Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Cloning of human genes encoding novel G protein-coupled receptors

Energy Technology Data Exchange (ETDEWEB)

Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

1994-10-01

We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

Integrated cannabinoid CB1 receptor transmission within the amygdala-prefrontal cortical pathway modulates neuronal plasticity and emotional memory encoding.

Science.gov (United States)

Tan, Huibing; Lauzon, Nicole M; Bishop, Stephanie F; Bechard, Melanie A; Laviolette, Steven R

2010-06-01

The cannabinoid CB1 receptor system is functionally involved in the processing and encoding of emotionally salient sensory information, learning and memory. The CB1 receptor is found in high concentrations in brain structures that are critical for emotional processing, including the basolateral amygdala (BLA) and the medial prefrontal cortex (mPFC). In addition, synaptic plasticity in the form of long-term potentiation (LTP) within the BLA > mPFC pathway is an established correlate of exposure to emotionally salient events. We performed a series of in vivo LTP studies by applying tetanic stimulation to the BLA combined with recordings of local field potentials within prelimbic cortical (PLC) region of the rat mPFC. Systemic pretreatment with AM-251 dose dependently blocked LTP along the BLA-PLC pathway and also the behavioral acquisition of conditioned fear memories. We next performed a series of microinfusion experiments wherein CB1 receptor transmission within the BLA > PLC circuit was pharmacologically blocked. Asymmetrical, interhemispheric blockade of CB1 receptor transmission along the BLA > PLC pathway prevented the acquisition of emotionally salient associative memory. Our results indicate that coordinated CB1 receptor transmission within the BLA > PLC pathway is critically involved in the encoding of emotional fear memories and modulates neural plasticity related to the encoding of emotionally salient associative learning.

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

Csseverin inhibits apoptosis through mitochondria-mediated pathways triggered by Ca2 + dyshomeostasis in hepatocarcinoma PLC cells.

Directory of Open Access Journals (Sweden)

Mengchen Shi

2017-11-01

Full Text Available Numerous experimental and epidemiological studies have demonstrated a link between Clonorchis sinensis (C. sinensis infestation and cholangiocarcinoma (CCA as well as hepatocellular carcinoma (HCC. The underlying molecular mechanism involved in the malignancy of CCA and HCC has not yet been addressed. Csseverin, a component of the excretory/secretory products of C. sinensis (CsESPs, was confirmed to cause obvious apoptotic inhibition in the human HCC cell line PLC. However, the antiapoptotic mechanism is unclear. In the present study, we investigated the cellular features of the antiapoptotic mechanism upon transfection of the Csseverin gene.In the present study, we evaluated the effects of Csseverin gene overexpression on the apoptosis of PLC cells using an Annexin PE/7-AAD assay. Western blotting was applied to quantify the activation of caspase-3 and caspase-9, the mitochondrial translocation of Bax and the release of Cyt c upon Csseverin overexpression in PLC cells. Laser scanning confocal microscopy was used to analyze the changes of intracellular calcium. Fluorescence assay and immunofluorescence assays were performed to observe the changes of the mitochondrial permeability transition pore (MPTP.The overexpression of Csseverin in PLC cells showed apoptosis resistance after the induction of apoptosis. Additionally, the activation of caspase-3 and caspase-9 was specifically weakened in Csseverin overexpression PLC cells. The overexpression of Csseverin reduced the increase in intracellular free Ca2+, thereby inhibiting MPTP opening in PLC cells. Moreover, Bax mitochondrial translocation and the subsequent release of Cyt c were downregulated in apoptotic Csseverin overexpression PLC cells.The present findings suggest that Csseverin, a component of CsESPs, confers protection from human HCC cell apoptosis via the inactivation of membranous Ca2+ channels. Csseverin might be involved in the process of HCC through C. sinensis infestation in

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

PLC VVVF Elevator Control System

OpenAIRE

Tang, Yujian; Gui, Tianyu

2016-01-01

The aim of the thesis is to introduce the PLC VVVF elevator and its control system. The thesis can be divided into three parts. The first part is about the overview of the lift: the kinds of the lift and the structure of the lift, it shows the knowledge about the components and the operating systems of the lift. The second part is about the PLC control system, it’s about the operations of the lift from the introduction about the hardware and software of the PLC control system. And the thi...

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Modeling a Consistent Behavior of PLC-Sensors

Directory of Open Access Journals (Sweden)

E. V. Kuzmin

2014-01-01

Full Text Available The article extends the cycle of papers dedicated to programming and verificatoin of PLC-programs by LTL-specification. This approach provides the availability of correctness analysis of PLC-programs by the model checking method.The model checking method needs to construct a finite model of a PLC program. For successful verification of required properties it is important to take into consideration that not all combinations of input signals from the sensors can occur while PLC works with a control object. This fact requires more advertence to the construction of the PLC-program model.In this paper we propose to describe a consistent behavior of sensors by three groups of LTL-formulas. They will affect the program model, approximating it to the actual behavior of the PLC program. The idea of LTL-requirements is shown by an example.A PLC program is a description of reactions on input signals from sensors, switches and buttons. In constructing a PLC-program model, the approach to modeling a consistent behavior of PLC sensors allows to focus on modeling precisely these reactions without an extension of the program model by additional structures for realization of a realistic behavior of sensors. The consistent behavior of sensors is taken into account only at the stage of checking a conformity of the programming model to required properties, i. e. a property satisfaction proof for the constructed model occurs with the condition that the model contains only such executions of the program that comply with the consistent behavior of sensors.

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Development of tools for automatic generation of PLC code

CERN Document Server

Koutli, Maria; Rochez, Jacques

This Master thesis was performed at CERN and more specifically in the EN-ICE-PLC section. The Thesis describes the integration of two PLC platforms, that are based on CODESYS development tool, to the CERN defined industrial framework, UNICOS. CODESYS is a development tool for PLC programming, based on IEC 61131-3 standard, and is adopted by many PLC manufacturers. The two PLC development environments are, the SoMachine from Schneider and the TwinCAT from Beckhoff. The two CODESYS compatible PLCs, should be controlled by the SCADA system of Siemens, WinCC OA. The framework includes a library of Function Blocks (objects) for the PLC programs and a software for automatic generation of the PLC code based on this library, called UAB. The integration aimed to give a solution that is shared by both PLC platforms and was based on the PLCOpen XML scheme. The developed tools were demonstrated by creating a control application for both PLC environments and testing of the behavior of the code of the library.

Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

Directory of Open Access Journals (Sweden)

Sher L Hendrickson

2010-09-01

Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

A highly divergent gene cluster in honey bees encodes a novel silk family.

Science.gov (United States)

Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

2006-11-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

Development of tools for automatic generation of PLC code

OpenAIRE

Koutli, Maria; Chasapis, Georgios; Rochez, Jacques

2014-01-01

This Master thesis was performed at CERN and more specifically in the EN-ICE-PLC section. The Thesis describes the integration of two PLC platforms, that are based on CODESYS development tool, to the CERN defined industrial framework, UNICOS. CODESYS is a development tool for PLC programming, based on IEC 61131-3 standard, and is adopted by many PLC manufacturers. The two PLC development environments are, the SoMachine from Schneider and the TwinCAT from Beckhoff. The two CODESYS compatible P...

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

On Construction and Verification of PLC-Programs

Directory of Open Access Journals (Sweden)

E. V. Kuzmin

2012-01-01

Full Text Available We review some methods and approaches to programming discrete problems for Programmable Logic Controllers on the example of constructing PLC-programs for controling a code lock. For these approaches we evaluate the usability of the model checking method for the analysis of program correctness with respect to the automatic verification tool Cadence SMV. Some possible PLC-program vulnerabilities arising at a number approaches to programming of PLC are revealed.

Úzkopásmová PLC komunikace se standardy G3-PLC, PRIME a IEEE-1901.2

OpenAIRE

Skrášek, Tomáš

2015-01-01

Diplomová práce pojednává o standardech úzkopásmové PLC komunikace. V teoretické části jsou popsány všechny dostupné OFDM standardy, mezi něž patří G3-PLC, PRIME, IEEE-1901.2 a G.hnem. Praktická část se zabývá standardy PRIME a G3-PLC. Dále je také porovnán systém OFDM se systémem komunikace na jedné nosné frekvenci v prostředí s reálným rušením. V poslední části je popsán návrh dvou firmware pro PLC modemy Texas Instruments TMDSPLCKIT-V3, které umožňují UART komunikaci a dálkový sběr dat. K ...

Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

Science.gov (United States)

Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

2017-11-23

The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

Usage of Wifi Technology for PLC Programming

Directory of Open Access Journals (Sweden)

Jaromír ŠKUTA

2009-06-01

Full Text Available This contribution describes usage of WIFI technology for programming and parameterization of application in PLC. INSYS WLAN unit from the Microelectronics INSYS Corporation is the base of application. Software access point with using USB WIFI component WL167 is running in industrial PC. Particular PC clients are connecting into network infrastructure PLC by the help of this access point and INSYS WLAN unit. This connection allows configuring and uploading program into this PLC.

Empirical P-L-C relations for delta Scuti stars

International Nuclear Information System (INIS)

Gupta, S.K.

1978-01-01

Separate P-L-C relations have been empirically derived by sampling the delta Scuti stars according to their pulsation modes. The results based on these relations have been compared with those estimated from the model based P-L-C relations and the other existing empirical P-L-C relations. It is found that a separate P-L-C relation for each pulsation mode provides a better correspondence with observations. (Auth.)

Automatic production of Iodine-123 with PLC 135/U

International Nuclear Information System (INIS)

Moghaddam-Banaem, L.; Afarideh, H.

2004-01-01

In this project, the automatic system for production of Iodine-123 with PLC/135μ Siemens, which is designed and installed for the first time in Iran, is discussed. The PLC (Programmable Logic Controller) is used to control industrial processing, which is similar to a computer and consists of central processing unit and memory and Input/Output units. PLC receives input information from auxiliary units such as sensors, switches, etc. and software processes data in memory and then sends commands to output units such as relays, motors, etc.The target section in Iodine production consists of 8 stages. In order to be sure automation works properly the system can be operated both manually and automatically. First PLC checks Manual/Automatic switch and in the case of automatic mode, PLC runs the program in memory and processing is done automatically. For this purpose, PLC takes the value of pressures and temperatures from analog inputs and after processing them it sends commands to digital output to activate valves or vacuum pumps or heaters. In this paper the following subjects are discussed: 1) Production of Iodine 123 2) PLC structure and auxiliary boards 3) Sensors and actuators and their connection to PLC 4) Software flowchart

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

Science.gov (United States)

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

NARCIS (Netherlands)

Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

1996-01-01

Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Bacteriophage-encoded shiga toxin gene in atypical bacterial host

Directory of Open Access Journals (Sweden)

Casas Veronica

2011-07-01

Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

Application of PLC in irradiation controlling system

International Nuclear Information System (INIS)

Qin Wenjuan; Lin Baoling; Wang Mingtao; Huang Daorong; Yao Qiuguo; Gao Weixiang; Yang Kun; Xue Changlin; Pu Jiangling

2005-01-01

To deal with the multiprogramming controlling system and computer gathering and printing measure data in Irradiation Station, we adopted Programmable Logic Controller (brief: PLC) instead of PCB to control Irradiation System. PLC improved the anti-jamming ability and debugged for convenience. (authors)

Automated Formal Verification for PLC Control Systems

CERN Multimedia

Fernández Adiego, Borja

2014-01-01

Programmable Logic Controllers (PLCs) are widely used devices used in industrial control systems. Ensuring that the PLC software is compliant with its specification is a challenging task. Formal verification has become a recommended practice to ensure the correctness of the safety-critical software. However, these techniques are still not widely applied in industry due to the complexity of building formal models, which represent the system and the formalization of requirement specifications. We propose a general methodology to perform automated model checking of complex properties expressed in temporal logics (e.g. CTL, LTL) on PLC programs. This methodology is based on an Intermediate Model (IM), meant to transform PLC programs written in any of the languages described in the IEC 61131-3 standard (ST, IL, etc.) to different modeling languages of verification tools. This approach has been applied to CERN PLC programs validating the methodology.

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

Translation of PLC Programs to x86 for Simulation and Verification

CERN Document Server

Sallai, Gyula

2017-01-01

PLC programs are written in special languages, variants of the languages defined in the IEC 61131 standard. These programs cannot be directly executed on personal computers (on x86 architecture). To perform simulation of the PLC program or diagnostics during development, either a real PLC or a PLC simulator has to be used. However, these solutions are often inflexible and they do not provide appropriate performance. By generating x86-representations (semantically equivalent programs which can be executed on PCs, e.g. written in C, C++ or Java) of the PLC programs, some of these challenges could be met. PLCverif is a PLC program verification tool developed at CERN which includes a parser for Siemens PLC programs. In this work, we describe a code generator based on this parser of PLCverif. This work explores the possibilities and challenges of generating programs in widely-used general purpose languages from PLC programs, and provides a proof-of-concept code generation implementation. The presented solution dem...

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

A Classification of PLC Models and Applications

NARCIS (Netherlands)

Mader, Angelika H.; Boel, R.; Stremersch, G.

In the past years there is an increasing interest in analysing PLC applications with formal methods. The first step to this end is to get formal models of PLC applications. Meanwhile, various models for PLCs have already been introduced in the literature. In our paper we discuss several

PLC control of 50 MW klystron modulators

International Nuclear Information System (INIS)

Shang Lei; Liu Gongfa; Chen Liping; Lu Yeming; Hong Jun; Zhang Yi; Zhao Feng

2004-01-01

Upgrade project of the 50 MW klystron modulators of Hefei Light Source (HLS) was firstly introduced. PLC control system of modulators was employed to replace the old control and monitor system, which was based on relay logic circuit and manual operation method. the PLC system becomes a sub system of the new EPICS control system of HLS. Constant-current, switch-mode and high voltage power supplies were adopted to replace the old 50 Hz power supplies. The technology of modulators was improved and operation was more reliable. The design method, hardware and software of PLC control of modulators were described and the performance was presented. (authors)

The Integration of DCS I/O to an Existing PLC

Science.gov (United States)

Sadhukhan, Debashis; Mihevic, John

2013-01-01

At the NASA Glenn Research Center (GRC), Existing Programmable Logic Controller (PLC) I/O was replaced with Distributed Control System (DCS) I/O, while keeping the existing PLC sequence Logic. The reason for integration of the PLC logic and DCS I/O, along with the evaluation of the resulting system is the subject of this paper. The pros and cons of the old system and new upgrade are described, including operator workstation screen update times. Detail of the physical layout and the communication between the PLC, the DCS I/O and the operator workstations are illustrated. The complex characteristics of a central process control system and the plan to remove the PLC processors in future upgrades is also discussed.

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

Science.gov (United States)

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

Realizace úzkopásmových PLC modemů

OpenAIRE

Kubíček, Lukáš

2012-01-01

Diplomová práce se věnuje úzkopásmové technologii přenosu dat el. sítí NN (PLC) a~možnostem jejího využití v senzorových sítích. Zabývá se jak strukturou a základními vlastnostmi PLC standardu, tak možnostmi jeho uplatnění v praxi. Hlavní částí této práce je realizace PLC sítě pomocí IO ST7570 firmy STMicroelectronics. Jako příklad praktického využití PLC technologie je tato síť připojena k počítači, ve kterém jsou data ze senzoru (wattmetru) připojenému k PLC modemu ukládána pomocí aplikace ...

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

78 FR 11976 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2013-02-21

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT... (AD) for all Rolls-Royce plc (RR) RB211-524 series turbofan engines. That AD currently requires...-16724 (76 FR 40217, July 8, 2011), for all RR plc RB211-524 series turbofan engines. That AD required...

77 FR 6668 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2012-02-09

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT... all Rolls-Royce plc RB211-Trent 500 series turbofan engines. This AD requires a one-time inspection of... RB211- Trent 560A2-61 turbofan engines that have not complied with Rolls- Royce plc Service Bulletin No...

Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

PLC based control system for RAM assembly test facility

International Nuclear Information System (INIS)

Kulkarni, S.S.; Kumar, Vinaya; Chandra, Umesh

1994-01-01

The flexibility, expandability, ease of programming and diagnostic features makes the programmable logic controller (PLC) suitable for a variety of control applications in engineering system test facilities. A PLC based control system for RAM assembly test facility (RATF) and for testing the related hydraulic components is being developed and installed at BARC. This paper describes the approach taken for meeting the control requirements and illustrates the PLC software that has been developed. (author). 1 fig

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

The application of PLC in 60Co container inspection system

International Nuclear Information System (INIS)

Huang Yibin; Xiang Xincheng

2001-01-01

The author discusses the interlock technique of 60 Co container inspection system, and introduces the hardware structure and program of interlock control system using PLC. Due to adopting PLC distributed control, the system works stably and reliably. The successful application of PLC in 60 Co container inspection system has some use for reference in nuclear technology field

Parameters Evaluation of PLC Dependability and Safety

Directory of Open Access Journals (Sweden)

Juraj Zdansky

2006-01-01

Full Text Available This paper is focused on evaluation of dependability and safety parameters of PLC (Programmable Logic Controller. Achievement of requested level of these parameters is an application assumption for using PLC in control of safety critical processes. Evaluation of these parameters can be made on the base of suitable model and it can be influenced by system architecture when necessary.

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Automated turn pike using PLC and SCADA

Science.gov (United States)

Silpa Sreedhar, P.; Aiswarya, P.; Kathirvelan, J.

2017-11-01

We propose a smart turnpike based on Programmable Logic Controller (PLC) and Supervisory Control and Data Acquisition Systems (SCADA) in this paper. In this work, the basic idea is to measure the weight of the vehicles and classify them according to its weight to the respective lanes. It is difficult for the turnpike people to monitor the whole process all the time. So, this PLC based diversion system can be implemented in turnpikes to reduce the difficulties. This method will work based on weight sensors (piezo-resistive) whose output will be fed to a PLC, which will control the vehicle diversion. Using SCADA software, the whole process can be monitored from a remote area. The algorithm developed in this successfully installed in real time system.

Power Line Communication (PLC) in Space - Current Status and Outlook

Science.gov (United States)

Wolf, J.

2012-05-01

The Power Line Communication (PLC) technology as known from various terrestrial applications, e.g. in building automation, in the automotive sector and on aircraft, appears to be a promising technology for the use on spacecraft. Starting from a critical overview on existing terrestrial PLC applications with their pros and cons, the paper gives a motivation for the introduction of the PLC technology on spacecraft, discusses the potential areas where it can be applied and is highlighting the potential problem areas. A short overview of on-going ESA PLC activities is provided and an outlook is given.

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

PLC-based mode multi/demultiplexers for mode division multiplexing

Science.gov (United States)

Saitoh, Kunimasa; Hanzawa, Nobutomo; Sakamoto, Taiji; Fujisawa, Takeshi; Yamashita, Yoko; Matsui, Takashi; Tsujikawa, Kyozo; Nakajima, Kazuhide

2017-02-01

Recently developed PLC-based mode multi/demultiplexers (MUX/DEMUXs) for mode division multiplexing (MDM) transmission are reviewed. We firstly show the operation principle and basic characteristics of PLC-based MUX/DEMUXs with an asymmetric directional coupler (ADC). We then demonstrate the 3-mode (2LP-mode) multiplexing of the LP01, LP11a, and LP11b modes by using fabricated PLC-based mode MUX/DEMUX on one chip. In order to excite LP11b mode in the same plane, a PLC-based LP11 mode rotator is introduced. Finally, we show the PLC-based 6-mode (4LP-mode) MUX/DEMUX with a uniform height by using ADCs, LP11 mode rotators, and tapered waveguides. It is shown that the LP21a mode can be excited from the LP11b mode by using ADC, and the two nearly degenerated LP21b and LP02 modes can be (de)multiplexed separately by using tapered mode converter from E13 (E31) mode to LP21b (LP02) mode.

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

Applying Model Checking to Industrial-Sized PLC Programs

CERN Document Server

AUTHOR|(CDS)2079190; Darvas, Daniel; Blanco Vinuela, Enrique; Tournier, Jean-Charles; Bliudze, Simon; Blech, Jan Olaf; Gonzalez Suarez, Victor M

2015-01-01

Programmable logic controllers (PLCs) are embedded computers widely used in industrial control systems. Ensuring that a PLC software complies with its specification is a challenging task. Formal verification has become a recommended practice to ensure the correctness of safety-critical software but is still underused in industry due to the complexity of building and managing formal models of real applications. In this paper, we propose a general methodology to perform automated model checking of complex properties expressed in temporal logics (\\eg CTL, LTL) on PLC programs. This methodology is based on an intermediate model (IM), meant to transform PLC programs written in various standard languages (ST, SFC, etc.) to different modeling languages of verification tools. We present the syntax and semantics of the IM and the transformation rules of the ST and SFC languages to the nuXmv model checker passing through the intermediate model. Finally, two real cases studies of \\CERN PLC programs, written mainly in th...

Automatic control model of water filling system with Allen Bradley Micrologix 1400 PLC

Science.gov (United States)

Harahap, R.; Adyatma, AF; Fahmi, F.

2018-02-01

Programmable Logic Controller or PLC today plays an important role in most industrial control systems. PLC usage can be encountered in almost all fields of industry, not only in the manufacturing world but also on many other things such as elevators in office buildings, hotels hospitals, and others. PLC is an electronic control tool that operates in logic that its programming can be modified with relative ease. As with any controller in general, the PLC processes input signals to further discharge output according to the desired program. PLC usage is very broad because of its high reliability, can be reprogrammed or modified with relative ease, and very helpful in the tracking troubleshooting. One type of existing PLC is Allen Bradley PLC. Allen Bradley PLC program is commonly used in various industries. PLC Allen Bradley (AB) has several types, and one of them is the type of Micrologic 1400. In this study we design a system as a comparison with the conventional system. For that to explore the use of a PLC program which will be supported by a simulator tool, including a program to RSLogic 500, how to programming, monitoring via RSView32, and modification. It is expected to understand the application aspect of operation and programming of this specific PLC and its potential. The purpose of this research is to design water filling automation system by using Allen Bradley Micrologic 1400 type 1766-L32BXB PLC, empowering the use of Allen Bradley Micrologic 1400 PLC and to regulate the desired process to obtain efficiency and effectiveness compared with conventional system arrangement using Relay.

Salicylic acid modulates levels of phosphoinositide dependent-phospholipase C substrates and products to remodel the Arabidopsis suspension cell transcriptome

Directory of Open Access Journals (Sweden)

Eric eRuelland

2014-11-01

Full Text Available Basal phosphoinositide-dependent phospholipase C (PI-PLC activity controls gene expression in Arabidopsis suspension cells and seedlings. PI-PLC catalyzes the production of phosphorylated inositol and diacylglycerol (DAG from phosphoinositides. It is not known how PI-PLC regulates the transcriptome although the action of DAG-kinase (DGK on DAG immediately downstream from PI-PLC is responsible for some of the regulation. We previously established a list of genes whose expression is affected in the presence of PI-PLC inhibitors. Here this list of genes was used as a signature in similarity searches of curated plant hormone response transcriptome data. The strongest correlations obtained with the inhibited PI-PLC signature were with salicylic acid (SA treatments. We confirm here that in Arabidopsis suspension cells SA treatment leads to an increase in phosphoinositides, then demonstrate that SA leads to a significant 20% decrease in phosphatidic acid, indicative of a decrease in PI-PLC products. Previous sets of microarray data were re-assessed. The SA response of one set of genes was dependent on phosphoinositides. Alterations in the levels of a second set of genes, mostly SA-repressed genes, could be related to decreases in PI-PLC products that occur in response to SA action. Together, the two groups of genes comprise at least 40% of all SA-responsive genes. Overall these two groups of genes are distinct in the functional categories of the proteins they encode, their promoter cis-elements and their regulation by DGK or phospholipase D. SA-regulated genes dependent on phosphoinositides are typical SA response genes while those with an SA response that is possibly dependent on PI-PLC products are less SA-specific. We propose a model in which SA inhibits PI-PLC activity and alters levels of PI-PLC products and substrates, thereby regulating gene expression divergently.

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Transacsys PLC - Final Results

CERN Multimedia

2002-01-01

Final results from Transacsys PLC. A subsidary of this company was set up to develop the CERN EDH system into a commercial product but incurred too much financial loss so the project was cancelled (1/2 page).

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Electromagnetic compatibility of PLC adapters for in-home/domestic networks

Science.gov (United States)

Potisk, Lukas; Hallon, Jozef; Orgon, Milos; Fujdiak, Radek

2018-01-01

The use of programable logic controllers (PLC) technology in electrical networks 230 V causes electromagnetic radiation that interferes with other electrical equipment connected to the network [1-4]. Therefore, this article describes the issues of electromagnetic compatibility (EMC) of new PLC adapters used in IP broadband services in a multi-user environment. The measurements of disturbing electromagnetic field originated in PLC adapters were made in a certified laboratory EMC (laboratory of electromagnetic compatibility) in the Institute of Electrical Engineering at Faculty of Electrical Engineering and Information Technology of the Slovak University of Technology in Bratislava. The measured spectra of the radiated electromagnetic field will be compared with the results obtained when testing older PLC modems [5].

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

Optical interconnection for a polymeric PLC device using simple positional alignment.

Science.gov (United States)

Ryu, Jin Hwa; Kim, Po Jin; Cho, Cheon Soo; Lee, El-Hang; Kim, Chang-Seok; Jeong, Myung Yung

2011-04-25

This study proposes a simple cost-effective method of optical interconnection between a planar lightwave circuit (PLC) device chip and an optical fiber. It was conducted to minimize and overcome the coupling loss caused by lateral offset which is due to the process tolerance and the dimensional limitation existing between PLC device chips and fiber array blocks with groove structures. A PLC device chip and a fiber array block were simultaneously fabricated in a series of polymer replication processes using the original master. The dimensions (i.e., width and thickness) of the under-clad of the PLC device chip were identical to those of the fiber array block. The PLC device chip and optical fiber were aligned by simple positional control for the vertical direction of the PLC device chip under a particular condition. The insertion loss of the proposed 1 x 2 multimode optical splitter device interconnection was 4.0 dB at 850 nm and the coupling loss was below 0.1 dB compared with single-fiber based active alignment.

Practical application with plc in manipulation of a robotic arm

Directory of Open Access Journals (Sweden)

Cristian Barz

2014-12-01

Full Text Available This paper presents the use of a robotic arm PLC Siemens in order not using CNC commands. This is done by programming the PLC ladder diagram language that makes movement on the three axes of the arm by means of stepper motors. Required command console PLC is built with the help of a touch screen HMI Weintek. In the user interface are introduced distances and displacement speeds on the three axes.

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

Reliability Analysis for Safety Grade PLC(POSAFE-Q)

International Nuclear Information System (INIS)

Choi, Kyung Chul; Song, Seung Whan; Park, Gang Min; Hwang, Sung Jae

2012-01-01

Safety Grade PLC(Programmable Logic Controller), POSAFE-Q, was developed recently in accordance with nuclear regulatory and requirements. In this paper, describe reliability analysis for digital safety grade PLC (especially POSAFE-Q). Reliability analysis scope is Prediction, Calculation of MTBF (Mean Time Between Failure), FMEA (Failure Mode Effect Analysis), PFD (Probability of Failure on Demand). (author)

Full-automatic Special Drill Hydraulic System and PLC Control

Directory of Open Access Journals (Sweden)

Tian Xue Jun

2016-01-01

Full Text Available A hydraulic-driven and PLC full-automatic special drill is introduced, working principle of the hydraulic system and PLC control system are analyzed and designed, this equipment has the advantages of high efficiency, superior quality and low cost etc.

The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

Directory of Open Access Journals (Sweden)

LUCIA KUSUMAWATI

2013-09-01

Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

Science.gov (United States)

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

Efficient Implementation of a Symbol Timing Estimator for Broadband PLC.

Science.gov (United States)

Nombela, Francisco; García, Enrique; Mateos, Raúl; Hernández, Álvaro

2015-08-21

Broadband Power Line Communications (PLC) have taken advantage of the research advances in multi-carrier modulations to mitigate frequency selective fading, and their adoption opens up a myriad of applications in the field of sensory and automation systems, multimedia connectivity or smart spaces. Nonetheless, the use of these multi-carrier modulations, such as Wavelet-OFDM, requires a highly accurate symbol timing estimation for reliably recovering of transmitted data. Furthermore, the PLC channel presents some particularities that prevent the direct use of previous synchronization algorithms proposed in wireless communication systems. Therefore more research effort should be involved in the design and implementation of novel and robust synchronization algorithms for PLC, thus enabling real-time synchronization. This paper proposes a symbol timing estimator for broadband PLC based on cross-correlation with multilevel complementary sequences or Zadoff-Chu sequences and its efficient implementation in a FPGA; the obtained results show a 90% of success rate in symbol timing estimation for a certain PLC channel model and a reduced resource consumption for its implementation in a Xilinx Kyntex FPGA.

Efficient Implementation of a Symbol Timing Estimator for Broadband PLC

Directory of Open Access Journals (Sweden)

Francisco Nombela

2015-08-01

Full Text Available Broadband Power Line Communications (PLC have taken advantage of the research advances in multi-carrier modulations to mitigate frequency selective fading, and their adoption opens up a myriad of applications in the field of sensory and automation systems, multimedia connectivity or smart spaces. Nonetheless, the use of these multi-carrier modulations, such as Wavelet-OFDM, requires a highly accurate symbol timing estimation for reliably recovering of transmitted data. Furthermore, the PLC channel presents some particularities that prevent the direct use of previous synchronization algorithms proposed in wireless communication systems. Therefore more research effort should be involved in the design and implementation of novel and robust synchronization algorithms for PLC, thus enabling real-time synchronization. This paper proposes a symbol timing estimator for broadband PLC based on cross-correlation with multilevel complementary sequences or Zadoff-Chu sequences and its efficient implementation in a FPGA; the obtained results show a 90% of success rate in symbol timing estimation for a certain PLC channel model and a reduced resource consumption for its implementation in a Xilinx Kyntex FPGA.

Silica-based PLC with heterogeneously-integrated PDs for one-chip DP-QPSK receiver.

Science.gov (United States)

Kurata, Yu; Nasu, Yusuke; Tamura, Munehisa; Kasahara, Ryoichi; Aozasa, Shinichi; Mizuno, Takayuki; Yokoyama, Haruki; Tsunashima, Satoshi; Muramoto, Yoshifumi

2012-12-10

To realize a DP-QPSK receiver PLC, we heterogeneously integrated eight high-speed PDs on a silica-based PLC platform with a PBS, 90-degree optical hybrids and a VOA. The use of a 2.5%-Δ waveguide reduced the receiver PLC size to 11 mm x 11 mm. We successfully demonstrated 32 Gbaud DP-QPSK signal demodulation with the receiver PLC.

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Control Systems of Rubber Dryer Machinery Components Using Programmable Logic Control (PLC)

Science.gov (United States)

Hendra; Yulianto, A. S.; Indriani, A.; Hernadewita; Hermiyetti

2018-02-01

Application of programmable logic control (PLC) is widely used on the control systems in the many field engineering such as automotive, aviation, food processing and other industries [1-2]. PLC is simply program to control many automatic activity, easy to use, flexible and others. PLC using the ladder program to solve and regulated the control system component. In previous research, PLC was used for control system of rotary dryer machine. In this paper PLC are used for control system of motion component in the rubber dryer machinery. Component of rubber dryer machine is motors, gearbox, sprocket, heater, drying chamber and bearing. Principle working of rubber dryer machinery is wet rubber moving into the drying chamber by sprocket. Sprocket is driven by motors that conducted by PLC to moving and set of wet rubber on the drying chamber. Drying system uses greenhouse effect by making hanger dryer design in the form of line path. In this paper focused on motion control system motors and sensors drying rubber using PLC. The results show that control system of rubber dryer machinery can work in accordance control input and the time required to dry the rubber.

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

OpenAIRE

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-01-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

Directory of Open Access Journals (Sweden)

Leontina GURGU

2012-12-01

Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

DEFF Research Database (Denmark)

Kjaerulff, S; Davey, William John; Nielsen, O

1994-01-01

We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

Development of Multipurpose PLC trainer for the simulator of reactor safety system

International Nuclear Information System (INIS)

Syaiful Bakhri; Deswandri; Ahmad Abtokhi

2014-01-01

PLC becomes one of the essential components for the current type of reactor which based on digital instrumentation and control. Several studies have demonstrated the promising results including the implementation of PLC's for RSG-GAS research reactor. However, research for the safety and reliability analysis can not be carried out freely in the existing systems.Therefore, this research aims to develop a PLC trainer employing micro PLC OMRON CP1MA which can be useful for simulator of various topics in reactor safety. Two experimental tests were carried out to show the PLC’s performances. The first experimental testing implementing reactor protection system of research reactor RSG-GAS shows the capacity of PLC system to identify the initiator of the SCRAM logic as well as giving a promptly response. Secondly, the application of PLC to controls the water level in dual reservoir system simulation, demonstrates the simplicity of the operation and design while maintaining the best performances. (author)

A study of PLC system vulnerability checklists in nuclear power plants

International Nuclear Information System (INIS)

Cha, Ki Jong; Cho, Gi Ho; Ahn, Jaeh Young; Kim, Young Mi; Kwon, Yong Il

2012-01-01

Because the design of the PLCs (Programmable Logic Controller) in the I and C (Instrument and Control) systems for NPP (Nuclear Power Plant) were carried out independently, the problems of cyber security were not addressed in the PLC system designs. Recently, the analysis and the countermeasure development for the PLC systems became mandatory due to the developments in cyber attack techniques and the increasingly revealed vulnerability to such attacks. A comparative analysis on the cyber security checklist of PLC in industry control system and in NPP systems was carried out, and in this paper, the cyber security regulatory trend and the PLC usage status are described

A study of PLC system vulnerability checklists in nuclear power plants

Energy Technology Data Exchange (ETDEWEB)

Cha, Ki Jong; Cho, Gi Ho; Ahn, Jaeh Young [Convergence technology Research Commercialization Center, Daejeon (Korea, Republic of); Kim, Young Mi; Kwon, Yong Il [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

2012-10-15

Because the design of the PLCs (Programmable Logic Controller) in the I and C (Instrument and Control) systems for NPP (Nuclear Power Plant) were carried out independently, the problems of cyber security were not addressed in the PLC system designs. Recently, the analysis and the countermeasure development for the PLC systems became mandatory due to the developments in cyber attack techniques and the increasingly revealed vulnerability to such attacks. A comparative analysis on the cyber security checklist of PLC in industry control system and in NPP systems was carried out, and in this paper, the cyber security regulatory trend and the PLC usage status are described.

Valyl-tRNA synthetase gene of Escherichia coli K12: Molecular genetic characterization and homology within a family of aminoacyl-tRNA synthetases

International Nuclear Information System (INIS)

Heck, J.D. III.

1988-01-01

This work reports the subcloning and characterization of the molecular elements necessary for the expression of the Escherichia coli valS gene encoding valyl-tRNA synthetase. The valS gene was subcloned from plasmid pLC26-22 by genetic complementation of a valS ts strain. The DNA region encoding the valS structural gene was determined by in vitro coupled transcription-translation assays. Cells transformed with a plasmid containing a full length copy of the valS gene enhanced in vivo valyl-tRNA synthetase specific activity twelve-fold. DNA sequences flanking the valS structural gene are presented. The transcription initiation sites of the valS gene were determined, in vivo and in vitro, by S1 nuclease protection studies, primer-extension analysis and both [α- 32 P]labeled and [γ- 32 P]end-labeled in vitro transcription assays. The DNA sequence of the valS gene of Escherichia coli has been determined. Significant similarity at the primary sequence level was detected between valyl-tRNA synthetase of E. coli and other known branched-chain aminoacyl-tRNA synthetases. An extended open reading frame (ORF) encoded on the DNA strand opposite the valS structural gene is described

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Using of Finite Automation at Programming PLC

Directory of Open Access Journals (Sweden)

Karol Rastocny

2004-01-01

Full Text Available The paper is concerning with systematic advances at programming programmable logic controllers (PLC, which comes out from algebraic description of behaviour of sequential circuit, in the way of finite automaton. This kind of access is streamlining the work of a programmer and enabling to use formalisms in the of whole process of system development, that is from process of analysing demands to process of verification and validation created program. The paper considers about using of ladder diagram at programming PLC.

Webová aplikace v PLC PFC200

OpenAIRE

Michalík, David

2017-01-01

Tato bakalářská práce se věnuje implementaci vlastního způsobu ovládání vstupů, výstupů a paměti PLC PFC200 od firmy WAGO pomocí dynamického webového rozhraní. Součástí práce je popis PLC, způsobů jeho ovládání, rešerše volně dostupných webových serverů pro Linux a popis metod pro vytvoření real-time ovládání. Výstupem je webová aplikace běžící na webovém serveru v PLC, využívající vlastní runtime systém formou daemon programů. This bachelor’s thesis is mainly focused on implementation of ...

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

Science.gov (United States)

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

Programmable logic controller (PLC) for safety systems of nuclear plants

International Nuclear Information System (INIS)

Sen, S.K.; Karmakar, G.; Joseph, Jose; Patil, R.K.

2002-01-01

Full text: A programmable logic controller (PLC) has been developed by RCnD, BARC for use in the safety critical systems in nuclear power plants. This PLC uses qualified hardware developed in RCnD for use in NPP. The programming software conforms to IEC-61131 part 3. The application programming is done on function block diagram (FBD) editor and the FBD is automatically converted into code in high level language (C / C++). This feature makes the application easily decipherable and therefore easily subjected to reviews and other validation techniques. The key to make quality software for use in nuclear systems is to enforce various standards in the design and development of the software, something, which is not possible to do with a commercially available PLC. This PLC with its software completely transparent lends itself to rigorous verification and validation easily

The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

International Nuclear Information System (INIS)

Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

2007-01-01

The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

Trends in Control Area of PLC Reliability and Safety Parameters

Directory of Open Access Journals (Sweden)

Juraj Zdansky

2008-01-01

Full Text Available Extension of the PLC application possibilities is closely related to increase of reliability and safety parameters. If the requirement of reliability and safety parameters will be suitable, the PLC could by implemented to specific applications such the safety-related processes control. The goal of this article is to show the way which producers are approaching to increase PLC`s reliability and safety parameters. The second goal is to analyze these parameters for range of present choice and describe the possibility how the reliability and safety parameters can be affected.

Analysis of the PLC object model in the PF linac

International Nuclear Information System (INIS)

Abe, Isamu; Shirakawa, Akihiro; Nakahara, Kazuo; Tanaka, Masahiko

1995-01-01

Device controllers (front end) for the KEK PF Linac, which has been operated for more than ten years, had to be renewed, because there is no longer support from hardware manufacturer. To reduce maintenance costs, device controllers are planed to be replaced by PLC (Programmable Logic Controller). Investigations launched in the late 1994s for the PLC have carried out in order to make sure of the I/O stability and network possibilities. In this paper, the software for the PLC is discussed based on the OOP concept. (author)

Development of radioactive source scanner based on PLC

International Nuclear Information System (INIS)

Yang Guogui; Gao Xiang; Guo Hongli

2013-01-01

The radioactive radial uniformity of 68 Ge line radioactive sources is a critical quality parameter. The radioactive source scanner with linear scanning function is developed by making use of high-speed pulse counters, high-speed pulse output ports, and the powerful instruction system of Siemens S7-200 series programmable logic controller (PLC). A computer used as a host computer of the instrument communicate with. the PLC by point to point interface (PPI) protocol, The instrument with functions of data collection, transmission, displaying, saving, motion control and instrument parameter settings, can be used to measure the radioactive radial uniformity and total activity of line radioactive source. The advantages of Using the PLC to develop nuclear instrumentation are development speed, strong anti-interference ability, and low-cost. This paper mainly describes the control system implementation and feature of the instrument. (authors)

Úzkopásmová PLC komunikace pro Smart Metering

OpenAIRE

Kubů, Jiří

2016-01-01

Tato bakalářská práce se zabývá úzkopásmovou PLC komunikací. V práci je popsán základní princip, rozdělení PLC komunikace, historie technologie, využívané komunikační standardy a rušení ovlivňující datovou komunikaci této technologie. V rámci této práce byly provedeny i experimentální měření v reálném prostředí s modemy od firmy Texas Instruments C2000 PLC TMDSPLCKITV4 a C2000 PLC TMDSPLCKIT-V3. Výsledky tohoto měření jsou reálné přenosové rychlosti. Dále byla vytvořena aplikace pro dálkový s...

Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

Science.gov (United States)

Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

2016-01-01

Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

Construction and Verification of PLC LD-programs by LTL-specification

Directory of Open Access Journals (Sweden)

E. V. Kuzmin

2013-01-01

Full Text Available An approach to construction and verification of PLC LD-programs for discrete problems is proposed. For the specification of the program behavior, we use the linear-time temporal logic LTL. Programming is carried out in the LD-language (Ladder Diagram according to an LTL-specification. The correctness analysis of an LTL-specification is carried out by the symbolic model checking tool Cadence SMV. A new approach to programming and verification of PLC LD-programs is shown by an example. For a discrete problem, we give a LD-program, its LTL-specification and an SMV-model. The purpose of the article is to describe an approach to programming PLC, which would provide a possibility of LD-program correctness analysis by the model checking method. Under the proposed approach, the change of the value of each program variable is described by a pair of LTL-formulas. The first LTL-formula describes situations which increase the value of the corresponding variable, the second LTL-formula specifies conditions leading to a decrease of the variable value. The LTL-formulas (used for speci- fication of the corresponding variable behavior are constructive in the sense that they construct the PLC-program (LD-program, which satisfies temporal properties expressed by these formulas. Thus, the programming of PLC is reduced to the construction of LTLspecification of the behavior of each program variable. In addition, an SMV-model of a PLC LD-program is constructed according to LTL-specification. Then, the SMV-model is analysed by the symbolic model checking tool Cadence SMV.

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

PLC/DTAM Software Programs for Pumping Instrumentation and Control Skid X

International Nuclear Information System (INIS)

HORNER, T.M.

2001-01-01

This document describes the software programs for the Allen-Bradley SLC 500 programmable logic controller (PLC) and the Allen-Bradley DTAM PLUS operator interface module used on Pumping Instrumentation and Control (PIC) skid ''X''. The software programs for the SLC 500 and DTAM Plus are based on the core programs provided by Allen-Bradley. The PLC and DTAM software programs on skid ''D'' for SX-104 are the baseline programs. These baselines will be tailored for each individual BY-farm skid. An Acceptance Test Procedure (ATP) and an Operational Test Procedure (OTP) verify that the software programs meet the specific requirements for BY-105 pumping. This document represents the final PLC and DTAM programs for PIC skid ''X'' at BY-105. These programs were printed out after the performance of the OTP. The OTP acts as the final qualification test for the software programs. Functional requirements and details of the PLC ladder logic are described in this document. The final programs entered into the PLC and DTAM Plus are included as Appendices to this document

77 FR 13485 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2012-03-07

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT... series turbofan engines. This AD requires inspecting the front combustion liner head section for cracking.... (c) Applicability This AD applies to Rolls-Royce plc (RR) RB211-Trent 800 turbofan engines, all...

Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

Directory of Open Access Journals (Sweden)

Yannick Pauchet

Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

Effects of TCDD on the expression of nuclear encoded mitochondrial genes

International Nuclear Information System (INIS)

Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

2010-01-01

Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

Modelling and Formal Verification of Timing Aspects in Large PLC Programs

CERN Document Server

Fernandez Adiego, B; Blanco Vinuela, E; Tournier, J-C; Gonzalez Suarez, V M; Blech, J O

2014-01-01

One of the main obstacle that prevents model checking from being widely used in industrial control systems is the complexity of building formal models out of PLC programs, especially when timing aspects need to be integrated. This paper brings an answer to this obstacle by proposing a methodology to model and verify timing aspects of PLC programs. Two approaches are proposed to allow the users to balance the trade-off between the complexity of the model, i.e. its number of states, and the set of specifications possible to be verified. A tool supporting the methodology which allows to produce models for different model checkers directly from PLC programs has been developed. Verification of timing aspects for real-life PLC programs are presented in this paper using NuSMV.

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

Science.gov (United States)

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

77 FR 73268 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2012-12-10

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT... certain Rolls-Royce plc (RR) RB211-Trent 900 series turbofan engines. This AD requires inspection of the... turbofan engines, all serial numbers. (d) Reason This AD was prompted by a Trent 900 engine experiencing a...

77 FR 56760 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2012-09-14

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT... all Rolls-Royce plc (RR) RB211-Trent 800 series turbofan engines. This AD requires removing from...-17, 892-17, 892B-17, and 895-17 turbofan engines that have an intermediate pressure (IP) turbine disc...

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

Science.gov (United States)

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

NARCIS (Netherlands)

Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

2008-01-01

Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Emulation of Narrowband Powerline Data Transmission Channels and Evaluation of PLC Systems

OpenAIRE

Liu, Wenqing

2013-01-01

This work proposes advanced emulation of the physical layer behavior of NB-PLC channels and the application of a channel emulator for the evaluation of NB-PLC systems. In addition, test procedures and reference channels are proposed to improve efficiency and accuracy in the system evaluation and classification. This work shows that the channel emulator-based solution opens new ways toward flexible, reliable and technology-independent performance assessment of PLC modems.

Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

DEFF Research Database (Denmark)

Kovacs, J A; Powell, F; Edman, J C

1993-01-01

hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

78 FR 17297 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2013-03-21

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT... (AD) for all Rolls-Royce plc (RR) RB211 Trent 500 series turbofan engines. That AD currently requires... 9, 2012), for all RR RB211 Trent 500 series turbofan engines. That AD requires a one-time inspection...

WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

Science.gov (United States)

Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

2016-06-01

The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

77 FR 32007 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2012-05-31

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT... all Rolls-Royce plc (RR) RB211-Trent 800 series turbofan engines. This AD requires removal from...-17, 877- 17, 884-17, 884B-17, 892-17, 892B-17, and 895-17 turbofan engines. (d) Reason This AD was...

78 FR 6749 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2013-01-31

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT... (AD) for all Rolls-Royce plc (RR) models RB211 Trent 768-60, 772-60, and 772B-60 turbofan engines... 772B-60 turbofan engines. (d) Reason This AD was prompted by low-pressure (LP) compressor blade partial...

Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

International Nuclear Information System (INIS)

Nebohacova, M.

2000-01-01

Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

Upgradation in SCADA and PLC of existing LN_2 control system for SST-1

International Nuclear Information System (INIS)

Panchal, Pradip; Mahesuria, Gaurang; Panchal, Rohit; Patel, Rakesh; Sonara, Dashrath; Pitroda, Dipen; Nimavat, Hiren; Tanna, Vipul; Pradhan, Subrata

2016-01-01

Highlights: • The control system of LN_2 Management System of SST-1 is designed on PLC and SCADA. • The implementation and results of up-gradation in PLC and SCADA are reported. • The up-gradation in PLC and SCADA has improved the reliability & availability of SST-1 LN_2 system. - Abstract: Helium Refrigerator/Liquefier system of Steady State Superconducting Tokamak (SST-1) incorporates Liquid Nitrogen (LN_2) pre-cooling system. LN_2 is used for 80 K thermal shields of SST-1, current feeder system and integrated flow distribution and control system. The LN_2 management system is distributed system and requires automatic control. Initially LN_2 control system had Citect based Supervisory Control and Data Acquisition (SCADA) and Koyo make Programmable Logic Controller (PLC). With the passage of time and due to unavailability of their hardware, it is being obsoleted. So, the requirements of new PLC and SCADA systems have been envisaged to make uninterruptable operation of SST-1 cryogenic system. Therefore, Wonderware SCADA and Schneider Electric make PLC is programmed to replace Citect SCADA and Koyo PLC. New control features have been added in upgraded control system for better management of LN_2 system. This upgradation of SCADA and PLC is completed, tested successfully and in operation. Operational performance highlights of the new upgraded system are presented in this paper.

Development and Application of POSAFE-Q PLC Platform

International Nuclear Information System (INIS)

Lee, MyeongKyun; Song, SeungWhan; Yun, DongHwa

2012-01-01

The Safety-grade Programmable Logic Controller (PLC) Platform named POSAFE-Q was developed so that it meets the requirements of the Safety Class 1E, Quality Class 1, and Seismic Category I. Development process of the POSAFE-Q software developed in accordance with software life cycles. The POSAFE-Q meets safety and suitability for design are based on digital I and C laws, guidelines and technical standards. The POSAFE-Q PLC obtained approval for Topical Report from the Nuclear Safety and Security Commission in Korea. (author)

Towards Designing PLC Networks for Ubiquitous Connectivity in Enterprises

OpenAIRE

Ali, Kamran; Pefkianakis, Ioannis; Liu, Alex X.; Kim, Kyu-Han

2016-01-01

Powerline communication (PLC) provides inexpensive, secure and high speed network connectivity, by leveraging the existing power distribution networks inside the buildings. While PLC technology has the potential to improve connectivity and is considered a key enabler for sensing, control, and automation applications in enterprises, it has been mainly deployed for improving connectivity in homes. Deploying PLCs in enterprises is more challenging since the power distribution network is more com...

Application of PLC in the crane control system of MJTR

International Nuclear Information System (INIS)

Li Ziqiang; Ji Xiangdong

2004-01-01

The paper describes the application of PLC (Programmable Controller) in the control system of the bridge crane. PLC is the essential part of the control system, which uses some equipment such as frequency transformer and photoelectric switch to implement remote, manual and automatic centering functions. This paper emphasizes the programming of the automatic hole centering

Wavelet-OFDM Signal Transmission Characteristics with High-Speed PLC Modem

Science.gov (United States)

Nakagawa, Kenichi; Tokuda, Masamitsu; Igata, Yuji

In this paper, we measured the interference immunity characteristics of high-speed PLC system using Wavelet-OFDM when the narrowband conducted interference wave signal was injected. As the results, it was clear that (1) measured PHY rate at the all frequency band hardly decreased in C/I (Carrier to Interference ratio) of above 20dB, but began to decrease rapidly in C/I of below 0dB when the interference signal was injected in the frequency band of high-speed PLC signal, (2) when C/I became from 0dB to -20dB, the measured PHY rate at the frequency existing the notch band were improved around 10Mbps than that at the frequency not existing the notch band, (3) when the narrowband interference wave was injected outside of frequency band of high-speed PLC signal, the measured PHY rate did not decrease than that in each notch band. Therefore, it was revealed that high-speed PLC system using Wavelet-OFDM had good interference immunity characteristics.

Machine interlock and protection system based on PLC for the SSRF linac

International Nuclear Information System (INIS)

Chou Wenjun; Zhou Dayong; Chen Jianfeng; Shen Liren; Liu Yajuan

2008-01-01

This paper describes a machine interlock and protection system used for accelerators based on EPICS (Experimental physics and industrial control system). The system is composed of a front-end computer and an FM-3R logic controller PLC. The alarm signal is passed by the hardware directly, and would be deal with PLC. The reporting, recording and analyst of the event are accomplished by EPICS control software. And PLC is linked to the EPICS by Internet. (authors)

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

77 FR 75831 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2012-12-26

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT... certain serial numbers (S/Ns) of Rolls-Royce plc (RR) RB211-Trent 768-60, 772- 60, and 772B-60 turbofan... use any of the RB211-Trent 768-60, 772-60, and 772B-60 turbofan engines listed by S/N in this AD...

Application of Kingview and PLC in friction durability test system

Science.gov (United States)

Gao, Yinhan; Cui, Jing; Yang, Kaiyu; Ke, Hui; Song, Bing

2013-01-01

Using PLC and Kingview software, a friction durability test system is designed. The overall program, hardware configuration, software structure and monitoring interface are described in detail. PLC ensures the stability of data acquisition, and the KingView software makes the HMI easy to manipulate. The practical application shows that the proposed system is cheap, economical and highly reliable.

76 FR 65136 - Airworthiness Directives; Rolls-Royce plc (RR) Turbofan Engines

Science.gov (United States)

2011-10-20

... Airworthiness Directives; Rolls-Royce plc (RR) Turbofan Engines AGENCY: Federal Aviation Administration (FAA... information identified in this AD, contact Rolls-Royce plc, Corporate Communications, P.O. Box 31, Derby... 8, 2011, to perform the inspection. Costs of Compliance Based on the service information, we...

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

Science.gov (United States)

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

Directory of Open Access Journals (Sweden)

Bertin Stéphane

2011-10-01

Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

Science.gov (United States)

Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

2011-03-01

Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

78 FR 54149 - Airworthiness Directives; Rolls-Royce plc (RR) Turbofan Engines

Science.gov (United States)

2013-09-03

... Airworthiness Directives; Rolls-Royce plc (RR) Turbofan Engines AGENCY: Federal Aviation Administration (FAA... service information identified in this AD, contact Rolls-Royce plc, Corporate Communications, P.O. Box 31... per hour. Replacement parts are estimated to cost about $2,271 per engine. Based on these figures, we...

Normal and pathological NMR imaging aspects of the posterolateral corner (PLC) of the knee

International Nuclear Information System (INIS)

Tardieu, M.; Lazennec, J.Y.; Christel, P.; Brasseur, J.L.; Roger, B.; Grenier, P.

1995-01-01

The purpose of the study is to compare normal PLC (limits lateral condyle anterior sub luxation) anatomy and its magnetic resonance imaging (MRI) appearance, with the various lesions observed in MRI, from the simple popliteus tendinous contusion to the complete PLC rupture. For this specific work on PLC lesions, we selected 61 examinations among the traumatic knees explored during the last 3 years. Surgical correlation is obtained for the 61 patients. MRI examinations are performed on a 0.5 T. unit. Normal PLC anatomy is compared to the dissection of 4 anatomic subjects. Normal MRI slices are evaluated with this reference analysis. The principle anatomical structures of the PLC include the lateral collateral ligament, the popliteus tendon, the arcuate ligament, the fabello fibular ligament, the posterolateral condylar capsule, and the posterior horn of the lateral meniscus. Surgical findings confirm PLC lesion for 58 patients with 3 false positive. Diagnosis of these lesions is important because chronical posterolateral laxity is secondary to the destabilization of lateral condyle. Unrecognized and untreated posterolateral instability may result in failure of ACL (limits lateral condyle posterior sub-luxation) reconstruction. When clinical tests are doubtful or complex, or the examination very painful, MRI evaluates completely the traumatic knee and particularly the PLC. (authors). 3 refs., 26 figs

Fc gamma receptor activation induces the tyrosine phosphorylation of both phospholipase C (PLC)-gamma 1 and PLC-gamma 2 in natural killer cells

OpenAIRE

1992-01-01

Crosslinking of the low affinity immunoglobulin G (IgG) Fc receptor (Fc gamma R type III) on natural killer (NK) cells initiates antibody- dependent cellular cytotoxicity. During this process, Fc gamma R stimulation results in the rapid activation of phospholipase C (PLC), which hydrolyzes membrane phosphoinositides, generating inositol-1,4,5- trisphosphate and sn-1,2-diacylglycerol as second messengers. We have recently reported that PLC activation after Fc gamma R stimulation can be inhibit...

OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2008-12-01

Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

Science.gov (United States)

This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

Design and implementation of tutorials for PLC B&R Automation

OpenAIRE

Sýkora, Daniel

2014-01-01

Tato bakalářská práce se zabývá návrhem a realizací úloh pro PLC B&R a podrobným návodem práce v Automation Studio. Obsahuje také informace o firmě B&R Automation Ges. m. b. H. a jejích produktech. Návrh úloh probíhal ve vývojovém prostředí B&R Automation Studio. Praktická úloha na regulaci teploty byla řešena a odzkoušena na B&R PLC X20. This bachelor’s thesis deals with the design and the implementation tutorials for PLC B&R as well as the detailed instructions of work in the Automation ...

The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

DEFF Research Database (Denmark)

Christensen, P U; Davey, William John; Nielsen, O

1997-01-01

In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

The Design and Realization of Virtual Machine of Embedded Soft PLC Running System

Directory of Open Access Journals (Sweden)

Qingzhao Zeng

2014-11-01

Full Text Available Currently soft PLC has been the focus of study object for many countries. Soft PLC system consists of the developing system and running system. A Virtual Machine is an important part in running system even in the whole soft PLC system. It explains and performs intermediate code generated by the developing system and updates I/O status of PLC in order to complete its control function. This paper introduced the implementation scheme and execution process of the embedded soft PLC running system Virtual Machine, and mainly introduced its software implementation method, including the realization of the input sampling program, the realization of the instruction execution program and the realization of output refresh program. Besides, an operation code matching method was put forward in the instruction execution program design. Finally, the test takes PowerPC/P1010 (Freescale as the hardware platform and Vxworks as the operating system, the system test result shows that accuracy, the real-time performance and reliability of Virtual Machine.

Application of PLC to mine hoist

International Nuclear Information System (INIS)

Zheng Liquan

2003-01-01

This paper describes the reform of the hoister JMK 1.85 x 4 (B) with programmable logic controller (PLC), introduces hardware architecture, software architecture and interference protection measures, and presents the existential problems and suggestions for improvement

Voltage Control System of A DC Generator Using PLC

OpenAIRE

Subrata CHATTOPADHYAY; Sagarika PAL

2008-01-01

The voltage control system of a DC generator may suffer from high frequency oscillations without offset or low frequency oscillation with offset. A PID controller can eliminate both these errors. In the present paper, the voltage control system of a DC generator using a PLC based PID controller has been designed. Operation of PLC as a continuous controller has been described and the load characteristic of DC generator with and without controller have been determined experimentally and reporte...

Intelligent Traffic Light Based on PLC Control

Science.gov (United States)

Mei, Lin; Zhang, Lijian; Wang, Lingling

2017-11-01

The traditional traffic light system with a fixed control mode and single control function is contradicted with the current traffic section. The traditional one has been unable to meet the functional requirements of the existing flexible traffic control system. This paper research and develop an intelligent traffic light called PLC control system. It uses PLC as control core, using a sensor module for receiving real-time information of vehicles, traffic control mode for information to select the traffic lights. Of which control mode is flexible and changeable, and it also set the countdown reminder to improve the effectiveness of traffic lights, which can realize the goal of intelligent traffic diversion, intelligent traffic diversion.

A formal safety analysis for PLC software-based safety critical system using Z

International Nuclear Information System (INIS)

Koh, Jung Soo

1997-02-01

This paper describes a formal safety analysis technique which is demonstrated by performing empirical formal safety analysis with the case study of beamline hutch door Interlock system that is developed by using PLC (Programmable Logic Controller) systems at the Pohang Accelerator Laboratory. In order to perform formal safety analysis, we have built the Z formal specifications representation from user requirement written in ambiguous natural language and target PLC ladder logic, respectively. We have also studied the effective method to express typical PLC timer component by using specific Z formal notation which is supported by temporal history. We present a formal proof technique specifying and verifying that the hazardous states are not introduced into ladder logic in the PLC-based safety critical system. And also, we have found that some errors or mismatches in user requirement and final implemented PLC ladder logic while analyzing the process of the consistency and completeness of Z translated formal specifications. In the case of relatively small systems like Beamline hutch door interlock system, a formal safety analysis including explicit proof is highly recommended so that the safety of PLC-based critical system may be enhanced and guaranteed. It also provides a helpful benefits enough to comprehend user requirement expressed by ambiguous natural language

Implementation of PID autotuning procedure in PLC controller

Directory of Open Access Journals (Sweden)

Daniun Marcin

2017-01-01

Full Text Available In this paper, we present the automatic PID tuning procedure based on the Method of Moments and AMIGO tuning rules. The advantage of the Method of Moments is that the time constant and transport delay are estimated at the areas rather than on the individual points. This results in high resistance to the measurement noises. The sensitivity to measurement noises is a serious problem in other autotuning methods. The second advantage of this method is that it approximates plant during identification process to first order model with time delay. We combined the Method of Moments with the AMIGO tuning rules and implemented this combination as a stand-alone autotuning procedure in Siemens S7-1200 PLC controller. Next, we compared this method with two built-in PID autotuning procedures which were available in Siemens S7-1200 PLC controller. The procedure was tested for three types of plant models: with lag-dominated, balanced, and delay-dominated dynamics. We simulated the plants on a PC in Matlab R2013a. The connection between the PC and PLC was maintained through a National Instruments data acquisition board, NI PCI-6229. We conducted tests for step change in the set point, trajectory tracking, and load disturbances. To assess control quality, we used IAE index. We limited our research to PI algorithm. The results prove that proposed method was better than two built-in tuning methods provided by Siemens, oscillating between a few and even a dozen percent in most cases. The proposed method is universal and can be implemented in any PLC controller.

[Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

Science.gov (United States)

Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

2016-12-04

Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

Upgradation in SCADA and PLC of existing LN{sub 2} control system for SST-1

Energy Technology Data Exchange (ETDEWEB)

Panchal, Pradip, E-mail: pradip@ipr.res.in; Mahesuria, Gaurang; Panchal, Rohit; Patel, Rakesh; Sonara, Dashrath; Pitroda, Dipen; Nimavat, Hiren; Tanna, Vipul; Pradhan, Subrata

2016-11-15

Highlights: • The control system of LN{sub 2} Management System of SST-1 is designed on PLC and SCADA. • The implementation and results of up-gradation in PLC and SCADA are reported. • The up-gradation in PLC and SCADA has improved the reliability & availability of SST-1 LN{sub 2} system. - Abstract: Helium Refrigerator/Liquefier system of Steady State Superconducting Tokamak (SST-1) incorporates Liquid Nitrogen (LN{sub 2}) pre-cooling system. LN{sub 2} is used for 80 K thermal shields of SST-1, current feeder system and integrated flow distribution and control system. The LN{sub 2} management system is distributed system and requires automatic control. Initially LN{sub 2} control system had Citect based Supervisory Control and Data Acquisition (SCADA) and Koyo make Programmable Logic Controller (PLC). With the passage of time and due to unavailability of their hardware, it is being obsoleted. So, the requirements of new PLC and SCADA systems have been envisaged to make uninterruptable operation of SST-1 cryogenic system. Therefore, Wonderware SCADA and Schneider Electric make PLC is programmed to replace Citect SCADA and Koyo PLC. New control features have been added in upgraded control system for better management of LN{sub 2} system. This upgradation of SCADA and PLC is completed, tested successfully and in operation. Operational performance highlights of the new upgraded system are presented in this paper.

Model-based automated testing of critical PLC programs.

CERN Document Server

Fernández Adiego, B; Tournier, J-C; González Suárez, V M; Bliudze, S

2014-01-01

Testing of critical PLC (Programmable Logic Controller) programs remains a challenging task for control system engineers as it can rarely be automated. This paper proposes a model based approach which uses the BIP (Behavior, Interactions and Priorities) framework to perform automated testing of PLC programs developed with the UNICOS (UNified Industrial COntrol System) framework. This paper defines the translation procedure and rules from UNICOS to BIP which can be fully automated in order to hide the complexity of the underlying model from the control engineers. The approach is illustrated and validated through the study of a water treatment process.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

A formal safety analysis for PLC software-based safety critical system using Z

International Nuclear Information System (INIS)

Koh, Jung Soo; Seong, Poong Hyun

1997-01-01

This paper describes a formal safety analysis technique which is demonstrated by performing empirical formal safety analysis with the case study of beamline hutch door Interlock system that is developed by using PLC (Programmable Logic Controller) systems at the Pohang Accelerator Laboratory. In order to perform formed safety analysis, we have built the Z formal specifications representation from user requirement written in ambiguous natural language and target PLC ladder logic, respectively. We have also studied the effective method to express typical PLC timer component by using specific Z formal notation which is supported by temporal history. We present a formal proof technique specifying and verifying that the hazardous states are not introduced into ladder logic in the PLC-based safety critical system

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

Science.gov (United States)

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

Science.gov (United States)

Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

1997-06-01

Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

MultiController: the PLC-SCADA object for advanced regulation

CERN Document Server

Ortola, J

2007-01-01

Nowadays, industrial solutions with PLCs (Programmable Logic Controllers) have basic control loop features. The SCADA (Supervisory Control And Data Acquisition) system is a key point of the process control system due to an efficient HMI (Human Machine Interfaces) that provides an open method of tuning and leading possibilities. As a consequence, advanced control algorithms have to be developed and implemented for those PLC-SCADA solutions in order to provide perspectives in solving complex and critical regulation problems. The MultiController is an object integrated for a large scale project at CERN (the European Organization for Nuclear Research) named LHC-GCS (Large Hadron Collider - Gas Control System). It is developed for a Framework called CERN-UNICOS based on PLC-SCADA facilities. The MultiController object offers various advanced control loop strategies. It gives to the user advanced control algorithms like PID, Smith Predictor, PFC, GPC and RST. It is implemented as a monolithic entity (in PLC and SCA...

Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

NARCIS (Netherlands)

Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

2000-01-01

We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

Separation of integrin-dependent adhesion from morphological changes based on differential PLC specificities.

Science.gov (United States)

Wooten, D K; Teague, T K; McIntyre, B W

1999-01-01

In normal lymphocytes an inside-out signal up-regulating integrin adhesion is followed by a ligand-mediated outside-in cell spreading signal. Protein kinase C (PKC) inhibition blocks lymphocyte adherence to and spreading on fibronectin. In contrast, putative PLC inhibitors yield distinct differences with respect to adhesion and morphology. The phosphatidylinositol-specific phospholipase C (PLC) inhibitor neomycin blocked spreading of CD3/CD28-activated T cells on fibronectin by disrupting adhesion. Furthermore, when an additional inside-out signal for fibronectin adhesion is unnecessary such as with HPB-ALL T leukemic or phorbol-myristate-acetate-treated normal T cells, neomycin treatment does not alter adhesion or morphology. However, the phosphatidylcholine-specific PLC inhibitor D609 abrogates cell spreading without affecting adhesion to fibronectin in these cells as well as the CD3/CD28-activated T cells. These results strongly suggest that inside-out signaling for the integrin alpha4beta1 in lymphocytes proceeds through phosphatidylinositol-specific PLC and PKC, whereas the outside-in signal utilizes phosphatidylcholine-specific PLC and PKC.

[Virulent gene prevalence of foodborne Listeria monocytogenes in China in 2005].

Science.gov (United States)

Yang, Yang; Fu, Ping; Guo, Yun-Chang; Pei, Xiao-Yan; Liu, Xiu-Mei

2010-12-01

To study the virulent gene prevalence of foodborne Listeria monocytogenes (LM) isolated from China. 78 LM isolates derived from raw meat, cooked food, aquatic products and vegetables of 13 provinces and cities.LM isolates were investigated for prevalence of virulence genes (LIPI-1 (prfA, plcA, hly, mpl, actA, plcB); LIPI-2 (inlA, inlB), and iap) by PCR method. 87.2% (68/78) of the isolates were prfA positive, 98.7% (77/78) of the isolates were plcA, actA and plcB positive, 97.4% (76/78) of the isolates were hly positive, 87.2% (68/78) of the isolates were mpl positive, 92.3% (72/78) of the isolates were inlA positive, 100% (78/78) of the isolates were inlB positive, 98.7% (77/78) of the isolates were iap positive. Among 21 virulent gene negative isolates, there was 7 isolates lack of two or more virulence genes. The rate of virulence genes deletion isolates from cooked meat was 31.3% (10/32), the rate of virulence genes deletion isolates from raw meat was 16.1% (5/31), the rate of virulence genes deletion isolates from vegetables was 36.4% (4/11) and rate of virulence genes deletion isolates from seafood was 50% (2/4). No significant difference was found (χ(2) = 3.721, P > 0.05). The virulence gene array-1 strains were dominant among these isolates. Among 78 LM isolates, prevalent of virulent genes were different except inlB, virulence genes of LIP-1 were deleted prevalently among isolates, virulence gene deletion patterns were diverse.

Voltage Control System of A DC Generator Using PLC

Directory of Open Access Journals (Sweden)

Subrata CHATTOPADHYAY

2008-06-01

Full Text Available The voltage control system of a DC generator may suffer from high frequency oscillations without offset or low frequency oscillation with offset. A PID controller can eliminate both these errors. In the present paper, the voltage control system of a DC generator using a PLC based PID controller has been designed. Operation of PLC as a continuous controller has been described and the load characteristic of DC generator with and without controller have been determined experimentally and reported in this paper.

Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

DEFF Research Database (Denmark)

Kristensen, Michael; Lok, Finn; Planchot, Véronique

1999-01-01

with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

Transforming PLC Programs into Formal Models for Verification Purposes

CERN Document Server

Darvas, D; Blanco, E

2013-01-01

Most of CERN’s industrial installations rely on PLC-based (Programmable Logic Controller) control systems developed using the UNICOS framework. This framework contains common, reusable program modules and their correctness is a high priority. Testing is already applied to find errors, but this method has limitations. In this work an approach is proposed to transform automatically PLC programs into formal models, with the goal of applying formal verification to ensure their correctness. We target model checking which is a precise, mathematical-based method to check formalized requirements automatically against the system.

Performance analysis of the PLC (Power Line Communication) in medium voltage electrical networks; Analise de desempenho de sistemas PLC em redes eletricas de media tensao

Energy Technology Data Exchange (ETDEWEB)

Mota, A.A.; Paleta, R. [Pontificia Universidade Catolica de Campinas (PUC-Campinas), SP (Brazil)], E-mail: amota@puc-campinas.edu.br; Mota, L.T.M.; Ricardo, R.A. [Indelmatec Engenharia, Campinas, SP (Brazil)], E-mail: mota@indelmatec.com.br

2009-07-01

Nowadays, the information access in communication networks is widely explored due to the increase of Internet users. In this context, the PLC (Power Line Communication) technology is an alternative for data transmission. This technology is based on the usage of transmission/distribution power lines for data transmission. However there are some problems related to the usage of this technology: adequate data transmission rates and generation of acceptable levels of electromagnetic interference (EMI). This work had the objective of studying the performance of PLC systems in medium voltage electrical networks, through the assess of data transmission rates and the generated EMI. Tests were carried out in a test field that corresponded to a medium voltage electrical network and the obtained results show that, under some circumstances, the PLC system does not reach the existent technical recommendations. (author)

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

Science.gov (United States)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

Science.gov (United States)

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

Directory of Open Access Journals (Sweden)

Huanqiang Zhao

2016-08-01

Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

Directory of Open Access Journals (Sweden)

Baiquan Ma

2015-11-01

Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

File list: Pol.Plc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Plc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Plc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Plc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.20.RNA_polymerase_II.AllCell.bed ...

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

File list: Pol.Plc.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Placent...a http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Plc.50.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Plc.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Plc.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Plc.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Plc.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.50.RNA_polymerase_III.AllCell.bed ...

Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

Directory of Open Access Journals (Sweden)

Nadja Knoll

Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

75 FR 46864 - Airworthiness Directives; Short Brothers PLC Model SD3 Airplanes

Science.gov (United States)

2010-08-04

...-0225; Directorate Identifier 2009-NM-203-AD] RIN 2120-AA64 Airworthiness Directives; Short Brothers PLC... this proposed AD, contact Short Brothers PLC, Airworthiness, P.O. Box 241, Airport Road, Belfast, BT3... amend this proposed AD based on those comments. We will post all comments we receive, without change, to...

Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

OpenAIRE

Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

1994-01-01

Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

Fifth Baltic Sea pollution load compilation (PLC-5)

Energy Technology Data Exchange (ETDEWEB)

Knuuttila, S.; Svendsen, L. M.; Staaf, H.; Kotilainen, P.; Boutrup, S.; Pyhala, M.; Durkin, M.

2011-07-01

This report includes the main results from the Fifth Pollution Load Compilation abbreviated PLC-5. It includes quantified annual waterborne total loads (from rivers, unmonitored and coastal areas as well as direct point and diffuse sources discharging directly to the Baltic Sea) from 1994 to 2008 to provide a basis for evaluating any decreasing (or increasing) trends in the total waterborne inputs to the Baltic Sea. Chapter 1 contains the objectives of PLC and the framework on classification of inputs and sources. Chapter 2 includes a short description of the Baltic Sea catchment area, while the methods for quantification and analysis together with quality assurance topics are briefly introduced in Chapter 3. More detailed information on methodologies is presented in the PLC-5 guidelines (HELCOM 2006). Chapter 4 reports the total inputs to the Baltic Sea of nutrients and selected heavy metals. Furthermore, the results of the quatification of discharges and losses of nitrogen and phosphorus from point and diffuse sources into inland surface waters within the Baltic Sea catchment area (source-oriented approach or gross loads) as well as the total load to the maritime area (load-oriented approarch or net loads) in 2006 are shown. Typically, results are presented by country and by main Baltic Sea sub-region. In Chapter 5, flow normalization is introduced and the results of trend analyses on 1994-2008 time series data on total waterborne loads of nitrogen and phosphorus are given together with a first evaluation of progress in obtaining the provisional reduction targets by country and by main Baltic Sea sub-region. Chapter 6 includes discussion of some of the main conclusions and advice for future PLCs. The annexes contain the flow-normalized annual load data and figures and tables with results from the PLC-5.

PLC and DTAM Software Programs for Pumping Instrumentation and Control Skid N

International Nuclear Information System (INIS)

KOCH, M.R.

2000-01-01

This document describe the software programs for the Programmable Logic Controller and the Datable Access Module for Pumping Instrumentation and Control skid ''N''. The Appendices contains copies of the printouts of these software programs. This document describes the software programs for the Allen-Bradley SLC 500 programmable logic controller (PLC) and the Allen-Bradley DTAM PLUS operator interface module used on Pumping Instrumentation and Control (PIC) skid ''N''. The software programs for the SLC 500 and DTAM Plus are based on the core programs provided by Allen-Bradley. The PLC and DTAM software programs on skid ''D'' for SX-104 are the baseline programs. These baselines have been tailored for U-farm skids. The skid ''N'' program for U-109 is similar to the skid ''M'' program for U-102. An Acceptance Test Procedure (ATP) and an Operational Test Procedure (OTP) verify that the software programs meet the specific requirements for U-109 pumping. This document represents the final PLC and DTAM programs for PIC skid ''N'' at U-109. These programs were printed out after the performance of the OTP. The OTP acts as the final qualification test for the software programs. Functional requirements and details of the PLC ladder logic are described in this document. The final programs entered into the PLC and DTAM Plus are included as Appendices to this document

File list: InP.Plc.50.Input_control.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Plc.50.Input_control.AllCell hg19 Input control Input control Placenta SRX19004...9,SRX080366 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Plc.50.Input_control.AllCell.bed ...

File list: InP.Plc.05.Input_control.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Plc.05.Input_control.AllCell hg19 Input control Input control Placenta SRX19004...9,SRX080366 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Plc.05.Input_control.AllCell.bed ...

Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

Directory of Open Access Journals (Sweden)

Muscariello Lidia

2006-05-01

Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

Integration of the HVCM PLC into the PEFP Control System

International Nuclear Information System (INIS)

Song, Young Gi; Jang, Ji Ho; Kwon, Hyeok Jung; Cho, Yong Sub

2011-01-01

The High Voltage Converter Modulators (HVCM) for the 100-MeV accelerator was installed to drive the 20-MeV linac. There are two klystrons in the 20-MeV linac and one modulator was used to drive two klystrons simultaneously. The HVCM for the 20-MeV linac area in Korea Atomic Energy Research Institute (KAERI) is shown in Fig. 1. We were faced with the necessity of integrating Programmable Logic Controllers (PLCs) for the HVCM into the Proton Engineering Frontier Project (PEFP) control system. At the PEFP, Experimental Physics and Industrial Control System (EPICS) has become the most widely used solution for building control systems for 100MeV proton accelerator. The EPICS as a standard development tool is a distributed architecture that provides several solutions such as independent programming tools for operating system, operator interface tools, and archiving tools. Although EPICS is used directly in our control system, HVCMs were delivered with the Allen-Bradley ControlLogix as a PLC. The industrial PLC has been verified for safety systems. We need to connect an interface from our EPICS control system to AB-PLC using Ethernet/IP (ControlNet over Ethernet) protocol over Ethernet. In this paper, we will present the communication protocol and EPICS IOC installation for the EPICS based PLC control system

PLC-controlled cryostats for the BlackGEM and MeerLICHT detectors

Science.gov (United States)

Raskin, Gert; Morren, Johan; Pessemier, Wim; Bloemen, Steven; Klein-Wolt, Marc; Roelfsema, Ronald; Groot, Paul; Aerts, Conny

2016-08-01

BlackGEM is an array of telescopes, currently under development at the Radboud University Nijmegen and at NOVA (Netherlands Research School for Astronomy). It targets the detection of the optical counterparts of gravitational waves. The first three BlackGEM telescopes are planned to be installed in 2018 at the La Silla observatory (Chile). A single prototype telescope, named MeerLICHT, will already be commissioned early 2017 in Sutherland (South Africa) to provide an optical complement for the MeerKAT radio array. The BlackGEM array consists of, initially, a set of three robotic 65-cm wide-field telescopes. Each telescope is equipped with a single STA1600 CCD detector with 10.5k x 10.5k 9-micron pixels that covers a 2.7 square degrees field of view. The cryostats for housing these detectors are developed and built at the KU Leuven University (Belgium). The operational model of BlackGEM requires long periods of reliable hands-off operation. Therefore, we designed the cryostats for long vacuum hold time and we make use of a closed-cycle cooling system, based on Polycold PCC Joule-Thomson coolers. A single programmable logic controller (PLC) controls the cryogenic systems of several BlackGEM telescopes simultaneously, resulting in a highly reliable, cost-efficient and maintenance-friendly system. PLC-based cryostat control offers some distinct advantages, especially for a robotic facility. Apart of temperature monitoring and control, the PLC also monitors the vacuum quality, the power supply and the status of the PCC coolers (compressor power consumption and temperature, pressure in the gas lines, etc.). Furthermore, it provides an alarming system and safe and reproducible procedures for automatic cool down and warm up. The communication between PLC and higher-level software takes place via the OPC-UA protocol, offering a simple to implement, yet very powerful interface. Finally, a touch-panel display on the PLC provides the operator with a user-friendly and robust

Realization of PLC to the Variable Frequency Speed Regulation System of Mine Local Ventilator based on RS-485 Communication

Science.gov (United States)

Ma, Kai; Li, Jian; Yun, Yichong

2018-03-01

The article first introduces the merits of serial communication in the PLC to the variable frequency speed regulation system of mine local ventilator, and then sets up a hardware application development platform of PLC and inverter based on RS-485 communication technology, next presents communication initialization of the PLC and Inverter. Finally according to the control requirements, PLC send run operation & monitoring instruction to Inverter, realizes the serial communication control between the PLC and Inverter.

The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

Science.gov (United States)

Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

2016-10-01

Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

Automated Translation of Safety Critical Application Software Specifications into PLC Ladder Logic

Science.gov (United States)

Leucht, Kurt W.; Semmel, Glenn S.

2008-01-01

The numerous benefits of automatic application code generation are widely accepted within the software engineering community. A few of these benefits include raising the abstraction level of application programming, shorter product development time, lower maintenance costs, and increased code quality and consistency. Surprisingly, code generation concepts have not yet found wide acceptance and use in the field of programmable logic controller (PLC) software development. Software engineers at the NASA Kennedy Space Center (KSC) recognized the need for PLC code generation while developing their new ground checkout and launch processing system. They developed a process and a prototype software tool that automatically translates a high-level representation or specification of safety critical application software into ladder logic that executes on a PLC. This process and tool are expected to increase the reliability of the PLC code over that which is written manually, and may even lower life-cycle costs and shorten the development schedule of the new control system at KSC. This paper examines the problem domain and discusses the process and software tool that were prototyped by the KSC software engineers.

Prototype of Automated PLC Model Checking Using Continuous Integration Tools

CERN Document Server

Lettrich, Michael

2015-01-01

To deal with the complexity of operating and supervising large scale industrial installations at CERN, often Programmable Logic Controllers (PLCs) are used. A failure in these control systems can cause a disaster in terms of economic loses, environmental damages or human losses. Therefore the requirements to software quality are very high. To provide PLC developers with a way to verify proper functionality against requirements, a Java tool named PLCverif has been developed which encapsulates and thus simplifies the use of third party model checkers. One of our goals in this project is to integrate PLCverif in development process of PLC programs. When the developer changes the program, all the requirements should be verified again, as a change on the code can produce collateral effects and violate one or more requirements. For that reason, PLCverif has been extended to work with Jenkins CI in order to trigger automatically the verication cases when the developer changes the PLC program. This prototype has been...

Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

Directory of Open Access Journals (Sweden)

Bingzhi Chen

Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

Directory of Open Access Journals (Sweden)

Borchardt Stephanie M

2006-07-01

Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

Evaluation of PLC Channel Capacity and ABER Performances for OFDM-Based Two-Hop Relaying Transmission

Directory of Open Access Journals (Sweden)

Sana Ezzine

2017-01-01

Full Text Available Powerline network is recognized as a favorable infrastructure for Smart Grid to transmit information in the network thanks to its broad coverage and low cost deployment. The existing works are trying to improve and adapt transmission techniques to reduce Powerline Communication (PLC channel attenuation and exploit the limited bandwidth to support high data rate over long distances. Two-hop relaying BroadBand PLC (BB-PLC system, in which Orthogonal Frequency Division Multiplexing (OFDM is used, is considered in this paper. We derive and compare the PLC channel capacity and the end-to-end Average BER (ABER for OFDM-based direct link (DL BB-PLC system and for OFDM-based two-hop relaying BB-PLC system for Amplify and Forward (AF and Decode and Forward (DF protocols. We analyze the improvements when we consider the direct link in a cooperative communication when the relay node only transmits the correctly decoded signal. Maximum ratio combining is employed at the destination node to detect the transmitted signal. In addition, in this paper, we highlight the impact of the relay location on the channel capacity and ABER for AF and DF transmission protocols. Moreover, an efficient use of the direct link was also investigated in this paper.

Bit rate maximization for multicast LP-OFDM systems in PLC context

OpenAIRE

Maiga , Ali; Baudais , Jean-Yves; Hélard , Jean-François

2009-01-01

ISBN: 978-88-900984-8-2.; International audience; In this paper, we propose a new resource allocation algorithm based on linear precoding technique for multicast OFDM systems. Linear precoding technique applied to OFDM systems has already proved its ability to significantly increase the system throughput in a powerline communication (PLC) context. Simulations through PLC channels show that this algorithm outperforms the classical multicast method (up to 7.3% bit rate gain) and gives better pe...

Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

International Nuclear Information System (INIS)

Woloschak, G.E.; Chang-Liu, Chin-Mei

1994-01-01

Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

76 FR 80430 - Rio Tinto plc and Rio Tinto Limited; Notice of Application

Science.gov (United States)

2011-12-23

... plc and Rio Tinto Limited; Notice of Application December 19, 2011. AGENCY: Securities and Exchange Commission (``Commission''). ACTION: Notice of application under section 3(b)(2) and 45(a) of the Investment Company Act of 1940 (the ``Act''). SUMMARY: Summary of Application: Rio Tinto plc (``RTP'') and Rio Tinto...

Evaluation of PLC Channel Capacity and ABER Performances for OFDM-Based Two-Hop Relaying Transmission

OpenAIRE

Ezzine, Sana; Abdelkefi, Fatma; Cances, Jean Pierre; Meghdadi, Vahid; Bouallégue, Ammar

2017-01-01

Powerline network is recognized as a favorable infrastructure for Smart Grid to transmit information in the network thanks to its broad coverage and low cost deployment. The existing works are trying to improve and adapt transmission techniques to reduce Powerline Communication (PLC) channel attenuation and exploit the limited bandwidth to support high data rate over long distances. Two-hop relaying BroadBand PLC (BB-PLC) system, in which Orthogonal Frequency Division Multiplexing (OFDM) is u...

Connecting programmable logic controllers (PLC) to control and data acquisition a comparison of the JET and Wendelstein 7-X approach

International Nuclear Information System (INIS)

Hennig, Christine; Kneupner, Klaus; Kinna, David

2012-01-01

Highlights: ► We describe 2 ways connecting PLCs to fusion control and data acquisition software. ► At W7-X standardization of the PLC type eases the maintenance of the software. ► At JET PLCs are interfaced with a daemon that hides the PLC specific part. ► There is potential to unify the approaches towards a common fusion PLC interface. - Abstract: The use of programmable logic controllers (PLC) for automation of electromechanical processes is an industrial control system technology. It is more and more in use within the fusion community. Traditionally PLC based systems are operated and maintained using proprietary SCADA systems (supervisory control and data acquisition). They are hardly ever integrated with the fusion control and data acquisition systems. An overview of the state of the art in fusion is given in the article. At JET an inhouse “black box protocol” approach has been developed to communicate with any external system via a dedicated http based protocol. However, a PLC usually cannot be modified to implement this special protocol. Hence, a software layer has been developed that interfaces a PLC by implementing the PLC specific communication part on one side and the black box protocol part on the other side. The software is completely data driven i.e. editing the data structure changes the logic accordingly. It can be tested using the web capability of the black box protocol. Multiple PLC types from different vendors are supported, thus multiple protocols to interface the PLC are in use. Depending on the PLC type and available tools it can be necessary to program the PLC accordingly. Wendelstein 7-X uses another approach. For every single PLC a dedicated communication from and to CoDaC is implemented. This communication is projected (programmed) in the PLC and configurable (data driven) on the CoDaC side. The protocol is UDP based and observed via timeout mechanisms. The use of PLCs for Wendelstein 7-X is standardized. Therefore a single

Connecting programmable logic controllers (PLC) to control and data acquisition a comparison of the JET and Wendelstein 7-X approach

Energy Technology Data Exchange (ETDEWEB)

Hennig, Christine, E-mail: Christine.Hennig@ipp.mpg.de [Max-Planck-Institut fuer Plasmaphysik, Wendelsteinstrasse 1, 17491 Greifswald (Germany); Kneupner, Klaus; Kinna, David [JET-EFDA, Culham Science Centre, OX14 3DB Abingdon (United Kingdom)

2012-12-15

Highlights: Black-Right-Pointing-Pointer We describe 2 ways connecting PLCs to fusion control and data acquisition software. Black-Right-Pointing-Pointer At W7-X standardization of the PLC type eases the maintenance of the software. Black-Right-Pointing-Pointer At JET PLCs are interfaced with a daemon that hides the PLC specific part. Black-Right-Pointing-Pointer There is potential to unify the approaches towards a common fusion PLC interface. - Abstract: The use of programmable logic controllers (PLC) for automation of electromechanical processes is an industrial control system technology. It is more and more in use within the fusion community. Traditionally PLC based systems are operated and maintained using proprietary SCADA systems (supervisory control and data acquisition). They are hardly ever integrated with the fusion control and data acquisition systems. An overview of the state of the art in fusion is given in the article. At JET an inhouse 'black box protocol' approach has been developed to communicate with any external system via a dedicated http based protocol. However, a PLC usually cannot be modified to implement this special protocol. Hence, a software layer has been developed that interfaces a PLC by implementing the PLC specific communication part on one side and the black box protocol part on the other side. The software is completely data driven i.e. editing the data structure changes the logic accordingly. It can be tested using the web capability of the black box protocol. Multiple PLC types from different vendors are supported, thus multiple protocols to interface the PLC are in use. Depending on the PLC type and available tools it can be necessary to program the PLC accordingly. Wendelstein 7-X uses another approach. For every single PLC a dedicated communication from and to CoDaC is implemented. This communication is projected (programmed) in the PLC and configurable (data driven) on the CoDaC side. The protocol is UDP based and

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Application of PLC timing control in the neutral beam injector of HT-7

International Nuclear Information System (INIS)

Song Shihua; Liu Zhimin; Liu Sheng; Hu Chundong

2006-01-01

HT-7 tokamak high power Neutral Beam Injector heating system runs in the mode of pulse timing-control of PLC. The thesis discusses the theory about the operation for the experiment of discharge, which is controlled by PLC logical connection and introduces excellent user-friendly operating interface and the development of the ladder application program and upper monitor program in the VB6.0 environment. Monitor the conditions of power and facility real time by the upper monitor interface. The application of PLC control system ensures the experiment facility running safely and convenient for modifying and setting the parameter simply during the course of experiment. (authors)

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Arbitration Award of ICSID on the Investment Disputes of Churchill Mining PLC v. Republic of Indonesia

Directory of Open Access Journals (Sweden)

Yordan Gunawan

2017-03-01

Full Text Available The research is aimed at analyzing the ICSID (International Centre Settlement Investment Dispute decision in solving a dispute between Churchill Mining PLC and the Government of the Republic of Indonesia. The case brought to the public attention, because mining license owned by PT. Ridlatama which acquired from Churchill Mining PLC had been revocated. Churchill Mining PLC holds 75% share of PT. Ridlatama and it suffered losses caused by the revocation of its mining license. Churchill Mining PLC filed the case to the local court but it failed. Churchill Mining PLC then sought ruling from International arbitration or ICSID. On December 6, 2016, ICSID issued a decision that clearly threw out Churchill Mining PLC claim. ICSID, the World Bank court, ordered the firm to pay a total of US$.9.446.528 in cost to the Government of the Republic of Indonesia. It is based on the evidences that the UK-Australia company did the fraud and had document forgery of coal mining permit in East Kutai, Indonesia. So the firm has violated the Bilateral Investment Treaties between Indonesia-UK and Indonesia-Australia.

Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

Directory of Open Access Journals (Sweden)

Berkhout Ben

2006-12-01

Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

The PLC: a logical development

OpenAIRE

Walker, Mark; Bissell, Christopher; Monk, John

2010-01-01

Programmable Logic Controllers (PLCs) have been used to control industrial processes and equipment for over 40 years, having their first commercially recognised application in 1969. Since then there have been enormous changes in the design and application of PLCs, yet developments were evolutionary rather than radical. The flexibility of the PLC does not confine it to industrial use and it has been used for disparate non-industrial control applications . This article reviews the history, deve...

File list: InP.Plc.20.Input_control.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Plc.20.Input_control.AllCell mm9 Input control Input control Placenta SRX112971...02,SRX404310,SRX1072160,SRX871507,SRX192097,SRX192098,SRX192099,SRX204148 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Plc.20.Input_control.AllCell.bed ...

File list: InP.Plc.05.Input_control.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Plc.05.Input_control.AllCell mm9 Input control Input control Placenta SRX344647...160,SRX204147,SRX404310,SRX871506,SRX871507,SRX192098,SRX192097,SRX192099 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Plc.05.Input_control.AllCell.bed ...

File list: InP.Plc.10.Input_control.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Plc.10.Input_control.AllCell mm9 Input control Input control Placenta SRX344648...310,SRX871506,SRX142911,SRX871507,SRX204148,SRX192098,SRX192097,SRX192099 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Plc.10.Input_control.AllCell.bed ...

Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

International Nuclear Information System (INIS)

Hayat, S.; Cheng, Z.; Chen, X.

2016-01-01

The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

Directory of Open Access Journals (Sweden)

Ghaffari Novin M.

2015-06-01

Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

Directory of Open Access Journals (Sweden)

Jacqueline Schmuckli-Maurer

Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

PLAT: An Automated Fault and Behavioural Anomaly Detection Tool for PLC Controlled Manufacturing Systems.

Science.gov (United States)

Ghosh, Arup; Qin, Shiming; Lee, Jooyeoun; Wang, Gi-Nam

2016-01-01

Operational faults and behavioural anomalies associated with PLC control processes take place often in a manufacturing system. Real time identification of these operational faults and behavioural anomalies is necessary in the manufacturing industry. In this paper, we present an automated tool, called PLC Log-Data Analysis Tool (PLAT) that can detect them by using log-data records of the PLC signals. PLAT automatically creates a nominal model of the PLC control process and employs a novel hash table based indexing and searching scheme to satisfy those purposes. Our experiments show that PLAT is significantly fast, provides real time identification of operational faults and behavioural anomalies, and can execute within a small memory footprint. In addition, PLAT can easily handle a large manufacturing system with a reasonable computing configuration and can be installed in parallel to the data logging system to identify operational faults and behavioural anomalies effectively.

PLAT: An Automated Fault and Behavioural Anomaly Detection Tool for PLC Controlled Manufacturing Systems

Directory of Open Access Journals (Sweden)

Arup Ghosh

2016-01-01

Full Text Available Operational faults and behavioural anomalies associated with PLC control processes take place often in a manufacturing system. Real time identification of these operational faults and behavioural anomalies is necessary in the manufacturing industry. In this paper, we present an automated tool, called PLC Log-Data Analysis Tool (PLAT that can detect them by using log-data records of the PLC signals. PLAT automatically creates a nominal model of the PLC control process and employs a novel hash table based indexing and searching scheme to satisfy those purposes. Our experiments show that PLAT is significantly fast, provides real time identification of operational faults and behavioural anomalies, and can execute within a small memory footprint. In addition, PLAT can easily handle a large manufacturing system with a reasonable computing configuration and can be installed in parallel to the data logging system to identify operational faults and behavioural anomalies effectively.

Reliability Analysis of Safety Grade PLC(POSAFE-Q) for Nuclear Power Plants

International Nuclear Information System (INIS)

Kim, J. Y.; Lyou, J.; Lee, D. Y.; Choi, J. G.; Park, W. M.

2006-01-01

The Part Count Method of the military standard MILHDK- 217F has been used for the reliability prediction of the nuclear field. This handbook determines the Programmable Logic Controller (PLC) failure rate by summing the failure rates of the individual component included in the PLC. Normally it is easily predictable that the components added for the fault detection improve the reliability of the PLC. But the application of this handbook is estimated with poor reliability because of the increased component number for the fault detection. To compensate this discrepancy, the quantitative reliability analysis method is suggested using the functional separation model in this paper. And it is applied to the Reactor Protection System (RPS) being developed in Korea to identify any design weak points from a safety point of view

Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

2017-01-01

The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

An evolutionarily conserved gene family encodes proton-selective ion channels.

Science.gov (United States)

Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

2018-03-02

Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

The Research about Embedded Soft PLC Running System Based on ARM

Directory of Open Access Journals (Sweden)

Fang Ding

2014-09-01

Full Text Available The paper discusses the overall construction and operational principle of soft PLC. Considering the real time request of the system, we use Linux+RTAI dual core system as software platform. In this platform, the implementation method of soft PLC operational system is introduced. Especially, the design of instruction analysis module is emphasized. On the basis of energy flow concept, the logic algorithm is established, aligning to the left bus. Finally, the system is tested to evaluate the desired control behavior.

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

Science.gov (United States)

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

Directory of Open Access Journals (Sweden)

Bryan D Moyer

Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

Directory of Open Access Journals (Sweden)

Kouji Shimoda

2002-01-01

Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

DEFF Research Database (Denmark)

Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

2018-01-01

The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

Development of Safety Grade PLC (POSAFE-Q) and Performance Test Results

International Nuclear Information System (INIS)

Kim, Chang Hwoi; Park, Won Man; Choi, Jong Gyun; Lee, Dong Young; No, Young Hun; Song, Seung Hwan

2006-01-01

The safety grade PLC (POSAFE-Q) is being developed in the Korea Nuclear Instrumentation and Control System (KNICS) R and D project. The PLC satisfies Safety Class 1E, Quality Class 1, and Seismic Category I. The software such as the RTOS and firmware are being developed according to the safety critical software life cycle. Especially, the formal method is applied to design the SRS (Software Requirement Spec.) and the SDS (Software Design Specification.) to be error-free. The POSAFE-Q has several modules such as processor module, input and output modules, communication modules, redundant processor module, redundant power modules, etc,. To verify the function and performance, several tests such as CT, IT and ST were performed. And also, the equipment qualification test for environment, EMI and EMC, and seismic ware performed. All tests are satisfied with the requirements and specification for safety grade PLC, and the criteria for safety system in nuclear power plants

Development of Safety Grade PLC (POSAFE-Q) and Performance Test Results

Energy Technology Data Exchange (ETDEWEB)

Kim, Chang Hwoi; Park, Won Man; Choi, Jong Gyun; Lee, Dong Young [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of); No, Young Hun; Song, Seung Hwan [POSCON, Seoul (Korea, Republic of)

2006-07-01

The safety grade PLC (POSAFE-Q) is being developed in the Korea Nuclear Instrumentation and Control System (KNICS) R and D project. The PLC satisfies Safety Class 1E, Quality Class 1, and Seismic Category I. The software such as the RTOS and firmware are being developed according to the safety critical software life cycle. Especially, the formal method is applied to design the SRS (Software Requirement Spec.) and the SDS (Software Design Specification.) to be error-free. The POSAFE-Q has several modules such as processor module, input and output modules, communication modules, redundant processor module, redundant power modules, etc,. To verify the function and performance, several tests such as CT, IT and ST were performed. And also, the equipment qualification test for environment, EMI and EMC, and seismic ware performed. All tests are satisfied with the requirements and specification for safety grade PLC, and the criteria for safety system in nuclear power plants.

Praksisnær skoleudvikling og PLC som strategisk udviklingsaktør

DEFF Research Database (Denmark)

Christensen, Ole; Bach, Anna

2017-01-01

I det følgende belyses, hvorledes PLC kan udvikles som strategisk udviklingsaktør og understøtte praksisnær skoleudvikling. Vi ønsker at belyse hvorledes Bekendtgørelsens overordnede intentioner kan få retning og rammer og dermed medvirke til, at hele det pædagogiske personale indgår i skoleudvik......I det følgende belyses, hvorledes PLC kan udvikles som strategisk udviklingsaktør og understøtte praksisnær skoleudvikling. Vi ønsker at belyse hvorledes Bekendtgørelsens overordnede intentioner kan få retning og rammer og dermed medvirke til, at hele det pædagogiske personale indgår i...... skoleudviklingen. I den forbindelse er det vores erfaring, at PLC kan spille en central rolle i forbindelse med den praksisnære og lokale skoleudvikling. Erfaringerne bygger især på udviklings- og forskningsprojekter fra kommunerne Kolding, København, Roskilde og Tårnby. Der har været tale om praksisnære...

Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

Science.gov (United States)

Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

Slovak Electric, Plc., 1998

International Nuclear Information System (INIS)

1997-06-01

Slovenske elektrarne, a.s. (Slovak Electric, Plc., abbrevation 'SE, a.s.') is the Slovak electricity generating utility, incorporated on November 1, 1994 as one of new companies formed from substantially all of the assets and a legal successor of Slovensky energeticky podnik, s.p., founded on January 1, 1969 in the form of SEP group. From its predecessor, Slovak Electric, Plc., took over generation of power, operation of 220 kV and 400 kV power system, transit, import, export, and sale of electricity. It is also involved in generation, distribution, and sale of heat. At present, SE's share of electriciry sales in the Slovak Republic is 88.47%. Electricity is delivered to three regional distribution companies and directly to several major industrial enterprises. SE, a.s. operates one nuclear power station, three thermal power plants, and 30 hydro power plants. The second nuclear power plant is under construction (state up tu June 1997) and SE is participating in the construction of two hydro power plants and one combined cycle power plant. The efforts of SE, s.a. focus on the generation of power and heat with minimal environmental impacts. Ecology is given priority in the SE, a.s. development programmes. SE's mission is to permanently satisfy customers' needs, for an acceptable price and with minimal environmental impact. On this CD ROM next chapters are presented: (1) The structure of the Company; (2) Production units; (3) The economic power of the Company; (4) The operation culture; (5) The strategic plans of the Company

Applying Hamming Code to Memory System of Safety Grade PLC (POSAFE-Q) Processor Module

Energy Technology Data Exchange (ETDEWEB)

Kim, Taehee; Hwang, Sungjae; Park, Gangmin [POSCO Nuclear Technology, Seoul (Korea, Republic of)

2013-05-15

If some errors such as inverted bits occur in the memory, instructions and data will be corrupted. As a result, the PLC may execute the wrong instructions or refer to the wrong data. Hamming Code can be considered as the solution for mitigating this mis operation. In this paper, we apply hamming Code, then, we inspect whether hamming code is suitable for to the memory system of the processor module. In this paper, we applied hamming code to existing safety grade PLC (POSAFE-Q). Inspection data are collected and they will be referred for improving the PLC in terms of the soundness. In our future work, we will try to improve time delay caused by hamming calculation. It will include CPLD optimization and memory architecture or parts alteration. In addition to these hamming code-based works, we will explore any methodologies such as mirroring for the soundness of safety grade PLC. Hamming code-based works can correct bit errors, but they have limitation in multi bits errors.

A Research on Seamless Platform Change of Reactor Protection System From PLC to FPGA

Energy Technology Data Exchange (ETDEWEB)

Yoo, Junbeom; Lee, Jonghoon [Konkuk Univ., Seoul (Korea, Republic of); Lee, Jangsoo [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2013-08-15

The PLC (Programmable Logic Controller) has been widely used to implement real-time controllers in nuclear RPSs (Reactor Protection Systems). Increasing complexity and maintenance cost, however, are now demanding more powerful and cost-effective implementation such as FPGA (Field-Programmable Gate Array). Abandoning all experience and knowledge accumulated over the decades and starting an all-new development approach is too risky for such safety-critical systems. This paper proposes an RPS software development process with a platform change from PLC to FPGA, while retaining all outputs from the established development. This paper transforms FBD designs of the PLC-based software development into a behaviorally-equivalent Verilog program, which is a starting point of a typical FPGA-based hardware development. We expect that the proposed software development process can bridge the gap between two software developing approaches with different platforms, such as PLC and FPGA. This paper also demonstrates its effectiveness using an example of a prototype version of a real-world RPS in Korea.

A Research on Seamless Platform Change of Reactor Protection System From PLC to FPGA

International Nuclear Information System (INIS)

Yoo, Junbeom; Lee, Jonghoon; Lee, Jangsoo

2013-01-01

The PLC (Programmable Logic Controller) has been widely used to implement real-time controllers in nuclear RPSs (Reactor Protection Systems). Increasing complexity and maintenance cost, however, are now demanding more powerful and cost-effective implementation such as FPGA (Field-Programmable Gate Array). Abandoning all experience and knowledge accumulated over the decades and starting an all-new development approach is too risky for such safety-critical systems. This paper proposes an RPS software development process with a platform change from PLC to FPGA, while retaining all outputs from the established development. This paper transforms FBD designs of the PLC-based software development into a behaviorally-equivalent Verilog program, which is a starting point of a typical FPGA-based hardware development. We expect that the proposed software development process can bridge the gap between two software developing approaches with different platforms, such as PLC and FPGA. This paper also demonstrates its effectiveness using an example of a prototype version of a real-world RPS in Korea

Applying Hamming Code to Memory System of Safety Grade PLC (POSAFE-Q) Processor Module

International Nuclear Information System (INIS)

Kim, Taehee; Hwang, Sungjae; Park, Gangmin

2013-01-01

If some errors such as inverted bits occur in the memory, instructions and data will be corrupted. As a result, the PLC may execute the wrong instructions or refer to the wrong data. Hamming Code can be considered as the solution for mitigating this mis operation. In this paper, we apply hamming Code, then, we inspect whether hamming code is suitable for to the memory system of the processor module. In this paper, we applied hamming code to existing safety grade PLC (POSAFE-Q). Inspection data are collected and they will be referred for improving the PLC in terms of the soundness. In our future work, we will try to improve time delay caused by hamming calculation. It will include CPLD optimization and memory architecture or parts alteration. In addition to these hamming code-based works, we will explore any methodologies such as mirroring for the soundness of safety grade PLC. Hamming code-based works can correct bit errors, but they have limitation in multi bits errors

A RESEARCH ON SEAMLESS PLATFORM CHANGE OF REACTOR PROTECTION SYSTEM FROM PLC TO FPGA

Directory of Open Access Journals (Sweden)

JUNBEOM YOO

2013-08-01

Full Text Available The PLC (Programmable Logic Controller has been widely used to implement real-time controllers in nuclear RPSs (Reactor Protection Systems. Increasing complexity and maintenance cost, however, are now demanding more powerful and cost-effective implementation such as FPGA (Field-Programmable Gate Array. Abandoning all experience and knowledge accumulated over the decades and starting an all-new development approach is too risky for such safety-critical systems. This paper proposes an RPS software development process with a platform change from PLC to FPGA, while retaining all outputs from the established development. This paper transforms FBD designs of the PLC-based software development into a behaviorally-equivalent Verilog program, which is a starting point of a typical FPGA-based hardware development. We expect that the proposed software development process can bridge the gap between two software developing approaches with different platforms, such as PLC and FPGA. This paper also demonstrates its effectiveness using an example of a prototype version of a real-world RPS in Korea.

Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

Science.gov (United States)

Pyne, C; Bognar, A L

1992-03-01

The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

Science.gov (United States)

Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

2017-12-26

The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

A Remote PLC Laboratory (RLab) for Distance Practical Work of Industrial Automation

Science.gov (United States)

Haritman, E.; Somantri, Y.; Wahyudin, D.; Mulyana, E.

2018-02-01

A laboratory is an essential equipment for engineering students to do a useful practical work. Therefore, universities should provide an adequate facility for practical work. On the other hand, industrial automation laboratory would offer students beneficial experience by using various educational PLC kits. This paper describes the development of Web-based Programmable Logic Controller (PLC) remote laboratory called RLab. It provides an environment for learners to study PLC application to control the level of the non-interacting tank. The RLab architecture is based on a Moodle and Remote Desktop, which also manages the booking system of the schedule of practical work in the laboratory. The RLab equipped by USB cameras providing a real-time view of PLC environment. To provide a secured system, the RLab combines Moodle and Remote Desktop application for the authentication system and management of remote users. Moodle will send PartnerID and password to connect to TeamViewer. It has been examined that the laboratory requirement, time and flexibility restrictions constitute a significant obstacle facing traditional students desiring to finish the course. A remote access laboratory can be eliminating time and flexibility restrictions. The preliminary study of RLab usability proved that such system is adequate to give the learners a distance practical work environment.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Science.gov (United States)

Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

2013-01-01

The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Directory of Open Access Journals (Sweden)

Linda J Savage

Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

NARCIS (Netherlands)

Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

2015-01-01

Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

Data communication between Panasonic PLC and PC using SerialPort control in C#.NET environment

Science.gov (United States)

Gao, Ting; Gan, Xiaochuan; Ma, Liqun

2015-02-01

With the gradual promotion of Microsoft.NET platform, C# as an object-oriented programming language based on the platform has been widely used. Therefore, more attention is concentrated on how to achieve the communication between Panasonic PLC and PC efficiently and fast in C#.NET environment. In this paper, a method of using SerialPort control which could be used for achieving communication between PLC and PC is introduced. Meanwhile, the reason of abnormal thread when displayed the receiving data in form is analyzed and the programming method to solve the problem of thread safety is designed. Achieving the communication of Panasonic PLC and PC in C#.NET environment can give full play to the advantages of the .NET framework. It is practical, easy communication, high reliability and can combine with other measurement and calibration procedures effectively and conveniently. Configuration software is expensive and can only communicate with PLC separately, but these shortcomings can be solved in C#.NET environment. A well-designed user interface realized real-time monitoring of PLC parameters and achieved management and control integration. The experiment show that this method of data transfer is accurate and the program' running is stable.

Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

NARCIS (Netherlands)

Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

Science.gov (United States)

Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

2005-01-01

Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

Science.gov (United States)

Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

2004-10-01

The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

DEFF Research Database (Denmark)

Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

2016-01-01

genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

Equity valuation of Tesco Plc.

OpenAIRE

Schmitz, Clemens

2015-01-01

This dissertation aimed to value the British retailer Tesco Plc. The objective was to determine a target price for the company and as a consequence determine a buy or sell recommendation when comparing it to the current market price. After the state of the art of literature regarding equity valuation has been assessed, the retail industry as well as Tesco have been analysed in more detail. Based on this, the retail business of Tesco has been valued using the Adjusted Present Va...

Development of the safety PLC for plant protection system

Energy Technology Data Exchange (ETDEWEB)

Kim, Chang Hwoi; Lee, Dong Young [Korea Atomic Energy Research Institute, Taejeon (Korea, Republic of)

2005-11-15

The safety PLC (POSAFE-Q) is developing in the Korea Nuclear Instrumentation and Control System (KNICS) R and D project. The PLC satisfies Safety Class 1E, Quality Class 1, and Seismic Category I. The software such as RTOS and firmware are developed according to safety critical software life cycle. Especially, the formal method is applied to design SRS (Software Requirement Spec.) and SDS (Software Design Specification.) for error-free. The developed software according to software life cycle is verified by independent software V and V team. The overall response time from an input to the outputs shall be 50ms or less. The prototype for the POSAFE-Q was developed and functional testing and equipment qualification tests have been underway.

An Architecture Of Plc Ls Xbc-Dr30e Based Clean Water Controlling System

Directory of Open Access Journals (Sweden)

M.Jusuf Jamanawar Purba

2017-12-01

Full Text Available In the industrial field the good controlling system is definitely required to improve the working efficiency of a system. The type of controller PLC Programmable Logic Controller used in Clean Water Controlling System in Electrical Workshop with PLC LS XBC-DR30E. Furthermore such system consistently uses two types of component they are Relay and Timer. The clean water pump control aims to pump the water in well A to storage tank B. The pump will work when water-contained well A is marked by sensor level well A on and the water inside storage tank B is under level 3. When the water inside storage tank B is under level 2 both pumps M1 and M2 will work to fill storage tank B. on the contrary when storage tank B is above level 2 only one pump M1 works until the tank reach level 3. In addition when storage tank B is above level 3 both pumps will stop working. However along with the advancement of recent technology the above system can be controlled by using PLC Programmable Logic Controller. Therefore it is possible to apply the controlling method of PLC as the semester Vs practical module. Based on the trial performed the PLC-based clean water system is well-functioned as the working description compiled before the operation of the tool.

PLC based control system and maintenance activities at NCAR, Bilaspur

International Nuclear Information System (INIS)

Dewangan, Jaidev; Trivedi, T.; Patel, Shiv P.; Malik, C.; Kumar, Rakesh; Gupta, Santosh Kumar; Bajpai, P.K.

2015-01-01

A 3.0 MV high current low energy Pelletron Accelerator facility (Model 9SDH-4, NEC, USA) with TORUIS (ion source for H + and He 2+ beam current H + ion ∼ 50μA @ 6 MeV, He 2+ at ∼ 10μA) and SNICS-II ion source for heavy ions has been commissioned as 'National Centre for Accelerator Based Research' in the Department of Pure and Applied Physics, Guru Ghasidas Vishwavidyalaya. In this paper, we detail out the control system developed and implemented at NCAR. The basic idea of controlling the machine is by providing the output signal through PLC to ACPC of accelerator using user interface points provided by the manufacturer. The PLC based system generates output signal once it receives the feedback signals from search and secure switches, door lock switches and scram switches interlocked with PLC. The output is controlled by ladder logic and is activated only when all the radiation monitors are in healthy state and outside radiations monitor having low radiation level. The details of control system and maintenance activities will be discussed in the paper

Enterprise network with software Asterisk PBX based on the PLC technology

Directory of Open Access Journals (Sweden)

Michal Maar

2017-01-01

Full Text Available This article presents the software Asterisk PBX solution design in enterprise PLC network (Power Line Communication. The description of the installation and configuration of software Asterisk PBX is involved in the design. The secure interconnection of two enterprise PLC network is implemented via the telecommunication tunnel with security grant using the Cisco routers. The connection between two Asterisk PBXs is designed in context of the establishment of the tunnel. The subject of the article is also cross/connection of exchanges Asterisk PBX and hardware PBX - IP Panasonic PBX K-NS500.

A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

Science.gov (United States)

Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

2015-01-01

This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

Science.gov (United States)

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-12-12

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

Directory of Open Access Journals (Sweden)

Meng Sun

2014-12-01

Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

β Absorption dust concentration monitor system based on the PLC

International Nuclear Information System (INIS)

Lian Dexing; Zhou Xiuliang; Liu Liyan; Li Zonglun; Cao Guanghui; Mao Wanchong

2011-01-01

To provide an on-line automatic system for dust concentration monitor is the purpose of this design.The system based on β-ray-absorption-method,employing PLC (Programmable Logic Controller) control technology, is presented. The user input parameter setup,the data acquisition and processing, and the communication with computer can be effectively regulated using the advanced PLC control technology. It has the features of high reliability, easy operation and easy maintenance, and the ability to monitor remotely. Measurement range: 0.1-1500 mg/m 3 , Accuracy: ±9%. The structure,working principle, electric circuit and software development of the system are introduced in detail. (authors)

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

OpenAIRE

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-01-01

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

Bringing Automated Model Checking to PLC Program Development - A CERN Case Study

CERN Document Server

Fernandez Adiego, B; Tournier, J-C; Blanco Vinuela, E; Gonzalez Suarez, V M

2014-01-01

Verification of critical software is a high priority but a challenging task for industrial control systems. Model checking appears to be an appropriate approach for this purpose. However, this technique is not widely used in industry yet, due to some obstacles. The main obstacles encountered when trying to apply formal verification techniques at industrial installations are the difficulty of creating models out of PLC programs and defining formally the specification requirements. In addition, models produced out of real-life programs have a huge state space, thus preventing the verification due to performance issues. Our work at CERN (European Organization for Nuclear Research) focuses on developing efficient automatic verification methods for industrial critical installations based on PLC (Programmable Logic Controller) control systems. In this paper, we present a tool generating automatically formal models out of PLC code. The tool implements a general methodology which can support several input languages, ...

A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

Directory of Open Access Journals (Sweden)

Ashley L Waldron

Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

Bringing Automated Formal Verification to PLC Program Development

CERN Document Server

Fernández Adiego, Borja; Blanco Viñuela, Enrique

Automation is the field of engineering that deals with the development of control systems for operating systems such as industrial processes, railways, machinery or aircraft without human intervention. In most of the cases, a failure in these control systems can cause a disaster in terms of economic losses, environmental damages or human losses. For that reason, providing safe, reliable and robust control systems is a first priority goal for control engineers. Ideally, control engineers should be able to guarantee that both software and hardware fulfill the design requirements. This is an enormous challenge in which industry and academia have been working and making progresses in the last decades. This thesis focuses on one particular type of control systems that operates industrial processes, the PLC (Programmable Logic Controller) - based control systems. Moreover it targets one of the main challenges for these systems, guaranteeing that PLC programs are compliant with their specifications. Traditionally ...

76 FR 52288 - Airworthiness Directives; Rolls-Royce plc (RR) Trent 800 Series Turbofan Engines

Science.gov (United States)

2011-08-22

...-0836; Directorate Identifier 2010-NE-38-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom: telephone 44 (0) 1332 242424; fax 44 (0) 1332... based on those comments. We will post all comments we receive, without change, to http://www.regulations...

A PLC generic requirements and specification for safety-related applications in nuclear power plants

International Nuclear Information System (INIS)

Han, Jea Bok; Lee, C. K.; Lee, D. Y.

2001-12-01

This report presents the requirements and specification to be applied to the generic qualification of programmable Logic Controller(PLC), which is being developed as part of the KNICS project, 'Development of the Digital Reactor Safety Systems' of which purpose is the application to safety-related instrumentation and control systems in nuclear power plants. This report defines the essential and critical characteristics that shall be included as part of a PLC design for safety-related application. The characteristics include performance, reliability, accuracy, the overall response time from an input to the PLC exceeding it trip condition to the resulting outputs, and the specification of processors and memories in digital controller. It also specifies the quality assurance process for software development, dealing with executive software, firmware, application software tools for developing the application software, and human machine interface(HMI). In addition, this report reviews the published standards and guidelines that are required for the PLC development and the quality assurance processes such as environment requirements, seismic withstand requirements, EMI/RFI withstand requirements, and isolation test

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Technical considerations for the development of an engineering safety features control system with PLC

International Nuclear Information System (INIS)

Lee, C. K.; Kim, C. H.; Han, J. B.; Kim, H.; Lee, S. S.

2002-01-01

Technical considerations are summarized for the development of an ESFCS(Engineered Safety Features Control System) with PLC (Programmable Logic Controller). The ESFCS is required for the mitigation of plant accident conditions and therefore developed in conformance with the design requirements applied to the safety critical system. The design of ESFCS primarily considered its safety, and the system has an architecture that will be able to minimize spurious actuation. The PLC based functional distribution and redundant design features are adopted, and the fieldbus is applied in the communication of information and control signals between PLC processors. It is expected that the ESFCS will have several advanced design features compared with the conventional systems supplied by foreign vendors

Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

Directory of Open Access Journals (Sweden)

Yuepeng eHan

2015-04-01

Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

Science.gov (United States)

Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

2009-01-01

There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

Amersham International plc. Report and Accounts 1995

International Nuclear Information System (INIS)

1995-01-01

The Annual Report and Accounts for Amersham International plc for the year 1995 are presented. This leading health science company develops products, services and technologies based on its expertise in labelling and detection at the molecular level. Recent work in the fields of life science research, nuclear medicine and industrial quality and safety assurance are described. (UK)

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

International Nuclear Information System (INIS)

Reynolds, P.; Weber, S.; Prakash, L.

1985-01-01

The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

An advanced lab frame PC-PLC regime for a power supply control

International Nuclear Information System (INIS)

Abdel-Bary, M

2010-01-01

A lab frame automatic control system (LFACS) based on a programmable logic controller (PLC) is designed, developed and tested in the laboratory. The LFACS is designed to control and monitor one DC power supply with output current accuracy 0.001 amps, one automatic valve. Also the LFACS will monitor one full range vacuum measurement and one water leak detector. The control system is built based on the internationally standard programmable logic controller (PLC) from Siemens. Two software's have been used; firstly SIMATIC S 7 lite has been used to build the control program and safety interlocks, secondly winCC flexible (runs in a PC computer and communicates with the PLC by multi point interface PC adapter (MPI) has been used to build the user-machine interface . This lab frame control system will be generalized to a global control system to control the MGC-20 cyclotron. The lab tests showed a reliable and flexible control system.

Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

DEFF Research Database (Denmark)

Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

2004-01-01

Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

76 FR 24796 - Airworthiness Directives; Rolls-Royce plc RB211-Trent 800 Series Turbofan Engines

Science.gov (United States)

2011-05-03

... Airworthiness Directives; Rolls-Royce plc RB211-Trent 800 Series Turbofan Engines AGENCY: Federal Aviation.... Request To Revise the Compliance Times Four commenters, American Airlines, Delta Airlines, Rolls-Royce plc... SNPRM were developed to minimize the risk of uncontained disc failure, based on the age of the parts in...

Session 1984-1985. Radioactive waste. Minutes of evidence, Monday 13 May 1985. British Nuclear Fuels plc

Energy Technology Data Exchange (ETDEWEB)

1985-01-01

The Environment Select Committee of the House of Commons received a memorandum from British Nuclear Fuels plc on the treatment and preparation for disposal of radioactive wastes, under the headings: introduction; waste categories; waste management policy; waste arisings; waste treatment plans; appendix I - British Nuclear Fuels plc; appendix II - the nuclear fuel cycle for Magnox, AGR and LWR reactors; appendix III - control of liquid radioactive discharges from Sellafield and their environmental impact. Representatives of BNF plc were examined on the subject of the memorandum and the minutes of evidence are recorded.

Session 1984-85. Radioactive waste. Minutes of evidence, Monday 13 May 1985. British Nuclear Fuels plc

International Nuclear Information System (INIS)

1985-01-01

The Environment Select Committee of the House of Commons received a memorandum from British Nuclear Fuels plc on the treatment and preparation for disposal of radioactive wastes, under the headings: introduction; waste categories; waste management policy; waste arisings; waste treatment plans; appendix I - British Nuclear Fuels plc; appendix II - the nuclear fuel cycle for Magnox, AGR and LWR reactors; appendix III - control of liquid radioactive discharges from Sellafield and their environmental impact. Representatives of BNF plc were examined on the subject of the memorandum and the minutes of evidence are recorded. (U.K.)

70Z/3 Cbl induces PLC gamma 1 activation in T lymphocytes via an alternate Lat- and Slp-76-independent signaling mechanism.

Science.gov (United States)

Graham, Laurie J; Verí, Maria-Concetta; DeBell, Karen E; Noviello, Cristiana; Rawat, Rashmi; Jen, Sandy; Bonvini, Ezio; Rellahan, Barbara

2003-04-24

The oncoprotein 70Z/3 Cbl signals in an autonomous fashion or through blockade of endogenous c-Cbl, a negative regulator of signaling. The mechanism of 70Z/3 Cbl-induced signaling was investigated by comparing the molecular requirements for 70Z/3 Cbl- and TCR-induced phospholipase C gamma 1 (PLC gamma 1) activation. 70Z/3 Cbl-induced PLC gamma 1 tyrosine phosphorylation required, in addition to the PLC gamma 1 N-terminal SH2 domain, the C-terminal SH2 and SH3 domains that were dispensable for TCR-induced phosphorylation. Deletion of the leucine zipper of 70Z/3 Cbl did not eliminate 70Z/3 Cbl-induced PLC gamma 1 phosphorylation, suggesting that blockage of c-Cbl via dimerization with 70Z/3 Cbl cannot fully explain 70Z/3 Cbl activating characteristics. The complete elimination of PLC gamma 1 phosphorylation required deleting the SH3 domain-binding region of 70Z/3 Cbl, consistent with 70Z/3 Cbl binding the PLC gamma 1 SH3 domain. 70Z/3 Cbl-induced PLC gamma 1 phosphorylation required Zap-70, as for the TCR, and the tyrosine kinase binding domain of 70Z/3 Cbl, which binds Zap-70, but did not require PLC gamma 1 binding to Lat, a crucial interaction in TCR-induced PLC gamma 1 phosphorylation. Furthermore, 70Z/3 Cbl-induced activation of NFAT, a PLC gamma 1/Ca(2+)-dependent transcriptional event, required Zap-70, but was independent of Slp-76, an adapter required for TCR-induced NFAT activation. These results suggest that 70Z/3 Cbl and PLC gamma 1 form a TCR-, Lat- and Slp-76-independent complex that leads to PLC gamma 1 phosphorylation and activation.

AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

Science.gov (United States)

Lu, Y P; Li, Z S; Rea, P A

1997-07-22

Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

Science.gov (United States)

Kim, K S; Farrand, S K

1996-06-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

Directory of Open Access Journals (Sweden)

Elías Trujillo-Esquivel

2017-09-01

Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

DEFF Research Database (Denmark)

Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

2015-01-01

at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

Application of PLC technology in measurement of beam profile on 100 MeV accelerator

International Nuclear Information System (INIS)

Yu Luyang; Chinese Academy of Sciences, Beijing; Chen Yongzhong; Chen Yongzhong; Liu Dekang; Chinese Academy of Sciences, Beijing

2005-01-01

A comprehensive introduction is given to the real-time measuring method, which is based on the Programmable Logic Controller (PLC) technology and can measure intensity and profile of the beam by a scintillator screen. The whole system has many advantages, such as good reliability, high precision, intuitional measurement, etc. due to the use of the PLC and Labview software. (authors)

Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

Science.gov (United States)

Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

2002-05-25

All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

Science.gov (United States)

Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

2012-01-01

We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

[Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

Science.gov (United States)

Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

2008-01-01

The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

PowerGen plc report and accounts 1994

International Nuclear Information System (INIS)

1994-01-01

The annual report and accounts of PowerGen plc for the year 1994 are presented. Financial highlights are quoted, followed by the Chairman's statement, reviews by the Chief Executive and Financial Directors, reports by the Auditors and Directors, balance sheets and details of the consolidated profit and loss account and principal accounting policies. A four year summary and shareholder information are included. (UK)

75 FR 61114 - Airworthiness Directives; Rolls-Royce plc RB211-Trent 800 Series Turbofan Engines

Science.gov (United States)

2010-10-04

... Airworthiness Directives; Rolls-Royce plc RB211-Trent 800 Series Turbofan Engines AGENCY: Federal Aviation.... Fax: (202) 493-2251. Contact Rolls-Royce plc, P.O. Box 31, Derby, England, DE248BJ; telephone: 011-44... AD. We will consider all comments received by the closing date and may amend this proposed AD based...

75 FR 264 - Airworthiness Directives; Rolls-Royce plc RB211-Trent 800 Series Turbofan Engines

Science.gov (United States)

2010-01-05

...-1004; Directorate Identifier 2009-NE-36-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc.... Contact Rolls-Royce plc, P.O. Box 31, Derby, England; telephone: 011-44-1332-249428; fax: 011-44-1332... AD. We will consider all comments received by the closing date and may amend this proposed AD based...

77 FR 1009 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-524 Series Turbofan Engines

Science.gov (United States)

2012-01-09

... Airworthiness Directives; Rolls-Royce plc (RR) RB211-524 Series Turbofan Engines AGENCY: Federal Aviation... 5, 2005). ADDRESSES: For service information identified in this AD, contact Rolls-Royce plc, P.O...,000. Based on these figures, we estimate the total cost of the AD to U.S. operators to be $4,206,960...

Five Year Retrospective Study of the Financial Situation of Northern Foods Plc., United Kingdom

Directory of Open Access Journals (Sweden)

Louie DACOSTA

2016-09-01

Full Text Available This study was conducted as a retrospective analysis of Northern Foods Plc., once a major player in FTSE 350 Food Sector, to evaluate its financial situation over a five year period. The ex post factor research design was used for this study. Annual reports and databases on Northern Foods Plc., and Associated British Foods Plc., were used to perform a series of ratio analyses. The results revealed that Northern Foods Plc.’s performance has been declining as evidenced in the profitability ratios calculated. Also, financial strength was weak and working capital has not been effectively managed, hence affecting its cash and profit generation potentials. The company was limited in its ability to grow and expand as it needed to regularly fund its pension deficit, and finance its high levels of debt. The study concludes that Northern Foods was not in a very strong financial position, yet it was not making the required investments to improve, hence its takeover though this paper will not rule out non-financial issues. Furthermore, the study prescribed five generic points to improve the financial health of any organisation.

Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

NARCIS (Netherlands)

Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

2008-01-01

The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

Directory of Open Access Journals (Sweden)

Aris Haryanto

2016-01-01

Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

Application of PLC to dynamic control system for liquid He cryogenic pumping facility on JT-60U NBI system

International Nuclear Information System (INIS)

Honda, A.; Okano, F.; Ooshima, K.; Akino, N.; Kikuchi, K.; Tanai, Y.; Takenouchi, T.; Numazawa, S.; Ikeda, Y.

2008-01-01

The control system of the cryogenic facility in the JT-60 NBI system has been replaced by employing the PLC (Programmable Logic Controller) and SCADA (Supervisory Control And Data Acquisition) system. The original control system was constructed about 20 years ago by specifying the DCS (Distributed Control System) computer to deal with ∼400 feedback loops. Recently, troubles on this control system have increased due to its age-induced deterioration. To maintain the high reliability of the cryogenic facility, a new control system has been planned with the PLC and SCADA systems. Their attractive features include high market availability and cost-effectiveness, however, the use of PLC for such a large facility with ∼400 feedback loops has not been established because of insufficient processing capability of the early PLC. Meanwhile, the recent progress in the PLC enables to use the FBD (function block diagram) programming language for 500 function blocks. By optimizing the function blocks and connecting them in the FBD language, the feedback loops have been successfully replaced from DCS to PLC without a software developer. Moreover, an oscillation of the liquid He level, which often occurs during the cooldown mode of the cryopumps, can be automatically stabilized by easily adding a new process program in the PLC. At present, the new control system has worked well

A PLC platform-independent structural analysis on FBD programs for digital reactor protection systems

International Nuclear Information System (INIS)

Jung, Sejin; Yoo, Junbeom; Lee, Young-Jun

2017-01-01

Highlights: • FBD has been widely used to implement safety-critical software for PLC-based systems. • The safety-critical software should be developed strictly with safety programming guidelines. • There are no argued rules that have specific links to higher guidelines NUREG/CR-6463 PLC platform-independently. • This paper proposes a set of rules on the structure of FBD programs with providing specific links to higher guidelines. • This paper also provides CASE tool ‘FBD Checker’ for analyzing the structure of FBD. - Abstract: FBD (function block diagram) has been widely used to implement safety-critical software for PLC (programmable logic controller)-based digital nuclear reactor protection systems. The software should be developed strictly in accordance with safety programming guidelines such as NUREG/CR-6463. Software engineering tools of PLC vendors enable us to present structural analyses using FBD programs, but specific rules pertaining to the guidelines are enclosed within the commercial tools, and specific links to the guidelines are not clearly communicated. This paper proposes a set of rules on the structure of FBD programs in accordance with guidelines, and we develop an automatic analysis tool for FBD programs written in the PLCopen TC6 format. With the proposed tool, any FBD program that is transformed into an open format can be analyzed the PLC platform-independently. We consider a case study on FBD programs obtained from a preliminary version of a Korean nuclear power plant, and we demonstrate the effectiveness and potential of the proposed rules and analysis tool.

The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

Directory of Open Access Journals (Sweden)

Lukasz Michal Szafron

Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

Restructuring of SE, Plc - from a functionally managed company to a process managed commercial-production company

International Nuclear Information System (INIS)

Ravasz, V.

2004-01-01

The purpose of this presentation is to inform the participants about present changes currently occurred within Slovenske elektrarne, a. s. (SE, Plc). Changes are related to the liberalisation of the electricity market and expected accession of Slovakia to EU. To support its competitiveness, the SE, Plc became a customer-oriented company, prepared to the access of strategic investor. The paper includes the basic information about centralisation and project of Restructuring of SE, Plc., which has started in December 2003. The aim of Restructuring is the change from functionally managed company to a process managed commercial-production company

77 FR 20987 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2012-04-09

... Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT. ACTION... the Federal Register. That AD applies to RB211-Trent 800 series turbofan engines. The last comment...

75 FR 61361 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-535 Series Turbofan Engines

Science.gov (United States)

2010-10-05

...-0994; Directorate Identifier 2009-NE-39-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR...-Royce plc., P.O. Box 31, Derby, DE24 8BJ, United Kingdom; Telephone: 011 44 1332 242424, Fax: 011 44... based on those comments. We will post all comments we receive, without change, to http://www.regulations...

76 FR 65997 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-535 Series Turbofan Engines

Science.gov (United States)

2011-10-25

...-0994; Directorate Identifier 2009-NE-39-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... Friday, except Federal holidays. For service information identified in this AD, contact Rolls-Royce plc.... Based on these figures, we estimate the cost of this proposed AD on U.S. operators to be $1,499,400. FAA...

76 FR 2605 - Airworthiness Directives; Rolls-Royce plc RB211-Trent 800 Series Turbofan Engines

Science.gov (United States)

2011-01-14

... Airworthiness Directives; Rolls-Royce plc RB211-Trent 800 Series Turbofan Engines AGENCY: Federal Aviation... holidays. Fax: (202) 493-2251. Contact Rolls-Royce plc, P.O. Box 31, DERBY, DE24 8BJ, UK; telephone 44 (0... AD. We will consider all comments received by the closing date and may amend this proposed AD based...

Event notification system with a PLC

International Nuclear Information System (INIS)

Kawase, M.; Yoshikawa, Hiroshi; Sakaki, Hironao; Takahashi, Hiroki; Sako, Hiroyuki; Kamiya, Junichiro; Takayanagi, Tomohiro

2004-01-01

When an interlock occurs in the equipment, it is required to notify the upper rank control system of the Interlock and receive information for apparatus information in the upper rank control system as at high speed as possible. In the apparatus using FA-M3, it can respond to this by using the notice function of an event. This report shows the event notification system with a PLC based Kicker electromagnet power supply for 3GeV RCS. (author)

PLC-based LP₁₁ mode rotator for mode-division multiplexing transmission.

Science.gov (United States)

Saitoh, Kunimasa; Uematsu, Takui; Hanzawa, Nobutomo; Ishizaka, Yuhei; Masumoto, Kohei; Sakamoto, Taiji; Matsui, Takashi; Tsujikawa, Kyozo; Yamamoto, Fumihiko

2014-08-11

A PLC-based LP11 mode rotator is proposed. The proposed mode rotator is composed of a waveguide with a trench that provides asymmetry of the waveguide. Numerical simulations show that converting LP11a (LP11b) mode to LP11b (LP11a) mode can be achieved with high conversion efficiency (more than 90%) and little polarization dependence over a wide wavelength range from 1450 nm to 1650 nm. In addition, we fabricate the proposed LP11 mode rotator using silica-based PLC. It is confirmed that the fabricated mode rotator can convert LP11a mode to LP11b mode over a wide wavelength range.

Heating systems with PLC and frequency control

International Nuclear Information System (INIS)

Abdallah, Salah; Abu-Mallouh, Riyad

2008-01-01

In this work, medium capacity controlled heating system is designed and constructed. The programming method of control of heating process is achieved by means of integrated programmable logic controller (PLC) and frequency inverter (FI). The PLC main function is to determine the required temperatures levels and the related time intervals of the heating hold time in the furnace. FI is used to control the dynamic change of temperature between various operating points. The designed system shows the capability for full control of temperature from zero to maximum for any required range of time in case of increasing or decreasing the temperature. All variables of the system will be changed gradually until reaching their needed working points. An experimental study was performed to investigate the effect of tempering temperature and tempering time on hardness and fatigue resistance of 0.4% carbon steel. It was found that increasing tempering temperature above 550 deg. C or tempering time decreases the hardness of the material. It was also found that there is a maximum number of cycles to which the specimen can survive what ever the applied load was

Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

Science.gov (United States)

Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

2015-01-01

For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

77 FR 4648 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-535 Series Turbofan Engine

Science.gov (United States)

2012-01-31

... Airworthiness Directives; Rolls-Royce plc (RR) RB211-535 Series Turbofan Engine AGENCY: Federal Aviation... identified in this AD, contact Rolls-Royce plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom; phone: 011 44... parts are required. Based on these figures, we estimate the cost of this AD on U.S. operators to be $1...

75 FR 63727 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-524 Series Turbofan Engines

Science.gov (United States)

2010-10-18

...-0162; Directorate Identifier 2004-NE-19-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR...-2251. Contact Rolls-Royce plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom; telephone: 011-44-1332... would cost $0. Based on these figures, we estimate the total cost of the AD to U.S. operators would be...

PLC based development of control, monitoring and interlock for 100 kW, 45.6 MHz ICRH system

International Nuclear Information System (INIS)

Jadav, Hiralal; Joshi, Rameshkumar; Mali, Aniruddh K.; Kadia; Bhavesh; Parmar; Maganbhai, Kiritkumar; Kulkarni, S.V.

2015-01-01

This paper presents details of PLC based system development for 100KW at the rate 45.6 MHz. Presently in ICRH RF DAC (Data acquisition and control) system existing based on real time VME and linux operating system. The ICRH system consists of 1.5 MW RF generator operating at 22- 40MHz which is used for second harmonic heating and pre-ionization experiments on SST-1 Tokamak at 1.5T and 3T magnetic field operation respectively. The task of PLC system in RF ICRH is to control, monitoring and interlocks HVDC power supply signal. Voltage and current signal of 2 kW, 20 kW, tetrode for 100 kW RF tube electrode like Filament, Control grid, Plate, Screen grid, signal monitor and voltage set raised by PLC analog IO module. Acknowledgement of the HVDC supply Filament, Control grid, Plate, Screen grid power supply is monitor and interlocks by PLC Digital IO module to interlocks stop the RF pulse and off HV power supply. The RF pulse(shot) to trigger signal generator (5mw) RF power output feed to LPA then chain of 2 KW, 20 KW, 100 KW at the rate 45.6 MHz. The programming logic controller (PLC) software is written in ladder language for AH500 Delta make using ISP Soft 2.04 and GUI is in the table form to control and monitor the parameters. Communication of PLC to PC by ethernet LAN network. (author)

Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

Directory of Open Access Journals (Sweden)

Hui-Yeng Y Yap

Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

Science.gov (United States)

Santiago, Margarita; Gardner, Richard C

2015-07-01

Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

Multiprog Virtual Laboratory Applied to PLC Programming Learning

Science.gov (United States)

Shyr, Wen-Jye

2010-01-01

This study develops a Multiprog virtual laboratory for a mechatronics education designed to teach how to programme a programmable logic controller (PLC). The study was carried out with 34 students in the Department of Industry Education and Technology at National Changhua University of Education in Taiwan. In total, 17 students were assigned to…

Design of EAST LHCD high power supply feedback control system based on PLC

International Nuclear Information System (INIS)

Hu Huaichuan; Shan Jiafang

2009-01-01

Design of EAST LHCD -35kV/5.6MW high power supply feedback control system based on PLC is described. Industrial computer and PLC are used to control high power supply in the system. PID arithmetic is adopted to achieve the feedback control of voltage of high power supply. Operating system is base on real-time operating system of QNX. Good controlling properties and reliable protective properties of the feedback control system are proved by the experiment results. (authors)

British Nuclear Fuels plc: report and accounts 1987-88

International Nuclear Information System (INIS)

1989-01-01

The Energy Committee has considered the report and accounts of BNFL (British Nuclear Fuels PLC) for the year 1987-88. The report looks at BNFL as a government owned PLC - its activities and financial performance. Various questions are raised about the underlying financial position justifying the optimism portrayed in the report and accounts. The impact of cost-plus contracts on UK customers is examined. The economics of THORP (Thermal Oxide Reprocessing Plant) are also examined especially as the escalation in the cost of constructing THORP means that a substantial loss will be made in the reprocessing of waste for which contracts were signed in the late 1960s or early 1970s. The main conclusions of the report are summarized. One of these is that the UK must be cautious about becoming a repository of foreign nuclear waste. Other specific recommendations are made - some about the decommissioning of BNFL plant. (UK)

Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

Science.gov (United States)

Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

2009-02-27

All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

NB-PLC channel modelling with cyclostationary noise addition & OFDM implementation for smart grid

Science.gov (United States)

Thomas, Togis; Gupta, K. K.

2016-03-01

Power line communication (PLC) technology can be a viable solution for the future ubiquitous networks because it provides a cheaper alternative to other wired technology currently being used for communication. In smart grid Power Line Communication (PLC) is used to support communication with low rate on low voltage (LV) distribution network. In this paper, we propose the channel modelling of narrowband (NB) PLC in the frequency range 5 KHz to 500 KHz by using ABCD parameter with cyclostationary noise addition. Behaviour of the channel was studied by the addition of 11KV/230V transformer, by varying load location and load. Bit error rate (BER) Vs signal to noise ratio SNR) was plotted for the proposed model by employing OFDM. Our simulation results based on the proposed channel model show an acceptable performance in terms of bit error rate versus signal to noise ratio, which enables communication required for smart grid applications.

The effect of a dynamic PCL brace on patellofemoral compartment pressures in PCL-and PCL/PLC-deficient knees.

Science.gov (United States)

Welch, Tyler; Keller, Thomas; Maldonado, Ruben; Metzger, Melodie; Mohr, Karen; Kvitne, Ronald

2017-12-01

The natural history of posterior cruciate ligament (PCL) deficiency includes the development of arthrosis in the patellofemoral joint (PFJ). The purpose of this biomechanical study was to evaluate the hypothesis that dynamic bracing reduces PFJ pressures in PCL- and combined PCL/posterolateral corner (PLC)-deficient knees. Controlled Laboratory Study. Eight fresh frozen cadaveric knees with intact cruciate and collateral ligaments were included. PFJ pressures and force were measured using a pressure mapping system via a lateral arthrotomy at knee flexion angles of 30°, 60°, 90°, and 120° in intact, PCL-deficient, and PCL/PLC-deficient knees under a combined quadriceps/hamstrings load of 400 N/200 N. Testing was then repeated in PCL- and PCL/PLC-deficient knees after application of a dynamic PCL brace. Application of a dynamic PCL brace led to a reduction in peak PFJ pressures in PCL-deficient knees. In addition, the brace led to a significant reduction in peak pressures in PCL/PLC-deficient knees at 60°, 90°, and 120° of flexion. Application of the dynamic brace also led to a reduction in total PFJ force across all flexion angles for both PCL- and PCL/PLC-deficient knees. Dynamic bracing reduces PFJ pressures in PCL- and combined PCL/PLC-deficient knees, particularly at high degrees of knee flexion.

Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

You Wanhui

2012-04-01

Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

OpenAIRE

Hahn, F M; Baker, J A; Poulter, C D

1996-01-01

Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

Science.gov (United States)

Tornow, J; Santangelo, G M

1994-06-01

A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

77 FR 10355 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines

Science.gov (United States)

2012-02-22

... Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines AGENCY: Federal Aviation... service of certain critical engine parts based on reduced life limits. This new AD reduces the life limits... effective March 28, 2012. ADDRESSES: For service information identified in this AD, contact Rolls-Royce plc...

Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

International Nuclear Information System (INIS)

Chisholm, G.E.; Summers, W.C.

1986-01-01

The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

NARCIS (Netherlands)

Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

2002-01-01

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

The Application of PLC (Powerline Communications) in Brazil in the regulatory viewpoint; A aplicacao do PLC no Brasil do ponto de vista regulatorio

Energy Technology Data Exchange (ETDEWEB)

Vieira, Daniel; Silva Filho, Armando [Agencia Nacional de Energia Eletrica (ANEEL), Brasilia, DF (Brazil). Superintendencia de Regulacao dos Servicos de Distribuicao

2010-07-01

The Powerline Communications technology - PLC allows transmission of data, voice, image and access to high speed internet by the grid, so that a power plug can also be an access point to the network communication. Considering that the electric grid reaches the vast majority of households, there is great potential in using this technology as a tool to achieve the reality of digital inclusion in the country. However, its implementation must be accompanied by effective regulation, both through policies with respect to the conditions of use of radio frequencies, as in regulating the use of distribution networks of electricity as a means of transport for communication signal. In this context, the present article deals with the fundamental rules governing the application of PLC technology from the standpoint of the distributors and consumers of electricity, with attention to quality assurance of electrical energy and facility security.

3D digital image correlation investigation of PLC effect in a new Ni-Co base superalloy

Science.gov (United States)

Gao, Y.; Fu, S. H.; Cheng, T.; Huo, X.; Zhang, Q. C.

2013-06-01

Repeated plastic instability accompanying serrated yielding in stress-strain curves and localization of deformation is observed during plastic deformation of many metallic alloys when tensile specimens are deformed under certain experimental conditions of temperature, strain rate, and pre-deformation. This phenomenon is referred to as the Portevin- Le Chatelier (PLC) effect. TMW alloy, a newly developed Ni-Co base superalloy for aircraft engine application, also exhibit PLC effect during tensile test at temperatures ranging from 300 ° to 600 °, which are also the temperature range for engine working. In this paper, a 3D digital image correlation (3D DIC) measurement system was established to observe the localization of deformation (PLC band) in a tensile test performed on TMW alloy specimen at temperature of 400 °. The 3D DIC system, with displacement measurement accuracy up to 0.01 pixels and strain measurement accuracy up to 100 μɛ, has a high performance in displacement field calculation with more than 10000 points every second on a 3.1G Hz CPU computer. The test result shows that, the PLC bands are inclined at an angle of about 60° to the tensile axis. Unlike tensile test performed on aluminums alloy, the widths of PLC bands of TMW alloy specimen, ranging from 4 mm to 4.5 mm, are much greater than the specimen thickness (0.25 mm).

Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

Science.gov (United States)

van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

2016-01-01

Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

NARCIS (Netherlands)

Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

2006-01-01

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

Directory of Open Access Journals (Sweden)

Řičicová Markéta

2010-04-01

Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

Saltwell PIC Skid Programmable Logic Controller (PLC) Software Configuration Management Plan

International Nuclear Information System (INIS)

KOCH, M.R.

1999-01-01

This document provides the procedures and guidelines necessary for computer software configuration management activities during the operation and maintenance phases of the Saltwell PIC Skids as required by LMH-PRO-309/Rev. 0, Computer Software Quality Assurance, Section 2.6, Software Configuration Management. The software configuration management plan (SCMP) integrates technical and administrative controls to establish and maintain technical consistency among requirements, physical configuration, and documentation for the Saltwell PIC Skid Programmable Logic Controller (PLC) software during the Hanford application, operations and maintenance. This SCMP establishes the Saltwell PIC Skid PLC Software Baseline, status changes to that baseline, and ensures that software meets design and operational requirements and is tested in accordance with their design basis

The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

Science.gov (United States)

Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

2017-03-01

The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

Science.gov (United States)

Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

2016-06-01

The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

76 FR 78805 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines

Science.gov (United States)

2011-12-20

... Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines AGENCY: Federal Aviation... all Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines. This AD results from mandatory... inspection of the FOHE mounts. We did not change the AD based on this comment. Request To Add Requirement To...

76 FR 68663 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines

Science.gov (United States)

2011-11-07

...-0755; Directorate Identifier 2010-NE-12-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... Rolls-Royce plc, Corporate Communications, P.O. Box 31, Derby, England, DE248BJ; phone: 011-44-1332... date and may amend this proposed AD based on those comments. We will post all comments we receive...

Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

Science.gov (United States)

Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

2003-08-01

ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

Science.gov (United States)

Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

2011-01-01

Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

78 FR 6206 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2013-01-30

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT..., RB211-Trent 977-84, RB211-Trent 977B-84 and RB211-Trent 980-84 turbofan engines. This AD requires on...

The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

Science.gov (United States)

Shukla, Avi; Chatterjee, Anirvan

2018-01-01

Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

A combined PLC and CPU approach to multiprocessor control

International Nuclear Information System (INIS)

Harris, J.J.; Broesch, J.D.; Coon, R.M.

1995-10-01

A sophisticated multiprocessor control system has been developed for use in the E-Power Supply System Integrated Control (EPSSIC) on the DIII-D tokamak. EPSSIC provides control and interlocks for the ohmic heating coil power supply and its associated systems. Of particular interest is the architecture of this system: both a Programmable Logic Controller (PLC) and a Central Processor Unit (CPU) have been combined on a standard VME bus. The PLC and CPU input and output signals are routed through signal conditioning modules, which provide the necessary voltage and ground isolation. Additionally these modules adapt the signal levels to that of the VME I/O boards. One set of I/O signals is shared between the two processors. The resulting multiprocessor system provides a number of advantages: redundant operation for mission critical situations, flexible communications using conventional TCP/IP protocols, the simplicity of ladder logic programming for the majority of the control code, and an easily maintained and expandable non-proprietary system

Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

International Nuclear Information System (INIS)

Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

1988-01-01

Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

Directory of Open Access Journals (Sweden)

Mignon A Keaton

2011-03-01

Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

NARCIS (Netherlands)

Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

2015-01-01

The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

75 FR 45560 - Airworthiness Directives; Rolls-Royce plc (RR) RB211-Trent 800 Series Turbofan Engines

Science.gov (United States)

2010-08-03

...-0755; Directorate Identifier 2010-NE-12-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... based on engine thrust rating but now based on operating shaft speeds) introduced by Rolls- Royce. The...-Royce plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom: Telephone 44 (0) 1332 242424; fax 44 (0) 1332...

76 FR 72650 - Airworthiness Directives; Rolls-Royce plc (RR) RB211 Trent 800 Series Turbofan Engines

Science.gov (United States)

2011-11-25

...-0959; Directorate Identifier 2011-NE-25-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc (RR... holidays. Fax: (202) 493-2251. Contact Rolls-Royce plc, P.O. Box 31, Derby, DE24 8BJ, United Kingdom; phone... AD. We will consider all comments received by the closing date and may amend this proposed AD based...

A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

Science.gov (United States)

Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

2015-07-01

The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

A fast PID controller Design for Modern PLC for Process Control Application

International Nuclear Information System (INIS)

Mirza, A.; Nafis, A.; Anees, R.M.; Idris, S.

2004-01-01

PID is the most widely used control scheme in the process industry. Pill controllers are utilized for the control of such varied parameters as pressure, flow, temperature, etc. One characteristic of these parameters is that they posses slow dynamics. Most of the available digital controllers can manipulate only a single parameter- multiple controllers are required for control of more than one parameter. The Fast PID Controller for Modem PLC (Programmable Logic Controller) developed by the authors, provides control of several parameters at a time (through a single Pill control element), enhanced programmability including variable sampling period, parameter monitoring and data storage, which may be easily implemented in a PLC. (author)

Development of Application Programming Tool for Safety Grade PLC (POSAFE-Q)

International Nuclear Information System (INIS)

Koo, Kyungmo; You, Byungyong; Kim, Tae-Wook; Cho, Sengjae; Lee, Jin S.

2006-01-01

The pSET (POSAFE-Q Software Engineering Tool) is an application programming tool of the POSAFE-Q which is a safety graded programmable logic controller (PLC) developed for the reactor protect system of the nuclear power plant. The pSET provides an integrated development environment (IDE) which includes editors, compiler, simulator, down loader, debugger, and monitor. The pSET supports the IEC61131-3 standard software model and languages such as LD (ladder diagram) and FBD (function block diagram) which are two of the most widely used PLC programming languages in industry fields. The pSET will also support SFC (sequential function chart) language. The pSET is developed as a part of a Korea Nuclear Instrumentation and Control System (KNICS) project

Developing a Novel USB-PLC Controller for a Mechatronics Cloud Laboratory

Directory of Open Access Journals (Sweden)

Wen-Jye Shyr

2013-04-01

Full Text Available This study proposes the development and implementation of a novel Universal Serial Bus (USB-Programmable Logic Controller (PLC, called a USB-PLC controller, for a mechatronics cloud laboratory. The aim of a mechatronics cloud laboratory is to provide state of the art research quality equipment to students, allowing them to conduct hands-on experiments via the Internet. One objective of the cloud laboratory is to not only provide equipment for conducting set experiments, but also to provide a means for students to access research equipment in order to conduct individual research experiments. The proposed controller for these cloud laboratory experiments has been chosen in order to expose the students to as many different engineering and technology disciplines as possible.

Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

Science.gov (United States)

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

2013-01-01

Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

Science.gov (United States)

Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

2017-03-01

The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

A Cost Effective Solution for Development Environment for Data Acquisition, Monitoring and Simulation of PLC Controlled Applications

Directory of Open Access Journals (Sweden)

O. Bjelica

2014-06-01

Full Text Available It is very important to test and monitor the operation of Programmable Logic Controller (PLC in real time (online. Nowadays, conventional, but expensive monitoring systems for PLCs, such as Supervisory Control and Data Acquisition (SCADA systems, software and hardware simulators (or debuggers, are widely used. This paper proposes a user friendly and cost-effective development environment for monitoring, data acquisition and online simulation of applications with PLC. The purpose of this solution is to simulate the process which is controlled by the PLC. The performances of the proposed development environment are presented on the examples of washing machine and dishwasher simulators.

An Integrated Software Development Framework for PLC and FPGA based Digital I and Cs

International Nuclear Information System (INIS)

Yoo, Jun Beom; Kim, Eui Sub; Lee, Dong Ah; Choi, Jong Gyun

2014-01-01

NuDE 2.0 (Nuclear Development Environment) is a model-based software development environment for safety- critical digital systems in nuclear power plants. It makes possible to develop PLC-based systems as well as FPGA-based systems simultaneously from the same requirement or design specifications. The case study showed that the NuDE 2.0 can be adopted as an effective method of bridging the gap between the existing PLC and upcoming FPGA-based developments as well as a means of gaining diversity

An Integrated Software Development Framework for PLC and FPGA based Digital I and Cs

Energy Technology Data Exchange (ETDEWEB)

Yoo, Jun Beom; Kim, Eui Sub; Lee, Dong Ah [Konkuk University, Seoul (Korea, Republic of); Choi, Jong Gyun [KAERI, Daejeon (Korea, Republic of)

2014-08-15

NuDE 2.0 (Nuclear Development Environment) is a model-based software development environment for safety- critical digital systems in nuclear power plants. It makes possible to develop PLC-based systems as well as FPGA-based systems simultaneously from the same requirement or design specifications. The case study showed that the NuDE 2.0 can be adopted as an effective method of bridging the gap between the existing PLC and upcoming FPGA-based developments as well as a means of gaining diversity.

Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

International Nuclear Information System (INIS)

Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

2005-01-01

Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

Directory of Open Access Journals (Sweden)

Tuffery Pierre

2009-12-01

Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

Directory of Open Access Journals (Sweden)

Moysés Elias-Neto

2013-06-01

Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Design and development of PLC based offline impedance matching system for ICRH experiment

International Nuclear Information System (INIS)

Joshi, Ramesh; Jadav, H.M.; Mali, Aniruddh; Kulkarni, S.V.

2015-01-01

Ion Cyclotron Resonance Heating (ICRH) transmission line has two impedance matching networks, one for offline matching which has been employed before experimental shot. Another is online impedance matching which has been employed during experimental shot. Offline matching network consists of two static stubs, coarse tuner and coarse phase shifter identical in both transmission lines. There are motorized arrangement installed in each stubs and phase shifters. Both stubs are being used to vary transmission line length. Phase shifter is used to match the frequency of generated RF power. Programmable Logic Controller (PLC) based automation and control technique has been designed and developed for the system. Offline matching should be operated below 1 kHz frequency in order to move stepper motors. Program generates required square pulses which employed to motor controller to move either in upward or downward direction. In existing system this operation has been carried out using VME. To reduce the load on VME, PLC based system has been designed and integrated with main DAC system. WinCC software has been used (as SCADA/HMI) to develop front end GUI which communicates with OPC server. Further, OPC communicates with PLC for control of motorized arrangement. This paper describes technical details,design and development of PLC based offline matching system using WinCC as user interface. The communication between WinCC application and hardware devices was realized by OPC technique. The developed system has friendly graphical user interface, high-level automation and comprehensive function such as experimental process control. The system was proved to be reliable and accurate in practical application. (author)

Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

Science.gov (United States)

Sudagidan, Mert; Aydin, Ali

2010-04-15

In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

Science.gov (United States)

Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

2006-01-24

Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

Directory of Open Access Journals (Sweden)

Ying Wang

Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

Experimental Study of 6LoPLC for Home Energy Management Systems

Directory of Open Access Journals (Sweden)

Augustine Ikpehai

2016-12-01

Full Text Available Ubiquitous connectivity is already transforming residential dwellings into smart homes. As citizens continue to embrace the smart home paradigm, a new generation of low-rate and low-power communication systems is required to leverage the mass market presented by energy management in homes. Although Power Line Communication (PLC technology has evolved in the last decade, the adaptation of PLC for constrained networks is not fully charted. By adapting some features of IEEE 802.15.4 and IPv6 over Low-power Wireless Personal Area Network (6LoWPAN into power lines, this paper demonstrates a low-rate, low-power PLC system over the IPv6 network (referred to as 6LoPLC, for Home Energy Management System (HEMS applications. The overall idea is to provide a framework for assessing various scenarios that cannot be easily investigated with the limited number of evaluation hardware available. In this respect, a network model is developed in NS-3 (Version 21 to measure several important characteristics of the designed system and then validated with experimental results obtained using the Hanadu evaluation kits. Following the good agreement between the two, the NS-3 model is utilised to investigate more complex scenarios and various use-cases, such as the effects of impulsive noise, the number of nodes and packet size on the latency and Bit Error Rate (BER performances. We further demonstrate that for different network and application configurations, optimal data sizes exist. For instance, the results reveal that in order to guarantee 99% system reliability, the HEMS application data must not exceed 64 bytes. Finally, it is shown that with impulsive noise in a HEMS network comprising 50 appliances, provided the size of the payload does not exceed 64 bytes, monitoring and control applications incur a maximum latency of 238.117 ms and 248.959 ms, respectively; both of which are within acceptable limits.

Prospective radiological dose assessment. Amersham plc (Amersham site) variation application December 1998

International Nuclear Information System (INIS)

Allott, R.

2001-01-01

Amersham plc (previously Nycomed-Amersham plc) submitted an application to the Environment Agency in December 1998 for a variation to their radioactive waste discharge authorisations granted under the Radioactive Substances Act 1993. The application requested a reduction in the discharge limits for certain radionuclides and no change for the remaining radionuclides. Amersham plc undertook a further review of their discharge requirements and submitted a new assessment for revised limits in January 2001. This report provides an assessment of the radiological implications of discharges at these revised limits requested by Amersham plc and the limits proposed by the Agency. It has been prepared by the National Compliance Assessment Service at the request of Thames Region to support their determination of the application. Four candidate critical groups were identified who could be exposed to discharges from the Amersham site: 1) Sewage workers at the Maple Lodge sewage works who might be exposed to external radiation from discharges contained within sewage and inadvertently inhale or ingest sewage. 2) Anglers on the Grand Union Canal who eat a small proportion of their annual catch of freshwater fish, who drink water abstracted solely from the River Colne and eat vegetables irrigated by water from the canal. 3) Persons living closest to site who eat locally produced food. 4) Dog walkers living near to site who eat locally produced food. For continuous discharges at the Agency's proposed annual limits, the highest dose of 160 μSv/y is predicted to be received by infants who live closest to the site and eat locally produced food. Therefore, this has been identified as the critical group. Children and adults living at the same location and eating locally produced food receive doses of 140 μSv/y and 130 μSv/y respectively. The critical group dose is less than the source constraint of 300 μSv/y. The dose is dominated by direct radiation from the site (110 μSv/y) and the

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

Directory of Open Access Journals (Sweden)

DEWI FITRIANI

2010-06-01

Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

OpenAIRE

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

DEFF Research Database (Denmark)

Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

2014-01-01

OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

Directory of Open Access Journals (Sweden)

Melanie Brunsch

Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

77 FR 21588 - Hart and Cooley, Inc., A Subsidiary of Tomkins, PLC Including On-Site Leased Workers from...

Science.gov (United States)

2012-04-10

... Subsidiary of Tomkins, PLC Including On- Site Leased Workers from Reliable, Masiello Employment Services..., applicable to workers of Hart and Cooley, Inc., a subsidiary of Tomkins, PLC, including on-site leased... workers. Based on these findings, the Department is amending this certification to include workers leased...

75 FR 34172 - Rexam Closure Systems, Inc., a Subsidiary of Rexam PLC, Including On-Site Leased Workers From...

Science.gov (United States)

2010-06-16

... Illinois Manufacturing, Hamlet, NC; Amended Certification Regarding Eligibility To Apply for Worker... PLC, Hamlet, North Carolina. The notice was published in the Federal Register on April 23, 2010 (75 FR... at the Hamlet, North Carolina location of Rexam Closure Systems, Inc., a subsidiary of Rexam PLC. The...

Knowledge-based engineering of a PLC controlled telescope

Science.gov (United States)

Pessemier, Wim; Raskin, Gert; Saey, Philippe; Van Winckel, Hans; Deconinck, Geert

2016-08-01

As the new control system of the Mercator Telescope is being finalized, we can review some technologies and design methodologies that are advantageous, despite their relative uncommonness in astronomical instrumentation. Particular for the Mercator Telescope is that it is controlled by a single high-end soft-PLC (Programmable Logic Controller). Using off-the-shelf components only, our distributed embedded system controls all subsystems of the telescope such as the pneumatic primary mirror support, the hydrostatic bearing, the telescope axes, the dome, the safety system, and so on. We show how real-time application logic can be written conveniently in typical PLC languages (IEC 61131-3) and in C++ (to implement the pointing kernel) using the commercial TwinCAT 3 programming environment. This software processes the inputs and outputs of the distributed system in real-time via an observatory-wide EtherCAT network, which is synchronized with high precision to an IEEE 1588 (PTP, Precision Time Protocol) time reference clock. Taking full advantage of the ability of soft-PLCs to run both real-time and non real-time software, the same device also hosts the most important user interfaces (HMIs or Human Machine Interfaces) and communication servers (OPC UA for process data, FTP for XML configuration data, and VNC for remote control). To manage the complexity of the system and to streamline the development process, we show how most of the software, electronics and systems engineering aspects of the control system have been modeled as a set of scripts written in a Domain Specific Language (DSL). When executed, these scripts populate a Knowledge Base (KB) which can be queried to retrieve specific information. By feeding the results of those queries to a template system, we were able to generate very detailed "browsable" web-based documentation about the system, but also PLC software code, Python client code, model verification reports, etc. The aim of this paper is to

Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

OpenAIRE

Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

2017-01-01

Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

Design and Implementation of an over Current Protection Laboratory for Electrical Power Transmission Systems Based on PLC Techniques

Directory of Open Access Journals (Sweden)

Hassaan Th. H. Thabet

2018-01-01

Full Text Available This paper describes a modern approach for the protection of transmission lines to ensure theirsafety against the faults occurred in power systems. Our approach uses a Programmable LogicController (PLC to realize a transmission line as an over current protection relay. A conditioningcircuit was designed, implemented and tested to collect data obtained from Hall Effect sensors which convert them to suitable analog values compatible with PLC's inputs. Results obtained by our PLC control system are very similar to those obtained by the conventional relays but more efficient. An Automatic Reclosing System (ARS for remote faults is also included in this approach. Our PLC control system and its algorithm are illustrated in this paper also. This approach is designed to be used in electrical networks laboratories as an educational unit in electrical departments of engineering collages and technical institutes; it can be used also in real power systems through suitable interfacing facilities.

Parathyroid Hormone Activates Phospholipase C (PLC)-Independent Protein Kinase C Signaling Pathway via Protein Kinase A (PKA)-Dependent Mechanism: A New Defined Signaling Route Would Induce Alternative Consideration to Previous Conceptions.

Science.gov (United States)

Tong, Guojun; Meng, Yue; Hao, Song; Hu, Shaoyu; He, Youhua; Yan, Wenjuan; Yang, Dehong

2017-04-20

BACKGROUND Parathyroid hormone (PTH) is an effective anti-osteoporosis agent, after binding to its receptor PTHR1, several signaling pathways, including cAMP/protein kinase A (PKA) and phospholipase C (PLC)/protein kinase C (PKC), are initiated through G proteins; with the cAMP/PKA pathway as the major pathway. Earlier studies have reported that PTHR1 might also activate PKC via a PLC-independent mechanism, but this pathway remains unclear. MATERIAL AND METHODS In HEK293 cells, cAMP accumulation was measured with ELISA and PKC was measured with fluorescence resonance energy transfer (FRET) analysis using CKAR plasmid. In MC3T3-E1 cells, real-time PCR was performed to examine gene expressions. Then assays for cell apoptosis, cell differentiation, alkaline phosphatase activity, and mineralization were performed. RESULTS The FRET analysis found that PTH(1-34), [G1,R19]PTH(1-34) (GR(1-34), and [G1,R19]PTH(1-28) (GR(1-28) were all activated by PKC. The PKC activation ability of GR(1-28) was blocked by cAMP inhibitor (Rp-cAMP) and rescued with the addition of active PKA-α and PKA-β. The PKC activation ability of GR(1-34) was partially inhibited by Rp-cAMP. In MC3T3-E1 cells, gene expressions of ALP, CITED1, NR4a2, and OSX that was regulated by GR(1-28) were significantly changed by the pan-PKC inhibitor Go6983. After pretreatment with Rp-cAMP, the gene expressions of ALP, CITED1, and OPG were differentially regulated by GR(1-28) or GR(1-34), and the difference was blunted by Go6983. PTH(1-34), GR(1-28), and GR(1-34) significantly decreased early apoptosis and augmented osteoblastic differentiation in accordance with the activities of PKA and PKC. CONCLUSIONS PLC-independent PKC activation induced by PTH could be divided into two potential mechanisms: one was PKA-dependent and associated with PTH(1-28); the other was PKA-independent and associated with PTH(29-34). We also found that PTH could activate PLC-independent PKC via PKA-dependent mechanisms.

Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

Science.gov (United States)

Vouille, V; Amiche, M; Nicolas, P

1997-09-01

We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

OpenAIRE

Xu, J; Johnson, R C

1995-01-01

Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

Slovak Electric, Plc., 1997

International Nuclear Information System (INIS)

1997-06-01

Slovenske elektrarne, a.s. (Slovak Electric, Plc.) was established on November 1, 1994 as one entity among new entities created as successors to the former Slovensky energeticky podnik. The subject activity is the generation of electric power, operation of transmission 220 kV and 400 kV systems, transit, import, export, and sales of electric power. Besides these activities the company deals with generation, distribution, and sales of heat. The company operates one nuclear power station, three thermal power plants, and thirty hydro power plants. One nuclear Power plant is under construction (state up tu June 1997). On this CD ROM next chapters are presented: (1) The structure of the company; (2) The production Units; (3) The economic power of the company; (4) The operation culture of the company; (5) The strategic plans of the company

Operating experiences with programmable logic controller (PLC) system of Indian Pressurised Heavy Water Reactors (PHWR)

International Nuclear Information System (INIS)

Ughade, A.V.; Singh, Ranjeet; Bhattacharya, P.K.; Kulkarni, R.K.; Chandra, Umesh

2005-01-01

PLC system was introduced for the first time in Kaiga-1,2 and RAPS-3,4 Nuclear Power Plants (NPPs) for Station Logic Control of Non Safety Related (NSR) and Safety related (SR) systems. However, the safety system logics are still relay based. The experience on the deployment of PLC system, which is computer-based, has brought out various implementation issues. This paper give details of such experiences, the solutions emerged and applied for plants under operation/construction. (author)

Design and Implementation of PLC-Based Automatic Sun tracking System for Parabolic Trough Solar Concentrator

Directory of Open Access Journals (Sweden)

Wang Jinping

2016-01-01

Full Text Available A sun-tracking system for parabolic trough solar concentrators (PTCs is a control system used to orient the concentrator toward the sun always, so that the maximum energy can be collected. The work presented here is a design and development of PLC based sun tracking control system for PTC. Sun tracking control system consists of a Programmable Logic Controller (PLC and a single axis hydraulic drives tracking control system. Hydraulic drives and the necessary tracking angle algorithm have been designed and developed to perform the technical tasks. A PLC unit was employed to control and monitor the mechanical movement of the PTC and to collect and store data related to the tracking angle of PTC. It is found that the tracking error of the system is less than 0.6°. Field experience shows that tracking algorithm act stable and reliable and suit for PTCs.

Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

Directory of Open Access Journals (Sweden)

Riley Laura M

2012-03-01

Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

PLC Based Automatic Multistoried Car Parking System

OpenAIRE

Swanand S .Vaze; Rohan S. Mithari

2014-01-01

This project work presents the study and design of PLC based Automatic Multistoried Car Parking System. Multistoried car parking is an arrangement which is used to park a large number of vehicles in least possible place. For making this arrangement in a real plan very high technological instruments are required. In this project a prototype of such a model is made. This prototype model is made for accommodating twelve cars at a time. Availability of the space for parking is detecte...

Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

Science.gov (United States)

Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

2017-10-01

Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

Effects of 5-fluorouracil on biological characteristics and drug resistance mechanisms of liver cancer cell line PLC/RAF/5

Directory of Open Access Journals (Sweden)

CHENG Kangwen

2015-09-01

Full Text Available ObjectiveTo study the changes in biological characteristics of a liver cancer cell line PLC/RAF/5 after repeated exposure to a chemotherapy drug, 5-fluorouraci (5-FU, and to investigate the relationship between drug-resistant liver cancer cells and liver cancer stem cells. MethodsA low concentration of 5-FU (1 μg/ml was used to treat the human liver cancer cell line PLC/RAF/5 repeatedly to establish the PLC/RAF/5/5-FU cell line. Morphological differences between the two types of cells were observed. The inhibitory effects of different concentrations of 5-FU (0, 0.25, 0.5, 1, 1.5, and 2 μg/ml on the proliferation of the two types of cells were determined using the CCK-8 assay. Apoptosis of the two types of cells after exposure to different concentrations of 5-FU (0.5, 1, and 2 μg/ml for 48 h was analyzed using flow cytometry. The proportions of side population cells in both types of cells were measured using flow cytometry. The colony-forming ability was compared between the two types of cells by the plate colony-forming assay. The expression of Bax, Bcl-2, ABCG2, and FoxM1 proteins in both types of cells was examined by Western blot. Between-group comparison was performed by t test. ResultsThe PLC/RAF/5/5-FU cell line was successfully established using the chemotherapy drug 5-FU. Compared with the PLC/RAF/5 cells, the PLC/RAF/5/5-FU cells had a larger volume, fewer protrusions, a changed shape of a long shuttle, and enhanced refractivity. Moreover, compared with the parent cells, the PLC/RAF/5/5-FU cells had a significantly lower sensitivity to the inhibitory effect of 5-FU on proliferation, a significantly lower proportion of cells at the G0/G1 phase of the cell cycle, significantly higher proportions of cells at the S and G2/M phases, significantly higher resistance to apoptosis, a significantly higher proportion of side population cells, and significantly enhanced proliferation (P＜0.05. According to the results of Western blot assay, the

Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

Science.gov (United States)

Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

2013-12-01

The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

Directory of Open Access Journals (Sweden)

Craxton Molly

2007-07-01

Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

WenTong HuoXue Cream Can Inhibit the Reduction of the Pain-Related Molecule PLC-β3 in the Dorsal Root Ganglion of a Rat Model of Diabetic Peripheral Neuropathy.

Science.gov (United States)

Feng, Chengcheng; Xu, Lijuan; Guo, Shiyun; Chen, Qian; Shen, Yuguo; Zang, Deng; Ma, Li

2018-01-01

WenTong HuoXue Cream (WTHX-Cream) has been shown to effectively alleviate clinical symptoms of diabetic peripheral neuropathy (DPN). This study investigated the gene and protein expression of the pain-related molecule PLC- β 3 in the dorsal root ganglion (DRG) of DPN rats. 88 specific pathogen-free male Wistar rats were randomly divided into placebo (10 rats) and DPN model (78 rats) groups, and the 78 model rats were used to establish the DPN model by intraperitoneal injection of streptozotocin and were then fed a high-fat diet for 8 weeks. These rats were randomly divided into the model group, the high-, medium-, and low-dose WTHX-Cream + metformin groups, the metformin group, the capsaicin cream group, and the capsaicin cream + metformin group. After 4 weeks of continuous drug administration, the blood glucose, body weight, behavioral indexes, and sciatic nerve conduction velocity were measured. The pathological structure of the DRG and the sciatic nerve were observed. PLC- β 3 mRNA and protein levels in the DRG of rats were measured. Compared with the model group, the high-dose WTHX-Cream group showed increased sciatic nerve conduction velocity, improved sciatic nerve morphological changes, and increased expression of PLC- β 3 mRNA and protein in the DRG. This study showed that WTHX-Cream improves hyperalgesia symptoms of DPN by inhibiting the reduction of PLC- β 3 mRNA and protein expression in the diabetic DRG of DPN rats.

WenTong HuoXue Cream Can Inhibit the Reduction of the Pain-Related Molecule PLC-β3 in the Dorsal Root Ganglion of a Rat Model of Diabetic Peripheral Neuropathy

Directory of Open Access Journals (Sweden)

Chengcheng Feng

2018-01-01

Full Text Available WenTong HuoXue Cream (WTHX-Cream has been shown to effectively alleviate clinical symptoms of diabetic peripheral neuropathy (DPN. This study investigated the gene and protein expression of the pain-related molecule PLC-β3 in the dorsal root ganglion (DRG of DPN rats. 88 specific pathogen-free male Wistar rats were randomly divided into placebo (10 rats and DPN model (78 rats groups, and the 78 model rats were used to establish the DPN model by intraperitoneal injection of streptozotocin and were then fed a high-fat diet for 8 weeks. These rats were randomly divided into the model group, the high-, medium-, and low-dose WTHX-Cream + metformin groups, the metformin group, the capsaicin cream group, and the capsaicin cream + metformin group. After 4 weeks of continuous drug administration, the blood glucose, body weight, behavioral indexes, and sciatic nerve conduction velocity were measured. The pathological structure of the DRG and the sciatic nerve were observed. PLC-β3 mRNA and protein levels in the DRG of rats were measured. Compared with the model group, the high-dose WTHX-Cream group showed increased sciatic nerve conduction velocity, improved sciatic nerve morphological changes, and increased expression of PLC-β3 mRNA and protein in the DRG. This study showed that WTHX-Cream improves hyperalgesia symptoms of DPN by inhibiting the reduction of PLC-β3 mRNA and protein expression in the diabetic DRG of DPN rats.

Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

Science.gov (United States)

Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

2018-02-01

Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

75 FR 17630 - Airworthiness Directives; Rolls-Royce plc RB211 Trent 700 and Trent 800 Series Turbofan Engines

Science.gov (United States)

2010-04-07

...-0364; Directorate Identifier 2009-NE-27-AD] RIN 2120-AA64 Airworthiness Directives; Rolls-Royce plc... based on those comments. We will post all comments we receive, without change, to http://www.regulations... Service Information Rolls-Royce plc has issued Alert Service Bulletin RB.211-72-AG086, dated December 4...

Plantaricyclin A, a Novel Circular Bacteriocin Produced by Lactobacillus plantarum NI326: Purification, Characterization, and Heterologous Production.

Science.gov (United States)

Borrero, Juan; Kelly, Eoin; O'Connor, Paula M; Kelleher, Philip; Scully, Colm; Cotter, Paul D; Mahony, Jennifer; van Sinderen, Douwe

2018-01-01

Bacteriocins from lactic acid bacteria (LAB) are of increasing interest in recent years due to their potential as natural preservatives against food and beverage spoilage microorganisms. In a screening study for LAB, we isolated from olives a strain, Lactobacillus plantarum NI326, with activity against the beverage-spoilage bacterium Alicyclobacillus acidoterrestris Genome sequencing of NI326 enabled the identification of a gene cluster (designated plc ) encoding a putative circular bacteriocin and proteins involved in its modification, transport, and immunity. This novel bacteriocin, named plantaricyclin A (PlcA), was grouped into the circular bacteriocin subgroup II due to its high degree of similarity with other gassericin A-like bacteriocins. Purification of PlcA from the supernatant of Lb. plantarum NI326 resulted in an active peptide with a molecular mass of 5,570 Da, corresponding to that predicted from the (processed) PlcA amino acid sequence. The plc gene cluster was cloned and expressed in Lactococcus lactis NZ9000, resulting in the production of an active 5,570-Da bacteriocin in the supernatant. PlcA is believed to be produced as a 91-amino-acid precursor with a 33-amino-acid leader peptide, which is predicted to be removed, followed by joining of the N and C termini via a covalent linkage to form the mature 58-amino-acid circular bacteriocin PlcA. We report the characterization of a circular bacteriocin produced by Lb. plantarum The inhibition displayed against A. acidoterrestris highlights its potential use as a preservative in food and beverages. IMPORTANCE In this work, we describe the purification and characterization of an antimicrobial peptide, termed plantaricyclin A (PlcA), produced by a Lactobacillus plantarum strain isolated from olives. This peptide has a circular structure, and all genes involved in its production, circularization, and secretion were identified. PlcA shows antimicrobial activity against different strains, including

Modeling of Hydration, Compressive Strength, and Carbonation of Portland-Limestone Cement (PLC Concrete

Directory of Open Access Journals (Sweden)

Xiao-Yong Wang

2017-01-01

Full Text Available Limestone is widely used in the construction industry to produce Portland limestone cement (PLC concrete. Systematic evaluations of hydration kinetics, compressive strength development, and carbonation resistance are crucial for the rational use of limestone. This study presents a hydration-based model for evaluating the influences of limestone on the strength and carbonation of concrete. First, the hydration model analyzes the dilution effect and the nucleation effect of limestone during the hydration of cement. The degree of cement hydration is calculated by considering concrete mixing proportions, binder properties, and curing conditions. Second, by using the gel–space ratio, the compressive strength of PLC concrete is evaluated. The interactions among water-to-binder ratio, limestone replacement ratio, and strength development are highlighted. Third, the carbonate material contents and porosity are calculated from the hydration model and are used as input parameters for the carbonation model. By considering concrete microstructures and environmental conditions, the carbon dioxide diffusivity and carbonation depth of PLC concrete are evaluated. The proposed model has been determined to be valid for concrete with various water-to-binder ratios, limestone contents, and curing periods.

Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

OpenAIRE

Steven Steven; Yoni F Syukriani; Julius B Dewanto

2016-01-01

Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

78 FR 5126 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2013-01-24

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT... turbofan engines. This AD requires replacement of the fuel oil heat exchanger (FOHE). This AD was prompted...-84 turbofan engines with a fuel oil heat exchanger (FOHE), part number 47111-1241, installed. (d...

The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

Science.gov (United States)

Lin, J W; Lu, H C; Chen, H Y; Weng, S F

1997-10-09

Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

DEFF Research Database (Denmark)

Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

2014-01-01

The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

Comportamiento de la Tecnología PLC en la Red Eléctrica

OpenAIRE

García Guibout, J.; García Garino, Carlos; Fusario, Rubén J.; Castro Lechtaler, Antonio; Sevilla, Guillermo

2007-01-01

La tecnología PLC1 - PowerLine Communications- está referida a la transmisión de datos utilizando la red eléctrica, tanto domiciliaria, como la red de distribución de baja tensión. Dependiendo del tipo de red que se utilice como soporte esta tecnología se divide en PLC indoor y outdoor. La primera se refiere a la utilización de la red domiciliaria y utiliza las frecuencias más altas de 5 MHz a 30 ó 40 MHz. La segunda, outdoor, usa la red de distribución y las frecuencias bajas de 1 MHz a 5 ó ...

Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

Science.gov (United States)

Hempel, Niels; Görisch, Helmut; Mern, Demissew S

2013-09-01

Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

Directory of Open Access Journals (Sweden)

Tiane Martin de Moura

2012-10-01

Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

Energy Technology Data Exchange (ETDEWEB)

Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

1996-03-05

We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

PLC based automatic control of pasteurize mix in ice cream production

Science.gov (United States)

Yao, Xudong; Liang, Kai

2013-03-01

This paper describes the automatic control device of pasteurized mix in the ice cream production process.We design a scheme of control system using FBD program language and develop the programmer in the STEP 7-Micro/WIN software, check for any bugs before downloading into PLC .These developed devices will able to provide flexibility and accuracy to control the step of pasteurized mix. The operator just Input the duration and temperature of pasteurized mix through control panel. All the steps will finish automatically without any intervention in a preprogrammed sequence stored in programmable logic controller (PLC). With the help of this equipment we not only can control the quality of ice cream for various conditions, but also can simplify the production process. This control system is inexpensive and can be widely used in ice cream production industry.

Existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot

Science.gov (United States)

Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza

2016-01-01

Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

Science.gov (United States)

Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

2015-11-14

FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

LENUS (Irish Health Repository)

Martin, Ronny

2011-04-01

The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

Directory of Open Access Journals (Sweden)

Beatriz Moreno

2016-07-01

Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from

Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

Science.gov (United States)

Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

2007-07-01

Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

78 FR 70487 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2013-11-26

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT... turbofan engines. This AD requires removal of certain high-pressure (HP) and intermediate-pressure (IP..., RB211 Trent 768-60, 772-60, and 772B-60 turbofan engines with turbine disc part numbers (P/Ns) and...

78 FR 68360 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2013-11-14

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT... turbofan engines. The AD number is incorrect in the Regulatory text. This document corrects that error. In... turbofan engines. As published, the AD number 2013-19-17 under Sec. 39.13 [Amended], is incorrect. No other...

78 FR 61171 - Airworthiness Directives; Rolls-Royce plc Turbofan Engines

Science.gov (United States)

2013-10-03

... Airworthiness Directives; Rolls-Royce plc Turbofan Engines AGENCY: Federal Aviation Administration (FAA), DOT... (RR) RB211-535E4-B-37 series turbofan engines. This AD requires removal of affected parts using a...-B-37 series turbofan engines. (d) Unsafe Condition This AD was prompted by recalculating the lives...

Methods of Certification tests PLC-Networks in Compliance Safety Information

Directory of Open Access Journals (Sweden)

A. A. Balaev

2011-12-01

Full Text Available The aim of this research was description of the methodology of the audit plc-network to meet the requirements of information security. The technique is based on the provisions of the guidance documents and model FSTEC Russia test object methods of information on safety information.

Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

Directory of Open Access Journals (Sweden)

Peter K Busk

Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

Spreading of genes encoding enterotoxins, haemolysins, adhesin and biofilm among methicillin resistant Staphylococcus aureus strains with staphylococcal cassette chromosome mec type IIIA isolated from burn patients.

Science.gov (United States)

Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad

2016-08-01

The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.

Molecular cloning and functional analysis of the gene encoding ...

African Journals Online (AJOL)

Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

Use of nfsB, encoding nitroreductase, as a reporter gene to determine the mutational spectrum of spontaneous mutations in Neisseria gonorrhoeae

Directory of Open Access Journals (Sweden)

Dunham Stephen

2009-11-01

Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.

Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

Science.gov (United States)

Roten, C A; Brandt, C; Karamata, D

1991-04-01

Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

Science.gov (United States)

Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

2005-05-15

Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

Extensive diversification of IgD-, IgY-, and truncated IgY(δFc)-encoding genes in the red-eared turtle (Trachemys scripta elegans).

Science.gov (United States)

Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng

2012-10-15

IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.

Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures.

Directory of Open Access Journals (Sweden)

Senta Heiss-Blanquet

Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.

Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

Science.gov (United States)

Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

2015-05-01

Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

Directory of Open Access Journals (Sweden)

Alene Kast

2015-05-01

Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

Drosophila fatty acid taste signals through the PLC pathway in sugar-sensing neurons.

Directory of Open Access Journals (Sweden)

Pavel Masek

Full Text Available Taste is the primary sensory system for detecting food quality and palatability. Drosophila detects five distinct taste modalities that include sweet, bitter, salt, water, and the taste of carbonation. Of these, sweet-sensing neurons appear to have utility for the detection of nutritionally rich food while bitter-sensing neurons signal toxicity and confer repulsion. Growing evidence in mammals suggests that taste for fatty acids (FAs signals the presence of dietary lipids and promotes feeding. While flies appear to be attracted to fatty acids, the neural basis for fatty acid detection and attraction are unclear. Here, we demonstrate that a range of FAs are detected by the fly gustatory system and elicit a robust feeding response. Flies lacking olfactory organs respond robustly to FAs, confirming that FA attraction is mediated through the gustatory system. Furthermore, flies detect FAs independent of pH, suggesting the molecular basis for FA taste is not due to acidity. We show that low and medium concentrations of FAs serve as an appetitive signal and they are detected exclusively through the same subset of neurons that sense appetitive sweet substances, including most sugars. In mammals, taste perception of sweet and bitter substances is dependent on phospholipase C (PLC signaling in specialized taste buds. We find that flies mutant for norpA, a Drosophila ortholog of PLC, fail to respond to FAs. Intriguingly, norpA mutants respond normally to other tastants, including sucrose and yeast. The defect of norpA mutants can be rescued by selectively restoring norpA expression in sweet-sensing neurons, corroborating that FAs signal through sweet-sensing neurons, and suggesting PLC signaling in the gustatory system is specifically involved in FA taste. Taken together, these findings reveal that PLC function in Drosophila sweet-sensing neurons is a conserved molecular signaling pathway that confers attraction to fatty acids.

Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.