [Laboratory for Ultrafast Microscopy and Electron Scattering (LUMES), ICMP, Ecole Polytechnique Fédérale de Lausanne, CH-1015 Lausanne (Switzerland)

    2013-09-23

    Highlights: • We present the implementation of a femtosecond-resolved ultrafast TEM. • This is the first ultrafast TEM based on a thermionic gun geometry. • An additional condenser lens has been used to maximize the electron count. • We achieved a time resolution of about 300 fs and an energy resolution of 1 eV. - Abstract: In this paper, the design and implementation of a femtosecond-resolved ultrafast transmission electron microscope is presented, based on a thermionic gun geometry. Utilizing an additional magnetic lens between the electron acceleration and the nominal condenser lens system, a larger percentage of the electrons created at the cathode are delivered to the specimen without degrading temporal, spatial and energy resolution significantly, while at the same time maintaining the femtosecond temporal resolution. Using the photon-induced near field electron microscopy effect (PINEM) on silver nanowires the cross-correlation between the light and electron pulses was measured, showing the impact of the gun settings and initiating laser pulse duration on the electron bunch properties. Tuneable electron pulses between 300 fs and several ps can be obtained, and an overall energy resolution around 1 eV was achieved.

  20. Energy Conservation in Optical Fibers With Distributed Brick-Walls Filters

    Science.gov (United States)

    Garcia, Javier; Ghozlan, Hassan; Kramer, Gerhard

    2018-05-01

    A band-pass filtering scheme is proposed to mitigate spectral broadening and channel coupling in the Nonlinear Schr\\"odinger (NLS) fiber optic channel. The scheme is modeled by modifying the NLS Equation to include an attenuation profile with multiple brick-wall filters centered at different frequencies. It is shown that this brick-walls profile conserves the total in-band energy of the launch signal. Furthermore, energy fluctuations between the filtered channels are characterized, and conditions on the channel spacings are derived that ensure energy conservation in each channel. The maximum spectral efficiency of such a system is derived, and a constructive rule for achieving it using Sidon sequences is provided.

  1. Power electronics - The key technology for Renewable Energy Systems

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Ma, Ke; Yang, Yongheng

    2014-01-01

    The energy paradigms in many countries (e.g. Germany and Denmark) have experienced a significant change from fossil-based resources to clean renewables (e.g. wind turbines and photovoltaics) in the past few decades. The scenario of highly penetrated renewables is going to be further enhanced...... - Denmark expects to be 100 % fossil-free by 2050. Consequently, it is required that the production, distribution and use of the energy should be as technologically efficient as possible and incentives to save energy at the end-user should also be strengthened. In order to realize the transition smoothly...... and effectively, energy conversion systems, currently based on power electronics technology, will again play an essential role in this energy paradigm shift. Using highly efficient power electronics in power generation, power transmission/distribution and end-user application, together with advanced control...

  2. Energy Based Clutter Filtering for Vector Flow Imaging

    DEFF Research Database (Denmark)

    Villagómez Hoyos, Carlos Armando; Jensen, Jonas; Ewertsen, Caroline

    2017-01-01

    for obtaining vector flow measurements, since the spectra overlaps at high beam-to-flow angles. In this work a distinct approach is proposed, where the energy of the velocity spectrum is used to differentiate among the two signals. The energy based method is applied by limiting the amplitude of the velocity...... spectrum function to a predetermined threshold. The effect of the clutter filtering is evaluated on a plane wave (PW) scan sequence in combination with transverse oscillation (TO) and directional beamforming (DB) for velocity estimation. The performance of the filter is assessed by comparison...

  3. 3D simulation of electron and ion transmission of GEM-based detectors

    Science.gov (United States)

    Bhattacharya, Purba; Mohanty, Bedangadas; Mukhopadhyay, Supratik; Majumdar, Nayana; da Luz, Hugo Natal

    2017-10-01

    Time Projection Chamber (TPC) has been chosen as the main tracking system in several high-flux and high repetition rate experiments. These include on-going experiments such as ALICE and future experiments such as PANDA at FAIR and ILC. Different R&D activities were carried out on the adoption of Gas Electron Multiplier (GEM) as the gas amplification stage of the ALICE-TPC upgrade version. The requirement of low ion feedback has been established through these activities. Low ion feedback minimizes distortions due to space charge and maintains the necessary values of detector gain and energy resolution. In the present work, Garfield simulation framework has been used to study the related physical processes occurring within single, triple and quadruple GEM detectors. Ion backflow and electron transmission of quadruple GEMs, made up of foils with different hole pitch under different electromagnetic field configurations (the projected solutions for the ALICE TPC) have been studied. Finally a new triple GEM detector configuration with low ion backflow fraction and good electron transmission properties has been proposed as a simpler GEM-based alternative suitable for TPCs for future collider experiments.

  4. Soft X-ray multilayers and filters

    CERN Document Server

    Wang Zhan Shan; Tang Wei Xing; Qin Shuji; Zhou Bing; Chen Ling Ya

    2002-01-01

    The periodic and non-periodic multilayers were designed by using a random number to change each layer and a suitable merit function. Ion beam sputtering and magnetron sputtering were used to fabricate various multilayers and beam splitters in soft X-ray range. The characterization of multilayers by small angle X-ray diffraction, Auger electron spectroscopy, Rutherford back scattering spectroscopy and reflectivity illustrated the multilayers had good structures and smooth interlayers. The reflectivity and transmission of a beam splitter is about 5%. The fabrication and transmission properties of Ag, Zr were studied. The Rutherford back scattering spectroscopy and auger electron spectroscopy were used to investigate the contents and distributions of impurities and influence on qualities of filters. The attenuation coefficients were corrected by the data obtained by measurements

  5. Isotope analysis in the transmission electron microscope.

    Science.gov (United States)

    Susi, Toma; Hofer, Christoph; Argentero, Giacomo; Leuthner, Gregor T; Pennycook, Timothy J; Mangler, Clemens; Meyer, Jannik C; Kotakoski, Jani

    2016-10-10

    The Ångström-sized probe of the scanning transmission electron microscope can visualize and collect spectra from single atoms. This can unambiguously resolve the chemical structure of materials, but not their isotopic composition. Here we differentiate between two isotopes of the same element by quantifying how likely the energetic imaging electrons are to eject atoms. First, we measure the displacement probability in graphene grown from either 12 C or 13 C and describe the process using a quantum mechanical model of lattice vibrations coupled with density functional theory simulations. We then test our spatial resolution in a mixed sample by ejecting individual atoms from nanoscale areas spanning an interface region that is far from atomically sharp, mapping the isotope concentration with a precision better than 20%. Although we use a scanning instrument, our method may be applicable to any atomic resolution transmission electron microscope and to other low-dimensional materials.

  6. Use of astronomy filters in fluorescence microscopy.

    Science.gov (United States)

    Piper, Jörg

    2012-02-01

    Monochrome astronomy filters are well suited for use as excitation or suppression filters in fluorescence microscopy. Because of their particular optical design, such filters can be combined with standard halogen light sources for excitation in many fluorescent probes. In this "low energy excitation," photobleaching (fading) or other irritations of native specimens are avoided. Photomicrographs can be taken from living motile fluorescent specimens also with a flash so that fluorescence images can be created free from indistinctness caused by movement. Special filter cubes or dichroic mirrors are not needed for our method. By use of suitable astronomy filters, fluorescence microscopy can be carried out with standard laboratory microscopes equipped with condensers for bright-field (BF) and dark-field (DF) illumination in transmitted light. In BF excitation, the background brightness can be modulated in tiny steps up to dark or black. Moreover, standard industry microscopes fitted with a vertical illuminator for examinations of opaque probes in DF or BF illumination based on incident light (wafer inspections, for instance) can also be used for excitation in epi-illumination when adequate astronomy filters are inserted as excitatory and suppression filters in the illuminating and imaging light path. In all variants, transmission bands can be modulated by transmission shift.

  7. An improved image alignment procedure for high-resolution transmission electron microscopy.

    Science.gov (United States)

    Lin, Fang; Liu, Yan; Zhong, Xiaoyan; Chen, Jianghua

    2010-06-01

    Image alignment is essential for image processing methods such as through-focus exit-wavefunction reconstruction and image averaging in high-resolution transmission electron microscopy. Relative image displacements exist in any experimentally recorded image series due to the specimen drifts and image shifts, hence image alignment for correcting the image displacements has to be done prior to any further image processing. The image displacement between two successive images is determined by the correlation function of the two relatively shifted images. Here it is shown that more accurate image alignment can be achieved by using an appropriate aperture to filter the high-frequency components of the images being aligned, especially for a crystalline specimen with little non-periodic information. For the image series of crystalline specimens with little amorphous, the radius of the filter aperture should be as small as possible, so long as it covers the innermost lattice reflections. Testing with an experimental through-focus series of Si[110] images, the accuracies of image alignment with different correlation functions are compared with respect to the error functions in through-focus exit-wavefunction reconstruction based on the maximum-likelihood method. Testing with image averaging over noisy experimental images from graphene and carbon-nanotube samples, clear and sharp crystal lattice fringes are recovered after applying optimal image alignment. Copyright 2010 Elsevier Ltd. All rights reserved.

  8. In situ disordering of monoclinic titanium monoxide Ti5O5 studied by transmission electron microscope TEM.

    Science.gov (United States)

    Rempel, А А; Van Renterghem, W; Valeeva, А А; Verwerft, M; Van den Berghe, S

    2017-09-07

    The superlattice and domain structures exhibited by ordered titanium monoxide Ti 5 O 5 are disrupted by low energy electron beam irradiation. The effect is attributed to the disordering of the oxygen and titanium sublattices. This disordering is caused by the displacement of both oxygen and titanium atoms by the incident electrons and results in a phase transformation of the monoclinic phase Ti 5 O 5 into cubic B1 titanium monoxide. In order to determine the energies required for the displacement of titanium or oxygen atoms, i.e. threshold displacement energies, a systematic study of the disappearance of superstructure reflections with increasing electron energy and electron bombardment dose has been performed in situ in a transmission electron microscope (TEM). An incident electron energy threshold between 120 and 140 keV has been observed. This threshold can be ascribed to the displacements of titanium atoms with 4 as well as with 5 oxygen atoms as nearest neighbors. The displacement threshold energy of titanium atoms in Ti 5 O 5 corresponding with the observed incident electron threshold energy lies between 6.0 and 7.5 eV. This surprisingly low value can be explained by the presence of either one or two vacant oxygen lattice sites in the nearest neighbors of all titanium atoms.

  9. Low energy electron transport in furfural

    International Nuclear Information System (INIS)

    Lozano, A.I.; Garcia, G.; Krupa, K.; Ferreira da Silva, F.; Limao-Vieira, P.; Blanco, F.; Munoz, A.; Jones, D.B.; Brunger, M.J.

    2017-01-01

    The cyclic configuration of the furfural molecule is similar to the 5-membered ring structure constituting the sugar units of the DNA helix, hence its importance in biology. In this paper, we report on an initial investigation into the transport of electrons through a gas cell containing 1 mtorr of gaseous furfural. Results from our Monte Carlo simulation are implicitly checked against those from a corresponding electron transmission measurement. To enable this simulation a self-consistent cross section data base was constructed. This data base is benchmarked through new total cross section measurements which are also described here. In addition, again to facilitate the simulation, our preferred energy loss distribution function is presented and discussed

  10. Analysis on electronic control unit of continuously variable transmission

    Science.gov (United States)

    Cao, Shuanggui

    Continuously variable transmission system can ensure that the engine work along the line of best fuel economy, improve fuel economy, save fuel and reduce harmful gas emissions. At the same time, continuously variable transmission allows the vehicle speed is more smooth and improves the ride comfort. Although the CVT technology has made great development, but there are many shortcomings in the CVT. The CVT system of ordinary vehicles now is still low efficiency, poor starting performance, low transmission power, and is not ideal controlling, high cost and other issues. Therefore, many scholars began to study some new type of continuously variable transmission. The transmission system with electronic systems control can achieve automatic control of power transmission, give full play to the characteristics of the engine to achieve optimal control of powertrain, so the vehicle is always traveling around the best condition. Electronic control unit is composed of the core processor, input and output circuit module and other auxiliary circuit module. Input module collects and process many signals sent by sensor and , such as throttle angle, brake signals, engine speed signal, speed signal of input and output shaft of transmission, manual shift signals, mode selection signals, gear position signal and the speed ratio signal, so as to provide its corresponding processing for the controller core.

  11. Nucleation of diamond by pure carbon ion bombardment--a transmission electron microscopy study

    International Nuclear Information System (INIS)

    Yao, Y.; Liao, M.Y.; Wang, Z.G.; Lifshitz, Y.; Lee, S.

    2005-01-01

    A cross-sectional high-resolution transmission electron microscopy (HRTEM) study of a film deposited by a 1 keV mass-selected carbon ion beam onto silicon held at 800 deg. C is presented. Initially, a graphitic film with its basal planes perpendicular to the substrate is evolving. The precipitation of nanodiamond crystallites in upper layers is confirmed by HRTEM, selected area electron diffraction, and electron energy loss spectroscopy. The nucleation of diamond on graphitic edges as predicted by Lambrecht et al. [W. R. L. Lambrecht, C. H. Lee, B. Segall, J. C. Angus, Z. Li, and M. Sunkara, Nature, 364 607 (1993)] is experimentally confirmed. The results are discussed in terms of our recent subplantation-based diamond nucleation model

  12. Number transmission of 0.6 and 0.8MeV electrons in elemental materials

    International Nuclear Information System (INIS)

    Harami, Taikan; Takagaki, Torao; Matsuda, Koji; Nakai, Yohta.

    1975-01-01

    The number transmissions of electrons in Be, Al, Cu and Ag were obtained experimentally for well collimated electron beams of 0.6 and 0.8 MeV. Experimental results of the present work join smoothly to the previous ones of 1.0 MeV to 2.0 MeV electrons. The ratios of extrapolated range Rsub(ex) to true range R 0 give generally minimum values near 1 MeV (approximately 2mc 2 ) as well as the stopping power. An investigation was done for empirical equation of the form eta=exp(-xP/CEsup(m)), where E is the incident electron energy, x, penetration depth, and p, C and m are the parameters determined from experimental data. (author)

  13. On artefact-free reconstruction of low-energy (30–250 eV) electron holograms

    Energy Technology Data Exchange (ETDEWEB)

    Latychevskaia, Tatiana, E-mail: tatiana@physik.uzh.ch; Longchamp, Jean-Nicolas; Escher, Conrad; Fink, Hans-Werner

    2014-10-15

    Low-energy electrons (30–250 eV) have been successfully employed for imaging individual biomolecules. The most simple and elegant design of a low-energy electron microscope for imaging biomolecules is a lensless setup that operates in the holographic mode. In this work we address the problem associated with the reconstruction from the recorded holograms. We discuss the twin image problem intrinsic to inline holography and the problem of the so-called biprism-like effect specific to low-energy electrons. We demonstrate how the presence of the biprism-like effect can be efficiently identified and circumvented. The presented sideband filtering reconstruction method eliminates the twin image and allows for reconstruction despite the biprism-like effect, which we demonstrate on both, simulated and experimental examples. - Highlights: • Radiation damage-free imaging of individual biomolecules. • Elimination of the twin image in inline holograms. • Circumventing biprism-like effect in low-energy electron holograms. • Artefact-free reconstructions of low-energy electron holograms.

  14. On artefact-free reconstruction of low-energy (30–250 eV) electron holograms

    International Nuclear Information System (INIS)

    Latychevskaia, Tatiana; Longchamp, Jean-Nicolas; Escher, Conrad; Fink, Hans-Werner

    2014-01-01

    Low-energy electrons (30–250 eV) have been successfully employed for imaging individual biomolecules. The most simple and elegant design of a low-energy electron microscope for imaging biomolecules is a lensless setup that operates in the holographic mode. In this work we address the problem associated with the reconstruction from the recorded holograms. We discuss the twin image problem intrinsic to inline holography and the problem of the so-called biprism-like effect specific to low-energy electrons. We demonstrate how the presence of the biprism-like effect can be efficiently identified and circumvented. The presented sideband filtering reconstruction method eliminates the twin image and allows for reconstruction despite the biprism-like effect, which we demonstrate on both, simulated and experimental examples. - Highlights: • Radiation damage-free imaging of individual biomolecules. • Elimination of the twin image in inline holograms. • Circumventing biprism-like effect in low-energy electron holograms. • Artefact-free reconstructions of low-energy electron holograms

  15. Total electron scattering cross sections for methanol and ethanol at intermediate energies

    International Nuclear Information System (INIS)

    Silva, D G M; Tejo, T; Lopes, M C A; Muse, J; Romero, D; Khakoo, M A

    2010-01-01

    Absolute total cross section (TCS) measurements of electron scattering from gaseous methanol and ethanol molecules are reported for impact energies from 60 to 500 eV, using the linear transmission method. The attenuation of intensity of a collimated electron beam through the target volume is used to determine the absolute TCS for a given impact energy, using the Beer-Lambert law to first approximation. Besides these experimental measurements, we have also determined TCS using the additivity rule.

  16. Ponderomotive phase plate for transmission electron microscopes

    Science.gov (United States)

    Reed, Bryan W [Livermore, CA

    2012-07-10

    A ponderomotive phase plate system and method for controllably producing highly tunable phase contrast transfer functions in a transmission electron microscope (TEM) for high resolution and biological phase contrast imaging. The system and method includes a laser source and a beam transport system to produce a focused laser crossover as a phase plate, so that a ponderomotive potential of the focused laser crossover produces a scattering-angle-dependent phase shift in the electrons of the post-sample electron beam corresponding to a desired phase contrast transfer function.

  17. Power Electronics for Renewable Energy Systems - Status and Trends

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Ma, Ke; Yang, Yongheng

    2014-01-01

    electronics in generation, transmission/distribution and end-user application, together with advanced controls, can pave the way for renewable energy resources. In view of this, some of the most promising renewable candidates like wind power and photovoltaic, which are becoming a significant part...... in the electricity production, are explored in this paper. Issues like technology demands, power converter topologies, and control structures are addressed. Some special focuses are also paid on the emerging trends in power electronics development for those systems....

  18. Composition measurement in substitutionally disordered materials by atomic resolution energy dispersive X-ray spectroscopy in scanning transmission electron microscopy.

    Science.gov (United States)

    Chen, Z; Taplin, D J; Weyland, M; Allen, L J; Findlay, S D

    2017-05-01

    The increasing use of energy dispersive X-ray spectroscopy in atomic resolution scanning transmission electron microscopy invites the question of whether its success in precision composition determination at lower magnifications can be replicated in the atomic resolution regime. In this paper, we explore, through simulation, the prospects for composition measurement via the model system of Al x Ga 1-x As, discussing the approximations used in the modelling, the variability in the signal due to changes in configuration at constant composition, and the ability to distinguish between different compositions. Results are presented in such a way that the number of X-ray counts, and thus the expected variation due to counting statistics, can be gauged for a range of operating conditions. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Optimization of Monochromated TEM for Ultimate Resolution Imaging and Ultrahigh Resolution Electron Energy Loss Spectroscopy

    KAUST Repository

    Lopatin, Sergei; Cheng, Bin; Liu, Wei-Ting; Tsai, Meng-Lin; He, Jr-Hau; Chuvilin, Andrey

    2017-01-01

    The performance of a monochromated transmission electron microscope with Wien type monochromator is optimized to achieve an extremely narrow energy spread of electron beam and an ultrahigh energy resolution with spectroscopy. The energy spread in the beam is improved by almost an order of magnitude as compared to specified values. The optimization involves both the monochromator and the electron energy loss detection system. We demonstrate boosted capability of optimized systems with respect to ultra-low loss EELS and sub-angstrom resolution imaging (in a combination with spherical aberration correction).

  20. Optimization of Monochromated TEM for Ultimate Resolution Imaging and Ultrahigh Resolution Electron Energy Loss Spectroscopy

    KAUST Repository

    Lopatin, Sergei

    2017-09-01

    The performance of a monochromated transmission electron microscope with Wien type monochromator is optimized to achieve an extremely narrow energy spread of electron beam and an ultrahigh energy resolution with spectroscopy. The energy spread in the beam is improved by almost an order of magnitude as compared to specified values. The optimization involves both the monochromator and the electron energy loss detection system. We demonstrate boosted capability of optimized systems with respect to ultra-low loss EELS and sub-angstrom resolution imaging (in a combination with spherical aberration correction).

  1. Electronic Biometric Transmission Specification. Version 1.2

    Science.gov (United States)

    2006-11-08

    Prescribed by ANSI Std Z39-18 Electronic Biometric Transmission Specification DIN: DOD_BTF_TS_EBTS_ Nov06_01.02.00 i Revision History Revision...contains: • the ORI • a Greenwich Mean (a.k.a. Zulu or UTC) date/time stamp • a code for the software used at the point of collection/transmission...long names and would generally include the tribe name. Subfield 1 Item 1 Character Type AS Characters 1 to 50 Special Characters: Any 7-bit non

  2. Transmission electron microscopy in micro-nanoelectronics

    CERN Document Server

    Claverie, Alain

    2013-01-01

    Today, the availability of bright and highly coherent electron sources and sensitive detectors has radically changed the type and quality of the information which can be obtained by transmission electron microscopy (TEM). TEMs are now present in large numbers not only in academia, but also in industrial research centers and fabs.This book presents in a simple and practical way the new quantitative techniques based on TEM which have recently been invented or developed to address most of the main challenging issues scientists and process engineers have to face to develop or optimize sem

  3. In-situ transmission electron microscopy growth of nanoparticles under extreme conditions

    International Nuclear Information System (INIS)

    Luce, F. P.; Azevedo, G. de M.; Baptista, D. L.; Zawislak, F. C.; Oliviero, E.; Fichtner, P. F. P.

    2016-01-01

    The formation and time resolved behavior of individual Pb nanoparticles embedded in silica have been studied by in-situ transmission electron microscopy observations at high temperatures (400–1100 °C) and under 200 keV electron irradiation. It is shown that under such extreme conditions, nanoparticles can migrate at long distances presenting a Brownian-like behavior and eventually coalesce. The particle migration phenomenon is discussed considering the influence of the thermal energy and the electron irradiation effects on the atomic diffusion process which is shown to control particle migration. These results and comparison with ex-situ experiments tackle the stability and the microstructure evolution of nanoparticles systems under extreme conditions. It elucidates on the effects of energetic particle irradiation-annealing treatments either as a tool or as a detrimental issue that could hamper their long-term applications in radiation-harsh environments such as in space or nuclear sectors

  4. A nonlinear filtering algorithm for denoising HR(S)TEM micrographs

    International Nuclear Information System (INIS)

    Du, Hongchu

    2015-01-01

    Noise reduction of micrographs is often an essential task in high resolution (scanning) transmission electron microscopy (HR(S)TEM) either for a higher visual quality or for a more accurate quantification. Since HR(S)TEM studies are often aimed at resolving periodic atomistic columns and their non-periodic deviation at defects, it is important to develop a noise reduction algorithm that can simultaneously handle both periodic and non-periodic features properly. In this work, a nonlinear filtering algorithm is developed based on widely used techniques of low-pass filter and Wiener filter, which can efficiently reduce noise without noticeable artifacts even in HR(S)TEM micrographs with contrast of variation of background and defects. The developed nonlinear filtering algorithm is particularly suitable for quantitative electron microscopy, and is also of great interest for beam sensitive samples, in situ analyses, and atomic resolution EFTEM. - Highlights: • A nonlinear filtering algorithm for denoising HR(S)TEM images is developed. • It can simultaneously handle both periodic and non-periodic features properly. • It is particularly suitable for quantitative electron microscopy. • It is of great interest for beam sensitive samples, in situ analyses, and atomic resolution EFTEM

  5. Catalysts under Controlled Atmospheres in the Transmission Electron Microscope

    DEFF Research Database (Denmark)

    Hansen, Thomas Willum; Wagner, Jakob Birkedal

    2014-01-01

    of resolution. Using suitably clean gases, modified pumping schemes, and short pathways through dense gas regions, these issues are now circumvented. Here we provide an account of best practice using environmental transmission electron microscopy on catalytic systems illustrated using select examples from......Over time, there has been an increasing interest in observing catalysts in their operating environment at high spatial resolution and ultimately to determine the structure of a catalytically active surface. One tool with the potential to do exactly this in direct space is the transmission electron...

  6. Filtering peripheral high temperature electrons in a cylindrical rf-driven plasmas by an axisymmetric radial magnetic field

    Science.gov (United States)

    Akahoshi, Hikaru; Takahashi, Kazunori; Ando, Akira

    2018-03-01

    High temperature electrons generated near a radial wall of a cylindrical source tube in a radiofrequency (rf) inductively-coupled plasma is filtered by an axisymmetric radial magnetic field formed near the source exit by locating annular permanent magnets, where the axial magnetic field strength in the radially central region is fairly uniform inside the source tube and is close to zero near the source exit. The source is operated at 3 mTorr in argon and the rf antenna is powered by a 13.56 MHz and 400 W rf generator. Measurement of electron energy probability functions shows the presence of the peripheral high temperature electrons inside the source, while the temperature of the peripheral electrons downstream of the source is observed to be reduced.

  7. The design of a 3 GHz thermionic RF-gun and energy filter for MAX-lab

    CERN Document Server

    Anderberg, B; Demirkan, M; Eriksson, M; Malmgren, L; Werin, S

    2002-01-01

    A new pre-injector has been designed for the MAX-laboratory. It consists of an RF-gun and a magnetic energy filter. The newly designed RF-gun geometry will be operated at 3 GHz in the thermionic mode using a BaO cathode. The pre-injector will provide a 2.3 MeV electron beam in 3 ps micro pulses to a new injector system currently under construction.

  8. Microwave energy transmission system for solar power station

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, Hiroshi

    1988-05-05

    This paper deals with a microwave wireless energy transmission system which will be required for a solar power station under investigation, particularly, it describes its foundation and future investigation. It is supposed that for realization of microwave wireless transmission techniques, it is most important to investigate the effect of strong microwave beams on a plasma environment, establish control techniques for microwave beams in which a retro-directive system is combined with a computer control system, and develop a semiconductor transmission module. Institute of Space and Astronautical Science (Japan) made an experiment on the effect of microwaves on ionospheric plasma by using an observatory rocket. The institute has planned to make an experiment on a microwave energy transmission system which is to be mounted to a small-scale space flyer unit in order to examine the control of microwave beams and 10 KW power transmission, in addition to investigation on the interaction of microwave energy beams with a plasma environment. (4 figs, 3 tabs, 20 refs)

  9. Optimum filter selection for Dual Energy X-ray Applications through Analytical Modeling

    International Nuclear Information System (INIS)

    Koukou, V; Martini, N; Sotiropoulou, P; Nikiforidis, G; Michail, C; Kalyvas, N; Kandarakis, I; Fountos, G

    2015-01-01

    In this simulation study, an analytical model was used in order to determine the optimal acquisition parameters for a dual energy breast imaging system. The modeled detector system, consisted of a 33.91mg/cm 2 Gd 2 O 2 S:Tb scintillator screen, placed in direct contact with a high resolution CMOS sensor. Tungsten anode X-ray spectra, filtered with various filter materials and filter thicknesses were examined for both the low- and high-energy beams, resulting in 3375 combinations. The selection of these filters was based on their K absorption edge (K-edge filtering). The calcification signal-to-noise ratio (SNR tc ) and the mean glandular dose (MGD) were calculated. The total mean glandular dose was constrained to be within acceptable levels. Optimization was based on the maximization of the SNR tc /MGD ratio. The results showed that the optimum spectral combination was 40kVp with added beam filtration of 100 μm Ag and 70kVp Cu filtered spectrum of 1000 μm for the low- and high-energy, respectively. The minimum detectable calcification size was 150 μm. Simulations demonstrate that this dual energy X-ray technique could enhance breast calcification detection. (paper)

  10. Observation of superconducting fluxons by transmission electron microscopy: A Fourier space approach to calculate the electron optical phase shifts and images

    International Nuclear Information System (INIS)

    Beleggia, M.; Pozzi, G.

    2001-01-01

    An approach is presented for the calculation of the electron optical phase shift experienced by high-energy electrons in a transmission electron microscope, when they interact with the magnetic field associated with superconducting fluxons in a thin specimen tilted with respect to the beam. It is shown that by decomposing the vector potential in its Fourier components and by calculating the phase shift of each component separately, it is possible to obtain the Fourier transform of the electron optical phase shift, which can be inverted either analytically or numerically. It will be shown how this method can be used to recover the result, previously obtained by the real-space approach, relative to the case of a straight flux tube perpendicular to the specimen surfaces. Then the method is applied to the case of a London fluxon in a thin film, where the bending and the broadening of the magnetic-field lines due to the finite specimen thickness are now correctly taken into account and not treated approximately by means of a parabolic fit. Finally, it will be shown how simple models for the pancake structure of the fluxon can be analyzed within this framework and the main features of electron transmission images predicted

  11. Transmission Electron Microscopy Studies of Electron-Selective Titanium Oxide Contacts in Silicon Solar Cells

    KAUST Repository

    Ali, Haider; Yang, Xinbo; Weber, Klaus; Schoenfeld, Winston V.; Davis, Kristopher O.

    2017-01-01

    In this study, the cross-section of electron-selective titanium oxide (TiO2) contacts for n-type crystalline silicon solar cells were investigated by transmission electron microscopy. It was revealed that the excellent cell efficiency of 21

  12. Energy Reconstruction and high-speed Data Transmission with FPGAs for the Upgrade of the ATLAS Liquid Argon Calorimeter at LHC

    CERN Document Server

    Stärz, Steffen

    The Liquid Argon calorimeter of the ATLAS detector at CERN near Geneva is equipped with improved readout and trigger electronics for the operation at higher luminosity LHC in the frame of several upgrades (Phase-0, I, and II). Special attention is given to an early digitisation of detector raw data and their following digital data transmission and processing via FPGAs already for the Level-1 trigger. The upgrades additionally foresee to provide higher spatial granularity information for the Level-1 trigger in order to improve its performance for low momentum single particles at increased collision rates. The first part of this dissertation contains the development and implementation of a modular detector simulation framework, AREUS, which allows to analyse different filter algorithms for the energy reconstruction as well as their performance with respect to the expected digitised detector raw data. In this detector simulation framework the detailed algorithmic functionality of the FPGAs has been taken into ac...

  13. Low-bias flat band-stop filter based on velocity modulated gaussian graphene superlattice

    Science.gov (United States)

    Sattari-Esfahlan, S. M.; Shojaei, S.

    2018-05-01

    Transport properties of biased planar Gaussian graphene superlattice (PGGSL) with Fermi velocity barrier is investigated by transfer matrix method (TMM). It is observed that enlargement of bias voltage over miniband width breaks the miniband to WSLs leads to suppressing resonant tunneling. Transmission spectrum shows flat wide stop-band property controllable by external bias voltage with stop-band width of near 200 meV. The simulations demonstrate that strong velocity barriers prevent tunneling of Dirac electrons leading to controllable enhancement of stop-band width. By increasing ratio of Fermi velocity in barriers to wells υc stop-band width increase. As wide transmission stop-band width (BWT) of filter is tunable from 40 meV to 340 meV is obtained by enhancing ratio of υc from 0.2 to 1.5, respectively. Proposed structure suggests easy tunable wide band-stop electronic filter with a modulated flat stop-band characteristic by height of electrostatic barrier and structural parameters. Robust sensitivity of band width to velocity barrier intensity in certain bias voltages and flat band feature of proposed filter may be opens novel venue in GSL based flat band low noise filters and velocity modulation devices.

  14. Investigation of superthermal asymmetric electron distributions using electron cyclotron wave transmission in tokamaks

    International Nuclear Information System (INIS)

    Giruzzi, G.; Fidone, I.; Marcha, M.J.

    1991-01-01

    The asymmetric electron distribution generated during lower hybrid current drive has been computed using a 3-D Fokker-Planck code. The superthermal tail and the resulting current are generally a combination of two components streaming in opposite toroidal directions. An appropriate diagnostic method for experimental investigation of the two superthermal populations is wave transmission of two equivalent rays with equal and opposite values of the refractive index. These equivalent rays can be realized by launching the waves from symmetric positions with respect ot the equatorial plane at equal and opposite angles in the toroidal direction. Using an appropriate ray tracing code, the damping of the two rays is computed and it is shown that it results from electrons with opposite parallel velocities. The differential transmission is then a measure of the overall asymmetry of the electron momentum distribution. (author). 12 refs, 8 figs

  15. Spin dependent transport of hot electrons through ultrathin epitaxial metallic films

    Energy Technology Data Exchange (ETDEWEB)

    Heindl, Emanuel

    2010-06-23

    In this work relaxation and transport of hot electrons in thin single crystalline metallic films is investigated by Ballistic Electron Emission Microscopy. The electron mean free paths are determined in an energy interval of 1 to 2 eV above the Fermi level. While fcc Au-films appear to be quite transmissive for hot electrons, the scattering lengths are much shorter for the ferromagnetic alloy FeCo revealing, furthermore, a strong spin asymmetry in hot electron transport. Additional information is gained from temperature dependent studies in combination with golden rule approaches in order to disentangle the impact of several relaxation and transport properties. It is found that bcc Fe-films are much less effective in spin filtering than films made of the FeCo-alloy. (orig.)

  16. Simpplified extended Kalman filter phase noise estimation for CO-OFDM transmissions.

    Science.gov (United States)

    Nguyen, Tu T; Le, Son T; Wuilpart, Marc; Yakusheva, Tatiana; Mégret, Patrice

    2017-10-30

    We propose a flexible simplified extended Kalman filter (S-EKF) scheme that can be applied in both pilot-aided and blind modes for phase noise compensation in 16-QAM CO-OFDM transmission systems employing a small-to-moderate number of subcarriers. The performance of the proposed algorithm is evaluated and compared with conventional pilot-aided (PA) and blind phase search (BPS) methods via extensive an Monte Carlo simulation in a back-to-back configuration and with a dual polarization fiber transmission. For 64 subcarrier 32 Gbaud 16-QAM CO-OFDM systems with 200 kHz combined laser linewidths, an optical signal-to-noise ratio penalty as low as 1 dB can be achieved with the proposed S-EKF scheme using only 2 pilots in the pilot-aided mode and just 4 inputs in the blind mode, resulting in a spectrally efficient enhancement by a factor of 3 and a computational effort reduction by a factor of more than 50 in comparison with the conventional PA and the BPS methods, respectively.

  17. Electron-beam-induced reduction of Fe3+ in iron phosphate dihydrate, ferrihydrite, haemosiderin and ferritin as revealed by electron energy-loss spectroscopy

    International Nuclear Information System (INIS)

    Pan, Ying-Hsi; Vaughan, Gareth; Brydson, Rik; Bleloch, Andrew; Gass, Mhairi; Sader, Kasim; Brown, Andy

    2010-01-01

    The effect of high-energy electron irradiation on ferritin/haemosiderin cores (in an iron-overloaded human liver biopsy), its mineral analogue; six-line ferrihydrite (6LFh), and iron phosphate dihydrate (which has similar octahedral ferric iron to oxygen coordination to that in ferrihydrite and ferritin/haemosiderin cores) has been investigated using electron energy-loss spectroscopy (EELS). Fe L 2,3 -ionisation edges were recorded on two types of electron microscope: a 200 keV transmission electron microscope (TEM) and a 100 keV scanning transmission electron microscope (STEM), in order to investigate the damage mechanisms in operation and to establish a methodology for minimum specimen alteration during analytical electron microscopic characterisation. A specimen damage mechanism dominated by radiolysis that results in the preferential loss of iron co-ordinating ligands (O, OH and H 2 O) is discussed. The net result of irradiation is structural re-organisation and reduction of iron within the iron hydroxides. At sufficiently low electron fluence and particularly in the lower incident energy, finer probe diameter STEM, the alteration is shown to be minimal. All the materials examined exhibit damage which as a function of cumulative fluence is best fitted by an inverse power-law, implying that several chemical and structural changes occur in response to the electron beam and we suggest that these are governed by secondary processes arising from the primary ionisation event. This work affirms that electron fluence and current density should be considered when measuring mixed valence ratios with EELS.

  18. Scanning transmission low-energy electron microscopy

    Czech Academy of Sciences Publication Activity Database

    Müllerová, Ilona; Hovorka, Miloš; Konvalina, Ivo; Unčovský, M.; Frank, Luděk

    2011-01-01

    Roč. 55, č. 4 (2011), 2:1-6 ISSN 0018-8646 R&D Projects: GA AV ČR IAA100650902; GA MŠk ED0017/01/01 Institutional research plan: CEZ:AV0Z20650511 Keywords : TEM * STEM * SEM Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.723, year: 2011

  19. Development of the Atomic-Resolution Environmental Transmission Electron Microscope

    DEFF Research Database (Denmark)

    Gai, Pratibha L.; Boyes, Edward D.; Yoshida, Kenta

    2016-01-01

    The development of the novel atomic-resolution environmental transmission electron microscope (atomic-resolution ETEM) for directly probing dynamic gas–solid reactions in situ at the atomic level under controlled reaction conditions consisting of gas environment and elevated temperatures is descr......The development of the novel atomic-resolution environmental transmission electron microscope (atomic-resolution ETEM) for directly probing dynamic gas–solid reactions in situ at the atomic level under controlled reaction conditions consisting of gas environment and elevated temperatures...... is used to study steels, graphene, nanowires, etc. In this chapter, the experimental setup of the microscope column and its peripherals are described....

  20. Heating without heat: Thermodynamics of passive energy filters between finite systems.

    Science.gov (United States)

    Muñoz-Tapia, R; Brito, R; Parrondo, J M R

    2017-09-01

    Passive filters allowing the exchange of particles in a narrow band of energy are currently used in microrefrigerators and energy transducers. In this Rapid Communication, we analyze their thermal properties using linear irreversible thermodynamics and kinetic theory, and discuss a striking phenomenon: the possibility of simultaneously increasing or decreasing the temperatures of two systems without any supply of energy. This occurs when the filter induces a flow of particles whose energy is between the average energies of the two systems. Here we show that this selective transfer of particles does not need the action of any sort of Maxwell demon and can be carried out by passive filters without compromising the second law of thermodynamics. This phenomenon allows us to design cycles between two reservoirs at temperatures T_{1}

  1. Measurement of high-energy electrons by means of a Cherenkov detector in ISTTOK tokamak

    Energy Technology Data Exchange (ETDEWEB)

    Jakubowski, L., E-mail: lech.Jjakubowski@ipj.gov.p [Andrzej Soltan Institute for Nuclear Studies (IPJ), 05-400 Otwock-Swierk (Poland); Zebrowski, J. [Andrzej Soltan Institute for Nuclear Studies (IPJ), 05-400 Otwock-Swierk (Poland); Plyusnin, V.V. [Association Euratom/IST, Instituto de Plasmas e Fusao Nuclear, Instituto Superior Tecnico, Av. Rovisco Pais, 1049 - 001 Lisboa (Portugal); Malinowski, K.; Sadowski, M.J.; Rabinski, M. [Andrzej Soltan Institute for Nuclear Studies (IPJ), 05-400 Otwock-Swierk (Poland); Fernandes, H.; Silva, C.; Duarte, P. [Association Euratom/IST, Instituto de Plasmas e Fusao Nuclear, Instituto Superior Tecnico, Av. Rovisco Pais, 1049 - 001 Lisboa (Portugal)

    2010-10-15

    The paper concerns detectors of the Cherenkov radiation which can be used to measure high-energy electrons escaping from short-living plasma. Such detectors have high temporal (about 1 ns) and spatial (about 1 mm) resolution. The paper describes a Cherenkov-type detector which was designed, manufactured and installed in the ISTTOK tokamak in order to measure fast runaway electrons. The radiator of that detector was made of an aluminium nitride (AlN) tablet with a light-tight filter on its front surface. Cherenkov signals from the radiator were transmitted through an optical cable to a fast photomultiplier. It made possible to perform direct measurements of the runaway electrons of energy above 80 keV. The measured energy values and spatial characteristics of the recorded electrons appeared to be consistent with results of numerical modelling of the runaway electron generation process in the ISTTOK tokamak.

  2. Counting graphene layers with very slow electrons

    Energy Technology Data Exchange (ETDEWEB)

    Frank, Ludĕk; Mikmeková, Eliška; Müllerová, Ilona [Institute of Scientific Instruments AS CR, v.v.i., Královopolská 147, 61264 Brno (Czech Republic); Lejeune, Michaël [Laboratoire de Physique de la Matière Condensée, Faculté des Sciences d' Amiens, Universite de Picardie Jules Verne, 33 rue Saint Leu, 80039 Amiens Cedex 2 (France)

    2015-01-05

    The study aimed at collection of data regarding the transmissivity of freestanding graphene for electrons across their full energy scale down to the lowest energies. Here, we show that the electron transmissivity of graphene drops with the decreasing energy of the electrons and remains below 10% for energies below 30 eV, and that the slow electron transmissivity value is suitable for reliable determination of the number of graphene layers. Moreover, electrons incident below 50 eV release adsorbed hydrocarbon molecules and effectively clean graphene in contrast to faster electrons that decompose these molecules and create carbonaceous contamination.

  3. Low-energy electron irradiation induced top-surface nanocrystallization of amorphous carbon film

    Science.gov (United States)

    Chen, Cheng; Fan, Xue; Diao, Dongfeng

    2016-10-01

    We report a low-energy electron irradiation method to nanocrystallize the top-surface of amorphous carbon film in electron cyclotron resonance plasma system. The nanostructure evolution of the carbon film as a function of electron irradiation density and time was examined by transmission electron microscope (TEM) and Raman spectroscopy. The results showed that the electron irradiation gave rise to the formation of sp2 nanocrystallites in the film top-surface within 4 nm thickness. The formation of sp2 nanocrystallite was ascribed to the inelastic electron scattering in the top-surface of carbon film. The frictional property of low-energy electron irradiated film was measured by a pin-on-disk tribometer. The sp2 nanocrystallized top-surface induced a lower friction coefficient than that of the original pure amorphous film. This method enables a convenient nanocrystallization of amorphous surface.

  4. Great Plains Wind Energy Transmission Development Project

    Energy Technology Data Exchange (ETDEWEB)

    Brad G. Stevens, P.E.; Troy K. Simonsen; Kerryanne M. Leroux

    2012-06-09

    In fiscal year 2005, the Energy & Environmental Research Center (EERC) received funding from the U.S. Department of Energy (DOE) to undertake a broad array of tasks to either directly or indirectly address the barriers that faced much of the Great Plains states and their efforts to produce and transmit wind energy at the time. This program, entitled Great Plains Wind Energy Transmission Development Project, was focused on the central goal of stimulating wind energy development through expansion of new transmission capacity or development of new wind energy capacity through alternative market development. The original task structure was as follows: Task 1 - Regional Renewable Credit Tracking System (later rescoped to Small Wind Turbine Training Center); Task 2 - Multistate Transmission Collaborative; Task 3 - Wind Energy Forecasting System; and Task 4 - Analysis of the Long-Term Role of Hydrogen in the Region. As carried out, Task 1 involved the creation of the Small Wind Turbine Training Center (SWTTC). The SWTTC, located Grand Forks, North Dakota, consists of a single wind turbine, the Endurance S-250, on a 105-foot tilt-up guyed tower. The S-250 is connected to the electrical grid on the 'load side' of the electric meter, and the power produced by the wind turbine is consumed locally on the property. Establishment of the SWTTC will allow EERC personnel to provide educational opportunities to a wide range of participants, including grade school through college-level students and the general public. In addition, the facility will allow the EERC to provide technical training workshops related to the installation, operation, and maintenance of small wind turbines. In addition, under Task 1, the EERC hosted two small wind turbine workshops on May 18, 2010, and March 8, 2011, at the EERC in Grand Forks, North Dakota. Task 2 involved the EERC cosponsoring and aiding in the planning of three transmission workshops in the midwest and western regions. Under Task

  5. Filtering peripheral high temperature electrons in a cylindrical rf-driven plasmas by an axisymmetric radial magnetic field

    Directory of Open Access Journals (Sweden)

    Hikaru Akahoshi

    2018-03-01

    Full Text Available High temperature electrons generated near a radial wall of a cylindrical source tube in a radiofrequency (rf inductively-coupled plasma is filtered by an axisymmetric radial magnetic field formed near the source exit by locating annular permanent magnets, where the axial magnetic field strength in the radially central region is fairly uniform inside the source tube and is close to zero near the source exit. The source is operated at 3 mTorr in argon and the rf antenna is powered by a 13.56 MHz and 400 W rf generator. Measurement of electron energy probability functions shows the presence of the peripheral high temperature electrons inside the source, while the temperature of the peripheral electrons downstream of the source is observed to be reduced.

  6. HEPA filter testing - Department of Energy Office of Nuclear Energy Facilities

    Energy Technology Data Exchange (ETDEWEB)

    Sherwood, G.L. Jr. [Department of Energy, Washington, DC (United States)

    1995-02-01

    This paper provides the background of, and some results from, a review of HEPA filter testing during 1993 at selected Department of Energy (DOE) facilities. Recommendations for improvements in standards resulting from the review are also presented.

  7. A condensed matter electron momentum spectrometer with parallel detection in energy and momentum

    Energy Technology Data Exchange (ETDEWEB)

    Storer, P; Caprari, R S; Clark, S A.C.; Vos, M; Weigold, E

    1994-03-01

    An electron momentum spectrometer has been constructed which measures electron binding energies and momenta by fully determining the kinematics of the incident, scattered and ejected electrons resulting from (e,2e) ionizing collisions in a thin solid foil. The spectrometer operates with incident beam energies of 20-30 keV in an asymmetric, non-coplanar scattering geometry. Bethe ridge kinematics are used. The technique uses transmission through the target foil, but it is most sensitive to the surface from which the 1.2 keV electrons emerge, to a depth of about 5 nm. Scattered and ejected electron energies and azimuthal angles are detected in parallel using position sensitive detection, yielding true coincidence count rates of 6 Hz from a 5.5 nm thick evaporated carbon target and an incident beam current of around 100 nA. The energy resolution is approximately 1.3 eV and momentum resolution approximately 0.15 a{sub 0}{sup -1}. The energy resolution could readily be improved by monochromating the incident electron beam. 28 refs., 15 figs.

  8. A condensed matter electron momentum spectrometer with parallel detection in energy and momentum

    International Nuclear Information System (INIS)

    Storer, P.; Caprari, R.S.; Clark, S.A.C.; Vos, M.; Weigold, E.

    1994-03-01

    An electron momentum spectrometer has been constructed which measures electron binding energies and momenta by fully determining the kinematics of the incident, scattered and ejected electrons resulting from (e,2e) ionizing collisions in a thin solid foil. The spectrometer operates with incident beam energies of 20-30 keV in an asymmetric, non-coplanar scattering geometry. Bethe ridge kinematics are used. The technique uses transmission through the target foil, but it is most sensitive to the surface from which the 1.2 keV electrons emerge, to a depth of about 5 nm. Scattered and ejected electron energies and azimuthal angles are detected in parallel using position sensitive detection, yielding true coincidence count rates of 6 Hz from a 5.5 nm thick evaporated carbon target and an incident beam current of around 100 nA. The energy resolution is approximately 1.3 eV and momentum resolution approximately 0.15 a 0 -1 . The energy resolution could readily be improved by monochromating the incident electron beam. 28 refs., 15 figs

  9. Pricing and Capacity Planning Problems in Energy Transmission Networks

    DEFF Research Database (Denmark)

    Villumsen, Jonas Christoffer

    strategy. In the Nordic electricity system a market with zonal prices is adopted. We consider the problem of designing zones in an optimal way explicitly considering uncertainty. Finally, we formulate the integrated problem of pipeline capacity expansion planning and transmission pricing in natural gas...... necessitates a radical change in the way we plan and operate energy systems. Another paradigm change which began in the 1990’s for electricity systems is that of deregulation. This has led to a variety of different market structures implemented across the world. In this thesis we discuss capacity planning...... and transmission pricing problems in energy transmission networks. Although the modelling framework applies to energy networks in general, most of the applications discussed concern the transmission of electricity. A number of the problems presented involves transmission switching, which allows the operator...

  10. Transmission electron microscope CCD camera

    Science.gov (United States)

    Downing, Kenneth H.

    1999-01-01

    In order to improve the performance of a CCD camera on a high voltage electron microscope, an electron decelerator is inserted between the microscope column and the CCD. This arrangement optimizes the interaction of the electron beam with the scintillator of the CCD camera while retaining optimization of the microscope optics and of the interaction of the beam with the specimen. Changing the electron beam energy between the specimen and camera allows both to be optimized.

  11. Some thoughts on source monochromation and the implications for electron energy loss spectroscopy

    CERN Document Server

    Brydson, R; Brown, A

    2003-01-01

    We briefly outline the factors determining the intrinsic widths of features in electron energy loss near edge structure (ELNES) measured by electron energy loss spectroscopy (EELS) in the transmission electron microscope (TEM). We have made estimates of the differing contributions of both the initial and final state lifetime effects in the ELNES ionisation processes and also show how these may be combined with the instrumental energy resolution. We discuss the potential benefits of source monochromation for ELNES measurements via a comparison of these theoretical estimates with experimental spectra from the literature. We show that for certain core level excitations, solid state broadening mechanisms may be the fundamental limiting factor for resolving fine detail in ELNES. (orig.)

  12. A simple way to obtain backscattered electron images in a scanning transmission electron microscope.

    Science.gov (United States)

    Tsuruta, Hiroki; Tanaka, Shigeyasu; Tanji, Takayoshi; Morita, Chiaki

    2014-08-01

    We have fabricated a simple detector for backscattered electrons (BSEs) and incorporated the detector into a scanning transmission electron microscope (STEM) sample holder. Our detector was made from a 4-mm(2) Si chip. The fabrication procedure was easy, and similar to a standard transmission electron microscopy (TEM) sample thinning process based on ion milling. A TEM grid containing particle objects was fixed to the detector with a silver paste. Observations were carried out using samples of Au and latex particles at 75 and 200 kV. Such a detector provides an easy way to obtain BSE images in an STEM. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Graphene valley pseudospin filter using an extended line defect

    Science.gov (United States)

    Gunlycke, Daniel; White, Carter

    2011-03-01

    Although graphene exhibits excellent electron and thermal transport properties, it does not have an intrinsic band gap, required to use graphene as a replacement material for silicon and other semiconductors in conventional electronics. The band structure of graphene with its two cones near the Fermi level, however, offers opportunities to develop non-traditional applications. One such avenue is to exploit the valley degeneracy in graphene to develop valleytronics. A central component in valleytronics is the valley filter, just as the spin filter is central in spintronics. Herein, we present a two-dimensional valley filter based on scattering of electrons and holes off a recently observed extended line defect [Nat. Nanotech.5, 326 (2010)] within graphene. The transmission probability depends strongly on the valley pseudospin and the angle of incidence of the incident quasiparticles. Quasiparticles arriving at the line defect at a high angle of incidence lead to a valley polarization of the transmitted beam that is near 100 percent. This work was supported by ONR, directly and through NRL.

  14. Characterization of Li-rich layered oxides by using transmission electron microscope

    Directory of Open Access Journals (Sweden)

    Hu Zhao

    2017-07-01

    Full Text Available Lithium-rich layered oxides (LrLOs deliver extremely high specific capacities and are considered to be promising candidates for electric vehicle and smart grid applications. However, the application of LrLOs needs further understanding of the structural complexity and dynamic evolution of monoclinic and rhombohedral phases, in order to overcome the issues including voltage decay, poor rate capability, initial irreversible capacity loss and etc. The development of aberration correction for the transmission electron microscope and concurrent progress in electron spectroscopy, have fueled rapid progress in the understanding of the mechanism of such issues. New techniques based on the transmission electron microscope are first surveyed, and the applications of these techniques for the study of the structure, migration of transition metal, and the activation of oxygen of LrLOs are then explored in detail, with a particular focus on the mechanism of voltage decay. Keywords: Lithium-ion battery, Transmission electron microscope, Lithium-rich layered oxide, Cathode material

  15. Changes in the transmission properties of multi-tooth plasmonic nano-filters (multi-TPNFs) caused by geometrical imperfection

    International Nuclear Information System (INIS)

    Khaksar, A; Fatemi, H

    2012-01-01

    To model the filtering behavior of a multi-tooth plasmonic nano-filter (multi-TPNF), an equivalent circuitry composed of a set of serried impedances is considered. The changes caused in its filtering behavior are proposed as a measuring tool to investigate the effect of the geometrical imperfections occurring during the manufacture of the device. Consequently, the effects of changes in the nominal size of each of the geometrical parameters of a multi-TPNF sample, such as its tooth height, d, its tooth width, w, and the separation between two successive teeth, Δ, on its transmittance are investigated. It is observed that each single tooth of the multi-TPNF and also the waveguide between any of its two successive teeth exhibit a very Fabry–Perot interferometer like behavior. The variation of the transmission spectra of a multi-TPNF whose geometrical parameters are imperfect is compared with the desired filter, and also the effect of the number of geometrically imperfect teeth of the multi-TPNF on the filtering spectra is examined. (paper)

  16. Transmission electron microscopy studies of C3N4H4 treated at high pressure and high temperature

    International Nuclear Information System (INIS)

    Yu, R C; Chen, L C; Zhu, J L; Li, F Y; Liu, Z X; Qin, Z C; Yu, T N; Jin, C Q; Duan, X F; Zhang, Z

    2002-01-01

    C 3 N 4 H 4 was treated at 6.0 GPa and 1500 deg C for 2.5 min. Powder x-ray measurement shows that the sample is decomposed and a hexagonal graphite phase forms. Transmission electron microscopy studies show that small amounts of diamond and amorphous carbon phase coexist with the graphite phase. Parallel electron energy-loss spectroscopy analysis was also carried out for these phases

  17. Transmission electron microscopy of nanostructures synthesized by laser and charged particle beam interaction with materials

    International Nuclear Information System (INIS)

    Dey, G. K.

    2011-01-01

    Transmission Electron Microscopy (TEM), because of its ability to image atomic arrangements directly and its ability to give spectroscopic information at similar resolution has emerged as a very powerful tool for understanding the structure of materials at atomic level. TEM has been particularly useful in resolving the interface structures in materials. This form of microscopy is very suitable for resolving the structure and defects in ultrafine microstructures such as those of the nanocrystalline phases. After a brief description of the different characterization abilities of the aberration corrected transmission electron microscope, this presentation describes the results of TEM investigations on nanocrystalline microstructures generated by laser materials interaction and due to interaction of electrons and ions with materials. Excimer laser has become an attractive choice for new and precision application for ablation and deposition in recent times. In this work, a KrF excimer laser having 30 ns pulse width and 600 mJ energy at source has been used to deposit zirconia on Zr-base alloy in order to explore the ability of the thin oxide film to act as a diffusion barrier to hydrogen ingress into the alloy. It has been found that the variation in pressure by an order of three has resulted in maximum influence on the roughness of the laser deposited oxide film that has not been possible to achieve by other parameters within the range of the instrument. Present study has also indicated an interrelation among the roughness, adherence and the film-thickness, where the last one is indicated by the XPS study. Transmission electron microscopy was carried out to study the size, size distribution and defects in the deposited film. Nanocrystalline phases generated by interaction of electron and ion irradiation of Zr based alloys; Ni based alloys and Fe based alloys have been examined in detail by conventional and high resolution transmission electron microscopy. Results of

  18. Electron energy-loss spectroscopy of quasi-one-dimensional cuprates and vanadates

    International Nuclear Information System (INIS)

    Atzkern, S.

    2001-01-01

    In a combination of experimental and theoretical methods in this thesis the electronic structures of quasi-one-dimensional cuprates and vanadates were studied. For this the momentum-dependent loss function was measured by means of the electron energy-loss spectroscopy in transmission on monocrystals of Li 2 CuO 2 , CuGeO 3 , V 2 O 5 and α'-NaVO 5 . The comparison of the experimental data with results from band-structure and cluster calculations allowed conclusions on the mobility and correlations of the electrons in these systems

  19. Power Electronics – The Key Technology for Renewable Energy System Integration

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Yang, Yongheng; Ma, Ke

    2015-01-01

    The energy paradigms in many countries (e.g. Germany and Denmark) have experienced a significant change from fossil-based resources to clean renewables (e.g. wind turbines and photovoltaics) in the past few decades. The scenario of highly penetrated renewables is going to be further enhanced...... – Denmark expects to be 100 % fossil-free by 2050. Consequently, it is required that the production, distribution and use of the energy should be as technologically efficient as possible and incentives to save energy at the end-user should also be strengthened. In order to realize the transition smoothly...... and effectively, energy conversion systems, currently based on power electronics technology, will again play an essential role in this energy paradigm shift. Using highly efficient power electronics in power generation, power transmission/distribution and end-user application, together with advanced control...

  20. Ultra-stable implanted 83Rb/83mKr electron sources for the energy scale monitoring in the KATRIN experiment

    CERN Document Server

    Zboril, M.; Beck, M.; Bonn, J.; Dragoun, O.; Jakubek, J.; Johnston, K.; Kovalik, A.; Otten, E.W.; Schlösser, K.; Slezak, M.; Spalek, A.; Thümmler, T.; Venos, D.; Zemlicka, J.; Weinheimer, C.

    2013-01-01

    The KATRIN experiment aims at the direct model-independent determination of the average electron neutrino mass via the measurement of the endpoint region of the tritium beta decay spectrum. The electron spectrometer of the MAC-E filter type is used, requiring very high stability of the electric filtering potential. This work proves the feasibility of implanted 83Rb/83mKr calibration electron sources which will be utilised in the additional monitor spectrometer sharing the high voltage with the main spectrometer of KATRIN. The source employs conversion electrons of 83mKr which is continuously generated by 83Rb. The K-32 conversion line (kinetic energy of 17.8 keV, natural line width of 2.7 eV) is shown to fulfill the KATRIN requirement of the relative energy stability of +/-1.6 ppm/month. The sources will serve as a standard tool for continuous monitoring of KATRIN's energy scale stability with sub-ppm precision. They may also be used in other applications where the precise conversion lines can be separated fr...

  1. Heat transport and electron cooling in ballistic normal-metal/spin-filter/superconductor junctions

    International Nuclear Information System (INIS)

    Kawabata, Shiro; Vasenko, Andrey S.; Ozaeta, Asier; Bergeret, Sebastian F.; Hekking, Frank W.J.

    2015-01-01

    We investigate electron cooling based on a clean normal-metal/spin-filter/superconductor junction. Due to the suppression of the Andreev reflection by the spin-filter effect, the cooling power of the system is found to be extremely higher than that for conventional normal-metal/nonmagnetic-insulator/superconductor coolers. Therefore we can extract large amount of heat from normal metals. Our results strongly indicate the practical usefulness of the spin-filter effect for cooling detectors, sensors, and quantum bits

  2. Heat transport and electron cooling in ballistic normal-metal/spin-filter/superconductor junctions

    Energy Technology Data Exchange (ETDEWEB)

    Kawabata, Shiro, E-mail: s-kawabata@aist.go.jp [Electronics and Photonics Research Institute (ESPRIT), National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki 305-8568 (Japan); Vasenko, Andrey S. [LPMMC, Université Joseph Fourier and CNRS, 25 Avenue des Martyrs, BP 166, 38042 Grenoble (France); Ozaeta, Asier [Centro de Física de Materiales (CFM-MPC), Centro Mixto CSIC-UPV/EHU, Manuel de Lardizabal 5, E-20018 San Sebastián (Spain); Bergeret, Sebastian F. [Centro de Física de Materiales (CFM-MPC), Centro Mixto CSIC-UPV/EHU, Manuel de Lardizabal 5, E-20018 San Sebastián (Spain); Donostia International Physics Center (DIPC), Manuel de Lardizabal 5, E-20018 San Sebastián (Spain); Hekking, Frank W.J. [LPMMC, Université Joseph Fourier and CNRS, 25 Avenue des Martyrs, BP 166, 38042 Grenoble (France)

    2015-06-01

    We investigate electron cooling based on a clean normal-metal/spin-filter/superconductor junction. Due to the suppression of the Andreev reflection by the spin-filter effect, the cooling power of the system is found to be extremely higher than that for conventional normal-metal/nonmagnetic-insulator/superconductor coolers. Therefore we can extract large amount of heat from normal metals. Our results strongly indicate the practical usefulness of the spin-filter effect for cooling detectors, sensors, and quantum bits.

  3. A comparative transmission electron microscopy, energy dispersive x-ray spectroscopy and spatially resolved micropillar compression study of the yttria partially stabilised zirconia - porcelain interface in dental prosthesis

    Energy Technology Data Exchange (ETDEWEB)

    Lunt, Alexander J.G., E-mail: alexander.lunt@chch.ox.ac.uk [Department of Engineering Science, University of Oxford, Parks Road, Oxford, Oxfordshire OX1 3PJ (United Kingdom); Mohanty, Gaurav, E-mail: gaurav.mohanty@empa.ch [EMPA Materials Science & Technology, Feuerwerkerstrasse 39, CH-3602 Thun (Switzerland); Ying, Siqi, E-mail: siqi.ying@eng.ox.ac.uk [Department of Engineering Science, University of Oxford, Parks Road, Oxford, Oxfordshire OX1 3PJ (United Kingdom); Dluhoš, Jiří, E-mail: jiri.dluhos@tescan.cz [TESCAN Brno, s.r.o., Libušina tř. 1, 623 00 Brno-Kohoutovice (Czech Republic); Sui, Tan, E-mail: tan.sui@eng.ox.ac.uk [Department of Engineering Science, University of Oxford, Parks Road, Oxford, Oxfordshire OX1 3PJ (United Kingdom); Neo, Tee K., E-mail: neophyte@singnet.com.sg [Specialist Dental Group, Mount Elizabeth Orchard, 3 Mount Elizabeth, #08-03/08-08/08-10, 228510 (Singapore); Michler, Johann, E-mail: johann.michler@empa.ch [EMPA Materials Science & Technology, Feuerwerkerstrasse 39, CH-3602 Thun (Switzerland); Korsunsky, Alexander M., E-mail: alexander.korsunsky@eng.ox.ac.uk [Department of Engineering Science, University of Oxford, Parks Road, Oxford, Oxfordshire OX1 3PJ (United Kingdom)

    2015-12-01

    Recent studies into the origins of failure of yttria partially stabilised zirconia–porcelain veneered prosthesis have revealed the importance of micro-to-nano scale characterisation of this interface zone. Current understanding suggests that the heat treatment, residual stresses and varying microstructure at this location may contribute to near-interface porcelain chipping. In this study the chemical, microstructural and mechanical property variation across the interfacial zone has been characterised at two differing length scales and using three independent techniques; energy dispersive X-ray spectroscopy, transmission electron microscopy and micropillar compression. Energy dispersive X-ray spectroscopy mapping of the near-interface region revealed, for the first time, that the diffusional lengths of twelve principal elements are limited to within 2–6 μm of the interface. This study also revealed that 0.2–2 μm diameter zirconia grains had become detached from the bulk and were embedded in the near-interface porcelain. Transmission electron microscopy analysis demonstrated the presence of nanoscale spherical features, indicative of tensile creep induced voiding, within the first 0.4–1.5 μm from the interface. Within zirconia, variations in grain size and atomistic structure were also observed within the 3 μm closest to the interface. Micropillar compression was performed over a 100 μm range on either side of the interface at the spatial resolution of 5 μm. This revealed an increase in zirconia and porcelain loading modulus at close proximities (< 5 μm) to the interface and a decrease in zirconia modulus at distances between 6 and 41 μm from this location. The combination of the three experimental techniques has revealed intricate details of the microstructural, chemical and consequently mechanical heterogeneities in the YPSZ–porcelain interface, and demonstrated that the length scales typically associated with this behaviour are approximately ± 5

  4. Power Electronics and Control of Renewable Energy Systems

    DEFF Research Database (Denmark)

    Iov, Florin; Ciobotaru, Mihai; Sera, Dezso

    2007-01-01

    sources from the conventional, fossil (and short term) based energy sources to renewable energy resources. Another is to use high efficient power electronics in power generation, power transmission/distribution and end-user application. This paper discuss some of the most emerging renewable energy sources......The global electrical energy consumption is still rising and there is a demand to double the power capacity within 20 years. The production, distribution and use of energy should be as technological efficient as possible and incentives to save energy at the end-user should also be set up....... Deregulation of energy has in the past lowered the investment in larger power plants, which means the need for new electrical power sources may be very high in the near future. Two major technologies will play important roles to solve the future problems. One is to change the electrical power production...

  5. A Monte Carlo investigation of contaminant electrons due to a novel in vivo transmission detector

    International Nuclear Information System (INIS)

    Asuni, G; Jensen, J M; McCurdy, B M C

    2011-01-01

    A novel transmission detector (IBA Dosimetry, Germany) developed as an IMRT quality assurance tool, intended for in vivo patient dose measurements, is studied here. The goal of this investigation is to use Monte Carlo techniques to characterize treatment beam parameters in the presence of the detector and to compare to those of a plastic block tray (a frequently used clinical device). Particular attention is paid to the impact of the detector on electron contamination model parameters of two commercial dose calculation algorithms. The linac head together with the COMPASS transmission detector (TRD) was modeled using BEAMnrc code. To understand the effect of the TRD on treatment beams, the contaminant electron fluence, energy spectra, and angular distributions at different SSDs were analyzed for open and non-open (i.e. TRD and block tray) fields. Contaminant electrons in the BEAMnrc simulations were separated according to where they were created. Calculation of surface dose and the evaluation of contributions from contaminant electrons were performed using the DOSXYZnrc user code. The effect of the TRD on contaminant electrons model parameters in Eclipse AAA and Pinnacle 3 dose calculation algorithms was investigated. Comparisons of the fluence of contaminant electrons produced in the non-open fields versus open field show that electrons created in the non-open fields increase at shorter SSD, but most of the electrons at shorter SSD are of low energy with large angular spread. These electrons are out-scattered or absorbed in air and contribute less to surface dose at larger SSD. Calculated surface doses with the block tray are higher than those with the TRD. Contribution of contaminant electrons to dose in the buildup region increases with increasing field size. The additional contribution of electrons to surface dose increases with field size for TRD and block tray. The introduction of the TRD results in a 12% and 15% increase in the Gaussian widths used in the

  6. Photonic Color Filters Integrated with Organic Solar Cells for Energy Harvesting

    KAUST Repository

    Park, Hui Joon; Xu, Ting; Lee, Jae Yong; Ledbetter, Abram; Guo, L. Jay

    2011-01-01

    Color filters are indispensable in most color display applications. In most cases, they are chemical pigment-based filters, which produce a particular color by absorbing its complementary color, and the absorbed energy is totally wasted

  7. Delay Estimator and Improved Proportionate Multi-Delay Adaptive Filtering Algorithm

    Directory of Open Access Journals (Sweden)

    E. Verteletskaya

    2012-04-01

    Full Text Available This paper pertains to speech and acoustic signal processing, and particularly to a determination of echo path delay and operation of echo cancellers. To cancel long echoes, the number of weights in a conventional adaptive filter must be large. The length of the adaptive filter will directly affect both the degree of accuracy and the convergence speed of the adaptation process. We present a new adaptive structure which is capable to deal with multiple dispersive echo paths. An adaptive filter according to the present invention includes means for storing an impulse response in a memory, the impulse response being indicative of the characteristics of a transmission line. It also includes a delay estimator for detecting ranges of samples within the impulse response having relatively large distribution of echo energy. These ranges of samples are being indicative of echoes on the transmission line. An adaptive filter has a plurality of weighted taps, each of the weighted taps having an associated tap weight value. A tap allocation/control circuit establishes the tap weight values in response to said detecting means so that only taps within the regions of relatively large distributions of echo energy are turned on. Thus, the convergence speed and the degree of estimation in the adaptation process can be improved.

  8. Application of Boltzmann equation to electron transmission and seconary electron emission

    International Nuclear Information System (INIS)

    Lanteri, H.; Bindi, R.; Rostaing, P.

    1979-01-01

    A method is presented for numerical treatment of integro-differential equation, based upon finite difference techniques. This method allows to formulate in a satisfactory manner the Boltzmann's equation applied to backscattering, transmission and secondary emission of metallic targets, avoiding must of the restrictive hypothesis, used until now in these models. For aluminium, the calculated energy spectra, angular distribution, transmission and backscattering coefficients, and secondary emission yield, are found to be in good agreement with experiment [fr

  9. Simulation of Probe Position-Dependent Electron Energy-Loss Fine Structure

    Energy Technology Data Exchange (ETDEWEB)

    Oxley, M. P.; Kapetanakis, M. D.; Prange, Micah P.; Varela, M.; Pennycook, Stephen J.; Pantelides, Sokrates T.

    2014-03-31

    We present a theoretical framework for calculating probe-position-dependent electron energy-loss near-edge structure for the scanning transmission electron microscope by combining density functional theory with dynamical scattering theory. We show how simpler approaches to calculating near-edge structure fail to include the fundamental physics needed to understand the evolution of near-edge structure as a function of probe position and investigate the dependence of near-edge structure on probe size. It is within this framework that density functional theory should be presented, in order to ensure that variations of near-edge structure are truly due to local electronic structure and how much from the diffraction and focusing of the electron beam.

  10. Spin filtering in a Rashba–Dresselhaus–Aharonov–Bohm double-dot interferometer

    International Nuclear Information System (INIS)

    Matityahu, Shlomi; Aharony, Amnon; Entin-Wohlman, Ora; Tarucha, Seigo

    2013-01-01

    We study the spin-dependent transport of spin-1/2 electrons through an interferometer made of two elongated quantum dots or quantum nanowires, which are subject to both an Aharonov–Bohm flux and (Rashba and Dresselhaus) spin–orbit interactions. Similar to the diamond interferometer proposed in our previous papers (Aharony et al 2011 Phys. Rev. B 84 035323; Matityahu et al 2013 Phys. Rev. B 87 205438), we show that the double-dot interferometer can serve as a perfect spin filter due to a spin interference effect. By appropriately tuning the external electric and magnetic fields which determine the Aharonov–Casher and Aharonov–Bohm phases, and with some relations between the various hopping amplitudes and site energies, the interferometer blocks electrons with a specific spin polarization, independent of their energy. The blocked polarization and the polarization of the outgoing electrons is controlled solely by the external electric and magnetic fields and do not depend on the energy of the electrons. Furthermore, the spin filtering conditions become simpler in the linear-response regime, in which the electrons have a fixed energy. Unlike the diamond interferometer, spin filtering in the double-dot interferometer does not require high symmetry between the hopping amplitudes and site energies of the two branches of the interferometer and thus may be more appealing from an experimental point of view. (paper)

  11. Atomic-resolution transmission electron microscopy of electron beam–sensitive crystalline materials

    Science.gov (United States)

    Zhang, Daliang; Zhu, Yihan; Liu, Lingmei; Ying, Xiangrong; Hsiung, Chia-En; Sougrat, Rachid; Li, Kun; Han, Yu

    2018-02-01

    High-resolution imaging of electron beam–sensitive materials is one of the most difficult applications of transmission electron microscopy (TEM). The challenges are manifold, including the acquisition of images with extremely low beam doses, the time-constrained search for crystal zone axes, the precise image alignment, and the accurate determination of the defocus value. We develop a suite of methods to fulfill these requirements and acquire atomic-resolution TEM images of several metal organic frameworks that are generally recognized as highly sensitive to electron beams. The high image resolution allows us to identify individual metal atomic columns, various types of surface termination, and benzene rings in the organic linkers. We also apply our methods to other electron beam–sensitive materials, including the organic-inorganic hybrid perovskite CH3NH3PbBr3.

  12. Atomic-resolution transmission electron microscopy of electron beam–sensitive crystalline materials

    KAUST Repository

    Zhang, Daliang

    2018-01-18

    High-resolution imaging of electron beam-sensitive materials is one of the most difficult applications of transmission electron microscopy (TEM). The challenges are manifold, including the acquisition of images with extremely low beam doses, the time-constrained search for crystal zone axes, the precise image alignment, and the accurate determination of the defocus value. We develop a suite of methods to fulfill these requirements and acquire atomic-resolution TEM images of several metal organic frameworks that are generally recognized as highly sensitive to electron beams. The high image resolution allows us to identify individual metal atomic columns, various types of surface termination, and benzene rings in the organic linkers. We also apply our methods to other electron beam–sensitive materials, including the organic-inorganic hybrid perovskite CH3NH3PbBr3.

  13. Electron-Spin Filters Would Offer Spin Polarization Greater than 1

    Science.gov (United States)

    Ting, David Z.

    2009-01-01

    A proposal has been made to develop devices that would generate spin-polarized electron currents characterized by polarization ratios having magnitudes in excess of 1. Heretofore, such devices (denoted, variously, as spin injectors, spin polarizers, and spin filters) have typically offered polarization ratios having magnitudes in the approximate range of 0.01 to 0.1. The proposed devices could be useful as efficient sources of spin-polarized electron currents for research on spintronics and development of practical spintronic devices.

  14. Calculation of electron transmission through aluminium foil

    International Nuclear Information System (INIS)

    Abroyan, M.A.; Mel'ker, A.I.; Mikhajlin, A.I.; Sirotinkin, V.V.; Tokmakov, I.L.

    1987-01-01

    Calculated by Monte Carlo method energy and angular distributions of electrons transmitted through aluminium foil with 50 μm thickness are presented. 200-500 electron energy ranges and angles of electron incidence on foil from 0 to 40 deg C are considered. That allows to use results for more universal accelerator group, for example, for accelerators with scanning beam used in industry. The received values of angular and energy characteristics allow to increase essentially estimation accuracy of accelerator extraction devices and dose distribution on irradiating item

  15. Renewable Energy Zone (REZ) Transmission Planning Process: A Guidebook for Practitioners

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Nathan [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Flores-Espino, Francisco [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Hurlbut, David J. [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2017-09-05

    Achieving clean energy goals may require new investments in transmission, especially if planners anticipate economic growth and increased demand for electricity. The renewable energy zone (REZ) transmission planning process can help policymakers ensure their infrastructure investments achieve national goals in the most economical manner. Policymakers, planners, and system operators around the world have used variations of the REZ process to chart the expansion of their transmission networks and overcome the barriers of traditional transmission planning. This guidebook seeks to help power system planners, key decision makers, and stakeholders understand and use the REZ transmission planning process to integrate transmission expansion planning and renewable energy generation planning.

  16. Shape resonances in low-energy-electron collisions with halopyrimidines

    Energy Technology Data Exchange (ETDEWEB)

    Barbosa, Alessandra Souza; Bettega, Márcio H. F., E-mail: bettega@fisica.ufpr.br [Departamento de Física, Universidade Federal do Paraná, Caixa Postal 19044, 81531-990 Curitiba, Paraná (Brazil)

    2013-12-07

    We report calculated cross sections for elastic collisions of low-energy electrons with halopyrimidines, namely, 2-chloro, 2-bromo, and 5-bromopyrimidine. We employed the Schwinger multichannel method with pseudopotentials to compute the cross sections in the static-exchange and static-exchange plus polarization levels of approximation for energies up to 10 eV. We found four shape resonances for each molecule: three of π* nature localized on the ring and one of σ* nature localized along the carbon–halogen bond. We compared the calculated positions of the resonances with the electron transmission spectroscopy data measured by Modelli et al. [J. Phys. Chem. A 115, 10775 (2011)]. In general the agreement between theory and experiment is good. In particular, our results show the existence of a π* temporary anion state of A{sub 2} symmetry for all three halopyrimidines, in agreement with the dissociative electron attachment spectra also reported by Modelli et al. [J. Phys. Chem. A 115, 10775 (2011)].

  17. Path-separated electron interferometry in a scanning transmission electron microscope

    Science.gov (United States)

    Yasin, Fehmi S.; Harvey, Tyler R.; Chess, Jordan J.; Pierce, Jordan S.; McMorran, Benjamin J.

    2018-05-01

    We report a path-separated electron interferometer within a scanning transmission electron microscope. In this setup, we use a nanofabricated grating as an amplitude-division beamsplitter to prepare multiple spatially separated, coherent electron probe beams. We achieve path separations of 30 nm. We pass the  +1 diffraction order probe through amorphous carbon while passing the 0th and  ‑1 orders through vacuum. The probes are then made to interfere via imaging optics, and we observe an interference pattern at the CCD detector with up to 39.7% fringe visibility. We show preliminary experimental results in which the interference pattern was recorded during a 1D scan of the diffracted probes across a test phase object. These results qualitatively agree with a modeled interference predicted by an independent measurement of the specimen thickness. This experimental design can potentially be applied to phase contrast imaging and fundamental physics experiments, such as an exploration of electron wave packet coherence length.

  18. Improved Scheduling Mechanisms for Synchronous Information and Energy Transmission.

    Science.gov (United States)

    Qin, Danyang; Yang, Songxiang; Zhang, Yan; Ma, Jingya; Ding, Qun

    2017-06-09

    Wireless energy collecting technology can effectively reduce the network time overhead and prolong the wireless sensor network (WSN) lifetime. However, the traditional energy collecting technology cannot achieve the balance between ergodic channel capacity and average collected energy. In order to solve the problem of the network transmission efficiency and the limited energy of wireless devices, three improved scheduling mechanisms are proposed: improved signal noise ratio (SNR) scheduling mechanism (IS2M), improved N-SNR scheduling mechanism (INS2M) and an improved Equal Throughput scheduling mechanism (IETSM) for different channel conditions to improve the whole network performance. Meanwhile, the average collected energy of single users and the ergodic channel capacity of three scheduling mechanisms can be obtained through the order statistical theory in Rayleig, Ricean, Nakagami- m and Weibull fading channels. It is concluded that the proposed scheduling mechanisms can achieve better balance between energy collection and data transmission, so as to provide a new solution to realize synchronous information and energy transmission for WSNs.

  19. Decentralized control of transmission rates in energy-critical wireless networks

    KAUST Repository

    Xia, Li

    2013-06-01

    In this paper, we discuss the decentralized optimization of delay and energy consumption in a multi-hop wireless network. The goal is to minimize the energy consumption of energy-critical nodes and the overall packet transmission delay of the network. The transmission rates of energy-critical nodes are adjustable according to the local information of nodes, i.e., the length of packets queued. The multi-hop network is modeled as a queueing network.We prove that the system performance is monotone w.r.t. (with respect to) the transmission rate, thus the “bang-bang” control is an optimal control. We also prove that there exists a threshold type control policy which is optimal. We propose a decentralized algorithm to control transmission rates of these energy-critical nodes. Some simulation experiments are conducted to demonstrate the effectiveness of our approach.

  20. Decentralized control of transmission rates in energy-critical wireless networks

    KAUST Repository

    Xia, Li; Shihada, Basem

    2013-01-01

    In this paper, we discuss the decentralized optimization of delay and energy consumption in a multi-hop wireless network. The goal is to minimize the energy consumption of energy-critical nodes and the overall packet transmission delay of the network. The transmission rates of energy-critical nodes are adjustable according to the local information of nodes, i.e., the length of packets queued. The multi-hop network is modeled as a queueing network.We prove that the system performance is monotone w.r.t. (with respect to) the transmission rate, thus the “bang-bang” control is an optimal control. We also prove that there exists a threshold type control policy which is optimal. We propose a decentralized algorithm to control transmission rates of these energy-critical nodes. Some simulation experiments are conducted to demonstrate the effectiveness of our approach.

  1. Status report of the S-DALINAC polarized electron injector SPIN at Darmstadt

    Energy Technology Data Exchange (ETDEWEB)

    Eckardt, Christian; Bahlo, Thore; Bangert, Phillip; Barday, Roman; Bonnes, Uwe; Brunken, Marco; Eichhorn, Ralf; Enders, Joachim; Platz, Markus; Poltoratska, Yuliya; Roth, Markus; Schneider, Fabian; Wagner, Markus; Weber, Antje; Zwicker, Benjamin [Institut fuer Kernphysik, Technische Universitaet Darmstadt (Germany); Ackermann, Wolfgang; Mueller, Wolfgang F.O.; Weiland, Thomas [Institut fuer Theorie Elektromagnetischer Felder, Technische Universitaet Darmstadt (Germany)

    2010-07-01

    At the superconducting 130 MeV Darmstadt electron linac S-DALINAC a source of polarized electrons is being installed. Polarized electrons are produced by photoemission from a negative electron affinity strained superlattice GaAs cathode and preaccelerated to 100 keV. With a Wien filter and Mott polarimeter in the beam line the polarization is manipulated and measured. For beam diagnostics wire scanners, fluorescent screens and a coaxial Faraday cup are included. To measure the beam polarization at higher energies, a 5-10 MeV Mott polarimeter and a 50-130 MeV Moeller polarimeter as well as a Compton transmission polarimeter will be installed. We report on the status of the implementation and show plans for future development and experiments.

  2. Cognitive radio-based transmission energy management in Wi-Fi nodes

    CSIR Research Space (South Africa)

    Olwal, TO

    2012-10-01

    Full Text Available -services. To solve such problems, in part, this study addresses the transmission energy management in Wi-Fi networks. Figure 1: Internet needs of rural communities PROPOSAL A cognitive radio-based transmission energy management (CR-TEM) solution for Wi... is incorporated into the Wi-Fi device to monitor the operation environments. Based on the environmental data, the transmission energy is adaptively adjusted until optimal conditions are achieved. Figure 2 illustrates the fundamentals of the cognitive radio...

  3. High-resolution transmission electron microscopy and energetics of flattened carbon nonoshells

    International Nuclear Information System (INIS)

    Bourgeois, L.N.; Bursill, L.A.

    1998-01-01

    When examined under a high-resolution transmission electron microscope, carbon soot produced alongside buckytubes in an arc-discharge is found to contain a small percentage of flattened carbon shells. These objects are shown to be small graphite flakes which eliminated their dangling bonds by terminating their edges with highly curved junctions. Ideal models for these structures are presented, and their energy estimated. The calculations show that the establishment of highly curved junctions is energetically favourable for a graphite flake in an inert atmosphere. Flattened shells also appear more stable than their 'inflated' counterparts (fullerene 'onions' and buckytubes) when the shell dimensions obey specific criteria.(authors)

  4. An Ensemble of Neural Networks for Online Electron Filtering at the ATLAS Experiment.

    CERN Document Server

    Da Fonseca Pinto, Joao Victor; The ATLAS collaboration

    2018-01-01

    In 2017 the ATLAS experiment implemented an ensemble of neural networks (NeuralRinger algorithm) dedicated to improving the performance of filtering events containing electrons in the high-input rate online environment of the Large Hadron Collider at CERN, Geneva. The ensemble employs a concept of calorimetry rings. The training procedure and final structure of the ensemble are used to minimize fluctuations from detector response, according to the particle energy and position of incidence. A detailed study was carried out to assess profile distortions in crucial offline quantities through the usage of statistical tests and residual analysis. These details and the online performance of this algorithm during the 2017 data-taking will be presented.

  5. Electronic control of a 4-speed automatic transmission with lock-up clutch

    Energy Technology Data Exchange (ETDEWEB)

    Schwab, M.

    1984-01-01

    The paper describes the electronic control of an automatic 4-speed transmission with lock-up clutch. As compared to purely hydraulically controlled transmissions, this control offers a clearly improved quality of shifting and the possibility of achieving improvements in fuel consumption thanks to a special economy program. The electronic control unit is a Bosch MOTRONIC which has been expanded to include the functions of transmission control. A special feature is the engine torque control which is implemented by way of retarding the ignition when shifting. This opens up an additional degree of freedom for optimizing a transmission in terms of shift comfort, life of the friction elements and the power which can be transmitted.

  6. Technical Note: On the impact of the incident electron beam energy on the primary dose component of flattening filter free photon beams.

    Science.gov (United States)

    Kuess, Peter; Georg, Dietmar; Palmans, Hugo; Lechner, Wolfgang

    2016-08-01

    For commercially available linear accelerators (Linacs), the electron energies of flattening filter free (FFF) and flattened (FF) beams are either identical or the electron energy of the FFF beam is increased to match the percentage depth dose curve (PDD) of the FF beam (in reference geometry). This study focuses on the primary dose components of FFF beams for both kinds of settings, studied on the same Linac. The measurements were conducted on a VersaHD Linac (Elekta, Crawley, UK) for both FF and FFF beams with nominal energies of 6 and 10 MV. In the clinical setting of the VersaHD, the energy of FFFM (Matched) beams is set to match the PDDs of the FF beams. In contrast the incident electron beam of the FFFU beam was set to the same energy as for the FF beam. Half value layers (HVLs) and a dual parameter beam quality specifier (DPBQS) were determined. For the 6 MV FFFM beam, HVL and DPBQS values were very similar compared to those of the 6 MV FF beam, while for the 10 MV FFFM and FF beams, only %dd(10)x and HVL values were comparable (differences below 1.5%). This shows that matching the PDD at one depth does not guarantee other beam quality dependent parameters to be matched. For FFFU beams, all investigated beam quality specifiers were significantly different compared to those for FF beams of the same nominal accelerator potential. The DPBQS of the 6 MV FF and FFFM beams was equal within the measurement uncertainty and was comparable to published data of a machine with similar TPR20,10 and %dd(10)x. In contrast to that, the DPBQS's two parameters of the 10 MV FFFM beam were substantially higher compared to those for the 10 MV FF beam. PDD-matched FF and FFF beams of both nominal accelerator potentials were observed to have similar HVL values, indicating similarity of their primary dose components. Using the DPBQS revealed that the mean attenuation coefficient was found to be the same within the uncertainty of 0.8% for 6 MV FF and 6 MV FFFM beams, while for 10 MV

  7. Electron scattering resonances and dissociative attachment in polyatomic molecules

    International Nuclear Information System (INIS)

    Olthoff, J.K.

    1985-01-01

    A relatively new technique, electron transmission spectroscopic, is now being used to investigate the unoccupied valence molecular orbitals of many chemical compounds. Electron-transmission spectroscopy measures the energy of negative ion states that arise from electron capture into unoccupied molecular orbitals. Additional information about the unoccupied orbitals may be obtained if the negative ion decays by way of dissociation. Determination of the identity, kinetic energy, and production rates of stable ion fragments supplies information about the shape and position of the potential energy curves which describe the electronic states of the molecule and the anion. Used together, photoelectron, electron transmission, and dissociation data can produce a complete picture of a molecule's valence electronic structure. For this work, a time-of-flight mass spectrometer was attached to an electron transmission spectrometer to observe negative ion fragments due to dissociative attachment. The mass spectrometer measures the identify and kinetic energy of stable negative ions as a function of incident electron energy. Electron transmission spectra and ion production data were acquired for many compounds in four chemical categories

  8. Electron attachment to indole and related molecules

    Energy Technology Data Exchange (ETDEWEB)

    Modelli, Alberto, E-mail: alberto.modelli@unibo.it [Dipartimento di Chimica “G. Ciamician”, Universitá di Bologna, via Selmi 2, 40126 Bologna (Italy); Centro Interdipartimentale di Ricerca in Scienze Ambientali (CIRSA), Universitá di Bologna, via S. Alberto 163, 48123 Ravenna (Italy); Jones, Derek, E-mail: d.jones@isof.cnr.it [ISOF, Istituto per la Sintesi Organica e la Fotoreattività, C.N.R., via Gobetti 101, 40129 Bologna (Italy); Pshenichnyuk, Stanislav A., E-mail: sapsh@anrb.ru [Institute of Molecule and Crystal Physics, Ufa Research Centre, Russian Academy of Sciences, Prospekt Oktyabrya 151, 450075 Ufa (Russian Federation)

    2013-11-14

    Gas-phase formation of temporary negative ion states via resonance attachment of low-energy (0–6 eV) electrons into vacant molecular orbitals of indoline (I), indene (II), indole (III), 2-methylen-1,3,3-trimethylindoline (IV), and 2,3,3-trimethyl-indolenine (V) was investigated for the first time by electron transmission spectroscopy (ETS). The description of their empty-level structures was supported by density functional theory and Hartree-Fock calculations, using empirically calibrated linear equations to scale the calculated virtual orbital energies. Dissociative electron attachment spectroscopy (DEAS) was used to measure the fragment anion yields generated through dissociative decay channels of the parent molecular anions of compounds I-V, detected with a mass filter as a function of the incident electron energy in the 0–14 eV energy range. The vertical and adiabatic electron affinities were evaluated at the B3LYP/6-31+G(d) level as the anion/neutral total energy difference. The same theoretical method is also used for evaluation of the thermodynamic energy thresholds for production of the negative fragments observed in the DEA spectra. The loss of a hydrogen atom from the parent molecular anion ([M-H]{sup −}) provides the most intense signal in compounds I-IV. The gas-phase DEAS data can provide support for biochemical reaction mechanisms in vivo involving initial hydrogen abstraction from the nitrogen atom of the indole moiety, present in a variety of biologically important molecules.

  9. The multilayered structure of ultrathin amorphous carbon films synthesized by filtered cathodic vacuum arc deposition

    KAUST Repository

    Wang, Na

    2013-08-01

    The structure of ultrathin amorphous carbon (a-C) films synthesized by filtered cathodic vacuum arc (FCVA) deposition was investigated by high-resolution transmission electron microscopy, electron energy loss spectroscopy, and x-ray photoelectron spectroscopy. Results of the plasmon excitation energy shift and through-thickness elemental concentration show a multilayered a-C film structure comprising an interface layer consisting of C, Si, and, possibly, SiC, a buffer layer with continuously increasing sp 3 fraction, a relatively thicker layer (bulk film) of constant sp 3 content, and an ultrathin surface layer rich in sp 2 hybridization. A detailed study of the C K-edge spectrum indicates that the buffer layer between the interface layer and the bulk film is due to the partial backscattering of C+ ions interacting with the heavy atoms of the silicon substrate. The results of this study provide insight into the minimum thickness of a-C films deposited by FCVA under optimum substrate bias conditions. Copyright © 2013 Materials Research Society.

  10. H- ion source using a localized virtual magnetic filter in the plasma electrode: type I LV magnetic filter

    International Nuclear Information System (INIS)

    Oka, Y.; Kaneko, O.; Tsumori, K.; Takeiri, Y.; Osakabe, M.; Kawamoto, T.; Asano, E.; Akiyama, R.

    1999-12-01

    A new multicusp H - ion source using a Localized Virtual magnetic filter of type I [Ref.6] in the plasma electrode is investigated. A multipole (MP) arrangement with a spacing of 10 mm of the magnet bars holds an extraction hole, optimizing the efficient production of high H - current, and at the same time only a small electron component was co-extracted with the H - ions. The local filter arrangement separates the beam electrons at a low energy. It is shown that the co-extracted total electron current is determined principally by the integrated magnetic field flux (Gcm) of the local filter with an extraction system at a constant extraction voltage. When the value of the Gcm is increased, the total electron component is reduced, while the H - electrical efficiency had a broad maximum around the optimized value of the Gcm. A thicker plasma electrode should be necessary for sufficient reduction of electron current. In pure hydrogen operation, the achieved current density of H - is 10 mA/cm 2 . When Cs was seeded in a filter optimized for pure volume mode H - production, the maximum H - current density obtained is 51 mA/cm 2 and the ratio I ele /H - is ∼0.4 without applying a bias potential. (author)

  11. Electron-beam-induced reduction of Fe{sup 3+} in iron phosphate dihydrate, ferrihydrite, haemosiderin and ferritin as revealed by electron energy-loss spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Ying-Hsi; Vaughan, Gareth; Brydson, Rik [Institute for Materials Research, SPEME, University of Leeds, Leeds LS2 9JT (United Kingdom); Bleloch, Andrew; Gass, Mhairi [SuperSTEM, Daresbury Laboratories, Warrington WA4 4AD (United Kingdom); Sader, Kasim [Institute for Materials Research, SPEME, University of Leeds, Leeds LS2 9JT (United Kingdom); SuperSTEM, Daresbury Laboratories, Warrington WA4 4AD (United Kingdom); Brown, Andy, E-mail: a.p.brown@leeds.ac.uk [Institute for Materials Research, SPEME, University of Leeds, Leeds LS2 9JT (United Kingdom)

    2010-07-15

    The effect of high-energy electron irradiation on ferritin/haemosiderin cores (in an iron-overloaded human liver biopsy), its mineral analogue; six-line ferrihydrite (6LFh), and iron phosphate dihydrate (which has similar octahedral ferric iron to oxygen coordination to that in ferrihydrite and ferritin/haemosiderin cores) has been investigated using electron energy-loss spectroscopy (EELS). Fe L{sub 2,3}-ionisation edges were recorded on two types of electron microscope: a 200 keV transmission electron microscope (TEM) and a 100 keV scanning transmission electron microscope (STEM), in order to investigate the damage mechanisms in operation and to establish a methodology for minimum specimen alteration during analytical electron microscopic characterisation. A specimen damage mechanism dominated by radiolysis that results in the preferential loss of iron co-ordinating ligands (O, OH and H{sub 2}O) is discussed. The net result of irradiation is structural re-organisation and reduction of iron within the iron hydroxides. At sufficiently low electron fluence and particularly in the lower incident energy, finer probe diameter STEM, the alteration is shown to be minimal. All the materials examined exhibit damage which as a function of cumulative fluence is best fitted by an inverse power-law, implying that several chemical and structural changes occur in response to the electron beam and we suggest that these are governed by secondary processes arising from the primary ionisation event. This work affirms that electron fluence and current density should be considered when measuring mixed valence ratios with EELS.

  12. Auroral electron energies

    International Nuclear Information System (INIS)

    McEwan, D.J.; Duncan, C.N.; Montalbetti, R.

    1981-01-01

    Auroral electron characteristic energies determined from ground-based photometer measurements of the ratio of 5577 A OI and 4278 A N 2 + emissions are compared with electron energies measured during two rocket flights into pulsating aurora. Electron spectra with Maxwellian energy distributions were observed in both flights with an increase in characteristic energy during each pulsation. During the first flight on February 15, 1980 values of E 0 ranging from 1.4 keV at pulsation minima to 1.8 keV at pulsation maxima were inferred from the 5577/4278 ratios, in good agreement with rocket measurements. During the second flight on February 23, direct electron energy measurements yielded E 0 values of 1.8 keV rising to 2.1 keV at pulsation maxima. The photometric ratio measurements in this case gave inferred E 0 values about 0.5 keV lower. This apparent discrepancy is considered due to cloud cover which impaired the absolute emission intensity measurements. It is concluded that the 5577/4278 ratio does yield a meaningful measure of the characteristic energy of incoming electrons. This ratio technique, when added to the more sensitive 6300/4278 ratio technique usable in stable auroras can now provide more complete monitoring of electron influx characteristics. (auth)

  13. Electron mean-free-path filtering in Dirac material for improved thermoelectric performance.

    Science.gov (United States)

    Liu, Te-Huan; Zhou, Jiawei; Li, Mingda; Ding, Zhiwei; Song, Qichen; Liao, Bolin; Fu, Liang; Chen, Gang

    2018-01-30

    Recent advancements in thermoelectric materials have largely benefited from various approaches, including band engineering and defect optimization, among which the nanostructuring technique presents a promising way to improve the thermoelectric figure of merit ( zT ) by means of reducing the characteristic length of the nanostructure, which relies on the belief that phonons' mean free paths (MFPs) are typically much longer than electrons'. Pushing the nanostructure sizes down to the length scale dictated by electron MFPs, however, has hitherto been overlooked as it inevitably sacrifices electrical conduction. Here we report through ab initio simulations that Dirac material can overcome this limitation. The monotonically decreasing trend of the electron MFP allows filtering of long-MFP electrons that are detrimental to the Seebeck coefficient, leading to a dramatically enhanced power factor. Using SnTe as a material platform, we uncover this MFP filtering effect as arising from its unique nonparabolic Dirac band dispersion. Room-temperature zT can be enhanced by nearly a factor of 3 if one designs nanostructures with grain sizes of ∼10 nm. Our work broadens the scope of the nanostructuring approach for improving the thermoelectric performance, especially for materials with topologically nontrivial electronic dynamics.

  14. Scanning electron microscope investigations of nuclear pore filters in polyester foils

    International Nuclear Information System (INIS)

    Hopfe, J.

    1980-01-01

    In order to understand and characterize the action of nuclear pore filters it is necessary to know their surface, as well as their bulk, structure. In the present work, investigations of the surface structure (pore size, pore density, pore distribution) and of the pore geometry, especially in the bulk of the filters, are carried out by scanning electron microscopic (SEM) studies. The preparation technique needed is liquid-nitrogen freeze-fracturing followed by a conductive-coating step. Nuclear pore filters studied in this paper were produced by a track etching technique. Laboratory specimens were obtained by bombarding 10 μm thick polyester foils with Xe-ions and a subsequent etching with 20% NaOH. The SEM results are shown and discussed. (author)

  15. From Microwave Filter to Digital Filter and Back Again

    DEFF Research Database (Denmark)

    Dalby, Arne Brejning

    1989-01-01

    A new very simple state variable flow graph representation for interdigital transmission line bandpass filters is presented, which has led to two important results: 1) A new type of digital filter with properties, that surpass the properties of most other (all pole) digital filtertypes. 2) The st...

  16. A high-transmission liquid-crystal Fabry-Perot infrared filter for electrically tunable spectral imaging detection

    Science.gov (United States)

    Liu, Zhonglun; Xin, Zhaowei; Long, Huabao; Wei, Dong; Dai, Wanwan; Zhang, Xinyu; Wang, Haiwei; Xie, Changsheng

    2018-02-01

    Previous studies have presented the usefulness of typical liquid-crystal Fabry-Perot (LC-FP) infrared filters for spectral imaging detection. Yet, their infrared transmission performances still remain to improve or even rise. In this paper, we propose a new type of electrically tunable LC-FP infrared filter to solve the problem above. The key component of the device is a FP resonant cavity composed of two parallel plane mirrors, in which the zinc selenide (ZnSe) materials with a very high transmittance in the mid-long-wavelength infrared regions are used as the electrode substrates and a layer of nano-aluminum (Al) film, which is directly contacted with liquid-crystal materials, is chosen to make high reflective mirrors as well as the electrodes. Particularly, it should be noted that the directional layer made up of ployimide (PI) used previously is removed. The experiment results indicate that the filter can reduce the absorption of infrared wave remarkably, and thus highlight a road to effectively improve the infrared transmittance ability.

  17. Review of Department of Energy HEPA filter test activities

    International Nuclear Information System (INIS)

    McIntyre, J.A.

    1993-01-01

    Filter Test Facilities (FTFs) and the FTF Technical Support Group (TSG) continue to provide services to the Department of Energy (DOE). Additional tasks relating to the HEPA filter cycle have been added to the TSG. The tasks include the quality assessment review for the in-place testing of HEPA filters at DOE sites and the formation of an in-place testing standards writing group. Summary of ongoing FTFs and TSG activities for FY 1990-FY 1992 including the technical input for implementation of the High Flow Alternative Test System (HFATS), update of the DOE Standards, the status of the quality assessment review and in-place testing standards writing group are discussed

  18. In situ Electrical measurements in Transmission Electron Microscopy

    NARCIS (Netherlands)

    Rudneva, M.

    2013-01-01

    In the present thesis the combination of real-time electricalmeasurements on nano-sampleswith simultaneous examination by transmission electron microscope (TEM) is discussed. Application of an electrical current may lead to changes in the samples thus the possibility to correlate such changes with

  19. Depth profiling: RBS versus energy-dispersive X-ray imaging using scanning transmission electron microscopy

    International Nuclear Information System (INIS)

    Markwitz, Andreas

    2000-01-01

    Rutherford backscattering spectrometry (RBS) is known to be one of the techniques ideal for analysis of thin films. Elemental concentrations of matrix components and impurities can be investigated as well as depth profiles of almost each element of the periodic table. Best of all, RBS has both a high sensitivity and a high depth resolution, and is a non-destructive analysis technique that does not require specific sample preparation. Solid-state samples are mounted without preparation inside a high-vacuum analysis chamber. However, depth-related interpretation of elemental depth profiles requires the material density of the specimen and stopping power values to be taken into consideration. In many cases, these parameters can be estimated with sufficient precision. However, the assumed density can be inaccurate for depth scales in the nanometer range. For example, in the case of Ge nanoclusters in 500 nm thick SiO 2 layers, uncertainty is related to the actual position of a very thin Ge nanocluster band. Energy-dispersive X-ray emission (EDX) spectroscopy, using a high-resolution scanning transmission electron microscope (STEM) can assist in removing this uncertainty. By preparing a thin section of the specimen, EDX can be used to identify the position of the Ge nanocluster band very precisely, by correlating the Ge profile with the depth profiles of silicon and oxygen. However, extraction of the concentration profiles from STEM-EDX spectra is in general not straightforward. Therefore, a combination of the two very different analysis techniques is often the best and only successful way to extract high-resolution concentration profiles

  20. Pulsed Power for a Dynamic Transmission Electron Microscope

    Energy Technology Data Exchange (ETDEWEB)

    dehope, w j; browning, n; campbell, g; cook, e; king, w; lagrange, t; reed, b; stuart, b; Shuttlesworth, R; Pyke, B

    2009-06-25

    Lawrence Livermore National Laboratory (LLNL) has converted a commercial 200kV transmission electron microscope (TEM) into an ultrafast, nanoscale diagnostic tool for material science studies. The resulting Dynamic Transmission Electron Microscope (DTEM) has provided a unique tool for the study of material phase transitions, reaction front analyses, and other studies in the fields of chemistry, materials science, and biology. The TEM's thermionic electron emission source was replaced with a fast photocathode and a laser beam path was provided for ultraviolet surface illumination. The resulting photoelectron beam gives downstream images of 2 and 20 ns exposure times at 100 and 10 nm spatial resolution. A separate laser, used as a pump pulse, is used to heat, ignite, or shock samples while the photocathode electron pulses, carefully time-synchronized with the pump, function as probe in fast transient studies. The device functions in both imaging and diffraction modes. A laser upgrade is underway to make arbitrary cathode pulse trains of variable pulse width of 10-1000 ns. Along with a fast e-beam deflection scheme, a 'movie mode' capability will be added to this unique diagnostic tool. This talk will review conventional electron microscopy and its limitations, discuss the development and capabilities of DTEM, in particularly addressing the prime and pulsed power considerations in the design and fabrication of the DTEM, and conclude with the presentation of a deflector and solid-state pulser design for Movie-Mode DTEM.

  1. Pulsed Power for a Dynamic Transmission Electron Microscope

    International Nuclear Information System (INIS)

    DeHope, W.J.; Browning, N.; Campbell, G.; Cook, E.; King, W.; Lagrange, T.; Reed, B.; Stuart, B.; Shuttlesworth, R.; Pyke, B.

    2009-01-01

    Lawrence Livermore National Laboratory (LLNL) has converted a commercial 200kV transmission electron microscope (TEM) into an ultrafast, nanoscale diagnostic tool for material science studies. The resulting Dynamic Transmission Electron Microscope (DTEM) has provided a unique tool for the study of material phase transitions, reaction front analyses, and other studies in the fields of chemistry, materials science, and biology. The TEM's thermionic electron emission source was replaced with a fast photocathode and a laser beam path was provided for ultraviolet surface illumination. The resulting photoelectron beam gives downstream images of 2 and 20 ns exposure times at 100 and 10 nm spatial resolution. A separate laser, used as a pump pulse, is used to heat, ignite, or shock samples while the photocathode electron pulses, carefully time-synchronized with the pump, function as probe in fast transient studies. The device functions in both imaging and diffraction modes. A laser upgrade is underway to make arbitrary cathode pulse trains of variable pulse width of 10-1000 ns. Along with a fast e-beam deflection scheme, a 'movie mode' capability will be added to this unique diagnostic tool. This talk will review conventional electron microscopy and its limitations, discuss the development and capabilities of DTEM, in particularly addressing the prime and pulsed power considerations in the design and fabrication of the DTEM, and conclude with the presentation of a deflector and solid-state pulser design for Movie-Mode DTEM

  2. Structural Fingerprinting of Nanocrystals in the Transmission Electron Microscope

    Science.gov (United States)

    Rouvimov, Sergei; Plachinda, Pavel; Moeck, Peter

    2010-03-01

    Three novel strategies for the structurally identification of nanocrystals in a transmission electron microscope are presented. Either a single high-resolution transmission electron microscopy image [1] or a single precession electron diffractogram (PED) [2] may be employed. PEDs from fine-grained crystal powders may also be utilized. Automation of the former two strategies is in progress and shall lead to statistically significant results on ensembles of nanocrystals. Open-access databases such as the Crystallography Open Database which provides more than 81,500 crystal structure data sets [3] or its mainly inorganic and educational subsets [4] may be utilized. [1] http://www.scientificjournals.org/journals 2007/j/of/dissertation.htm [2] P. Moeck and S. Rouvimov, in: {Drugs and the Pharmaceutical Sciences}, Vol. 191, 2009, 270-313 [3] http://cod.ibt.lt, http://www.crystallography.net, http://cod.ensicaen.fr, http://nanocrystallography.org, http://nanocrystallography.net, http://journals.iucr.org/j/issues/2009/04/00/kk5039/kk5039.pdf [4] http://nanocrystallography.research.pdx.edu/CIF-searchable

  3. Rashba-Zeeman-effect-induced spin filtering energy windows in a quantum wire

    International Nuclear Information System (INIS)

    Xiao, Xianbo; Nie, Wenjie; Chen, Zhaoxia; Zhou, Guanghui; Li, Fei

    2014-01-01

    We perform a numerical study on the spin-resolved transport in a quantum wire (QW) under the modulation of both Rashba spin-orbit coupling (SOC) and a perpendicular magnetic field by using the developed Usuki transfer-matrix method in combination with the Landauer-Büttiker formalism. Wide spin filtering energy windows can be achieved in this system for unpolarized spin injection. In addition, both the width of energy window and the magnitude of spin conductance within these energy windows can be tuned by varying Rashba SOC strength, which can be apprehended by analyzing the energy dispersions and spin-polarized density distributions inside the QW, respectively. Further study also demonstrates that these Rashba-SOC-controlled spin filtering energy windows show a strong robustness against disorders. These findings may not only benefit to further understand the spin-dependent transport properties of a QW in the presence of external fields but also provide a theoretical instruction to design a spin filter device.

  4. Rashba-Zeeman-effect-induced spin filtering energy windows in a quantum wire

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Xianbo, E-mail: xxb-11@hotmail.com; Nie, Wenjie [School of Computer, Jiangxi University of Traditional Chinese Medicine, Nanchang 330004 (China); Chen, Zhaoxia [School of Mechatronics Engineering, East China Jiaotong University, Nanchang 330013 (China); Zhou, Guanghui [Department of Physics and Key Laboratory for Low-Dimensional Quantum Structures and Manipulation (Ministry of Education), Hunan Normal University, Changsha 410081 (China); Li, Fei, E-mail: wltlifei@sina.com [Office of Scientific Research, Jiangxi University of Traditional Chinese Medicine, Nanchang 330004 (China)

    2014-06-14

    We perform a numerical study on the spin-resolved transport in a quantum wire (QW) under the modulation of both Rashba spin-orbit coupling (SOC) and a perpendicular magnetic field by using the developed Usuki transfer-matrix method in combination with the Landauer-Büttiker formalism. Wide spin filtering energy windows can be achieved in this system for unpolarized spin injection. In addition, both the width of energy window and the magnitude of spin conductance within these energy windows can be tuned by varying Rashba SOC strength, which can be apprehended by analyzing the energy dispersions and spin-polarized density distributions inside the QW, respectively. Further study also demonstrates that these Rashba-SOC-controlled spin filtering energy windows show a strong robustness against disorders. These findings may not only benefit to further understand the spin-dependent transport properties of a QW in the presence of external fields but also provide a theoretical instruction to design a spin filter device.

  5. Analysis of retarding field energy analyzer transmission by simulation of ion trajectories

    Science.gov (United States)

    van de Ven, T. H. M.; de Meijere, C. A.; van der Horst, R. M.; van Kampen, M.; Banine, V. Y.; Beckers, J.

    2018-04-01

    Retarding field energy analyzers (RFEAs) are used routinely for the measurement of ion energy distribution functions. By contrast, their ability to measure ion flux densities has been considered unreliable because of lack of knowledge about the effective transmission of the RFEA grids. In this work, we simulate the ion trajectories through a three-gridded RFEA using the simulation software SIMION. Using idealized test cases, it is shown that at high ion energy (i.e., >100 eV) the transmission is equal to the optical transmission rather than the product of the individual grid transparencies. Below 20 eV, ion trajectories are strongly influenced by the electric fields in between the grids. In this region, grid alignment and ion focusing effects contribute to fluctuations in transmission with ion energy. Subsequently the model has been used to simulate the transmission and energy resolution of an experimental RFEA probe. Grid misalignments reduce the transmission fluctuations at low energy. The model predicts the minimum energy resolution, which has been confirmed experimentally by irradiating the probe with a beam of ions with a small energy bandwidth.

  6. Probing low-energy hyperbolic polaritons in van der Waals crystals with an electron microscope

    KAUST Repository

    Govyadinov, Alexander A.

    2017-07-14

    Van der Waals materials exhibit intriguing structural, electronic, and photonic properties. Electron energy loss spectroscopy within scanning transmission electron microscopy allows for nanoscale mapping of such properties. However, its detection is typically limited to energy losses in the eV range-too large for probing low-energy excitations such as phonons or mid-infrared plasmons. Here, we adapt a conventional instrument to probe energy loss down to 100 meV, and map phononic states in hexagonal boron nitride, a representative van der Waals material. The boron nitride spectra depend on the flake thickness and on the distance of the electron beam to the flake edges. To explain these observations, we developed a classical response theory that describes the interaction of fast electrons with (anisotropic) van der Waals slabs, revealing that the electron energy loss is dominated by excitation of hyperbolic phonon polaritons, and not of bulk phonons as often reported. Thus, our work is of fundamental importance for interpreting future low-energy loss spectra of van der Waals materials.Here the authors adapt a STEM-EELS system to probe energy loss down to 100 meV, and apply it to map phononic states in hexagonal boron nitride, revealing that the electron loss is dominated by hyperbolic phonon polaritons.

  7. Probing low-energy hyperbolic polaritons in van der Waals crystals with an electron microscope.

    Science.gov (United States)

    Govyadinov, Alexander A; Konečná, Andrea; Chuvilin, Andrey; Vélez, Saül; Dolado, Irene; Nikitin, Alexey Y; Lopatin, Sergei; Casanova, Fèlix; Hueso, Luis E; Aizpurua, Javier; Hillenbrand, Rainer

    2017-07-21

    Van der Waals materials exhibit intriguing structural, electronic, and photonic properties. Electron energy loss spectroscopy within scanning transmission electron microscopy allows for nanoscale mapping of such properties. However, its detection is typically limited to energy losses in the eV range-too large for probing low-energy excitations such as phonons or mid-infrared plasmons. Here, we adapt a conventional instrument to probe energy loss down to 100 meV, and map phononic states in hexagonal boron nitride, a representative van der Waals material. The boron nitride spectra depend on the flake thickness and on the distance of the electron beam to the flake edges. To explain these observations, we developed a classical response theory that describes the interaction of fast electrons with (anisotropic) van der Waals slabs, revealing that the electron energy loss is dominated by excitation of hyperbolic phonon polaritons, and not of bulk phonons as often reported. Thus, our work is of fundamental importance for interpreting future low-energy loss spectra of van der Waals materials.Here the authors adapt a STEM-EELS system to probe energy loss down to 100 meV, and apply it to map phononic states in hexagonal boron nitride, revealing that the electron loss is dominated by hyperbolic phonon polaritons.

  8. Probing low-energy hyperbolic polaritons in van der Waals crystals with an electron microscope

    KAUST Repository

    Govyadinov, Alexander A.; Konečná , Andrea; Chuvilin, Andrey; Vé lez, Saü l; Dolado, Irene; Nikitin, Alexey Y.; Lopatin, Sergei; Casanova, Fè lix; Hueso, Luis E.; Aizpurua, Javier; Hillenbrand, Rainer

    2017-01-01

    Van der Waals materials exhibit intriguing structural, electronic, and photonic properties. Electron energy loss spectroscopy within scanning transmission electron microscopy allows for nanoscale mapping of such properties. However, its detection is typically limited to energy losses in the eV range-too large for probing low-energy excitations such as phonons or mid-infrared plasmons. Here, we adapt a conventional instrument to probe energy loss down to 100 meV, and map phononic states in hexagonal boron nitride, a representative van der Waals material. The boron nitride spectra depend on the flake thickness and on the distance of the electron beam to the flake edges. To explain these observations, we developed a classical response theory that describes the interaction of fast electrons with (anisotropic) van der Waals slabs, revealing that the electron energy loss is dominated by excitation of hyperbolic phonon polaritons, and not of bulk phonons as often reported. Thus, our work is of fundamental importance for interpreting future low-energy loss spectra of van der Waals materials.Here the authors adapt a STEM-EELS system to probe energy loss down to 100 meV, and apply it to map phononic states in hexagonal boron nitride, revealing that the electron loss is dominated by hyperbolic phonon polaritons.

  9. Renewable Energy Zone (REZ) Transmission Planning Process

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Nathan [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2018-03-08

    A REZ is a geographical area that enables the development of profitable, cost-effective, grid-connected renewable energy (RE). The REZ Transmission Planning Process is a proactive approach to plan, approve, and build transmission infrastructure connecting REZs to the power system which helps to increase the share of solar, wind and other RE resources in the power system while maintaining reliability and economics, and focuses on large-scale wind and solar resources that can be developed in sufficient quantities to warrant transmission system expansion and upgrades.

  10. Study of semiconductor valence plasmon line shapes via electron energy-loss spectroscopy in the transmission electron microscope

    International Nuclear Information System (INIS)

    Kundmann, M.K.

    1988-11-01

    Electron energy-loss spectra of the semiconductors Si, AlAs, GaAs, InAs, InP, and Ge are examined in detail in the regime of outer-shell and plasmon energy losses (0--100eV). Particular emphasis is placed on modeling and analyzing the shapes of the bulk valence plasmon lines. A line shape model based on early work by Froehlich is derived and compared to single-scattering probability distributions extracted from the measured spectra. Model and data are found to be in excellent agreement, thus pointing the way to systematic characterization of the plasmon component of EELS spectra. The model is applied to three separate investigations. 82 refs

  11. Development of a transmission positron microscope

    Energy Technology Data Exchange (ETDEWEB)

    Matsuya, M., E-mail: matsuya@jeol.co.jp [JEOL Ltd., 1-2 Musashino, 3-Chome, Akishima, Tokyo 196-8558 (Japan); Jinno, S. [Department of Applied Chemistry, Chiba University, Yayoi, Inage, Chiba, Chiba 263-8552 (Japan); Ootsuka, T.; Inoue, M. [JEOL Ltd., 1-2 Musashino, 3-Chome, Akishima, Tokyo 196-8558 (Japan); Kurihara, T. [High Energy Accelerator Research Organization, Oho, Tsukuba, Ibaraki 305-0801 (Japan); Doyama, M.; Inoue, M. [Teikyo University of Science and Technology, Uenohara, Yamanashi 409-0913 (Japan); Fujinami, M. [Department of Applied Chemistry, Chiba University, Yayoi, Inage, Chiba, Chiba 263-8552 (Japan)

    2011-07-21

    A practical transmission positron microscope (TPM) JEM-1011B has been developed to survey differences in the interaction of positron and electron beams with materials, and is installed in the Slow Positron Facility of High Energy Accelerator Research Organization (KEK). The TPM can share positron and electron beams, and can also be used as a transmission electron microscope (TEM). Positron transmission images up to magnification 10,000x (resolution: 50 nm) and positron diffraction patterns up to 044 family were successfully obtained by the TPM comparing them with those of electrons. The differences in material transmittances for both beams have been measured, and can be explained by the calculated results of the Monte Carlo simulation code PENELOPE-2008.

  12. Energy losses of superconducting power transmission cables in the grid

    DEFF Research Database (Denmark)

    Østergaard, Jacob; Okholm, Jan; Lomholt, Karin

    2001-01-01

    One of the obvious motives for development of superconducting power transmission cables is reduction of transmission losses. Loss components in superconducting cables as well as in conventional cables have been examined. These losses are used for calculating the total energy losses of conventional...... as well as superconducting cables when they are placed in the electric power transmission network. It is concluded that high load connections are necessary to obtain energy saving by the use of HTSC cables. For selected high load connections, an energy saving of 40% is expected. It is shown...

  13. Single Crystal Filters for Neutron Spectrometry

    International Nuclear Information System (INIS)

    Habib, N.

    2008-01-01

    A study of neutron transmission properties trough a large single crystals specimens of Si, Ge, Pb, Bi and sapphire at 300 K and 80 K have been made for a wide range of neutron energies. The effectiveness of such filters is given by the ratio of the total cross-section of unwanted epithermal neutrons to that the desired thermal neutron beam and by the optimum choice of the crystal orientation, its mosaic spread, thickness and temperature.Our study indicates that sapphire is significantly more effective than the others for a wide range of neutron energies

  14. Electromagnetic Compatibility of Transcutaneous Energy Transmission Systemfor Totally Implantable Artificial Heart

    Science.gov (United States)

    Shiba, Kenji; Koshiji, Kohji

    Transcutaneous Energy Transmission (TET) is one way of providing the energy needed to power a totally implantable artificial heart (TIAH). In the present study, an externally coupled TET system was implanted in a prototype human phantom to evaluate emission and immunity. In the emission evaluation, measurements were conducted based on CISPR Pub.11 and VDE 0871 standards, while immunity tests were based on the standards of the IEC 61000-4 series. The magnetic field of the radiated emission was measured using a loop antenna. At 0.1[MHz], we found the greatest magnetic field of 47.8 [dBμA/m], somewhat less than CISPR’s upper limit of 54 [dBμA/m]. For the conducted emission, by installing a noise filter and ferrite beads in the input section of the DC-power supply, conducted emission could be kept within the allowable limits of CISPR Pub.11 and VDE 0871. Finally, the immunity tests against radiated and conducted emission, electrostatic discharge and voltage fluctuation proved that the prototype could withstand the maximum level of disturbance. These results confirmed that the TET system implanted in a human phantom could, through modification, meet the emission and immunity standards.

  15. Enhanced thermal stability of a polymer solar cell blend induced by electron beam irradiation in the transmission electron microscope

    Energy Technology Data Exchange (ETDEWEB)

    Bäcke, Olof, E-mail: obacke@chalmers.se [Department of Applied Physics, Chalmers University of Technology, 41296 Göteborg (Sweden); Lindqvist, Camilla; Diaz de Zerio Mendaza, Amaia [Department of Chemistry and Chemical Engineering, Chalmers University of Technology, 41296 Göteborg (Sweden); Gustafsson, Stefan [Department of Applied Physics, Chalmers University of Technology, 41296 Göteborg (Sweden); Wang, Ergang; Andersson, Mats R.; Müller, Christian [Department of Chemistry and Chemical Engineering, Chalmers University of Technology, 41296 Göteborg (Sweden); Kristiansen, Per Magnus [Institute of Polymer Nanotechnology (INKA), FHNW University of Applied Science and Arts Northwestern Switzerland, 5210 Windisch (Switzerland); Laboratory for Micro- and Nanotechnology, Paul Scherrer Institute, 5232 Villigen (Switzerland); Olsson, Eva, E-mail: eva.olsson@chalmers.se [Department of Applied Physics, Chalmers University of Technology, 41296 Göteborg (Sweden)

    2017-05-15

    We show by in situ microscopy that the effects of electron beam irradiation during transmission electron microscopy can be used to lock microstructural features and enhance the structural thermal stability of a nanostructured polymer:fullerene blend. Polymer:fullerene bulk-heterojunction thin films show great promise for use as active layers in organic solar cells but their low thermal stability is a hindrance. Lack of thermal stability complicates manufacturing and influences the lifetime of devices. To investigate how electron irradiation affects the thermal stability of polymer:fullerene films, a model bulk-heterojunction film based on a thiophene-quinoxaline copolymer and a fullerene derivative was heat-treated in-situ in a transmission electron microscope. In areas of the film that exposed to the electron beam the nanostructure of the film remained stable, while the nanostructure in areas not exposed to the electron beam underwent large phase separation and nucleation of fullerene crystals. UV–vis spectroscopy shows that the polymer:fullerene films are stable for electron doses up to 2000 kGy. - Highlights: • Thermal stability of a polymer: fullerne blend is increased using electron irradiation. • Using in-situ transmission electron microscopy the nanostructure is studied. • Electron irradiation stops phase separation between the polymer and fullerene. • Electron irradiation quenches the formation and nucleation of fullerene crystals.

  16. Transmission Electron Microscopy and Diffractometry of Materials

    CERN Document Server

    Fultz, Brent

    2013-01-01

    This book explains concepts of transmission electron microscopy (TEM) and x-ray diffractometry (XRD) that are important for the characterization of materials. The fourth edition adds important new techniques of TEM such as electron tomography, nanobeam diffraction, and geometric phase analysis. A new chapter on neutron scattering completes the trio of x-ray, electron and neutron diffraction. All chapters were updated and revised for clarity. The book explains the fundamentals of how waves and wavefunctions interact with atoms in solids, and the similarities and differences of using x-rays, electrons, or neutrons for diffraction measurements. Diffraction effects of crystalline order, defects, and disorder in materials are explained in detail. Both practical and theoretical issues are covered. The book can be used in an introductory-level or advanced-level course, since sections are identified by difficulty. Each chapter includes a set of problems to illustrate principles, and the extensive Appendix includes la...

  17. Processing scarce biological samples for light and transmission electron microscopy

    Directory of Open Access Journals (Sweden)

    P Taupin

    2008-06-01

    Full Text Available Light microscopy (LM and transmission electron microscopy (TEM aim at understanding the relationship structure-function. With advances in biology, isolation and purification of scarce populations of cells or subcellular structures may not lead to enough biological material, for processing for LM and TEM. A protocol for preparation of scarce biological samples is presented. It is based on pre-embedding the biological samples, suspensions or pellets, in bovine serum albumin (BSA and bis-acrylamide (BA, cross-linked and polymerized. This preparation provides a simple and reproducible technique to process biological materials, present in limited quantities that can not be amplified, for light and transmission electron microscopy.

  18. A sub-50meV spectrometer and energy filter for use in combination with 200kV monochromated (S)TEMs.

    Science.gov (United States)

    Brink, H A; Barfels, M M G; Burgner, R P; Edwards, B N

    2003-09-01

    A high-energy resolution post-column spectrometer for the purpose of electron energy loss spectroscopy (EELS) and energy-filtered TEM in combination with a monochromated (S)TEM is presented. The prism aberrations were corrected up to fourth order using multipole elements improving the electron optical energy resolution and increasing the acceptance of the spectrometer for a combination of object area and collection angles. Electronics supplying the prism, drift tube, high-tension reference and critical lenses have been newly designed such that, in combination with the new electron optics, a sub-50 meV energy resolution has been realized, a 10-fold improvement over past post-column spectrometer designs. The first system has been installed on a 200 kV monochromated TEM at the Delft University of Technology. Total system energy resolution of sub-100 meV has been demonstrated. For a 1s exposure the resolution degraded to 110 meV as a result of noise. No further degradation in energy resolution was measured for exposures up to 1 min at 120 kV. Spectral resolution measurements, performed on the pi* peak of the BN K-edge, demonstrated a 350 meV (FWHM) peak width at 200 kV. This measure is predominantly determined by the natural line width of the BN K-edge.

  19. Transmission electron microscope studies of crystalline LiNbO3

    International Nuclear Information System (INIS)

    Pareja, R.; Gonzalez, R.; Chen, Y.

    1984-01-01

    Transmission electron microscope investigations in both as-grown and hydrogen-reduced LiNbO 3 reveal that niobium oxide precipitates can be produced by in situ irradiations in the electron microscope. The precipitation process is produced by a combined effect of ionizing electrons and the thermal heating of the specimens during irradiation. It is proposed that the composition of the precipitates is primarily Nb 2 O 5

  20. Evaluation of the effects of different filters and helium bag on the reduction of electron contamination in photon beam of Neptune linac

    International Nuclear Information System (INIS)

    Bahreyni Toosi, M. T.; Saberi, H.; Momen Nejad, M.

    2005-01-01

    Skin sparing is one of the most desirable characteristics of high energy photon beams. However, the photons emerging from the target of linacs are contaminated by secondary electrons as a result of their interactions with air, collimators, flattening filter and any other objects in their path. This phenomenon tends to increase the skin dose received by the patients. A practical and simple way to reduce the contribution of electron contamination is to place a sheet of medium to high Z material just after the secondary collimator. In this study, filters having different thickness and atomic number were applied and their effectiveness on the reduction of skin dose was evaluated. Materials and Methods: The filters of different thickness and atomic number were applied. The percent depth dose values were determined by the direct measurements made in a Scanditronix water phantom using a PTW 31006 Pin Point chamber having a sensitive volume of 0.015 cm 3 . A Perspex filter holder was made to be installed on the accessory slot. A plastic bag containing helium was also made using thin plastic sheet to study the effect of the helium bag when it replaces the air column between the head of the linac and the phantom. All of the measurements were carried out for the three field sizes of 10*10, 20*20 and 25*25 cm 2 . The setups were adjusted for SSD 100 cm. The ratio of the surface dose to maximum dose (Ds) was used as the criterion to determine the optimum filter. Results: The dosimetry results obtained in the water phantom indicated that a 0.4 mm thick Pb filter is the most effective one. This filter reduces the Ds for the field sizes of 10*10, 20*20 and 25*25 cm 2 by 5.7, 7.9 and 9.6%, respectively. Also the simultaneous use of the optimum filter and He bag is more effective than the filter alone. It reduces the Ds by 6.3, 10.1 and 12.3% for the field sizes of 10*10,20*20 and 25*25 cm 2 , respectively. Discussion and Conclusion: Based on the results of this work it is evident

  1. A dynamic elastic and inelastic scattering theory of high-energy electrons

    International Nuclear Information System (INIS)

    Wang Zhonglin

    1990-01-01

    A review is given on the applications of elastic multislice theory for simulating the images and diffractions of reflection electron microscopy. The limitation of this theory is illustrated according to some experimental observations. A generalized elastic and inelastic multislice theory is then introduced from quantum mechanics; its applications for approaching inelastic plasmon excitation and phonon excitation (or thermal diffuse scattering) are discussed. The energy-filtered inelastic high resolution images can be simulated based on this theory

  2. Study of electron transmission through thin metallic films by the electron moessbauer spectroscopy

    International Nuclear Information System (INIS)

    Babikova, Yu.F.; Vakar, O.M.; Gruzin, O.M.; Petrikin, Yu.V.

    1983-01-01

    Results of the experimental study of the transmission of conversion electrons through aluminium, iron, tin and gold films are presented. Absorption of resonance electrons of the Moessbauer nuclide 57 Fe, formed during target irradiation with γ-quanta of 57 Co source in chromium matrix has been studied. It is asserted that absorption of conversion electrons in films of different elements is similar; at that, like in the case of β-particles, the law of absorption of resonance electrons, emitted from the flat layer, is exponential For conversion electrons of the Moessbauer nuclide 57 Fe the absorption coefficient is (0.025+-0.002) cm 2 /μg, which in the case of iron absorbing film corresponds to (20.0+-1.0)x10 4 cm -1

  3. Kalman Filtering and Smoothing of the Van Allen Probes Observations to Estimate the Radial, Energy and Pitch Angle Diffusion Rates

    Science.gov (United States)

    Podladchikova, T.; Shprits, Y.; Kellerman, A. C.

    2015-12-01

    The Kalman filter technique combines the strengths of new physical models of the Earth's radiation belts with long-term spacecraft observations of electron fluxes and therefore provide an extremely useful method for the analysis of the state and evolution of the electron radiation belts. However, to get the reliable data assimilation output, the Kalman filter application is confronted with a set of fundamental problems. E.g., satellite measurements are usually limited to a single location in space, which confines the reconstruction of the global evolution of the radiation environment. The uncertainties arise from the imperfect description of the process dynamics and the presence of observation errors, which may cause the failure of data assimilation solution. The development of adaptive Kalman filter that combines the Van Allen Probes data and 3-D VERB code, its accurate customizations in the reconstruction of model describing the phase space density (PSD) evolution, extension of the possibilities to use measurement information, and the model adjustment by developing the identification techniques of model and measurement errors allowed us to reveal hidden and implicit regularities of the PSD dynamics and obtain quantitative and qualitative estimates of radial, energy and pitch angle diffusion characteristics from satellite observations. In this study we propose an approach to estimate radial, energy and pitch angle diffusion rates, as well as the direction of their propagation.

  4. Transmission environmental scanning electron microscope with scintillation gaseous detection device.

    Science.gov (United States)

    Danilatos, Gerasimos; Kollia, Mary; Dracopoulos, Vassileios

    2015-03-01

    A transmission environmental scanning electron microscope with use of a scintillation gaseous detection device has been implemented. This corresponds to a transmission scanning electron microscope but with addition of a gaseous environment acting both as environmental and detection medium. A commercial type of low vacuum machine has been employed together with appropriate modifications to the detection configuration. This involves controlled screening of various emitted signals in conjunction with a scintillation gaseous detection device already provided with the machine for regular surface imaging. Dark field and bright field imaging has been obtained along with other detection conditions. With a progressive series of modifications and tests, the theory and practice of a novel type of microscopy is briefly shown now ushering further significant improvements and developments in electron microscopy as a whole. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. High-sensitivity visualization of localized electric fields using low-energy electron beam deflection

    Science.gov (United States)

    Jeong, Samuel; Ito, Yoshikazu; Edwards, Gary; Fujita, Jun-ichi

    2018-06-01

    The visualization of localized electronic charges on nanocatalysts is expected to yield fundamental information about catalytic reaction mechanisms. We have developed a high-sensitivity detection technique for the visualization of localized charges on a catalyst and their corresponding electric field distribution, using a low-energy beam of 1 to 5 keV electrons and a high-sensitivity scanning transmission electron microscope (STEM) detector. The highest sensitivity for visualizing a localized electric field was ∼0.08 V/µm at a distance of ∼17 µm from a localized charge at 1 keV of the primary electron energy, and a weak local electric field produced by 200 electrons accumulated on the carbon nanotube (CNT) apex can be visualized. We also observed that Au nanoparticles distributed on a CNT forest tended to accumulate a certain amount of charges, about 150 electrons, at a ‑2 V bias.

  6. A new ASE filter: the 20-fold prism monochromator

    NARCIS (Netherlands)

    Bakker, L.P.; Freriks, J.M.; Kroesen, G.M.W.

    1999-01-01

    A new ASE filter is presented, consisting of 20 dispersion prisms and two spatial filters. The transmission of the filter is measured with a ring-dye laser. The 1 width of the filter is 0.23 nm. The transmission is approximately 80% for the transmitted wavelengths. The rejection is in the order of .

  7. Power Electronics – Key Technology for Renewable Energy Systems – Status and Future

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Yang, Yongheng; Ma, Ke

    2013-01-01

    play an essential role. Using highly efficient power electronics in power generation, power transmission/ distribution and end-user application, together with advanced control solutions, can pave the way for renewable energies. In view of this, some of the most emerging renewable energies, e.g. wind......The energy paradigms in many countries (e.g. Germany and Denmark) have experienced a significant change from fossil-based resources to clean renewables in the past few decades. The scenario of highly penetrated renewables is going to be further enhanced. This requires that the production......, distribution and use of the energy should be as technological efficient as possible and incentives to save energy at the end-user should also be streng-thened. In order to realize the transition smoothly and effectively, energy conversion systems, currently based on power electronics technology, will again...

  8. Feasibility Studies of the Two Filters Method in TJ-II for Electron Temperature Measurements in High Density Plasmas

    International Nuclear Information System (INIS)

    Baiao, D.; Medina, F.; Ochando, M.; Varandas, C.

    2009-01-01

    The TJ-II plasma soft X-ray emission was studied in order to establish an adequate setup for an electron temperature diagnostic suitable for high density, with spatial and temporal resolutions, based on the two-filters method. The preliminary experimental results reported were obtained with two diagnostics (an X-ray PHA based on a Ge detector and a tomography system) already installed in TJ-II stellarator. These results lead to the conclusion that the two-filters method was a suitable option for an electron temperature diagnostic for high-density plasmas in TJ-II. We present the design and fi rst results obtained with a prototype for the measurement of electron temperature in TJ-II plasmas heated with energetic neutral beams. This system consists in two AXUV20A detectors which measure the soft X-ray plasma emissivity trough beryllium filters of different thickness. From the two-filters technique it is possible to estimate the electron temperature. The analyses carried out allowed concluding which filter thicknesses are most suited for TJ-II plasmas, and enhanced the need of a computer code to simulate signals and plasma compositions. (Author) 7 refs.

  9. Feasibility Studies of the Two Filters Method in TJ-II for Electron Temperature Measurements in High Density Plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Baiao, D.; Medina, F.; Ochando, M.; Varandas, C.

    2009-07-01

    The TJ-II plasma soft X-ray emission was studied in order to establish an adequate setup for an electron temperature diagnostic suitable for high density, with spatial and temporal resolutions, based on the two-filters method. The preliminary experimental results reported were obtained with two diagnostics (an X-ray PHA based on a Ge detector and a tomography system) already installed in TJ-II stellarator. These results lead to the conclusion that the two-filters method was a suitable option for an electron temperature diagnostic for high-density plasmas in TJ-II. We present the design and fi rst results obtained with a prototype for the measurement of electron temperature in TJ-II plasmas heated with energetic neutral beams. This system consists in two AXUV20A detectors which measure the soft X-ray plasma emissivity trough beryllium filters of different thickness. From the two-filters technique it is possible to estimate the electron temperature. The analyses carried out allowed concluding which filter thicknesses are most suited for TJ-II plasmas, and enhanced the need of a computer code to simulate signals and plasma compositions. (Author) 7 refs.

  10. Self-powered detector probes for electron and gamma-ray beam monitoring in high-power industrial accelerators

    International Nuclear Information System (INIS)

    Lone, M.A.

    1992-08-01

    A self-powered detector (SPD) is a simple passive device that consists of a coaxial probe with a metallic outer sleeve, a mineral oxide insulating layer, and a metallic inner core. SPDs are used in nuclear reactors for monitoring neutron and gamma ray fields. Responses of various SPDs to electron and gamma ray beams from industrial accelerators were investigated with Monte Carlo simulations. By judicious choice of transmission filters, threshold SPD probes were investigated for on-line monitoring of the beam energy spectrum of the high-power IMPELA industrial electron accelerator. (Author) (14 figs, 16 refs.)

  11. Three-Dimensional scanning transmission electron microscopy of biological specimens

    KAUST Repository

    De Jonge, Niels; Sougrat, Rachid; Northan, Brian M.; Pennycook, Stephen J.

    2010-01-01

    A three-dimensional (3D) reconstruction of the cytoskeleton and a clathrin-coated pit in mammalian cells has been achieved from a focal-series of images recorded in an aberration-corrected scanning transmission electron microscope (STEM

  12. Wave energy transmission apparatus for high-temperature environments

    Science.gov (United States)

    Buckley, John D. (Inventor); Edwards, William C. (Inventor); Kelliher, Warren C. (Inventor); Carlberg, Ingrid A. (Inventor)

    2010-01-01

    A wave energy transmission apparatus has a conduit made from a refractory oxide. A transparent, refractory ceramic window is coupled to the conduit. Wave energy passing through the window enters the conduit.

  13. [Review of wireless energy transmission system for total artificial heart].

    Science.gov (United States)

    Zhang, Chi; Yang, Ming

    2009-11-01

    This paper sums up the fundamental structure of wireless energy transmission system for total artificial heart, and compares the key parameters and performance of some representative systems. After that, it is discussed that the future development trend of wireless energy transmission system for total artificial heart.

  14. In situ transmission electron microscopy and scanning transmission electron microscopy studies of sintering of Ag and Pt nanoparticles

    International Nuclear Information System (INIS)

    Asoro, M.A.; Ferreira, P.J.; Kovar, D.

    2014-01-01

    Transmission electron microscopy and scanning transmission electron microscopy studies were conducted in situ on 2–5 nm Pt and 10–40 nm Ag nanoparticles to study mechanisms for sintering and to measure relevant sintering kinetics in nanoscale particles. Sintering between two separated particles was observed to initiate by either (1) diffusion of the particles on the sample support or (2) diffusion of atoms or small clusters of atoms to the neck region between the two particles. After particle contact, the rate of sintering was controlled by atomic surface diffusivity. The surface diffusivity was determined as a function of particle size and temperature from experimental measurements of the rate of neck growth of the particles. The surface diffusivities did not show a strong size effect for the range of particle sizes that were studied. The surface diffusivity for Pt nanoparticles exhibited the expected Arrhenius temperature dependence and did not appear to be sensitive to the presence of surface contaminants. In contrast, the surface diffusivity for Ag nanoparticles was affected by the presence of impurities such as carbon. The diffusivities for Ag nanoparticles were consistent with previous measurements of bulk surface diffusivities for Ag in the presence of C, but were significantly slower than those obtained from pristine Ag

  15. In-situ straining and time-resolved electron tomography data acquisition in a transmission electron microscope.

    Science.gov (United States)

    Hata, S; Miyazaki, S; Gondo, T; Kawamoto, K; Horii, N; Sato, K; Furukawa, H; Kudo, H; Miyazaki, H; Murayama, M

    2017-04-01

    This paper reports the preliminary results of a new in-situ three-dimensional (3D) imaging system for observing plastic deformation behavior in a transmission electron microscope (TEM) as a directly relevant development of the recently reported straining-and-tomography holder [Sato K et al. (2015) Development of a novel straining holder for transmission electron microscopy compatible with single tilt-axis electron tomography. Microsc. 64: 369-375]. We designed an integrated system using the holder and newly developed straining and image-acquisition software and then developed an experimental procedure for in-situ straining and time-resolved electron tomography (ET) data acquisition. The software for image acquisition and 3D visualization was developed based on the commercially available ET software TEMographyTM. We achieved time-resolved 3D visualization of nanometer-scale plastic deformation behavior in a Pb-Sn alloy sample, thus demonstrating the capability of this system for potential applications in materials science. © The Author 2016. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Electron Source Brightness and Illumination Semi-Angle Distribution Measurement in a Transmission Electron Microscope.

    Science.gov (United States)

    Börrnert, Felix; Renner, Julian; Kaiser, Ute

    2018-05-21

    The electron source brightness is an important parameter in an electron microscope. Reliable and easy brightness measurement routes are not easily found. A determination method for the illumination semi-angle distribution in transmission electron microscopy is even less well documented. Herein, we report a simple measurement route for both entities and demonstrate it on a state-of-the-art instrument. The reduced axial brightness of the FEI X-FEG with a monochromator was determined to be larger than 108 A/(m2 sr V).

  17. Nano-structured thin films : a Lorentz transmission electron microscopy and electron holography study

    NARCIS (Netherlands)

    Hosson, J.Th.M. de; Raedt, H.A. De; Zhong, ZY; Saka, H; Kim, TH; Holm, EA; Han, YF; Xie, XS

    2005-01-01

    This paper aims at applying advanced transmission electron microscopy (TEM) to functional materials, such as ultra-soft magnetic films for high-frequency inductors, to reveal the structure-property relationship. The ultimate goal is to delineate a more quantitative way to obtain information of the

  18. Energy and bandwidth-efficient wireless transmission

    CERN Document Server

    Gao, Wei

    2017-01-01

    This book introduces key modulation and predistortion techniques for approaching energy and spectrum-efficient transmission for wireless communication systems. The book presents a combination of theoretical principles, practical implementations, and actual tests. It focuses on spectrum-efficient modulation and energy-efficient transmission techniques in the portable wireless communication systems, and introduces currently developed and designed RF transceivers in the latest wireless markets. Most materials, design examples, and design strategies used are based on the author’s two decades of work in the digital communication fields, especially in the areas of the digital modulations, demodulations, digital signal processing, and linearization of power amplifiers. The applications of these practical products and equipment cover the satellite communications on earth station systems, microwave communication systems, 2G GSM and 3G WCDMA mobile communication systems, and 802.11 WLAN systems.

  19. Morphology of gills of the seawater fish Cathorops spixii (Agassiz (Ariidae by scanning and transmission electron microscopy

    Directory of Open Access Journals (Sweden)

    Daura R. Eiras-Stofella

    2002-12-01

    Full Text Available Gills of the seawater fish Cathorops spixii (Agassiz, 1829 were submitted to routine processing for observation in scanning and transmission electron microscopy. The wrinkled surface of the gill filaments showed well-defined cellular ultrastructures. Microridges on cellular surface were projected over all gill structures, including respiratory lamellae. Chloride cells were usually at primary lamellae. Some rodlet cells were found. Mucous secretory cells were uncommon at all parts of the gill arches. The pharyngeal region of the gill arches showed a lot of taste buds but no spines. There were small and strong rakers. Such morphology is indicative of fishes that swallow small food but do not have filtering habits. At the ultrastructural level the gills of C. spixii presented the typical morphological pattern of Teleostei fishes.

  20. On the threshold conditions for electron beam damage of asbestos amosite fibers in the transmission electron microscope (TEM).

    Science.gov (United States)

    Martin, Joannie; Beauparlant, Martin; Sauvé, Sébastien; L'Espérance, Gilles

    2016-12-01

    Asbestos amosite fibers were investigated to evaluate the damage caused by a transmission electron microscope (TEM) electron beam. Since elemental x-ray intensity ratios obtained by energy dispersive x-ray spectroscopy (EDS) are commonly used for asbestos identification, the impact of beam damage on these ratios was evaluated. It was determined that the magnesium/silicon ratio best represented the damage caused to the fiber. Various tests showed that most fibers have a current density threshold above which the chemical composition of the fiber is modified. The value of this threshold current density varied depending on the fiber, regardless of fiber diameter, and in some cases could not be determined. The existence of a threshold electron dose was also demonstrated. This value was dependent on the current density used and can be increased by providing a recovery period between exposures to the electron beam. This study also established that the electron beam current is directly related to the damage rate above a current density of 165 A/cm 2 . The large number of different results obtained suggest, that in order to ensure that the amosite fibers are not damaged, analysis should be conducted below a current density of 100 A/cm 2 .

  1. Energy Transmission and Infrastructure

    Energy Technology Data Exchange (ETDEWEB)

    Mathison, Jane

    2012-12-31

    The objective of Energy Transmission and Infrastructure Northern Ohio (OH) was to lay the conceptual and analytical foundation for an energy economy in northern Ohio that will: • improve the efficiency with which energy is used in the residential, commercial, industrial, agricultural, and transportation sectors for Oberlin, Ohio as a district-wide model for Congressional District OH-09; • identify the potential to deploy wind and solar technologies and the most effective configuration for the regional energy system (i.e., the ratio of distributed or centralized power generation); • analyze the potential within the district to utilize farm wastes to produce biofuels; • enhance long-term energy security by identifying ways to deploy local resources and building Ohio-based enterprises; • identify the policy, regulatory, and financial barriers impeding development of a new energy system; and • improve energy infrastructure within Congressional District OH-09. This objective of laying the foundation for a renewable energy system in Ohio was achieved through four primary areas of activity: 1. district-wide energy infrastructure assessments and alternative-energy transmission studies; 2. energy infrastructure improvement projects undertaken by American Municipal Power (AMP) affiliates in the northern Ohio communities of Elmore, Oak Harbor, and Wellington; 3. Oberlin, OH-area energy assessment initiatives; and 4. a district-wide conference held in September 2011 to disseminate year-one findings. The grant supported 17 research studies by leading energy, policy, and financial specialists, including studies on: current energy use in the district and the Oberlin area; regional potential for energy generation from renewable sources such as solar power, wind, and farm-waste; energy and transportation strategies for transitioning the City of Oberlin entirely to renewable resources and considering pedestrians, bicyclists, and public transportation as well as drivers

  2. Technical Note: On the impact of the incident electron beam energy on the primary dose component of flattening filter free photon beams

    International Nuclear Information System (INIS)

    Kuess, Peter; Georg, Dietmar; Lechner, Wolfgang; Palmans, Hugo

    2016-01-01

    Purpose: For commercially available linear accelerators (Linacs), the electron energies of flattening filter free (FFF) and flattened (FF) beams are either identical or the electron energy of the FFF beam is increased to match the percentage depth dose curve (PDD) of the FF beam (in reference geometry). This study focuses on the primary dose components of FFF beams for both kinds of settings, studied on the same Linac. Methods: The measurements were conducted on a VersaHD Linac (Elekta, Crawley, UK) for both FF and FFF beams with nominal energies of 6 and 10 MV. In the clinical setting of the VersaHD, the energy of FFF M (Matched) beams is set to match the PDDs of the FF beams. In contrast the incident electron beam of the FFF U beam was set to the same energy as for the FF beam. Half value layers (HVLs) and a dual parameter beam quality specifier (DPBQS) were determined. Results: For the 6 MV FFF M beam, HVL and DPBQS values were very similar compared to those of the 6 MV FF beam, while for the 10 MV FFF M and FF beams, only %dd(10) x and HVL values were comparable (differences below 1.5%). This shows that matching the PDD at one depth does not guarantee other beam quality dependent parameters to be matched. For FFF U beams, all investigated beam quality specifiers were significantly different compared to those for FF beams of the same nominal accelerator potential. The DPBQS of the 6 MV FF and FFF M beams was equal within the measurement uncertainty and was comparable to published data of a machine with similar TPR 20,10 and %dd(10) x . In contrast to that, the DPBQS’s two parameters of the 10 MV FFF M beam were substantially higher compared to those for the 10 MV FF beam. Conclusions: PDD-matched FF and FFF beams of both nominal accelerator potentials were observed to have similar HVL values, indicating similarity of their primary dose components. Using the DPBQS revealed that the mean attenuation coefficient was found to be the same within the uncertainty of

  3. Origin of spin-dependent asymmetries in electron transmission through ultrathin ferromagnetic films

    International Nuclear Information System (INIS)

    Gokhale, M.P.; Mills, D.L.

    1991-01-01

    We present theoretical calculations of exchange asymmetries in the transmission of electrons through ultrathin films of ferromagnetic Fe. The results account nicely for the magnitude of the asymmetries observed by Pappas et al. in photoemission studies of Cu covered by an ultrathin film of Fe. We argue that exchange asymmetry in the transmissivity of the Fe film, rather than the spin dependence of the electron mean free path, is responsible for the effects reported by these authors

  4. Transmission electron microscopy of mercury metal

    KAUST Repository

    Anjum, Dalaver H.

    2016-03-28

    Summary: Transmission electron microcopy (TEM) analysis of liquid metals, especially mercury (Hg), is difficult to carry out because their specimen preparation poses a daunting task due to the unique surface properties of these metals. This paper reports a cryoTEM study on Hg using a novel specimen preparation technique. Hg metal is mixed with water using sonication and quenched in liquid ethane cryogen. This technique permits research into the morphological, phase and structural properties of Hg at nanoscale dimensions. © 2016 Royal Microscopical Society.

  5. Nanometer-scale, quantitative composition mappings of InGaN layers from a combination of scanning transmission electron microscopy and energy dispersive x-ray spectroscopy

    International Nuclear Information System (INIS)

    Pantzas, K; Voss, P L; Ougazzaden, A; Patriarche, G; Largeau, L; Mauguin, O; Troadec, D; Gautier, S; Moudakir, T; Suresh, S

    2012-01-01

    Using elastic scattering theory we show that a small set of energy dispersive x-ray spectroscopy (EDX) measurements is sufficient to experimentally evaluate the scattering function of electrons in high-angle annular dark field scanning transmission microscopy (HAADF-STEM). We then demonstrate how to use this function to transform qualitative HAADF-STEM images of InGaN layers into precise, quantitative chemical maps of the indium composition. The maps obtained in this way combine the resolution of HAADF-STEM and the chemical precision of EDX. We illustrate the potential of such chemical maps by using them to investigate nanometer-scale fluctuations in the indium composition and their impact on the growth of epitaxial InGaN layers. (paper)

  6. Transmission sputtering of gold thin-films by low-energy (< 1 keV) xenon ions: I. The system and the measurement

    International Nuclear Information System (INIS)

    Ayrault, G.; Seidman, D.N.

    1978-01-01

    A novel system for direct measurement of the transmission sputtering yields of ion-irradiated thin films is described. The system was specifically designed for the study of the transmission sputtering caused by low energy ( 0 A thick) which was mounted in a JEM 200 transmission electron-microscope holder. The temperature of the specimen could be varied between approx. 25 and 300 K employing a continuous-transfer liquid-helium cryostat. The particles (atoms or ions) ejected from the unirradiated surface of the gold thin-film were detected by two channetron electron-multiplier arrays in the Chevron configuration; the Chevron detector was able to detect individual transmission sputtered particles when operated in the saturated mode. To further enhance resolution the electron cascades, produced by the CEMA, were amplified and shaped electronically into uniform square pulses. The shaped signals were detected with an Ithaco 391A lock-in amplifier (LIA). With the aid of a ratiometer feature in the LIA we were able to measure directly the ratio of the transmission sputtered-current (I/sub t/) to the incident ion-current (I/sub b/); for I/sub b/ = μA cm -2 a ratio of I/sub t//I/sub b/ as small as 1 x 10 -9 was measured. A detailed discussion of the calibration procedure and the experimental errors, involved in this technique, are also presented. 45 references

  7. Resonance electron attachment to plant hormones and its likely connection with biochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Pshenichnyuk, Stanislav A., E-mail: sapsh@anrb.ru [Institute of Molecule and Crystal Physics, Ufa Research Centre, Russian Academy of Sciences, Prospekt Oktyabrya 151, 450075 Ufa (Russian Federation); Modelli, Alberto [Dipartimento di Chimica “G. Ciamician”, Università di Bologna, via Selmi 2, 40126 Bologna, Italy and Centro Interdipartimentale di Ricerca in Scienze Ambientali, via S. Alberto 163, 48123 Ravenna (Italy)

    2014-01-21

    Gas-phase formation of temporary negative ion states via resonance attachment of low-energy (0–6 eV) electrons into vacant molecular orbitals of salicylic acid (I) and its derivatives 3-hydroxy- (II) and 4-hydroxybenzoic acid (III), 5-cloro salicylic acid (IV) and methyl salicylate (V) was investigated for the first time by electron transmission spectroscopy. The description of their empty-level structures was supported by density functional theory and Hartree-Fock calculations, using empirically calibrated linear equations to scale the calculated virtual orbital energies. Dissociative electron attachment spectroscopy (DEAS) was used to measure the fragment anion yields generated through dissociative decay channels of the parent molecular anions of compounds I–V, detected with a mass filter as a function of the incident electron energy in the 0–14 eV energy range. The most intense negative fragment produced by DEA to isomers I–III is the dehydrogenated molecular anion [M–H]{sup −}, mainly formed at incident electron energies around 1 eV. The vertical and adiabatic electron affinities were evaluated at the B3LYP/6-31+G(d) level as the anion/neutral total energy difference. The same theoretical method was also used for evaluation of the thermodynamic energy thresholds for production of the negative fragments observed in the DEA spectra. The gas-phase DEAS data can provide support for biochemical reaction mechanisms in vivo.

  8. Resonance electron attachment to plant hormones and its likely connection with biochemical processes

    International Nuclear Information System (INIS)

    Pshenichnyuk, Stanislav A.; Modelli, Alberto

    2014-01-01

    Gas-phase formation of temporary negative ion states via resonance attachment of low-energy (0–6 eV) electrons into vacant molecular orbitals of salicylic acid (I) and its derivatives 3-hydroxy- (II) and 4-hydroxybenzoic acid (III), 5-cloro salicylic acid (IV) and methyl salicylate (V) was investigated for the first time by electron transmission spectroscopy. The description of their empty-level structures was supported by density functional theory and Hartree-Fock calculations, using empirically calibrated linear equations to scale the calculated virtual orbital energies. Dissociative electron attachment spectroscopy (DEAS) was used to measure the fragment anion yields generated through dissociative decay channels of the parent molecular anions of compounds I–V, detected with a mass filter as a function of the incident electron energy in the 0–14 eV energy range. The most intense negative fragment produced by DEA to isomers I–III is the dehydrogenated molecular anion [M–H] − , mainly formed at incident electron energies around 1 eV. The vertical and adiabatic electron affinities were evaluated at the B3LYP/6-31+G(d) level as the anion/neutral total energy difference. The same theoretical method was also used for evaluation of the thermodynamic energy thresholds for production of the negative fragments observed in the DEA spectra. The gas-phase DEAS data can provide support for biochemical reaction mechanisms in vivo

  9. Sensor Transmission Power Schedule for Smart Grids

    Science.gov (United States)

    Gao, C.; Huang, Y. H.; Li, J.; Liu, X. D.

    2017-11-01

    Smart grid has attracted much attention by the requirement of new generation renewable energy. Nowadays, the real-time state estimation, with the help of phasor measurement unit, plays an important role to keep smart grid stable and efficient. However, the limitation of the communication channel is not considered by related work. Considering the familiar limited on-board batteries wireless sensor in smart grid, transmission power schedule is designed in this paper, which minimizes energy consumption with proper EKF filtering performance requirement constrain. Based on the event-triggered estimation theory, the filtering algorithm is also provided to utilize the information contained in the power schedule. Finally, its feasibility and performance is demonstrated using the standard IEEE 39-bus system with phasor measurement units (PMUs).

  10. An energy-filtering device coupled to a quadrupole mass spectrometer for soft-landing molecular ions on surfaces with controlled energy

    Energy Technology Data Exchange (ETDEWEB)

    Bodin, A.; Laloo, R.; Abeilhou, P.; Guiraud, L.; Gauthier, S.; Martrou, D. [Nanosciences Group, CEMES, CNRS UPR 8011 and University Toulouse III - Paul Sabatier, 29 rue Jeanne Marvig, BP94347, F-31055 Toulouse Cedex 4 (France)

    2013-09-15

    We have developed an energy-filtering device coupled to a quadrupole mass spectrometer to deposit ionized molecules on surfaces with controlled energy in ultra high vacuum environment. Extensive numerical simulations as well as direct measurements show that the ion beam flying out of a quadrupole exhibits a high-energy tail decreasing slowly up to several hundred eV. This energy distribution renders impossible any direct soft-landing deposition of molecular ions. To remove this high-energy tail by energy filtering, a 127° electrostatic sector and a specific triplet lenses were designed and added after the last quadrupole of a triple quadrupole mass spectrometer. The results obtained with this energy-filtering device show clearly the elimination of the high-energy tail. The ion beam that impinges on the sample surface satisfies now the soft-landing criterion for molecular ions, opening new research opportunities in the numerous scientific domains involving charges adsorbed on insulating surfaces.

  11. Laser Energy Transmission for a Wireless Energy Supply to Robots

    OpenAIRE

    Kawashima, Nobuki; Takeda, Kazuya

    2008-01-01

    We can find a lot of robot applications in construction activities, where it is very difficult or dangerous for a man to access and only robots can work. The time will come soon when the actual use of those robots is extensively realized and the wireless energy transmission technology using laser is a unique means to supply energy to those robots.

  12. The HURRA filter: An easy method to eliminate collimator artifacts in high-energy gamma camera images.

    Science.gov (United States)

    Perez-Garcia, H; Barquero, R

    The correct determination and delineation of tumor/organ size is crucial in 2-D imaging in 131 I therapy. These images are usually obtained using a system composed of a Gamma camera and high-energy collimator, although the system can produce artifacts in the image. This article analyses these artifacts and describes a correction filter that can eliminate those collimator artifacts. Using free software, ImageJ, a central profile in the image is obtained and analyzed. Two components can be seen in the fluctuation of the profile: one associated with the stochastic nature of the radiation, plus electronic noise and the other periodically across the position in space due to the collimator. These frequencies are analytically obtained and compared with the frequencies in the Fourier transform of the profile. A specially developed filter removes the artifacts in the 2D Fourier transform of the DICOM image. This filter is tested using a 15-cm-diameter Petri dish with 131 I radioactive water (big object size) image, a 131 I clinical pill (small object size) image, and an image of the remainder of the lesion of two patients treated with 3.7GBq (100mCi), and 4.44GBq (120mCi) of 131 I, respectively, after thyroidectomy. The artifact is due to the hexagonal periodic structure of the collimator. The use of the filter on large-sized images reduces the fluctuation by 5.8-3.5%. In small-sized images, the FWHM can be determined in the filtered image, while this is impossible in the unfiltered image. The definition of tumor boundary and the visualization of the activity distribution inside patient lesions improve drastically when the filter is applied to the corresponding images obtained with HE gamma camera. The HURRA filter removes the artifact of high-energy collimator artifacts in planar images obtained with a Gamma camera without reducing the image resolution. It can be applied in any study of patient quantification because the number of counts remains invariant. The filter makes

  13. Post-ion beam induced degradation of copper layers in transmission electron microscopy specimens

    Science.gov (United States)

    Seidel, F.; Richard, O.; Bender, H.; Vandervorst, W.

    2015-11-01

    Copper containing transmission electron microscopy (TEM) specimens frequently show corrosion after focused ion beam (FIB) preparation. This paper reveals that the corrosion product is a Cu-S phase growing over the specimen surface. The layer is identified by energy-dispersive x-ray spectroscopy, and lattice spacing indexing of power spectra patterns. The corrosion process is further studied by TEM on cone-shaped specimens, which are intentionally stored after FIB preparation with S flakes for short time. Furthermore, a protective method against corrosion is developed by varying the time in the FIB vacuum and the duration of a subsequent plasma cleaning.

  14. Multi-region optimal deployment of renewable energy considering different interregional transmission scenarios

    International Nuclear Information System (INIS)

    Wang, Ge; Zhang, Qi; Mclellan, Benjamin C.; Li, Hailong

    2016-01-01

    Renewable energy is expected to play much more important role in future low-carbon energy system, however, renewable energy has problems with regard to load-following and regional imbalance. This study aims to plan the deployment of intermittent renewable energy in multiple regions considering the impacts of regional natural conditions and generation capacity mix as well as interregional transmission capacity using a multi-region dynamic optimization model. The model was developed to find optimized development paths toward future smart electricity systems with high level penetration of intermittent renewable energy considering regional differences and interregional transmission at national scale. As a case study, the model was applied to plan power generation in nine interconnected regions in Japan out to 2030. Four scenarios were proposed with different supporting policies for the interregional power transmission infrastructures and different nuclear power phase-out scenarios. The analysis results show that (i) the government's support for power transmission infrastructures is vital important to develop more intermittent renewable energy in appropriate regions and utilize renewable energy more efficiently; (ii) nuclear and renewable can complement rather than replace each other if enough interregional transmission capacity is provided. - Highlights: • Plan the optimal deployment of intermittent renewable energy in multiple regions. • A multi-region dynamic optimization model was developed. • The impacts of natural conditions and interregional transmission are studied. • The government's support for transmission is vital important for renewable energy. • Nuclear and renewable can complement rather than replace each other.

  15. Calculations of atomic sputtering and displacement cross-sections in solid elements by electrons with energies from threshold to 1.5 MV

    International Nuclear Information System (INIS)

    Bradley, C.R.

    1988-12-01

    The kinetics of knock-on collisions of relativistic electrons with nuclei and details of the numerical evaluation of differential, recoil, and total Mott cross-sections are reviewed and discussed. The effects of electron beam induced displacement and sputtering, in the transmission electron microscope (TEM) environment, on microanalysis are analyzed with particular emphasis placed on the removal of material by knock-on sputtering. The mass loss predicted due to transmission knock-on sputtering is significant for many elements under conditions frequently encountered in microanalysis. Total Mott cross-sections are tabulated for all naturally occurring solid elements up to Z = 92 at displacement energies of one, two, four, and five times the sublimation energy and for accelerating voltages accessible in the transmission electron microscope. Fortran source code listings for the calculation of the differential Mott cross-section as a function of electron scattering angle (dMottCS), as a function of nuclear recoil angle (RECOIL), and the total Mott cross-section (TOTCS) are included. 48 refs., 21 figs., 12 tabs

  16. Computer simulation of high resolution transmission electron micrographs: theory and analysis

    International Nuclear Information System (INIS)

    Kilaas, R.

    1985-03-01

    Computer simulation of electron micrographs is an invaluable aid in their proper interpretation and in defining optimum conditions for obtaining images experimentally. Since modern instruments are capable of atomic resolution, simulation techniques employing high precision are required. This thesis makes contributions to four specific areas of this field. First, the validity of a new method for simulating high resolution electron microscope images has been critically examined. Second, three different methods for computing scattering amplitudes in High Resolution Transmission Electron Microscopy (HRTEM) have been investigated as to their ability to include upper Laue layer (ULL) interaction. Third, a new method for computing scattering amplitudes in high resolution transmission electron microscopy has been examined. Fourth, the effect of a surface layer of amorphous silicon dioxide on images of crystalline silicon has been investigated for a range of crystal thicknesses varying from zero to 2 1/2 times that of the surface layer

  17. Design and experimentally measure a high performance metamaterial filter

    Science.gov (United States)

    Xu, Ya-wen; Xu, Jing-cheng

    2018-03-01

    Metamaterial filter is a kind of expecting optoelectronic device. In this paper, a metal/dielectric/metal (M/D/M) structure metamaterial filter is simulated and measured. Simulated results indicate that the perfect impedance matching condition between the metamaterial filter and the free space leads to the transmission band. Measured results show that the proposed metamaterial filter achieves high performance transmission on TM and TE polarization directions. Moreover, the high transmission rate is also can be obtained when the incident angle reaches to 45°. Further measured results show that the transmission band can be expanded through optimizing structural parameters. The central frequency of the transmission band is also can be adjusted through optimizing structural parameters. The physical mechanism behind the central frequency shifted is solved through establishing an equivalent resonant circuit model.

  18. Economics and a novel voltage conversion technique associated with exporting Wyoming's energy by HVDC transmission

    Science.gov (United States)

    Xu, Kaili

    Wyoming is by far the largest coal producing state in the US, but local utilization is extremely low. As much as 92% of Wyoming's coal is shipped to the other states and is mainly consumed by their electricity producers. Coal accounts for more than 50% of the US electricity generation and is one of the least expensive energy sources. Wyoming could utilize its coal better by exporting electricity instead of exporting the coal only in its raw form. Natural gas is another important energy resource in Wyoming but local utilization is even lower. As a result of the development in coalbed methane fields, natural gas production in Wyoming is almost in pace with its coal production. In addition to constructing more new pipelines, new transmission lines should be considered as an alternative way of exporting this energy. Because of their enormous electricity market sizes and high electricity prices, California, Texas and Illinois are chosen to be the target markets for Wyoming's electricity. The proposed transmission schemes use High Voltage DC (HVDC) lines, which are suitable for long distance and cross-system power transmission. Technical and economic feasibilities are studied in details. The Wyoming-California scheme has a better return of investment than both the Wyoming-Texas and the Wyoming-Illinois schemes. A major drawback of HVDC transmission is the high level of harmonics generated by the converters. Elaborate filtering is required at both the AC and the DC sides. A novel pulse-multiplication method is proposed in the thesis to reduce the harmonics from the converter source. By introducing an averaging inductor, the proposed method uses less thyristors to achieve the same high-pulse operation as the existing series scheme. The reduction of thyristors makes the switching circuit more reliable and easier to control and maintain. Harmonic analysis shows that the harmonic level can be reduced to about one third of the original system. The proposed method is also

  19. An angular selective electron gun for the KATRIN experiment

    Energy Technology Data Exchange (ETDEWEB)

    Zacher, Michael; Ortjohann, Hans-Werner; Steinbrink, Nicholas; Josten, Lorenz; Hannen, Volker; Weinheimer, Christian; Winzen, Daniel [Westfaelische Wilhelms-Universitaet, Muenster (Germany); Collaboration: KATRIN-Collaboration

    2013-07-01

    The KArlsruhe TRItium Neutrino experiment aims for a measurement of the electron anti-neutrino mass with a sensitivity of 200 meV/c{sup 2} (95% C.L.) by analysing the endpoint region of the tritium β-decay. The main spectrometer (MAC-E filter type, 23m length) is one of the central parts of the experiment, featuring an energy resolution of Δ E<1 eV. For commissioning of the spectrometer a well defined electron source is needed that allows to determine the transmission characteristics and compare the electromagnetic properties to simulations. For this purpose an angular selective electron gun was developed. A pulsed UV-Laser produces electrons via the photo-electric effect, which are then accelerated electrostatically in a magnetic field. It features a small energy spread, a sharp selectable emission angle and covers the whole magnetic flux tube of KATRIN. By that, the characteristics of the spectrometer can be investigated with high precision. The time structure of the electron pulses allows time of flight measurements, offering enhanced sensitivity. The talk gives an overview about the e-gun design and its properties.

  20. Cross-sectional transmission electron microscopy of semiconductors

    International Nuclear Information System (INIS)

    Sadana, D.K.

    1982-10-01

    A method to prepare cross-sectional (X) semiconductor specimens for transmission electron microscopy (TEM) has been described. The power and utility of XTEM has been demonstrated. It has been shown that accuracy and interpretation of indirect structural-defects profiling techniques, namely, MeV He + channeling and secondary ion mass spectrometry (SIMS) can be greatly enhanced by comparing their results with those obtained by XTEM from the same set of samples

  1. Analog data transmission via fiber optics

    International Nuclear Information System (INIS)

    Cisneros, E.L.; Burgueno, G.F.

    1987-01-01

    In the SLAC Linear Collider Detector (SLD), as in most high-energy particle detectors, the electromagnetic noise environment is the limiting factor in electronic readout performance. Front-end electronics are particularly susceptible to electromagnetic interference (EMI), and great care has been taken to minimize its effects. The transfer of preprocessed analog signals from the detector environs, to the remote digital processing electronics, by conventional means (via metal conductors), may ultimately limit the performance of the system. Because it is highly impervious to EMI and ground loops, a fiber-optic medium has been chosen for the transmission of these signals. This paper describes several fiber-optic transmission schemes which satisfy the requirements of the SLD analog data transmission

  2. Analog data transmission via fiber optics

    International Nuclear Information System (INIS)

    Cisneros, E.L.; Burgueno, G.F.

    1986-10-01

    In the SLAC Linear Collider Detector (SLD), as in most high-energy particle detectors, the electromagnetic noise environment is the limiting factor in electronic readout performance. Front-end electronics are particulary susceptible to electromagnetic interference (EMI), and great care has been taken to minimize its effects. The transfer of preprocessed analog signals from the detector environs, to the remote digital processing electronics, by conventional means (via metal conductors), may ultimately limit the performance of the system. Because it is highly impervious to EMI and ground loops, a fiber-optic medium has been chosen for the transmission of these signals. This paper describes several fiber-optic transmission schemes which satisfy the requirements of the SLD analog data transmission

  3. Octennial History of the Development and Quality of High-Efficiency Filters for the US Atomic Energy Program

    Energy Technology Data Exchange (ETDEWEB)

    Gilbert, H. [United States Atomic Energy Commission, Washington, DC (United States)

    1968-12-15

    Two facilities are operated for the US atomic energy commission in its program to ensure the uniform quality of commercially manufactured high-efficiency particulate filters. the filter-testing program was started in january 1960 after it was realized that the commercial fire-resistant product incorporated deficiencies of manufacture. the record of testing for quality assurance by the two facilities and an analysis of factors governing the quality of filters are presented. the analysis is complemented with a description of efforts, made in the course of the filter testing, to improve the design of the filter for efficiency and reliability. the fire-resistant (hepa) filter of 1959 was inadequate. the inadequacy of the filter, now judged by reflection, was brought about by the intensive accelerated efforts to replace and preclude, wherever possible in the US atomic energy program, use of filters made of combustible materials. this desire for fire resistance of filters has proliferated widely among other members of the international atomic energy family. the intensive AEC effort caused US industry to produce filters of fire-resistant design but without the opportunity for development of manufacturing technology adequate for ensuring reliability of the filter. the state of the fire-resistant filter today is in sharp contrast to the 1959 filter. the testing program, coupled with a program for continuing improvement of the filter, has resulted in the effective removal of radioactive aerosols at atomic energy installations on a consistent and dependable basis. (author)

  4. Determination of the electronic temperature in the torsatron TJ-I Upgrade by the two filters

    Energy Technology Data Exchange (ETDEWEB)

    Medina, F.; Ochando, M.

    1994-07-01

    A Te monitor for the TJ-IU torsatron, based on the two-filters method, has been designed. It will consist of two surface-barrier silicon detectors looking at the same plasma region through berylium filters of different thickness. Plasma electron temperature is deduced from the ratio of the soft-x-ray fluxes transmitted through the two filters. The flexibility in magnetic configuration of TJ-IU plasmas has been taken into account in the mechanical design of this diagnostic. It will be attached to an upper 1 port of the vacuum vessel and the whole system will be movable both, to change the spatial resolution when needed and to enable the scan of the full plasma cross-section to obtain the radial profile of electron temperature in a shot-to-shot basis. (Author) 7 refs.

  5. Determination of the electronic temperature in the torsatron TJ-I Upgrade by the two filters

    International Nuclear Information System (INIS)

    Medina, F.; Ochando, M.

    1994-01-01

    A Te monitor for the TJ-IU torsatron, based on the two-filters method, has been designed. It will consist of two surface-barrier silicon detectors looking at the same plasma region through berylium filters of different thickness. Plasma electron temperature is deduced from the ratio of the soft-x-ray fluxes transmitted through the two filters. The flexibility in magnetic configuration of TJ-IU plasmas has been taken into account in the mechanical design of this diagnostic. It will be attached to an upper 1 port of the vacuum vessel and the whole system will be movable both, to change the spatial resolution when needed and to enable the scan of the full plasma cross-section to obtain the radial profile of electron temperature in a shot-to-shot basis. (Author) 7 refs

  6. Determination of the electronic temperature in the torsatron TJ-I Upgrade by the two filters

    International Nuclear Information System (INIS)

    Medina, F.; Ochando, M.

    1994-01-01

    A Te monitor for the TJ-IU torsatron, based on the two-filters method, has been designed. It will consist of two surface-barrier silicon detectors looking at the same plasma region through berilium filters of different thickness. Plasma electron temperature is deduced from the ratio of the soft-x-ray fluxes transmitted through the two filters. The flexibility in magnetic configuration of TJ-IU plasmas has been taken into account in the mechanical design of this diagnostic. It will be attached to an upper port of the vacuum vessel and the whole system will be movable both, to change the spatial resolution when needed and to enable the scan of the full plasma cross-section to obtain the radial profile of electron temperature in a shot-to-shot basis. (Author)

  7. Atomic column resolved electron energy-loss spectroscopy

    International Nuclear Information System (INIS)

    Duscher, G.; Pennycook, S.J.; Browning, N.D.

    1998-01-01

    Spatially resolved electron energy-loss spectroscopy (EELS) is rapidly developing into a unique and powerful tool to characterize internal interfaces. Because atomic column resolved Z-contrast imaging can be performed simultaneously with EELS in the scanning transmission electron microscope, this combination allows the atomic structure to be correlated with the electronic structure, and thus the local properties of interfaces or defects can be determined directly. However, the ability to characterize interfaces and defects at that level requires not only high spatial resolution but also the exact knowledge of the beam location, from where the spectrum is obtained. Here we discuss several examples progressing from cases where the limitation in spatial resolution is given by the microscopes or the nature of the sample, to one example of impurity atoms at a grain boundary, which show intensity and fine structure changes from atomic column to atomic column. Such data can be interpreted as changes in valence of the impurity, depending on its exact site in the boundary plane. Analysis ofthis nature is a valuable first step in understanding the microscopic structural, optical and electronic properties of materials. (orig.)

  8. Scanning electron microscopy and transmission electron microscopy study of hot-deformed gamma-TiAl-based alloy microstructure.

    Science.gov (United States)

    Chrapoński, J; Rodak, K

    2006-09-01

    The aim of this work was to assess the changes in the microstructure of hot-deformed specimens made of alloys containing 46-50 at.% Al, 2 at.% Cr and 2 at.% Nb (and alloying additions such as carbon and boron) with the aid of scanning electron microscopy and transmission electron microscopy techniques. After homogenization and heat treatment performed in order to make diverse lamellae thickness, the specimens were compressed at 1000 degrees C. Transmission electron microscopy examinations of specimens after the compression test revealed the presence of heavily deformed areas with a high density of dislocation. Deformation twins were also observed. Dynamically recrystallized grains were revealed. For alloys no. 2 and no. 3, the recovery and recrystallization processes were more extensive than for alloy no. 1.

  9. High-resolution monochromated electron energy-loss spectroscopy of organic photovoltaic materials.

    Science.gov (United States)

    Alexander, Jessica A; Scheltens, Frank J; Drummy, Lawrence F; Durstock, Michael F; Hage, Fredrik S; Ramasse, Quentin M; McComb, David W

    2017-09-01

    Advances in electron monochromator technology are providing opportunities for high energy resolution (10 - 200meV) electron energy-loss spectroscopy (EELS) to be performed in the scanning transmission electron microscope (STEM). The energy-loss near-edge structure in core-loss spectroscopy is often limited by core-hole lifetimes rather than the energy spread of the incident illumination. However, in the valence-loss region, the reduced width of the zero loss peak makes it possible to resolve clearly and unambiguously spectral features at very low energy-losses (photovoltaics (OPVs): poly(3-hexlythiophene) (P3HT), [6,6] phenyl-C 61 butyric acid methyl ester (PCBM), copper phthalocyanine (CuPc), and fullerene (C 60 ). Data was collected on two different monochromated instruments - a Nion UltraSTEM 100 MC 'HERMES' and a FEI Titan 3 60-300 Image-Corrected S/TEM - using energy resolutions (as defined by the zero loss peak full-width at half-maximum) of 35meV and 175meV, respectively. The data was acquired to allow deconvolution of plural scattering, and Kramers-Kronig analysis was utilized to extract the complex dielectric functions. The real and imaginary parts of the complex dielectric functions obtained from the two instruments were compared to evaluate if the enhanced resolution in the Nion provides new opto-electronic information for these organic materials. The differences between the spectra are discussed, and the implications for STEM-EELS studies of advanced materials are considered. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Optimal design of active EMC filters

    Science.gov (United States)

    Chand, B.; Kut, T.; Dickmann, S.

    2013-07-01

    A recent trend in automotive industry is adding electrical drive systems to conventional drives. The electrification allows an expansion of energy sources and provides great opportunities for environmental friendly mobility. The electrical powertrain and its components can also cause disturbances which couple into nearby electronic control units and communication cables. Therefore the communication can be degraded or even permanently disrupted. To minimize these interferences, different approaches are possible. One possibility is to use EMC filters. However, the diversity of filters is very large and the determination of an appropriate filter for each application is time-consuming. Therefore, the filter design is determined by using a simulation tool including an effective optimization algorithm. This method leads to improvements in terms of weight, volume and cost.

  11. High-pass filtering and dynamic gain regulation enhance vertical bursts transmission along the mossy fiber pathway of cerebellum

    Directory of Open Access Journals (Sweden)

    Jonathan Mapelli

    2010-05-01

    Full Text Available Signal elaboration in the cerebellum mossy fiber input pathway presents controversial aspects, especially concerning gain regulation and the spot-like (rather than beam-like appearance of granular-to-molecular layer transmission. By using voltage-sensitive dye (VSD imaging in rat cerebellar slices (Mapelli et al., 2010, we found that mossy fiber bursts optimally excited the granular layer above ~50 Hz and the overlaying molecular layer above ~100 Hz, thus generating a cascade of high-pass filters. NMDA receptors enhanced transmission in the granular, while GABA-A receptors depressed transmission in both the granular and molecular layer. Burst transmission gain was controlled through a dynamic frequency-dependent involvement of these receptors. Moreover, while high-frequency transmission was enhanced along vertical lines connecting the granular to molecular layer, no high-frequency enhancement was observed along the parallel fiber axis in the molecular layer. This was probably due to the stronger effect of Purkinje cell GABA-A receptor-mediated inhibition occurring along the parallel fibers than along the granule cell axon ascending branch. The consequent amplification of burst responses along vertical transmission lines could explain the spot-like activation of Purkinje cells observed following punctuate stimulation in vivo .

  12. Electron volt spectroscopy on a pulsed neutron source using resonance absorption filters

    International Nuclear Information System (INIS)

    Newport, R.J.; Williams, W.G.

    1983-05-01

    The design aspects of an inelastic neutron spectrometer based on energy selection by the resonance absorption filter difference method are discussed. Detailed calculations of the accessible dynamical range (Q, ω), energy and momentum transfer resolutions and representative count rates are presented for Sm and Ta resonance filters in an inverse geometry spectrometer on a high intensity pulsed source such as the RAL Spallation Neutron Source (SNS). A discussion is given of the double-difference method, which provides a means of improving the resonance attenuation peak shape. As a result of this study, as well as preliminary experimental results, recommendations are made for the future development of the technique. (author)

  13. Research of isolated resonances using the average energy shift method for filtered neutron beam

    International Nuclear Information System (INIS)

    Gritzay, O.O.; Grymalo, A.K.; Kolotyi, V.V.; Mityushkin, O.O.; Venediktov, V.M.

    2010-01-01

    This work is devoted to detailed description of one of the research directions in the Neutron Physics Department (NPD), namely, to research of resonance parameters of isolated nuclear level at the filtered neutron beam on the horizontal experimental channel HEC-8 of the WWR-M reactor. Research of resonance parameters is an actual problem nowadays. This is because there are the essential differences between the resonance parameter values in the different evaluated nuclear data library (ENDL) for many nuclei. Research of resonance parameter is possible due to the set of the neutron cross sections received at the same filter, but with the slightly shifted filter average energy. The shift of the filter average energy is possible by several processes. In this work this shift is realized by neutron energy dependence on scattering angle. This method is provided by equipment.

  14. Detection of pulmonary nodules on lung X-ray images. Studies on multi-resolutional filter and energy subtraction images

    International Nuclear Information System (INIS)

    Sawada, Akira; Sato, Yoshinobu; Kido, Shoji; Tamura, Shinichi

    1999-01-01

    The purpose of this work is to prove the effectiveness of an energy subtraction image for the detection of pulmonary nodules and the effectiveness of multi-resolutional filter on an energy subtraction image to detect pulmonary nodules. Also we study influential factors to the accuracy of detection of pulmonary nodules from viewpoints of types of images, types of digital filters and types of evaluation methods. As one type of images, we select an energy subtraction image, which removes bones such as ribs from the conventional X-ray image by utilizing the difference of X-ray absorption ratios at different energy between bones and soft tissue. Ribs and vessels are major causes of CAD errors in detection of pulmonary nodules and many researches have tried to solve this problem. So we select conventional X-ray images and energy subtraction X-ray images as types of images, and at the same time select ∇ 2 G (Laplacian of Guassian) filter, Min-DD (Minimum Directional Difference) filter and our multi-resolutional filter as types of digital filters. Also we select two evaluation methods and prove the effectiveness of an energy subtraction image, the effectiveness of Min-DD filter on a conventional X-ray image and the effectiveness of multi-resolutional filter on an energy subtraction image. (author)

  15. Structure Identification in High-Resolution Transmission Electron Microscopic Images

    DEFF Research Database (Denmark)

    Vestergaard, Jacob Schack; Kling, Jens; Dahl, Anders Bjorholm

    2014-01-01

    A connection between microscopic structure and macroscopic properties is expected for almost all material systems. High-resolution transmission electron microscopy is a technique offering insight into the atomic structure, but the analysis of large image series can be time consuming. The present ...

  16. Three-Dimensional Orientation Mapping in the Transmission Electron Microscope

    DEFF Research Database (Denmark)

    Liu, Haihua; Schmidt, Søren; Poulsen, Henning Friis

    2011-01-01

    resolution of 200 nanometers (nm). We describe here a nondestructive technique that enables 3D orientation mapping in the transmission electron microscope of mono- and multiphase nanocrystalline materials with a spatial resolution reaching 1 nm. We demonstrate the technique by an experimental study...

  17. Impact of energy filtering and carrier localization on the thermoelectric properties of granular semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Narducci, Dario, E-mail: dario.narducci@unimib.it [Department of Materials Science, University of Milano Bicocca, via Cozzi 53, 20125 Milano (Italy); Consorzio DeltaTi Research (Italy); Selezneva, Ekaterina [Department of Materials Science, University of Milano Bicocca, via Cozzi 53, 20125 Milano (Italy); Cerofolini, Gianfranco [Department of Materials Science, University of Milano Bicocca, via Cozzi 53, 20125 Milano (Italy); Consorzio DeltaTi Research (Italy); Frabboni, Stefano; Ottaviani, Giampiero [Department of Physics, University of Modena and Reggio Emilia, via Campi 213, 41100 Modena (Italy)

    2012-09-15

    Energy filtering has been widely considered as a suitable tool to increase the thermoelectric performances of several classes of materials. In its essence, energy filtering provides a way to increase the Seebeck coefficient by introducing a strongly energy-dependent scattering mechanism. Under certain conditions, however, potential barriers may lead to carrier localization, that may also affect the thermoelectric properties of a material. A model is proposed, actually showing that randomly distributed potential barriers (as those found, e.g., in polycrystalline films) may lead to the simultaneous occurrence of energy filtering and carrier localization. Localization is shown to cause a decrease of the actual carrier density that, along with the quantum tunneling of carriers, may result in an unexpected increase of the power factor with the doping level. The model is corroborated toward experimental data gathered by several authors on degenerate polycrystalline silicon and lead telluride. - Graphical abstract: In heavily doped semiconductors potential barriers may lead to both carrier energy filtering and localization. This may lead to an enhancement of the thermoelectric properties of the material, resulting in an unexpected increase of the power factor with the doping level. Highlights: Black-Right-Pointing-Pointer Potential barriers are shown to lead to carrier localization in thermoelectric materials. Black-Right-Pointing-Pointer Evidence is put forward of the formation of a mobility edge. Black-Right-Pointing-Pointer Energy filtering and localization may explain the enhancement of power factor in degenerate semiconductors.

  18. Performances of Dose Measurement of Commercial Electronic Dosimeters using Geiger Muller Tube and PIN Diode

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Hyunjun; Kim, Chankyu; Kim, Yewon; Kim, Giyoon; Cho, Gyuseong [Korea Advanced Institute of Science and Technology, Daejeon (Korea, Republic of)

    2014-05-15

    There are two categories in personal dosimeters, one is passive type dosimeter such as TLD (thermoluminescence dosimeter) and the other is active type dosimeter such as electronic dosimeter can show radiation dose immediately while TLD needs long time to readout its data by heating process. For improving the reliability of measuring dose for any energy of radiations, electronic dosimeter uses energy filter by metal packaging its detector using aluminum or copper, but measured dose of electronic dosimeter with energy filter cannot be completely compensated in wide radiation energy region. So, in this paper, we confirmed the accuracy of dose measurement of two types of commercial EPDs using Geiger Muller tube and PIN diode with CsI(Tl) scintillator in three different energy of radiation field. The experiment results for Cs-137 was almost similar with calculation value in the results of both electronic dosimeters, but, the other experiment values with Na-22 and Co-60 had higher error comparing with Cs-137. These results were caused by optimization of their energy filters. The optimization was depending on its thickness of energy filter. So, the electronic dosimeters have to optimizing the energy filter for increasing the accuracy of dose measurement or the electronic dosimeter using PIN diode with CsI(Tl) scintillator uses the multi-channel discriminator for using its energy information.

  19. Foucault imaging by using non-dedicated transmission electron microscope

    International Nuclear Information System (INIS)

    Taniguchi, Yoshifumi; Matsumoto, Hiroaki; Harada, Ken

    2012-01-01

    An electron optical system for observing Foucault images was constructed using a conventional transmission electron microscope without any special equipment for Lorentz microscopy. The objective lens was switched off and an electron beam was converged by a condenser optical system to the crossover on the selected area aperture plane. The selected area aperture was used as an objective aperture to select the deflected beam for Foucault mode, and the successive image-forming lenses were controlled for observation of the specimen images. The irradiation area on the specimen was controlled by selecting the appropriate diameter of the condenser aperture.

  20. Foucault imaging by using non-dedicated transmission electron microscope

    Science.gov (United States)

    Taniguchi, Yoshifumi; Matsumoto, Hiroaki; Harada, Ken

    2012-08-01

    An electron optical system for observing Foucault images was constructed using a conventional transmission electron microscope without any special equipment for Lorentz microscopy. The objective lens was switched off and an electron beam was converged by a condenser optical system to the crossover on the selected area aperture plane. The selected area aperture was used as an objective aperture to select the deflected beam for Foucault mode, and the successive image-forming lenses were controlled for observation of the specimen images. The irradiation area on the specimen was controlled by selecting the appropriate diameter of the condenser aperture.

  1. Foucault imaging by using non-dedicated transmission electron microscope

    Energy Technology Data Exchange (ETDEWEB)

    Taniguchi, Yoshifumi [Science and Medical Systems Business Group, Hitachi High-Technologies Corp., Ichige, Hitachinaka, Ibaraki 312-8504 (Japan); Matsumoto, Hiroaki [Corporate Manufacturing Strategy Group, Hitachi High-Technologies Corp., Ishikawa-cho, Hitachinaka, Ibaraki 312-1991 (Japan); Harada, Ken [Central Research Laboratory, Hitachi Ltd., Hatoyama, Saitama 350-0395 (Japan)

    2012-08-27

    An electron optical system for observing Foucault images was constructed using a conventional transmission electron microscope without any special equipment for Lorentz microscopy. The objective lens was switched off and an electron beam was converged by a condenser optical system to the crossover on the selected area aperture plane. The selected area aperture was used as an objective aperture to select the deflected beam for Foucault mode, and the successive image-forming lenses were controlled for observation of the specimen images. The irradiation area on the specimen was controlled by selecting the appropriate diameter of the condenser aperture.

  2. Impact of potassium doping on the electronic structure of tetracene and pentacene: An electron energy-loss study

    Energy Technology Data Exchange (ETDEWEB)

    Roth, Friedrich, E-mail: Friedrich.Roth@cfel.de [Center for Free-Electron Laser Science / DESY, Notkestraße 85, D-22607 Hamburg (Germany); Knupfer, Martin, E-mail: M.Knupfer@ifw-dresden.de [IFW Dresden, P.O. Box 270116, D-01171 Dresden (Germany)

    2015-10-21

    We report the doping induced changes of the electronic structure of tetracene and pentacene probed by electron energy-loss spectroscopy in transmission. A comparison between the dynamic response of undoped and potassium-intercalated tetracene and pentacene emphasizes the appearance of a new excitation feature in the former gap upon potassium addition. Interestingly, the momentum dependency of this new excitation shows a negative dispersion. Moreover, the analysis of the C 1s and K 2p core-level excitation results in a significantly lower doping level compared to potassium doped picene, a recently discovered superconductor. Therefore, the present electronic structure investigations open a new pathway to better understand the exceptional differences between acenes and phenacene and their divergent behavior upon alkali doping.

  3. Light transmission through intraocular lenses with or without yellow chromophore (blue light filter) and its potential influence on functional vision in everyday environmental conditions.

    Science.gov (United States)

    Owczarek, Grzegorz; Gralewicz, Grzegorz; Skuza, Natalia; Jurowski, Piotr

    2016-01-01

    In this research the factors used to evaluate the light transmission through two types of acrylic hydrophobic intraocular lenses, one that contained yellow chromophore that blocks blue light transmission and the other which did not contain that filter, were defined according to various light condition, e.g., daylight and at night. The potential influence of light transmission trough intraocular lenses with or without yellow chromophore on functional vision in everyday environmental conditions was analysed.

  4. Probing plasmons in three dimensions by combining complementary spectroscopies in a scanning transmission electron microscope

    International Nuclear Information System (INIS)

    Hachtel, J A; Haglund, R F; Pantelides, S T; Marvinney, C; Mayo, D; Mouti, A; Lupini, A R; Chisholm, M F; Mu, R; Pennycook, S J

    2016-01-01

    The nanoscale optical response of surface plasmons in three-dimensional metallic nanostructures plays an important role in many nanotechnology applications, where precise spatial and spectral characteristics of plasmonic elements control device performance. Electron energy loss spectroscopy (EELS) and cathodoluminescence (CL) within a scanning transmission electron microscope have proven to be valuable tools for studying plasmonics at the nanoscale. Each technique has been used separately, producing three-dimensional reconstructions through tomography, often aided by simulations for complete characterization. Here we demonstrate that the complementary nature of the two techniques, namely that EELS probes beam-induced electronic excitations while CL probes radiative decay, allows us to directly obtain a spatially- and spectrally-resolved picture of the plasmonic characteristics of nanostructures in three dimensions. The approach enables nanoparticle-by-nanoparticle plasmonic analysis in three dimensions to aid in the design of diverse nanoplasmonic applications. (paper)

  5. The effect of different electrodes on the electronic transmission of benzene junctions: Analytical approach

    Energy Technology Data Exchange (ETDEWEB)

    Mohebbi, Razie; Seyed-Yazdi, Jamileh, E-mail: j.seyedyazdi@vru.ac.ir

    2016-06-01

    In this paper we have investigated the electronic transmission of systems electrode–benzene–electrode using the Landauer approach. The effect of different electrodes made of metal (Au) and semiconductors (Si, TiO{sub 2}) is investigated. These three electrodes are compared between them and the results show that the electronic transmission of benzene junctions, when using semiconductor electrodes, is associated to a gap in transmission which is due to the electrodes band gap. As a consequence, a threshold voltage is necessary to obtain conducting channels.

  6. Efficient spin filtering in a disordered semiconductor superlattice in the presence of Dresselhaus spin-orbit coupling

    International Nuclear Information System (INIS)

    Khayatzadeh Mahani, Mohammad Reza; Faizabadi, Edris

    2008-01-01

    The influence of the Dresselhaus spin-orbit coupling on spin polarization by tunneling through a disordered semiconductor superlattice was investigated. The Dresselhaus spin-orbit coupling causes the spin polarization of the electron due to transmission possibilities difference between spin up and spin down electrons. The electron tunneling through a zinc-blende semiconductor superlattice with InAs and GaAs layers and two variable distance In x Ga (1-x) As impurity layers was studied. One hundred percent spin polarization was obtained by optimizing the distance between two impurity layers and impurity percent in disordered layers in the presence of Dresselhaus spin-orbit coupling. In addition, the electron transmission probability through the mentioned superlattice is too much near to one and an efficient spin filtering was recommended

  7. Control Strategies for Trap Filter Interfaced Three-Phase Grid Connected Converters

    DEFF Research Database (Denmark)

    Min, Huang

    In order to utilize renewable energy systems power electronics are needed to convert the energy to grid. The AC-DC and DC-AC power conversion are dominant in wind power system and photovoltaic system. However, the use of PWM scheme introduces undesirable harmonics. In order to enhance the grid...... damping in order to stabilize the whole system with resonance issue. LC trap filter application for current source converters to reduce the size of the filter and get a higher power factor....... integration of the renewable energy systems, the filter plays an important role. Even though this topic has already been widely studied, there are many optimizations and problems should be solved. How to design a filter for grid-connected converters in distributed generation system to get a lower loss...

  8. A pulsed, mono-energetic and angular-selective UV photo-electron source for the commissioning of the KATRIN experiment

    Energy Technology Data Exchange (ETDEWEB)

    Behrens, J. [Institut fuer Kernphysik, WWU Muenster, Muenster (Germany); Karlsruhe Institute of Technology, IEKP, Eggenstein-Leopoldshafen (Germany); Ranitzsch, P.C.O.; Hannen, V.; Ortjohann, H.W.; Rest, O.; Winzen, D.; Zacher, M.; Weinheimer, C. [Institut fuer Kernphysik, WWU Muenster, Muenster (Germany); Beck, M. [Institut fuer Kernphysik, WWU Muenster, Muenster (Germany); Johannes-Gutenberg Universitaet, Institut fuer Physik, Mainz (Germany); Beglarian, A. [Karlsruhe Institute of Technology, IPE, Eggenstein-Leopoldshafen (Germany); Erhard, M.; Groh, S.; Kraus, M. [IEKP, Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany); Schloesser, K.; Thuemmler, T. [Karlsruhe Institute of Technology, IKP, Karlsruhe (Germany); Valerius, K. [Institut fuer Kernphysik, WWU Muenster, Muenster (Germany); Karlsruhe Institute of Technology, IKP, Karlsruhe (Germany); Wierman, K.; Wilkerson, J.F. [University of North Carolina, Department of Physics and Astronomy, Chapel Hill, NC (United States)

    2017-06-15

    The KATRIN experiment aims to determine the neutrino mass scale with a sensitivity of 200 meV/c{sup 2} (90% C.L.) by a precision measurement of the shape of the tritium β-spectrum in the endpoint region. The energy analysis of the decay electrons is achieved by a MAC-E filter spectrometer. To determine the transmission properties of the KATRIN main spectrometer, a mono-energetic and angular-selective electron source has been developed. In preparation for the second commissioning phase of the main spectrometer, a measurement phase was carried out at the KATRIN monitor spectrometer where the device was operated in a MAC-E filter setup for testing. The results of these measurements are compared with simulations using the particle-tracking software ''Kassiopeia'', which was developed in the KATRIN collaboration over recent years. (orig.)

  9. Self-assembly of silicon nanowires studied by advanced transmission electron microscopy

    Directory of Open Access Journals (Sweden)

    Marta Agati

    2017-02-01

    Full Text Available Scanning transmission electron microscopy (STEM was successfully applied to the analysis of silicon nanowires (SiNWs that were self-assembled during an inductively coupled plasma (ICP process. The ICP-synthesized SiNWs were found to present a Si–SiO2 core–shell structure and length varying from ≈100 nm to 2–3 μm. The shorter SiNWs (maximum length ≈300 nm were generally found to possess a nanoparticle at their tip. STEM energy dispersive X-ray (EDX spectroscopy combined with electron tomography performed on these nanostructures revealed that they contain iron, clearly demonstrating that the short ICP-synthesized SiNWs grew via an iron-catalyzed vapor–liquid–solid (VLS mechanism within the plasma reactor. Both the STEM tomography and STEM-EDX analysis contributed to gain further insight into the self-assembly process. In the long-term, this approach might be used to optimize the synthesis of VLS-grown SiNWs via ICP as a competitive technique to the well-established bottom-up approaches used for the production of thin SiNWs.

  10. Transmission Electron Microscopy of a CMSX-4 Ni-Base Superalloy Produced by Selective Electron Beam Melting

    Directory of Open Access Journals (Sweden)

    Alireza B. Parsa

    2016-10-01

    Full Text Available In this work, the microstructures of superalloy specimens produced using selective electron beam melting additive manufacturing were characterized. The materials were produced using a CMSX-4 powder. Two selective electron beam melting processing strategies, which result in higher and lower effective cooling rates, are described. Orientation imaging microscopy, scanning transmission electron microscopy and conventional high resolution transmission electron microscopy are used to investigate the microstructures. Our results suggest that selective electron beam melting processing results in near equilibrium microstructures, as far as γ′ volume fractions, the formation of small amounts of TCP phases and the partitioning behavior of the alloy elements are concerned. As expected, higher cooling rates result in smaller dendrite spacings, which are two orders of magnitude smaller than observed during conventional single crystal casting. During processing, columnar grains grow in <100> directions, which are rotated with respect to each other. There are coarse γ/γ′ microstructures in high angle boundary regions. Dislocation networks form low angle boundaries. A striking feature of the as processed selective electron beam melting specimens is their high dislocation density. From a fundamental point of view, this opens new possibilities for the investigation of elementary dislocation processes which accompany solidification.

  11. Chemical Reactions of Molecules Promoted and Simultaneously Imaged by the Electron Beam in Transmission Electron Microscopy.

    Science.gov (United States)

    Skowron, Stephen T; Chamberlain, Thomas W; Biskupek, Johannes; Kaiser, Ute; Besley, Elena; Khlobystov, Andrei N

    2017-08-15

    The main objective of this Account is to assess the challenges of transmission electron microscopy (TEM) of molecules, based on over 15 years of our work in this field, and to outline the opportunities in studying chemical reactions under the electron beam (e-beam). During TEM imaging of an individual molecule adsorbed on an atomically thin substrate, such as graphene or a carbon nanotube, the e-beam transfers kinetic energy to atoms of the molecule, displacing them from equilibrium positions. Impact of the e-beam triggers bond dissociation and various chemical reactions which can be imaged concurrently with their activation by the e-beam and can be presented as stop-frame movies. This experimental approach, which we term ChemTEM, harnesses energy transferred from the e-beam to the molecule via direct interactions with the atomic nuclei, enabling accurate predictions of bond dissociation events and control of the type and rate of chemical reactions. Elemental composition and structure of the reactant molecules as well as the operating conditions of TEM (particularly the energy of the e-beam) determine the product formed in ChemTEM processes, while the e-beam dose rate controls the reaction rate. Because the e-beam of TEM acts simultaneously as a source of energy for the reaction and as an imaging tool monitoring the same reaction, ChemTEM reveals atomic-level chemical information, such as pathways of reactions imaged for individual molecules, step-by-step and in real time; structures of illusive reaction intermediates; and direct comparison of catalytic activity of different transition metals filmed with atomic resolution. Chemical transformations in ChemTEM often lead to previously unforeseen products, demonstrating the potential of this method to become not only an analytical tool for studying reactions, but also a powerful instrument for discovery of materials that can be synthesized on preparative scale.

  12. Magnetic filter apparatus and method for generating cold plasma in semicoductor processing

    Science.gov (United States)

    Vella, Michael C.

    1996-01-01

    Disclosed herein is a system and method for providing a plasma flood having a low electron temperature to a semiconductor target region during an ion implantation process. The plasma generator providing the plasma is coupled to a magnetic filter which allows ions and low energy electrons to pass therethrough while retaining captive the primary or high energy electrons. The ions and low energy electrons form a "cold plasma" which is diffused in the region of the process surface while the ion implantation process takes place.

  13. Magnetic filter apparatus and method for generating cold plasma in semiconductor processing

    Science.gov (United States)

    Vella, M.C.

    1996-08-13

    Disclosed herein is a system and method for providing a plasma flood having a low electron temperature to a semiconductor target region during an ion implantation process. The plasma generator providing the plasma is coupled to a magnetic filter which allows ions and low energy electrons to pass therethrough while retaining captive the primary or high energy electrons. The ions and low energy electrons form a ``cold plasma`` which is diffused in the region of the process surface while the ion implantation process takes place. 15 figs.

  14. A Game Theoretic Fault Detection Filter

    Science.gov (United States)

    Chung, Walter H.; Speyer, Jason L.

    1995-01-01

    The fault detection process is modelled as a disturbance attenuation problem. The solution to this problem is found via differential game theory, leading to an H(sub infinity) filter which bounds the transmission of all exogenous signals save the fault to be detected. For a general class of linear systems which includes some time-varying systems, it is shown that this transmission bound can be taken to zero by simultaneously bringing the sensor noise weighting to zero. Thus, in the limit, a complete transmission block can he achieved, making the game filter into a fault detection filter. When we specialize this result to time-invariant system, it is found that the detection filter attained in the limit is identical to the well known Beard-Jones Fault Detection Filter. That is, all fault inputs other than the one to be detected (the "nuisance faults") are restricted to an invariant subspace which is unobservable to a projection on the output. For time-invariant systems, it is also shown that in the limit, the order of the state-space and the game filter can be reduced by factoring out the invariant subspace. The result is a lower dimensional filter which can observe only the fault to be detected. A reduced-order filter can also he generated for time-varying systems, though the computational overhead may be intensive. An example given at the end of the paper demonstrates the effectiveness of the filter as a tool for fault detection and identification.

  15. Quantitative atomic resolution mapping using high-angle annular dark field scanning transmission electron microscopy

    International Nuclear Information System (INIS)

    Van Aert, S.; Verbeeck, J.; Erni, R.; Bals, S.; Luysberg, M.; Dyck, D. Van; Tendeloo, G. Van

    2009-01-01

    A model-based method is proposed to relatively quantify the chemical composition of atomic columns using high angle annular dark field (HAADF) scanning transmission electron microscopy (STEM) images. The method is based on a quantification of the total intensity of the scattered electrons for the individual atomic columns using statistical parameter estimation theory. In order to apply this theory, a model is required describing the image contrast of the HAADF STEM images. Therefore, a simple, effective incoherent model has been assumed which takes the probe intensity profile into account. The scattered intensities can then be estimated by fitting this model to an experimental HAADF STEM image. These estimates are used as a performance measure to distinguish between different atomic column types and to identify the nature of unknown columns with good accuracy and precision using statistical hypothesis testing. The reliability of the method is supported by means of simulated HAADF STEM images as well as a combination of experimental images and electron energy-loss spectra. It is experimentally shown that statistically meaningful information on the composition of individual columns can be obtained even if the difference in averaged atomic number Z is only 3. Using this method, quantitative mapping at atomic resolution using HAADF STEM images only has become possible without the need of simultaneously recorded electron energy loss spectra.

  16. The core contribution of transmission electron microscopy to functional nanomaterials engineering.

    Science.gov (United States)

    Carenco, Sophie; Moldovan, Simona; Roiban, Lucian; Florea, Ileana; Portehault, David; Vallé, Karine; Belleville, Philippe; Boissière, Cédric; Rozes, Laurence; Mézailles, Nicolas; Drillon, Marc; Sanchez, Clément; Ersen, Ovidiu

    2016-01-21

    Research on nanomaterials and nanostructured materials is burgeoning because their numerous and versatile applications contribute to solve societal needs in the domain of medicine, energy, environment and STICs. Optimizing their properties requires in-depth analysis of their structural, morphological and chemical features at the nanoscale. In a transmission electron microscope (TEM), combining tomography with electron energy loss spectroscopy and high-magnification imaging in high-angle annular dark-field mode provides access to all features of the same object. Today, TEM experiments in three dimensions are paramount to solve tough structural problems associated with nanoscale matter. This approach allowed a thorough morphological description of silica fibers. Moreover, quantitative analysis of the mesoporous network of binary metal oxide prepared by template-assisted spray-drying was performed, and the homogeneity of amino functionalized metal-organic frameworks was assessed. Besides, the morphology and internal structure of metal phosphide nanoparticles was deciphered, providing a milestone for understanding phase segregation at the nanoscale. By extrapolating to larger classes of materials, from soft matter to hard metals and/or ceramics, this approach allows probing small volumes and uncovering materials characteristics and properties at two or three dimensions. Altogether, this feature article aims at providing (nano)materials scientists with a representative set of examples that illustrates the capabilities of modern TEM and tomography, which can be transposed to their own research.

  17. Sample Preparation and Imaging of Exosomes by Transmission Electron Microscopy.

    Science.gov (United States)

    Jung, Min Kyo; Mun, Ji Young

    2018-01-04

    Exosomes are nano-sized extracellular vesicles secreted by body fluids and are known to represent the characteristics of cells that secrete them. The contents and morphology of the secreted vesicles reflect cell behavior or physiological status, for example cell growth, migration, cleavage, and death. The exosomes' role may depend highly on size, and the size of exosomes varies from 30 to 300 nm. The most widely used method for exosome imaging is negative staining, while other results are based on Cryo-Transmission Electron Microscopy, Scanning Electron Microscopy, and Atomic Force Microscopy. The typical exosome's morphology assessed through negative staining is a cup-shape, but further details are not yet clear. An exosome well-characterized through structural study is necessary particular in medical and pharmaceutical fields. Therefore, function-dependent morphology should be verified by electron microscopy techniques such as labeling a specific protein in the detailed structure of exosome. To observe detailed structure, ultrathin sectioned images and negative stained images of exosomes were compared. In this protocol, we suggest transmission electron microscopy for the imaging of exosomes including negative staining, whole mount immuno-staining, block preparation, thin section, and immuno-gold labelling.

  18. Transmission electron microscopy physics of image formation and microanalysis

    CERN Document Server

    Reimer, Ludwig

    1984-01-01

    The aim of this book is to outline the physics of image formation, electron­ specimen interactions and image interpretation in transmission electron mic­ roscopy. The book evolved from lectures delivered at the University of Munster and is a revised version of the first part of my earlier book Elek­ tronenmikroskopische Untersuchungs- und Priiparationsmethoden, omitting the part which describes specimen-preparation methods. In the introductory chapter, the different types of electron microscope are compared, the various electron-specimen interactions and their applications are summarized and the most important aspects of high-resolution, analytical and high-voltage electron microscopy are discussed. The optics of electron lenses is discussed in Chapter 2 in order to bring out electron-lens properties that are important for an understanding of the function of an electron microscope. In Chapter 3, the wave optics of elec­ trons and the phase shifts by electrostatic and magnetic fields are introduced; Fresne...

  19. Low-energy electron point projection microscopy of suspended graphene, the ultimate 'microscope slide'

    International Nuclear Information System (INIS)

    Mutus, J Y; Livadaru, L; Urban, R; Salomons, M H; Cloutier, M; Wolkow, R A; Robinson, J T

    2011-01-01

    Point projection microscopy (PPM) is used to image suspended graphene by using low-energy electrons (100-205 eV). Because of the low energies used, the graphene is neither damaged nor contaminated by the electron beam for doses of the order of 10 7 electrons per nm 2 . The transparency of graphene is measured to be 74%, equivalent to electron transmission through a sheet twice as thick as the covalent radius of sp 2 -bonded carbon. Also observed is rippling in the structure of the suspended graphene, with a wavelength of approximately 26 nm. The interference of the electron beam due to diffraction off the edge of a graphene knife edge is observed and is used to calculate a virtual source size of 4.7±0.6 A for the electron emitter. It is demonstrated that graphene can serve as both the anode and the substrate in PPM, thereby avoiding distortions due to strong field gradients around nanoscale objects. Graphene can be used to image objects suspended on the sheet using PPM and, in the future, electron holography.

  20. Rocket experiment METS - Microwave Energy Transmission in Space

    Science.gov (United States)

    Kaya, N.; Matsumoto, H.; Akiba, R.

    A Microwave Energy Transmission in Space (METS) rocket experiment is being planned by the Solar Power Satellite Working Group at the Institute of Space and Astronautical Science in Japan for the forthcoming International Space Year, 1992. The METS experiment is an advanced version of the previous MINIX rocket experiment (Matsumoto et al., 1990). This paper describes a conceptual design of the METS rocket experiment. It aims at verifying a newly developed microwave energy transmission system for space use and to study nonlinear effects of the microwave energy beam in the space plasma environment. A high power microwave of 936 W will be transmitted by the new phased-array antenna from a mother rocket to a separated target (daughter rocket) through the ionospheric plasma. The active phased-array system has a capability of focusing the microwave energy around any spatial point by controlling the digital phase shifters individually.

  1. Rocket experiment METS Microwave Energy Transmission in Space

    Science.gov (United States)

    Kaya, N.; Matsumoto, H.; Akiba, R.

    A METS (Microwave Energy Transmission in Space) rocket experiment is being planned by the SPS (Solar Power Satellite) Working Group at the Institute of Space and Astronautical Science (ISAS) in Japan for the forthcoming International Space Year (ISY), 1992. The METS experiment is an advanced version of our MINIX rocket experiment. This paper describes the conceptual design for the METS rocket experiment. Aims are to verify the feasibility of a newly developed microwave energy transmission system designed for use in space and to study nonlinear effects of the microwave energy beam on space plasma. A high power microwave (936 W) will be transmitted by a new phase-array antenna from a mother rocket to a separate target (daughter rocket) through the Earth's ionospheric plasma. The active phased-array system has the capability of being able to focus the microwave energy at any spatial point by individually controlling the digital phase shifters.

  2. Development Of A Method For Measurement Of Total Neutron Cross Sections Based On The Neutron Transmission Method Using A He-3 Counter On Filtered Neutron Beams At Dalat Research Reactor

    International Nuclear Information System (INIS)

    Tran Tuan Anh; Dang Lanh; Nguyen Canh Hai; Nguyen Xuan Hai; Pham Kien; Nguyen Thuy Nham; Pham Ngoc Son; Ho Huu Thang

    2007-01-01

    Determination of total neutron cross sections and average resonance parameters in the energy range from tens keV to hundreds keV is important for fast reactors calculations and designs because this energy range gives the most output of all neutron induced reactions in the spectrum of fast reactors. Besides, the total neutron cross section measurement is also one of the methods for determination of s, p and d-wave neutron strength functions. The purpose of this project is to develop a method for measurement of total neutron cross sections based on the neutron transmission technique using a He-3 counter. The average total neutron cross sections of 238 U were obtained from neutron transmission measurements on filtered neutron beams of 55 keV and 144 keV at the horizontal channel No.4 of the Dalat research reactor. The present results have been compared with the previous measurements, and the evaluated data from ENDF/B-6.8 library. (author)

  3. Three-dimensional nanofabrication by electron-beam-induced deposition using 200-keV electrons in scanning transmission electron microscope

    International Nuclear Information System (INIS)

    Liu, Z.Q.; Mitsuishi, K.; Furuya, K.

    2005-01-01

    Attempts were made to fabricate three-dimensional nanostructures on and out of a substrate by electron-beam-induced deposition in a 200-kV scanning transmission electron microscope. Structures with parallel wires over the substrate surface were difficult to fabricate due to the direct deposition of wires on both top and bottom surfaces of the substrate. Within the penetration depth of the incident electron beam, nanotweezers were fabricated by moving the electron beam beyond different substrate layers. Combining the deposition of self-supporting wires and self-standing tips, complicated three-dimensional doll-like, flag-like, and gate-like nanostructures that extend out of the substrate were successfully fabricated with one-step or multi-step scans of the electron beam. Effects of coarsening, nucleation, and distortion during electron-beam-induced deposition are discussed. (orig.)

  4. Compton scattering of photons from electrons in magnetically insulated transmission lines

    International Nuclear Information System (INIS)

    Brower, K.L.; VanDevender, J.P.

    1979-01-01

    Self-magnetically insulated transmission lines are used for power transport between the vacuum insulator and the diode in high current particle accelerators. Since the efficiency of the power transport depends on the details of the initial line geometry, i.e., the injector, the dependence of the electron canonical momentum distribution on the injector geometry should reveal the loss mechanism. We propose to study that dependence experimentally through a Compton scattering diagnostic. The spectrum of scattered light reveals the electron velocity distribution perpendicular to the direction of flow. The design of the diagnostic is in progress. Our preliminary analysis is based on the conservation of energy and canonical momentum for a single electron in the anti E and anti B fields determined from 2-D calculations. For the Mite accelerator with power flow along Z, the normalized canonical momentum, μ, is in the range - 0.7 < μ less than or equal to 0. For anti k/sub i/ parallel to circumflex Y, and anti k/sub s/ circumflex X, our analysis indicates that the scattered photons have 1.1 eV less than or equal to h nu/sub s/ < 5.6 eV for ruby laser scattering and can be detected with PM tubes

  5. Optimum transmission system expansion offshore considering renewable energy sources

    NARCIS (Netherlands)

    Torbaghan, Shahab S.; Gibescu, Madeleine

    2017-01-01

    This chapter provides an overview of transmission expansion planning (TEP) methods and their practical application. First, it discusses the strategic importance of the transmission system. Next, it describes the reasons why TEP remains a challenge for systems with a large share of renewable energy.

  6. Imaging and elemental mapping of biological specimens with a dual-EDS dedicated scanning transmission electron microscope

    Science.gov (United States)

    Wu, J.S.; Kim, A. M.; Bleher, R.; Myers, B.D.; Marvin, R. G.; Inada, H.; Nakamura, K.; Zhang, X.F.; Roth, E.; Li, S.Y.; Woodruff, T. K.; O'Halloran, T. V.; Dravid, Vinayak P.

    2013-01-01

    A dedicated analytical scanning transmission electron microscope (STEM) with dual energy dispersive spectroscopy (EDS) detectors has been designed for complementary high performance imaging as well as high sensitivity elemental analysis and mapping of biological structures. The performance of this new design, based on a Hitachi HD-2300A model, was evaluated using a variety of biological specimens. With three imaging detectors, both the surface and internal structure of cells can be examined simultaneously. The whole-cell elemental mapping, especially of heavier metal species that have low cross-section for electron energy loss spectroscopy (EELS), can be faithfully obtained. Optimization of STEM imaging conditions is applied to thick sections as well as thin sections of biological cells under low-dose conditions at room- and cryogenic temperatures. Such multimodal capabilities applied to soft/biological structures usher a new era for analytical studies in biological systems. PMID:23500508

  7. Power Electronics

    DEFF Research Database (Denmark)

    Iov, Florin; Ciobotaru, Mihai; Blaabjerg, Frede

    2008-01-01

    is to change the electrical power production sources from the conventional, fossil (and short term) based energy sources to renewable energy resources. The other is to use high efficient power electronics in power generation, power transmission/distribution and end-user application. This paper discuss the most...... emerging renewable energy sources, wind energy, which by means of power electronics are changing from being a minor energy source to be acting as an important power source in the energy system. Power electronics is the enabling technology and the presentation will cover the development in wind turbine...... technology from kW to MW, discuss which power electronic solutions are most feasible and used today....

  8. Electron scattering by Ne, Ar and Kr at intermediate and high energies, 0.5-10 keV

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, G.; Roteta, M.; Manero, F. [Centro de Investigaciones Energeticas Medioambientales y Tecnologicas (CIEMAT), Departamento de Fusion y Particulas Elementales, Madrid (Spain); Blanco, F. [Universidad Complutense de Madrid, Facultad de Fisica, Departamento de Fisica Atomica Molecular y Nuclear, Madrid (Spain); Williart, A. [Universidad Nacional de Educacion a Distancia, Facultad de Ciencias, Departamento de Fisica de los Materiales, Madrid (Spain)

    1999-04-28

    Semi-empirical total cross sections for electron scattering of noble gases (Ne, Ar and Kr) in the energy range 0.5-10 keV have been obtained by combining transmission-beam measurements for impact energies up to 6 keV with an asymptotic behaviour at higher energies according to the Born-Bethe approximation. The influence of the forward electron scattering on the experimental system has been evaluated by means of a Monte Carlo electron transport simulation. Theoretical values have also been obtained by applying the Born approximation in the case of inelastic processes and by means of an atomic scattering potential for the elastic part. The results of these calculations show an excellent agreement with the semi-empirical values in the above-mentioned energy range. (author)

  9. Monte Carlo-based investigations on the impact of removing the flattening filter on beam quality specifiers for photon beam dosimetry.

    Science.gov (United States)

    Czarnecki, Damian; Poppe, Björn; Zink, Klemens

    2017-06-01

    The impact of removing the flattening filter in clinical electron accelerators on the relationship between dosimetric quantities such as beam quality specifiers and the mean photon and electron energies of the photon radiation field was investigated by Monte Carlo simulations. The purpose of this work was to determine the uncertainties when using the well-known beam quality specifiers or energy-based beam specifiers as predictors of dosimetric photon field properties when removing the flattening filter. Monte Carlo simulations applying eight different linear accelerator head models with and without flattening filter were performed in order to generate realistic radiation sources and calculate field properties such as restricted mass collision stopping power ratios (L¯/ρ)airwater, mean photon and secondary electron energies. To study the impact of removing the flattening filter on the beam quality correction factors k Q , this factor for detailed ionization chamber models was calculated by Monte Carlo simulations. Stopping power ratios (L¯/ρ)airwater and k Q values for different ionization chambers as a function of TPR1020 and %dd(10) x were calculated. Moreover, mean photon energies in air and at the point of measurement in water as well as mean secondary electron energies at the point of measurement were calculated. The results revealed that removing the flattening filter led to a change within 0.3% in the relationship between %dd(10) x and (L¯/ρ)airwater, whereby the relationship between TPR1020 and (L¯/ρ)airwater changed up to 0.8% for high energy photon beams. However, TPR1020 was a good predictor of (L¯/ρ)airwater for both types of linear accelerator with energies filter within 1.1% and 1.6% was observed for TPR1020 and %dd(10) x respectively. The results of this study have shown that removing the flattening filter led to a change in the relationship between the well-known beam quality specifiers and dosimetric quantities at the point of measurement

  10. A Practical Core Loss Model for Filter Inductors of Power Electronic Converters

    DEFF Research Database (Denmark)

    Matsumori, Hiroaki; Shimizu, Toshihisa; Wang, Xiongfei

    2018-01-01

    This paper proposes a core loss model for filter inductors of power electronic converters. The model allows a computationally efficient analysis on the core loss of the inductor under the square voltage excitation and the premagnetization condition. First, the core loss of the filter inductor under...... buck chopper excitation is evaluated with the proposed model and compared with the conventional methods. The comparison shows that the proposed method results in a better core loss prediction under the premagnetized condition than that of conventional alternatives. Then, the core loss of the filter...... inductor with the pulsewidth modulated inverter excitation is evaluated, which shows that the proposed model not only accurately predicts the core loss but also identifies the hysteresis loss part. These results demonstrate that the approach can further be used for the development of magnetic materials...

  11. Method for analysis of averages over transmission energy of resonance neutrons

    International Nuclear Information System (INIS)

    Komarov, A.V.; Luk'yanov, A.A.

    1981-01-01

    Experimental data on transmissions on iron specimens in different energy groups have been analyzed on the basis of an earlier developed theoretical model for the description of resonance neutron averages in transmission energy, as the functions of specimen thickness and mean resonance parameters. The parameter values obtained agree with the corresponding data evaluated in the theory of mean neutron cross sections. The method suggested for the transmission description permits to reproduce experimental results for any thicknesses of specimens [ru

  12. Balanced microwave filters

    CERN Document Server

    Hong, Jiasheng; Medina, Francisco; Martiacuten, Ferran

    2018-01-01

    This book presents and discusses strategies for the design and implementation of common-mode suppressed balanced microwave filters, including, narrowband, wideband, and ultra-wideband filters This book examines differential-mode, or balanced, microwave filters by discussing several implementations of practical realizations of these passive components. Topics covered include selective mode suppression, designs based on distributed and semi-lumped approaches, multilayer technologies, defect ground structures, coupled resonators, metamaterials, interference techniques, and substrate integrated waveguides, among others. Divided into five parts, Balanced Microwave Filters begins with an introduction that presents the fundamentals of balanced lines, circuits, and networks. Part 2 covers balanced transmission lines with common-mode noise suppression, including several types of common-mode filters and the application of such filters to enhance common-mode suppression in balanced bandpass filters. Next, Part 3 exa...

  13. Electron-optical design parameters for a high-resolution electron monochromator

    International Nuclear Information System (INIS)

    Tanaka, H.; Huebner, R.H.

    1976-01-01

    Detailed design parameters of a new, high-resolution electron monochromator are presented. The design utilizes a hemispherical filter as the energy-dispersing element and combines both cylindrical and aperture electrostatic lenses to accelerate, decelerate, transport, and focus the electron beam from the cathode to the interaction region

  14. In situ Transmission Electron Microscopy of catalyst sintering

    DEFF Research Database (Denmark)

    DeLaRiva, Andrew T.; Hansen, Thomas Willum; Challa, Sivakumar R.

    2013-01-01

    Recent advancements in the field of electron microscopy, such as aberration correctors, have now been integrated into Environmental Transmission Electron Microscopes (TEMs), making it possible to study the behavior of supported metal catalysts under operating conditions at atomic resolution. Here......, we focus on in situ electron microscopy studies of catalysts that shed light on the mechanistic aspects of catalyst sintering. Catalyst sintering is an important mechanism for activity loss, especially for catalysts that operate at elevated temperatures. Literature from the past decade is reviewed...... along with our recent in situ TEM studies on the sintering of Ni/MgAl2O4 catalysts. These results suggest that the rapid loss of catalyst activity in the earliest stages of catalyst sintering could result from Ostwald ripening rather than through particle migration and coalescence. The smallest...

  15. Effect of number of of projections on inverse radon transform based image reconstruction by using filtered back-projection for parallel beam transmission tomography

    International Nuclear Information System (INIS)

    Qureshi, S.A.; Mirza, S.M.; Arif, M.

    2007-01-01

    This paper present the effect of number of projections on inverse Radon transform (IRT) estimation using filtered back-projection (FBP) technique for parallel beam transmission tomography. The head phantom and the lung phantom have been used in this work. Various filters used in this study include Ram-Lak, Shepp-Logan, Cosin, Hamming and Hanning filters. The slices have been reconstructed by increasing the number of projections through parallel beam transmission tomography keeping the projections uniformly distributed. The Euclidean and Mean Squared errors and peak signal-to-noise ratio (PSNR) have been analyzed for their sensitiveness as functions of number of projections. It has found that image quality improves with the number of projections but at the cost of the computer time. The error has been minimized to get the best approximation of inverse Radon transform (IRT) as the number of projections is enhanced. The value of PSNR has been found to increase from 8.20 to 24.53 dB as the number of projections is raised from 5 to 180 for head phantom. (author)

  16. Voltmeter with Compton electrons

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, N R; Gorbics, S G; Weidenheimer, D M [Berkeley Research Associates, Springfield, VA (United States)

    1997-12-31

    A technique to measure the electron end point energy of bremsstrahlung in the MV regime using only two detectors is described. One of the detector measures the total radiation, the other filters out all except the hardest photons by looking only at their Compton electrons, whose average energy is determined with a magnetic field. (author). 4 figs., 2 refs.

  17. In Situ High-Resolution Transmission Electron Microscopy (TEM) Observation of Sn Nanoparticles on SnO2 Nanotubes Under Lithiation.

    Science.gov (United States)

    Cheong, Jun Young; Chang, Joon Ha; Kim, Sung Joo; Kim, Chanhoon; Seo, Hyeon Kook; Shin, Jae Won; Yuk, Jong Min; Lee, Jeong Yong; Kim, Il-Doo

    2017-12-01

    We trace Sn nanoparticles (NPs) produced from SnO2 nanotubes (NTs) during lithiation initialized by high energy e-beam irradiation. The growth dynamics of Sn NPs is visualized in liquid electrolytes by graphene liquid cell transmission electron microscopy. The observation reveals that Sn NPs grow on the surface of SnO2 NTs via coalescence and the final shape of agglomerated NPs is governed by surface energy of the Sn NPs and the interfacial energy between Sn NPs and SnO2 NTs. Our result will likely benefit more rational material design of the ideal interface for facile ion insertion.

  18. Numerical method to calculate the quantum transmission, resonance and eigenvalue energies: application to a biased multibarrier systems

    Energy Technology Data Exchange (ETDEWEB)

    Maiz, F., E-mail: fethimaiz@gmail.com [University of Cartage, Nabeul Engineering Preparatory Institute, Merazka, 8000 Nabeul (Tunisia); King Khalid University, Faculty of Science, Physics Department, PO Box 9004, Abha 61413 (Saudi Arabia)

    2015-04-15

    A novel method to calculate the quantum transmission, resonance and eigenvalue energies forming the sub-bands structure of non-symmetrical, non-periodical semiconducting heterostructure potential has been proposed in this paper. The method can be applied on a multilayer system with varying thickness of the layer and effective mass of electrons and holes. Assuming an approximated effective mass and using Bastard's boundary conditions, Schrödinger equation at each media is solved and then using a confirmed recurrence method, the transmission and reflection coefficients and the energy quantification condition are expressed. They are simple combination of coupled equations. Schrödinger's equation solutions are Airy functions or plane waves, depending on the electrical potential energy slope. To illustrate the feasibility of the proposed method, the N barriers – (N−1) wells structure for N=3, 5, 8, 9, 17 and 35 are studied. All results show very good agreements with previously published results obtained from applying different methods on similar systems.

  19. Digital acquisition and processing of electron micrographs using a scanning transmission electron microscope

    International Nuclear Information System (INIS)

    Engel, A.; Christen, F.; Michel, B.

    1981-01-01

    A digital acquisition system that collects multichannel information from a scanning transmission electron microscope (STEM) and its application are described. The hardware comprises (i) single electron counting detectors, (ii) a digital scan generator, (iii) a digital multi-channel on-line processor, (iv) an interface to a minicomputer, and (v) a display system. Experimental results characterizing these components are presented, and their performance is discussed. The software includes assembler coded programs for dynamic file maintenance and fast acquisition of image data, a display driver, and FORTRAN coded application programs. The usefulness of digitized STEM is illustrated by a variety of biological applications. (orig.)

  20. Applications of transmission electron microscopy in the materials and mineral sciences

    International Nuclear Information System (INIS)

    Murr, L.E.

    1975-01-01

    Unique capabilities of transmission electron microscopy in characterizing the structure and properties of metals, minerals, and other crystaline materials are illustrated and compared with observations in the scanning electron and field-ion microscopes. Contrast mechanisms involving both mass-thickness and diffraction processes are illustrated, and examples presented of applications of bright and dark-field techiques. Applications of the electron microscope in the investigation of metallurgical and mineralogical problems are outlined with representative examples [pt

  1. Three-Dimensional scanning transmission electron microscopy of biological specimens

    KAUST Repository

    De Jonge, Niels

    2010-01-18

    A three-dimensional (3D) reconstruction of the cytoskeleton and a clathrin-coated pit in mammalian cells has been achieved from a focal-series of images recorded in an aberration-corrected scanning transmission electron microscope (STEM). The specimen was a metallic replica of the biological structure comprising Pt nanoparticles 2-3 nm in diameter, with a high stability under electron beam radiation. The 3D dataset was processed by an automated deconvolution procedure. The lateral resolution was 1.1 nm, set by pixel size. Particles differing by only 10 nm in vertical position were identified as separate objects with greater than 20% dip in contrast between them. We refer to this value as the axial resolution of the deconvolution or reconstruction, the ability to recognize two objects, which were unresolved in the original dataset. The resolution of the reconstruction is comparable to that achieved by tilt-series transmission electron microscopy. However, the focal-series method does not require mechanical tilting and is therefore much faster. 3D STEM images were also recorded of the Golgi ribbon in conventional thin sections containing 3T3 cells with a comparable axial resolution in the deconvolved dataset. © 2010 Microscopy Society of America.

  2. Enhanced thermal stability of a polymer solar cell blend induced by electron beam irradiation in the transmission electron microscope.

    Science.gov (United States)

    Bäcke, Olof; Lindqvist, Camilla; de Zerio Mendaza, Amaia Diaz; Gustafsson, Stefan; Wang, Ergang; Andersson, Mats R; Müller, Christian; Kristiansen, Per Magnus; Olsson, Eva

    2017-05-01

    We show by in situ microscopy that the effects of electron beam irradiation during transmission electron microscopy can be used to lock microstructural features and enhance the structural thermal stability of a nanostructured polymer:fullerene blend. Polymer:fullerene bulk-heterojunction thin films show great promise for use as active layers in organic solar cells but their low thermal stability is a hindrance. Lack of thermal stability complicates manufacturing and influences the lifetime of devices. To investigate how electron irradiation affects the thermal stability of polymer:fullerene films, a model bulk-heterojunction film based on a thiophene-quinoxaline copolymer and a fullerene derivative was heat-treated in-situ in a transmission electron microscope. In areas of the film that exposed to the electron beam the nanostructure of the film remained stable, while the nanostructure in areas not exposed to the electron beam underwent large phase separation and nucleation of fullerene crystals. UV-vis spectroscopy shows that the polymer:fullerene films are stable for electron doses up to 2000kGy. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Electronically Tunable Current Controlled Current Conveyor Transconductance Amplifier-Based Mixed-Mode Biquadratic Filter with Resistorless and Grounded Capacitors

    Directory of Open Access Journals (Sweden)

    Hua-Pin Chen

    2017-03-01

    Full Text Available A new electronically tunable mixed-mode biquadratic filter with three current controlled current conveyor transconductance amplifiers (CCCCTAs and two grounded capacitors is proposed. With current input, the filter can realise lowpass (LP, bandpass (BP, highpass (HP, bandstop (BS and allpass (AP responses in current mode and LP, BP and HP responses in transimpedance mode. With voltage input, the filter can realise LP, BP, HP, BS and AP responses in voltage and transadmittance modes. Other attractive features of the mixed-mode biquadratic filter are (1 the use of two grounded capacitors, which is ideal for integrated circuit implementation; (2 orthogonal control of the quality factor (Q and resonance angular frequency (ωo for easy electronic tenability; (3 low input impedance and high output impedance for current signals; (4 high input impedance for voltage signal; (5 avoidance of need for component-matching conditions; (6 resistorless and electronically tunable structure; (7 low active and passive sensitivities; and (8 independent control of the voltage transfer gains without affecting the parameters ωo and Q.

  4. Structural characterization and gas reactions of small metal particles by high resolution in-situ TEM (Transmission Electron Microscopy) and TED (Transmission Electron Diffraction)

    Science.gov (United States)

    Heinemann, K.

    1987-01-01

    The detection and size analysis of small metal particles supported on amorphous substrates becomes increasingly difficult when the particle size approaches that of the phase contrast background structures of the support. An approach of digital image analysis, involving Fourier transformation of the original image, filtering, and image reconstruction was studied with respect to the likelihood of unambiguously detecting particles of less than 1 nm diameter on amorphous substrates from a single electron micrograph.

  5. Electron energy-loss spectroscopy

    International Nuclear Information System (INIS)

    Egerton, R.

    1997-01-01

    As part of the commemorative series of articles to mark the hundredth anniversary of the discovery of the electron, this article discusses electron energy-loss spectroscopy. The physical and chemical properties of materials can be studied by considering the energy that electrons use as they travel through a solid, often in conjunction with other analytical techniques. The technique is often combined with electron diffraction and high-resolution imaging and can be used to provide elemental identification down to the atomic scale. (UK)

  6. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  7. Analysis of piezoelectric energy harvester under modulated and filtered white Gaussian noise

    Science.gov (United States)

    Quaranta, Giuseppe; Trentadue, Francesco; Maruccio, Claudio; Marano, Giuseppe C.

    2018-05-01

    This paper proposes a comprehensive method for the electromechanical probabilistic analysis of piezoelectric energy harvesters subjected to modulated and filtered white Gaussian noise (WGN) at the base. Specifically, the dynamic excitation is simulated by means of an amplitude-modulated WGN, which is filtered through the Clough-Penzien filter. The considered piezoelectric harvester is a cantilever bimorph modeled as Euler-Bernoulli beam with a concentrated mass at the free-end, and its global behavior is approximated by the fundamental vibration mode (which is tuned with the dominant frequency of the dynamic input). A resistive electrical load is considered in the circuit. Once the Lyapunov equation of the coupled electromechanical problem has been formulated, an original and efficient semi-analytical procedure is proposed to estimate mean and standard deviation of the electrical energy extracted from the piezoelectric layers.

  8. Cross-layer Energy Optimization Under Image Quality Constraints for Wireless Image Transmissions.

    Science.gov (United States)

    Yang, Na; Demirkol, Ilker; Heinzelman, Wendi

    2012-01-01

    Wireless image transmission is critical in many applications, such as surveillance and environment monitoring. In order to make the best use of the limited energy of the battery-operated cameras, while satisfying the application-level image quality constraints, cross-layer design is critical. In this paper, we develop an image transmission model that allows the application layer (e.g., the user) to specify an image quality constraint, and optimizes the lower layer parameters of transmit power and packet length, to minimize the energy dissipation in image transmission over a given distance. The effectiveness of this approach is evaluated by applying the proposed energy optimization to a reference ZigBee system and a WiFi system, and also by comparing to an energy optimization study that does not consider any image quality constraint. Evaluations show that our scheme outperforms the default settings of the investigated commercial devices and saves a significant amount of energy at middle-to-large transmission distances.

  9. Electron cyclotron waves transmission: new approach for the characterization of electron distribution functions in Tokamak hot plasmas

    International Nuclear Information System (INIS)

    Michelot, Y.

    1995-10-01

    Fast electrons are one of the basic ingredients of plasma operations in many existing thermonuclear fusion research devices. However, the understanding of fast electrons dynamics during creation and sustainment of the superthermal electrons tail is far for being satisfactory. For this reason, the Electron Cyclotron Transmission (ECT) diagnostic was implemented on Tore Supra tokamak. It consists on a microwave transmission system installed on a vertical chord crossing the plasma center and working in the frequency range 77-109 GHz. Variations of the wave amplitude during the propagation across the plasma may be due to refraction and resonant absorption. For the ECT, the most common manifestation of refraction is a reduction of the received power density with respect to the signal detected in vacuum, due to the spreading and deflection of the wave beam. Wave absorption is observed in the vicinity of the electron cyclotron harmonics and may be due both to thermal plasma and to superthermal electron tails. It has a characteristic frequency dependence due to the relativistic mass variation in the wave-electron resonance condition. This thesis presents the first measurements of: the extraordinary mode optical depth at the third harmonics, the electron temperature from the width of a cyclotron absorption line and the relaxation times of the electron distribution during lower hybrid current drive from the ordinary mode spectral superthermal absorption line at the first harmonic. (J.S.). 175 refs., 110 figs., 9 tabs., 3 annexes

  10. Neutron filters for producing monoenergetic neutron beams

    International Nuclear Information System (INIS)

    Harvey, J.A.; Hill, N.W.; Harvey, J.R.

    1982-01-01

    Neutron transmission measurements have been made on high-purity, highly-enriched samples of 58 Ni (99.9%), 60 Ni (99.7%), 64 Zn (97.9%) and 184 W (94.5%) to measure their neutron windows and to assess their potential usefulness for producing monoenergetic beams of intermediate energies from a reactor. Transmission measurements on the Los Alamos Sc filter (44.26 cm Sc and 1.0 cm Ti) have been made to determine the characteristics of the transmitted neutron beam and to measure the total cross section of Sc at the 2.0 keV minimum. When corrected for the Ti and impurities, a value of 0.35 +- 0.03 b was obtained for this minimum

  11. Resonance propagation of parallel-operated DC-AC converters with LCL filters

    DEFF Research Database (Denmark)

    Lu, Xiaonan; Liserre, Marco; Sun, Kai

    2012-01-01

    filter has higher power density, its resonance problem should be noticed. In a large renewable energy farm, multiple converters inside are connected in parallel. In this way, the analysis of the resonance problem should be expanded. Compared to a conventional single LCL filter system, additional...... performance is also influenced. In this paper, the resonance propagation of parallel converter system with a local capacitor for reactive power compensation is analyzed in detail. Simulation and experiment results support the theoretical analyses.......With the higher penetration of renewable energy into modern power system, power electronics converters are most commonly employed as the interfaces to the grid. At the same time, to deal with high frequency harmonic components, LCL filters are usually adopted. Although compared to L-filters, LCL...

  12. Magnetic energy analyser for slow electrons

    International Nuclear Information System (INIS)

    Limberg, W.

    1974-08-01

    A differential spectrometer with high time and energy resolution has been developed using the principle of energy analysis with a longitudinal homogeneous magnetic field. This way it is possible to measure the energy distribution of low energy electrons (eV-range) in the presence of high energy electrons without distortions by secondary electrons. The functioning and application of the analyzer is demonstrated by measuring the energy distributions of slow electrons emitted by a filament. (orig.) [de

  13. Direct observations of the MOF (UiO-66) structure by transmission electron microscopy

    KAUST Repository

    Zhu, Liangkui; Zhang, Daliang; Xue, Ming; Li, Huan; Qiu, Shilun

    2013-01-01

    As a demonstration of ab initio structure characterizations of nano metal organic framework (MOF) crystals by high resolution transmission electron microscopy (HRTEM) and electron diffraction tomography methods, a Zr-MOF (UiO-66) structure

  14. Study of the niobium dehydrogenation process by transmission electron microscopy

    International Nuclear Information System (INIS)

    Bulhoes, I.A.M.; Akune, K.

    1983-01-01

    The evolution of the micro-structure of Nb-H, during the dehydrogenation process through thermal treatment, has been studied by Transmission Electron Microscopy. The results are used in order to interpret the variation of the line resolution of Electron Channeling Pattern (ECP) of Nb-H as a function of isochronous annealing temperature. It is concluded that the improvement of the ECP line resolution is enhanced of β hydrate in Nb. (Author) [pt

  15. Solar Energy Delivering Greenhouse with an Integrated NIR filter

    NARCIS (Netherlands)

    Sonneveld, P.J.; Swinkels, G.L.A.M.; Holterman, H.J.; Tuijl, van B.A.J.; Bot, G.P.A.

    2008-01-01

    The scope of this investigation is the design and development of a new type of greenhouse with an integrated filter for rejecting near infrared radiation (NIR) and a solar energy delivery system. Cooled greenhouses are an important issue to cope with the combination of high global radiation and high

  16. Robust image alignment for cryogenic transmission electron microscopy.

    Science.gov (United States)

    McLeod, Robert A; Kowal, Julia; Ringler, Philippe; Stahlberg, Henning

    2017-03-01

    Cryo-electron microscopy recently experienced great improvements in structure resolution due to direct electron detectors with improved contrast and fast read-out leading to single electron counting. High frames rates enabled dose fractionation, where a long exposure is broken into a movie, permitting specimen drift to be registered and corrected. The typical approach for image registration, with high shot noise and low contrast, is multi-reference (MR) cross-correlation. Here we present the software package Zorro, which provides robust drift correction for dose fractionation by use of an intensity-normalized cross-correlation and logistic noise model to weight each cross-correlation in the MR model and filter each cross-correlation optimally. Frames are reliably registered by Zorro with low dose and defocus. Methods to evaluate performance are presented, by use of independently-evaluated even- and odd-frame stacks by trajectory comparison and Fourier ring correlation. Alignment of tiled sub-frames is also introduced, and demonstrated on an example dataset. Zorro source code is available at github.com/CINA/zorro. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Electron holography study of magnetization behavior in the writer pole of a perpendicular magnetic recording head by a 1 MV transmission electron microscope.

    Science.gov (United States)

    Hirata, Kei; Ishida, Yoichi; Akashi, Tetsuya; Shindo, Daisuke; Tonomura, Akira

    2012-01-01

    The magnetic domain structure of the writer poles of perpendicular magnetic recording heads was studied using electron holography. Although the domain structure of a 100-nm-thick writer pole could be observed with a 300 kV transmission electron microscope, that of the 250-nm-thick writer pole could not be analyzed due to the limited transmission capability of the instrument. On the other hand, the detailed domain structure of the 250-nm-thick writer pole was successfully analyzed by a 1 MV electron microscope using its high transmission capability. The thickness and material dependency of the domain structure of a writer pole were discussed.

  18. Localness of energy cascade in hydrodynamic turbulence, II. Sharp spectral filter

    Energy Technology Data Exchange (ETDEWEB)

    Aluie, Hussein [Los Alamos National Laboratory; Eyink, Gregory L [JOHNS HOPKINS UNIV.

    2009-01-01

    We investigate the scale-locality of subgrid-scale (SGS) energy flux and interband energy transfers defined by the sharp spectral filter. We show by rigorous bounds, physical arguments, and numerical simulations that the spectral SGS flux is dominated by local triadic interactions in an extended turbulent inertial range. Interband energy transfers are also shown to be dominated by local triads if the spectral bands have constant width on a logarithmic scale. We disprove in particular an alternative picture of 'local transfer by nonlocal triads,' with the advecting wavenumber mode at the energy peak. Although such triads have the largest transfer rates of all individual wavenumber triads, we show rigorously that, due to their restricted number, they make an asymptotically negligible contribution to energy flux and log-banded energy transfers at high wavenumbers in the inertial range. We show that it is only the aggregate effect of a geometrically increasing number of local wavenumber triads which can sustain an energy cascade to small scales. Furthermore, nonlocal triads are argued to contribute even less to the space-average energy flux than is implied by our rigorous bounds, because of additional cancellations from scale-decorrelation effects. We can thus recover the -4/3 scaling of nonlocal contributions to spectral energy flux predicted by Kraichnan's abridged Lagrangian-history direct-interaction approximation and test-field model closures. We support our results with numerical data from a 512{sup 3} pseudospectral simulation of isotropic turbulence with phase-shift dealiasing. We also discuss a rigorous counterexample of Eyink [Physica D 78, 222 (1994)], which showed that nonlocal wavenumber triads may dominate in the sharp spectral flux (but not in the SGS energy flux for graded filters). We show that this mathematical counter example fails to satisfy reasonable physical requirements for a turbulent velocity field, which are employed in our

  19. Frequency division transmission imaging and synthetic aperture reconstruction

    DEFF Research Database (Denmark)

    Gran, Fredrik; Jensen, Jørgen Arendt

    2006-01-01

    In synthetic transmit aperture imaging only a few transducer elements are used in every transmission, which limits the signal-to-noise ratio (SNR). The penetration depth can be increased by using all transmitters in every transmission. In this paper, a method for exciting all transmitters in every...... corresponding to the excitation waveforms, the different transmitters can be decoded at the receiver. The matched filter of a specific waveform will allow information only from this waveform to pass through, thereby separating it from the other waveforms. This means that all transmitters can be used in every...... transmission, and the information from the different transmitters can be separated instantaneously. Compared to traditional synthetic transmit aperture (STA) imaging, in which the different transmitters are excited sequentially, more energy is transmitted in every transmission, and a better signal...

  20. electron energy-loss spectroscopy

    International Nuclear Information System (INIS)

    Egerton, R.

    1997-01-01

    As part of a commemorative series of articles to mark the hundredth anniversary of the discovery of the electron, this article describes the use of electron energy-loss spectroscopy. The physical and chemical properties of materials can be studied by considering the energy that electrons use as they travel through a solid, often in conjunction with other analytical techniques. The technique is often combined with electron diffraction and high-resolution imaging and can be used to provide elemental identification down to the atomic scale. 6 figs

  1. Study of interactions of a electron beam of 10 MeV energy and matter

    International Nuclear Information System (INIS)

    Askri, Boubaker

    2002-01-01

    In this work, we tried to extend the algorithm of the Monte Carlo method to the case of relativistic electrons of energy 10 MeV through the material, after appropriate to the simple case of non-relativistic electrons of energy 20 keV. It was determined the coefficients of reflection, transmission and absorption of electrons through the middle in both cases. As the energy and angular distributions of electrons transmitted. The results show a fairly good precision on the determination of the three coefficients. For the non-relativistic case, it was in 1000 simulations of 1000 lots electrons for gold and aluminum, it has reached an accuracy of about 0.5 pour cent. For the relativistic case, it was 20 lots of simulations for 500 electrons carbon and aluminum. we reached an accuracy of about 2, 5 pour cent determining the coefficients. The energy and angular distributions of electrons transmitted, are close those derived from the program GEANT, taken as a reference and as comparison tool. It hopes to increase the accuracy by increasing the number of lots and the size of each batch of electrons. However, the process took six days to simulate ten miles electrons under normal conditions on the HP9000 machine calculation takes a greatest time of execution for a statistical sample of smaller great. Several criteria are necessary to optimize the study. About improving the theoretical model and the algorithm, and implementation the procedure on a machine more powerful computing. (Author)

  2. Transmission spectra of electrons through the Thue-Morse graphene superlattice

    International Nuclear Information System (INIS)

    Korol', A.M.

    2014-01-01

    The transmission spectra of the Thue-Morse superlattice (SL) based on a monolayer gapped graphene are investigated. The SL consists of rectangular barriers located along the Ox axis. The Thue-Morse aperiodic modulation is proposed to be realized due to the difference in values of the gap width in different SL elements. It is shown that the effective splitting of the allowed bands (and thereby the arising of a series of gaps) is observed under the influence of the aperiodic factor in the case of normal incidence of the electron wave on the SL as well as in the case of oblique incidence. The spectra are periodical with potential barrier height. In some regions of the spectra, the splitting of bands is subjected to the Fibonacci inflation rule in every new Thue-Morse generation. As in the periodical graphene-based SL, in every Thue-Morse sequence a superlattice Dirac point is created. The width of the gap associated with this point depends on SL parameters substantially; at the same time the energy location of this gap depends weakly on mass term in the Hamiltonian and it does not depend on SL period. The spectra dependence on the angle of electron wave incidence is not substantial

  3. Characterizing deformed ultrafine-grained and nanocrystalline materials using transmission Kikuchi diffraction in a scanning electron microscope

    International Nuclear Information System (INIS)

    Trimby, Patrick W.; Cao, Yang; Chen, Zibin; Han, Shuang; Hemker, Kevin J.; Lian, Jianshe; Liao, Xiaozhou; Rottmann, Paul; Samudrala, Saritha; Sun, Jingli; Wang, Jing Tao; Wheeler, John; Cairney, Julie M.

    2014-01-01

    Graphical abstract: -- Abstract: The recent development of transmission Kikuchi diffraction (TKD) in a scanning electron microscope enables fast, automated orientation mapping of electron transparent samples using standard electron backscatter diffraction (EBSD) hardware. TKD in a scanning electron microscope has significantly better spatial resolution than conventional EBSD, enabling routine characterization of nanocrystalline materials and allowing effective measurement of samples that have undergone severe plastic deformation. Combining TKD with energy dispersive X-ray spectroscopy (EDS) provides complementary chemical information, while a standard forescatter detector system below the EBSD detector can be used to generate dark field and oriented dark field images. Here we illustrate the application of this exciting new approach to a range of deformed, ultrafine grained and nanocrystalline samples, including duplex stainless steel, nanocrystalline copper and highly deformed titanium and nickel–cobalt. The results show that TKD combined with EDS is a highly effective and widely accessible tool for measuring key microstructural parameters at resolutions that are inaccessible using conventional EBSD

  4. Amelioration of Electrical Power Quality based on Modulated Power Filter Compensator

    Directory of Open Access Journals (Sweden)

    Karrar Hameed Kadhim

    2017-08-01

    Full Text Available This paper deals with the performance of modeling and implementation of Modulated Power Filter Compensator ( MPFC based on synchronous generator to enhance Electrical Power Quality (EPQ performance , rectification power factor , voltage fixity and decreasing transmission line losses for 300 km transmission line . In this paper (MPFC sketch attendants for intelligent network stability and optimum exploitation. The proposal Flexible AC Transmission Systems ( FACTS can be expanded to distributed renewable energy interface and exploitation systems and also will be easy to modify for voltage fixity, Achieve the required stability, perfect usage and Compensation requirements. MATLAB SIMLINK version R2009b were used as a model of (MPFC.

  5. Electron beam potential measurements on an inductive-store, opening-switch accelerator

    International Nuclear Information System (INIS)

    Riordan, J.C.; Goyer, J.R.; Kortbawi, D.; Meachum, J.S.; Mendenhall, R.S.; Roth, I.S.

    1993-01-01

    Direct measurement of the accelerating potential in a relativistic electron beam accelerator is difficult, particularly when the diode is downstream from a plasma opening switch. An indirect potential measurement can be obtained from the high energy tail of the bremsstrahlung spectrum generated as the electron beam strikes the anode. The authors' time-resolved spectrometer contains 7 silicon pin diode detectors filtered with 2 to 15 mm of lead to span an electron energy range of 0.5 to 2 MeV. A Monte-Carlo transport code was used to provide calibration curves, and the resulting potential measurements have been confirmed in experiments on the PITHON accelerator. The spectrometer has recently been deployed on PM1, an inductive-store, opening-switch testbed. The diode voltage measurements from the spectrometer are in good agreement with the diode voltage measured upstream and corrected using transmission line relations. The x-ray signal and spectral voltage rise 10 ns later than the corrected electrical voltage, however, indicating plasma motion between the opening switch and the diode

  6. Energy loss and thermalization of low-energy electrons

    International Nuclear Information System (INIS)

    LaVerne, J.A.; Mozumder, A.; Notre Dame Univ., IN

    1984-01-01

    Various processes involved in the moderation of low-energy electrons (< 10 keV in energy) have been delineated in gaseous and liquid media. The discussion proceeds in two stages. The first stage ends and the second stage begins when the electron energy equals the first excitation potential of the medium. The second stage ends with thermalization. Cross sections for electronic excitation and for the excitation (and de-excitation) of sub-electronic processes have been evaluated and incorporated in suitable stopping power and transport theories. Comparison between experiment and theory and intercomparisons between theories and experiments have been provided where possible. (author)

  7. A study on displacement of crystalline diffraction peaks in electron-beam irradiated filter paper cellulose

    International Nuclear Information System (INIS)

    Zhou Ruimin; Xiang Qun; Song Jing

    1997-01-01

    It is found that the crystalline diffraction angles of the electron-beam irradiated filter paper cellulose shift regularly when the irradiation dose is increased. The experiments indicate that the molecules between crystalline area and amorphous area in the filter paper cellulose will be degraded by the irradiation and the cellulose molecules in the surface of crystal will come off, thus the microcrystalline dimension will be reduced and the diffraction angle will become smaller. The fact that intensity of the 002 peak for filter paper samples decreases gradually with the increasing storage time can be attributed to the post-irradiation effect

  8. Ion source for thinning of specimen in transmission electron microscopy

    International Nuclear Information System (INIS)

    Hammer, K.; Rothe, R.

    1983-01-01

    Thinning of specimen for transmission electron microscopy is carried out by means of sputtering. Construction, design, and operation parameters of an ion source are presented. Because the plasma is produced by means of hollow cathode glow discharges, no special focusing system is used

  9. Transmission electron microscopy study of unhydrided,dehydrided and annealed LaNi5

    NARCIS (Netherlands)

    Veirman, de A.E.M.; Staals, A.A.; Notten, P.H.L.

    1994-01-01

    The influence of hydrogen absorption on the microstructure of LaNi5 powders has been investigated by transmission electron microscopy. At the surface of the unhydrided and dehydrided LaNi5 grains a reaction layer is observed. By means of selected area electron diffraction this layer is found to

  10. In situ transmission electron microscopy for magnetic nanostructures

    DEFF Research Database (Denmark)

    Ngo, Duc-The; Kuhn, Luise Theil

    2016-01-01

    Nanomagnetism is a subject of great interest because of both application and fundamental aspects in which understanding of the physical and electromagnetic structure of magnetic nanostructures is essential to explore the magnetic properties. Transmission electron microscopy (TEM) is a powerful tool...... that allows understanding of both physical structure and micromagnetic structure of the thin samples at nanoscale. Among TEM techniques, in situ TEM is the state-of-the-art approach for imaging such structures in dynamic experiments, reconstructing a real-time nanoscale picture of the properties......-structure correlation. This paper aims at reviewing and discussing in situ TEM magnetic imaging studies, including Lorentz microscopy and electron holography in TEM, applied to the research of magnetic nanostructures....

  11. Study of real space wave functions with electron energy loss spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Löffler, S.

    2013-07-01

    In this work, new methods to study the real space wave functions of electrons in a solid using transmission electron microscopy (TEM) and electron energy loss spectrometry (EELS) are presented. To this end, the theory of both elastic and inelastic electron scattering is treated in a density-matrix formalism. In the process, the central quantities of inelastic electron scattering - the mixed dynamic form factor (MDFF) and the double differential scattering cross section (DDSCS) - are introduced. In addition to the formal theory, several approximations and simplifications, as well as their respective validities, are discussed. Furthermore, a method for diagonalizing the mixed dynamic form factor is described, which allows calculating high resolution energy filtered TEM images with unprecedented accuracy. Subsequently, several applications of the aforementioned theory to real-world examples are presented. On the one hand, the example of Silicon serves to demonstrate how the radial wave functions in the bulk can be measured; the agreement with the theoretical predictions proves to be very good. On the other hand, the determination of the wave functions' azimuthal dependence is derived. It turns out that the symmetry of the system under investigation is crucial to the success of this endeavor. With the new techniques presented here, it will be possible to measure electronic properties with atomic resolution, which can be of great importance, particularly in material science. (author) [German] In der vorliegenden Arbeit werden neue Methoden vorgestellt, mit deren Hilfe Elektronenwellenfunktionen in Festkörpern mittels Transmissionselektronenmikroskopie (TEM) und Elektronenenergieverlustspektrometrie (EELS) direkt im Realraum vermessen werden können. Zu diesem Zweck wird sowohl die Theorie der elastischen Elektronenbeugung als auch die der inelastischen Elektronenstreuung im Dichtematrixformalismus dargestellt. Dabei werden die zentralen Größen der inelastischen

  12. Observations of localised dielectric excitations, secondary events and ionisation damage by scanning transmission electron microscopy

    International Nuclear Information System (INIS)

    Howie, A.

    1988-01-01

    In the scanning transmission electron microscope (STEM) a high intensity /approximately/0.5nm diameter, probe of 100 keV electrons is formed. This can be positioned to collect energy loss spectra from surfaces, interfaces, small spheres or other particles at controlled values of impact parameter or can be scanned across the object (usually a thin film) to produce high resolution images formed from a variety of signals - small angle or large angle (Z contrast) elastic scattering, inelastic scattering (both valence and core losses), secondary electron emission and x-ray or optical photon emission. The high spatial resolution achievable in a variety of simple structures raises many unsolved theoretical problems concerning the generation, propagation and decay of excitations in inhomogeneous media. These range from quite well posed problems in the mathematical physics of dielectric excitation to problems of plasmon propagation and rather more exotic and less well understood problems of radiation damage. 15 refs., 4 figs

  13. The role of phantom and treatment head generated bremsstrahlung in high-energy electron beam dosimetry

    International Nuclear Information System (INIS)

    Sorcini, B.B.; Hyoedynmaa, S.; Brahme, A.

    1996-01-01

    An analytical expression has been derived for the phantom generated bremsstrahlung photons in plane-parallel monoenergetic electron beams normally incident on material of any atomic number (Be, H 2 O, Al, Cu and U). The expression is suitable for the energy range from 1 to 50 MeV and it is solely based on known scattering power and radiative and collision stopping power data for the material at the incident electron energy. The depth dose distribution due to the bremsstrahlung generated by the electrons in the phantom is derived by convolving the bremsstrahlung energy fluence produced in the phantom with a simple analytical energy deposition kernel. The kernel accounts for both electrons and photons set in motion by the bremsstrahlung photons. The energy loss by the primary electrons, the build-up of the electron fluence and the generation, attenuation and absorption of bremsstrahlung photons are all taken into account in the analytical formula. The longitudinal energy deposition kernel is derived analytically and it is consistent with both the classical biexponential relation describing the photon depth dose distribution and the exponential attenuation of the primary photons. For comparison Monte Carlo calculated energy deposition distributions using ITS3 code were used. Good agreement was found between the results with the analytical expression and the Monte Carlo calculation. For tissue equivalent materials, the maximum total energy deposition differs by less than 0.2% from Monte Carlo calculated dose distributions. The result can be used to estimate the depth dependence of phantom generated bremsstrahlung in different materials in therapeutic electron beams and the bremsstrahlung production in different electron absorbers such as scattering foils, transmission monitors and photon and electron collimators. By subtracting the phantom generated bremsstrahlung from the total bremsstrahlung background the photon contamination generated in the treatment head can be

  14. NaI(Tl) electron energy resolution

    CERN Document Server

    Mengesha, W

    2002-01-01

    NaI(Tl) electron energy resolution eta sub e was measured using the Modified Compton Coincidence Technique (MCCT). The MCCT allowed detection of nearly monoenergetic internal electrons resulting from the scattering of incident 662 keV gamma rays within a primary NaI(Tl) detector. Scattered gamma rays were detected using a secondary HPGe detector in a coincidence mode. Measurements were carried out for electron energies ranging from 16 to 438 keV, by varying the scattering angle. Measured HPGe coincidence spectra were deconvolved to determine the scattered energy spectra from the NaI(Tl) detector. Subsequently, the NaI(Tl) electron energy spectra were determined by subtracting the energy of scattered spectra from the incident source energy (662 keV). Using chi-squared minimization, iterative deconvolution of the internal electron energy spectra from the measured NaI(Tl) spectra was then used to determine eta sub e at the electron energy of interest. eta sub e values determined using this technique represent va...

  15. Opportunities and Challenges of AC/DC Transmission Network Planning Considering High Proportion Renewable Energy

    Directory of Open Access Journals (Sweden)

    Arslan Habib

    2018-03-01

    Full Text Available The time and space distribution characteristics of future high proportion of renewable energy sources will bring unprecedented challenges to the electric power system’s processing and planning, the basic form of electric power system and operating characteristics will have fundamental changes. Based on the research status quo at home and abroad, this paper expounds the four scientific problems of the transmission network planning with high proportion of renewable energy. Respectively, from the network source collaborative planning, transmission network flexible planning. With the distribution network in conjunction with the transmission network planning, transmission planning program comprehensive evaluation and decision-making methods. This paper puts forward the research ideas and framework of transmission network planning considering the high proportion of renewable energy. At the end, the future high proportion of (renewable energy grid-connected transmission network’s opportunities and challenges are presented.

  16. Algorithm Development for Multi-Energy SXR based Electron Temperature Profile Reconstruction

    Science.gov (United States)

    Clayton, D. J.; Tritz, K.; Finkenthal, M.; Kumar, D.; Stutman, D.

    2012-10-01

    New techniques utilizing computational tools such as neural networks and genetic algorithms are being developed to infer plasma electron temperature profiles on fast time scales (> 10 kHz) from multi-energy soft-x-ray (ME-SXR) diagnostics. Traditionally, a two-foil SXR technique, using the ratio of filtered continuum emission measured by two SXR detectors, has been employed on fusion devices as an indirect method of measuring electron temperature. However, these measurements can be susceptible to large errors due to uncertainties in time-evolving impurity density profiles, leading to unreliable temperature measurements. To correct this problem, measurements using ME-SXR diagnostics, which use three or more filtered SXR arrays to distinguish line and continuum emission from various impurities, in conjunction with constraints from spectroscopic diagnostics, can be used to account for unknown or time evolving impurity profiles [K. Tritz et al, Bull. Am. Phys. Soc. Vol. 56, No. 12 (2011), PP9.00067]. On NSTX, ME-SXR diagnostics can be used for fast (10-100 kHz) temperature profile measurements, using a Thomson scattering diagnostic (60 Hz) for periodic normalization. The use of more advanced algorithms, such as neural network processing, can decouple the reconstruction of the temperature profile from spectral modeling.

  17. Cross-section of single-crystal materials used as thermal neutron filters

    International Nuclear Information System (INIS)

    Adib, M.

    2005-01-01

    Transmission properties of several single crystal materials important for neutron scattering instrumentation are presented. A computer codes are developed which permit the calculation of thermal diffuse and Bragg-scattering cross-sections of silicon., and sapphire as a function of material's constants, temperature and neutron energy, E, in the range 0.1 MeV .A discussion of the use of their single-crystal as a thermal neutron filter in terms of the optimum crystal thickness, mosaic spread, temperature, cutting plane and tuning for efficient transmission of thermal-reactor neutrons is given

  18. High Resolution Transmission Electron Microscope Observation of Zero-Strain Deformation Twinning Mechanisms in Ag

    Science.gov (United States)

    Liu, L.; Wang, J.; Gong, S. K.; Mao, S. X.

    2011-04-01

    We have observed a new deformation-twinning mechanism using the high resolution transmission electron microscope in polycrystalline Ag films, zero-strain twinning via nucleation, and the migration of a Σ3{112} incoherent twin boundary (ITB). This twinning mechanism produces a near zero macroscopic strain because the net Burgers vectors either equal zero or are equivalent to a Shockley partial dislocation. This observation provides new insight into the understanding of deformation twinning and confirms a previous hypothesis: detwinning could be accomplished via the nucleation and migration of Σ3{112} ITBs. The zero-strain twinning mechanism may be unique to low staking fault energy metals with implications for their deformation behavior.

  19. Magnetic Electron Filtering by Fluid Models for the PEGASES Thruster

    Science.gov (United States)

    Leray, Gary; Chabert, Pascal; Lichtenberg, Allan; Lieberman, Michael

    2009-10-01

    The PEGASES thruster produces thrust by creating positive and negative ions, which are then accelerated. To accelerate both type of ions, electrons need to be filtered, which is achieved by applying a static magnetic field strong enough to magnetize the electrons but not the ions. A 1D fluid model with three species (electrons, positive and negative ions) and an analytical model are proposed to understand this process for an oxygen plasma with p = 10 mTorr and B0 = 300 G [1]. The resulting ion-ion plasma formation in the transverse direction (perpendicular to the magnetic field) is demonstrated. It is shown that an additional electron/positive ion loss term is required. The solutions are evaluated for two main parameters: the ionizing fraction at the plasma center (x = 0), ne0/ng, and the electronegativity ratio at the center, α0=nn0/ne0. The effect of geometry and magnetic field amplitude are also discussed. [4pt] [1] Leray G, Chabert P, Lichtenberg A J and Lieberman M A, J. Phys. D: Appl. Phys., Plasma Modelling Cluster issue, to appear (2009)

  20. Building America Top Innovations 2014 Profile: California Energy Standards Recognize the Importance of Filter Selection

    Energy Technology Data Exchange (ETDEWEB)

    none,

    2014-11-01

    This 2014 Top Innovation profile describes Building America research on HVAC air filter sizing that prompted a change in the California “Title 24” Energy Code requiring filter manufacturers, HVAC designers, and HERS raters to make changes that will encourage the use of higher MERV filters without degrading HVAC performance.