
Sample records for endogenous reverse transcriptase

  1. Endogenous reverse transcriptase (RT) activity and Chromatin remodeling in normal and transformed cells and early embryos

    International Nuclear Information System (INIS)

    Spadafora, C.; Sciamanna, I.; Misteli, T.


    Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma

  2. Susceptibility of recombinant porcine endogenous retrovirus reverse transcriptase to nucleoside and non-nucleoside inhibitors. (United States)

    Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X


    Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.

  3. Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors. (United States)

    Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M


    Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these

  4. Activation of endogenous retrovirus reverse transcriptase in multiple sclerosis patient lymphocytes by inactivated HSV-1, HHV-6 and VZV

    DEFF Research Database (Denmark)

    Brudek, Tomasz; Lühdorf, Pernille; Christensen, Tove


    Human endogenous retroviruses (HERVs) and herpesviruses have been associated with the development of multiple sclerosis (MS). These virus groups interact with each other and have been shown to induce synergistic immune responses. Here, we focus on the possible role of herpesviruses as contributing...

  5. Reverse transcriptase inhibitors as microbicides. (United States)

    Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido


    The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.

  6. Reverse transcriptase inhibitors as potential colorectal microbicides. (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J


    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.

  7. Immune pressure analysis of protease and reverse transcriptase ...

    African Journals Online (AJOL)

    /dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...

  8. HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors

    DEFF Research Database (Denmark)

    Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran


    BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...

  9. Calibrated user-friendly reverse transcriptase-PCR assay

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Rammer, P


    We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...

  10. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  11. Natural Plant Alkaloid (Emetine Inhibits HIV-1 Replication by Interfering with Reverse Transcriptase Activity

    Directory of Open Access Journals (Sweden)

    Ana Luiza Chaves Valadão


    Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.

  12. Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy? (United States)

    Nolan, David


    Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.

  13. NMR structure of the HIV-1 reverse transcriptase thumb subdomain

    Energy Technology Data Exchange (ETDEWEB)

    Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)


    The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.

  14. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor. (United States)

    Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko


    HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.

  15. Antitumor effect of combination of the inhibitors of two new oncotargets: proton pumps and reverse transcriptase. (United States)

    Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano


    Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.

  16. [Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors]. (United States)

    Tarasova, O A; Filimonov, D A; Poroikov, V V


    Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.

  17. Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor. (United States)

    Sharma, Mamta; Saravolatz, Louis D


    Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.

  18. Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis

    Directory of Open Access Journals (Sweden)

    Ma Bi


    Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.

  19. Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ † (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.


    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271

  20. A second chance for telomerase reverse transcriptase in anticancer immunotherapy. (United States)

    Zanetti, Maurizio


    Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.

  1. 2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase

    International Nuclear Information System (INIS)

    Starnes, M.C.


    2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells

  2. Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

    International Nuclear Information System (INIS)

    Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado


    LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

  3. Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

    International Nuclear Information System (INIS)

    Bavand, M.R.; Laub, O.


    Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

  4. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin


    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  5. Evidence for a relief of repression mechanism for activation of the human telomerase reverse transcriptase promoter. (United States)

    Wang, Shuwen; Zhu, Jiyue


    The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.

  6. Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity (United States)

    House, M.L.; Kim, C.H.; Reno, P.W.


    Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.

  7. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang


    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  8. Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients

    DEFF Research Database (Denmark)

    Lundgren, Jens


    BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...

  9. Evolving uses of oral reverse transcriptase inhibitors in the HIV-1 epidemic: From treatment to prevention

    NARCIS (Netherlands)

    R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)


    textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the

  10. Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory

    Directory of Open Access Journals (Sweden)

    Edward J. Steele


    Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.

  11. Anti-HBV treatment induces novel reverse transcriptase mutations with reflective effect on HBV S antigen

    NARCIS (Netherlands)

    Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina


    The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences

  12. The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand. (United States)

    Zhao, Chen; Pyle, Anna Marie


    The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Telomerase reverse transcriptase promoter mutations in bladder cancer

    DEFF Research Database (Denmark)

    Allory, Yves; Beukers, Willemien; Sagrera, Ana


    for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...

  14. Crystal structures of HIV-1 nonnucleoside reverse transcriptase inhibitors: N-benzyl-4-methyl-benzimidazoles (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.


    HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.

  15. Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase


    DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami


    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...

  16. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors


    Nicolas Sluis-Cremer


    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...

  17. Enzyme engineering through evolution: thermostable recombinant group II intron reverse transcriptases provide new tools for RNA research and biotechnology. (United States)

    Collins, Kathleen; Nilsen, Timothy W


    Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.

  18. Role of the K101E substitution in HIV-1 reverse transcriptase in resistance to rilpivirine and other nonnucleoside reverse transcriptase inhibitors. (United States)

    Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A


    Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.

  19. Computational drug design strategies applied to the modelling of human immunodeficiency virus-1 reverse transcriptase inhibitors

    Directory of Open Access Journals (Sweden)

    Lucianna Helene Santos


    Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.

  20. Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder. (United States)

    Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao


    Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.

  1. Structure-based methods to predict mutational resistance to diarylpyrimidine non-nucleoside reverse transcriptase inhibitors. (United States)

    Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M


    Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.

  2. Biophysical Insights into the Inhibitory Mechanism of Non-Nucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer


    Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.

  3. Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma


    Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei


    Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...

  4. Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.

    Directory of Open Access Journals (Sweden)

    Anna Figueiredo


    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.

  5. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.


    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  6. Prediction of mutational tolerance in HIV-1 protease and reverse transcriptase using flexible backbone protein design.

    Directory of Open Access Journals (Sweden)

    Elisabeth Humphris-Narayanan

    Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.

  7. Fragment Based Strategies for Discovery of Novel HIV-1 Reverse Transcriptase and Integrase Inhibitors. (United States)

    Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda


    Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.

  8. Polyurethane intravaginal ring for controlled delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1. (United States)

    Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F


    Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association

  9. Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase. (United States)

    Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V


    Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.


    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha


    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  11. The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Dolores Bautista-España

    Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.

  12. Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase. (United States)

    Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari


    Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.

  13. An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

    DEFF Research Database (Denmark)

    Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas


    Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

  14. Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors. (United States)

    Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A


    We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.

  15. Differential Regulation of Telomerase Reverse Transcriptase Promoter Activation and Protein Degradation by Histone Deacetylase Inhibition. (United States)

    Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis


    Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.

  16. Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP. (United States)

    Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E


    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  17. Evaluation of nevirapine and/or hydroxyurea with nucleoside reverse transcriptase inhibitors in treatment-naive HIV-1-infected subjects

    NARCIS (Netherlands)

    Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.


    Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add

  18. Nonnucleoside Reverse-transcriptase Inhibitor- vs Ritonavir-boosted Protease Inhibitor-based Regimens for Initial Treatment of HIV Infection

    DEFF Research Database (Denmark)

    Borges, Álvaro H; Lundh, Andreas; Tendal, Britta


    BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...

  19. Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments. (United States)

    Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen


    Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection

  20. TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats (United States)

    Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin


    In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472

  1. Naringin Reverses Hepatocyte Apoptosis and Oxidative Stress Associated with HIV-1 Nucleotide Reverse Transcriptase Inhibitors-Induced Metabolic Complications

    Directory of Open Access Journals (Sweden)

    Oluwafeyisetan O. Adebiyi


    Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.

  2. Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells

    Directory of Open Access Journals (Sweden)

    Yong Teng


    Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.

  3. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo


    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  4. Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase. (United States)

    Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami


    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

  5. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali


    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  6. Dideoxynucleoside HIV reverse transcriptase inhibitors and drug-related hepatotoxicity: a case report

    Directory of Open Access Journals (Sweden)

    Lapadula Giuseppe


    Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.

  7. Reverse transcriptase directs viral evolution in a deep ocean methane seep (United States)

    Paul, B. G.; Bagby, S. C.


    Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.

  8. Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer

    International Nuclear Information System (INIS)

    Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen


    Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts

  9. The emerging profile of cross-resistance among the nonnucleoside HIV-1 reverse transcriptase inhibitors. (United States)

    Sluis-Cremer, Nicolas


    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

  10. 3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    S. Ganguly


    Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.

  11. A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome

    Directory of Open Access Journals (Sweden)

    Marcin Kierczak


    Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.

  12. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer


    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

  13. Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma. (United States)

    Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei


    Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .

  14. 4'-Ethynyl-2-fluoro-2'-deoxyadenosine, MK-8591: a novel HIV-1 reverse transcriptase translocation inhibitor. (United States)

    Markowitz, Martin; Sarafianos, Stefan G


    4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.

  15. Structural investigation of HIV-1 nonnucleoside reverse transcriptase inhibitors: 2-Aryl-substituted benzimidazoles (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.


    Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.

  16. Telomerase Activation in Atherosclerosis and Induction of Telomerase Reverse Transcriptase Expression by Inflammatory Stimuli in Macrophages (United States)

    Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis


    Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948

  17. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki


    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  18. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

    Directory of Open Access Journals (Sweden)

    Ilaria eSciamanna


    Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  19. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer (United States)

    Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado


    In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  20. Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿


    Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.


    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...

  1. Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P


    RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.

  2. Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

    Directory of Open Access Journals (Sweden)

    Ajay Kumar


    Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

  3. Reverse Transcriptase-Containing Particles Induced in Rous Sarcoma Virus-Transformed Rat Cells by Arginine Deprivation (United States)

    Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel


    Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137

  4. Leptin as a critical regulator of hepatocellular carcinoma development through modulation of human telomerase reverse transcriptase

    Directory of Open Access Journals (Sweden)

    Stefanou Nikolaos


    Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.

  5. The structure of FIV reverse transcriptase and its implications for non-nucleoside inhibitor resistance.

    Directory of Open Access Journals (Sweden)

    Meytal Galilee


    Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study

  6. Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide. (United States)

    Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D


    TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients

  7. The predictive and prognostic potential of plasma telomerase reverse transcriptase (TERT) RNA in rectal cancer patients (United States)

    Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita


    Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673

  8. New prognostic factor telomerase reverse transcriptase promotor mutation presents without MR imaging biomarkers in primary glioblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)


    Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: // imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)

  9. HIV Salvage Therapy Does Not Require Nucleoside Reverse Transcriptase Inhibitors: A Randomized, Controlled Trial. (United States)

    Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H


    Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. ( NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).

  10. Rapid and reversible epigenome editing by endogenous chromatin regulators. (United States)

    Braun, Simon M G; Kirkland, Jacob G; Chory, Emma J; Husmann, Dylan; Calarco, Joseph P; Crabtree, Gerald R


    Understanding the causal link between epigenetic marks and gene regulation remains a central question in chromatin biology. To edit the epigenome we developed the FIRE-Cas9 system for rapid and reversible recruitment of endogenous chromatin regulators to specific genomic loci. We enhanced the dCas9-MS2 anchor for genome targeting with Fkbp/Frb dimerizing fusion proteins to allow chemical-induced proximity of a desired chromatin regulator. We find that mSWI/SNF (BAF) complex recruitment is sufficient to oppose Polycomb within minutes, leading to activation of bivalent gene transcription in mouse embryonic stem cells. Furthermore, Hp1/Suv39h1 heterochromatin complex recruitment to active promoters deposits H3K9me3 domains, resulting in gene silencing that can be reversed upon washout of the chemical dimerizer. This inducible recruitment strategy provides precise kinetic information to model epigenetic memory and plasticity. It is broadly applicable to mechanistic studies of chromatin in mammalian cells and is particularly suited to the analysis of endogenous multi-subunit chromatin regulator complexes.Understanding the link between epigenetic marks and gene regulation requires the development of new tools to directly manipulate chromatin. Here the authors demonstrate a Cas9-based system to recruit chromatin remodelers to loci of interest, allowing rapid, reversible manipulation of epigenetic states.

  11. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods. (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit


    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  12. Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

    International Nuclear Information System (INIS)

    Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.


    The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

  13. Replication-dependent 65R→K reversion in human immunodeficiency virus type 1 reverse transcriptase double mutant K65R + L74V

    International Nuclear Information System (INIS)

    Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.


    Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies

  14. Telomerase reverse transcriptase locus polymorphisms and cancer risk: a field synopsis and meta-analysis. (United States)

    Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato


    Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic

  15. [Diagnostic significance of serum free DNA human telomerase reverse transcriptase quantitative determination on spinal cord injury]. (United States)

    Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B


    Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.

  16. Characterization of active reverse transcriptase and nucleoprotein complexes of the yeast retrotransposon Ty3 in vitro. (United States)

    Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L


    Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.

  17. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae). (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna


    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  18. In Vitro Evaluation of Nonnucleoside Reverse Transcriptase Inhibitors UC-781 and TMC120-R147681 as Human Immunodeficiency Virus Microbicides† (United States)

    Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul


    The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562

  19. Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India. (United States)

    Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind


    A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

  20. APOBEC3DE Inhibits LINE-1 Retrotransposition by Interacting with ORF1p and Influencing LINE Reverse Transcriptase Activity.

    Directory of Open Access Journals (Sweden)

    Weizi Liang

    Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.

  1. Structural requirements for the binding of tRNA Lys3 to reverse transcriptase of the human immunodeficiency virus type 1

    NARCIS (Netherlands)

    Oude Essink, B. B.; Das, A. T.; Berkhout, B.


    Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA

  2. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA? (United States)

    Schuster, W; Brennicke, A


    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  3. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    International Nuclear Information System (INIS)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki


    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

  4. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)


    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

  5. Leptin upregulates telomerase activity and transcription of human telomerase reverse transcriptase in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Ren, He, E-mail: [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)


    The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.

  6. In vitro cross-resistance profile of nucleoside reverse transcriptase inhibitor (NRTI) BMS-986001 against known NRTI resistance mutations. (United States)

    Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark


    BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.

  7. A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

    NARCIS (Netherlands)

    Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.


    The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who

  8. Phylogenetic analysis of HIV-1 reverse transcriptase sequences from 382 patients recruited in JJ Hospital of Mumbai, India, between 2002 and 2008. (United States)

    Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J


    Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.

  9. Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies (United States)

    A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

  10. Mutation V111I in HIV-2 reverse transcriptase increases the fitness of the nucleoside analogue-resistant K65R and Q151M viruses

    NARCIS (Netherlands)

    I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)


    textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have

  11. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy: the D: A: D study

    NARCIS (Netherlands)

    Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,


    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  12. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy : the D: A: D study

    NARCIS (Netherlands)

    Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.


    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  13. Novel (2,6-difluorophenyl)(2-(phenylamino)pyrimidin-4-yl) methanones with restricted conformation as potent non-nucleoside reverse transcriptase inhibitors against HIV-1

    Czech Academy of Sciences Publication Activity Database

    Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko


    Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016

  14. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  15. Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples

    NARCIS (Netherlands)

    Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.


    Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved

  16. Human Immunodeficiency Virus type-1 reverse transcriptase exists as post-translationally modified forms in virions and cells

    Directory of Open Access Journals (Sweden)

    Warrilow David


    Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.

  17. Telomerase Reverse Transcriptase Deficiency Prevents Neointima Formation Through Chromatin Silencing of E2F1 Target Genes. (United States)

    Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis


    Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.

  18. Autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter suppresses human ovarian carcinoma growth in vitro and in mice. (United States)

    Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue


    To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis

  19. The development of HEPT-type HIV non-nucleoside reverse transcriptase inhibitors and its implications for DABO family. (United States)

    Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong


    1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.

  20. Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis. (United States)

    Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi


    Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

  1. Free Energy-Based Virtual Screening and Optimization of RNase H Inhibitors of HIV-1 Reverse Transcriptase. (United States)

    Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio


    We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.

  2. In Vitro Antioxidant Properties, HIV-1 Reverse Transcriptase and Acetylcholinesterase Inhibitory Effects of Traditional Herbal Preparations Sold in South Africa

    Directory of Open Access Journals (Sweden)

    Johannes Van Staden


    Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.

  3. Probing the communication of deoxythymidine triphosphate in HIV-1 reverse transcriptase by communication maps and interaction energy studies. (United States)

    Gnanasekaran, Ramachandran


    We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.

  4. Molecular Docking Studies of Marine Diterpenes as Inhibitors of Wild-Type and Mutants HIV-1 Reverse Transcriptase

    Directory of Open Access Journals (Sweden)

    Alessandra M. T. de Souza


    Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.

  5. A trypsin inhibitor from rambutan seeds with antitumor, anti-HIV-1 reverse transcriptase, and nitric oxide-inducing properties. (United States)

    Fang, Evandro Fei; Ng, Tzi Bun


    Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.

  6. Inhibition of human immunodeficiency virus type 1 infection by the candidate microbicide dapivirine, a nonnucleoside reverse transcriptase inhibitor. (United States)

    Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R


    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.

  7. Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿ (United States)

    Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.


    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331

  8. MicroRNA Regulation of Telomerase Reverse Transcriptase (TERT: Micro Machines Pull Strings of Papier-Mâché Puppets

    Directory of Open Access Journals (Sweden)

    Ammad Ahmad Farooqi


    Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.

  9. The brown algae Pl.LSU/2 group II intron-encoded protein has functional reverse transcriptase and maturase activities.

    Directory of Open Access Journals (Sweden)

    Madeleine Zerbato

    Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.

  10. Standardized comparison of the relative impacts of HIV-1 reverse transcriptase (RT) mutations on nucleoside RT inhibitor susceptibility. (United States)

    Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W


    Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.

  11. Computational Analysis of Molecular Interaction Networks Underlying Change of HIV-1 Resistance to Selected Reverse Transcriptase Inhibitors. (United States)

    Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan


    Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at:

  12. Impact of HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype: results of a global collaboration.

    Directory of Open Access Journals (Sweden)

    Rami Kantor


    Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.

  13. Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil. (United States)

    Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino


    Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

  14. The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro

    Directory of Open Access Journals (Sweden)

    Gronenborn Angela M


    Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.

  15. A randomized trial comparing initial HAART regimens of nelfinavir/nevirapine and ritonavir/saquinavir in combination with two nucleoside reverse transcriptase inhibitors

    DEFF Research Database (Denmark)

    Kirk, Ole; Lundgren, Jens D; Pedersen, Court


    BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....

  16. Structural studies of series HIV-1 nonnucleoside reverse transcriptase inhibitors 1-(2,6-difluorobenzyl)-2-(2,6-difluorophenyl)-benzimidazoles with different 4-substituents (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.


    Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.

  17. The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli


    Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

  18. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti


    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  19. A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method


    Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao


    Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

  20. Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice (United States)

    Li, Runqin; Zhang, Yinglin


    Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632

  1. Rapid Genome Detection of Schmallenberg Virus and Bovine Viral Diarrhea Virus by Use of Isothermal Amplification Methods and High-Speed Real-Time Reverse Transcriptase PCR


    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin


    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...

  2. Molecular docking and 3D-QSAR studies on triazolinone and pyridazinone, non-nucleoside inhibitor of HIV-1 reverse transcriptase. (United States)

    Sivan, Sree Kanth; Manga, Vijjulatha


    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.

  3. Pharmacokinetics and tolerability of the new second-generation nonnucleoside reverse- transcriptase inhibitor KM-023 in healthy subjects

    Directory of Open Access Journals (Sweden)

    Cha YJ


    Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600

  4. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires. (United States)

    Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z


    Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From

  5. A quantitative reverse-transcriptase PCR assay for the assessment of drug activities against intracellular Theileria annulata schizonts

    Directory of Open Access Journals (Sweden)

    Isabel Hostettler


    Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.

  6. Zidovudine (AZT monotherapy selects for the A360V mutation in the connection domain of HIV-1 reverse transcriptase.

    Directory of Open Access Journals (Sweden)

    Jessica H Brehm

    Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.

  7. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires

    Directory of Open Access Journals (Sweden)

    Sukrit Silas


    Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.

  8. Probing the mechanistic consequences of 5-fluorine substitution on cytidine nucleotide analogue incorporation by HIV-1 reverse transcriptase. (United States)

    Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S


    Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.

  9. Structural and Preclinical Studies of Computationally Designed Non-Nucleoside Reverse Transcriptase Inhibitors for Treating HIV infection

    Energy Technology Data Exchange (ETDEWEB)

    Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.


    The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.

  10. Radiation-induced progressive decreasing in the expression of reverse transcriptase gene of hEST2 and telomerase activity

    International Nuclear Information System (INIS)

    Zhu Hanneng; Chen Wenying; Xiong Sidong


    Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)

  11. Risk Factors for Incident Diabetes in a Cohort Taking First-Line Nonnucleoside Reverse Transcriptase Inhibitor-Based Antiretroviral Therapy. (United States)

    Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen


    Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.

  12. Reptin is required for the transcription of telomerase reverse transcriptase and over-expressed in gastric cancer

    Directory of Open Access Journals (Sweden)

    Liu Tiantian


    Full Text Available Abstract Background Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER stability and is aberrantly expressed in certain cancers. Given its role in chromatin remodeling and transcription regulation, we determined the effect of Reptin on the transcription of the telomerase reverse transcriptase (hTERT gene, a key component of the telomerase complex and its expression in gastric cancer. Results Knocking down Reptin or its partner Pontin using small interfering RNA in gastric and cervical cancer cells led to significant decreases in hTERT mRNA, but hTERT promoter activity was inhibited in only Reptin-depleted cells. Reptin interacted with the c-MYC oncoprotein and its stimulatory effect on the hTERTpromoter was significantly dependent on functional E-boxes in the promoter. Moreover, Reptin bound to the hTERT proximal promoter and the loss of the Reptin occupancy led to dissociation of c-MYC from the hTERT promoter in Reptin-depleted cells. Reptin inhibition dramatically impaired clonogenic potential of gastric cancer cells by inducing cell growtharrest and over-expression of Reptin was observed in primary gastric cancer specimens. Conclusions The hTERT gene is a direct target of Reptin, and hTERT transcription requires constitutive expression of Reptin and its cooperation with c-MYC. Thus, Reptin regulates telomerase at two different levels. This finding, together with the requirementof Reptin for the clonogenic potential of cancer cells and its over-expression in gastriccancer and other solid tumors, suggests that Reptin may be a putative therapeutic target.

  13. Association of telomerase reverse transcriptase promoter mutations with clinicopathological features and prognosis of thyroid cancer: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Su X


    Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation

  14. Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

    Directory of Open Access Journals (Sweden)

    Winny Xie


    Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

  15. Reverse Transcriptase drug resistance mutations in HIV-1 Subtype C infected patients on ART in Karonga District, Malawi

    LENUS (Irish Health Repository)

    Bansode, Vijay B


    Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge

  16. Telomerase activity-independent function of telomerase reverse transcriptase is involved in acrylamide-induced neuron damage. (United States)

    Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X


    Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.

  17. Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis. (United States)

    Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine


    Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

  18. A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication. (United States)

    Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon


    The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription

  19. Efavirenz Has the Highest Anti-Proliferative Effect of Non-Nucleoside Reverse Transcriptase Inhibitors against Pancreatic Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Markus Hecht

    Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic

  20. Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

    Directory of Open Access Journals (Sweden)

    Tandale Babasaheb V


    Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy

  1. Structural Insights into HIV Reverse Transcriptase Mutations Q151M and Q151M Complex That Confer Multinucleoside Drug Resistance

    Energy Technology Data Exchange (ETDEWEB)

    Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy


    HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.

  2. Development and customization of a color-coded microbeads-based assay for drug resistance in HIV-1 reverse transcriptase. (United States)

    Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki


    Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.

  3. Development of elvitegravir resistance and linkage of integrase inhibitor mutations with protease and reverse transcriptase resistance mutations.

    Directory of Open Access Journals (Sweden)

    Mark A Winters

    Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.

  4. Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis. (United States)

    Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M


    Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The

  5. Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR. (United States)

    Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M


    Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

  6. In Vitro Cross-Resistance Profiles of Rilpivirine, Dapivirine, and MIV-150, Nonnucleoside Reverse Transcriptase Inhibitor Microbicides in Clinical Development for the Prevention of HIV-1 Infection. (United States)

    Giacobbi, Nicholas S; Sluis-Cremer, Nicolas


    Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.

  7. Lentin, a novel and potent antifungal protein from shitake mushroom with inhibitory effects on activity of human immunodeficiency virus-1 reverse transcriptase and proliferation of leukemia cells. (United States)

    Ngai, Patrick H K; Ng, T B


    From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.

  8. N348I in the connection domain of HIV-1 reverse transcriptase confers zidovudine and nevirapine resistance.

    Directory of Open Access Journals (Sweden)

    Soo-Huey Yap


    Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which

  9. Expression of human telomerase reverse transcriptase protein in oral epithelial dysplasia and oral squamous cell carcinoma: An immunohistochemical study (United States)

    Raghunandan, Bangalore Nagarajachar; Sanjai, Karpagaselvi; Kumaraswamy, Jayalakshmi; Papaiah, Lokesh; Pandey, Bhavna; Jyothi, Bellur MadhavaRao


    Background: Telomerase is an RNA-dependent DNA polymerase that synthesizes TTAGGG telomeric DNA sequences and almost universally provides the molecular basis for unlimited proliferative potential. The telomeres become shorter with each cycle of replication and reach a critical limit; most cells die or enter stage of replicative senescence. Telomere length maintenance by telomerase is required for all the cells that exhibit limitless replicative potential. It has been postulated that reactivation of telomerase expression is necessary for the continuous proliferation of neoplastic cells to attain immortality. Use of immunohistochemistry (IHC) is a useful, reliable method of localizing the human telomerase reverse transcriptase (hTERT) protein in tissue sections which permits cellular localization. Although there exists a lot of information on telomerase in oral cancer, little is known about their expression in oral epithelial dysplasia and their progression to oral squamous cell carcinoma (OSCC) compared to normal oral mucosa. This study addresses this lacuna. Aims: To compare the expression of hTERT protein in oral epithelial dysplasia and OSCC with normal oral mucosa by Immunohistochemical method. Subjects and Methods: In this preliminary study, IHC was used to detect the expression of hTERT protein in OSCC (n = 20), oral epithelial dysplasia (n = 21) and normal oral mucosa (n = 10). The tissue localization of immunostain, cellular localization of immunostain, nature of stain, intensity of stain, percentage of cells stained with hTERT protein were studied. A total number of 100 cells were counted in each slide. Statistical Analysis: All the data were analyzed using SPSS software version 16.0. The tissue localization, cellular localization of cytoplasmic/nuclear/both of hTERT stain, staining intensity was compared across the groups using Pearson's Chi-square test. The mean percentage of cells stained for oral epithelial dysplasia, OSCC and normal oral mucosa were

  10. Karakteristik Reverse Transcriptase Gen Polymerase Virus Hepatitis B Pada Penderita Hepatitis B Kronis Asimptomatik Pra-Pengobatan

    Directory of Open Access Journals (Sweden)

    Turyadi Turyadi


    Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase.   Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis

  11. A nonlinear QSAR study using oscillating search and SVM as an efficient algorithm to model the inhibition of reverse transcriptase by HEPT derivatives

    International Nuclear Information System (INIS)

    Ferkous, F.; Saihi, Y.


    Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)

  12. Synthesis and evaluation of "AZT-HEPT", "AZT-pyridinone", and "ddC-HEPT" conjugates as inhibitors of HIV reverse transcriptase. (United States)

    Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C


    To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.

  13. [The efficacy of autocatalytic casapse-3 driven by human telomerase reverse transcriptase promoter on human ovarian carcinoma]. (United States)

    Song, Yue; Shen, Keng; Yu, Jing-rong


    To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp), and investigate its antitumor effect on ovarian cancer in vitro and in vivo. Recombinant adenovirus expressing autocatalytic caspase-3 (rev-csapase-3) driven by hTERTp, AdHT-rev-casp3, was constructed. Ad-rev-casp3 expressing rev-caspase-3 driven by cytomegalovirus promoter (CMVp) was used as a positive control. hTERT positive human ovarian cancer cells of the line AO and hTERT-negative human umbilical venous endothelial cells (HUVECs) were cultured and transfected with AdHT-rev-casp3, Ad-rev-casp3, or Ad-EGFG expressing enhanced green fluorescent protein as control group. Western blotting, Cell Counting Kit (CCK-8), flow cytometry, and TUNEL were used to detect the expression of p17, active subunit of caspase-3, and p85, a poly ADP-ribose polymerase (PARP) cleavage fragment, and they were also used to measure the cell survival rate and apoptotic rate. Western blotting was used to detect the expression of active caspase-3 and its substrate PARP in the AO cells and HUVECs. Twenty nude BALB/c mice were inoculated subcutaneously with AO cells to establish subcutaneous tumor models, when the tumor grew to the volume of 150 mm3 the rats were divided into 4 equal groups to undergo intra-tumor injection of AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, and phosphate-buffered saline (PBS) respectively, the survival rate tumor inhibition rate was observed, 72 days later the mice were killed with their livers and tumors taken out, and Western blotting was used to detect the expression of active caspase-3. Another 40 mice underwent intraperitoneal injection of AO cells to establish intraperitoneal transplanted tumor models, 21 days later the rats were divided into 4 equal groups to be injected intraperitoneally with AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, or PBS, the survival rate was observed, and the blood levels of alanine transaminase

  14. Synthesis, biological evaluation and molecular modeling of 2-Hydroxyisoquinoline-1,3-dione analogues as inhibitors of HIV reverse transcriptase associated ribonuclease H and polymerase. (United States)

    Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang


    Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  15. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) using pre-steady-state kinetics. (United States)

    Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S


    The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

    DEFF Research Database (Denmark)

    Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy


    Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...

  17. Viral resuppression and detection of drug resistance following interruption of a suppressive non-nucleoside reverse transcriptase inhibitor-based regimen

    DEFF Research Database (Denmark)

    Fox, Zoe; Phillips, Andrew; Cohen, Cal


    the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...

  18. Etravirine and Rilpivirine Drug Resistance Among HIV-1 Subtype C Infected Children Failing Non-Nucleoside Reverse Transcriptase Inhibitor-Based Regimens in South India. (United States)

    Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami


    We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.

  19. A new general method for simultaneous fitting of temperature and concentration dependence of reaction rates yields kinetic and thermodynamic parameters for HIV reverse transcriptase specificity. (United States)

    Li, An; Ziehr, Jessica L; Johnson, Kenneth A


    Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Deep sequencing analysis of HIV-1 reverse transcriptase at baseline and time of failure in patients receiving rilpivirine in the phase III studies ECHO and THRIVE. (United States)

    Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan


    Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.

  1. Comparative analysis of drug resistance mutations in the human immunodeficiency virus reverse transcriptase gene in patients who are non-responsive, responsive and naive to antiretroviral therapy. (United States)

    Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad


    Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.

  2. Extensive Mutagenesis of the Conserved Box E Motif in Duck Hepatitis B Virus P Protein Reveals Multiple Functions in Replication and a Common Structure with the Primer Grip in HIV-1 Reverse Transcriptase


    Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael


    Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...

  3. Frequency of intron loss correlates with processed pseudogene abundance: a novel strategy to test the reverse transcriptase model of intron loss. (United States)

    Zhu, Tao; Niu, Deng-Ke


    Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.

  4. Guanidinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymer as siRNA carriers for inhibiting human telomerase reverse transcriptase expression. (United States)

    Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong


    In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.

  5. The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA

    Directory of Open Access Journals (Sweden)

    Niu Meijuan


    Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.

  6. Active methamphetamine use is associated with transmitted drug resistance to non-nucleoside reverse transcriptase inhibitors in individuals with HIV infection of unknown duration. (United States)

    Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M


    Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.

  7. Active Methamphetamine Use is Associated with Transmitted Drug Resis-tance to Non-Nucleoside Reverse Transcriptase Inhibitors in Individuals with HIV Infection of Unknown Duration (United States)

    Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M


    Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691

  8. Reverse transcriptase real-time PCR for detection and quantification of viable Campylobacter jejuni directly from poultry faecal samples

    DEFF Research Database (Denmark)

    Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens


    Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...

  9. Etravirine and rilpivirine resistance in HIV-1 subtype CRF01_AE-infected adults failing non-nucleoside reverse transcriptase inhibitor-based regimens. (United States)

    Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat


    We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.

  10. Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures. (United States)

    Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis


    At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

  11. Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study. (United States)

    Spackman, Erica; Suarez, David L


    Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

  12. Profile of Mutations in the Reverse Transcriptase and Overlapping Surface Genes of Hepatitis B Virus (HBV) in Treatment-Naïve Indonesian HBV Carriers. (United States)

    Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake


    Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.

  13. Incorporation of deoxyribonucleotides and ribonucleotides by a dNTP-binding cleft mutated reverse transcriptase in hepatitis B virus core particles

    International Nuclear Information System (INIS)

    Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin


    Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems

  14. Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals. (United States)

    Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L


    The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

  15. Design, synthesis and biological evaluations of N-Hydroxy thienopyrimidine-2,4-diones as inhibitors of HIV reverse transcriptase-associated RNase H. (United States)

    Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang


    Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50  = 0.04 μM) with decent antiviral potency (EC 50  = 7.4 μM) and no cytotoxicity (CC 50  > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50  = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    Directory of Open Access Journals (Sweden)

    M. Usta


    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  17. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Directory of Open Access Journals (Sweden)

    Meng Shuang


    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  18. Generation of thermostable Moloney murine leukemia virus reverse transcriptase variants using site saturation mutagenesis library and cell-free protein expression system. (United States)

    Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi


    We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.

  19. Structure-based design, synthesis, and biological evaluation of novel pyrrolyl aryl sulfones: HIV-1 non-nucleoside reverse transcriptase inhibitors active at nanomolar concentrations. (United States)

    Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P


    Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.

  20. Purification and Characterization of a White Laccase with Pronounced Dye Decolorizing Ability and HIV-1 Reverse Transcriptase Inhibitory Activity from Lepista nuda

    Directory of Open Access Journals (Sweden)

    Mengjuan Zhu


    Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.

  1. Apoptosis and reduced cell proliferation of HL-60 cell line caused by human telomerase reverse transcriptase inhibition by siRNA. (United States)

    Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin


    The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.

  2. A novel peptide-nucleotide dual vaccine of human telomerase reverse transcriptase induces a potent cytotoxic T-cell response in vivo

    International Nuclear Information System (INIS)

    Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun


    Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers

  3. Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

    International Nuclear Information System (INIS)

    Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.


    Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

  4. Inhibition of HIV-1 reverse transcriptase-catalyzed synthesis by intercalated DNA Benzo[a]Pyrene 7,8-Dihydrodiol-9,10-Epoxide adducts.

    Directory of Open Access Journals (Sweden)

    Parvathi Chary

    Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.

  5. Maintenance of differentiation potential of human bone marrow mesenchymal stem cells immortalized by human telomerase reverse transcriptase gene despite of extensive proliferation

    International Nuclear Information System (INIS)

    Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha


    Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols

  6. Tetrahymena telomerase protein p65 induces conformational changes throughout telomerase RNA (TER) and rescues telomerase reverse transcriptase and TER assembly mutants. (United States)

    Berman, Andrea J; Gooding, Anne R; Cech, Thomas R


    The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.

  7. Diaryltriazine non-nucleoside reverse transcriptase inhibitors are potent candidates for pre-exposure prophylaxis in the prevention of sexual HIV transmission. (United States)

    Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido


    Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.

  8. Discovery of dapivirine, a nonnucleoside HIV-1 reverse transcriptase inhibitor, as a broad-spectrum antiviral against both influenza A and B viruses. (United States)

    Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun


    The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Development and Characterization of a Vaginal Film Containing Dapivirine, a Non- nucleoside Reverse Transcriptase Inhibitor (NNRTI), for prevention of HIV-1 sexual transmission. (United States)

    Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia


    Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.

  10. A comparison of the ability of rilpivirine (TMC278 and selected analogues to inhibit clinically relevant HIV-1 reverse transcriptase mutants

    Directory of Open Access Journals (Sweden)

    Johnson Barry C


    Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.

  11. Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction. (United States)

    Amendola, R


    The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

  12. Effect of captan on the exonuclease activities of DNA polymerase I from E. coli and reverse transcriptase from avian myeloblastosis virus

    International Nuclear Information System (INIS)

    Freeman-Wittig, M.J.B.


    The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan

  13. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum (United States)

    Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang


    A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408

  14. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

    Directory of Open Access Journals (Sweden)

    Yanrui Li


    Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.

  15. Unique case of oligoastrocytoma with recurrence and grade progression: Exhibiting differential expression of high mobility group-A1 and human telomerase reverse transcriptase (United States)

    Gandhi, Puneet; Khare, Richa; Niraj, Kavita; Garg, Nitin; Sorte, Sandeep K; Gulwani, Hanni


    Mixed gliomas, primarily oligoastrocytomas, account for about 5%-10% of all gliomas. Distinguishing oligoastrocytoma based on histological features alone has limitations in predicting the exact biological behavior, necessitating ancillary markers for greater specificity. In this case report, human telomerase reverse transcriptase (hTERT) and high mobility group-A1 (HMGA1); markers of proliferation and stemness, have been quantitatively analyzed in formalin-fixed paraffin-embedded tissue samples of a 34 years old patient with oligoastrocytoma. Customized florescence-based immunohistochemistry protocol with enhanced sensitivity and specificity is used in the study. The patient presented with a history of generalized seizures and his magnetic resonance imaging scans revealed infiltrative ill-defined mass lesion with calcified foci within the left frontal white matter, suggestive of glioma. He was surgically treated at our center for four consecutive clinical events. Histopathologically, the tumor was identified as oligoastrocytoma-grade II followed by two recurrence events and final progression to grade III. Overall survival of the patient without adjuvant therapy was more than 9 years. Glial fibrillary acidic protein, p53, Ki-67, nuclear atypia index, pre-operative neutrophil-lymphocyte ratio, are the other parameters assessed. Findings suggest that hTERT and HMGA1 are linked to tumor recurrence and progression. Established markers can assist in defining precise histopathological grade in conjuction with conventional markers in clinical setup. PMID:27672647

  16. Effects of exogenous ATM gene on mRNA expression of human telomerase reverse transcriptase in AT cells induced by irradiation

    International Nuclear Information System (INIS)

    Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong


    The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)

  17. Design and performance of the CDC real-time reverse transcriptase PCR swine flu panel for detection of 2009 A (H1N1) pandemic influenza virus. (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen


    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.

  18. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies. (United States)

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi


    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  19. Design, synthesis and antiviral evaluation of novel heteroarylcarbothioamide derivatives as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and RDDP functions. (United States)

    Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo


    In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail:

  20. Prediction of the binding mode and resistance profile for a dual-target pyrrolyl diketo acid scaffold against HIV-1 integrase and reverse-transcriptase-associated ribonuclease H. (United States)

    Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng


    The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.

  1. 3D-QSAR CoMFA of a series of DABO derivatives as HIV-1 reverse transcriptase non-nucleoside inhibitors. (United States)

    de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão


    A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.

  2. Expression of dopamine receptors in the subthalamic nucleus of the rat: characterization using reverse transcriptase-polymerase chain reaction and autoradiography

    International Nuclear Information System (INIS)

    Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.


    We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  3. K70Q adds high-level tenofovir resistance to "Q151M complex" HIV reverse transcriptase through the enhanced discrimination mechanism.

    Directory of Open Access Journals (Sweden)

    Atsuko Hachiya


    Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.

  4. Introducing Catastrophe-QSAR. Application on Modeling Molecular Mechanisms of Pyridinone Derivative-Type HIV Non-Nucleoside Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Marius Lazea


    Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.

  5. Prognostic role of a multigene reverse transcriptase-PCR assay in patients with node-negative breast cancer not receiving adjuvant systemic therapy. (United States)

    Esteva, Francisco J; Sahin, Aysegul A; Cristofanilli, Massimo; Coombes, Kevin; Lee, Sang-Joon; Baker, Joffre; Cronin, Maureen; Walker, Michael; Watson, Drew; Shak, Steven; Hortobagyi, Gabriel N


    To test the ability of a reverse transcriptase-PCR (RT-PCR) assay, based on gene expression profiles, to accurately determine the risk of recurrence in patients with node-negative breast cancer who did not receive systemic therapy using formalin-fixed, paraffin-embedded tissue. A secondary objective was to determine whether the quantitative RT-PCR data correlated with immunohistochemistry assay data regarding estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status. We obtained archival paraffin-embedded tissue from patients with invasive breast cancer but no axillary lymph node involvement who had received no adjuvant systemic therapy and been followed for at least 5 years. RNA was extracted from three 10-microm-thick sections. The expression of 16 cancer-related genes and 5 reference genes was quantified using RT-PCR. A gene expression algorithm was used to calculate a recurrence score for each patient. We then assessed the ability of the test to accurately predict distant recurrence-free survival in this population. We identified 149 eligible patients. Median age at diagnosis was 59 years; mean tumor diameter was 2 cm; and 69% of tumors were estrogen receptor positive. Median follow-up was 18 years. The 5-year disease-free survival rate for the group was 80%. The 21 gene-based recurrence score was not predictive of distant disease recurrence. However, a high concordance between RT-PCR and immunohistochemical assays for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status was noted. RT-PCR can be done on paraffin-embedded tissue to validate the large numbers of genes associated with breast cancer recurrence. However, further work needs to be done to develop an assay to identify the likelihood of recurrent disease in patients with node-negative breast cancer who do not receive adjuvant tamoxifen or chemotherapy.

  6. Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay. (United States)

    Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B


    Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

  7. Pre-existing mutations in reverse transcriptase of hepatitis B virus in treatment-naive Chinese patients with chronic hepatitis B.

    Directory of Open Access Journals (Sweden)

    Jie Xu

    Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.

  8. Molecular cloning of Kuruma shrimp Marsupenaeus japonicus endonuclease-reverse transcriptase and its positive role in white spot syndrome virus and Vibrio alginolyticus infection. (United States)

    Ma, Xiongchao; Sun, Baozhen; Zhu, Fei


    This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. A new strategy to inhibit the excision reaction catalysed by HIV-1 reverse transcriptase: compounds that compete with the template–primer (United States)

    Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.


    Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225

  10. Application of 3D-QSAR, Pharmacophore, and Molecular Docking in the Molecular Design of Diarylpyrimidine Derivatives as HIV-1 Nonnucleoside Reverse Transcriptase Inhibitors. (United States)

    Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi


    Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.

  11. Adenosine 3',5'-cyclic monophosphate (cAMP)-dependent phosphoregulation of mitochondrial complex I is inhibited by nucleoside reverse transcriptase inhibitors

    International Nuclear Information System (INIS)

    Lund, Kaleb C.; Wallace, Kendall B.


    Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug

  12. Rapid genome detection of Schmallenberg virus and bovine viral diarrhea virus by use of isothermal amplification methods and high-speed real-time reverse transcriptase PCR. (United States)

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin


    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  13. Development and validation of a rapid reversed-phase HPLC method for the determination of the non-nucleoside reverse transcriptase inhibitor dapivirine from polymeric nanoparticles. (United States)

    das Neves, José; Sarmento, Bruno; Amiji, Mansoor M; Bahia, Maria Fernanda


    The objective of this work was to develop and validate a rapid reversed-phase (RP) high-performance liquid chromatography (HPLC) method for the in vitro pharmaceutical characterization of dapivirine-loaded polymeric nanoparticles. Chromatographic runs were performed on a RP C18 column with a mobile phase comprising acetonitrile-0.5% (w/v) triethanolamine solution in isocratic mode (80:20, v/v) at a flow rate of 1 ml/min. Dapivirine was detected at a wavelength of 290 nm. The method was shown to be specific, linear in the range of 1-50 microg/ml (R(2)=0.9998), precise at the intra-day and inter-day levels as reflected by the relative standard deviation values (less than 0.85%), accurate (recovery rate of 100.17+/-0.35%), and robust to changes in the mobile phase and column brand. The detection and quantitation limits were 0.08 and 0.24 microg/ml, respectively. The method was successfully used to determine the loading capacity and association efficiency of dapivirine in poly(lactic-co-glycolic acid)-based nanoparticles and its in vitro release. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  14. Evolutionary relationships within a subgroup of HERV-K-related human endogenous retroviruses

    NARCIS (Netherlands)

    Zsíros, J.; Jebbink, M. F.; Lukashov, V. V.; Voûte, P. A.; Berkhout, B.


    The prototype endogenous retrovirus HERV-K10 was identified in the human genome by its homology to the exogenous mouse mammary tumour virus. By analysis of a short 244 bp segment of the reverse transcriptase (RT) gene of other HERV-K10-like sequences, it has become clear that these elements

  15. Selective suppression of autocatalytic caspase-3 driven by two-step transcriptional amplified human telomerase reverse transcriptase promoter on ovarian carcinoma growth in vitro and in mice. (United States)

    Song, Yue; Xin, Xing; Xia, Zhijun; Zhai, Xingyue; Shen, Keng


    The objective of our study was to construct recombinant adenovirus (rAd) AdHTVP2G5-rev-casp3, which expresses autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp) with a two-step transcription amplification (TSTA) system and investigate its antitumor effects on ovarian cancer in vitro and in vivo. Fluorescent detection was used to detect EGFP expression in various cells. Cell viabilities were determined using the Cell Counting Kit-8 and flow cytometry. RT-PCR and immunoblotting assays were used to detect cellular apoptotic activities. Tumor growth and survival of tumor-bearing mice were studied. The hTERTp-TSTA system showed the strongest activity in hTERT-positive cancer cells when compared with hTERTp and cytomeglovirus promoter (CMVp). In contrast, it showed no activity in hTERT‑negative HUVECs. AdHTVP2G5‑rev-casp3 markedly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 17.8 ± 3.5% at an MOI of 70, which was significantly lower than that by AdHT-rev-casp3 and Ad-rev-casp3 (rAds which express rev-caspase-3 driven by hTERTp and CMVp, respectively). In contrast, AdHTVP2G5‑rev-casp3 induced little HUVEC death with a viability rate of 92.7 ± 5.2% at the same MOI. Additionally, AdHTVP2G5-rev-casp3 (MOI=70) caused significant apoptosis in AO cells with an apoptotic rate of 42%. The tumor growth suppression rate of AdHTVP2G5-rev-casp3 was 81.52%, significantly higher than that of AdHT-rev-casp3 (54.94%) or Ad-rev-casp3 (21.35%). AdHTVP2G5-rev-casp3 significantly improved the survival of tumor-bearing mice with little liver damage, with a mean survival of 258 ± 28 days. These results showed that AdHTVP2G5-rev-casp3 caused effective apoptosis with significant tumor selectivity, strongly suppressed tumor growth and improved mouse survival with little liver toxicity. It can be a potent therapeutic agent for tumor targeted treatment of ovarian cancer.

  16. Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue. (United States)

    Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram


    Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

  17. A new fluorescence/PET probe for targeting intracellular human telomerase reverse transcriptase (hTERT) using Tat peptide-conjugated IgM

    International Nuclear Information System (INIS)

    Jung, Kyung oh; Youn, Hyewon; Kim, Seung Hoo; Kim, Young-Hwa; Kang, Keon Wook; Chung, June-Key


    Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and "6"4Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.

  18. MicroRNA-532 and microRNA-3064 inhibit cell proliferation and invasion by acting as direct regulators of human telomerase reverse transcriptase in ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Lin Bai

    Full Text Available Human telomerase reverse transcriptase (hTERT plays a crucial role in ovarian cancer (OC progression. However, the mechanisms underlying hTERT upregulation in OC, and the specific microRNAs (miRNAs involved in the regulation of hTERT in OC cells, remains unclear. We performed a bioinformatics search to identify potential miRNAs that bind to the 3'-untranslated region (3'-UTR region of the hTERT mRNA. We examined the expression levels of miR-532/miR-3064 in OC tissues and normal ovarian tissues, and analyzed the correlation between miRNA expression and OC patient outcomes. The impacts of miR-532/miR-3064 on hTERT expression were evaluated by western blot analysis and hTERT 3'-UTR reporter assays. We investigated the effects of miR-532/miR-3064 on proliferation and invasion in OC cells. We found that miR-532 and miR-3064 are down-regulated in OC specimens. We observed a significant association between reduced miR-532/miR-3064 expression and poorer survival of patients with OC. We confirmed that in OC cells, these two miRNAs downregulate hTERT levels by directly targeting its 3'-UTR region, and inhibited proliferation, EMT and invasion of OC cells. In addition, the overexpression of the hTERT cDNA lacking the 3'-UTR partially restored miR-532/miR-3064-inhibited OC cell proliferation and invasion. The silencing of hTERT by siRNA oligonucleotides abolished these malignant features, and phenocopied the effects of miR-532/miR-3064 overexpression. Furthermore, overexpression of miR-532/miR-3064 inhibits the growth of OC cells in vivo. Our findings demonstrate a miR-532/miR-3064-mediated mechanism responsible for hTERT upregulation in OC cells, and reveal a possibility of targeting miR-532/miR-3064 for future treatment of OC.

  19. Hypoxia induces telomerase reverse transcriptase (TERT gene expression in non-tumor fish tissues in vivo: the marine medaka (Oryzias melastigma model

    Directory of Open Access Journals (Sweden)

    Mok Helen OL


    Full Text Available Abstract Background Current understanding on the relationships between hypoxia, hypoxia-inducible factor-1 (HIF-1 and telomerase reverse transcriptase (TERT gene expression are largely based on in vitro studies in human cancer cells. Although several reports demonstrated HIF-1- mediated upregulation of the human TERT gene under hypoxia, conflicting findings have also been reported. Thus far, it remains uncertain whether these findings can be directly extrapolated to non-tumor tissues in other whole animal systems in vivo. While fish often encounter environmental hypoxia, the in vivo regulation of TERT by hypoxia in non-neoplastic tissues of fish remains virtually unknown. Results The adult marine medaka (Oryzias melastigma was employed as a model fish in this study. We have cloned and characterized a 3261-bp full-length TERT cDNA, omTERT, which encodes a protein of 1086 amino acids. It contains all of the functional motifs that are conserved in other vertebrate TERTs. Motif E is the most highly conserved showing 90.9–100% overall identity among the fish TERTs and 63.6% overall identity among vertebrates. Analysis of the 5'-flanking sequence of the omTERT gene identified two HRE (hypoxia-responsive element; nt. – 283 and – 892 cores. Overexpression of the HIF-1α induced omTERT promoter activity as demonstrated using transient transfection assays. The omTERT gene is ubiquitously expressed in fish under normoxia, albeit at varying levels, where highest expression was observed in gonads and the lowest in liver. In vivo expression of omTERT was significantly upregulated in testis and liver in response to hypoxia (at 96 h and 48 h, respectively, where concomitant induction of the omHIF-1α and erythropoietin (omEpo genes was also observed. In situ hybridization analysis showed that hypoxic induction of omTERT mRNA was clearly evident in hepatocytes in the caudal region of liver and in spermatogonia-containing cysts in testis. Conclusion This

  20. Development of a pan-Simbu real-time reverse transcriptase PCR for the detection of Simbu serogroup viruses and comparison with SBV diagnostic PCR systems. (United States)

    Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd


    Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable

  1. Safety, tolerability and pharmacokinetics of doravirine, a novel HIV non-nucleoside reverse transcriptase inhibitor, after single and multiple doses in healthy subjects. (United States)

    Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R


    Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once

  2. Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs. (United States)

    Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W


    Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We

  3. A new fluorescence/PET probe for targeting intracellular human telomerase reverse transcriptase (hTERT) using Tat peptide-conjugated IgM

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Kyung oh [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Youn, Hyewon, E-mail: [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Cancer Imaging Center, Seoul National University Hospital, Seoul (Korea, Republic of); Kim, Seung Hoo [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kim, Young-Hwa [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kang, Keon Wook [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Chung, June-Key, E-mail: [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of)


    Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and {sup 64}Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.

  4. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics


    Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.


    The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...

  5. Comparison of single and boosted protease inhibitor versus nonnucleoside reverse transcriptase inhibitor-containing cART regimens in antiretroviral-naïve patients starting cART after January 1, 2000

    DEFF Research Database (Denmark)

    Mocroft, A; Horban, A; Clumeck, N


    increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)

  6. Exogenous reference gene normalization for real-time reverse transcription-polymerase chain reaction analysis under dynamic endogenous transcription. (United States)

    Johnston, Stephen; Gallaher, Zachary; Czaja, Krzysztof


    Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2(-∆∆Ct) normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.

  7. High Potency of Indolyl Aryl Sulfone Nonnucleoside Inhibitors towards Drug-Resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutants Is Due to Selective Targeting of Different Mechanistic Forms of the Enzyme (United States)

    Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni


    Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294

  8. Structural optimization of N1-aryl-benzimidazoles for the discovery of new non-nucleoside reverse transcriptase inhibitors active against wild-type and mutant HIV-1 strains. (United States)

    Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania


    Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. [Construction of autocatalytic caspase-3 driven by amplified human telomerase reverse transcriptase promoter and its enhanced efficacy of inducing apoptosis in human ovarian carcinoma]. (United States)

    Song, Yue; Shen, Keng; He, Chun-Xia


    To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter amplified by two-step transcription amplification (hTERTp-TSTA), and investigate its antitumor effect in ovarian cancer in vitro and in vivo. Recombinant adenoviruses expressing autocatalytic caspase-3 (rev-caspase-3) driven by hTERTp-TSTA were prepared, which were named as AdHTVP2G5-rev-casp3. AdHT-rev-casp3, Ad-rev-casp3 and AdHTVP2G5-EGEP, which express rev-caspase-3 driven by hTERTp, cytomegalovirus promoter (CMVp) and enhanced green fluorescent protein (EGFP), respectively, were used as controls. Western blot, cell counting kit (CCK-8), flow cytometry (FCM) and TdT-mediated dUTP-biotin nick end labeling (TUNEL) were used to detect the expression of p17, active subunit of caspase-3, and p85, and to measure cell survival rates, apoptotic rates and cell cycle distribution in ovarian cell line AO and normal human umbilical vein endothelial cell line HUVEC, following treatments of AdHTVP2G5-rev-casp3. subcutaneous tumor models and abdominally spread tumor models of human ovarian carcinoma using AO cells in BALB/c nude mice were established. Following treatments of AdHTVP2G5-rev-casp3, western blot was used to detect the expression of active caspase-3 in abdominally spread tumors and liver tissues, respectively, and the mouse survival rates and the volume of tumor nodules were measured, and the serum level of alanine transaminase (ALT) and aspartate transaminase (AST) were analyzed to monitor liver damages and HE staining was used to detect the histopathological changes of various organs. The levels of p17 expression in AdHTVP2G5-rev-casp3-treated AO cells were significantly higher than that in Ad-rev-casp3 or AdHT-rev-casp3 treated AO cells, while no expression was observed in AdHTVP2G5-rev-casp3-treated HUVEC. There was strong cell killing of AdHTVP2G5-rev-casp3 of hTERT positive AO cells, but not of the hTERT-negative HUVEC cells

  10. Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients enrolled in the D:A:D study: a multi-cohort collaboration

    DEFF Research Database (Denmark)

    Sabin, Caroline A; Worm, Signe W; Weber, Rainer


    cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...

  11. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics (United States)

    Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.


    The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447

  12. Molecular docking of (5E)-3-(2-aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione on HIV-1 reverse transcriptase: novel drug acting on enzyme. (United States)

    Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan


    The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.

  13. [Reversibility of the leukocyte activation state studied in a model of endogenous pyrogen formation by granulocytes]. (United States)

    Rybakina, E G; Sorokin, A V


    The pyrogen-releasing capacity of rabbit exudate granulocytes can be temporarily suppressed during incubation in the whole plasma and then recovered during cell transfer into 0.15 M NaCl or stimulation with the bacterial lipopolysaccharide, pyrogenal. The inhibitors of protein synthesis added to the granulocytes when they are being transferred from plasma to 0.15 M NaCl do not suppress the pyrogen release. The inhibitory action of the whole plasma on the pyrogen release is due to the presence in it of potassium and calcium ions. The inhibitory factors of plasma reversibly suppress the pyrogen release but do not eliminate the leukocyte activation.

  14. In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

    International Nuclear Information System (INIS)

    Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong


    The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation

  15. In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

    Energy Technology Data Exchange (ETDEWEB)

    Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail:


    The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.

  16. Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry (United States)


    deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

  17. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay. (United States)

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei


    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  18. Substrate-induced stable enzyme-inhibitor complex formation allows tight binding of novel 2-aminopyrimidin-4(3H)-ones to drug-resistant HIV-1 reverse transcriptase mutants. (United States)

    Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni


    We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.

  19. Parallel screening of drug-like natural compounds using Caco-2 cell permeability QSAR model with applicability domain, lipophilic ligand efficiency index and shape property: A case study of HIV-1 reverse transcriptase inhibitors (United States)

    Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.


    The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.

  20. Novel HBV recombinants between genotypes B and C in 3'-terminal reverse transcriptase (RT) sequences are associated with enhanced viral DNA load, higher RT point mutation rates and place of birth among Chinese patients. (United States)

    Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong


    As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.

  1. Measuring enzymatic HIV-1 susceptibility to two reverse transcriptase inhibitors as a rapid and simple approach to HIV-1 drug-resistance testing.

    Directory of Open Access Journals (Sweden)

    Dieter Hoffmann

    Full Text Available Simple and cost-effective approaches for HIV drug-resistance testing are highly desirable for managing increasingly expanding HIV-1 infected populations who initiate antiretroviral therapy (ART, particularly in resource-limited settings. Non-nucleoside reverse trancriptase inhibitor (NNRTI-based regimens with an NRTI backbone containing lamivudine (3TC or emtricitabine (FTC are preferred first ART regimens. Failure with these drug combinations typically involves the selection of NNRTI- and/or 3TC/FTC-resistant viruses. Therefore, the availability of simple assays to measure both types of drug resistance is critical. We have developed a high throughput screening test for assessing enzymatic resistance of the HIV-1 RT in plasma to 3TC/FTC and NNRTIs. The test uses the sensitive "Amp-RT" assay with a newly-developed real-time PCR format to screen biochemically for drug resistance in single reactions containing either 3TC-triphosphate (3TC-TP or nevirapine (NVP. Assay cut-offs were defined based on testing a large panel of subtype B and non-subtype B clinical samples with known genotypic profiles. Enzymatic 3TC resistance correlated well with the presence of M184I/V, and reduced NVP susceptibility was strongly associated with the presence of K103N, Y181C/I, Y188L, and G190A/Q. The sensitivity and specificity for detecting resistance were 97.0% and 96.0% in samples with M184V, and 97.4% and 96.2% for samples with NNRTI mutations, respectively. We further demonstrate the utility of an HIV capture method in plasma by using magnetic beads coated with CD44 antibody that eliminates the need for ultracentifugation. Thus our results support the use of this simple approach for distinguishing WT from NNRTI- or 3TC/FTC-resistant viruses in clinical samples. This enzymatic testing is subtype-independent and can assist in the clinical management of diverse populations particularly in resource-limited settings.

  2. Design and Performance of the CDC Real-Time Reverse Transcriptase PCR Swine Flu Panel for Detection of 2009 A (H1N1) Pandemic Influenza Virus▿†‡ (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen


    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260

  3. 5-Hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as novel dual inhibitors of HIV-1 reverse transcriptase-associated ribonuclease H and integrase. (United States)

    Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong


    We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H  = 1.77 μM, IC 50 IN  = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  4. Evaluation of a Multiplex Real-Time Reverse Transcriptase PCR Assay for Detection and Differentiation of Influenza Viruses A and B during the 2001-2002 Influenza Season in Israel (United States)

    Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella


    The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650

  5. Role of the functional MNS16A VNTR-243 variant of the human telomerase reverse transcriptase gene in progression and response to therapy of patients with non-Hodgkin's B-cell lymphomas. (United States)

    Wysoczanska, B; Wrobel, T; Dobrzynska, O; Mazur, G; Bogunia-Kubik, K


    MNS16A is a functional polymorphic tandem repeat within the human telomerase reverse transcriptase (hTERT) gene. To investigate whether any of the MNS16A repeats represents a genetic risk factor for NHL susceptibility, progression of or response to therapy in 75 patients with non-Hodgkin's lymphomas (NHLs) and 126 healthy individuals were genotyped using the PCR-VNTR technique. A slightly higher frequency of the MNS16A VNTR-243 variant was detected among patients who did not respond to treatment (NR) as compared to patients with complete or partial remission (0.83 vs. 0.51, P = 0.055). NR patients more frequently developed aggressive than indolent type of the disease (0.92 vs. 0.41, P = 0.001). The VNTR-243 allele was more frequently detected among patients with an intermediate-high/high International Prognostic Index (IPI 3-4) score (P = 0.063), especially in patients with advanced age and IPI 3-4 (P = 0.040). In multivariate analysis, higher IPI 3-4 score (OR = 11.364, P = 0.051) and aggressive type of the disease (OR = 18.182, P = 0.012) were found to be independent genetic markers associated with nonresponse to treatment. Presence of the MNS16A VNTR-243 variant also strongly tended to affect the risk of a less favourable response to therapy and was more frequently present among nonresponders (OR = 5.848, P = 0.059). Genetic variation within the hTERT gene may affect the progression and treatment of lymphoproliferative disorders. © 2015 John Wiley & Sons Ltd.

  6. A comparison of the cytotoxicity and proinflammatory cytokine production of EndoSequence root repair material and ProRoot mineral trioxide aggregate in human osteoblast cell culture using reverse-transcriptase polymerase chain reaction. (United States)

    Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre


    The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  7. Towards discovering dual functional inhibitors against both wild type and K103N mutant HIV-1 reverse transcriptases: molecular docking and QSAR studies on 4,1-benzoxazepinone analogues (United States)

    Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang


    To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.

  8. A single dose of a MIV-150/Zinc acetate gel provides 24 h of protection against vaginal simian human immunodeficiency virus reverse transcriptase infection, with more limited protection rectally 8-24 h after gel use. (United States)

    Kenney, Jessica; Singer, Rachel; Derby, Nina; Aravantinou, Meropi; Abraham, Ciby J; Menon, Radhika; Seidor, Samantha; Zhang, Shimin; Gettie, Agegnehu; Blanchard, James; Piatak, Michael; Lifson, Jeffrey D; Fernández-Romero, José A; Zydowsky, Thomas M; Robbiani, Melissa


    Previously we showed that repeated vaginal application of a MIV-150/zinc acetate carrageenan (MIV-150/ZA/CG) gel and a zinc acetate carrageenan (ZA/CG) gel significantly protected macaques from vaginal simian human immunodeficiency virus reverse transcriptase (SHIV-RT) infection. Gels were applied either daily for 2 weeks or every other day for 4 weeks, and the animals were challenged 4-24 h later. Herein, we examined the effects of a single vaginal dose administered either before or after virus challenge. Encouraged by the vaginal protection seen with MIV-150/ZA/CG, we also tested it rectally. Vaginal applications of MIV-150/ZA/CG, ZA/CG, and CG gel were performed once 8-24 h before, 1 h after, or 24 h before and 1 h after vaginal challenge. Rectal applications of MIV-150/ZA/CG and CG gel were performed once 8 or 24 h before rectal challenge. While vaginal pre-challenge and pre/post-challenge application of MIV-150/ZA/CG gel offered significant protection (88%, pinfection prechallenge, but not significantly, and the effect was completely lost post-challenge. Rectal application of MIV-150/ZA/CG gel afforded limited protection against rectal challenge when applied 8-24 h before challenge. Thus, MIV-150/ZA/CG gel is a highly effective vaginal microbicide that demonstrates 24 h of protection from vaginal infection and may demonstrate efficacy against rectal infection when given close to the time of HIV exposure.

  9. Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis. (United States)

    Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin


    Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.

  10. Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro. (United States)

    Patick, A K; Boritzki, T J; Bloom, L A


    Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.

  11. Efavirenz or nevirapine in three-drug combination therapy with two nucleoside or nucleotide-reverse transcriptase inhibitors for initial treatment of HIV infection in antiretroviral-naïve individuals. (United States)

    Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi


    The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure

  12. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST). (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max


    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.

  13. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben


    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  14. Endogenous growth hormone and insulin after interposition of a reversed jejunal segment in short bowel syndrome. An experimental study on pigs

    Directory of Open Access Journals (Sweden)

    Papamichail Michail


    Full Text Available Abstract Background Interposition of a reversed jejunal loop in short bowel sydrome has previously been investigated in human along with animal models and seemed able to facilitate intestinal adaptation. However, it is unclear if growth hormone and insulin, well known for their implication in short bowel pathophysiology, intervene on this effect. Findings Porcine models were randomly allocated to two cohorts: (1 short bowel (SB group (n = 8 and (2 short bowel reverse jejunal segment (SB-RS group (n = 8. Amongst other parameters serum growth hormone and insulin were measured at baseline, as well as on postoperative day 30 and 60. Conclusion Both endogenous hormones failed to demonstrate significant difference in respect to potential direct effect to mechanisms of enhanced intestinal adaptation in reversed group

  15. Detection of human telomerase reverse transcriptase messenger ...

    African Journals Online (AJOL)

    Introduction and Objectives: Bladder cancer is an important national health problem as it is the leading cancer in men in Egypt. Cystoscopy and biopsy, currently remains the gold standard procedure for diagnosis, yet, it is invasive and costly. Urinary cytopathology remains to be the only non-invasive alternative method for ...

  16. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia. (United States)

    Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí


    Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

  17. Immortalization of Human Fetal Hepatocyte by Ectopic Expression of Human Telomerase Reverse Transcriptase, Human Papilloma Virus (E7) and Simian Virus 40 Large T (SV40 T) Antigen Towards Bioartificial Liver Support. (United States)

    Giri, Shibashish; Bader, Augustinus


    Generation of genetically stable and non-tumoric immortalization cell line from primary cells would be enormously useful for research and therapeutic purposes, but progress towards this goal has so far been limited. It is now universal acceptance that immortalization of human fetal hepatocytes based on recent advances of telomerase biology and oncogene, lead to unlimited population doubling could be the possible source for bioartificial liver device. Immortalization of human fetal hepatocytes cell line by ectopic expression of human telomerase reverse transcriptase (hTERT), human papilloma virus gene (E7) and simian virus 40 large T (SV40 T) antigens is main goal of present study. We used an inducible system containing human telomerase and E7, both of which are cloned into responder constructs controlled by doxycycline transactivator. We characterized the immortalized human fetal hepatocyte cells by analysis of green fluorescent cells (GFP) positive cells using flow cytometry (FACs) cell sorting and morphology, proliferative rate and antigen expression by immunohistochemical analysis. In addition to we analysized lactate formation, glucose consumption, albumin secretion and urea production of immortalized human fetal hepatocyte cells. After 25 attempts for transfection of adult primary hepatocytes by human telomerase and E7 to immortalize them, none of the transfection systems resulted in the production of a stable, proliferating cell line. Although the transfection efficiency was more than 70% on the first day, the vast majority of the transfected hepatocytes lost their signal within the first 5-7 days. The remaining transfected hepatocytes persisted for 2-4 weeks and divided one or two times without forming a clone. After 10 attempts of transfection human fetal hepatocytes using the same transfection system, we obtained one stable human fetal hepatocytes cell line which was able albumin secretion urea production and glucose consumption. We established a

  18. Comparison of real-time reverse transcriptase polymerase chain reaction of peripheral blood mononuclear cells, serum and cell-free body cavity effusion for the diagnosis of feline infectious peritonitis. (United States)

    Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin


    Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.

  19. Sequential emergence and clinical implications of viral mutants with K70E and K65R mutation in reverse transcriptase during prolonged tenofovir monotherapy in rhesus macaques with chronic RT-SHIV infection

    Directory of Open Access Journals (Sweden)

    Pedersen Niels C


    Full Text Available Abstract Background We reported previously on the emergence and clinical implications of simian immunodeficiency virus (SIVmac251 mutants with a K65R mutation in reverse transcriptase (RT, and the role of CD8+ cell-mediated immune responses in suppressing viremia during tenofovir therapy. Because of significant sequence differences between SIV and HIV-1 RT that affect drug susceptibilities and mutational patterns, it is unclear to what extent findings with SIV can be extrapolated to HIV-1 RT. Accordingly, to model HIV-1 RT responses, 12 macaques were inoculated with RT-SHIV, a chimeric SIV containing HIV-1 RT, and started on prolonged tenofovir therapy 5 months later. Results The early virologic response to tenofovir correlated with baseline viral RNA levels and expression of the MHC class I allele Mamu-A*01. For all animals, sensitive real-time PCR assays detected the transient emergence of K70E RT mutants within 4 weeks of therapy, which were then replaced by K65R mutants within 12 weeks of therapy. For most animals, the occurrence of these mutations preceded a partial rebound of plasma viremia to levels that remained on average 10-fold below baseline values. One animal eventually suppressed K65R viremia to undetectable levels for more than 4 years; sequential experiments using CD8+ cell depletion and tenofovir interruption demonstrated that both CD8+ cells and continued tenofovir therapy were required for sustained suppression of viremia. Conclusion This is the first evidence that tenofovir therapy can select directly for K70E viral mutants in vivo. The observations on the clinical implications of the K65R RT-SHIV mutants were consistent with those of SIVmac251, and suggest that for persons infected with K65R HIV-1 both immune-mediated and drug-dependent antiviral activities play a role in controlling viremia. These findings suggest also that even in the presence of K65R virus, continuation of tenofovir treatment as part of HAART may be

  20. Asymmetric Modification of Hepatitis B Virus (HBV) Genomes by an Endogenous Cytidine Deaminase inside HBV Cores Informs a Model of Reverse Transcription. (United States)

    Nair, Smita; Zlotnick, Adam


    Cytidine deaminases inhibit replication of a broad range of DNA viruses by deaminating cytidines on single-stranded DNA (ssDNA) to generate uracil. While several lines of evidence have revealed hepatitis B virus (HBV) genome editing by deamination, it is still unclear which nucleic acid intermediate of HBV is modified. Hepatitis B virus has a relaxed circular double-stranded DNA (rcDNA) genome that is reverse transcribed within virus cores from a RNA template. The HBV genome also persists as covalently closed circular DNA (cccDNA) in the nucleus of an infected cell. In the present study, we found that in HBV-producing HepAD38 and HepG2.2.15 cell lines, endogenous cytidine deaminases edited 10 to 25% of HBV rcDNA genomes, asymmetrically with almost all mutations on the 5' half of the minus strand. This region corresponds to the last half of the minus strand to be protected by plus-strand synthesis. Within this half of the genome, the number of mutations peaks in the middle. Overexpressed APOBEC3A and APOBEC3G could be packaged in HBV capsids but did not change the amount or distribution of mutations. We found no deamination on pregenomic RNA (pgRNA), indicating that an intact genome is encapsidated and deaminated during or after reverse transcription. The deamination pattern suggests a model of rcDNA synthesis in which pgRNA and then newly synthesized minus-sense single-stranded DNA are protected from deaminase by interaction with the virus capsid; during plus-strand synthesis, when enough dsDNA has been synthesized to displace the remaining minus strand from the capsid surface, the single-stranded DNA becomes deaminase sensitive. IMPORTANCE Host-induced mutation of the HBV genome by APOBEC proteins may be a path to clearing the virus. We examined cytidine-to-thymidine mutations in the genomes of HBV particles grown in the presence or absence of overexpressed APOBEC proteins. We found that genomes were subjected to deamination activity during reverse transcription

  1. Endogenous α-crystallin inhibits expression of caspase-3 induced by hypoxia in retinal neurons. (United States)

    Ying, Xi; Peng, Yanli; Zhang, Jiaping; Wang, Xingli; Wu, Nan; Zeng, Yuxiao; Wang, Yi


    To investigate the expression of endogenous, hypoxic stress-induced α-crystallin and caspase-3 in rat retinal neurons in vitro. Retinal neurons were cultured from Long-Evans rats. The expression of endogenous α-crystallin was analyzed by immunohistochemistry and reverse transcriptase-polymerase chain reaction (RT-PCR). Furthermore, hypoxic exposure was performed in cultured cells, and the expression of endogenous α-crystallin and caspase-3 was assayed by Western blotting. Positive α-crystallin staining was observed in cultured retinal neurons, and expression of endogenous α-crystallin mRNA peaked 3-5d after inoculation (Pendogenous, hypoxic stress-induced α-crystallin expression increased gradually, peaking 6h after hypoxia. The expression was more abundant compared to the control (Pendogenous α-crystallin in retinal neurons, especially over-expression induced by hypoxic stress, results in the down regulation of caspase-3. The data suggest that endogenous α-crystallin may act as an endogenous neuroprotective factor in retinal neurons. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Endogenous New World primate type C viruses isolated from owl monkey (Aotus trivirgatus) kidney cell line. (United States)

    Todaro, G J; Sherr, C J; Sen, A; King, N; Daniel, M D; Fleckenstein, B


    A type C virus (OMC-1) detected in a culture of owl monkey kidney cells resembled typical type C viruses morphologically, but was slightly larger than previously characterized mammalian type C viruses. OMC-1 can be transmitted to bat lung cells and cat embryo fibroblasts. The virions band at a density of 1.16 g/ml in isopycnic sucrose density gradients and contain reverse transcriptase and a 60-65S RNA genome composed of approximately 32S subunits. The reverse transcriptase is immunologically and biochemically distinct from the polymerases of othe retroviruses. Radioimmunoassays directed to the interspecies antigenic determinants of the major structure proteins of other type C viruses do not detect a related antigen in OMC-1. Nucleic acid hybridization experiments using labeled viral genomic RNA or proviral cDNA transcripts to normal cellular DNA of different species show that OMC-1 is an endogenous virus with multiple virogene copies (20-50 per haploid genome) present in normal owl monkey cells and is distinct from previously isolated type C and D viruses. Sequences related to the OMC-1 genome can be detected in other New World monkeys. Thus, similar to the Old World primates (e.g., baboons as a prototype), the New World monkeys contain endogenous type C viral genes that appear to have been transmitted in the primate germ line. Images PMID:76312

  3. Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis

    NARCIS (Netherlands)

    Felten, Sandra; Leutenegger, Christian M.; Balzer, Hans Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman|info:eu-repo/dai/nl/089740890; Hartmann, Katrin


    Background: Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse

  4. Body composition and metabolic outcomes after 96 weeks of treatment with ritonavir-boosted lopinavir plus either nucleoside or nucleotide reverse transcriptase inhibitors or raltegravir in patients with HIV with virological failure of a standard first-line antiretroviral therapy regimen: a substudy of the randomised, open-label, non-inferiority SECOND-LINE study. (United States)

    Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A


    Lipoatrophy is one of the most feared complications associated with the use of nucleoside or nucleotide reverse transcriptase inhibitors (N[t]RTIs). We aimed to assess soft-tissue changes in participants with HIV who had virological failure of a first-line antiretroviral (ART) regimen containing a non-nucleoside reverse transcriptase inhibitor plus two N(t)RTIs and were randomly assigned to receive a second-line regimen containing a boosted protease inhibitor given with either N(t)RTIs or raltegravir. Of the 37 sites that participated in the randomised, open-label, non-inferiority SECOND-LINE study, eight sites from five countries (Argentina, India, Malaysia, South Africa, and Thailand) participated in the body composition substudy. All sites had a dual energy x-ray absorptiometry (DXA) scanner and all participants enrolled in SECOND-LINE were eligible for inclusion in the substudy. Participants were randomly assigned (1:1), via a computer-generated allocation schedule, to receive either ritonavir-boosted lopinavir plus raltegravir (raltegravir group) or ritonavir-boosted lopinavir plus two or three N(t)RTIs (N[t]RTI group). Randomisation was stratified by site and screening HIV-1 RNA. Participants and investigators were not masked to group assignment, but allocation was concealed until after interventions were assigned. DXA scans were done at weeks 0, 48, and 96. The primary endpoint was mean percentage and absolute change in peripheral limb fat from baseline to week 96. We did intention-to-treat analyses of available data. This substudy is registered with, number NCT01513122. Between Aug 1, 2010, and July 10, 2011, we recruited 211 participants into the substudy. The intention-to-treat population comprised 102 participants in the N(t)RTI group and 108 participants in the raltegravir group, of whom 91 and 105 participants, respectively, reached 96 weeks. Mean percentage change in limb fat from baseline to week 96 was 16·8% (SD 32·6) in the N

  5. Docking and 3-D QSAR studies on indolyl aryl sulfones. Binding mode exploration at the HIV-1 reverse transcriptase non-nucleoside binding site and design of highly active N-(2-hydroxyethyl)carboxamide and N-(2-hydroxyethyl)carbohydrazide derivatives. (United States)

    Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano


    Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.

  6. Mining of biomarker genes from expressed sequence tags and differential display reverse transcriptase-polymerase chain reaction in the self-fertilizing fish, Kryptolebias marmoratus and their expression patterns in response to exposure to an endocrine-disrupting alkylphenol, bisphenol A. (United States)

    Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong


    Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.

  7. Endogenous antipyretics. (United States)

    Roth, Joachim


    The febrile increase of body temperature is regarded as a component of the complex host response to infection or inflammation that accompanies the activation of the immune system. Late phases of fever appear mediated by pro-inflammatory cytokines called endogenous pyrogens. The rise of body temperature is beneficial because it accelerates several components of the activated immune system. To prevent an excessive and dangerous rise of body temperature the febrile response is controlled, limited in strength and duration, and sometimes even prevented by the actions of endogenous antipyretic substances liberated systemically or within the brain during fever. In most cases the antipyretic effects are achieved by an inhibitory influence on the formation or action of endogenous pyrogens, or by effects on neuronal thermoregulatory circuits that are activated during fever. Endogenous antipyretic substances include steroid hormones, neuropeptides, cytokines and other molecules. It is the purpose of this review to consider the current state in the research on endogenous antipyretic systems.

  8. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST) (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max


    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase–polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains. PMID:25424931

  9. Endogenous Jaagsiekte Sheep Retrovirus RNA is expressed by different cell types in ovine foetus and placenta

    Directory of Open Access Journals (Sweden)

    E Sanna


    Full Text Available The endogenous retroviruses are inherited elements transmitted trough the germline of most animal species and their biological role is still controversial. Ovine Pulmonary Carcinoma (OPC represents a good model for studying the interactions of endogenous retroviruses with their exogenous counterparts. The type D exogenous retrovirus known as Jaagsiekte Sheep Retro-Virus (JSRV is necessary and sufficient to cause OPC in domestic and wild sheep, but both affected and unaffected animals host in their genome 15 to 20 copies of related endogenous retroviruses named endogenous JSRV (enJSRV. In this study we evaluated the expression of enJSRV gag sequences in ovine foetal and placental tissues. RNA in situ hybridisation was performed on tissue sections of thymi, lymph nodes and lungs from ovine foetuses and related placentas, taken at a late stage of development. Reverse transcriptase- in situ polymerase chain reactions were also carried out on placental samples to better define the involved cells. In foetal tissues, specific signals were observed in the thymus medulla, lymph nodes and, at a lesser extent, in foetal bronchiolar cells. In the placental tissues, positive areas were detected in various cell types in the sincythium-and cyto-trophoblast. These data demonstrate that en JSRV RNA is largely expressed in a broad spectrum of cells including tissues which are critical for the development of the immune system.

  10. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)



    Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

  11. A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus

    Directory of Open Access Journals (Sweden)

    Crumpacker Clyde S


    Full Text Available Abstract Background The major hurdle in the treatment of Human Immunodeficiency virus type 1 (HIV-1 includes the development of drug resistance-associated mutations in the target regions of the virus. Since reverse transcriptase (RT is essential for HIV-1 replication, several nucleoside analogues have been developed to target RT of the virus. Clinical studies have shown that mutations at RT codon 65 and 74 which are located in β3-β4 linkage group of finger sub-domain of RT are selected during treatment with several RT inhibitors, including didanosine, deoxycytidine, abacavir and tenofovir. Interestingly, the co-selection of K65R and L74V is rare in clinical settings. We have previously shown that K65R and L74V are incompatible and a R→K reversion occurs at codon 65 during replication of the virus. Analysis of the HIV resistance database has revealed that similar to K65R+L74V, the double mutant K65R+L74I is also rare. We sought to compare the impact of L→V versus L→I change at codon 74 in the background of K65R mutation, on the replication of doubly mutant viruses. Methods Proviral clones containing K65R, L74V, L74I, K65R+L74V and K65R+L74I RT mutations were created in pNL4-3 backbone and viruses were produced in 293T cells. Replication efficiencies of all the viruses were compared in peripheral blood mononuclear (PBM cells in the absence of selection pressure. Replication capacity (RC of mutant viruses in relation to wild type was calculated on the basis of antigen p24 production and RT activity, and paired analysis by student t-test was performed among RCs of doubly mutant viruses. Reversion at RT codons 65 and 74 was monitored during replication in PBM cells. In vitro processivity of mutant RTs was measured to analyze the impact of amino acid changes at RT codon 74. Results Replication kinetics plot showed that all of the mutant viruses were attenuated as compared to wild type (WT virus. Although attenuated in comparison to WT virus

  12. Simultaneous measurement of cholesterol 7 alpha-hydroxylase activity by reverse-phase high-performance liquid chromatography using both endogenous and exogenous [4-14C]cholesterol as substrate

    International Nuclear Information System (INIS)

    Hylemon, P.B.; Studer, E.J.; Pandak, W.M.; Heuman, D.M.; Vlahcevic, Z.R.; Chiang, J.Y.


    The HPLC-spectrophotometric method for measuring cholesterol 7 alpha-hydroxylase activity was modified by using a C-18 reverse-phase column to separate 7 alpha-hydroxy-4-cholesten-3-one and 4-cholesten-3-one and by adding 7 beta-hydroxycholesterol to each reaction mixture as an internal recovery standard. With this method, we were able to simultaneously measure cholesterol 7 alpha-hydroxylase activity using endogenous cholesterol and exogenous [4- 14 C]cholesterol as substrate. Rat liver cytosol differentially stimulated (286%) the 7 alpha-hydroxylation of exogenous [4- 14 C]-cholesterol. In contrast, total cholesterol 7 alpha-hydroxylase activity was stimulated only 35% by cytosol. This method should prove useful for studying mechanisms of cholesterol delivery to cholesterol 7 alpha-hydroxylase

  13. Endogene CGRP


    Höfer, Martina


    Hintergrund und Ziele Die vorliegende tierexperimentelle Arbeit beschäftigt sich mit der Frage, welche Rolle endogenes Calcitonin-gene related peptide (CGRP) in der Niere spielt. Hierbei untersuchten wir die renale CGRP Freisetzung aus renalen Afferenzen in vitro anhand von gesunden Tieren und einem pathologischen Modell der Glomerulonephritis. Man weiß bereits, dass sowohl sympathische als auch primär sensorische Neuronen die Entzündung und die Immunantwort in der Peripherie regulieren (68)....

  14. Hume and Endogenous Money


    Maria Pia Paganelli


    David Hume’s monetary theory has three standard yet inconsistent readings. As a forefather of the quantity theory of money, Hume sees money as neutral. As an inflationist, Hume sees an active positive role for monetary policy. As a monetarist, Hume sees an active positive role for monetary policy only in the short run. This paper reads Hume consistently instead by showing that for Hume money is endogenous and demand-driven. Hume would read the money equation in terms of reverse causation and ...

  15. Porcine Endogenous Retroviruses in Xenotransplantation—Molecular Aspects

    Directory of Open Access Journals (Sweden)

    Magdalena C. Kimsa


    Full Text Available In the context of the shortage of organs and other tissues for use in human transplantation, xenotransplantation procedures with material taken from pigs have come under increased consideration. However, there are unclear consequences of the potential transmission of porcine pathogens to humans. Of particular concern are porcine endogenous retroviruses (PERVs. Three subtypes of PERV have been identified, of which PERV-A and PERV-B have the ability to infect human cells in vitro. The PERV-C subtype does not show this ability but recombinant PERV-A/C forms have demonstrated infectivity in human cells. In view of the risk presented by these observations, the International Xenotransplantation Association recently indicated the existence of four strategies to prevent transmission of PERVs. This article focuses on the molecular aspects of PERV infection in xenotransplantation and reviews the techniques available for the detection of PERV DNA, RNA, reverse transcriptase activity and proteins, and anti-PERV antibodies to enable carrying out these recommendations. These methods could be used to evaluate the risk of PERV transmission in human recipients, enhance the effectiveness and reliability of monitoring procedures, and stimulate discussion on the development of improved, more sensitive methods for the detection of PERVs in the future.

  16. Porcine Endogenous Retroviruses in Xenotransplantation—Molecular Aspects (United States)

    Kimsa, Magdalena C.; Strzalka-Mrozik, Barbara; Kimsa, Malgorzata W.; Gola, Joanna; Nicholson, Peter; Lopata, Krzysztof; Mazurek, Urszula


    In the context of the shortage of organs and other tissues for use in human transplantation, xenotransplantation procedures with material taken from pigs have come under increased consideration. However, there are unclear consequences of the potential transmission of porcine pathogens to humans. Of particular concern are porcine endogenous retroviruses (PERVs). Three subtypes of PERV have been identified, of which PERV-A and PERV-B have the ability to infect human cells in vitro. The PERV-C subtype does not show this ability but recombinant PERV-A/C forms have demonstrated infectivity in human cells. In view of the risk presented by these observations, the International Xenotransplantation Association recently indicated the existence of four strategies to prevent transmission of PERVs. This article focuses on the molecular aspects of PERV infection in xenotransplantation and reviews the techniques available for the detection of PERV DNA, RNA, reverse transcriptase activity and proteins, and anti-PERV antibodies to enable carrying out these recommendations. These methods could be used to evaluate the risk of PERV transmission in human recipients, enhance the effectiveness and reliability of monitoring procedures, and stimulate discussion on the development of improved, more sensitive methods for the detection of PERVs in the future. PMID:24828841

  17. Sinomenine Hydrochloride Inhibits the Metastasis of Human Glioblastoma Cells by Suppressing the Expression of Matrix Metalloproteinase-2/-9 and Reversing the Endogenous and Exogenous Epithelial-Mesenchymal Transition. (United States)

    Jiang, Yumao; Jiao, Yue; Liu, Yang; Zhang, Meiyu; Wang, Zhiguo; Li, Yujuan; Li, Tao; Zhao, Xiaoliang; Wang, Danqiao


    As shown in our previous study, sinomenine hydrochloride (SH), the major bioactive alkaloid isolated from Sinomenium acutum Rehd. et Wils. (Fam. Menispermaceae ), initiates the autophagy-mediated death of human glioblastoma cells by generating reactive oxygen species and activating the autophagy-lysosome pathway. However, its effects on the migration and invasion of human glioblastoma cells have not yet been elucidated. Therefore, human glioblastoma U87 and SF767 cells were treated with SH (0.125 and 0.25 mM) for 24 h, and cell migration and invasion were assessed using scratch wound healing, migration and invasion assays. SH promoted G0/G1 phase arrest, inhibited the migration and invasion of the two cell lines, suppressed the activation of nuclear factor kappa B (NFκB) and the expression of matrix metalloproteinase (MMP)-2/-9, triggered endoplasmic reticulum (ER) stress, reversed the exogenous epithelial-mesenchymal transition (EMT) induced by the inflammatory microenvironment and the endogenous EMT. Additionally, NFκB p65 overexpression blocked the SH-mediated inhibitory effects on MMP-2/-9 expression and cell invasion. SH-induced autophagy was reduced in CCAAT/enhancer binding protein (C/EBP) homologous protein (CHOP) or autophagy-related 5 (ATG5)-silenced human glioblastoma cells and cells treated with 4-phenylbutyric acid (4-PBA) or 3-methyladenine (3-MA), as shown by the decreased levels of the microtubule-associated protein light chain 3B (LC3B)-II and autophagic vacuoles (AVs) stained with monodansylcadaverine (MDC), respectively. Moreover, knockdown of CHOP or ATG5 and treatment with 4-PBA or 3-MA abolished the SH-mediated inhibition of mesenchymal markers (vimentin, Snail and Slug) expression and cell invasion, respectively. Importantly, SH also regulated the above related pathways in nude mice. Based on these findings, SH inhibited cell proliferation by inducing cell cycle arrest, and attenuated the metastasis of U87 and SF767 cells by suppressing MMP

  18. Sinomenine Hydrochloride Inhibits the Metastasis of Human Glioblastoma Cells by Suppressing the Expression of Matrix Metalloproteinase-2/-9 and Reversing the Endogenous and Exogenous Epithelial-Mesenchymal Transition

    Directory of Open Access Journals (Sweden)

    Yumao Jiang


    Full Text Available As shown in our previous study, sinomenine hydrochloride (SH, the major bioactive alkaloid isolated from Sinomenium acutum Rehd. et Wils. (Fam. Menispermaceae, initiates the autophagy-mediated death of human glioblastoma cells by generating reactive oxygen species and activating the autophagy-lysosome pathway. However, its effects on the migration and invasion of human glioblastoma cells have not yet been elucidated. Therefore, human glioblastoma U87 and SF767 cells were treated with SH (0.125 and 0.25 mM for 24 h, and cell migration and invasion were assessed using scratch wound healing, migration and invasion assays. SH promoted G0/G1 phase arrest, inhibited the migration and invasion of the two cell lines, suppressed the activation of nuclear factor kappa B (NFκB and the expression of matrix metalloproteinase (MMP-2/-9, triggered endoplasmic reticulum (ER stress, reversed the exogenous epithelial-mesenchymal transition (EMT induced by the inflammatory microenvironment and the endogenous EMT. Additionally, NFκB p65 overexpression blocked the SH-mediated inhibitory effects on MMP-2/-9 expression and cell invasion. SH-induced autophagy was reduced in CCAAT/enhancer binding protein (C/EBP homologous protein (CHOP or autophagy-related 5 (ATG5-silenced human glioblastoma cells and cells treated with 4-phenylbutyric acid (4-PBA or 3-methyladenine (3-MA, as shown by the decreased levels of the microtubule-associated protein light chain 3B (LC3B-II and autophagic vacuoles (AVs stained with monodansylcadaverine (MDC, respectively. Moreover, knockdown of CHOP or ATG5 and treatment with 4-PBA or 3-MA abolished the SH-mediated inhibition of mesenchymal markers (vimentin, Snail and Slug expression and cell invasion, respectively. Importantly, SH also regulated the above related pathways in nude mice. Based on these findings, SH inhibited cell proliferation by inducing cell cycle arrest, and attenuated the metastasis of U87 and SF767 cells by suppressing

  19. The reverse transcription inhibitor abacavir shows anticancer activity in prostate cancer cell lines.

    Directory of Open Access Journals (Sweden)

    Francesca Carlini

    Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.

  20. APOBEC3G inhibits elongation of HIV-1 reverse transcripts.

    Directory of Open Access Journals (Sweden)

    Kate N Bishop


    Full Text Available APOBEC3G (A3G is a host cytidine deaminase that, in the absence of Vif, restricts HIV-1 replication and reduces the amount of viral DNA that accumulates in cells. Initial studies determined that A3G induces extensive mutation of nascent HIV-1 cDNA during reverse transcription. It has been proposed that this triggers the degradation of the viral DNA, but there is now mounting evidence that this mechanism may not be correct. Here, we use a natural endogenous reverse transcriptase assay to show that, in cell-free virus particles, A3G is able to inhibit HIV-1 cDNA accumulation not only in the absence of hypermutation but also without the apparent need for any target cell factors. We find that although reverse transcription initiates in the presence of A3G, elongation of the cDNA product is impeded. These data support the model that A3G reduces HIV-1 cDNA levels by inhibiting synthesis rather than by inducing degradation.

  1. Human cytomegalovirus (HCMV) induces human endogenous retrovirus (HERV) transcription. (United States)

    Assinger, Alice; Yaiw, Koon-Chu; Göttesdorfer, Ingmar; Leib-Mösch, Christine; Söderberg-Nauclér, Cecilia


    Emerging evidence suggests that human cytomegalovirus (HCMV) is highly prevalent in tumours of different origin. This virus is implied to have oncogenic and oncomodulatory functions, through its ability to control host gene expression. Human endogenous retroviruses (HERV) are also frequently active in tumours of different origin, and are supposed to contribute as cofactors to cancer development. Due to the high prevalence of HCMV in several different tumours, and its ability to control host cell gene expression, we sought to define whether HCMV may affect HERV transcription. Infection of 3 established cancer cell lines, 2 primary glioblastoma cells, endothelial cells from 3 donors and monocytes from 4 donors with HCMV (strains VR 1814 or TB40/F) induced reverse transcriptase (RT) activity in all cells tested, but the response varied between donors. Both, gammaretrovirus-related class I elements HERV-T, HERV-W, HERV-F and ERV-9, and betaretrovirus-related class II elements HML-2 - 4 and HML-7 - 8, as well as spuma-virus related class III elements of the HERV-L group were up-regulated in response to HCMV infection in GliNS1 cells. Up-regulation of HERV activity was more pronounced in cells harbouring active HCMV infection, but was also induced by UV-inactivated virus. The effect was only slightly affected by ganciclovir treatment and was not controlled by the IE72 or IE86 HCMV genes. Within this brief report we show that HCMV infection induces HERV transcriptional activity in different cell types.

  2. Endogenous Lunar Volatiles (United States)

    McCubbin, F. M.; Liu, Y.; Barnes, J. J.; Anand, M.; Boyce, J. W.; Burney, D.; Day, J. M. D.; Elardo, S. M.; Hui, H.; Klima, R. L.; Magna, T.; Ni, P.; Steenstra, E.; Tartèse, R.; Vander Kaaden, K. E.


    This abstract discusses numerous outstanding questions on the topic of endogenous lunar volatiles that will need to be addressed in the coming years. Although substantial insights into endogenous lunar volatiles have been gained, more work remains.

  3. Endogenous laminin is required for human airway smooth muscle cell maturation

    Directory of Open Access Journals (Sweden)

    Tran Thai


    Full Text Available Abstract Background Airway smooth muscle (ASM contraction underlies acute bronchospasm in asthma. ASM cells can switch between a synthetic-proliferative phenotype and a contractile phenotype. While the effects of extracellular matrix (ECM components on modulation of ASM cells to a synthetic phenotype have been reported, the role of ECM components on maturation of ASM cells to a contractile phenotype in adult lung is unclear. As both changes in ECM components and accumulation of contractile ASM are features of airway wall remodelling in asthma, we examined the role of the ECM protein, laminin, in the maturation of contractile phenotype in human ASM cells. Methods Human ASM cells were made senescence-resistant by stable expression of human telomerase reverse transcriptase. Maturation to a contractile phenotype was induced by 7-day serum deprivation, as assessed by immunoblotting for desmin and calponin. The role of laminin on ASM maturation was investigated by comparing the effects of exogenous laminin coated on culture plates, and of soluble laminin peptide competitors. Endogenous expression of laminin chains during ASM maturation was also measured. Results Myocyte binding to endogenously expressed laminin was required for ASM phenotype maturation, as laminin competing peptides (YIGSR or GRGDSP significantly reduced desmin and calponin protein accumulation that otherwise occurs with prolonged serum deprivation. Coating of plastic cell culture dishes with different purified laminin preparations was not sufficient to further promote accumulation of desmin or calponin during 7-day serum deprivation. Expression of α2, β1 and γ1 laminin chains by ASM cells was specifically up-regulated during myocyte maturation, suggesting a key role for laminin-2 in the development of the contractile phenotype. Conclusion While earlier reports suggest exogenously applied laminin slows the spontaneous modulation of ASM to a synthetic phenotype, we show for the

  4. Endogenous and ectopic expression of telomere regulating genes in chicken embryonic fibroblasts

    International Nuclear Information System (INIS)

    Michailidis, Georgios; Saretzki, Gabriele; Hall, Judith


    In this study, we compared the endogenous expression of genes encoding telomere regulating proteins in cultured chicken embryonic fibroblasts (CEFs) and 10-day-old chicken embryos. CEFs maintained in vitro senesced and senescence was accompanied by reduced telomere length, telomerase activity, and expression of the chicken (c) TRF1 gene. There was no change in TRF2 gene expression although the major TRF2 transcript identified in 10-day-old chicken embryos encoded a truncated TRF2 protein (TRF2'), containing an N-terminal dimerisation domain but lacking a myb-related DNA binding domain and nuclear localisation signal. Senescence of the CEFs in vitro was associated with the loss of the TRF2' transcript, indicative of a novel function for the encoded protein. Senescence was also coupled with decreased expression of RAD51, but increased RAD52 expression. These data support that RAD51 independent recombination mechanisms do not function in vitro to maintain chicken telomeres. To attempt to rescue the CEFs from replicative senescence, we stably transfected passage 3 CEFs with the human telomerase reverse transcriptase (hTERT) catalytic subunit. While hTERT expression was detected in the stable transfectants neither telomerase activity nor the stabilisation of telomere length was observed, and the transfectant cells senesced at the same passage number as the untransfected cells. These data indicate that the human TERT is incompatible with the avian telomere maintenance apparatus and suggest the functioning of a species specific telomere system in the avian

  5. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L


    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  6. Endogenous Prospect Theory


    Schmidt, Ulrich; Zank, Horst


    In previous models of (cumulative) prospect theory reference-dependence of preferences is imposed beforehand and the location of the reference point is exogenously determined. This paper provides an axiomatization of a new specification of cumulative prospect theory, termed endogenous prospect theory, where reference-dependence is derived from preference conditions and a unique reference point arises endogenously.

  7. Are endogenous feline leukemia viruses really endogenous? (United States)

    Stewart, H; Jarrett, O; Hosie, M J; Willett, B J


    Full length endogenous feline leukemia virus (FeLV) proviruses exist within the genomes of many breeds of domestic cat raising the possibility that they may also exist in a transmissible exogenous form. Such viruses would share receptor usage with the recombinant FeLV-B subgroup, a viral subgroup that arises in vivo by recombination between exogenous subgroup A virus (FeLV-A) and endogenous FeLV. Accordingly, all isolates of FeLV-B made to date have contained a "helper" FeLV-A, consistent with their recombinatorial origin. In order to assess whether endogenous viruses are transmitted between cats, we examined primary isolates of FeLV for which the viral subgroup had been determined for the presence of a subgroup B virus that lacked an FeLV-A. Here we describe the identification of two primary field isolates of FeLV (2518 and 4314) that appeared to contain subgroup B virus only by classical interference assays, raising the possibility of between-host transmission of endogenous FeLV. Sequencing of the env gene and U3 region of the 3' long terminal repeat (LTR) confirmed that both viral genomes contained endogenous viral env genes. However the viral 3' LTRs appeared exogenous in origin with a putative 3' recombination breakpoint residing at the 3' end of the env gene. Further, the FeLV-2518 virions also co-packaged a truncated FeLV-A genome containing a defective env gene, termed FeLV-2518(A) whilst no helper subgroup A viral genome was detected in virions of FeLV-4314. The acquisition of an exogenous LTR by the endogenous FeLV in 4314 may have allowed a recombinant FeLV variant to outgrow an exogenous FeLV-A virus that was presumably present during first infection. Given time, a similar evolution may also occur within the 2518 isolate. The data suggest that endogenous FeLVs may be mobilised by acquisition of exogenous LTRs yielding novel viruses that type biologically as FeLV-B. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Endogenous Locus Reporter Assays. (United States)

    Liu, Yaping; Hermes, Jeffrey; Li, Jing; Tudor, Matthew


    Reporter gene assays are widely used in high-throughput screening (HTS) to identify compounds that modulate gene expression. Traditionally a reporter gene assay is built by cloning an endogenous promoter sequence or synthetic response elements in the regulatory region of a reporter gene to monitor transcriptional activity of a specific biological process (exogenous reporter assay). In contrast, an endogenous locus reporter has a reporter gene inserted in the endogenous gene locus that allows the reporter gene to be expressed under the control of the same regulatory elements as the endogenous gene, thus more accurately reflecting the changes seen in the regulation of the actual gene. In this chapter, we introduce some of the considerations behind building a reporter gene assay for high-throughput compound screening and describe the methods we have utilized to establish 1536-well format endogenous locus reporter and exogenous reporter assays for the screening of compounds that modulate Myc pathway activity.

  9. Production of endogenous pyrogen. (United States)

    Dinarello, C A


    The production and release of endogenous pyrogen by the host is the first step in the pathogenesis of fever. Endogenous pyrogen is a low-molecular-weight protein released from phagocytic leukocytes in response to several substances of diverse nature. Some of these agents stimulate production of endogenous pyrogen because they are toxic; others act as antigens and interact with either antibody or sensitized lymphocytes in order to induce its production. Some tumors of macrophage origin produce the molecule spontaneously. Whatever the mechanism involved, endogenous pyrogen is synthesized following transcription of new DNA and translation of mRNA into new protein. Once synthesis is completed, the molecule is released without significant intracellular storage. Recent evidence suggests that following release, molecular aggregates form which are biologically active. In its monomer form, endogenous pyrogen is a potent fever-producing substance and mediates fever by its action on the thermoregulatory center.

  10. Effect of human vascular endothelial growth factor gene transfer on endogenous vascular endothelial growth factor mRNA expression in a rat fibroblast and osteoblast culture model. (United States)

    Li, Ru; Li, Claire H; Nauth, Aaron; McKee, Michael D; Schemitsch, Emil H


    Vascular endothelial growth factor (VEGF) plays an important role in promoting angiogenesis and osteogenesis during fracture repair. Our previous studies have shown that cell-based VEGF gene therapy enhances bone healing of a rabbit tibia segmental bone defect in vivo. The aim of this project was to examine the effect of exogenous human VEGF on the endogenous rat VEGF messenger RNA (mRNA) expression in a cell-based gene transfer model. Rat fibroblasts and osteoblasts were harvested from the dermal tissue and periosteum, respectively, of Fisher 344 rats. The cells were then cultured and transfected with pcDNA-human VEGF using Superfect reagent (Qiagen). Four experimental groups were created: 1) fibroblast-VEGF; 2) osteoblast-VEGF; 3) nontransfected fibroblast controls; and 4) nontransfected osteoblast controls. The cultured cells were harvested at 1, 3, and 7 days after the gene transfection. The total mRNA was extracted (Trizol; Invitrogen); both human VEGF and rat VEGF mRNA were measured by reverse transcriptase-polymerase chain reaction and quantified by VisionWorksLS. The human VEGF165 mRNA was detected by reverse transcriptase-polymerase chain reaction from transfected fibroblasts and osteoblasts at 1, 3, and 7 days after gene transfection. The human VEGF165 levels peaked at Day 1 and then gradually reduced expression in both transfected fibroblasts and osteoblasts. Two endogenous rat VEGF isoforms were detected in this cell culture model: rat VEGF120 and rat VEGF164. We compared the rat VEGF120 and rat VEGF164 expression level of the fibroblasts or osteoblasts that were transfected with human VEGF165, with nontransfected control cells. Both the transfected fibroblasts and osteoblasts showed greater expression of rat VEGF164 than nontransfected controls at Day 1 (peak level) and Day 3, but not at Day 7. The expression of rat VEGF120 was lower in transfected fibroblasts, but higher in transfected osteoblasts, than the relevant control groups at any time point

  11. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana


    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  12. Endogenous Pyrogen Physiology. (United States)

    Beisel, William R.


    Discusses the physiology of endogenous pyrogen (EP), the fever-producing factor of cellular origin. Included are: its hormone-like role, its molecular nature, bioassay procedures, cellular production and mechanisms of EP action. (SA)

  13. Characterisation of a human acid-sensing ion channel (hASIC1a) endogenously expressed in HEK293 cells. (United States)

    Gunthorpe, M J; Smith, G D; Davis, J B; Randall, A D


    Acid-sensing ion channels (ASICs) are a new and expanding family of proton-gated cation (Na+/Ca2+) channels that are widely expressed in sensory neurons and the central nervous system. Their distribution suggests that they may play a critical role in the sensation of the pain that accompanies tissue acidosis and may also be important in detecting the subtle pH variations that occur during neuronal signalling. Here, using whole-cell patch-clamp electrophysiology and reverse transcriptase-polymerase chain reaction (RT-PCR), we show that HEK293 cells, a commonly used cell line for the expression and characterisation of many ion channels, functionally express an endogenous proton-gated conductance attributable to the activity of human ASIC1a. These data therefore represent the first functional characterisation of hASIC1 and have many important implications for the use of HEK293 cells as a host cell system for the study of ASICs, vanilloid receptor-1 and any other proton-gated channel. With this latter point in mind we have devised a simple desensitisation strategy to selectively remove the contribution of hASIC1a from proton-gated currents recorded from HEK293 cells expressing vanilloid receptor-1.

  14. The Endogenous Exposome (United States)

    Nakamura, Jun; Mutlu, Esra; Sharma, Vyom; Collins, Leonard; Bodnar, Wanda; Yu, Rui; Lai, Yongquan; Moeller, Benjamin; Lu, Kun; Swenberg, James


    The concept of the Exposome, is a compilation of diseases and one’s lifetime exposure to chemicals, whether the exposure comes from environmental, dietary, or occupational exposures; or endogenous chemicals that are formed from normal metabolism, inflammation, oxidative stress, lipid peroxidation, infections, and other natural metabolic processes such as alteration of the gut microbiome. In this review, we have focused on the Endogenous Exposome, the DNA damage that arises from the production of endogenous electrophilic molecules in our cells. It provides quantitative data on endogenous DNA damage and its relationship to mutagenesis, with emphasis on when exogenous chemical exposures that produce identical DNA adducts to those arising from normal metabolism cause significant increases in total identical DNA adducts. We have utilized stable isotope labeled chemical exposures of animals and cells, so that accurate relationships between endogenous and exogenous exposures can be determined. Advances in mass spectrometry have vastly increased both the sensitivity and accuracy of such studies. Furthermore, we have clear evidence of which sources of exposure drive low dose biology that results in mutations and disease. These data provide much needed information to impact quantitative risk assessments, in the hope of moving towards the use of science, rather than default assumptions. PMID:24767943

  15. Transcrição reversa na determinação da expressão do mRNA para a enzima conversora de angiotensina testicular em animais tratados com zinco Assessment of the reverse transcriptase polymerase chain reaction technique in the determination of the mRNA expression for the testicular angiotensin-converting enzyme in zinc treated rats

    Directory of Open Access Journals (Sweden)

    Gilberto Simeone Henriques


    , primer concentration, hybridization temperature and number of denaturation, hybridization and extension cycles were evaluated. For this purpose, samples of testis from Wistar rats fed a zinc containing diet were used to extract total RNA using the phenol-chloroform-isothiocyanate reaction. Stable cDNA was then generated by the reverse transcription reaction. Using specific primers, the gene of interest (testicular isoform of the angiotensin-converting enzyme and the housekeeping gene for the expression of Glyceraldehyde-3-Phosphate Dehydrogenase were amplified. The samples were then submitted to gel eletrophoresis in agarose gel, stained with ethide bromide and visualized in a UV chamber. RESULTS: The results showed that the best reaction conditions for the chain reaction by the testicular isoform polymerase of the angiotensin-converting enzyme and for Glyceraldehyde-3-Phosphate Dehydrogenase were: (1 initial cDNA concentration of 2 µg, (2 primer concentration of 200nM, (3 hybridization temperature between 57.5ºC and 60.1ºC and (4 33 cycles. CONCLUSION: It was concluded that this optimization minimized interference of the technique, contributing to the production of true, comparative data for the testicular angiotensin- converting enzyme gene expression.

  16. Cytokines as endogenous pyrogens. (United States)

    Dinarello, C A


    Cytokines are pleiotropic molecules mediating several pathologic processes. Long before the discovery of cytokines as immune system growth factors or as bone marrow stimulants, investigators learned a great deal about cytokines when they studied them as the endogenous mediators of fever. The terms "granulocytic" or "endogenous pyrogen" were used to describe substances with the biologic property of fever induction. Today, we recognize that pyrogenicity is a fundamental biologic property of several cytokines and hence the clinically recognizeable property of fever links host perturbations during disease with fundamental perturbations in cell biology. In this review, the discoveries made on endogenous pyrogens are revisited, with insights into the importance of the earlier work to the present-day understanding of cytokines in health and in disease.

  17. Evolution of endogenous analgesia

    NARCIS (Netherlands)

    Niesters, Marieke


    Endogenous pain modulation is a complex phenomenon involved in the perception of pain. It consists of top-down inhibitory and facilitatory pathways that originate at higher sites within the central nervous system and converge at dorsal horn neurons in the spinal cord, to modulate incoming afferent

  18. Unemployment and endogenous growth

    NARCIS (Netherlands)

    van Schaik, A.B.T.M.; de Groot, H.L.F.


    In this paper we develop a two-sector endogenous growth model with a dual labour market, based on efficiency wages. Growth is driven by intentional R&D performed in the high-tech and high-wage sector. It is examined how a change in rivalry among firms affects simultaneously growth and unemployment.

  19. Detection and analysis of endogenous badnaviruses in the New Zealand flora. (United States)

    Lyttle, David J; Orlovich, David A; Guy, Paul L


    Badnaviruses and their host-integrated DNA occur in tropical crops and a few northern temperate species. Following the discovery of a badnavirus on a subantarctic island with floristic links to New Zealand, we postulated that badnaviruses exist in the New Zealand flora. Badnavirus reverse transcriptase (RT) sequences consist of variable regions flanked by highly conserved regions. This study used RT sequences to detect and characterize badnavirus sequences in the New Zealand flora and to investigate their utility for the study of broader aspects of plant biology. Molecular diversity of RT sequences was analysed using polymerase chain reaction and denaturing gradient gel electrophoresis (DGGE). In a study of the genus Melicytus, internal transcribed spacer (ITS) sequences were compared with the RT data. No freely replicating badnaviruses were detected but more than half of the species (37/60) contained RT sequences. Phylogenetic analysis of 21 RT sequences formed monophyletic groups distinct from other species and from badnaviruses. No frameshift mutations occurred in any of the sequences translated in silico. More detailed study of the genus Melicytus indicated broader applications for our approach. Analysis of RT sequences revealed the presence of a previously unrecognized species (confirmed using ITS). Inheritance of DGGE profiles by Melicytus ramiflorus seedlings suggested that this species may undergo apomixis. The presence of integrated badnavirus sequences in a wide range of taxa from this Southern Hemisphere flora indicates that these sequences may be common in many temperate regions. Potential to activate viruses from these sequences should be considered when placing these species in tissue culture or under other forms of abiotic or genomic stress. Analysis of endogenous RT sequences shows potential for the study of systematics, phylogenetics and plant reproductive biology.

  20. Endogenous growth and the environment

    NARCIS (Netherlands)

    Withagen, C.A.A.M.; Vellinga, N.


    This paper examines the relationship between environmental policy and growth, from the perspective of endogenous growth theory. In particular three standard endogenous growth models are supplemented with environmental issues, such as pollution and exhaustibility of natural resources. It is found

  1. Endogenous growth and environmental policy

    NARCIS (Netherlands)

    Withagen, C.A.A.M.; Vellinga, N.


    This paper examines the relationship between environmental policy and growth, from the perspective of endogenous growth theory. In particular three standard endogenous growth models are supplemented with environmental issues, such as pollution and exhaustibility of natural resources. It is found

  2. Immunohistochemical detection of human telomerase reverse transcriptase in oral cancer and pre-cancer

    Directory of Open Access Journals (Sweden)

    Jayanthi Palani


    Conclusion: There was increased expression of hTERT protein in OSCC and leukoplakia samples when compared to normal oral mucosa. The cellular localization, LI and LS in OSF were significantly different from OSCC and leukoplakia.

  3. Mechanism of polypurine tract primer generation by HIV-1 reverse transcriptase

    Czech Academy of Sciences Publication Activity Database

    Figiel, M.; Krepl, Miroslav; Park, S.; Poznanski, J.; Skowronek, K.; Golab, A.; Ha, T.; Šponer, Jiří; Nowotny, M.


    Roč. 293, č. 1 (2018), s. 191-202 ISSN 0021-9258 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:68081707 Keywords : human-immunodeficiency-virus * strand dna -synthesis * retroviral rnases-h * rna/ dna hybrid Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.125, year: 2016

  4. Coordination between the polymerase and RNase H activity of HIV-1 reverse transcriptase

    Czech Academy of Sciences Publication Activity Database

    Figiel, M.; Krepl, Miroslav; Poznanski, J.; Gotab, A.; Šponer, Jiří; Nowotny, M.


    Roč. 45, č. 6 (2017), s. 3341-3352 ISSN 0305-1048 R&D Projects: GA ČR GAP208/12/1878 Grant - others:GA MŠk(CZ) LO1305 Institutional support: RVO:68081707 Keywords : human-immunodeficiency-virus * rna/dna hybrid * force-field Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  5. In vitro HIV-1 evolution in response to triple reverse transcriptase inhibitors & in silico phenotypic analysis.

    Directory of Open Access Journals (Sweden)

    Barbara A Rath

    Full Text Available Effectiveness of ART regimens strongly depends upon complex interactions between the selective pressure of drugs and the evolution of mutations that allow or restrict drug resistance.Four clinical isolates from NRTI-exposed, NNRTI-naive subjects were passaged in increasing concentrations of NVP in combination with 1 µM 3 TC and 2 µM ADV to assess selective pressures of multi-drug treatment. A novel parameter inference procedure, based on a stochastic viral growth model, was used to estimate phenotypic resistance and fitness from in vitro combination passage experiments.Newly developed mathematical methods estimated key phenotypic parameters of mutations arising through selective pressure exerted by 3 TC and NVP. Concentrations of 1 µM 3 TC maintained the M184V mutation, which was associated with intrinsic fitness deficits. Increasing NVP concentrations selected major NNRTI resistance mutations. The evolutionary pathway of NVP resistance was highly dependent on the viral genetic background, epistasis as well as stochasticity. Parameter estimation indicated that the previously unrecognized mutation L228Q was associated with NVP resistance in some isolates.Serial passage of viruses in the presence of multiple drugs may resemble the selection of mutations observed among treated individuals and populations in vivo and indicate evolutionary preferences and restrictions. Phenotypic resistance estimated here "in silico" from in vitro passage experiments agreed well with previous knowledge, suggesting that the unique combination of "wet-" and "dry-lab" experimentation may improve our understanding of HIV-1 resistance evolution in the future.

  6. Pyrroloaryls and pyrroloheteroaryls: Inhibitors of the HIV fusion/attachment, reverse transcriptase and integrase

    Czech Academy of Sciences Publication Activity Database

    Patel, Rahul V.; Park, S.W.


    Roč. 23, č. 17 (2015), s. 5247-5263 ISSN 0968-0896 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Pyrrole * Arylthiopyrrole * Triciribine Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.923, year: 2015

  7. Tissue-specific expression of telomerase reverse transcriptase gene variants in Nicotiana tabacum

    Czech Academy of Sciences Publication Activity Database

    Jurečková, J.; Sýkorová, Eva; Hafidh, Said; Honys, David; Fajkus, Jiří; Fojtová, M.


    Roč. 245, č. 3 (2017), s. 549-561 ISSN 0032-0935 R&D Projects: GA ČR GA13-06943S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 ; RVO:61389030 Keywords : male gametophyte development * tobacco male gametophyte * allotetraploid nicotiana Subject RIV: EF - Botanics; EF - Botanics (UEB-Q) OBOR OECD: Plant sciences, botany; Plant sciences, botany (UEB-Q) Impact factor: 3.361, year: 2016

  8. A reverse transcriptase-PCR assay for detecting filarial infective larvae in mosquitoes.

    Directory of Open Access Journals (Sweden)

    Sandra J Laney


    Full Text Available Existing molecular assays for filarial parasite DNA in mosquitoes cannot distinguish between infected mosquitoes that contain any stage of the parasite and infective mosquitoes that harbor third stage larvae (L3 capable of establishing new infections in humans. We now report development of a molecular L3-detection assay for Brugia malayi in vectors based on RT-PCR detection of an L3-activated gene transcript.Candidate genes identified by bioinformatics analysis of EST datasets across the B. malayi life cycle were initially screened by PCR using cDNA libraries as templates. Stage-specificity was confirmed using RNA isolated from infected mosquitoes. Mosquitoes were collected daily for 14 days after feeding on microfilaremic cat blood. RT-PCR was performed with primer sets that were specific for individual candidate genes. Many promising candidates with strong expression in the L3 stage were excluded because of low-level transcription in less mature larvae. One transcript (TC8100, which encodes a particular form of collagen was only detected in mosquitoes that contained L3 larvae. This assay detects a single L3 in a pool of 25 mosquitoes.This L3-activated gene transcript, combined with a control transcript (tph-1, accession # U80971 that is constitutively expressed by all vector-stage filarial larvae, can be used to detect filarial infectivity in pools of mosquito vectors. This general approach (detection of stage-specific gene transcripts from eukaryotic pathogens may also be useful for detecting infective stages of other vector-borne parasites.

  9. Suicide Inhibitors of Reverse Transcriptase in the Therapy of AIDS and Other Retroviruses (United States)


    are shown below. One of the first, [N-(L-3-tran carboxyxiran-2-carbonyl)-L-leucyl]-amido (4-guanido) butane was isolated from Asperg /II japonicus and...using uridine nucleosides to enhance the antiviral selectivity. j, Synthesis of Uridine 2’ and 3*-Ribosoiroxr’es 3*-uridine spiroxirane was...system used (Figure 2). Also shown in this figure is the enhanced sensitivity of the vaccif recombinant HIV-RT to Foscarnet when expressed in monkey kidney

  10. Stimulating endogenous cardiac regeneration

    Directory of Open Access Journals (Sweden)

    Amanda eFinan


    Full Text Available The healthy adult heart has a low turnover of cardiac myocytes. The renewal capacity, however, is augmented after cardiac injury. Participants in cardiac regeneration include cardiac myocytes themselves, cardiac progenitor cells, and peripheral stem cells, particularly from the bone marrow compartment. Cardiac progenitor cells and bone marrow stem cells are augmented after cardiac injury, migrate to the myocardium, and support regeneration. Depletion studies of these populations have demonstrated their necessary role in cardiac repair. However, the potential of these cells to completely regenerate the heart is limited. Efforts are now being focused on ways to augment these natural pathways to improve cardiac healing, primarily after ischemic injury but in other cardiac pathologies as well. Cell and gene therapy or pharmacological interventions are proposed mechanisms. Cell therapy has demonstrated modest results and has passed into clinical trials. However, the beneficial effects of cell therapy have primarily been their ability to produce paracrine effects on the cardiac tissue and recruit endogenous stem cell populations as opposed to direct cardiac regeneration. Gene therapy efforts have focused on prolonging or reactivating natural signaling pathways. Positive results have been demonstrated to activate the endogenous stem cell populations and are currently being tested in clinical trials. A potential new avenue may be to refine pharmacological treatments that are currently in place in the clinic. Evidence is mounting that drugs such as statins or beta blockers may alter endogenous stem cell activity. Understanding the effects of these drugs on stem cell repair while keeping in mind their primary function may strike a balance in myocardial healing. To maximize endogenous cardiac regeneration,a combination of these approaches couldameliorate the overall repair process to incorporate the participation ofmultiple cell players.

  11. Exogenous vs. Endogenous Separation


    Ramey, Garey


    This paper assesses how various approaches to modelling the separation margin a¤ect the ability of the Mortensen-Pissarides job matching model to explain key facts about the aggregate labor market. Allowing for realistic time variation in the separation rate, whether exogenous or endogenous, greatly in- creases the unemployment variability generated by the model. Speci…cations with exogenous separation rates, whether constant or time-varying, fail to pro- duce realistic volatility and prod...

  12. Reverse Algols (United States)

    Leung, K. C.


    Reverse Algols, binary systems with a semidetached configuration in which the more massive component is in contact with the critical equipotential surface, are examined. Observational evidence for reverse Algols is presented and the parameters of seven reverse Algols are listed. The evolution of Algols and reverse Algols is discussed. It is suggested that, because reverse Algols represent the premass-reversal semidetached phase of close binary evolution, the evolutionary time scale between regular and reverse Algols is the ratio of the number of confirmed systems of these two Algol types.

  13. Reverse Logistics


    Kulikova, Olga


    This thesis was focused on the analysis of the concept of reverse logistics and actual reverse processes which are implemented in mining industry and finding solutions for the optimization of reverse logistics in this sphere. The objective of this paper was the assessment of the development of reverse logistics in mining industry on the example of potash production. The theoretical part was based on reverse logistics and mining waste related literature and provided foundations for further...

  14. The Endogenous Feedback Network

    DEFF Research Database (Denmark)

    Augustenborg, Claudia Carrara


    proposals, it will first be considered the extents of their reciprocal compatibility, tentatively shaping an integrated, theoretical profile of consciousness. A new theory, the Endogenous Feedback Network (EFN) will consequently be introduced which, beside being able to accommodate the main tenets...... of the reviewed theories, appears able to compensate for the explanatory gaps they leave behind. The EFN proposes consciousness as the phenomenon emerging from a distinct network of neural paths broadcasting the neural changes associated to any mental process. It additionally argues for the need to include a 5th...

  15. Combining Semi-Endogenous and Fully Endogenous Growth: a Generalization.


    Cozzi, Guido


    This paper shows that combining the semi-endogenous and the fully endogenous growth mechanisms with a general CES aggregator, either growth process can prevail in the balanced growth path depending on their degree of complementarity/substitutability. Policy-induced long-run economic switches to the fully endogenous steady state as the R&D employment ratio surpasses a positive threshold are possible if the two growth engines are gross substitutes.

  16. Endogenous viral elements in animal genomes.

    Directory of Open Access Journals (Sweden)

    Aris Katzourakis


    Full Text Available Integration into the nuclear genome of germ line cells can lead to vertical inheritance of retroviral genes as host alleles. For other viruses, germ line integration has only rarely been documented. Nonetheless, we identified endogenous viral elements (EVEs derived from ten non-retroviral families by systematic in silico screening of animal genomes, including the first endogenous representatives of double-stranded RNA, reverse-transcribing DNA, and segmented RNA viruses, and the first endogenous DNA viruses in mammalian genomes. Phylogenetic and genomic analysis of EVEs across multiple host species revealed novel information about the origin and evolution of diverse virus groups. Furthermore, several of the elements identified here encode intact open reading frames or are expressed as mRNA. For one element in the primate lineage, we provide statistically robust evidence for exaptation. Our findings establish that genetic material derived from all known viral genome types and replication strategies can enter the animal germ line, greatly broadening the scope of paleovirological studies and indicating a more significant evolutionary role for gene flow from virus to animal genomes than has previously been recognized.



    Rachma, Meutia Safrina


    There has been a long debate about the endogeneity of money supply. The main objective of this article is to identify whether money supply in Indonesia is an exogenous or an endogenous variable. Using a Vector Autoregressive model and monthly data 1997(5)-2010(6), the estimation result shows that money supply in Indonesia is an endogenous variable. The movement of broad money supply does influence the movement of base money and Consumer Price Index. Consequently, the central bank does not hav...

  18. Endogeneity Of Indonesian Money Supply


    Rachma, Meutia Safrina


    There has been a long debate about the endogeneity of money supply. The main objective of this article is to identify whether money supply in Indonesia is an exogenous or an endogenous variable. Using a Vector Autoregressive model and monthly data 1997(5)-2010(6), the estimation result shows that money supply in Indonesia is an endogenous variable. The movement of broad money supply does influence the movement of base money and Consumer Price Index. Consequently, the central bank does not hav...

  19. Habits, aspirations and endogenous fertility


    Luciano Fanti


    Motivated by the increasing literature on endogenous preferences as well as on endogenous fertility, this paper investigates the implications of the interaction of the endogenous determination of the number of children with habit and aspiration formation in an OLG model. In contrast with the previous literature, we show that greater aspirations may lead to higher savings, and more interestingly, always increase the neoclassical economic growth.

  20. Endogenous Monetary Policy Regime Change


    Troy Davig; Eric M. Leeper


    This paper makes changes in monetary policy rules (or regimes) endogenous. Changes are triggered when certain endogenous variables cross specified thresholds. Rational expectations equilibria are examined in three models of threshold switching to illustrate that (i) expectations formation effects generated by the possibility of regime change can be quantitatively important; (ii) symmetric shocks can have asymmetric effects; (iii) endogenous switching is a natural way to formally model preempt...

  1. Reverse Osmosis

    Indian Academy of Sciences (India)

    many applications, one of which is desalination of seawater. The inaugural Nobel Prize in Chemistry was awarded in 1901 to van 't Hoff for his seminal work in this area. The present article explains the principle of osmosis and reverse osmosis. Osmosis and Reverse Osmosis. As the name suggests, reverse osmosis is the ...

  2. Endogenous Lunar Volatiles (United States)

    McCubbin, F. M.; Liu, Y.; Barnes, J. J.; Boyce, J. W.; Day, J. M. D.; Elardo, S. M.; Hui, H.; Magna, T.; Ni, P.; Tartese, R.; hide


    The chapter will begin with an introduction that defines magmatic volatiles (e.g., H, F, Cl, S) versus geochemical volatiles (e.g., K, Rb, Zn). We will discuss our approach of understanding both types of volatiles in lunar samples and lay the ground work for how we will determine the overall volatile budget of the Moon. We will then discuss the importance of endogenous volatiles in shaping the "Newer Views of the Moon", specifically how endogenous volatiles feed forward into processes such as the origin of the Moon, magmatic differentiation, volcanism, and secondary processes during surface and crustal interactions. After the introduction, we will include a re-view/synthesis on the current state of 1) apatite compositions (volatile abundances and isotopic compositions); 2) nominally anhydrous mineral phases (moderately to highly volatile); 3) volatile (moderately to highly volatile) abundances in and isotopic compositions of lunar pyroclastic glass beads; 4) volatile (moderately to highly volatile) abundances in and isotopic compositions of lunar basalts; 5) volatile (moderately to highly volatile) abundances in and isotopic compositions of melt inclusions; and finally 6) experimental constraints on mineral-melt partitioning of moderately to highly volatile elements under lunar conditions. We anticipate that each section will summarize results since 2007 and focus on new results published since the 2015 Am Min review paper on lunar volatiles [9]. The next section will discuss how to use sample abundances of volatiles to understand the source region and potential caveats in estimating source abundances of volatiles. The following section will include our best estimates of volatile abundances and isotopic compositions (where permitted by available data) for each volatile element of interest in a number of important lunar reservoirs, including the crust, mantle, KREEP, and bulk Moon. The final section of the chapter will focus upon future work, outstanding questions

  3. Endogenous fertility and development traps with endogenous lifetime


    Fanti, Luciano; Gori, Luca


    We extend the literature on endogenous lifetime and economic growth by Chakraborty (2004) and Bunzel and Qiao (2005) to endogenous fertility. We show that development traps due to underinvestments in health cannot appear when fertility is an economic decision variable and the costs of children are represented by a constant fraction of the parents' income used for their upbringing.

  4. Intracytoplasmic maturation of the human immunodeficiency virus type 1 reverse transcription complexes determines their capacity to integrate into chromatin

    Directory of Open Access Journals (Sweden)

    Kashanchi Fatah


    Full Text Available Abstract Background The early events of the HIV-1 life cycle include entry of the viral core into target cell, assembly of the reverse transcription complex (RTCs performing reverse transcription, its transformation into integration-competent complexes called pre-integration complexes (PICs, trafficking of complexes into the nucleus, and finally integration of the viral DNA into chromatin. Molecular details and temporal organization of these processes remain among the least investigated and most controversial problems in the biology of HIV. Results To quantitatively evaluate maturation and nuclear translocation of the HIV-1 RTCs, nucleoprotein complexes isolated from the nucleus (nRTC and cytoplasm (cRTC of HeLa cells infected with MLV Env-pseudotyped HIV-1 were analyzed by real-time PCR. While most complexes completed reverse transcription in the cytoplasm, some got into the nucleus before completing DNA synthesis. The HIV-specific RNA complexes could get into the nucleus when reverse transcription was blocked by reverse transcriptase inhibitor, although nuclear import of RNA complexes was less efficient than of DNA-containing RTCs. Analysis of the RTC nuclear import in synchronized cells infected in the G2/M phase of the cell cycle showed enrichment in the nuclei of RTCs containing incomplete HIV-1 DNA compared to non-synchronized cells, where RTCs with complete reverse transcripts prevailed. Immunoprecipitation assays identified viral proteins IN, Vpr, MA, and cellular Ini1 and PML associated with both cRTCs and nRTCs, whereas CA was detected only in cRTCs and RT was diminished in nRTCs. Cytoplasmic maturation of the complexes was associated with increased immunoreactivity with anti-Vpr and anti-IN antibodies, and decreased reactivity with antibodies to RT. Both cRTCs and nRTCs carried out endogenous reverse transcription reaction in vitro. In contrast to cRTCs, in vitro completion of reverse transcription in nRTCs did not increase their

  5. Ezetimibe Increases Endogenous Cholesterol Excretion in Humans. (United States)

    Lin, Xiaobo; Racette, Susan B; Ma, Lina; Wallendorf, Michael; Ostlund, Richard E


    Ezetimibe improves cardiovascular outcomes when added to optimum statin treatment. It lowers low-density lipoprotein cholesterol and percent intestinal cholesterol absorption, but the exact cardioprotective mechanism is unknown. We tested the hypothesis that the dominant effect of ezetimibe is to increase the reverse transport of cholesterol from rapidly mixing endogenous cholesterol pool into the stool. In a randomized, placebo-controlled, double-blind parallel trial in 24 healthy subjects with low-density lipoprotein cholesterol 100 to 200 mg/dL, we measured cholesterol metabolism before and after a 6-week treatment period with ezetimibe 10 mg/d or placebo. Plasma cholesterol was labeled by intravenous infusion of cholesterol-d 7 in a lipid emulsion and dietary cholesterol with cholesterol-d 5 and sitostanol-d 4 solubilized in oil. Plasma and stool samples collected during a cholesterol- and phytosterol-controlled metabolic kitchen diet were analyzed by mass spectrometry. Ezetimibe reduced intestinal cholesterol absorption efficiency 30±4.3% (SE, P <0.0001) and low-density lipoprotein cholesterol 19.8±1.9% ( P =0.0001). Body cholesterol pool size was unchanged, but fecal endogenous cholesterol excretion increased 66.6±12.2% ( P <0.0001) and percent cholesterol excretion from body pools into the stool increased 74.7±14.3% ( P <0.0001), whereas plasma cholesterol turnover rose 26.2±3.6% ( P =0.0096). Fecal bile acids were unchanged. Ezetimibe increased the efficiency of reverse cholesterol transport from rapidly mixing plasma and tissue pools into the stool. Further work is needed to examine the potential relation of reverse cholesterol transport and whole body cholesterol metabolism to coronary events and the treatment of atherosclerosis. URL: Unique identifier: NCT01603758. © 2017 American Heart Association, Inc.

  6. Endogenous Information, Risk Characterization, and the Predictability of Average Stock Returns

    Directory of Open Access Journals (Sweden)

    Pradosh Simlai


    Full Text Available In this paper we provide a new type of risk characterization of the predictability of two widely known abnormal patterns in average stock returns: momentum and reversal. The purpose is to illustrate the relative importance of common risk factors and endogenous information. Our results demonstrates that in the presence of zero-investment factors, spreads in average momentum and reversal returns correspond to spreads in the slopes of the endogenous information. The empirical findings support the view that various classes of firms react differently to volatility risk, and endogenous information harbor important sources of potential risk loadings. Taken together, our results suggest that returns are influenced by random endogenous information flow, which is asymmetric in nature, and can be used as a performance attribution factor. If one fails to incorporate the existing asymmetric endogenous information hidden in the historical behavior, any attempt to explore average stock return predictability will be subject to an unquantified specification bias.

  7. Diagnosis of hepatitis C virus in Brazilian blood donors using a reverse transcriptase nested polymerase chain reaction: comparison with enzyme immunoassay and recombinant protein immunoblot assay Diagnóstico da hepatite por vírus C em doadores de sangue brasileiros, usando a reação de transcrição reversa e a reação em cadeia da polimerase "nested": comparação com os ensaios imunoenzimáticos e imunoblot recombinante

    Directory of Open Access Journals (Sweden)

    Neiva S. L. GONÇALES


    Full Text Available Screening blood donations for anti-HCV antibodies and alanine aminotransferase (ALT serum levels generally prevents the transmission of hepatitis C virus (HCV by transfusion. The aim of the present study was to evaluate the efficiency of the enzyme immunoassay (EIA screening policy in identifying potentially infectious blood donors capable to transmit hepatitis C through blood transfusion. We have used a reverse transcriptase (RT-nested polymerase chain reaction (PCR to investigate the presence of HCV-RNA in blood donors. The prevalence of HCV-RNA positive individuals was compared with the recombinant immunoblot assay (RIBA-2 results in order to assess the usefulness of both tests as confirmatory assays. Both tests results were also compared with the EIA-2 OD/C ratio (optical densities of the samples divided by the cut off value. ALT results were expressed as the ALT quotient (qALT, calculated dividing the ALT value of the samples by the maximum normal value (53UI/l for the method. Donors (n=178 were divided into five groups according to their EIA anti-HCV status and qALT: group A (EIA > or = 3, ALT or = 3, ALT>1, group C (11 and group E (EIA or = 3 and detectable HCV-RNA by RT-nested PCR. We have also noted that blood donors with RIBA-2 indeterminate presented a high degree of detectable HCV-RNA using RT-nested PCR (75%, especially when the c22.3 band was detected.Na prevenção da transmissão de Hepatite por Vírus C (HCV em transfusões de hemocomponentes, utiliza-se rotineiramente, como testes de triagem de doadores de sangue, ensaios que detectam anticorpos anti-HCV e dosagens da enzima alanina-aminotransferase (ALT. O presente estudo tem como objetivo principal avaliar a eficiência do ensaio imunoenzimático de segunda geração (EIA-2 como teste de triagem, na identificação de doadores de sangue potencialmente infectados, e portanto, capazes de transmitir hepatite C pelos hemocomponentes. Nós utilizamos o ensaio de transcri


    Directory of Open Access Journals (Sweden)

    Meutia Safrina Rachma


    Full Text Available There has been a long debate about the endogeneity of money supply. The main objective of this article is to identify whether money supply in Indonesia is an exogenous or an endogenous variable. Using a Vector Autoregressive model and monthly data 1997(5-2010(6, the estimation result shows that money supply in Indonesia is an endogenous variable. The movement of broad money supply does influence the movement of base money and Consumer Price Index. Consequently, the central bank does not have control power on money supply. The bank is only able to maintain the stability and control the movement of broad money supply. Keywords: Endogenous variable, money supply, vector autoregressionJEL classification numbers: E51, E52, E58

  9. 59 eyes with endogenous endophthalmitis

    DEFF Research Database (Denmark)

    Bjerrum, Søren Solborg; la Cour, Morten


    BACKGROUND: To study the epidemiology of patients with endogenous endophthalmitis in Denmark. MATERIAL AND METHODS: Retrospective and prospective case series of 59 eyes in patients with endogenous endophthalmitis in Denmark between 2000 and 2016. RESULTS: The age of the patients ranged from 28 to......, the visual outcome and the mortality of the patients. The epidemiology of the disease is very different in Scandinavia compared to Asia. The visual prognosis remains grave and the majority of the eyes lose useful vision....

  10. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.


    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  11. Further comparisons of endogenous pyrogens and leukocytic endogenous mediators. (United States)

    Kampschmidt, R F; Upchurch, H F; Worthington, M L


    It was recently shown (Murphy et al., Infect. Immun. 34:177-183), that rabbit macrophages produce two biochemically and immunologically distinct endogenous pyrogens. One of these has or copurifies with substances having a molecular weight of 13,000 and a pI of 7.3. This protein was produced by blood monocytes or inflammatory cells elicited in 16-h rabbit peritoneal exudates. These acute peritoneal exudates were produced by the intraperitoneal injection of large volumes of saline containing shellfish glycogen. When the leukocytes in these exudates were washed and incubated at 37 degrees C in saline, they released an endogenous pyrogen. The injection of this pyrogen into rabbits, rats, or mice caused the biological manifestations which have been attributed to leukocytic endogenous mediator. These effects were increases in blood neutrophils, the lowering of plasma iron and zinc levels, and the increased synthesis of the acute-phase proteins. The other rabbit endogenous pyrogen seems to be a family of proteins with isoelectric points between 4.5 and 5.0. These proteins are produced by macrophages in the lung, liver, or in chronic peritoneal exudates. In these experiments, the lower-isoelectric-point endogenous pyrogens were produced by macrophages from the peritoneal cavity of rabbits that had been injected 4 days earlier with 50 ml of light mineral oil. These rabbit pyrogens were found to have leukocytic endogenous mediator activity in mice but to be completely inactive in rats. When injected into rabbits, these proteins produced fever, lowered plasma iron, increased blood neutrophils, but failed to elevate plasma fibrinogen.

  12. Mobilization of endogenous retroviruses in mice after infection with an exogenous retrovirus. (United States)

    Evans, Leonard H; Alamgir, A S M; Owens, Nick; Weber, Nick; Virtaneva, Kimmo; Barbian, Kent; Babar, Amenah; Malik, Frank; Rosenke, Kyle


    Mammalian genomes harbor a large number of retroviral elements acquired as germ line insertions during evolution. Although many of the endogenous retroviruses are defective, several contain one or more intact viral genes that are expressed under certain physiological or pathological conditions. This is true of the endogenous polytropic retroviruses that generate recombinant polytropic murine leukemia viruses (MuLVs). In these recombinants the env gene sequences of exogenous ecotropic MuLVs are replaced with env gene sequences from an endogenous polytropic retrovirus. Although replication-competent endogenous polytropic retroviruses have not been observed, the recombinant polytropic viruses are capable of replicating in numerous species. Recombination occurs during reverse transcription of a virion RNA heterodimer comprised of an RNA transcript from an endogenous polytropic virus and an RNA transcript from an exogenous ecotropic MuLV RNA. It is possible that homodimers corresponding to two full-length endogenous RNA genomes are also packaged. Thus, infection by an exogenous virus may result not only in recombination with endogenous sequences, but also in the mobilization of complete endogenous retrovirus genomes via pseudotyping within exogenous retroviral virions. We report that the infection of mice with an ecotropic virus results in pseudotyping of intact endogenous viruses that have not undergone recombination. The endogenous retroviruses infect and are integrated into target cell genomes and subsequently replicate and spread as pseudotyped viruses. The mobilization of endogenous retroviruses upon infection with an exogenous retrovirus may represent a major interaction of exogenous retroviruses with endogenous retroviruses and may have profound effects on the pathogenicity of retroviral infections.

  13. Monopoly Insurance and Endogenous Information

    DEFF Research Database (Denmark)

    Lagerlöf, Johan N. M.; Schottmüller, Christoph


    We study a monopoly insurance model with endogenous information acquisi- tion. Through a continuous effort choice, consumers can determine the precision of a privately observed signal that is informative about their accident risk. The equilibrium effort is, depending on parameter values, either...

  14. Endogeneously arising network allocation rules

    NARCIS (Netherlands)

    Slikker, M.


    In this paper we study endogenously arising network allocation rules. We focus on three allocation rules: the Myerson value, the position value and the component-wise egalitarian solution. For any of these three rules we provide a characterization based on component efficiency and some balanced

  15. Endogenizing Prospect Theory's Reference Point


    Ulrich Schmidt; Horst Zank


    In previous models of (cumulative) prospect theory reference-dependence of preferences is imposed beforehand and the location of the reference point is exogenously determined. This note provides a foundation of prospect theory, where reference-dependence is derived from preference conditions and a unique reference point arises endogenously.

  16. Glucocorticoid-related bone changes from endogenous or exogenous glucocorticoids. (United States)

    Warriner, Amy H; Saag, Kenneth G


    Glucocorticoids have a negative impact on bone through direct effects on bone cells and indirect effects on calcium absorption. Here, recent findings regarding glucocorticoid-induced osteoporosis, bone changes in patients with endogenous glucocorticoid derangements, and treatment of steroid-induced bone disease are reviewed. Although the majority of our understanding arises from the outcomes of patients treated with exogenous steroids, endogenous overproduction appears to be similarly destructive to bone, but these effects are reversible with cure of the underlying disease process. Additionally, there are bone changes that occur in diseases that interrupt adrenal glucocorticoid production, both in response to our inability to perfectly match glucocorticoid replacement and also related to the underlying disease process. More investigation is required to understand which patients with endogenous overproduction or underproduction of glucocorticoid would benefit from osteoporosis treatment. Better understood is the benefit that can be achieved with currently approved treatments for glucocorticoid-induced osteoporosis from exogenous steroids. With growing concern of long-term use of bisphosphonates, however, further investigation into the duration of use and use in certain populations, such as children and premenopausal women, is essential. Glucocorticoid-induced osteoporosis is a complex disease that is becoming better understood through advances in the study of exogenous and endogenous glucocorticoid exposure. Further advancement of proper treatment and prevention is on the horizon.

  17. Endogenous opiates and behavior: 2014. (United States)

    Bodnar, Richard J


    This paper is the thirty-seventh consecutive installment of the annual review of research concerning the endogenous opioid system. It summarizes papers published during 2014 that studied the behavioral effects of molecular, pharmacological and genetic manipulation of opioid peptides, opioid receptors, opioid agonists and opioid antagonists. The particular topics that continue to be covered include the molecular-biochemical effects and neurochemical localization studies of endogenous opioids and their receptors related to behavior (endogenous opioids and receptors), and the roles of these opioid peptides and receptors in pain and analgesia (pain and analgesia); stress and social status (human studies); tolerance and dependence (opioid mediation of other analgesic responses); learning and memory (stress and social status); eating and drinking (stress-induced analgesia); alcohol and drugs of abuse (emotional responses in opioid-mediated behaviors); sexual activity and hormones, pregnancy, development and endocrinology (opioid involvement in stress response regulation); mental illness and mood (tolerance and dependence); seizures and neurologic disorders (learning and memory); electrical-related activity and neurophysiology (opiates and conditioned place preferences (CPP)); general activity and locomotion (eating and drinking); gastrointestinal, renal and hepatic functions (alcohol and drugs of abuse); cardiovascular responses (opiates and ethanol); respiration and thermoregulation (opiates and THC); and immunological responses (opiates and stimulants). This paper is the thirty-seventh consecutive installment of the annual review of research concerning the endogenous opioid system. It summarizes papers published during 2014 that studied the behavioral effects of molecular, pharmacological and genetic manipulation of opioid peptides, opioid receptors, opioid agonists and opioid antagonists. The particular topics that continue to be covered include the molecular

  18. Endogenous scheduling preferences and congestion

    DEFF Research Database (Denmark)

    Fosgerau, Mogens; Small, Kenneth


    We consider the timing of activities through a dynamic model of commuting with congestion, in which workers care solely about leisure and consumption. Implicit preferences for the timing of the commute form endogenously due to temporal agglomeration economies. Equilibrium exists uniquely and is i......We consider the timing of activities through a dynamic model of commuting with congestion, in which workers care solely about leisure and consumption. Implicit preferences for the timing of the commute form endogenously due to temporal agglomeration economies. Equilibrium exists uniquely...... and is indistinguishable from that of a generalized version of the classical Vickrey bottleneck model, based on exogenous trip-timing preferences, but optimal policies differ: the Vickrey model will misstate the benefits of a capacity increase, it will underpredict the benefits of congestion pricing, and pricing may make...

  19. Exogenic and endogenic Europa minerals (United States)

    Maynard-Casely, H. E.; Brand, H. E. A.; Wilson, S. A.


    The Galileo Near Infrared Mapping Spectrometer (NIMS) identified a significant `non-ice' component upon the surface of Jupiter's moon Europa. Current explanations invoke both endogenic and exogenic origins for this material. It has long been suggested that magnesium and sodium sulfate minerals could have leached from the rock below a putative ocean (endogenic) 1 and that sulfuric acid hydrate minerals could have been radiologically produced from ionised sulfur originally from Io's volcanoes (exogenic) 2. However, a more recent theory proposes that the `non-ice' component could be radiation damaged NaCl leached from Europa's speculative ocean 3. What if the minerals are actually from combination of both endogenic and exogenic sources? To investigate this possibility we have focused on discovering new minerals that might form in the combination of the latter two cases, that is a mixture of leached sulfates hydrates with radiologically produced sulfuric acid. To this end we have explored a number of solutions in the MgSO4-H2SO4-H2O and Na2SO4-H2SO4-H2O systems, between 80 and 280 K with synchrotron x-ray powder diffraction. We report a number of new materials formed in this these ternary systems. This suggests that it should be considered that the `non-ice' component of the Europa's surface could be a material derived from endogenic and exogenic components. 1 Kargel, J. S. Brine volcanism and the interior structures of asteroids and icy satellites. Icarus 94, 368-390 (1991). 2 Carlson, R. W., Anderson, M. S., Mehlman, R. & Johnson, R. E. Distribution of hydrate on Europa: Further evidence for sulfuric acid hydrate. Icarus 177, 461-471, doi:10.1016/j.icarus.2005.03.026 (2005). 3 Hand, K. P. & Carlson, R. W. Europa's surface color suggests an ocean rich with sodium chloride. Geophysical Research Letters, 2015GL063559, doi:10.1002/2015gl063559 (2015).

  20. Money, banks and endogenous volatility


    Pere Gomis-Porqueras


    In this paper I consider a monetary growth model in which banks provide liquidity, and the government fixes a constant rate of money creation. There are two underlying assets in the economy, money and capital. Money is dominated in rate of return. In contrast to other papers with a larger set of government liabilities, I find a unique equilibrium when agents' risk aversion is moderate. However, indeterminacies and endogenous volatility can be observed when agents are relatively risk averse.





    The new endogenous growth theories are a very important research area for shaping the most effective policies and long term sustainable development strategies. Endogenous growth theory has emerged as a reaction to the imperfections of neoclassical theory, by the fact that the economic growth is the endogenous product of an economical system.

  2. On the origins of endogenous thoughts. (United States)

    Tillas, Alexandros


    Endogenous thoughts are thoughts that we activate in a top-down manner or in the absence of the appropriate stimuli. We use endogenous thoughts to plan or recall past events. In this sense, endogenous thinking is one of the hallmarks of our cognitive lives. In this paper, I investigate how it is that we come to possess endogenous control over our thoughts. Starting from the close relation between language and thinking, I look into speech production-a process motorically controlled by the inferior frontal gyrus (IFG). Interestingly, IFG is also closely related to silent talking, as well as volition. The connection between IFG and volition is important given that endogenous thoughts are or at least greatly resemble voluntary actions. Against this background, I argue that IFG is key to understanding the origins of conscious endogenous thoughts. Furthermore, I look into goal-directed thinking and show that IFG plays a key role also in unconscious endogenous thinking.

  3. Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis


    Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi


    Background Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. Methods In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking...

  4. Comparison of Inhibitory Effect of Curcumin Nanoparticles and Free Curcumin in Human Telomerase Reverse Transcriptase Gene Expression in Breast Cancer

    Directory of Open Access Journals (Sweden)

    Nosratollah Zarghami


    Full Text Available Purpose: Telomerase is expressed in most cancers, including breast cancer. Curcumin, a polyphenolic compound that obtained from the herb of Curcuma longa, has many anticancer effects. But, its effect is low due to poor water solubility. In order to improve its solubility and drug delivery, we have utilized a β-cyclodextrin-curcumin inclusion complex. Methods: To evaluate cytotoxic effects of cyclodextrin-curcumin and free curcumin, MTT assay was done. Cells were treated with equal concentration of cyclodextrin-curcumin and free curcumin. Telomerase gene expression level in two groups was compared by Real-time PCR. Results: MTT assay demonstrated that β-cyclodextrin-curcumin enhanced curcumin delivery in T47D breast cancer cells. The level of telomerase gene expression in cells treated with cyclodextrin-curcumin was lower than that of cells treated with free curcumin (P=0.001. Conclusion: Results are suggesting that cyclodextrin-curcumin complex can be more effective than free curcumin in inhibition of telomerase expression.

  5. Enhanced activity of carbosilane dendrimers against HIV when combined with reverse transcriptase inhibitor drugs: searching for more potent microbicides

    Directory of Open Access Journals (Sweden)

    Vacas-Córdoba E


    Full Text Available Enrique Vacas-Córdoba,1–3 Marta Galán,3,4 Francisco J de la Mata,3,4 Rafael Gómez,3,4 Marjorie Pion,1–3 M Ángeles Muñoz-Fernández1–3 1Laboratorio InmunoBiología Molecular, Hospital General Universitario Gregorio Marañón, Madrid, Spain; 2Instituto de Investigación Sanitaria del Gregorio Marañón, Madrid, Spain; 3Networking Research Center on Bioengineering, Biomaterials and Nanomedicine, (CIBER-BBN, Madrid, Spain; 4Dendrimers for Biomedical Applications Group (BioInDen, University of Alcalá, Madrid, Spain Abstract: Self-administered topical microbicides or oral preexposure prophylaxis could be very helpful tools for all risk groups to decrease the human immunodeficiency virus (HIV-1 infection rates. Up until now, antiretrovirals (ARVs have been the most advanced microbicide candidates. Nevertheless, the majority of clinical trials has failed in HIV-1 patients. Nanotechnology offers suitable approaches to develop novel antiviral agents. Thereby, new nanosystems, such as carbosilane dendrimers, have been shown to be safe and effective compounds against HIV with great potential as topical microbicides. In addition, because most of the attempts to develop effective topical microbicides were unsuccessful, combinatorial strategies could be a valid approach when designing new microbicides. We evaluated various combinations of anionic carbosilane dendrimers with sulfated (G3-S16 and naphthyl sulfonated (G2-NF16 ended groups with different ARVs against HIV-1 infection. The G3-S16 and G2-NF16 dendrimers showed a synergistic or additive activity profile with zidovudine, efavirenz, and tenofovir in the majority of the combinations tested against the X4 and R5 tropic HIV-1 in cell lines, as well as in human primary cells. Therefore, the combination of ARVs and polyanionic carbosilane dendrimers enhances the antiviral potency of the individual compounds, and our findings support further clinical research on combinational approaches as potential microbicides to block the sexual transmission of HIV-1. Keywords: microbicides, HIV, carbosilane dendrimer, antiretroviral, synergy

  6. Nelfinavir and Non-Nucleoside Reverse Transcriptase Inhibitor-Based Salvage Regimes in Heavily Hiv Pretreated Patients

    Directory of Open Access Journals (Sweden)

    Jean-Guy Baril


    Full Text Available OBJECTIVE: To assess the efficacy of nelfinavir mesylate (NFV in combination with delavirdine mesylate(DLV or efavirenz (EFV and other antiretroviral agents following virological failure on other protease inhibitor (PI-based regimens.

  7. Diagnosis of sentinel lymph nodal metastases in malignant melanoma. Usefulness of genetic diagnosis by reverse transcriptase-polymerase chain reaction

    International Nuclear Information System (INIS)

    Isoda, Hideka; Mori, Tomoko; Nishio, Daisuke; Tokura, Yoshiki; Yasuda, Hiroshi


    Sentinel lymph node (SLN) biopsy has been performed in 25 patients with malignant melanoma for the last four years at the Department of Dermatology, University of Occupational and Environmental Health. SLNs were identified by using both patent blue dye and redionucleotide-labeled colloid methods. The removed SLNs were subjected to routine haematoxylin-eosin staining and immunohistochemical stainings for Melan-A, S-100 protein and HMB45, and 10 of 25 cases had positive SLN metastases. In 8 cases, mRNA for malignant melanoma related molecules, gp100, MART-1 and tyrosinase, was analyzed by RT-PCR, and 7 of 8 cases gave agreement with the histopathological results. One case had negative SLN metastasis on histopathological examination but exhibited amplification of mRNA for the melanoma-related molecules on RT-PCR analysis. (author)

  8. Reverse-Transcriptase PCR Detection of Leptospira: Absence of Agreement with Single-Specimen Microscopic Agglutination Testing. (United States)

    Waggoner, Jesse J; Balassiano, Ilana; Mohamed-Hadley, Alisha; Vital-Brazil, Juliana Magalhães; Sahoo, Malaya K; Pinsky, Benjamin A


    Reference diagnostic tests for leptospirosis include nucleic acid amplification tests, bacterial culture, and microscopic agglutination testing (MAT) of acute and convalescent serum. However, clinical laboratories often do not receive paired specimens. In the current study, we tested serum samples using a highly sensitive real-time nucleic acid amplification test for Leptospira and compared results to MAT performed on the same specimens. 478 serum samples from suspected leptospirosis cases in Rio de Janeiro were tested using a real-time RT-PCR for the diagnosis of leptospirosis, malaria and dengue (the Lepto-MD assay). The Lepto-MD assay detects all species of Leptospira (saprophytic, intermediate, and pathogenic), and in the current study, we demonstrate that this assay amplifies both Leptospira RNA and DNA. Dengue virus RNA was identified in 10 patients, and no cases of malaria were detected. A total of 65 samples (13.6%) were positive for Leptospira: 35 samples (7.3%) in the Lepto-MD assay, 33 samples (6.9%) by MAT, and 3 samples tested positive by both (kappa statistic 0.02). Poor agreement between methods was consistent regardless of the titer used to define positive MAT results or the day of disease at sample collection. Leptospira nucleic acids were detected in the Lepto-MD assay as late as day 22, and cycle threshold values did not differ based on the day of disease. When Lepto-MD assay results were added to the MAT results for all patients in 2008 (n=818), the number of detected leptospirosis cases increased by 30.4%, from 102 (12.5%) to 133 (16.3%). This study demonstrates a lack of agreement between nucleic acid detection of Leptospira and single-specimen MAT, which may result from the clearance of bacteremia coinciding with the appearance of agglutinating antibodies. A combined testing strategy for acute leptospirosis, including molecular and serologic testing, appears necessary to maximize case detection.

  9. Comparison of Inhibitory Effect of Curcumin Nanoparticles and Free Curcumin in Human Telomerase Reverse Transcriptase Gene Expression in Breast Cancer


    Nosratollah Zarghami; Abbas Rami; Fatemeh Kazemi-Lomedasht


    Purpose: Telomerase is expressed in most cancers, including breast cancer. Curcumin, a polyphenolic compound that obtained from the herb of Curcuma longa, has many anticancer effects. But, its effect is low due to poor water solubility. In order to improve its solubility and drug delivery, we have utilized a β-cyclodextrin-curcumin inclusion complex. Methods: To evaluate cytotoxic effects of cyclodextrin-curcumin and free curcumin, MTT assay was done. Cells were treated with equal concentrati...

  10. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy

    DEFF Research Database (Denmark)

    Bruyand, Mathias; Ryom, Lene; Shepherd, Leah


    -AIDS-defining cancers (NADC), AIDS-defining cancers (ADC), and the most frequently occurring ADC (Kaposi sarcoma, non-Hodgkin lymphoma) and NADC (lung, invasive anal, head/neck cancers, and Hodgkin lymphoma). RESULTS: A total of 41,762 persons contributed 241,556 person-years (PY). A total of 1832 cancers were...

  11. Taking aim at a moving target: designing drugs to inhibit drug-resistant HIV-1 reverse transcriptases. (United States)

    Sarafianos, Stefan G; Das, Kalyan; Hughes, Stephen H; Arnold, Eddy


    HIV undergoes rapid genetic variation; this variation is caused primarily by the enormous number of viruses produced daily in an infected individual. Because of this variation, HIV presents a moving target for drug and vaccine development. The variation within individuals has led to the generation of diverse HIV-1 subtypes, which further complicates the development of effective drugs and vaccines. In general, it is more difficult to hit a moving target than a stationary target. Two broad strategies for hitting a moving target (in this case, HIV replication) are to understand the movement and to aim at the portions that move the least. In the case of anti-HIV drug development, the first option can be addressed by understanding the mechanism(s) of drug resistance and developing drugs that effectively inhibit mutant viruses. The second can be addressed by designing drugs that interact with portions of the viral machinery that are evolutionarily conserved, such as enzyme active sites.

  12. Compounds acting against HIV: Imidazo[1,2-a]pyridines as non-nucleoside reverse transcriptase inhibitors (NNRTIs)

    CSIR Research Space (South Africa)

    Bode, M


    Full Text Available .6 µM N N NH Cl Res Act = 3% IC50 = 2 µM MAGI IC50 = 0.2 µM N N NH Cl Res Act = 5% IC50 = 3.5 µM MAGI IC50 = 0.18 µM N N NH Cl Res Act = 13% IC50 = 8 µM MAGI IC50 = 0.6 µM N N NH Cl Cl Res Act = 4% IC50 = 1.5 µM MAGI IC50... 2010 N N NH N N NH Cl N N NH Cl CN IC50= 4.4 uM (RT) IC50= 0.16 uM (PBMC) IC50= 0.41 uM (MAGI) cf . Nevirapine IC50=0.67 uM (RT) IC50=0.033 uM (PBMC) IC50= 29 uM (RT) IC50= 41 uM (PBMC) cf...

  13. Imidazo[1,2-a]pyridin-3-amines as potential HIV-1 non-nucleoside reverse transcriptase inhibitors

    CSIR Research Space (South Africa)

    Bode, ML


    Full Text Available ? Discovery Studio 2.5.5). The crystal structures of both the wild-type and K103N mutant forms of HIV-1 RT containing the diarylpyrimidine inhibitor rilpivirine (TMC-278) were used (pdb codes MEE and 3MEG, respectively).27 Etravirine (TMC-125... These drugs act by binding to a lipophilic, non-substrate binding pocket located about 10? from the substrate binding site. Binding induces conformational changes in the catalytic site, slowing catalytic activity markedly.3 About fifty structurally diverse...

  14. ONIOM DFT/PM3 calculations on the interaction between dapivirine and HIV-1 reverse transcriptase, a theoretical study. (United States)

    Liang, Y H; Chen, F E


    Theoretical investigations of the interaction between dapivirine and the HIV-1 RT binding site have been performed by the ONIOM2 (B3LYP/6-31G (d,p): PM3) and B3LYP/6-31G (d,p) methods. The results derived from this study indicate that this inhibitor dapivirine forms two hydrogen bonds with Lys101 and exhibits strong π-π stacking or H…π interaction with Tyr181 and Tyr188. These interactions play a vital role in stabilizing the NNIBP/dapivirine complex. Additionally, the predicted binding energy of the BBF optimized structure for this complex system is -18.20 kcal/mol.

  15. A multiplexed reverse transcriptase PCR assay for identification of viral respiratory pathogens at point-of-care

    Energy Technology Data Exchange (ETDEWEB)

    Letant, S E; .Ortiz, J I; Tammero, L; Birch, J M; Derlet, R W; Cohen, S; Manning, D; McBride, M T


    We have developed a nucleic acid-based assay that is rapid, sensitive, specific, and can be used for the simultaneous detection of 5 common human respiratory pathogens including influenza A, influenza B, parainfluenza type 1 and 3, respiratory syncytial virus, and adenovirus group B, C, and E. Typically, diagnosis on an un-extracted clinical sample can be provided in less than 3 hours, including sample collection, preparation, and processing, as well as data analysis. Such a multiplexed panel would enable rapid broad-spectrum pathogen testing on nasal swabs, and therefore allow implementation of infection control measures, and timely administration of antiviral therapies. This article presents a summary of the assay performance in terms of sensitivity and specificity. Limits of detection are provided for each targeted respiratory pathogen, and result comparisons are performed on clinical samples, our goal being to compare the sensitivity and specificity of the multiplexed assay to the combination of immunofluorescence and shell vial culture currently implemented at the UCDMC hospital. Overall, the use of the multiplexed RT-PCR assay reduced the rate of false negatives by 4% and reduced the rate of false positives by up to 10%. The assay correctly identified 99.3% of the clinical negatives, 97% of adenovirus, 95% of RSV, 92% of influenza B, and 77% of influenza A without any extraction performed on the clinical samples. The data also showed that extraction will be needed for parainfluenza virus, which was only identified correctly 24% of the time on un-extracted samples.

  16. Decrease of vitamin D concentration in patients with HIV infection on a non nucleoside reverse transcriptase inhibitor-containing regimen

    Directory of Open Access Journals (Sweden)

    Colebunders Robert


    Full Text Available Abstract Background Vitamin D is an important determinant of bone health and also plays a major role in the regulation of the immune system. Interestingly, vitamin D status before the start of highly active antiretroviral therapy (HAART has been recently associated with HIV disease progression and overall mortality in HIV-positive pregnant women. We prospectively studied vitamin D status in HIV individuals on HAART in Belgium. We selected samples from HIV-positive adults starting HAART with a pre-HAART CD4 T-cell count >100 cells/mm3 followed up for at least 12 months without a treatment change. We compared 25-hydroxyvitamin D plasma [25-(OHD] concentration in paired samples before and after 12 months of HAART. 25-(OHD levels are presented using two different cut-offs: Results Vitamin D deficiency was common before HAART, the frequency of plasma 25-(OHD concentrations below 20 ng/ml and 30 below ng/ml was 43.7% and 70.1% respectively. After 12 months on HAART, the frequency increased to 47.1% and 81.6%. HAART for 12 months was associated with a significant decrease of plasma 25-(OHD concentration (p = 0.001. Decreasing plasma 25-(OHD concentration on HAART was associated in the multivariate model with NNRTI-based regimen (p = 0.001 and lower body weight (p = 0.008. Plasma 25-(OHD concentrations decreased significantly in both nevirapine and efavirenz-containing regimens but not in PI-treated patients. Conclusions Vitamin D deficiency is frequent in HIV-positive individuals and NNRTI therapy further decreases 25-(OHD concentrations. Consequently, vitamin D status need to be checked regularly in all HIV-infected patients and vitamin D supplementation should be given when needed.

  17. Development of a quantitative competitive reverse transcriptase polymerase chain reaction for the quantification of growth hormone gene expression in pigs

    Directory of Open Access Journals (Sweden)

    Maurício Machaim Franco


    Full Text Available After the advent of the genome projects, followed by the discovery of DNA polymorphisms, basic understanding of gene expression is the next focus to explain the association between polymorphisms and the level of gene expression, as well as to demonstrate the interaction among genes. Among the various techniques for the investigation of transcriptional profiling involving patterns of gene expression, quantitative PCR is the simplest analytical laboratory technique. The objective of this work was to analyze two strategies of a competitive PCR technique for the quantification of the pig growth hormone (GH gene expression. A pair of primers was designed targeting exons 3 and 5, and two competitive PCR strategies were performed, one utilizing a specific amplicon as a competitor, and the other utilizing a low-stringency PCR amplicon as a competitor. The latter strategy proved to be easier and more efficient, offering an accessible tool that can be used in any kind of competitive reaction, facilitating the study of gene expression patterns for both genetics and diagnostics of infectious diseases.

  18. Indolylarylsulfones as HIV-1 non-nucleoside reverse transcriptase inhibitors: new cyclic substituents at indole-2-carboxamide. (United States)

    La Regina, Giuseppe; Coluccia, Antonio; Brancale, Andrea; Piscitelli, Francesco; Gatti, Valerio; Maga, Giovanni; Samuele, Alberta; Pannecouque, Christophe; Schols, Dominique; Balzarini, Jan; Novellino, Ettore; Silvestri, Romano


    New indolylarylsulfone derivatives bearing cyclic substituents at indole-2-carboxamide linked through a methylene/ethylene spacer were potent inhibitors of the WT HIV-1 replication in CEM and PBMC cells with inhibitory concentrations in the low nanomolar range. Against the mutant L100I and K103N RT HIV-1 strains in MT-4 cells, compounds 20, 24-26, 36, and 40 showed antiviral potency superior to that of NVP and EFV. Against these mutant strains, derivatives 20, 24-26, and 40 were equipotent to ETV. Molecular docking experiments on this novel series of IAS analogues have also suggested that the H-bond interaction between the nitrogen atom in the carboxamide chain of IAS and Glu138:B is important in the binding of these compounds. These results are in accordance with the experimental data obtained on the WT and on the mutant HIV-1 strains tested.

  19. The G-Patch Domain of Mason-Pfizer Monkey Virus Is a Part of Reverse Transcriptase

    Czech Academy of Sciences Publication Activity Database

    Křížová, Ivana; Hadravová, Romana; Štokrová, Jitka; Günterová, Jana; Doležal, Michal; Ruml, T.; Rumlová, Michaela; Pichová, Iva


    Roč. 68, č. 4 (2012), s. 1988-1998 ISSN 0022-538X R&D Projects: GA MŠk 1M0508; GA ČR GA204/09/1388 Grant - others:GA MŠk(CZ) ME 904 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA repair enzyme * retroviral protease * Toxoplasma gondii * leukemia-virus * containing RNA Subject RIV: CE - Biochemistry Impact factor: 5.076, year: 2012

  20. Design and synthesis of N₁-aryl-benzimidazoles 2-substituted as novel HIV-1 non-nucleoside reverse transcriptase inhibitors. (United States)

    Monforte, Anna-Maria; Ferro, Stefania; De Luca, Laura; Lo Surdo, Giuseppa; Morreale, Francesca; Pannecouque, Christophe; Balzarini, Jan; Chimirri, Alba


    A series of novel N1-aryl-2-arylthioacetamido-benzimidazoles were synthesized and evaluated as inhibitors of human immunodeficiency virus type-1 (HIV-1). Some of them proved to be effective in inhibiting HIV-1 replication at submicromolar and nanomolar concentration acting as HIV-1 non-nucleoside RT inhibitors (NNRTIs), with low cytotoxicity. The preliminary structure-activity relationship (SAR) of these new derivatives was discussed and rationalized by docking studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Detection and serotyping of dengue virus in serum samples by multiplex reverse transcriptase PCR-ligase detection reaction assay. (United States)

    Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M


    The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.

  2. The safety and pharmacokinetics of a reverse transcriptase inhibitor, 3TC, in patients with HIV infection: a phase I study

    NARCIS (Netherlands)

    van Leeuwen, R.; Lange, J. M.; Hussey, E. K.; Donn, K. H.; Hall, S. T.; Harker, A. J.; Jonker, P.; Danner, S. A.


    To determine the safety and pharmacokinetics of the nucleoside analogue, 3TC. A Phase I, open-label, single-centre study. Twenty asymptomatic, HIV-infected male patients with CD4 lymphocyte counts < 500 x 10(6)/l who had not received previous antiretroviral therapy completed the study. Each patient

  3. Endogenous scheduling preferences and congestion

    DEFF Research Database (Denmark)

    Fosgerau, Mogens; Small, Kenneth


    and leisure, but agglomeration economies at home and at work lead to scheduling preferences forming endogenously. Using bottleneck congestion technology, we obtain an equilibrium queuing pattern consistent with a general version of the Vickrey bottleneck model. However, the policy implications are different....... Compared to the predictions of an analyst observing untolled equilibrium and taking scheduling preferences as exogenous, we find that both the optimal capacity and the marginal external cost of congestion have changed. The benefits of tolling are greater, and the optimal time varying toll is different....

  4. Endogenous money, circuits and financialization


    Malcolm Sawyer


    This paper locates the endogenous money approach in a circuitist framework. It argues for the significance of the credit creation process for the evolution of the economy and the absence of any notion of ‘neutrality of money’. Clearing banks are distinguished from other financial institutions as the providers of initial finance in a circuit whereas other financial institutions operate in a final finance circuit. Financialization is here viewed in terms of the growth of financial assets an...

  5. Reversible Statistics

    DEFF Research Database (Denmark)

    Tryggestad, Kjell


    The study aims is to describe how the inclusion and exclusion of materials and calculative devices construct the boundaries and distinctions between statistical facts and artifacts in economics. My methodological approach is inspired by John Graunt's (1667) Political arithmetic and more recent work...... within constructivism and the field of Science and Technology Studies (STS). The result of this approach is here termed reversible statistics, reconstructing the findings of a statistical study within economics in three different ways. It is argued that all three accounts are quite normal, albeit...... in different ways. The presence and absence of diverse materials, both natural and political, is what distinguishes them from each other. Arguments are presented for a more symmetric relation between the scientific statistical text and the reader. I will argue that a more symmetric relation can be achieved...

  6. Human-Specific Endogenous Retroviruses

    Directory of Open Access Journals (Sweden)

    Anton Buzdin


    Full Text Available This review focuses on a small family of human-specific genomic repetitive elements, presented by 134 members that shaped ~330 kb of the human DNA. Although modest in terms of its copy number, this group appeared to modify the human genome activity by endogenizing ~50 functional copies of viral genes that may have important implications in the immune response, cancer progression, and antiretroviral host defense. A total of 134 potential promoters and enhancers have been added to the human DNA, about 50% of them in the close gene vicinity and 22% in gene introns. For 60 such human-specific promoters, their activity was confirmed by in vivo assays, with the transcriptional level varying ~1000-fold from hardly detectable to as high as ~3% of β-actin transcript level. New polyadenylation signals have been provided to four human RNAs, and a number of potential antisense regulators of known human genes appeared due to human-specific retroviral insertional activity. This information is given here in the context of other major genomic changes underlining differences between human and chimpanzee DNAs. Finally, a comprehensive database, is available for download, of human-specific and polymorphic endogenous retroviruses is presented, which encompasses the data on their genomic localization, primary structure, encoded viral genes, human gene neighborhood, transcriptional activity, and methylation status.

  7. Endogenous Opiates and Behavior: 2006 (United States)

    Bodnar, Richard J.


    This paper is the twenty-ninth consecutive installment of the annual review of research concerning the endogenous opioid system, now spanning thirty years of research. It summarizes papers published during 2006 that studied the behavioral effects of molecular, pharmacological and genetic manipulation of opioid peptides, opioid receptors, opioid agonists and opioid antagonists. The particular topics that continue to be covered include the molecular-biochemical effects and neurochemical localization studies of endogenous opioids and their receptors related to behavior (Section 2), and the roles of these opioid peptides and receptors in pain and analgesia (Section 3); stress and social status (Section 4); tolerance and dependence (Section 5); learning and memory (Section 6); eating and drinking (Section 7); alcohol and drugs of abuse (Section 8); sexual activity and hormones, pregnancy, development and endocrinology (Section 9); mental illness and mood (Section 10); seizures and neurological disorders (Section 11); electrical-related activity and neurophysiology (Section 12); general activity and locomotion (Section 13); gastrointestinal, renal and hepatic functions (Section 14); cardiovascular responses (Section 15); respiration and thermoregulation (Section 16); and immunological responses (Section 17). PMID:17949854

  8. Endogenous opiates and behavior: 2012. (United States)

    Bodnar, Richard J


    This paper is the thirty-fifth consecutive installment of the annual review of research concerning the endogenous opioid system. It summarizes papers published during 2012 that studied the behavioral effects of molecular, pharmacological and genetic manipulation of opioid peptides, opioid receptors, opioid agonists and opioid antagonists. The particular topics that continue to be covered include the molecular-biochemical effects and neurochemical localization studies of endogenous opioids and their receptors related to behavior (Section 2), and the roles of these opioid peptides and receptors in pain and analgesia (Section 3); stress and social status (Section 4); tolerance and dependence (Section 5); learning and memory (Section 6); eating and drinking (Section 7); alcohol and drugs of abuse (Section 8); sexual activity and hormones, pregnancy, development and endocrinology (Section 9); mental illness and mood (Section 10); seizures and neurologic disorders (Section 11); electrical-related activity and neurophysiology (Section 12); general activity and locomotion (Section 13); gastrointestinal, renal and hepatic functions (Section 14); cardiovascular responses (Section 15); respiration and thermoregulation (Section 16); and immunological responses (Section 17). Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Endogenous Receptor Agonists: Resolving Inflammation

    Directory of Open Access Journals (Sweden)

    Gerhard Bannenberg


    Full Text Available Controlled resolution or the physiologic resolution of a well-orchestrated inflammatory response at the tissue level is essential to return to homeostasis. A comprehensive understanding of the cellular and molecular events that control the termination of acute inflammation is needed in molecular terms given the widely held view that aberrant inflammation underlies many common diseases. This review focuses on recent advances in the understanding of the role of arachidonic acid and ω-3 polyunsaturated fatty acids (PUFA–derived lipid mediators in regulating the resolution of inflammation. Using a functional lipidomic approach employing LC-MS-MS–based informatics, recent studies, reviewed herein, uncovered new families of local-acting chemical mediators actively biosynthesized during the resolution phase from the essential fatty acids eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA. These new families of local chemical mediators are generated endogenously in exudates collected during the resolution phase, and were coined resolvins and protectins because specific members of these novel chemical families control both the duration and magnitude of inflammation in animal models of complex diseases. Recent advances on the biosynthesis, receptors, and actions of these novel anti-inflammatory and proresolving lipid mediators are reviewed with the aim to bring to attention the important role of specific lipid mediators as endogenous agonists in inflammation resolution.

  10. Detection of hepatitis C virus RNA using reverse transcription PCR

    International Nuclear Information System (INIS)

    Yap, S.F.


    Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory

  11. Endogenous money: the evolutionary versus revolutionary views


    Louis-Philippe Rochon; Sergio Rossi


    The purpose of this paper is to shed light on the endogenous nature of money. Contrary to the established post-Keynesian, or evolutionary, view, this paper argues that money has always been endogenous, irrespective of the historical period. Instead of the evolutionary theory of money and banking that can be traced back to Chick (1986), this paper puts forward a revolutionary definition of endogenous money consistent with many aspects of post-Keynesian economics as well as with the monetary ci...

  12. Endogenous price flexibility and optimal monetary policy


    Ozge Senay; Alan Sutherland


    Much of the literature on optimal monetary policy uses models in which the degree of nominal price flexibility is exogenous. There are, however, good reasons to suppose that the degree of price flexibility adjusts endogenously to changes in monetary conditions. This article extends the standard new Keynesian model to incorporate an endogenous degree of price flexibility. The model shows that endogenizing the degree of price flexibility tends to shift optimal monetary policy towards complete i...

  13. Endogenous, Imperfectly Competitive Business Cycles

    DEFF Research Database (Denmark)

    Whitta-Jacobsen, Hans Jørgen

    We investigate how imperfect competition affects the occurrence and the properties of endogenous, rational expectations business cycles in an overlapping generations model with constant returns to scale in production. The model has explicit product and labor markets all characterized...... by monopolistic competition. An implicit assumption of barriers to entry justifies that the number of firms is fixed even when positive profits occur. It turns out that both market power of firms on the product markets and market power of unions on the labor markets make the occurrence of cycles more likely....... In particular, imperfect competition on the product markets and the positive profits associated with it may have the effect that there is a cycle even if the labor supply curve is increasing in the real-wage rate. For competitive cycles is required not only a decreasing labor supply curve, but a wage elasticity...

  14. Applying Endogenous Knowledge in the African Context ...

    African Journals Online (AJOL)

    The question presented in this article is how to improve the dispute resolution competence of practitioners in Africa. The response offered involves enhancing the endogenous knowledge of a dispute and how to resolve it. This requires not only an understanding of what endogenous knowledge is, but also an alignment of ...

  15. Endogenous Peer Effects: Fact or Fiction? (United States)

    Yeung, Ryan; Nguyen-Hoang, Phuong


    The authors examine endogenous peer effects, which occur when a student's behavior or outcome is a function of the behavior or outcome of his or her peer group. Endogenous peer effects have important implications for educational policies such as busing, school choice and tracking. In this study, the authors quantitatively review the literature on…

  16. Human endogenous retroviruses and ADHD. (United States)

    Balestrieri, Emanuela; Pitzianti, Mariabernarda; Matteucci, Claudia; D'Agati, Elisa; Sorrentino, Roberta; Baratta, Antonia; Caterina, Rosa; Zenobi, Rossella; Curatolo, Paolo; Garaci, Enrico; Sinibaldi-Vallebona, Paola; Pasini, Augusto


    Several lines of evidences suggest that human endogenous retroviruses (HERVs) are implicated in the development of many complex diseases with a multifactorial aetiology and a strong heritability, such as neurological and psychiatric diseases. Attention deficit hyperactivity Disorder (ADHD) is a neurodevelopmental disorder that results from a complex interaction of environmental, biological and genetic factors. Our aim was to analyse the expression levels of three HERV families (HERV-H, K and W) in patients with ADHD. The expression of retroviral mRNAs from the three HERV families was evaluated in peripheral blood mononuclear cells (PBMCs) from 30 patients with ADHD and 30 healthy controls by quantitative RT-PCR. The expression levels of HERV-H are significantly higher in patients with ADHD compared to healthy controls, while there are no differences in the expression levels of HERV-K and W. Since the ADHD aetiology is due to a complex interaction of environmental, biological and genetic factors, HERVs may represent one link among these factors and clinical phenotype of ADHD. A future confirmation of HERV-H overexpression in a larger number of ADHD patients will make possible to identify it as a new parameter for this clinical condition, also contributing to deepen the study on the role of HERVs in the neurodevelopment diseases.

  17. Gravity effects on endogenous movements (United States)

    Johnsson, Anders; Antonsen, Frank

    Gravity effects on endogenous movements A. Johnsson * and F. Antonsen *+ * Department of Physics, Norwegian University of Science and Technology,NO-7491, Trond-heim, Norway, E-mail: + Present address: Statoil Research Center Trondheim, NO-7005, Trondheim, Norway Circumnutations in stems/shoots exist in many plants and often consists of more or less regular helical movements around the plumb line under Earth conditions. Recent results on circumnu-tations of Arabidopsis in space (Johnsson et al. 2009) showed that minute amplitude oscilla-tions exist in weightlessness, but that centripetal acceleration (mimicking the gravity) amplified and/or created large amplitude oscillations. Fundamental mechanisms underlying these results will be discussed by modeling the plant tissue as a cylinder of cells coupled together. As a starting point we have modeled (Antonsen 1998) standing waves on a ring of biological cells, as first discussed in a classical paper (Turing 1952). If the coupled cells can change their water content, an `extension' wave could move around the ring. We have studied several, stacked rings of cells coupled into a cylinder that together represent a cylindrical plant tissue. Waves of extensions travelling around the cylinder could then represent the observable circumnutations. The coupling between cells can be due to cell-to-cell diffusion, or to transport via channels, and the coupling can be modeled to vary in both longitudinal and transversal direction of the cylinder. The results from ISS experiments indicate that this cylindrical model of coupled cells should be able to 1) show self-sustained oscillations without the impact of gravity (being en-dogenous) and 2) show how an environmental factor like gravity can amplify or generate the oscillatory movements. Gravity has been introduced in the model by a negative, time-delayed feed-back transport across the cylinder. This represents the physiological reactions to acceler

  18. Coexistencia de variantes HIV-1 com insercao dipeptidica no gene da transcriptase reversa

    Directory of Open Access Journals (Sweden)

    Aline Aki Tanikawa


    Full Text Available O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.

  19. Contagion risk in endogenous financial networks

    International Nuclear Information System (INIS)

    Li, Shouwei; Sui, Xin


    Highlights: • We propose an endogenous financial network model. • Endogenous networks include interbank networks, inter-firm networks and bank-firm networks. • We investigate contagion risk in endogenous financial networks. - Abstract: In this paper, we investigate contagion risk in an endogenous financial network, which is characterized by credit relationships connecting downstream and upstream firms, interbank credit relationships and credit relationships connecting firms and banks. The findings suggest that: increasing the number of potential lenders randomly selected can lead to an increase in the number of bank bankruptcies, while the number of firm bankruptcies presents a trend of increase after the decrease; after the intensity of choice parameter rises beyond a threshold, the number of bankruptcies in three sectors (downstream firms, upstream firms and banks) shows a relatively large margin of increase, and keeps at a relatively high level; there exists different trends for bankruptcies in different sectors with the change of the parameter of credits’ interest rates.

  20. Endogenous Money, Output and Prices in India


    Das, Rituparna


    This paper proposes to quantify the macroeconometric relationships among the variables broad money, lending by banks, price, and output in India using simultaneous equations system keeping in view the issue of endogeneity.

  1. Some observations about the endogenous money theory


    Bertocco Giancarlo


    The endogenous money theory constitutes the core element of the post-keynesian monetary theory. The first formulation of this theory can be found in the works of Kaldor published in the 1970s. Taking these studies as a starting point, the post-keynesians elaborated two versions of the endogenous money theory which differ in their assumptions about the behaviour of the monetary authorities and the banking system, and hence offer different conclusions about the slope of the money supply curve. ...

  2. Invasive fungal infections in endogenous Cushing's syndrome (United States)

    Scheffel, Rafael Selbach; Dora, José Miguel; Weinert, Letícia Schwerz; Aquino, Valério; Maia, Ana Luiza; Canani, Luis Henrique; Goldani, Luciano Z.


    Cushing's syndrome is a condition characterized by elevated cortisol levels that can result from either augmented endogenous production or exogenous administration of corticosteroids. The predisposition to fungal infections among patients with hypercortisolemia has been noted since Cushing's original description of the disease. We describe here a patient with endogenous Cushing's syndrome secondary to an adrenocortical carcinoma, who developed concomitant disseminated cryptococcosis and candidiasis in the course of his disease. PMID:24470886

  3. Endogenous Money Supply and Money Demand


    Woon Gyu Choi; Seonghwan Oh


    This paper explores the behavior of money demand by explicitly accounting for the money supply endogeneity arising from endogenous monetary policy and financial innovations. Our theoretical analysis indicates that money supply factors matter in the money demand function when the money supply partially responds to money demand. Our empirical results with U.S. data provide strong evidence for the relevance of the policy stance to the demand for MI under a regime in which monetary policy is subs...

  4. Managing Reverse Logistics or Reversing Logistics Management?


    Brito, Marisa


    textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse logistics. The thesis brings insights on reverse logistics decision-making and it lays down theoretical principles for reverse logistics as a research field.In particular it puts together a framework ...

  5. Ciliary neurotrophic factor is an endogenous pyrogen. (United States)

    Shapiro, L; Zhang, X X; Rupp, R G; Wolff, S M; Dinarello, C A


    Fever is initiated by the action of polypeptide cytokines called endogenous pyrogens, which are produced by the host during inflammation, trauma, or infection and which elevate the thermoregulatory set point in the hypothalamus. Ciliary neurotrophic factor (CNTF) supports the differentiation and survival of central and peripheral neurons. We describe the activity of CNTF as intrinsically pyrogenic in the rabbit. CNTF induced a monophasic fever which rose rapidly (within the first 12 min) following intravenous injection; CNTF fever was blocked by pretreatment with indomethacin. The fever induced by CNTF was not due to contaminating endotoxins. Increasing doses of CNTF resulted in prolongation of the fever, suggesting the subsequent induction of additional endogenous pyrogenic activity. After passive transfer of plasma obtained during CNTF-induced fever, endogenous pyrogen activity was not present in the circulation; CNTF also did not induce the endogenous pyrogens interleukin 1, tumor necrosis factor, or interleukin 6 in vitro. Nevertheless, a second endogenous pyrogen may originate within the central nervous system following the systemic injection of CNTF. Of the four endogenous pyrogens described to date (interleukin 1, tumor necrosis factor, interferon, and interleukin 6), CNTF, like interleukin 6, utilizes the cell-surface gp 130 signal-transduction apparatus.

  6. Endogenous opioid antagonism in physiological experimental pain models

    DEFF Research Database (Denmark)

    Werner, Mads U; Pereira, Manuel P; Andersen, Lars Peter H


    hyperalgesia models (6 studies), 'pain' models (25 studies), summation models (2 studies), nociceptive reflex models (3 studies) and miscellaneous models (2 studies). A consistent reversal of analgesia by a MOR-antagonist was demonstrated in 10 of the 25 ITP-studies, including stress-induced analgesia and r...... ratings, threshold assessments and somatosensory evoked potentials (SSEP), did not appear consistent in 28 out of 32 'pain' model studies. In conclusion, only in 2 experimental human pain models, i.e., stress-induced analgesia and rTMS, administration of MOR-antagonist demonstrated a consistent effect......Opioid antagonists are pharmacological tools applied as an indirect measure to detect activation of the endogenous opioid system (EOS) in experimental pain models. The objective of this systematic review was to examine the effect of mu-opioid-receptor (MOR) antagonists in placebo-controlled, double...

  7. Breastfeeding and the risk of childhood asthma: A two-stage instrumental variable analysis to address endogeneity. (United States)

    Sharma, Nivita D


    Several explanations for the inconsistent results on the effects of breastfeeding on childhood asthma have been suggested. The purpose of this study was to investigate one unexplored explanation, which is the presence of a potential endogenous relationship between breastfeeding and childhood asthma. Endogeneity exists when an explanatory variable is correlated with the error term for reasons such as selection bias, reverse causality, and unmeasured confounders. Unadjusted endogeneity will bias the effect of breastfeeding on childhood asthma. To investigate potential endogeneity, a cross-sectional study of breastfeeding practices and incidence of childhood asthma in 87 pediatric patients in Georgia, the USA, was conducted using generalized linear modeling and a two-stage instrumental variable analysis. First, the relationship between breastfeeding and childhood asthma was analyzed without considering endogeneity. Second, tests for presence of endogeneity were performed and having detected endogeneity between breastfeeding and childhood asthma, a two-stage instrumental variable analysis was performed. The first stage of this analysis estimated the duration of breastfeeding and the second-stage estimated the risk of childhood asthma. When endogeneity was not taken into account, duration of breastfeeding was found to significantly increase the risk of childhood asthma (relative risk ratio [RR]=2.020, 95% confidence interval [CI]: [1.143-3.570]). After adjusting for endogeneity, duration of breastfeeding significantly reduced the risk of childhood asthma (RR=0.003, 95% CI: [0.000-0.240]). The findings suggest that researchers should consider evaluating how the presence of endogeneity could affect the relationship between duration of breastfeeding and the risk of childhood asthma. © 2017 EAACI and John Wiley and Sons A/S. Published by John Wiley and Sons Ltd.

  8. Managing Reverse Logistics or Reversing Logistics Management?

    NARCIS (Netherlands)

    M.P. de Brito (Marisa)


    textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse

  9. Reversible Thermoset Adhesives (United States)

    Mac Murray, Benjamin C. (Inventor); Tong, Tat H. (Inventor); Hreha, Richard D. (Inventor)


    Embodiments of a reversible thermoset adhesive formed by incorporating thermally-reversible cross-linking units and a method for making the reversible thermoset adhesive are provided. One approach to formulating reversible thermoset adhesives includes incorporating dienes, such as furans, and dienophiles, such as maleimides, into a polymer network as reversible covalent cross-links using Diels Alder cross-link formation between the diene and dienophile. The chemical components may be selected based on their compatibility with adhesive chemistry as well as their ability to undergo controlled, reversible cross-linking chemistry.

  10. From reverse transcription to human brain tumors

    Directory of Open Access Journals (Sweden)

    Dmitrenko V. V.


    Full Text Available Reverse transcriptase from avian myeloblastosis virus (AMV was the subject of the study, from which the investi- gations of the Department of biosynthesis of nucleic acids were started. Production of AMV in grams quantities and isolation of AMV reverse transcriptase were established in the laboratory during the seventies of the past cen- tury and this initiated research on the cDNA synthesis, cloning and investigation of the structure and functions of the eukaryotic genes. Structures of salmon insulin and insulin-like growth factor (IGF family genes and their transcripts were determined during long-term investigations. Results of two modern techniques, microarray-ba- sed hybridization and SAGE, were used for the identification of the genes differentially expressed in astrocytic gliomas and human normal brain. Comparison of SAGE results on the genes overexpressed in glioblastoma with the results of microarray analysis revealed a limited number of common genes. 105 differentially expressed genes, common to both methods, can be included in the list of candidates for the molecular typing of glioblastoma. The first experiments on the classification of glioblastomas based on the data of the 20 genes expression were conducted by using of artificial neural network analysis. The results of these experiments showed that the expression profiles of these genes in 224 glioblastoma samples and 74 normal brain samples could be according to the Koho- nen’s maps. The CHI3L1 and CHI3L2 genes of chitinase-like cartilage protein were revealed among the most overexpressed genes in glioblastoma, which could have prognostic and diagnostic potential. Results of in vitro experiments demonstrated that both proteins, CHI3L1 and CHI3L2, may initiate the phosphorylation of ERK1/ ERK2 and AKT kinases leading to the activation of MAPK/ERK1/2 and PI3K/AKT signaling cascades in human embryonic kidney 293 cells, human glioblastoma U87MG, and U373 cells. The new human cell line

  11. Tubal Ligation Reversal (United States)

    ... seal off the fallopian tubes, such as the Essure or Adiana systems, generally aren't reversible. Why ... electrocautery). Some types of sterilization, such as the Essure or Adiana systems, aren't considered reversible. Risks ...

  12. Host-virus interactions of mammalian endogenous retroviruses


    Farkašová, Helena


    Endogenous retroviruses (ERVs) originate by germline infection and subsequent mendelian inheritance of their exogenous counterparts. With notable exceptions, all mammalian ERVs are evolutionarily old and fixed in the population of its host species. Some groups of retroviruses were believed not to be able to form endogenous copies. We discovered an additional endogenous Lentivirus and a first endogenous Deltaretrovirus. Both of these groups were previously considered unable to form endogenous ...

  13. [The endogenous opioid system and drug addiction]. (United States)

    Maldonado, R


    Drug addiction is a chronic brain disorder leading to complex adaptive changes within the brain reward circuits. Several neurotransmitters, including the endogenous opioid system are involved in these changes. The opioid system plays a pivotal role in different aspects of addiction. Thus, opioid receptors and endogenous opioid peptides are largely distributed in the mesolimbic system and modulate dopaminergic activity within the reward circuits. Opioid receptors and peptides are selectively involved in several components of the addictive processes induced by opioids, cannabinoids, psychostimulants, alcohol and nicotine. This review is focused on the contribution of each component of the endogenous opioid system in the addictive properties of the different drugs of abuse. Copyright 2010 Elsevier Masson SAS. All rights reserved.

  14. Endogenous vs. exogenous regulations in the commons

    DEFF Research Database (Denmark)

    Abatayo, Anna Lou; Lynham, John


    It is widely believed that there is strong experimental evidence to support the idea that exogenously imposed regulations crowd out the intrinsic motivations of common pool resource (CPR) users to refrain from over-harvesting. We introduce a novel experimental design that attempts to disentangle...... potential confounds in previous experiments. A key feature of our experimental design is to have the exact same regulations chosen endogenously as those that are imposed exogenously. When we compare the same regulations chosen endogenously to those externally imposed, we observe no differences in extraction...... endogenous regulations with communication and exogenous regulations without communication. Our results suggest that externally imposed regulations do not crowd out intrinsic motivations in the lab and they confirm that communication facilitates cooperation to reduce extraction....

  15. Reverse logistics - a framework

    NARCIS (Netherlands)

    M.P. de Brito (Marisa); R. Dekker (Rommert)


    textabstractIn this paper we define and compare Reverse Logistics definitions. We start by giving an understanding framework of Reverse Logistics: the why-what-how. By this means, we put in context the driving forces for Reverse Logistics, a typology of return reasons, a classification of

  16. Feeding Releases Endogenous Opioids in Humans. (United States)

    Tuulari, Jetro J; Tuominen, Lauri; de Boer, Femke E; Hirvonen, Jussi; Helin, Semi; Nuutila, Pirjo; Nummenmaa, Lauri


    The endogenous opioid system supports a multitude of functions related to appetitive behavior in humans and animals, and it has been proposed to govern hedonic aspects of feeding thus contributing to the development of obesity. Here we used positron emission tomography to investigate whether feeding results in hedonia-dependent endogenous opioid release in humans. Ten healthy males were recruited for the study. They were scanned with the μ-opioid-specific ligand [ 11 C]carfentanil three times, as follows: after a palatable meal, a nonpalatable meal, and after an overnight fast. Subjective mood, satiety, and circulating hormone levels were measured. Feeding induced significant endogenous opioid release throughout the brain. This response was more pronounced following a nonpalatable meal versus a palatable meal, and independent of the subjective hedonic responses to feeding. We conclude that feeding consistently triggers cerebral opioid release even in the absence of subjective pleasure associated with feeding, suggesting that metabolic and homeostatic rather than exclusively hedonic responses play a role in the feeding-triggered cerebral opioid release. SIGNIFICANCE STATEMENT The endogenous opioid system supports both hedonic and homeostatic functions. It has been proposed that overeating and concomitant opioid release could downregulate opioid receptors and promote the development of obesity. However, it remains unresolved whether feeding leads to endogenous opioid release in humans. We used in vivo positron emission tomography to test whether feeding triggers cerebral opioid release and whether this response is associated with pleasurable sensations. We scanned volunteers using the μ-opioid receptor-specific radioligand [ 11 C]carfentanil three times, as follows: after an overnight fast, after consuming a palatable meal, and after consuming a nonpalatable meal. Feeding led to significant endogenous opioid release, and this occurred also in the absence of feeding

  17. Endogenous network of firms and systemic risk (United States)

    Ma, Qianting; He, Jianmin; Li, Shouwei


    We construct an endogenous network characterized by commercial credit relationships connecting the upstream and downstream firms. Simulation results indicate that the endogenous network model displays a scale-free property which exists in real-world firm systems. In terms of the network structure, with the expansion of the scale of network nodes, the systemic risk increases significantly, while the heterogeneities of network nodes have no effect on systemic risk. As for firm micro-behaviors, including the selection range of trading partners, actual output, labor requirement, price of intermediate products and employee salaries, increase of all these parameters will lead to higher systemic risk.

  18. Endogenous Generalized Weights under DEA Control

    DEFF Research Database (Denmark)

    Agrell, Per J.; Bogetoft, Peter

    Non-parametric efficiency analysis, such as Data Envelopment Analysis (DEA) relies so far on endogenous local or exogenous general weights, based on revealed preferences or market prices. However, as DEA is gaining popularity in regulation and normative budgeting, the strategic interest...... of the evaluated industry calls for attention. We offer endogenous general prices based on a reformulation of DEA where the units collectively propose the set of weights that maximize their efficiency. Thus, the sector-wide efficiency is then a result of compromising the scores of more specialized smaller units...

  19. An endogenous model of the credit network (United States)

    He, Jianmin; Sui, Xin; Li, Shouwei


    In this paper, an endogenous credit network model of firm-bank agents is constructed. The model describes the endogenous formation of firm-firm, firm-bank and bank-bank credit relationships. By means of simulations, the model is capable of showing some obvious similarities with empirical evidence found by other scholars: the upper-tail of firm size distribution can be well fitted with a power-law; the bank size distribution can be lognormally distributed with a power-law tail; the bank in-degrees of the interbank credit network as well as the firm-bank credit network fall into two-power-law distributions.

  20. Animal spirits, competitive markets, and endogenous growth (United States)

    Miyazaki, Kenji


    This paper uses a simple model with an endogenous discount rate and linear technology to investigate whether a competitive equilibrium has a higher balanced growth path (BGP) than the social planning solution and whether the BGP is determinate or indeterminate. The implications are as follows. To start with, people with an instinct to compare themselves with others possess an endogenous discount rate. In turn, this instinct affects the economic growth rate in a competitive market economy. The competitive market economy also sometimes achieves higher economic growth than a social planning economy. However, the outcomes of market economy occasionally fluctuate because of the presence of the self-fulfilling prophecy or animal spirits.

  1. [Mechanisms of leukocyte formation of endogenous pyrogen]. (United States)

    Rybakina, E G; Sorokin, A V


    A study was made of the kinetics of endogenous pyrogen production by rabbit blood and exudate leukocytes and possible role played by the products of activated leukocytes in autoregulation of the process. It was established that accumulation of endogenous pyrogen in the cell precedes its release by stimulated cells. Then the processes of active pyrogen formation and release gel interdependent: pyrogen formed releases from the cell; the lowering of pyrogen concentration in the cell is accompanied by the decrease of its content in the medium. No stimulating effect of the products activated during leukocyte inflammation on pyrogen formation by blood leukocytes was discovered.

  2. Endogenous MOV10 inhibits the retrotransposition of endogenous retroelements but not the replication of exogenous retroviruses (United States)


    Background The identification of cellular factors that regulate the replication of exogenous viruses and endogenous mobile elements provides fundamental understanding of host-pathogen relationships. MOV10 is a superfamily 1 putative RNA helicase that controls the replication of several RNA viruses and whose homologs are necessary for the repression of endogenous mobile elements. Here, we employ both ectopic expression and gene knockdown approaches to analyse the role of human MOV10 in the replication of a panel of exogenous retroviruses and endogenous retroelements. Results MOV10 overexpression substantially decreased the production of infectious retrovirus particles, as well the propagation of LTR and non-LTR endogenous retroelements. Most significantly, RNAi-mediated silencing of endogenous MOV10 enhanced the replication of both LTR and non-LTR endogenous retroelements, but not the production of infectious retrovirus particles demonstrating that natural levels of MOV10 suppress retrotransposition, but have no impact on infection by exogenous retroviruses. Furthermore, functional studies showed that MOV10 is not necessary for miRNA or siRNA-mediated mRNA silencing. Conclusions We have identified novel specificity for human MOV10 in the control of retroelement replication and hypothesise that MOV10 may be a component of a cellular pathway or process that selectively regulates the replication of endogenous retroelements in somatic cells. PMID:22727223

  3. Endogenous MOV10 inhibits the retrotransposition of endogenous retroelements but not the replication of exogenous retroviruses. (United States)

    Arjan-Odedra, Shetal; Swanson, Chad M; Sherer, Nathan M; Wolinsky, Steven M; Malim, Michael H


    The identification of cellular factors that regulate the replication of exogenous viruses and endogenous mobile elements provides fundamental understanding of host-pathogen relationships. MOV10 is a superfamily 1 putative RNA helicase that controls the replication of several RNA viruses and whose homologs are necessary for the repression of endogenous mobile elements. Here, we employ both ectopic expression and gene knockdown approaches to analyse the role of human MOV10 in the replication of a panel of exogenous retroviruses and endogenous retroelements. MOV10 overexpression substantially decreased the production of infectious retrovirus particles, as well the propagation of LTR and non-LTR endogenous retroelements. Most significantly, RNAi-mediated silencing of endogenous MOV10 enhanced the replication of both LTR and non-LTR endogenous retroelements, but not the production of infectious retrovirus particles demonstrating that natural levels of MOV10 suppress retrotransposition, but have no impact on infection by exogenous retroviruses. Furthermore, functional studies showed that MOV10 is not necessary for miRNA or siRNA-mediated mRNA silencing. We have identified novel specificity for human MOV10 in the control of retroelement replication and hypothesise that MOV10 may be a component of a cellular pathway or process that selectively regulates the replication of endogenous retroelements in somatic cells.

  4. Optimal income taxation with endogenous human capital

    NARCIS (Netherlands)

    Jacobs, B.


    This paper augments the theory of optimal linear income taxation by taking into account human capital accumulation as a dimension of labor supply. The distribution of earning potentials is endogenous because agents differ in the ability to learn. Taxation affects utilization rates of human capital

  5. Essays on Policy Evaluation with Endogenous Adoption (United States)

    Gentile, Elisabetta


    Over the last decade, experimental and quasi-experimental methods have been favored by researchers in empirical economics, as they provide unbiased causal estimates. However, when implementing a program, it is often not possible to randomly assign subjects to treatment, leading to a possible endogeneity bias. This dissertation consists of two…

  6. Place branding, embeddedness and endogenous rural development

    NARCIS (Netherlands)

    Donner, Mechthild; Horlings, Lummina; Fort, Fatiha; Vellema, Sietze


    This article deals with place branding on the regional scale, in the rural context of food and tourism networks in Europe. Place branding is linked to the concepts of endogenous rural development, territory and embeddedness, by analysing how the valorisation of specific rural assets takes shape.

  7. Climate changes and farmers' endogenous adaptation strategies ...

    African Journals Online (AJOL)

    It has been claimed that climate changes impact studies often assume certain adaptations and little explicit examination of how, when, why, and under what conditions they occur. This research aims at analysing the endogenous strategies developed by farmers in agricultural land and crop management. With random ...

  8. Endogenous thrombin potential in polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Aziz, Mubeena; Sidelmann, Johannes Jakobsen; Wissing, Marie Louise Muff


    OBJECTIVES: The objective of this study is to investigate plasma endogenous thrombin generation in four different phenotypes of polycystic ovary syndrome (PCOS) defined by Body Mass Index (BMI) and insulin resistance (IR). PCOS is diagnosed according to the Rotterdam criteria. DESIGN: Multicenter...

  9. Immigration, Endogenous Technology Adoption and Wages

    NARCIS (Netherlands)

    Ray Chaudhuri, A.; Pandey, Manish


    We document that immigration to U.S. states has increased the mass of workers at the lower range of the skill distribution. We use this change in skill distribution of workers to analyze the effect of immigration on wages. Our model allows firms to endogenously respond to the immigration-induced

  10. HERVd: the Human Endogenous Retrovirus Database: update

    Czech Academy of Sciences Publication Activity Database

    Pačes, Jan; Pavlíček, A.; Zíka, Radek; Jurka, J.; Pačes, Václav


    Roč. 32, č. 1 (2004), s. 50-50 ISSN 0305-1048 R&D Projects: GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : human * endogenous retrovirus * database Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.260, year: 2004

  11. Endogenous Quality Effects of Trade Policy

    NARCIS (Netherlands)

    J.L. Moraga-Gonzalez (José Luis); J.M.A. Viaene (Jean-Marie)


    textabstractWe study the optimal trade policy against a foreign oligopoly with endogenous quality. We show that, under the Most Favoured Nation (MFN) clause, a uniform tariff policy is always welfare improving over the free trade equilibrium. However, a nonuniform tariff policy is always desirable

  12. Optimized Formation of Benzyl Isothiocyanate by Endogenous ...

    African Journals Online (AJOL)

    Purpose: To use endogenous myrosinase in Carica papaya seed to convert benzyl glucosinolate (BG) to benzyl isothiocyanate (BITC) and then extract it for further studies. Methods: Process variables including seed powder particle size, sample-to-solvent ratio, pH of buffer solution, enzymolysis temperature, enzymolysis ...

  13. Structural classification of endogenous regulatory oligopeptides. (United States)

    Zamyatnin, A A


    Based on the criteria of 50% identity in the amino acid sequence, a new method for grouping endogenous regulatory oligopeptides into structural families is presented. Data from the EROP-Moscow data bank on 579 oligopeptides fitting a preset spectrum of functional activities revealed 73 structural oligopeptide groups, 36 of which were called families.

  14. Endogenous retrovirus sequences expressed in male mammalian ...

    African Journals Online (AJOL)

    Objectives: To review the research findings on the expression of endogenous retroviruses and retroviral-related particles in male mammalian reproductive tissues, and to discuss their possible role in normal cellular events and association with disease conditions in male reproductive tissues. Data sources: Published ...

  15. The Limit of Public Policy : Endogenous Preferences

    NARCIS (Netherlands)

    Bar-Gill, O.; Fershtman, C.


    In designing public policy it is not enough to consider the possible reaction of individuals to the chosen policy.Public policy may also affect the formation of preferences and norms in a society.The endogenous evolution of preferences, in addition to introducing a conceptual difficulty in

  16. Endogeneity in Strategy-Performance Analysis

    DEFF Research Database (Denmark)

    Rocha, Vera; Van Praag, Mirjam; B. Folta, Timothy


    , such as employees, strategic partners, customers, or investors, whose choices and preferences also affect the final decision. We discuss how endogeneity can plague the measurement of the performance effects of these two-sided strategic decisions—which are more complex, but more realistic, than prior representations...

  17. Managing spillovers: an endogenous sunk cost approach

    Czech Academy of Sciences Publication Activity Database

    Senyuta, Olena; Žigić, Krešimir


    Roč. 35, June (2016), s. 45-64 ISSN 0167-6245 R&D Projects: GA ČR(CZ) GAP402/12/0961 Institutional support: PRVOUK-P23 Keywords : endogenous sunk costs * innovations * knowledge spillovers Subject RIV: AH - Economics Impact factor: 0.739, year: 2016

  18. Applying Endogenous Knowledge in the African Context ...

    African Journals Online (AJOL)

    This requires not only an understanding of what endogenous knowledge is, but also an alignment of personal values, innovative strategies and an attitude of activism. An integral part of an extensive skills set to implement specifi c dispute resolution strategies is the ability to facilitate the free sharing of information about all ...

  19. Endogenous retrovirus sequences expressed in male mammalian ...

    African Journals Online (AJOL)

    In humans, one ERV family, human endogenous retrovirus- K (HERV-K) is abundantly expressed, and is associated with germ cell tumours, while ERV3 env is expressed in normal human testis. Conclusion: The expression of ERVs in male reproductive tissues suggests a possible role in normal and disease conditions ...

  20. [Endogenous pyrogen formation by bone marrow cells]. (United States)

    Efremov, O M; Sorokin, A V; El'kina, O A


    The cells of the rabbit bone marrow produced endogenous pyrogen in response to stimulation with bacterial lipopolysaccharide. Incubation of the cells in medium No 199 containing a 15% homologous serum is optimal for the release of pyrogen. It is supposed that the cells of the bone marrow take part in the formation of endgenous pyrogen and in the mechanism of pyrexia in the organism.

  1. Reversible flowchart languages and the structured reversible program theorem

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert


    Many irreversible computation models have reversible counterparts, but these are poorly understood at present. We introduce reversible flowcharts with an assertion operator and show that any reversible flowchart can be simulated by a structured reversible flowchart using only three control flow...... operators. Reversible flowcharts are r- Turing-complete, meaning that they can simuluate reversible Turing machines without garbage data. We also demonstrate the injectivization of classical flowcharts into reversible flowcharts. The reversible flowchart computation model provides a theoretical...


    Taylor, Bradley K; Corder, Gregory


    Endogenous activation of μ-opioid receptors (MORs) provides relief from acute pain. Recent studies have established that tissue inflammation produces latent pain sensitization (LS) that is masked by spinal MOR signaling for months, even after complete recovery from injury and re-establishment of normal pain thresholds. Disruption with MOR inverse agonists reinstates pain and precipitates cellular, somatic and aversive signs of physical withdrawal; this phenomenon requires N-methyl-D-aspartate receptor-mediated activation of calcium-sensitive adenylyl cyclase type 1 (AC1). In this review, we present a new conceptual model of the transition from acute to chronic pain, based on the delicate balance between LS and endogenous analgesia that develops after painful tissue injury. First, injury activates pain pathways. Second, the spinal cord establishes MOR constitutive activity (MORCA) as it attempts to control pain. Third, over time, the body becomes dependent on MORCA, which paradoxically sensitizes pain pathways. Stress or injury escalates opposing inhibitory and excitatory influences on nociceptive processing as a pathological consequence of increased endogenous opioid tone. Pain begets MORCA begets pain vulnerability in a vicious cycle. The final result is a silent insidious state characterized by the escalation of two opposing excitatory and inhibitory influences on pain transmission: LS mediated by AC1 (which maintains accelerator), and pain inhibition mediated by MORCA (which maintains the brake). This raises the prospect that opposing homeostatic interactions between MORCA analgesia and latent NMDAR–AC1-mediated pain sensitization create a lasting vulnerability to develop chronic pain. Thus, chronic pain syndromes may result from a failure in constitutive signaling of spinal MORs and a loss of endogenous analgesic control. An overarching long-term therapeutic goal of future research is to alleviate chronic pain by either: a) facilitating endogenous opioid

  3. The Unstructured Paramyxovirus Nucleocapsid Protein Tail Domain Modulates Viral Pathogenesis through Regulation of Transcriptase Activity. (United States)

    Thakkar, Vidhi D; Cox, Robert M; Sawatsky, Bevan; da Fontoura Budaszewski, Renata; Sourimant, Julien; Wabbel, Katrin; Makhsous, Negar; Greninger, Alexander L; von Messling, Veronika; Plemper, Richard K


    The paramyxovirus replication machinery comprises the viral large (L) protein and phosphoprotein (P-protein) in addition to the nucleocapsid (N) protein, which encapsidates the single-stranded RNA genome. Common to paramyxovirus N proteins is a C-terminal tail (Ntail). The mechanistic role and relevance for virus replication of the structurally disordered central Ntail section are unknown. Focusing initially on members of the Morbillivirus genus, a series of measles virus (MeV) and canine distemper virus (CDV) N proteins were generated with internal deletions in the unstructured tail section. N proteins with large tail truncations remained bioactive in mono- and polycistronic minireplicon assays and supported efficient replication of recombinant viruses. Bioactivity of Ntail mutants extended to N proteins derived from highly pathogenic Nipah virus. To probe an effect of Ntail truncations on viral pathogenesis, recombinant CDVs were analyzed in a lethal CDV/ferret model of morbillivirus disease. The recombinant viruses displayed different stages of attenuation ranging from ameliorated clinical symptoms to complete survival of infected animals, depending on the molecular nature of the Ntail truncation. Reinfection of surviving animals with pathogenic CDV revealed robust protection against a lethal challenge. The highly attenuated virus was genetically stable after ex vivo passaging and recovery from infected animals. Mechanistically, gradual viral attenuation coincided with stepwise altered viral transcriptase activity in infected cells. These results identify the central Ntail section as a determinant for viral pathogenesis and establish a novel platform to engineer gradual virus attenuation for next-generation paramyxovirus vaccine design. IMPORTANCE Investigating the role of the paramyxovirus N protein tail domain (Ntail) in virus replication, we demonstrated in this study that the structurally disordered central Ntail region is a determinant for viral

  4. Introduction to reversible computing

    CERN Document Server

    Perumalla, Kalyan S


    Few books comprehensively cover the software and programming aspects of reversible computing. Filling this gap, Introduction to Reversible Computing offers an expanded view of the field that includes the traditional energy-motivated hardware viewpoint as well as the emerging application-motivated software approach. Collecting scattered knowledge into one coherent account, the book provides a compendium of both classical and recently developed results on reversible computing. It explores up-and-coming theories, techniques, and tools for the application of rever

  5. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research. (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei


    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  6. Monoamines stimulate sex reversal in the saddleback wrasse. (United States)

    Larson, Earl T; Norris, David O; Gordon Grau, E; Summers, Cliff H


    Monoamine neurotransmitters (norepinephrine, dopamine, and serotonin) play an important role in reproduction and sexual behavior throughout the vertebrates. They are the first endogenous chemical signals in the regulation of the hypothalamo-pituitary-gonadal (HPG) axis. In teleosts with behavioral sex determination, much is known about behavioral cues that induce sex reversal. The cues are social, processed via the visual system and depend on the ratio of females to males in the population. The mechanisms by which these external behavioral cues are converted to an internal chemical regulatory process are largely unknown. The protogynous Hawaiian saddleback wrasse, Thalassoma duperrey, was used to investigate the biological pathway mediating the conversion of a social cue into neuroendocrine events regulating sex reversal. Because monoamines play an important role in the regulation of the HPG axis, they were selected as likely candidates for such a conversion. To determine if monoamines could affect sex reversal, drugs affecting monoamines were used in an attempt to either induce sex reversal under non-permissive conditions, or prevent sex reversal under permissive conditions. Increasing norepinephrine or blocking dopamine or serotonin lead to sex reversal in experimental animals under non-permissive conditions. Increasing serotonin blocked sex reversal under permissive conditions, while blocking dopamine or norepinephrine retarded the process. The results presented here demonstrate that monoamines contribute significantly to the control sex reversal. Norepinephrine stimulates initiation and completion of gonadal sex of reversal as well as color change perhaps directly via its effects on the HPG axis. Dopamine exercises inhibitory action on the initiation of sex reversal while 5-HT inhibits both initiation and completion of sex reversal. The serotonergic system appears to be an integral part of the pathway mediating the conversion of a social cue into a

  7. Reversibility of female sterilization. (United States)

    Siegler, A M; Hulka, J; Peretz, A


    The discussion considers the current status of reversibility of sterilization in the US and describes clinical and experimental efforts for developing techniques designed for reversibility. It focuses on regret following sterilization, reversal potential of current sterilization techniques, patient selection, current reversal techniques, results of sterilization procedures, experimental approaches to reversal of current techniques of sterilization, and sterilization procedures devised for reversibility, in humans and in animals. Request is the 1st stage of reversal, but a request for sterilization reversal (SR) does not always mean regret for a decision made at the time. Frequently it is a wish to restore fertility because life circumstances have changed after a sterilization that was ppropriate at the time it was performed. Schwyhart and Kutner reviewed 22 studies published between 1949-69 in which they found that the percentage of patients regretting the procedure ranged from 1.3-15%. Requests for reversal remain low in most countries, but if sterilization becomes a more popular method of contraception, requests will also increase. The ideal operation considered as a reversaible method of sterilization should include an easy, reliable outpatient method of tubal occlusion with miniml risk or patient discomfort that subsequently could be reversed without the need for a major surgical intervention. Endoscopic methods have progressed toward the 1st objective. A recent search of the literature uncovered few series of SR of more than 50 cases. The 767 operations found were analyzed with regard to pregnancy outcome. The precent of live births varied from 74-78.8%, and the occurance of tubal pregnancies ranged from 1.7-6.5%. All of the confounding variables in patient selection and small numbers of reported procedures preclude any conclusion about the different techniques or the number of operations that give a surgeon a level of expertise. Few authors classify their

  8. Endogenous Magnetic Reconnection in Solar Coronal Loops (United States)

    Asgari-Targhi, M.; Coppi, B.; Basu, B.; Fletcher, A.; Golub, L.


    We propose that a magneto-thermal reconnection process occurring in coronal loops be the source of the heating of the Solar Corona [1]. In the adopted model, magnetic reconnection is associated with electron temperature gradients, anisotropic electron temperature fluctuations and plasma current density gradients [2]. The input parameters for our theoretical model are derived from the most recent observations of the Solar Corona. In addition, the relevant (endogenous) collective modes can produce high energy particle populations. An endogenous reconnection process is defined as being driven by factors internal to the region where reconnection takes place. *Sponsored in part by the U.S. D.O.E. and the Kavli Foundation* [1] Beafume, P., Coppi, B. and Golub, L., (1992) Ap. J. 393, 396. [2] Coppi, B. and Basu, B. (2017) MIT-LNS Report HEP 17/01.

  9. Endogenous opioids encode relative taste preference. (United States)

    Taha, Sharif A; Norsted, Ebba; Lee, Lillian S; Lang, Penelope D; Lee, Brian S; Woolley, Joshua D; Fields, Howard L


    Endogenous opioid signaling contributes to the neural control of food intake. Opioid signaling is thought to regulate palatability, the reward value of a food item as determined by orosensory cues such as taste and texture. The reward value of a food reflects not only these sensory properties but also the relative value of competing food choices. In the present experiment, we used a consummatory contrast paradigm to manipulate the relative value of a sucrose solution for two groups of rats. Systemic injection of the nonspecific opioid antagonist naltrexone suppressed sucrose intake; for both groups, however, this suppression was selective, occurring only for the relatively more valuable sucrose solution. Our results indicate that endogenous opioid signaling contributes to the encoding of relative reward value.

  10. Endogenous Natural Complement Inhibitor Regulates Cardiac Development

    DEFF Research Database (Denmark)

    Mortensen, Simon A; Skov, Louise L; Kjaer-Sorensen, Kasper


    mechanisms during fetal development and adult homeostasis. In this article, we describe the function of an endogenous complement inhibitor, mannan-binding lectin (MBL)-associated protein (MAp)44, in regulating the composition of a serine protease-pattern recognition receptor complex, MBL-associated serine...... of MAp44 caused impaired cardiogenesis, lowered heart rate, and decreased cardiac output. These defects were associated with aberrant neural crest cell behavior. We found that MAp44 competed with MASP-3 for pattern recognition molecule interaction, and knockdown of endogenous MAp44 expression could...... be rescued by overexpression of wild-type MAp44. Our observations provide evidence that immune molecules are centrally involved in the orchestration of cardiac tissue development....

  11. Endogeneity of Money Supply: Evidence From Turkey

    Directory of Open Access Journals (Sweden)

    Oguzhan Cepni


    Full Text Available There is a long discussion among academics and central bankers about the theories of money supply. According to the exogenous view, central banks have the full control over money supply via policy actions including the adjustments of interest rates and reserve ratios, both of which alter commercial banks’ lending decisions. However, the theory of endogenous money supply emphasizes the role of demand for bank loans in money creation. More specifically, banks create money by meeting the demand of economic agents. In this study, we investigate which of the money supply theories holds in Turkish economy for the period 2006-2015 by employing cointegration and causality tests. Our findings show that the causality runs from bank loans to money supply both in the short and long terms, which supports the endogenous view in a sense that central bank and the banks fully meet the total demand for money in Turkish economy.

  12. Independent effects of endogenous and exogenous attention in touch. (United States)

    Jones, Alexander; Forster, Bettina


    Endogenous and exogenous attention in touch have typically been investigated separately. Here we use a double-cueing paradigm manipulating both types of orienting in each trial. Bilateral endogenous cues induced long-lasting facilitation of endogenous attention up to 2 s. However, the exogenous cue only elicited an effect at short intervals. Our results favour a supramodal account of attention and this study provides new insight into how endogenous and exogenous attention operates in the tactile modality.

  13. Endogenous pyrogen-like substance produced by reptiles. (United States)

    Bernheim, H A; Kluger, M J


    1. Injection of lizards (Dipsosaurus dorsalis) with rabbit endogenous pyrogen led to a fever. Injections with denatured endogenous pyrogen did not affect body temperature. 2. Injection of lizards with lizard endogenous pyrogen led to a fever of short duration, while injection of denatured lizard endogenous pyrogen produced no change in body temperature. 3. These data support the hypothesis that the febrile mechanism observed in the higher vertebrates has its origins in some primitive vertebrate.

  14. A General Theory of Endogenous Market Structures


    Federico Etro; Paolo Bertoletti


    We provide a unified approach to imperfect (monopolistic, Bertrand and Cournot) competition equilibria with demand functions derived from symmetric preferences over a large but finite number of goods. The equilibrium markups depend on the Morishima Elasticity of Substitution/Complementarity between goods, and can be derived directly from the utility functions and ranked unambiguously. We characterize the endogenous market structures, their dependence on market size, income and firms’ producti...

  15. Pensions with Heterogenous Individuals and Endogenous Fertility


    Cremer, Helmuth; Gahvari, Firouz; Pestieau, Pierre


    This paper studies the design of pension schemes in a society where fertility is endogenous and parents differ in their ability to raise children. In a world with perfect information, a pay-as-you-go social security system is characterized by equal pensions for all but different contributions which may or may not increase with the number of children. Additionally, fertility must be subsidized at the margin to correct for the externality that accompanies fertility. In a world of asymmetric inf...

  16. Endogenous Growth, Monetary Shocks and Nominal Rigidities


    Annicchiarico, Barbara; Pelloni, Alessandra; Lorenza, Rossi


    We introduce endogenous growth in an otherwise standard NK model with staggered prices and wages. Some results follow: (i) monetary volatility negatively affects long-run growth; (ii) the relation between nominal volatility and growth depends on the persistence of the nominal shocks and on the Taylor rule considered; (iii) a Taylor rule with smoothing increases the negative effect of nominal volatility on mean growth.

  17. Social Security, Intergenerational Transfers, and Endogenous Growth


    Junsen Zhang; Junxi Zhang


    In this paper, the effects of social security in a simple model of endogenous growth with alternative motives of having children are analyzed. It shows how the effects of social security depend on the size of the social security tax, the motive to have children, and the pattern of intergenerational transfers. The pattern of intergenerational transfers itself, however, is shown to change with the social security tax rate. When the social security tax is not too high, social security increases ...

  18. The endogeneity of money and the eurosystem


    Steiger, Otto


    The endogenous theory of money, developed by Basil Moore, argues that the supply of central bank money in modern economies is not under the control of the central bank. According to this view, a central bank typically supplies cash reserves automatically on demand at its minimum lending rate, resulting in a clearly horizontal money supply function. While the paper agrees with Moore that the supply of central bank money cannot be determined exogenously by the central bank, it wonders whether t...

  19. Endogeneity of Money Supply: Evidence From Turkey


    Oguzhan Cepni; Ibrahim Ethem Guney


    There is a long discussion among academics and central bankers about the theories of money supply. According to the exogenous view, central banks have the full control over money supply via policy actions including the adjustments of interest rates and reserve ratios, both of which alter commercial banks’ lending decisions. However, the theory of endogenous money supply emphasizes the role of demand for bank loans in money creation. More specifically, banks create money by meeting the demand ...

  20. Ciliary neurotrophic factor is an endogenous pyrogen.


    Shapiro, L; Zhang, X X; Rupp, R G; Wolff, S M; Dinarello, C A


    Fever is initiated by the action of polypeptide cytokines called endogenous pyrogens, which are produced by the host during inflammation, trauma, or infection and which elevate the thermoregulatory set point in the hypothalamus. Ciliary neurotrophic factor (CNTF) supports the differentiation and survival of central and peripheral neurons. We describe the activity of CNTF as intrinsically pyrogenic in the rabbit. CNTF induced a monophasic fever which rose rapidly (within the first 12 min) foll...

  1. Endogenous Retroviruses in the Genomics Era. (United States)

    Johnson, Welkin E


    Endogenous retroviruses comprise millions of discrete genetic loci distributed within the genomes of extant vertebrates. These sequences, which are clearly related to exogenous retroviruses, represent retroviral infections of the deep past, and their abundance suggests that retroviruses were a near-constant presence throughout the evolutionary history of modern vertebrates. Endogenous retroviruses contribute in myriad ways to the evolution of host genomes, as mutagens and as sources of genetic novelty (both coding and regulatory) to be acted upon by the twin engines of random genetic drift and natural selection. Importantly, the richness and complexity of endogenous retrovirus data can be used to understand how viruses spread and adapt on evolutionary timescales by combining population genetics and evolutionary theory with a detailed understanding of retrovirus biology (gleaned from the study of extant retroviruses). In addition to revealing the impact of viruses on organismal evolution, such studies can help us better understand, by looking back in time, how life-history traits, as well as ecological and geological events, influence the movement of viruses within and between populations.

  2. Endogenous cueing attenuates object substitution masking. (United States)

    Germeys, Filip; Pomianowska, I; De Graef, P; Zaenen, P; Verfaillie, K


    Object substitution masking (OSM) is a form of visual masking in which a briefly presented target surrounded by four small dots is masked by the continuing presence of the four dots after target offset. A major parameter in the prediction of OSM is the time required for attention to be directed to the target following its onset. Object substitution theory (Di Lollo et al. in J Exp Psychol Gen 129:481-507, 2000) predicts that the sooner attention can be focused at the target's location, the less masking will ensue. However, recently Luiga and Bachmann (Psychol Res 71:634-640, 2007) presented evidence that precueing of attention to the target location prior to target-plus-mask onset by means of a central (endogenous) arrow cue does not reduce OSM. When attention was cued exogenously, OSM was attenuated. Based on these results, Luiga and Bachmann argued that object substitution theory should be adapted by differentiating the ways of directing attention to the target location. The goal of the present study was to further examine the dissociation between the effects of endogenous and exogenous precueing on OSM. Contrary to Luiga and Bachmann, our results show that prior shifts of attention to the target location initiated by both exogenous and endogenous cues reduce OSM as predicted by object substitution theory and its computational model CMOS.

  3. Endogenous growth theory and regional development policy

    Directory of Open Access Journals (Sweden)

    Cvetanović Slobodan


    Full Text Available The numerous versions of endogenous explanations of economic growth emphasize the importance of technological change driving forces, as well as the existence of appropriate institutional arrangements. Endogenous growth theory contributes to a better understanding of various experiences with long-term growth of countries and regions. It changes the key assumptions of the Neoclassical growth theory and participates in the modern regional development physiology explanation. Based on these conclusions, the paper: a explicates the most important theoretical postulates of the theory, b explains the most important factors of economic growth in the regions in light of the Endogenous growth theory messages and c emphasizes the key determinants of regional competitiveness which in our view is conceptually between the phenomena of micro- and macro-competitiveness and represents their necessary and unique connection. First of all, micro-competitiveness is transformed into a regional competitiveness; then regional competitiveness is transformed into a macro-competitiveness. In turn, macro - influences the microeconomic competitiveness, and the circle is closed. After that, the process starts over again.

  4. Fanconi anemia proteins and endogenous stresses

    Energy Technology Data Exchange (ETDEWEB)

    Pang Qishen [Division of Experimental Hematology and Cancer Biology, Cincinnati Children' s Research Foundation, Cincinnati, OH (United States); Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, OH (United States); Andreassen, Paul R., E-mail: [Division of Experimental Hematology and Cancer Biology, Cincinnati Children' s Research Foundation, Cincinnati, OH (United States); Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, OH (United States)


    Each of the thirteen identified Fanconi anemia (FA) genes is required for resistance to DNA interstrand crosslinking agents, such as mitomycin C, cisplatin, and melphalan. While these agents are excellent tools for understanding the function of FA proteins in DNA repair, it is uncertain whether a defect in the removal of DNA interstrand crosslinks (ICLs) is the basis for the pathophysiology of FA. For example, DNA interstrand crosslinking agents induce other types of DNA damage, in addition to ICLs. Further, other DNA-damaging agents, such as ionizing or ultraviolet radiation, activate the FA pathway, leading to monoubiquitination of FANCD2 and FANCI. Also, FA patients display congenital abnormalities, hematologic deficiencies, and a predisposition to cancer in the absence of an environmental source of ICLs that is external to cells. Here we consider potential sources of endogenous DNA damage, or endogenous stresses, to which FA proteins may respond. These include ICLs formed by products of lipid peroxidation, and other forms of oxidative DNA damage. FA proteins may also potentially respond to telomere shortening or replication stress. Defining these endogenous sources of DNA damage or stresses is critical for understanding the pathogenesis of deficiencies for FA proteins. We propose that FA proteins are centrally involved in the response to replication stress, including replication stress arising from oxidative DNA damage.

  5. Fanconi anemia proteins and endogenous stresses

    International Nuclear Information System (INIS)

    Pang Qishen; Andreassen, Paul R.


    Each of the thirteen identified Fanconi anemia (FA) genes is required for resistance to DNA interstrand crosslinking agents, such as mitomycin C, cisplatin, and melphalan. While these agents are excellent tools for understanding the function of FA proteins in DNA repair, it is uncertain whether a defect in the removal of DNA interstrand crosslinks (ICLs) is the basis for the pathophysiology of FA. For example, DNA interstrand crosslinking agents induce other types of DNA damage, in addition to ICLs. Further, other DNA-damaging agents, such as ionizing or ultraviolet radiation, activate the FA pathway, leading to monoubiquitination of FANCD2 and FANCI. Also, FA patients display congenital abnormalities, hematologic deficiencies, and a predisposition to cancer in the absence of an environmental source of ICLs that is external to cells. Here we consider potential sources of endogenous DNA damage, or endogenous stresses, to which FA proteins may respond. These include ICLs formed by products of lipid peroxidation, and other forms of oxidative DNA damage. FA proteins may also potentially respond to telomere shortening or replication stress. Defining these endogenous sources of DNA damage or stresses is critical for understanding the pathogenesis of deficiencies for FA proteins. We propose that FA proteins are centrally involved in the response to replication stress, including replication stress arising from oxidative DNA damage.

  6. Induced pluripotency with endogenous and inducible genes

    International Nuclear Information System (INIS)

    Duinsbergen, Dirk; Eriksson, Malin; Hoen, Peter A.C. 't; Frisen, Jonas; Mikkers, Harald


    The recent discovery that two partly overlapping sets of four genes induce nuclear reprogramming of mouse and even human cells has opened up new possibilities for cell replacement therapies. Although the combination of genes that induce pluripotency differs to some extent, Oct4 and Sox2 appear to be a prerequisite. The introduction of four genes, several of which been linked with cancer, using retroviral approaches is however unlikely to be suitable for future clinical applications. Towards developing a safer reprogramming protocol, we investigated whether cell types that express one of the most critical reprogramming genes endogenously are predisposed to reprogramming. We show here that three of the original four pluripotency transcription factors (Oct4, Klf4 and c-Myc or MYCER TAM ) induced reprogramming of mouse neural stem (NS) cells exploiting endogenous SoxB1 protein levels in these cells. The reprogrammed neural stem cells differentiated into cells of each germ layer in vitro and in vivo, and contributed to mouse development in vivo. Thus a combinatorial approach taking advantage of endogenously expressed genes and inducible transgenes may contribute to the development of improved reprogramming protocols

  7. Endogenous lung regeneration: potential and limitations. (United States)

    Rock, Jason; Königshoff, Melanie


    The exploration of the endogenous regenerative potential of the diseased adult human lung represents an innovative and exciting task. In this pulmonary perspective, we discuss three major components essential for endogenous lung repair and regeneration: epithelial progenitor populations, developmental signaling pathways that regulate their reparative and regenerative potential, and the surrounding extracellular matrix in the human diseased lung. Over the past years, several distinct epithelial progenitor populations have been discovered within the lung, all of which most likely respond to different injuries by varying degrees. It has become evident that several progenitor populations are mutually involved in maintenance and repair, which is highly regulated by developmental pathways, such as Wnt or Notch signaling. Third, endogenous progenitor cells and developmental signaling pathways act in close spatiotemporal synergy with the extracellular matrix. These three components define and refine the highly dynamic microenvironment of the lung, which is altered in a disease-specific fashion in several chronic lung diseases. The search for the right mixture to induce efficient and controlled repair and regeneration of the diseased lung is ongoing and will open completely novel avenues for the treatment of patients with chronic lung disease.

  8. Endogenous leukotriene formation during anaphylactic shock

    International Nuclear Information System (INIS)

    Keppler, A.; Oerning, L.; Bernstroem, K.; Hammarstroem, S.


    Leukotriene (LT)C 4 is a biologically active substance, presumed to play major roles as a mediator of allergic and anaphylactic reactions. It is formed e.g. by basophilic and eosinophilic leukocytes, monocytes, macrophages, and mast cells. In cells having IgE receptors, bridging of these by divalent anti-IgE-receptor antibodies or by interaction between receptor-bound IgE and anti-IgE will induce LTC 4 formation. Leukotriene formation has also been demonstrated in other in vitro models of immediate hypersensivity. The biological actions of LTC 4 , comprise induction of airway obstruction, constriction of coronary arteries, hypotension, and plasma extravasation. Leukotriene formation in vivo may mediate anaphylactic shock symptoms and cause the death of an animal. In order to prove the presumed mediator role of this substance in anaphylactic reactions, it is necessary to demonstrate its endogenous formation during shock. Studies on the metabolism of LTC 4 have revealed rapid catabolism by various transformations of the peptide substituent. Recently, three metabolites were demonstrated to be excreted as end-products in man (LTE 4 ,) and the rat (N-acetyl LTE 4 and N-acetyl 11-trans LTE 4 ). By monitoring biliary N-acetyl LTE 4 levels, endogenous leukotriene formation in the rat was demonstrated in vivo after tissue trauma and endotoxin shock. We now wish to report evidence for endogenous leukotriene C 4 production during anaphylactic shock in guinea pigs. 37 refs. (author)

  9. Exercise induced asthma and endogenous opioids. (United States)

    Gaillard, R C; Bachman, M; Rochat, T; Egger, D; de Haller, R; Junod, A F


    Concentrations of endogenous opioid peptides in the plasma are increased during exercise and these substances have been implicated in the pathogenesis of asthma induced by chloropropramide and alcohol in diabetic patients. This work was undertaken to determine whether exercise induced asthma might be mediated by endogenous opioids. Plasma beta endorphin, met-enkephalin, and adrenocorticotrophic hormone (ACTH) concentrations were measured in five asthmatic patients and five normal volunteers breathing cold air during exercise. In four of the patients the effect of an infusion of naloxone on FEV1 was also measured during exercise induced asthma. Exercise produced acute bronchoconstriction in all asthmatics, characterised by a fall in FEV1; whereas no change occurred in normal subjects. There was no difference in plasma met-enkephalin, beta endorphin, and ACTH concentration between the two groups. Infusion of naloxone neither prevented nor worsened exercise induced asthma. These data suggest that endogenous opioids probably do not play a part in the development of exercise induced asthma. PMID:2944240

  10. The search for an endogenous activator. (United States)

    Gekowski, K. M.; Atkins, E.


    Certain febrile diseases are unaccompanied by infection or apparent hypersensitivity. In myocardial infarction or pulmonary embolism, for example, fever has been attributed to inflammation and/or tissue necrosis. Exogenous (microbial) pyrogens stimulate both human and animal monocytes/macrophages to produce endogenous pyrogen (EP) in vitro. To determine if plasma and cellular endogeneous mediators (EMs) of inflammation induced EP production, human mononuclear cells (M/L) were incubated for 18 hours with varying amounts of EM and the supernates assayed for EP in rabbits. Neutrophils (PMNs), which do not generate EP and yet are a feature of acute inflammation, were tested. Neither viable, phorbol myristic acetate-stimulated PMNs nor sonicated PMNs, red blood cells, or M/L stimulated human monocytes to produce EP. Human C3b and C5a, which mediate phagocytosis and chemotaxis, respectively, were also inactive. Despite its chemoattractant properties, the synthetic peptide FMLP failed to induce EP release. Since Poly I:Poly C (PIC: a synthetic, double-stranded RNA) is a potent pyrogen in rabbits, we investigated PIC, as well as a native, single-stranded RNA (from E. coli) and DNA (from calf thymus). None was active in vitro, and only PIC caused fever when given to rabbits intravenously. In summary, we have been unable to find an endogenous activator of EP from human monocytes to explain fevers associated with inflammation alone. PMID:3875936

  11. Quantum reverse hypercontractivity

    Energy Technology Data Exchange (ETDEWEB)

    Cubitt, Toby [Department of Computer Science, University College London, London, United Kingdom and Centre for Quantum Information and Foundations, DAMTP, University of Cambridge, Cambridge (United Kingdom); Kastoryano, Michael [NBIA, Niels Bohr Institute, University of Copenhagen, 2100 Copenhagen (Denmark); Montanaro, Ashley [School of Mathematics, University of Bristol, Bristol (United Kingdom); Temme, Kristan [Institute for Quantum Information and Matter, California Institute of Technology, Pasadena, California 91125 (United States)


    We develop reverse versions of hypercontractive inequalities for quantum channels. By generalizing classical techniques, we prove a reverse hypercontractive inequality for tensor products of qubit depolarizing channels. We apply this to obtain a rapid mixing result for depolarizing noise applied to large subspaces and to prove bounds on a quantum generalization of non-interactive correlation distillation.

  12. Atrioventricular Pacemaker Lead Reversal

    Directory of Open Access Journals (Sweden)

    Mehmet K Aktas, MD


    Full Text Available During cardiac surgery temporary epicardial atrial and ventricular leads are placed in case cardiac pacing is required postoperatively. We present the first reported series of patients with reversal of atrioventricular electrodes in the temporary pacemaker without any consequent deleterious hemodynamic effect. We review the electrocardiographic findings and discuss the findings that lead to the discovery of atrioventricular lead reversal.

  13. Endogenous Cholesterol Excretion Is Negatively Associated With Carotid Intima-Media Thickness in Humans. (United States)

    Lin, Xiaobo; Racette, Susan B; Ma, Lina; Wallendorf, Michael; Dávila-Román, Victor G; Ostlund, Richard E


    Epidemiological studies strongly suggest that lipid factors independent of low-density lipoprotein cholesterol contribute significantly to cardiovascular disease risk. Because circulating lipoproteins comprise only a small fraction of total body cholesterol, the mobilization and excretion of cholesterol from plasma and tissue pools may be an important determinant of cardiovascular disease risk. Our hypothesis is that fecal excretion of endogenous cholesterol is protective against atherosclerosis. Cholesterol metabolism and carotid intima-media thickness were quantitated in 86 nondiabetic adults. Plasma cholesterol was labeled by intravenous infusion of cholesterol-d 7 solubilized in a lipid emulsion and dietary cholesterol by cholesterol-d 5 and the nonabsorbable stool marker sitostanol-d 4 . Plasma and stool samples were collected while subjects consumed a cholesterol- and phytosterol-controlled metabolic kitchen diet and were analyzed by mass spectrometry. Carotid intima-media thickness was negatively correlated with fecal excretion of endogenous cholesterol ( r =-0.426; P cholesterol ( r =-0.472; P ≤0.0001), and daily percent excretion of cholesterol from the rapidly mixing cholesterol pool ( r =-0.343; P =0.0012) and was positively correlated with percent cholesterol absorption ( r =+0.279; P =0.0092). In a linear regression model controlling for age, sex, systolic blood pressure, hemoglobin A1c, low-density lipoprotein, high-density lipoprotein cholesterol, and statin drug use, fecal excretion of endogenous cholesterol remained significant ( P =0.0008). Excretion of endogenous cholesterol is strongly, independently, and negatively associated with carotid intima-media thickness. The reverse cholesterol transport pathway comprising the intestine and the rapidly mixing plasma, and tissue cholesterol pool could be an unrecognized determinant of cardiovascular disease risk not reflected in circulating lipoproteins. Further work is needed to relate measures of

  14. Development of an enrichment method for endogenous phosphopeptide characterization in human serum. (United States)

    La Barbera, Giorgia; Capriotti, Anna Laura; Cavaliere, Chiara; Ferraris, Francesca; Laus, Michele; Piovesana, Susy; Sparnacci, Katia; Laganà, Aldo


    The work describes the development of an enrichment method for the analysis of endogenous phosphopeptides in serum. Endogenous peptides can play significant biological roles, and some of them could be exploited as future biomarkers. In this context, blood is one of the most useful biofluids for screening, but a systematic investigation of the endogenous peptides, especially phosphorylated ones, is still lacking, mainly due to the lack of suitable analytical methods. Thus, in this paper, different phosphopeptide enrichment strategies were pursued, based either on metal oxide affinity chromatography (MOAC, in the form of commercial TiO 2 spin columns or magnetic graphitized carbon black-TiO 2 composite), or on immobilized metal ion affinity chromatography (IMAC, in the form of Ti 4+ -IMAC magnetic material or commercial Fe 3+ -IMAC spin columns). While MOAC strategies proved completely unsuccessful, probably due to interfering phospholipids displacing phosphopeptides, the IMAC materials performed very well. Different sample preparation strategies were tested, comprising direct dilution with the loading buffer, organic solvent precipitation, and lipid removal from the matrix, as well as the addition of phosphatase inhibitors during sample handling for maximized endogenous phosphopeptide enrichment. All data were acquired by a shotgun peptidomics approach, in which peptide samples were separated by reversed-phase nanoHPLC hyphenated with high-resolution tandem mass spectrometry. The devised method allowed the identification of 176 endogenous phosphopeptides in fresh serum added with inhibitors by the direct dilution protocol and the Ti 4+ -IMAC magnetic material enrichment, but good results could also be obtained from the commercial Fe 3+ -IMAC spin column adapted to the batch enrichment protocol.

  15. An algebra of reversible computation. (United States)

    Wang, Yong


    We design an axiomatization for reversible computation called reversible ACP (RACP). It has four extendible modules: basic reversible processes algebra, algebra of reversible communicating processes, recursion and abstraction. Just like process algebra ACP in classical computing, RACP can be treated as an axiomatization foundation for reversible computation.

  16. Gene expression analysis in prostate cancer: the importance of the endogenous control.

    LENUS (Irish Health Repository)

    Vajda, Alice


    Aberrant gene expression is a hallmark of cancer. Quantitative reverse-transcription PCR (qRT-PCR) is the gold-standard for quantifying gene expression, and commonly employs a house-keeping gene (HKG) as an endogenous control to normalize results; the choice of which is critical for accurate data interpretation. Many factors, including sample type, pathological state, and oxygen levels influence gene expression including putative HKGs. The aim of this study was to determine the suitability of commonly used HKGs for qRT-PCR in prostate cancer.

  17. Optimal Incentives in a Principal–Agent Model with Endogenous Technology

    Directory of Open Access Journals (Sweden)

    Marco A. Marini


    Full Text Available One of the standard predictions of the agency theory is that more incentives can be given to agents with lower risk aversion. In this paper, we show that this relationship may be absent or reversed when the technology is endogenous and projects with a higher efficiency are also riskier. Using a modified version of the Holmstrom and Milgrom’s framework, we obtain that lower agent’s risk aversion unambiguously leads to higher incentives when the technology function linking efficiency and riskiness is elastic, while the risk aversion–incentive relationship can be positive when this function is rigid.

  18. Studies on the production of endogenous pyrogen by rabbit monocytes: the role of calcium and cyclic nucleotides.


    Sigal, S. L.; Duff, G. W.; Atkins, E.


    Rabbit monocytes stimulated with endotoxin produced endogenous pyrogen, even under conditions of high or low extracellular calcium concentrations. Maximal production occurred when the concentration was in the near-physiological range. Prolonged incubation of cells with a calcium chelator prevented subsequent activation with endotoxin, an effect which was rapidly reversible by re-addition of calcium but not other cations. Addition of small amounts of lanthanum, which acts as a calcium channel ...

  19. Environmental policy, pollution, unemployment and endogenous growth

    DEFF Research Database (Denmark)

    Pedersen, Lars Haagen; Nielsen, Søren Bo; Sørensen, Peter Birch


    The paper develops a model of endogenous economic growth with pollution externalities and a labor market distorted by union monopoly power and by taxes and transfers. We study the optimal second-best pollution tax and abatement policy and find that a shift toward greener preferences will tend...... to reduce unemployment, although it will hamper growth. We also find that greater labor-market distortions call for higher pollution tax rates. Finally, we show that a switch from quantity control of pollution combined with grandfathering of pollution rights to regulation via emission charges has...

  20. Optimal pollution taxes and endogenous technological progress

    International Nuclear Information System (INIS)

    Parry, I.W.H.


    The optimal pollution tax becomes complicated when allowance is made for endogenous innovation, under a patent system. However, if anything, it is below marginal environmental damages, to counteract monopoly pricing by the patent holder, the common pool effect associated with research and a possible excess of patent holder revenue over the social benefits from innovation when environmental damages are convex. In cases where patents are weak at securing appropriability, for example when rivals can easily imitate around patented technologies, awarding research prizes or contracts is probably more efficient than raising the pollution tax. 24 refs., 4 figs

  1. Diverging patterns with endogenous labor migration. (United States)

    Reichlin, P; Rustichini, A


    "The standard neoclassical model cannot explain persistent migration flows and lack of cross-country convergence when capital and labor are mobile. Here we present a model where both phenomena may take place.... Our model is based on the Arrow-Romer approach to endogenous growth theory. We single out the importance of a (however weak) scale effect from the size of the workforce.... The main conclusion of this simple model is that lack of convergence, or even divergence, among countries is possible, even with perfect capital mobility and labor mobility." excerpt

  2. Endogenous population growth may imply chaos. (United States)

    Prskawetz, A; Feichtinger, G


    The authors consider a discrete-time neoclassical growth model with an endogenous rate of population growth. The resulting one-dimensional map for the capital intensity has a tilted z-shape. Using the theory of nonlinear dynamical systems, they obtain numerical results on the qualitative behavior of time paths for changing parameter values. Besides stable and periodic solutions, erratic time paths may result. In particular, myopic and far-sighted economies--assumed to be characterized by low and high savings rate respectively--are characterized by stable per capita capital stocks, while solutions with chaotic windows exist between these two extremes.

  3. Psychological rehabilitation of patients with endogenous disease

    Directory of Open Access Journals (Sweden)

    Tamara Kryvonis


    Full Text Available The rationale for early psychotherapeutic intervention in combination with psychopharmatherapy in patients with endogenous disorders is provided. The mechanisms of psychological defenses to deal with traumatic experience, used by personalities functioning on a psychotic level, are also described here. Characteristic behavior patterns of extended family members in terms of emotional codependence are provided. Individual pathopsychology is considered as a symptom of abnormal functioning of the family. Emphasis is placed on the importance of inclusion of family members in psychotherapeutic interaction in order to correct interpersonal relations.

  4. Endogenous Turnover of Cyanogenic Glycosides in Plants

    DEFF Research Database (Denmark)

    Picmanova, Martina

    , there is strong evidence that CNglcs serve a no less significant purpose as a transport and storage form of reduced nitrogen which may be remobilized and recycled to balance the needs of primary metabolism during certain developmental events. Reduced nitrogen from CNglcs may be recovered either via HCN refixation...... revealed the formation of glycosides of amides, carboxylic acids and "anitriles", including their di- and triglycosides, evidently derived from CNglcs. Based on results common to the three phylogenetically unrelated plant species, a recycling endogenous turnover pathway for CNglcs was suggested in which...

  5. Maintenance, endogeneous, respiration, lysis, decay and predation

    DEFF Research Database (Denmark)

    loosdrecht, Marc C. M. Van; Henze, Mogens


    mechanism is microbiologically correct. The lysis/decay model mechanism is a strongly simplified representation of reality. This paper tries to review the processes grouped under endogenous respiration in activated sludge models. Mechanisms and processes such as maintenance, lysis, internal and external...... decay, predation and death-regeneration are discussed. From recent microbial research it has become evident that cells do not die by themselves. Bacteria are however subject to predation by protozoa. Bacteria store reserve polymers that in absence of external substrate are used for growth...

  6. [Formation of endogenous pyrogen by mononuclear phagocytes]. (United States)

    Agasarov, L G


    Incubation of alveolar macrophages of rabbits and peritoneal macrophages of the abdominal cavity washing of albino mice does not lead to endogenous pyrogen release. Peritoneal macrophages obtained after peritoneal administration to mice of thioglycollate, glycogen or heterologous blood cells do not discharge pyrogen either during incubation without additional stimulation. Macrophages isolated after intraperitoneal administration of heterologous blood cells do not exhibit pyrogenic activity possibly because of a long period of time elapsed after phagocytosis of foreign agents. The triggering of pyrogen formation by macrophages can be effected by means of in vitro phagocytosis of corpuscular particles: staphylococci or heterologous blood cells.

  7. Sex reversal in vertebrates



    This special topic issue of Sexual Development gives an overview of sex reversal in vertebrates, from fishes naturally changing their sex, to rodents escaping the mammalian SRY-determining system. It offers eight up-to-date reviews on specific subjects in sex reversal, considering fishes, amphibians, reptiles, birds, marsupials, and placental mammals, including humans. The broad scope of represented animals makes this ideal for students and researchers, especially those interested in the...

  8. On thermodynamic and microscopic reversibility

    International Nuclear Information System (INIS)

    Crooks, Gavin E


    The word 'reversible' has two (apparently) distinct applications in statistical thermodynamics. A thermodynamically reversible process indicates an experimental protocol for which the entropy change is zero, whereas the principle of microscopic reversibility asserts that the probability of any trajectory of a system through phase space equals that of the time reversed trajectory. However, these two terms are actually synonymous: a thermodynamically reversible process is microscopically reversible, and vice versa

  9. Human endogenous retroviruses in neurologic disease. (United States)

    Christensen, Tove


    Endogenous retroviruses are pathogenic - in other species than the human. Disease associations for Human Endogenous RetroViruses (HERVs) are emerging, but so far an unequivocal pathogenetic cause-effect relationship has not been established. A role for HERVs has been proposed in neurological and neuropsychiatric diseases as diverse as multiple sclerosis (MS) and schizophrenia (SCZ). Particularly for MS, many aspects of the activation and involvement of specific HERV families (HERV-H/F and HERV-W/MSRV) have been reported, both for cells in the circulation and in the central nervous system. Notably envelope genes and their gene products (Envs) appear strongly associated with the disease. For SCZ, for ALS, and for HIV-associated dementia (HAD), indications are accumulating for involvement of the HERV-K family, and also HERV-H/F and/or HERV-W. Activation is reasonably a prerequisite for causality as most HERV sequences remain quiescent in non-pathological conditions, so the importance of regulatory pathways and epigenetics involved in regulating HERV activation, derepression, and also involvement of retroviral restriction factors, is emerging. HERV-directed antiretrovirals have potential as novel therapeutic paradigms in neurologic disease, particularly in MS. The possible protective or ameliorative effects of antiretroviral therapy in MS are substantiated by reports that treatment of HIV infection may be associated with a significantly decreased risk of MS. Further studies of HERVs, their role in neurologic diseases, and their potential as therapeutic targets are essential. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  10. Endogenous fibrinolysis facilitates clot retraction in vivo. (United States)

    Samson, Andre L; Alwis, Imala; Maclean, Jessica A A; Priyananda, Pramith; Hawkett, Brian; Schoenwaelder, Simone M; Jackson, Shaun P


    Clot retraction refers to the process whereby activated platelets transduce contractile forces onto the fibrin network of a thrombus, which over time increases clot density and decreases clot size. This process is considered important for promoting clot stability and maintaining blood vessel patency. Insights into the mechanisms regulating clot retraction at sites of vascular injury have been hampered by a paucity of in vivo experimental models. By pairing localized vascular injury with thrombin microinjection in the mesenteric circulation of mice, we have demonstrated that the fibrin network of thrombi progressively compacts over a 2-hour period. This was a genuine retraction process, as treating thrombi with blebbistatin to inhibit myosin IIa-mediated platelet contractility prevented shrinkage of the fibrin network. Real-time confocal analysis of fibrinolysis after recombinant tissue-type plasminogen activator (tPA) administration revealed that incomplete proteolysis of fibrin polymers markedly facilitated clot retraction. Similarly, inhibiting endogenous fibrinolysis with tranexamic acid reduced retraction of fibrin polymers in vivo. In vitro clot retraction experiments indicated that subthreshold doses of tPA facilitated clot retraction through a plasmin-dependent mechanism. These effects correlated with changes in the elastic modulus of fibrin clots. These findings define the endogenous fibrinolytic system as an important regulator of clot retraction, and show that promoting clot retraction is a novel and complementary means by which fibrinolytic enzymes can reduce thrombus size. © 2017 by The American Society of Hematology.

  11. Endogenous antispermatogenic agents: prospects for male contraception. (United States)

    Ewing, L L; Robaire, B


    A review of endogenous antispermatogenic agents as prospects for male contraception is reported. It is demonstrated that endogenous compounds exert regulatory influences at 4 major levels in the male: 1) between germ cells; 2) between Sertoli and germ cells; 3) between Leydig cells and seminiferous tubules; and 4) between the central nervous system and the testis. Efforts to interrupt spermatogenesis have failed to find application as male contraceptives for various reasons: 1) some investigators ignored the vulnerable control points by utilizing nonspecific agents; 2) others attacked a vulnerable control point but used synthetic drugs that had deleterious side effects; and 3) still others attacked a vulnerable control point with a relatively innocuous drug but used an impractical mode of drug administration. The potential for devising innovative techniques for administering relatively innocuous drugs at dosages sufficient to produce sterility without causing deleterious side effects is demonstrated. The most promising solution for the development of an antispermatogenic male contraceptive is the interference with the adenohypophyseal-gonadal axis via the subcutaneous sustained release of steroid formulations containing either androgen-danazol, androgen-progestin, or androgen-estrogen formulations. Another promising agent would be luteinizing releasing hormone agonist-androgen formulation.

  12. Insertional Polymorphisms of Endogenous Feline Leukemia Viruses (United States)

    Roca, Alfred L.; Nash, William G.; Menninger, Joan C.; Murphy, William J.; O'Brien, Stephen J.


    The number, chromosomal distribution, and insertional polymorphisms of endogenous feline leukemia viruses (enFeLVs) were determined in four domestic cats (Burmese, Egyptian Mau, Persian, and nonbreed) using fluorescent in situ hybridization and radiation hybrid mapping. Twenty-nine distinct enFeLV loci were detected across 12 of the 18 autosomes. Each cat carried enFeLV at only 9 to 16 of the loci, and many loci were heterozygous for presence of the provirus. Thus, an average of 19 autosomal copies of enFeLV were present per cat diploid genome. Only five of the autosomal enFeLV sites were present in all four cats, and at only one autosomal locus, B4q15, was enFeLV present in both homologues of all four cats. A single enFeLV occurred in the X chromosome of the Burmese cat, while three to five enFeLV proviruses occurred in each Y chromosome. The X chromosome and nine autosomal enFeLV loci were telomeric, suggesting that ectopic recombination between nonhomologous subtelomeres may contribute to enFeLV distribution. Since endogenous FeLVs may affect the infectiousness or pathogenicity of exogenous FeLVs, genomic variation in enFeLVs represents a candidate for genetic influences on FeLV leukemogenesis in cats. PMID:15767400

  13. Endogenous Technology Adoption and Medical Costs. (United States)

    Lamiraud, Karine; Lhuillery, Stephane


    Despite the claim that technology has been one of the most important drivers of healthcare spending growth over the past decades, technology variables are rarely introduced explicitly in cost equations. Furthermore, technology is often considered exogenous. Using 1996-2007 panel data on Swiss geographical areas, we assessed the impact of technology availability on per capita healthcare spending covered by basic health insurance whilst controlling for the endogeneity of health technology availability variables. Our results suggest that medical research, patent intensity and the density of employees working in the medical device industry are influential factors for the adoption of technology and can be used as instruments for technology availability variables in the cost equation. These results are similar to previous findings: CT and PET scanner adoption is associated with increased healthcare spending, whilst increased availability of percutaneous transluminal coronary angioplasty facilities is associated with reductions in per capita spending. However, our results suggest that the magnitude of these relationships is much greater in absolute value than that suggested by previous studies that did not control for the possible endogeneity of the availability of technologies. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  14. Charge-reversal nanoparticles: novel targeted drug delivery carriers. (United States)

    Chen, Xinli; Liu, Lisha; Jiang, Chen


    Spurred by significant progress in materials chemistry and drug delivery, charge-reversal nanocarriers are being developed to deliver anticancer formulations in spatial-, temporal- and dosage-controlled approaches. Charge-reversal nanoparticles can release their drug payload in response to specific stimuli that alter the charge on their surface. They can elude clearance from the circulation and be activated by protonation, enzymatic cleavage, or a molecular conformational change. In this review, we discuss the physiological basis for, and recent advances in the design of charge-reversal nanoparticles that are able to control drug biodistribution in response to specific stimuli, endogenous factors (changes in pH, redox gradients, or enzyme concentration) or exogenous factors (light or thermos-stimulation).

  15. Reversible Communicating Processes

    Directory of Open Access Journals (Sweden)

    Geoffrey Brown


    Full Text Available Reversible distributed programs have the ability to abort unproductive computation paths and backtrack, while unwinding communication that occurred in the aborted paths. While it is natural to assume that reversibility implies full state recovery (as with traditional roll-back recovery protocols, an interesting alternative is to separate backtracking from local state recovery. For example, such a model could be used to create complex transactions out of nested compensable transactions where a programmer-supplied compensation defines the work required to "unwind" a transaction. Reversible distributed computing has received considerable theoretical attention, but little reduction to practice; the few published implementations of languages supporting reversibility depend upon a high degree of central control. The objective of this paper is to demonstrate that a practical reversible distributed language can be efficiently implemented in a fully distributed manner. We discuss such a language, supporting CSP-style synchronous communication, embedded in Scala. While this language provided the motivation for the work described in this paper, our focus is upon the distributed implementation. In particular, we demonstrate that a "high-level" semantic model can be implemented using a simple point-to-point protocol.

  16. Phenotype and Functional Features of Human Telomerase Reverse Transcriptase Immortalized Human Airway Smooth Muscle Cells from Asthmatic and Non-Asthmatic Donors. (United States)

    Burgess, J K; Ketheson, A; Faiz, A; Limbert Rempel, K A; Oliver, B G; Ward, J P T; Halayko, A J


    Asthma is an obstructive respiratory disease characterised by chronic inflammation with airway hyperresponsiveness. In asthmatic airways, there is an increase in airway smooth muscle (ASM) cell bulk, which differs from non-asthmatic ASM in characteristics. This study aimed to assess the usefulness of hTERT immortalisation of human ASM cells as a research tool. Specifically we compared proliferative capacity, inflammatory mediator release and extracellular matrix (ECM) production in hTERT immortalised and parent primary ASM cells from asthmatic and non-asthmatic donors. Our studies revealed no significant differences in proliferation, IL-6 and eotaxin-1 production, or CTGF synthesis between donor-matched parent and hTERT immortalised ASM cell lines. However, deposition of ECM proteins fibronectin and fibulin-1 was significantly lower in immortalised ASM cells compared to corresponding primary cells. Notably, previously reported differences in proliferation and inflammatory mediator release between asthmatic and non-asthmatic ASM cells were retained, but excessive ECM protein deposition in asthmatic ASM cells was lost in hTERT ASM cells. This study shows that hTERT immortalised ASM cells mirror primary ASM cells in proliferation and inflammatory profile characteristics. Moreover, we demonstrate both strengths and weaknesses of this immortalised cell model as a representation of primary ASM cells for future asthma pathophysiological research.

  17. Phenotype and Functional Features of Human Telomerase Reverse Transcriptase Immortalized Human Airway Smooth Muscle Cells from Asthmatic and Non-Asthmatic Donors

    NARCIS (Netherlands)

    Burgess, J. K.; Ketheson, A.; Faiz, A.; Rempel, K. A. Limbert; Oliver, B. G.; Ward, J. P. T.; Halayko, A. J.


    Asthma is an obstructive respiratory disease characterised by chronic inflammation with airway hyperresponsiveness. In asthmatic airways, there is an increase in airway smooth muscle (ASM) cell bulk, which differs from non-asthmatic ASM in characteristics. This study aimed to assess the usefulness

  18. A Novel Aspartic Protease with HIV-1 Reverse Transcriptase Inhibitory Activity from Fresh Fruiting Bodies of the Wild Mushroom Xylaria hypoxylon

    Directory of Open Access Journals (Sweden)

    Qing-Xiu Hu


    Full Text Available A novel aspartic protease with HIV-1 RT inhibitory activity was isolated and characterized from fruiting bodies of the wild mushroom Xylaria hypoxylon. The purification protocol comprised distilled water homogenization and extraction step, three ion exchange chromatographic steps (on DEAE-cellulose, Q-Sepharose, and CM-cellulose in succession, and final purification was by FPLC on Superdex 75. The protease was adsorbed on all the three ion exchangers. It was a monomeric protein with a molecular mass of 43 kDa as estimated by SDS-PAGE and FPLC. Its N-terminal amino acid sequence was HYTELLSQVV, which exhibited no sequence homology to other proteases reported. The activity of the protease was adversely affected by Pepstatin A, indicating that it is an aspartic protease. The protease activity was maximal or nearly so in the pH range 6–8 and in the temperature range 35–60°C. The purified enzyme exhibited HIV-1 RT inhibitory activity with an IC50 value of 8.3 μM, but was devoid of antifungal, ribonuclease, and hemagglutinating activities.

  19. Evaluation of Energy Balance on Human Telomerase Reverse Transcriptase (hTERT) Alternative Splicing by Semi-quantitative RT-PCR in Human Umbilical Vein Endothelial Cells. (United States)

    Behjati, Mohaddeseh; Hashemi, Mohammad; Kazemi, Mohammad; Salehi, Mansoor; Javanmard, Shaghayegh Haghjooy


    Decreased high-energy phosphate level is involved in endothelial cell injury and dysfunction. Reduced telomerase activity in endothelial cells in parallel with reduced energy levels might be due to altered direction of alternative splicing machine as a complication of depleted energy during the process of atherosclerosis. Isolated human umbilical vein endothelial cells (HUVECs) were treated for 24 hours by oligomycine (OM) and 2-deoxy glucose (2-DG). After 24 hours, the effect of energy depletion on telomerase splicing pattern was evaluated using RT-PCR. Indeed, in both treated and untargeted cells, nitric oxide (NO) and von Willebrand factor (vWF) were measured. ATP was depleted in treated cells by 43.9% compared with control group. We observed a slight decrease in NO levels ( P = 0.09) and vWF ( P = 0.395) in the setting of 49.36% ATP depletion. In both groups, no telomerase gene expression was seen. Telomerase and housekeeping gene expression were found in positive control group (colon cancer tissue) and sample tissue. The absence of telomerase gene expression in HUVECs might be due to the mortality of these cells or the low level of telomerase gene expression in these cells under normal circumstances.

  20. Validation of tumor markers in central nervous system germ cell tumors by real-time reverse transcriptase polymerase chain reaction using formalin-fixed paraffin-embedded tissues. (United States)

    Kim, Dowhan; Lee, Da Hye; Choi, Junjeong; Shim, Kyu Won; Kim, Se Hoon


    The therapeutic protocols for treatment of germinomas and non-germinomatous germ cell tumors (NGGCTs) are completely different, so it is important to distinguish pure germinomas from NGGCTs. As it can be difficult to diagnose by morphology alone, immunohisto-chemistry (IHC) has been widely used as an ancillary test to improve diagnostic accuracy. However, IHC has limitations due to the misinterpretation of results or the aberrant loss of immunoreactivity. However, real-time RT-PCR has certain advantages over IHC, including its quantitative nature. The aim of our study was to evaluate the usefulness of real-time RT-PCR on formalin-fixed paraffin-embedded (FFPE) tissue blocks for the diagnosis of germ cell tumors of the central nervous system. We selected eight markers of germ cell tumors using a literature search, and validated them using real-time RT-PCR. Among them, POU5F1, NANOG and TGFB2 were statistically significant (P=0.05) in multiple comparisons (MANOVA) of three groups (pure germinomas, mature teratomas and malignant germ cell tumors). Two-group (pure germinomas and NGGCTs) discriminant analysis achieved a 70.0% success rate in cross-validation. We concluded that real-time RT-PCR using FFPE tissue has adequate validating power comparable to IHC in the diagnosis of central nervous system germ cell tumors; therefore, when IHC is not available, not conclusive or not informative, RT-PCR is a potential alternative to a repeat biopsy.