WorldWideScience

Sample records for element binding proteins

  1. Cyclic AMP response element binding protein and brain-derived ...

    Indian Academy of Sciences (India)

    Madhu

    The transcription factor cyclic AMP response element binding protein (CREB) and the neurotrophin brain-derived neurotrophic factor (BDNF) are targets of diverse classes of antidepressants and are known to be regulated in animal models and in patients suffering from depression. Given their role in neuronal plasticity, ...

  2. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity

    DEFF Research Database (Denmark)

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C

    2015-01-01

    Liver X receptor (LXR)α and LXRβ play key roles in hepatic de novo lipogenesis through their regulation of lipogenic genes, including sterol regulatory element-binding protein (SREBP)-1c and carbohydrate responsive element-binding protein (ChREBP). LXRs activate lipogenic gene transcription...

  3. Regulation of cyclic adenosine monophosphate response element binding protein on renin expression in kidney via complex cyclic adenosine monophosphate response element-binding-protein-binding protein/P300 recruitment.

    Science.gov (United States)

    Li, Pei; Zhang, Jing; Zhu, Yuanfang; Liu, Ming; Xuan, Jin

    2015-11-01

    Renin synthesis and release is the rate-limiting step in the renin-angiotensin system, because cyclic adenosine monophosphate (cAMP) has been identified as dominant pathway for renin gene expression, and cAMP response element-binding protein (CREB) is found in the human and mouse renin promoter. This study aimed to evaluate the role of CREB in expression of the renin gene. We created conditional deletion of CREB in mice with low-sodium diet, specifically in renin cells of the kidney. To assess the effect of CREB on renin expression, immunostaining of renin was used in samples from wild-type mice and mice with gene knock-down of CREB. Cyclic AMP response element-binding-protein-binding protein (CBP) and p300 were measured in cultured renin cells of the mice, and RNA detection was done with real-time polymerase chain reaction. With low-sodium diet, renin was expressed along the whole wall of the afferent glomerular arterioles in wild-type mice, while there was no increase or even decrease in renin expression in CREB-specific deletion mice; RNA level of renin in cultured cells decreased by 50% with single knock-down of CREB, CBP, or p300, and decreased 70% with triple knock-down of CREB, CBP, and p300. This study found that CREB was important for renin synthesis and the role of CREB can be achieved through the recruitment of co-activators CBP and p300.

  4. Lanosterol metabolism and sterol regulatory element binding protein (SREBP) expression in male germ cell maturation.

    Science.gov (United States)

    Fon Tacer, Klementina; Kalanj-Bognar, Svjetlana; Waterman, Michael R; Rozman, Damjana

    2003-06-01

    Expression of genes involved in cholesterol biosynthesis in male germ cells is insensitive to the negative cholesterol feedback regulation, in contrast to cholesterol level-sensitive/sterol regulatory element binding protein (SREBP)-dependent gene regulation in somatic cells. The role of sterol regulatory element binding proteins in spermatogenic cells was an enigma until recently, when a soluble, 55kDa cholesterol-insensitive form of SREBP2 (SREBP2gc) was discovered [Mol. Cell. Endocrinol. 22 (2002) 8478], being translated from a germ cell-specific SREBP2 mRNA. Our RT-PCR results also show that SREBP2 as well as SREBP1c mRNAs are detectable in prepubertal and postpubertal male germ cells while SREBP1a is not detected. Surprisingly, three SREBP2 immunoreactive proteins (72, 63 and 55kDa), that are not present in mouse liver nuclei, reside in testis nuclei of prepubertal and adult mice. The 55kDa protein is likely SREBP2gc, the other two isoforms are novel. HPLC measurements in liver and testes of fasted prepubertal and postpubertal mice showed no significant difference in cholesterol level. However, FF-MAS and lanosterol/testis-meiosis activating sterol (T-MAS) intermediates that are detectable mainly in testes, increase in fasted postpubertal mice which coincides well with the elevated level of 68kDa SREBP2. Similar to SREBP2gc, the two novel SREBP2 immunoreactive proteins seem to be insensitive to the level of cholesterol.

  5. Phosphate binding protein as the biorecognition element in a biosensor for phosphate

    Science.gov (United States)

    Salins, Lyndon L E.; Deo, Sapna K.; Daunert, Sylvia

    2004-01-01

    This work explores the potential use of a member of the periplasmic family of binding proteins, the phosphate binding protein (PBP), as the biorecognition element in a sensing scheme for the detection of inorganic phosphate (Pi). The selectivity of this protein originates from its natural role which, in Escherichia coli, is to serve as the initial receptor for the highly specific translocation of Pi to the cytoplasm. The single polypeptide chain of PBP is folded into two similar domains connected by three short peptide linkages that serve as a hinge. The Pi binding site is located deep within the cleft between the two domains. In the presence of the ligand, the two globular domains engulf the former in a hinge-like manner. The resultant conformational change constitutes the basis of the sensor development. A mutant of PBP (MPBP), where an alanine was replaced by a cysteine residue, was prepared by site-directed mutagenesis using the polymerase chain reaction (PCR). The mutant was expressed, from plasmid pSD501, in the periplasmic space of E. coli and purified in a single chromatographic step on a perfusion anion-exchange column. Site-specific labeling was achieved by attaching the fluorophore, N-[2-(1-maleimidyl)ethyl]-7-(diethylamino)coumarin-3-carboxamide (MDCC), to the protein through the sulfhydryl group of the cysteine moiety. Steady-state fluorescence studies of the MPBP-MDCC conjugate showed a change in the intensity of the signal upon addition of Pi. Calibration curves for Pi were constructed by relating the intensity of the fluorescence signal with the amount of analyte present in the sample. The sensing system was first developed and optimized on a spectrofluorometer using ml volumes of sample. It was then adapted to be used on a microtiter plate arrangement with microliter sample volumes. The system's versatility was finally proven by developing a fiber optic fluorescence-based sensor for monitoring Pi. In all three cases the detection limits for the

  6. [Association of cyclic adenosine monophosphate response element-binding protein gene and major depressive disorder].

    Science.gov (United States)

    Liu, Xiao-hua; Xu, Yi-feng; Cui, Dong-hong; Jiang, San-duo; Qian, Yi-ping; Yu, Shun-ying; Jiang, Kai-da

    2010-06-01

    To investigate the association between single nucleotide polymorphisms (SNPs) in cyclic adenosine monophosphate response element-binding protein(CREB1) gene and major depressive disorder (MDD). We recruited 105 parent-offspring trios of Chinese descent, extracted whole blood genomic DNA, and genotyped the SNPs in rs10932201 and rs6740584 loci. Single-marker transmission disequilibrium test (TDT), pairwise SNP linkage disequilibrium(LD) and haplotype-based TDT were performed. No significant association with MDD was observed for SNPs rs10932201 and rs6740584 (P=0.1004 and P=0.4986). However, there was strong positive association between the rs10932201-rs6740584 haplotype and MDD (P=0.00003241), and both haplotypes of A-C and A-T were significantly associated with MDD (P=0.020 and P=0.00022). The rs10932201-rs6740584 haplotype of the CREB1 gene may play an important role in the pathogenesis of MDD.

  7. Regulation of antidepressant activity by cAMP response element binding proteins.

    Science.gov (United States)

    Conti, Alana C; Blendy, Julie A

    2004-10-01

    Depression is a clinically and biologically heterogeneous disease that is one of the most prevalent and costly psychiatric disorders. It is the leading cause of disability regarding job performance and burden on family members in the United States and worldwide. Although the therapeutic efficacy of antidepressant drugs has been recognized for years, the exact molecular mechanisms of action remain elusive, making the systematic approach to the development of new drugs difficult. The acute increases in levels of monoamines brought about by various classes of antidepressants cannot account for the requirement of repeated, chronic administration for up to 2-6 wk before treatment benefits become evident. Furthermore, despite their efficacy, current antidepressant drugs improve symptoms in only 60% of patients treated. The development of new and better therapies depends on a thorough understanding of the neurobiology of depression and the molecular mechanisms underlying antidepressant drug action. Early studies focusing on alterations in the levels of receptors and second messengers helped define the important signaling pathways initiated by these drugs, whereas recent molecular studies suggested that long-term adaptations in cellular signaling mechanisms may be required for the onset and/or maintenance of antidepressant effects. Attention has now focused on downstream targets of Ca++ and cyclic adenosine monophosphate (cAMP) in the cell, such as the activation of transcription factors. This article discusses the transcription factor cAMP response element binding protein and a related protein, cyclic AMP response element modulator, and their roles as molecular mediators of antidepressant action.

  8. Sterol regulatory element-binding protein-1c knockdown protected INS-1E cells from lipotoxicity.

    Science.gov (United States)

    Li, J; Liu, X; Ran, X; Chen, J; Li, X; Wu, W; Huang, H; Huang, H; Long, Y; Liang, J; Cheng, J; Tian, H

    2010-01-01

    The reduction in insulin secretory capacity and beta-cell mass has been attributed, at least partially, to lipotoxicity, which may contribute to the development of type 2 diabetes. Chronic free fatty acids (FFA) exposure impairs pancreatic beta-cell function and induces beta-cell apoptosis. This study is to elucidate the underlying molecular mechanisms. We exposed INS-1E pancreatic beta-cell line to palmitate or oleate, and measured the glucose stimulated insulin secretion (GSIS). The effect of FFA on sterol regulatory element-binding protein (SREBP)-1c lipogenic pathway, and expression of genes involved in beta-cell functions, including AMPK (AMP-activated protein kinase), UCP-2 (uncoupling protein-2), IRS-2 (insulin receptor substrate-2), PDX-1 (pancreatic duodenal homeobox-1), GLUT-2 (glucose transporter-2) and B cell lymphoma/leukaemia-2 (Bcl-2) were investigated. Apoptosis of these exposed cells was determined by MitoCapture, Annexin V-Cy3 or terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling assay. Cell lipid accumulation was measured by oil red O staining or TG extraction. Also SREBP-1c expression knockdown were used. FFA treatment resulted in SREBP-1c overexpression, impaired GSIS, lipid accumulation, apoptosis of INS-1E cells. In addition, the expression of lipogenic genes and UCP-2 were upregulated, but AMPK, IRS-2, PDX-1, GLUT-2 and Bcl-2 were downregulated in the exposed cells. However, these lipotoxic effects of FFA were largely prevented by induction of a SREBP-1c small interfering RNA. These data suggest a strong correlation between FFA treatment and SREBP-1c activation in INS-1E cells. SREBP-1c might be a major factor responsible for beta-cell lipotoxicity, and SREBP-1c knockdown could protect INS-1E cells from lipotoxicity, which is implicating a therapeutic potential for treating diabetes related to lipotoxicity.

  9. Sterol regulatory element binding protein-1 (SREBP1) gene expression is similarly increased in polycystic ovary syndrome and endometrial cancer.

    Science.gov (United States)

    Shafiee, Mohamad N; Mongan, Nigel; Seedhouse, Claire; Chapman, Caroline; Deen, Suha; Abu, Jafaru; Atiomo, William

    2017-05-01

    Women with polycystic ovary syndrome have a three-fold higher risk of endometrial cancer. Insulin resistance and hyperlipidemia may be pertinent factors in the pathogenesis of both conditions. The aim of this study was to investigate endometrial sterol regulatory element binding protein-1 gene expression in polycystic ovary syndrome and endometrial cancer endometrium, and to correlate endometrial sterol regulatory element binding protein-1 gene expression with serum lipid profiles. A cross-sectional study was performed at Nottingham University Hospital, UK. A total of 102 women (polycystic ovary syndrome, endometrial cancer and controls; 34 participants in each group) were recruited. Clinical and biochemical assessments were performed before endometrial biopsies were obtained from all participants. Taqman real-time polymerase chain reaction for endometrial sterol regulatory element binding protein-1 gene and its systemic protein expression were analyzed. The body mass indices of women with polycystic ovary syndrome (29.28 ± 2.91 kg/m 2 ) and controls (28.58 ± 2.62 kg/m 2 ) were not significantly different. Women with endometrial cancer had a higher mean body mass index (32.22 ± 5.70 kg/m 2 ). Sterol regulatory element binding protein-1 gene expression was significantly increased in polycystic ovary syndrome and endometrial cancer endometrium compared with controls (p polycystic ovary syndrome, but this was not statistically significant. Similarly, statistically insignificant positive correlations were found between endometrial sterol regulatory element binding protein-1 gene expression and body mass index in endometrial cancer (r = 0.643, p = 0.06) and waist-hip ratio (r = 0.096, p = 0.073). Sterol regulatory element binding protein-1 gene expression was significantly positively correlated with triglyceride in both polycystic ovary syndrome and endometrial cancer (p = 0.028 and p = 0.027, respectively). Quantitative serum sterol regulatory

  10. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  11. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism.

    Science.gov (United States)

    Iizuka, Katsumi

    2017-02-22

    Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP) is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase), fructolysis (Glut5, ketohexokinase), and lipogenesis (acetyl CoA carboxylase, fatty acid synthase). ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp(-/-) mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  12. Functional analysis of two sterol regulatory element binding proteins in Penicillium digitatum.

    Directory of Open Access Journals (Sweden)

    Ruoxin Ruan

    Full Text Available The sterol regulatory element binding proteins (SREBPs are key regulators for sterol homeostasis in most fungi. In the citrus postharvest pathogen Penicillium digitatum, the SREBP homolog is required for fungicide resistance and regulation of CYP51 expression. In this study, we identified another SREBP transcription factor PdSreB in P. digitatum, and the biological functions of both SREBPs were characterized and compared. Inactivation of PdsreA, PdsreB or both genes in P. digitatum reduced ergosterol contents and increased sensitivities to sterol 14-α-demethylation inhibitors (DMIs and cobalt chloride. Fungal strains impaired at PdsreA but not PdsreB increased sensitivity to tridemorph and an iron chelator 2,2'-dipyridyl. Virulence assays on citrus fruit revealed that fungal strains impaired at PdsreA, PdsreB or both induce maceration lesions similar to those induced by wild-type. However, ΔPdsreA, ΔPdsreB or the double mutant strain rarely produce aerial mycelia on infected citrus fruit peels. RNA-Seq analysis showed the broad regulatory functions of both SREBPs in biosynthesis, transmembrane transportation and stress responses. Our results provide new insights into the conserved and differentiated regulatory functions of SREBP homologs in plant pathogenic fungi.

  13. Antiproliferative protein Tob directly regulates c-myc proto-oncogene expression through cytoplasmic polyadenylation element-binding protein CPEB.

    Science.gov (United States)

    Ogami, K; Hosoda, N; Funakoshi, Y; Hoshino, S

    2014-01-02

    The regulation of mRNA deadenylation constitutes a pivotal mechanism of the post-transcriptional control of gene expression. Here we show that the antiproliferative protein Tob, a component of the Caf1-Ccr4 deadenylase complex, is involved in regulating the expression of the proto-oncogene c-myc. The c-myc mRNA contains cis elements (CPEs) in its 3'-untranslated region (3'-UTR), which are recognized by the cytoplasmic polyadenylation element-binding protein (CPEB). CPEB recruits Caf1 deadenylase through interaction with Tob to form a ternary complex, CPEB-Tob-Caf1, and negatively regulates the expression of c-myc by accelerating the deadenylation and decay of its mRNA. In quiescent cells, c-myc mRNA is destabilized by the trans-acting complex (CPEB-Tob-Caf1), while in cells stimulated by the serum, both Tob and Caf1 are released from CPEB, and c-Myc expression is induced early after stimulation by the stabilization of its mRNA as an 'immediate-early gene'. Collectively, these results indicate that Tob is a key factor in the regulation of c-myc gene expression, which is essential for cell growth. Thus, Tob appears to function in the control of cell growth at least, in part, by regulating the expression of c-myc.

  14. Human sterol regulatory element-binding protein 1a contributes significantly to hepatic lipogenic gene expression.

    Science.gov (United States)

    Bitter, Andreas; Nüssler, Andreas K; Thasler, Wolfgang E; Klein, Kathrin; Zanger, Ulrich M; Schwab, Matthias; Burk, Oliver

    2015-01-01

    Sterol regulatory element-binding protein (SREBP) 1, the master regulator of lipogenesis, was shown to be associated with non-alcoholic fatty liver disease, which is attributed to its major isoform SREBP1c. Based on studies in mice, the minor isoform SREBP1a is regarded as negligible for hepatic lipogenesis. This study aims to elucidate the expression and functional role of SREBP1a in human liver. mRNA expression of both isoforms was quantified in cohorts of human livers and primary human hepatocytes. Hepatocytes were treated with PF-429242 to inhibit the proteolytic activation of SREBP precursor protein. SREBP1a-specifc and pan-SREBP1 knock-down were performed by transfection of respective siRNAs. Lipogenic SREBP-target gene expression was analyzed by real-time RT-PCR. In human liver, SREBP1a accounts for up to half of the total SREBP1 pool. Treatment with PF-429242 indicated SREBP-dependent auto-regulation of SREBP1a, which however was much weaker than of SREBP1c. SREBP1a-specifc knock-down also reduced significantly the expression of SREBP1c and of SREBP-target genes. Regarding most SREBP-target genes, simultaneous knock-down of both isoforms resulted in effects of only similar extent as SREBP1a-specific knock-down. We here showed that SREBP1a is significantly contributing to the human hepatic SREBP1 pool and has a share in human hepatic lipogenic gene expression. © 2015 S. Karger AG, Basel.

  15. Human Sterol Regulatory Element-Binding Protein 1a Contributes Significantly to Hepatic Lipogenic Gene Expression

    Directory of Open Access Journals (Sweden)

    Andreas Bitter

    2015-01-01

    Full Text Available Background/Aims: Sterol regulatory element-binding protein (SREBP 1, the master regulator of lipogenesis, was shown to be associated with non-alcoholic fatty liver disease, which is attributed to its major isoform SREBP1c. Based on studies in mice, the minor isoform SREBP1a is regarded as negligible for hepatic lipogenesis. This study aims to elucidate the expression and functional role of SREBP1a in human liver. Methods: mRNA expression of both isoforms was quantified in cohorts of human livers and primary human hepatocytes. Hepatocytes were treated with PF-429242 to inhibit the proteolytic activation of SREBP precursor protein. SREBP1a-specifc and pan-SREBP1 knock-down were performed by transfection of respective siRNAs. Lipogenic SREBP-target gene expression was analyzed by real-time RT-PCR. Results: In human liver, SREBP1a accounts for up to half of the total SREBP1 pool. Treatment with PF-429242 indicated SREBP-dependent auto-regulation of SREBP1a, which however was much weaker than of SREBP1c. SREBP1a-specifc knock-down also reduced significantly the expression of SREBP1c and of SREBP-target genes. Regarding most SREBP-target genes, simultaneous knock-down of both isoforms resulted in effects of only similar extent as SREBP1a-specific knock-down. Conclusion: We here showed that SREBP1a is significantly contributing to the human hepatic SREBP1 pool and has a share in human hepatic lipogenic gene expression.

  16. The regulatory element 3' to the A gamma-globin gene binds to the nuclear matrix and interacts with special A-T-rich binding protein 1 (SATB1), an SAR/MAR-associating region DNA binding protein.

    Science.gov (United States)

    Cunningham, J M; Purucker, M E; Jane, S M; Safer, B; Vanin, E F; Ney, P A; Lowrey, C H; Nienhuis, A W

    1994-08-15

    A cis-acting DNA regulatory element 3' to the A gamma-globin gene contains eight distinct regions of DNA-protein interaction distributed over 750 bp of DNA. The sequences of two foot-printed regions (sites I and IV) are A-T rich and generate a highly retarded complex on gel shift analysis with nuclear extract from human erythroleukemia (K562) cells. We have purified a 98-kD protein that reproduces this gel shift. Tryptic cleavage and peptide sequence analysis demonstrated that the 98-kD protein is identical to a recently cloned protein, special A-T-rich binding protein 1 (SATB1), that binds selectively to nuclear matrix/scaffold-associated regions of DNA (MARs/SARs). We have shown by functional analysis that the 3' A gamma regulatory element associates with the nuclear matrix. SATB1 mRNA was identified in K562 cells, and reverse transcriptase-polymerase chain reaction (RT-PCR) demonstrated its transcript in several other hematopoietic lines. Antisera to SATB1 caused ablation of the gel shift complex generated by both the crude nuclear extract and the purified 98-kD protein with the site I oligonucleotide. Furthermore, oligonucleotides that bind SATB1 inhibited formation of the site I gel shift complex when added as excess unlabeled competitor. An immunoblot analysis of the site I gel shift complex documented the presence of SATB1. Binding of SATB1 to two sites within the 3' A gamma regulatory element and its MAR/SAR activity suggests that this element may influence gene expression through interaction with the nuclear matrix.

  17. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity

    DEFF Research Database (Denmark)

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C

    2015-01-01

    in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin......Liver X receptor (LXR)α and LXRβ play key roles in hepatic de novo lipogenesis through their regulation of lipogenic genes, including sterol regulatory element-binding protein (SREBP)-1c and carbohydrate responsive element-binding protein (ChREBP). LXRs activate lipogenic gene transcription......-independent effects of feeding on LXR-mediated lipogenic gene expression in vivo, we subjected control and streptozotocin-treated LXRα/β(+/+) and LXRα/β(-/-) mice to a fasting-refeeding regime. We show that under hyperglycemic and hypoinsulinemic conditions, LXRs maintain their ability to upregulate the expression...

  18. Drosophila TDP-43 RNA-Binding Protein Facilitates Association of Sister Chromatid Cohesion Proteins with Genes, Enhancers and Polycomb Response Elements.

    Directory of Open Access Journals (Sweden)

    Amanda Swain

    2016-09-01

    Full Text Available The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs. RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers.

  19. Deficiency of carbohydrate response element-binding protein (ChREBP) reduces lipogenesis as well as glycolysis

    OpenAIRE

    Iizuka, Katsumi; Bruick, Richard K.; Liang, Guosheng; Horton, Jay D.; Uyeda, Kosaku

    2004-01-01

    The liver provides for long-term energy needs of the body by converting excess carbohydrate into fat for storage. Insulin is one factor that promotes hepatic lipogenesis, but there is increasing evidence that glucose also contributes to the coordinated regulation of carbohydrate and fat metabolism in liver by mechanisms that are independent of insulin. In this study, we show that the transcription factor, carbohydrate response element-binding protein (ChREBP), is required both for basal and c...

  20. A role for basic transcription element-binding protein 1 (BTEB1) in the autoinduction of thyroid hormone receptor beta.

    Science.gov (United States)

    Bagamasbad, Pia; Howdeshell, Kembra L; Sachs, Laurent M; Demeneix, Barbara A; Denver, Robert J

    2008-01-25

    Thyroid hormone (T(3)) induces gene regulation programs necessary for tadpole metamorphosis. Among the earliest responses to T(3) are the up-regulation of T(3) receptor beta (TRbeta; autoinduction) and BTEB1 (basic transcription element-binding protein 1). BTEB1 is a member of the Krüppel family of transcription factors that bind to GC-rich regions in gene promoters. The proximal promoter of the Xenopus laevis TrbetaA gene has seven GC-rich sequences, which led us to hypothesize that BTEB1 binds to and regulates TrbetaA. In tadpoles and the frog fibroblast-derived cell line XTC-2, T(3) up-regulated Bteb1 mRNA with faster kinetics than TrbetaA, and Bteb1 mRNA correlated with increased BTEB1 protein expression. BTEB1 bound to GC-rich sequences in the proximal TrbetaA promoter in vitro. By using chromatin immunoprecipitation assay, we show that BTEB1 associates with the TrbetaA promoter in vivo in a T(3) and developmental stage-dependent manner. Induced expression of BTEB1 in XTC-2 cells caused accelerated and enhanced autoinduction of the TrbetaA gene. This enhancement was lost in N-terminal truncated mutants of BTEB1. However, point mutations in the zinc fingers of BTEB1 that destroyed DNA binding did not alter the activity of the protein on TrbetaA autoinduction, suggesting that BTEB1 can function in this regard through protein-protein interactions. Our findings support the hypothesis that BTEB1 associates with the TrbetaA promoter in vivo and enhances autoinduction, but this action does not depend on its DNA binding activity. Cooperation among the protein products of immediate early genes may be a common mechanism for driving developmental signaling pathways.

  1. Cyclic adenosine monophosphate-responsive element-binding protein activation predicts an unfavorable prognosis in patients with hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    Yu L

    2014-05-01

    Full Text Available Lingxiang Yu,* Xiaodong Guo,* Peirui Zhang, Ruizhao Qi, Zhiwei Li, Shaogeng Zhang Department of Hepatobiliary Surgery, 302 Military Hospital of China, Beijing, People’s Republic of China *These authors contributed equally to this work Aim: To investigate the clinical significance of cyclic adenosine monophosphate-responsive element-binding (CREB and phosphorylated CREB (pCREB expression in human hepatocellular carcinoma (HCC. Materials and methods: Immunohistochemistry and Western blot analyses were performed to detect the expression and subcellular localizations of CREB and pCREB proteins in 130 pairs of HCC and adjacent nonneoplastic liver tissues. Results: Both immunohistochemistry and Western blot analyses showed that the expression levels of CREB and pCREB proteins in HCC tissues were significantly higher than those in the adjacent nonneoplastic liver tissues (both P<0.001. In addition, the combined upregulation of CREB and pCREB proteins (CREB-high/pCREB-high was significantly associated with serum α-fetoprotein (P=0.02, tumor stage (P<0.001, and tumor grade (P=0.01. Moreover, HCC patients with CREB-high/pCREB-high expression showed shortest 5-year disease-free survival and 5-year overall survival (both P<0.001. Furthermore, the multivariate survival analysis found that the combined upregulation of CREB and pCREB proteins may be an independent unfavorable prognostic factor for both 5-year disease-free survival and 5-year overall survival (both P=0.01 in HCC. Conclusion: Our data indicate for the first time that the activation of the CREB protein may be associated with tumor progression in HCC, and may serve as a valuable marker of prognosis for patients with this malignancy. Keywords: hepatocellular carcinoma, cyclic AMP-responsive element-binding protein, tumor progression, prognosis

  2. Maturation and activity of sterol regulatory element binding protein 1 is inhibited by acyl-CoA binding domain containing 3.

    Directory of Open Access Journals (Sweden)

    Yong Chen

    Full Text Available Imbalance of lipid metabolism has been linked with pathogenesis of a variety of human pathological conditions such as diabetes, obesity, cancer and neurodegeneration. Sterol regulatory element binding proteins (SREBPs are the master transcription factors controlling the homeostasis of fatty acids and cholesterol in the body. Transcription, expression, and activity of SREBPs are regulated by various nutritional, hormonal or stressful stimuli, yet the molecular and cellular mechanisms involved in these adaptative responses remains elusive. In the present study, we found that overexpressed acyl-CoA binding domain containing 3 (ACBD3, a Golgi-associated protein, dramatically inhibited SREBP1-sensitive promoter activity of fatty acid synthase (FASN. Moreover, lipid deprivation-stimulated SREBP1 maturation was significantly attenuated by ACBD3. With cell fractionation, gene knockdown and immunoprecipitation assays, it was showed that ACBD3 blocked intracellular maturation of SREBP1 probably through directly binding with the lipid regulator rather than disrupted SREBP1-SCAP-Insig1 interaction. Further investigation revealed that acyl-CoA domain-containing N-terminal sequence of ACBD3 contributed to its inhibitory effects on the production of nuclear SREBP1. In addition, mRNA and protein levels of FASN and de novo palmitate biosynthesis were remarkably reduced in cells overexpressed with ACBD3. These findings suggest that ACBD3 plays an essential role in maintaining lipid homeostasis via regulating SREBP1's processing pathway and thus impacting cellular lipogenesis.

  3. Piperine Induces Hepatic Low-Density Lipoprotein Receptor Expression through Proteolytic Activation of Sterol Regulatory Element-Binding Proteins.

    Science.gov (United States)

    Ochiai, Ayasa; Miyata, Shingo; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2015-01-01

    Elevated plasma low-density lipoprotein (LDL) cholesterol is considered as a risk factor for atherosclerosis. Because the hepatic LDL receptor (LDLR) uptakes plasma lipoproteins and lowers plasma LDL cholesterol, the activation of LDLR is a promising drug target for atherosclerosis. In the present study, we identified the naturally occurring alkaloid piperine, as an inducer of LDLR gene expression by screening the effectors of human LDLR promoter. The treatment of HepG2 cells with piperine increased LDLR expression at mRNA and protein levels and stimulated LDL uptake. Subsequent luciferase reporter gene assays revealed that the mutation of sterol regulatory element-binding protein (SREBP)-binding element abolished the piperine-mediated induction of LDLR promoter activity. Further, piperine treatments increased mRNA levels of several SREBP targets and mature forms of SREBPs. However, the piperine-mediated induction of the mature forms of SREBPs was not observed in SRD-15 cells, which lack insulin-induced gene-1 (Insig-1) and Insig-2. Finally, the knockdown of SREBPs completely abolished the piperine-meditated induction of LDLR gene expression in HepG2 cells, indicating that piperine stimulates the proteolytic activation of SREBP and subsequent induction of LDLR expression and activity.

  4. Piperine Induces Hepatic Low-Density Lipoprotein Receptor Expression through Proteolytic Activation of Sterol Regulatory Element-Binding Proteins.

    Directory of Open Access Journals (Sweden)

    Ayasa Ochiai

    Full Text Available Elevated plasma low-density lipoprotein (LDL cholesterol is considered as a risk factor for atherosclerosis. Because the hepatic LDL receptor (LDLR uptakes plasma lipoproteins and lowers plasma LDL cholesterol, the activation of LDLR is a promising drug target for atherosclerosis. In the present study, we identified the naturally occurring alkaloid piperine, as an inducer of LDLR gene expression by screening the effectors of human LDLR promoter. The treatment of HepG2 cells with piperine increased LDLR expression at mRNA and protein levels and stimulated LDL uptake. Subsequent luciferase reporter gene assays revealed that the mutation of sterol regulatory element-binding protein (SREBP-binding element abolished the piperine-mediated induction of LDLR promoter activity. Further, piperine treatments increased mRNA levels of several SREBP targets and mature forms of SREBPs. However, the piperine-mediated induction of the mature forms of SREBPs was not observed in SRD-15 cells, which lack insulin-induced gene-1 (Insig-1 and Insig-2. Finally, the knockdown of SREBPs completely abolished the piperine-meditated induction of LDLR gene expression in HepG2 cells, indicating that piperine stimulates the proteolytic activation of SREBP and subsequent induction of LDLR expression and activity.

  5. Caspase-2, a Novel Lipid Sensor under the Control of Sterol Regulatory Element Binding Protein 2†

    Science.gov (United States)

    Logette, E.; Le Jossic-Corcos, C.; Masson, D.; Solier, S.; Sequeira-Legrand, A.; Dugail, I.; Lemaire-Ewing, S.; Desoche, L.; Solary, E.; Corcos, L.

    2005-01-01

    Caspases play important roles in apoptotic cell death and in some other functions, such as cytokine maturation, inflammation, or differentiation. We show here that the 5′-flanking region of the human CASP-2 gene contains three functional response elements for sterol regulatory element binding proteins (SREBPs), proteins that mediate the transcriptional activation of genes involved in cholesterol, triacylglycerol, and fatty acid synthesis. Exposure of several human cell lines to statins, lipid-lowering drugs that drive SREBP proteolytic activation, induced the CASP-2 gene to an extent similar to that for known targets of SREBP proteins. Adenoviral vector-mediated transfer of active SREBP-2 also induced expression of the CASP-2 gene and the caspase-2 protein and increased the cholesterol and triacylglycerol cellular content. These rises in lipids were strongly impaired following small interfering RNA-mediated silencing of the CASP-2 gene. Taken together, our results identify the human CASP-2 gene as a member of the SREBP-responsive gene battery that senses lipid levels in cells and raise the possibility that caspase-2 participates in the control of cholesterol and triacylglycerol levels. PMID:16227610

  6. The Human CCHC-type Zinc Finger Nucleic Acid-Binding Protein Binds G-Rich Elements in Target mRNA Coding Sequences and Promotes Translation

    Directory of Open Access Journals (Sweden)

    Daniel Benhalevy

    2017-03-01

    Full Text Available The CCHC-type zinc finger nucleic acid-binding protein (CNBP/ZNF9 is conserved in eukaryotes and is essential for embryonic development in mammals. It has been implicated in transcriptional, as well as post-transcriptional, gene regulation; however, its nucleic acid ligands and molecular function remain elusive. Here, we use multiple systems-wide approaches to identify CNBP targets and function. We used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP to identify 8,420 CNBP binding sites on 4,178 mRNAs. CNBP preferentially bound G-rich elements in the target mRNA coding sequences, most of which were previously found to form G-quadruplex and other stable structures in vitro. Functional analyses, including RNA sequencing, ribosome profiling, and quantitative mass spectrometry, revealed that CNBP binding did not influence target mRNA abundance but rather increased their translational efficiency. Considering that CNBP binding prevented G-quadruplex structure formation in vitro, we hypothesize that CNBP is supporting translation by resolving stable structures on mRNAs.

  7. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity.

    Science.gov (United States)

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C; MacPherson, Laura; Ruan, Hai-Bin; Wu, Jing; Pedersen, Thomas Å; Steffensen, Knut R; Yang, Xiaoyong; Matthews, Jason; Mandrup, Susanne; Nebb, Hilde I; Grønning-Wang, Line M

    2015-04-01

    Liver X receptor (LXR)α and LXRβ play key roles in hepatic de novo lipogenesis through their regulation of lipogenic genes, including sterol regulatory element-binding protein (SREBP)-1c and carbohydrate responsive element-binding protein (ChREBP). LXRs activate lipogenic gene transcription in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin-independent effects of feeding on LXR-mediated lipogenic gene expression in vivo, we subjected control and streptozotocin-treated LXRα/β(+/+) and LXRα/β(-/-) mice to a fasting-refeeding regime. We show that under hyperglycemic and hypoinsulinemic conditions, LXRs maintain their ability to upregulate the expression of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose metabolic sensors upstream of ChREBP by modulating GK expression, nuclear O-GlcNAc signaling, and ChREBP expression and activity. Copyright © 2015 by the American Society for Biochemistry and Molecular Biology, Inc.

  8. Cyclic adenosine monophosphate-responsive element-binding protein activation predicts an unfavorable prognosis in patients with hepatocellular carcinoma.

    Science.gov (United States)

    Yu, Lingxiang; Guo, Xiaodong; Zhang, Peirui; Qi, Ruizhao; Li, Zhiwei; Zhang, Shaogeng

    2014-01-01

    To investigate the clinical significance of cyclic adenosine monophosphate-responsive element-binding (CREB) and phosphorylated CREB (pCREB) expression in human hepatocellular carcinoma (HCC). Immunohistochemistry and Western blot analyses were performed to detect the expression and subcellular localizations of CREB and pCREB proteins in 130 pairs of HCC and adjacent nonneoplastic liver tissues. Both immunohistochemistry and Western blot analyses showed that the expression levels of CREB and pCREB proteins in HCC tissues were significantly higher than those in the adjacent nonneoplastic liver tissues (both P<0.001). In addition, the combined upregulation of CREB and pCREB proteins (CREB-high/pCREB-high) was significantly associated with serum α-fetoprotein (P=0.02), tumor stage (P<0.001), and tumor grade (P=0.01). Moreover, HCC patients with CREB-high/pCREB-high expression showed shortest 5-year disease-free survival and 5-year overall survival (both P<0.001). Furthermore, the multivariate survival analysis found that the combined upregulation of CREB and pCREB proteins may be an independent unfavorable prognostic factor for both 5-year disease-free survival and 5-year overall survival (both P=0.01) in HCC. Our data indicate for the first time that the activation of the CREB protein may be associated with tumor progression in HCC, and may serve as a valuable marker of prognosis for patients with this malignancy.

  9. Regulation of steroid 5-{alpha} reductase type 2 (Srd5a2) by sterol regulatory element binding proteins and statin

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Young-Kyo [Department of Molecular Biology and Biochemistry, 3244 McGaugh Hall, University of California, UC Irvine, Irvine, CA 92697-3900 (United States); Zhu, Bing [Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0144 (United States); Jeon, Tae-Il [Department of Molecular Biology and Biochemistry, 3244 McGaugh Hall, University of California, UC Irvine, Irvine, CA 92697-3900 (United States); Osborne, Timothy F., E-mail: tfosborn@uci.edu [Department of Molecular Biology and Biochemistry, 3244 McGaugh Hall, University of California, UC Irvine, Irvine, CA 92697-3900 (United States)

    2009-11-01

    In this study, we show that sterol regulatory element binding proteins (SREBPs) regulate expression of Srd5a2, an enzyme that catalyzes the irreversible conversion of testosterone to dihydroxytestosterone in the male reproductive tract and is highly expressed in androgen-sensitive tissues such as the prostate and skin. We show that Srd5a2 is induced in livers and prostate from mice fed a chow diet supplemented with lovastatin plus ezitimibe (L/E), which increases the activity of nuclear SREBP-2. The three fold increase in Srd5a2 mRNA mediated by L/E treatment was accompanied by the induction of SREBP-2 binding to the Srd5a2 promoter detected by a ChIP-chip assay in liver. We identified a SREBP-2 responsive region within the first 300 upstream bases of the mouse Srd5a2 promoter by co-transfection assays which contain a site that bound SREBP-2 in vitro by an EMSA. Srd5a2 protein was also induced in cells over-expressing SREBP-2 in culture. The induction of Srd5a2 through SREBP-2 provides a mechanistic explanation for why even though statin therapy is effective in reducing cholesterol levels in treating hypercholesterolemia it does not compromise androgen production in clinical studies.

  10. Sterol regulatory element-binding proteins are regulators of the rat thyroid peroxidase gene in thyroid cells.

    Directory of Open Access Journals (Sweden)

    Christine Rauer

    Full Text Available Sterol regulatory element-binding proteins (SREBPs-1c and -2, which were initially discovered as master transcriptional regulators of lipid biosynthesis and uptake, were recently identified as novel transcriptional regulators of the sodium-iodide symporter gene in the thyroid, which is essential for thyroid hormone synthesis. Based on this observation that SREBPs play a role for thyroid hormone synthesis, we hypothesized that another gene involved in thyroid hormone synthesis, the thyroid peroxidase (TPO gene, is also a target of SREBP-1c and -2. Thyroid epithelial cells treated with 25-hydroxycholesterol, which is known to inhibit SREBP activation, had about 50% decreased mRNA levels of TPO. Similarly, the mRNA level of TPO was reduced by about 50% in response to siRNA mediated knockdown of both, SREBP-1 and SREBP-2. Reporter gene assays revealed that overexpression of active SREBP-1c and -2 causes a strong transcriptional activation of the rat TPO gene, which was localized to an approximately 80 bp region in the intron 1 of the rat TPO gene. In vitro- and in vivo-binding of both, SREBP-1c and SREBP-2, to this region in the rat TPO gene could be demonstrated using gel-shift assays and chromatin immunoprecipitation. Mutation analysis of the 80 bp region of rat TPO intron 1 revealed two isolated and two overlapping SREBP-binding elements from which one, the overlapping SRE+609/InvSRE+614, was shown to be functional in reporter gene assays. In connection with recent findings that the rat NIS gene is also a SREBP target gene in the thyroid, the present findings suggest that SREBPs may be possible novel targets for pharmacological modulation of thyroid hormone synthesis.

  11. Identification of the RNA recognition element of the RBPMS family of RNA-binding proteins and their transcriptome-wide mRNA targets

    Science.gov (United States)

    Farazi, Thalia A.; Leonhardt, Carl S.; Mukherjee, Neelanjan; Mihailovic, Aleksandra; Li, Song; Max, Klaas E.A.; Meyer, Cindy; Yamaji, Masashi; Cekan, Pavol; Jacobs, Nicholas C.; Gerstberger, Stefanie; Bognanni, Claudia; Larsson, Erik; Ohler, Uwe; Tuschl, Thomas

    2014-01-01

    Recent studies implicated the RNA-binding protein with multiple splicing (RBPMS) family of proteins in oocyte, retinal ganglion cell, heart, and gastrointestinal smooth muscle development. These RNA-binding proteins contain a single RNA recognition motif (RRM), and their targets and molecular function have not yet been identified. We defined transcriptome-wide RNA targets using photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) in HEK293 cells, revealing exonic mature and intronic pre-mRNA binding sites, in agreement with the nuclear and cytoplasmic localization of the proteins. Computational and biochemical approaches defined the RNA recognition element (RRE) as a tandem CAC trinucleotide motif separated by a variable spacer region. Similar to other mRNA-binding proteins, RBPMS family of proteins relocalized to cytoplasmic stress granules under oxidative stress conditions suggestive of a support function for mRNA localization in large and/or multinucleated cells where it is preferentially expressed. PMID:24860013

  12. Cyclic adenosine monophosphate-response element-binding protein mediates the proangiogenic or proinflammatory activity of gremlin.

    Science.gov (United States)

    Corsini, Michela; Moroni, Emanuela; Ravelli, Cosetta; Andrés, Germán; Grillo, Elisabetta; Ali, Imran H; Brazil, Derek P; Presta, Marco; Mitola, Stefania

    2014-01-01

    Angiogenesis and inflammation are closely related processes. Gremlin is a novel noncanonical vascular endothelial growth factor receptor-2 (VEGFR2) ligand that induces a proangiogenic response in endothelial cells (ECs). Here, we investigated the role of the cyclic adenosine monophosphate-response element (CRE)-binding protein (CREB) in mediating the proinflammatory and proangiogenic responses of ECs to gremlin. Gremlin induces a proinflammatory response in ECs, leading to reactive oxygen species and cyclic adenosine monophosphate production and the upregulation of proinflammatory molecules involved in leukocyte extravasation, including chemokine (C-C motif) ligand-2 (Ccl2) and Ccl7, chemokine (C-X-C motif) ligand-1 (Cxcl1), vascular cell adhesion molecule-1 (VCAM-1), and intercellular adhesion molecule-1 (ICAM-1). Accordingly, gremlin induces the VEGFR2-dependent phosphorylation, nuclear translocation, and transactivating activity of CREB in ECs. CREB activation mediates the early phases of the angiogenic response to gremlin, including stimulation of EC motility and permeability, and leads to monocyte/macrophage adhesion to ECs and their extravasation. All these effects are inhibited by EC transfection with a dominant-negative CREB mutant or with a CREB-binding protein-CREB interaction inhibitor that competes for CREB/CRE binding. Also, both recombinant gremlin and gremlin-expressing tumor cells induce proinflammatory/proangiogenic responses in vivo that are suppressed by the anti-inflammatory drug hydrocortisone. Similar effects were induced by the canonical VEGFR2 ligand VEGF-A165. Together, the results underline the tight cross-talk between angiogenesis and inflammation and demonstrate a crucial role of CREB activation in the modulation of the VEGFR2-mediated proinflammatory/proangiogenic response of ECs to gremlin.

  13. cAMP/Ca2+ response element-binding protein plays a central role in the biogenesis of respiratory chain proteins in mammalian cells.

    Science.gov (United States)

    De Rasmo, Domenico; Signorile, Anna; Papa, Francesco; Roca, Emilio; Papa, Sergio

    2010-06-01

    In mammalian cells, promotion of mitochondrial biogenesis by various agents involves cAMP and Ca(2+)-mediated signal transduction pathways. Recruitment of these pathways results in phosphorylation by cAMP and Ca(2+)-dependent protein kinases of cAMP/Ca(2+) response element-binding protein (CREB). Phosphorylation of CREB, bound to transcriptional complexes of target genes, activates a down-stream cascade of transcriptional complexes, which involve in sequence, the nuclear factors TORCs, PGC-1, NRF1 and NRF2, and the mitochondrial factor mitochondrial transcriptional factor A. CREB also binds directly to the D-loop of mitochondrial DNA and activates its expression. Activation of this network of transcriptional complexes results in concerted promotion of the expression of nuclear and mitochondrial genes encoding subunits of oxidative phosphorylation complexes.

  14. Identification and Characterization of Cyclic AMP Response Element-Binding Protein H Response Element in the Human Apolipoprotein A5 Gene Promoter

    Directory of Open Access Journals (Sweden)

    Kwang Hoon Song

    2013-01-01

    Full Text Available The cyclic AMP response element-binding protein H (CREBH plays important roles in hepatic lipogenesis, fatty acid oxidation, and lipolysis under metabolic stress. Here, we report CREBH as a novel regulator of human APOA5. Knockdown of endogenous CREBH expression via small interfering RNA resulted in the downregulation of human APOA5 mRNA expression in human hepatoma cells, HepG2. Sequence analysis suggested that putative CREBH response element (CREBHRE is located in the human APOA5 promoter region and is highly conserved in both human and rodent. To clarify whether the human APOA5 promoter is regulated by CREBH, we analyzed the human APOA5 promoter region using a transient transfection assay and determined that transfection of CREBH induced human APOA5 promoter activity. Moreover, it was shown that CREBH directly regulated human APOA5 gene expression by binding to a unique CREBHRE located in the proximal human APOA5 promoter region, using 5′-deletion and mutagenesis of human APOA5 promoter analysis and chromatin immunoprecipitation assay. Taken together, our results demonstrated that human APOA5 is directly regulated by CREBH via CREBHRE and provided a new insight into the role of this liver-specific bZIP transcription factor in lipoprotein metabolism and triglyceride homeostasis.

  15. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  16. Activation of sterol regulatory element-binding proteins in mice exposed to perfluorooctanoic acid for 28 days.

    Science.gov (United States)

    Yan, Shengmin; Wang, Jianshe; Dai, Jiayin

    2015-09-01

    Perfluoroalkyl acids are widely used in numerous industrial and commercial applications due to their unique physical and chemical characteristics. Although perfluorooctanoic acid (PFOA) is associated with hepatomegaly through peroxisome proliferator-activated receptor α (PPARα) activation, liver fat accumulation and changes in gene expression related to fatty acid metabolism could still be found in PPARα-null mice exposed to PFOA. To explore the potential effects of PFOA on sterol regulatory element-binding proteins (SREBPs) activity, male mice were dosed with either Milli-Q water or PFOA at doses of 0.08, 0.31, 1.25, 5, and 20 mg/kg/day by gavage for 28 days. Liver total cholesterol concentrations and PFOA contents showed a dose-dependent decrease and increase, respectively. Transcriptional activity of PPARα and SREBPs was significantly enhanced in livers. Protein expression analyzed by Western blotting showed that PFOA exposure stimulated SREBP maturation. Furthermore, proteins blocked SREBP precursor transport, insulin-induced gene 1 (INSIG1) and INSIG2 proteins, as well as a protein-mediated nuclear SREBP proteolysis, F-box and WD-40 domain protein 7, decreased in mouse liver exposed to PFOA. The expression levels of the miR-183-96-182 cluster, which is possibly involved in a regulatory loop intermediated by SREBPs maturation, were also increased in the mouse liver after PFOA exposure. We also observed that PFOA induced lipid content and PPARα in Hepa 1-6 cells after exposure to PFOA for 72 h but SREBPs were not activated in vitro. These results demonstrated that SREBPs were maturated by activating the miR-183-96-182 cluster-SREBP regulatory loop in PFOA-exposed mouse liver.

  17. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Directory of Open Access Journals (Sweden)

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  18. Extracellular Acidic pH Activates the Sterol Regulatory Element-Binding Protein 2 to Promote Tumor Progression.

    Science.gov (United States)

    Kondo, Ayano; Yamamoto, Shogo; Nakaki, Ryo; Shimamura, Teppei; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Yoshida, Tetsuo; Aburatani, Hiroyuki; Osawa, Tsuyoshi

    2017-02-28

    Conditions of the tumor microenvironment, such as hypoxia and nutrient starvation, play critical roles in cancer progression. However, the role of acidic extracellular pH in cancer progression is not studied as extensively as that of hypoxia. Here, we show that extracellular acidic pH (pH 6.8) triggered activation of sterol regulatory element-binding protein 2 (SREBP2) by stimulating nuclear translocation and promoter binding to its targets, along with intracellular acidification. Interestingly, inhibition of SREBP2, but not SREBP1, suppressed the upregulation of low pH-induced cholesterol biosynthesis-related genes. Moreover, acyl-CoA synthetase short-chain family member 2 (ACSS2), a direct SREBP2 target, provided a growth advantage to cancer cells under acidic pH. Furthermore, acidic pH-responsive SREBP2 target genes were associated with reduced overall survival of cancer patients. Thus, our findings show that SREBP2 is a key transcriptional regulator of metabolic genes and progression of cancer cells, partly in response to extracellular acidification. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. TnpA product encoded by the transposable element En-1 of Zea mays is a DNA binding protein.

    OpenAIRE

    Gierl, A.; Lütticke, S; Saedler, H

    1988-01-01

    TnpA protein, the function encoded by the most abundant transcript of En-1 was expressed in Escherichia coli. DNA binding experiments with partially purified tnpA protein revealed that it binds to the subterminal repetitive region of En-1. TnpA protein recognizes a 12-bp-long sequence motif which is reiterated several times at the termini of En-1. Binding is reduced if the cytosine residues of CG dinucleotides and CNG trinucleotides within the motif are methylated. These data suggest a model ...

  20. Suppression of prolactin expression by cabergoline requires prolactin regulatory element-binding protein (PREB) in GH3 cells.

    Science.gov (United States)

    Zhang, W; Murao, K; Imachi, H; Iwama, H; Chen, K; Fei, Z; Zhang, X; Ishida, T; Tamiya, T

    2010-07-01

    The prolactin regulatory element-binding protein (PREB) is a transcriptional factor that regulates prolactin (PRL) promoter activity in the anterior pituitary. Prolactinomas are the most common pituitary tumors. Administration of cabergoline, a selective dopamine D2-receptor agonist, has become the initial therapy of choice for most patients with prolactinomas. Although activation of the D2 receptor results in the inhibition of PRL synthesis, the details of the underlying mechanisms remain unknown. Samples of ten prolactinomas and ten nonfunctioning pituitary adenomas were analyzed by immunohistochemistry to detect the expression of PREB. The effect of cabergoline on PREB expression was assessed by western blotting and real-time polymerase chain reaction (PCR) analysis. Reporter gene analysis of PRL was employed to examine the role of PREB on cabergoline-induced suppression of PRL transcription. Immunohistochemical analysis revealed strong positive PREB expression in the prolactinoma tissue, but extremely weak or undetected expression in the nonfunctioning pituitary tumor tissue. Western blots probed with a PREB-specific antiserum revealed that the relative abundance of the PREB protein in the GH3 cells decreased in a dose-dependent manner in response to cabergoline treatment, as did the relative abundance of PREB mRNA. Although cabergoline inhibited the activity of the PRL promoter, mutation of PREB-binding site within the promoter abrogated the ability of cabergoline to inhibit the PRL promoter activity. We have demonstrated that PREB is expressed in prolactinomas and that the suppression of PRL expression by cabergoline requires the transcriptional factor PREB. (c) Georg Thieme Verlag KG Stuttgart . New York.

  1. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    Acyl-CoA-binding protein (ACBP) is an ubiquitously expressed 10-kDa protein which is present in high amounts in cells involved in solute transport or secretion. Rat ACBP is encoded by a gene containing the typical hallmarks of a housekeeping gene. Analysis of the promoter region of the rat ACBP g...

  2. Spatial Memory in the Morris Water Maze and Activation of Cyclic AMP Response Element-Binding (CREB) Protein within the Mouse Hippocampus

    Science.gov (United States)

    Porte, Yves; Buhot, Marie Christine; Mons, Nicole E.

    2008-01-01

    We investigated the spatio-temporal dynamics of learning-induced cAMP response element-binding protein activation/phosphorylation (pCREB) in mice trained in a spatial reference memory task in the water maze. Using immunohistochemistry, we examined pCREB immunoreactivity (pCREB-ir) in hippocampal CA1 and CA3 and related brain structures. During the…

  3. Long-Term Memory for Place Learning Is Facilitated by Expression of cAMP Response Element-Binding Protein in the Dorsal Hippocampus

    Science.gov (United States)

    Brightwell, Jennifer J.; Smith, Clayton A.; Neve, Rachael L.; Colombo, Paul J.

    2007-01-01

    Extensive research has shown that the hippocampus is necessary for consolidation of long-term spatial memory in rodents. We reported previously that rats using a place strategy to solve a cross maze task showed sustained phosphorylation of hippocampus cyclic AMP response element-binding protein (CREB), a transcription factor implicated in…

  4. Regulation of the CDP-choline pathway by sterol regulatory element binding proteins involves transcriptional and post-transcriptional mechanisms.

    Science.gov (United States)

    Ridgway, Neale D; Lagace, Thomas A

    2003-06-15

    The synthesis of phosphatidylcholine (PtdCho) by the CDP-choline pathway is under the control of the rate-limiting enzyme CTP:phosphocholine cytidylyltransferase (CCT). Sterol regulatory element binding proteins (SREBPs) have been proposed to regulate CCT at the transcriptional level, or via the synthesis of lipid activators or substrates of the CDP-choline pathway. To assess the contributions of these two mechanisms, we examined CCTalpha expression and PtdCho synthesis by the CDP-choline pathway in cholesterol and fatty acid auxotrophic CHO M19 cells inducibly expressing constitutively active nuclear forms of SREBP1a or SREBP2. Induction of either SREBP resulted in increased expression of mRNAs for sterol-regulated genes, elevated fatty acid and cholesterol synthesis (>10-50-fold) and increased PtdCho synthesis (2-fold). CCTalpha mRNA was increased 2-fold by enforced expression of SREBP1a or SREBP2. The resultant increase in CCTalpha protein and activity (2-fold) was restricted primarily to the soluble fraction of cells, and increased CCTalpha activity in vivo was not detected. Inhibition of the synthesis of fatty acids or their CoA esters by cerulenin or triacsin C respectively following SREBP induction effectively blocked the accompanying elevation in PtdCho synthesis. Thus PtdCho synthesis was driven by increased synthesis of fatty acids or a product thereof. These data show that transcriptional activation of CCTalpha is modest relative to that of other SREBP-regulated genes, and that stimulation of PtdCho synthesis by SREBPs in CHO cells is due primarily to increased fatty acid synthesis.

  5. Sterol regulatory element-binding protein-1c orchestrates metabolic remodeling of white adipose tissue by caloric restriction.

    Science.gov (United States)

    Fujii, Namiki; Narita, Takumi; Okita, Naoyuki; Kobayashi, Masaki; Furuta, Yurika; Chujo, Yoshikazu; Sakai, Masahiro; Yamada, Atsushi; Takeda, Kanae; Konishi, Tomokazu; Sudo, Yuka; Shimokawa, Isao; Higami, Yoshikazu

    2017-06-01

    Caloric restriction (CR) can delay onset of several age-related pathophysiologies and extend lifespan in various species, including rodents. CR also induces metabolic remodeling involved in activation of lipid metabolism, enhancement of mitochondrial biogenesis, and reduction of oxidative stress in white adipose tissue (WAT). In studies using genetically modified mice with extended lifespans, WAT characteristics influenced mammalian lifespans. However, molecular mechanisms underlying CR-associated metabolic remodeling of WAT remain unclear. Sterol regulatory element-binding protein-1c (Srebp-1c), a master transcription factor of fatty acid (FA) biosynthesis, is responsible for the pathogenesis of fatty liver (steatosis). Our study showed that, under CR conditions, Srebp-1c enhanced mitochondrial biogenesis via increased expression of peroxisome proliferator-activated receptor gamma coactivator-1α (Pgc-1α) and upregulated expression of proteins involved in FA biosynthesis within WAT. However, via Srebp-1c, most of these CR-associated metabolic alterations were not observed in other tissues, including the liver. Moreover, our data indicated that Srebp-1c may be an important factor both for CR-associated suppression of oxidative stress, through increased synthesis of glutathione in WAT, and for the prolongevity action of CR. Our results strongly suggested that Srebp-1c, the primary FA biosynthesis-promoting transcriptional factor implicated in fatty liver disease, is also the food shortage-responsive factor in WAT. This indicated that Srebp-1c is a key regulator of metabolic remodeling leading to the beneficial effects of CR. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  6. Identification of Rbd2 as a candidate protease for sterol regulatory element binding protein (SREBP) cleavage in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jinsil; Ha, Hye-Jeong [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-gu, Daejeon 34141 (Korea, Republic of); Kim, Sujin [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-gu, Daejeon 34141 (Korea, Republic of); Department of Functional Genomics, University of Science and Technology (UST), 217 Gajeong-ro, Yuseong-gu, Daejeon 34113 (Korea, Republic of); Choi, Ah-Reum [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-gu, Daejeon 34141 (Korea, Republic of); Lee, Sook-Jeong [Department of New Drug Discovery and Development, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon 34134 (Korea, Republic of); Hoe, Kwang-Lae, E-mail: kwanghoe@cnu.ac.kr [Department of New Drug Discovery and Development, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon 34134 (Korea, Republic of); Kim, Dong-Uk, E-mail: kimdongu@kribb.re.kr [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-gu, Daejeon 34141 (Korea, Republic of)

    2015-12-25

    Lipid homeostasis in mammalian cells is regulated by sterol regulatory element-binding protein (SREBP) transcription factors that are activated through sequential cleavage by Golgi Site-1 and Site-2 proteases. Fission yeast SREBP, Sre1, engages a different mechanism involving the Golgi Dsc E3 ligase complex, but it is not clearly understood exactly how Sre1 is proteolytically cleaved and activated. In this study, we screened the Schizosaccharomyces pombe non-essential haploid deletion collection to identify missing components of the Sre1 cleavage machinery. Our screen identified an additional component of the SREBP pathway required for Sre1 proteolysis named rhomboid protein 2 (Rbd2). We show that an rbd2 deletion mutant fails to grow under hypoxic and hypoxia-mimetic conditions due to lack of Sre1 activity and that this growth phenotype is rescued by Sre1N, a cleaved active form of Sre1. We found that the growth inhibition phenotype under low oxygen conditions is specific to the strain with deletion of rbd2, not any other fission yeast rhomboid-encoding genes. Our study also identified conserved residues of Rbd2 that are required for Sre1 proteolytic cleavage. All together, our results suggest that Rbd2 is a functional SREBP protease with conserved residues required for Sre1 cleavage and provide an important piece of the puzzle to understand the mechanisms for Sre1 activation and the regulation of various biological and pathological processes involving SREBPs. - Highlights: • An rbd2-deleted yeast strain shows defects in growth in response to low oxygen levels. • rbd2-deficient cells fail to generate cleaved Sre1 (Sre1N) under hypoxic conditions. • Expression of Sre1N rescues the rbd2 deletion mutant growth phenotype. • Rbd2 contains conserved residues potentially critical for catalytic activity. • Mutation of the conserved Rbd2 catalytic residues leads to defects in Sre1 cleavage.

  7. Crystal Structure of the Zorbamycin-Binding Protein ZbmA, the Primary Self-Resistance Element in Streptomyces flavoviridis ATCC21892

    Energy Technology Data Exchange (ETDEWEB)

    Rudolf, Jeffrey D. [Scripps Research Inst., Jupiter, FL (United States); Bigelow, Lance [Argonne National Lab. (ANL), Argonne, IL (United States); Chang, Changsoo [Argonne National Lab. (ANL), Argonne, IL (United States); Cuff, Marianne E. [Argonne National Lab. (ANL), Argonne, IL (United States); Lohman, Jeremy R. [Scripps Research Inst., Jupiter, FL (United States); Chang, Chin-Yuan [Scripps Research Inst., Jupiter, FL (United States); Ma, Ming [Scripps Research Inst., Jupiter, FL (United States); Yang, Dong [Scripps Research Inst., Jupiter, FL (United States); Clancy, Shonda [Argonne National Lab. (ANL), Argonne, IL (United States); Babnigg, Gyorgy [Argonne National Lab. (ANL), Argonne, IL (United States); Joachimiak, Andrzej [Argonne National Lab. (ANL), Argonne, IL (United States); Phillips, George N. [Rice Univ., Houston, TX (United States); Shen, Ben [Scripps Research Inst., Jupiter, FL (United States)

    2015-11-17

    The bleomycins (BLMs), tallysomycins (TLMs), phleomycin, and zorbamycin (ZBM) are members of the BLM family of glycopeptide-derived antitumor antibiotics. The BLM-producing Streptomyces verticillus ATCC15003 and the TLM-producing Streptoalloteichus hindustanus E465-94 ATCC31158 both possess at least two self-resistance elements, an N-acetyltransferase and a binding protein. The N-acetyltransferase provides resistance by disrupting the metal-binding domain of the antibiotic that is required for activity, while the binding protein confers resistance by sequestering the metal-bound antibiotic and preventing drug activation via molecular oxygen. We recently established that the ZBM producer, Streptomyces flavoviridis ATCC21892, lacks the N-acetyltransferase resistance gene and that the ZBM-binding protein, ZbmA, is sufficient to confer resistance in the producing strain. To investigate the resistance mechanism attributed to ZbmA, we determined the crystal structures of apo and Cu(II)-ZBM-bound ZbmA at high resolutions of 1.90 and 1.65 angstrom, respectively. A comparison and contrast with other structurally characterized members of the BLM-binding protein family revealed key differences in the protein ligand binding environment that fine-tunes the ability of ZbmA to sequester metal-bound ZBM and supports drug sequestration as the primary resistance mechanism in the producing organisms of the BLM family of antitumor antibiotics.

  8. Cyclic AMP responsive element-binding protein promotes renal cell carcinoma proliferation probably via the expression of spindle and kinetochore-associated protein 2.

    Science.gov (United States)

    Zhuang, Haihui; Meng, Xiangyu; Li, Yanyuan; Wang, Xue; Huang, Shuaishuai; Liu, Kaitai; Hehir, Michael; Fang, Rong; Jiang, Lei; Zhou, Jeff X; Wang, Ping; Ren, Yu

    2016-03-29

    Emerging evidence shows that the aberrantly expressed cyclic AMP responsive element-binding protein (CREB) is associated with tumor development and progression in several cancers. Spindle and kinetochore-associated protein 2 (SKA2) is essential for regulating the progress of mitosis. In this study, we evaluate in vitro and in vivo the functional relationship between CREB and SKA2 in renal cell carcinoma (RCC). Suppressing and replenishing CREB levels were used to manipulate SKA2 expression, observing the effects on RCC cell lines. Computational prediction and ChIP assay identified that CREB targeted ska2 by binding its CRE sequence in the human genome. Overexpression of CREB reversed the inhibited cell growth following siSKA2 treatment, and reduced the number of cells holding in mitosis. Decreased expression of CREB suppressed RCC cell growth and xenograft tumor formation, accompanied by reduced expression of SKA2. In RCC tumor samples from patients, mRNA for SKA2 were plotted near those of CREB in each sample, with significantly increased immunohistochemical staining of higher SKA2 and CREB in the higher TNM stages. The study adds evidence that CREB, a tumor oncogene, promotes RCC proliferation. It probably achieves this by increasing SKA2 expression.

  9. cAMP response element-binding protein and Yes-associated protein form a feedback loop that promotes neurite outgrowth.

    Science.gov (United States)

    Chen, Lei; Feng, Peimin; Peng, Anjiao; Qiu, Xiangmiao; Zhu, Xi; He, Shixu; Zhou, Dong

    2017-08-31

    The cAMP response element-binding (CREB) protein is a member of the CREB/activating transcription factor family that is activated by various extracellular stimuli. It has been shown that CREB-dependent transcription stimulation plays a key role in neuronal differentiation and plasticity, but the underlying mechanisms remain largely elusive. Here, we show that Yes-associated protein (YAP) is a direct target induced by CREB upon retinoic acid (RA)-induced neurite outgrowth stimuli in N2a cells. Interestingly, YAP knockout using the CRISPR/Cas9 system inhibits neuronal differentiation and reduced neurite length. We further show that YAP could directly bind to CREB via its N-terminal region, and loss of YAP results in instability of phosphorylated CREB upon neurite outgrowth stimuli. Transient expression of YAP could largely restore CREB expression and neurite outgrowth in YAP knockout cells. Together, our results suggest that CREB and YAP form a positive feedback loop that is critical to maintain the stability of phosphorylated CREB and promote neurite outgrowth. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  10. cAMP response element binding protein is required for differentiation of respiratory epithelium during murine development.

    Directory of Open Access Journals (Sweden)

    A Daniel Bird

    Full Text Available The cAMP response element binding protein 1 (Creb1 transcription factor regulates cellular gene expression in response to elevated levels of intracellular cAMP. Creb1(-/- fetal mice are phenotypically smaller than wildtype littermates, predominantly die in utero and do not survive after birth due to respiratory failure. We have further investigated the respiratory defect of Creb1(-/- fetal mice during development. Lungs of Creb1(-/- fetal mice were pale in colour and smaller than wildtype controls in proportion to their reduced body size. Creb1(-/- lungs also did not mature morphologically beyond E16.5 with little or no expansion of airway luminal spaces, a phenotype also observed with the Creb1(-/- lung on a Crem(-/- genetic background. Creb1 was highly expressed throughout the lung at all stages examined, however activation of Creb1 was detected primarily in distal lung epithelium. Cell differentiation of E17.5 Creb1(-/- lung distal epithelium was analysed by electron microscopy and showed markedly reduced numbers of type-I and type-II alveolar epithelial cells. Furthermore, immunomarkers for specific lineages of proximal epithelium including ciliated, non-ciliated (Clara, and neuroendocrine cells showed delayed onset of expression in the Creb1(-/- lung. Finally, gene expression analyses of the E17.5 Creb1(-/- lung using whole genome microarray and qPCR collectively identified respiratory marker gene profiles and provide potential novel Creb1-regulated genes. Together, these results demonstrate a crucial role for Creb1 activity for the development and differentiation of the conducting and distal lung epithelium.

  11. Cyclic adenosine monophosphate-responsive element-binding protein activation predicts an unfavorable prognosis in patients with hepatocellular carcinoma

    OpenAIRE

    Yu L; Guo X; Zhang P; Qi R; Li Z; Zhang S

    2014-01-01

    Lingxiang Yu,* Xiaodong Guo,* Peirui Zhang, Ruizhao Qi, Zhiwei Li, Shaogeng Zhang Department of Hepatobiliary Surgery, 302 Military Hospital of China, Beijing, People’s Republic of China *These authors contributed equally to this work Aim: To investigate the clinical significance of cyclic adenosine monophosphate-responsive element-binding (CREB) and phosphorylated CREB (pCREB) expression in human hepatocellular carcinoma (HCC). Materials and methods: Immunohistochemistry and Weste...

  12. MxaJ structure reveals a periplasmic binding protein-like architecture with unique secondary structural elements.

    Science.gov (United States)

    Myung Choi, Jin; Cao, Thinh-Phat; Wouk Kim, Si; Ho Lee, Kun; Haeng Lee, Sung

    2017-07-01

    MxaJ is a component of type II methanol dehydrogenase (MDH) that mediates electron transfer during methanol oxidation in methanotrophic bacteria. However, little is known about how MxaJ structurally cooperates with MDH and Cytochrome c L . Here, we report for the first time the crystal structure of MxaJ. MxaJ consists of eight α-helices and six β-strands, and resembles the "bi-lobate" folding architecture found in periplasmic binding proteins. Distinctive features of MxaJ include prominent loops and a β-strand around the hinge region supporting the ligand-binding cavity, which might provide a more favorable framework for interacting with proteins rather than small molecules. Proteins 2017; 85:1379-1386. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  13. Identification of the RNA recognition element of the RBPMS family of RNA-binding proteins and their transcriptome-wide mRNA targets.

    Science.gov (United States)

    Farazi, Thalia A; Leonhardt, Carl S; Mukherjee, Neelanjan; Mihailovic, Aleksandra; Li, Song; Max, Klaas E A; Meyer, Cindy; Yamaji, Masashi; Cekan, Pavol; Jacobs, Nicholas C; Gerstberger, Stefanie; Bognanni, Claudia; Larsson, Erik; Ohler, Uwe; Tuschl, Thomas

    2014-07-01

    Recent studies implicated the RNA-binding protein with multiple splicing (RBPMS) family of proteins in oocyte, retinal ganglion cell, heart, and gastrointestinal smooth muscle development. These RNA-binding proteins contain a single RNA recognition motif (RRM), and their targets and molecular function have not yet been identified. We defined transcriptome-wide RNA targets using photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) in HEK293 cells, revealing exonic mature and intronic pre-mRNA binding sites, in agreement with the nuclear and cytoplasmic localization of the proteins. Computational and biochemical approaches defined the RNA recognition element (RRE) as a tandem CAC trinucleotide motif separated by a variable spacer region. Similar to other mRNA-binding proteins, RBPMS family of proteins relocalized to cytoplasmic stress granules under oxidative stress conditions suggestive of a support function for mRNA localization in large and/or multinucleated cells where it is preferentially expressed. © 2014 Farazi et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  14. Protected P-Element Termini Suggest a Role for Inverted-Repeat-Binding Protein in Transposase-Induced Gap Repair in Drosophila Melanogaster

    Science.gov (United States)

    Staveley, B. E.; Heslip, T. R.; Hodgetts, R. B.; Bell, J. B.

    1995-01-01

    P-element transposition is thought to occur by a cut-and-paste mechanism that generates a double-strand break at the donor site, the repair of which can lead to internally deleted elements. We have generated a series of both phenotypically stronger and weaker allelic derivatives of vg(21), a vestigial mutant caused by a P-element insertion in the 5' region of the gene. Virtually all of the new alleles arose by internal deletion of the parental element in vg(21), and we have characterized a number of these internally deleted P elements. Depending upon the selection scheme used, we see a very different spectrum of amount and source of P-element sequences in the resultant derivatives. Strikingly, most of the breakpoints occur within the inverted-repeats such that the last 15-17 bp of the termini are retained. This sequence is known to bind the inverted-repeat-binding protein (IRBP). We propose that the IRBP may act to preserve the P-element ends when transposition produces a double-strand gap. This allows the terminus to serve as a template upon which DNA synthesis can act to repair the gap. Filler sequences found at the breakpoints of the internally deleted P elements resemble short stretches, often in tandem arrays, of these terminal sequences. The structure of the filler sequences suggests replication slippage may occur during the process of gap repair. PMID:7768441

  15. Effects of retinoic acid and hydrogen peroxide on sterol regulatory element-binding protein-1a activation during adipogenic differentiation of 3T3-L1 cells

    OpenAIRE

    Eldaim, Mabrouk A. Abd; Okamatsu-Ogura, Yuko; Terao, Akira; Kimura, Kazuhiro

    2010-01-01

    Both retinoic acid (RA) and oxidative stress (H2O2) increased transcription and cleavage of membrane-bound sterol regulatory element-binding protein (SREBP)-1, leading to enhanced transcription of fatty acid synthase (FAS) in hepatoma cells. On the other hand, RA and H2O2 decreased and increased lipogenesis in adipocytes, respectively, although roles of SREBP-1 activation in these effects remain to be elucidated. To elucidate its involvement, we examined the activation of SREBP...

  16. Impaired bidirectional synaptic plasticity and procedural memory formation in striatum-specific cAMP response element-binding protein-deficient mice

    OpenAIRE

    Pittenger, Christopher; Fasano, Stefania; Mazzocchi-Jones, David Martin; Dunnett, Stephen Bruce; Kandel, Eric R.; Brambilla, Riccardo

    2006-01-01

    The striatum has a well documented role in procedural learning and memory. However, the synaptic and molecular mechanisms of acquisition and storage of this form of memory remain poorly understood. We examined procedural memory and plasticity in transgenic mice reversibly expressing a dominant-negative cAMP response element-binding protein (CREB) mutant in the dorsal striatum. In these transgenic mice, corticostriatal long-term potentiation and depression are abolished, indicating that CREB f...

  17. Nonalcoholic fatty liver disease: Regulation of glucose and fat metabolism in the liver by Carbohydrate Response Element Binding Protein (ChREBP) and impact of dietary influence

    OpenAIRE

    Elkatry, Haiam Omar Mohamed

    2011-01-01

    Deregulationen in der Leberlipidsynthese sind häufig mit Adipositas und Diabetes Typ 2 verbunden und daher ist ein detailliertes Verständnis der beteiligten, regulierenden Stoffwechselwege sehr wichtig, um künftig potentielle therapeutische Targets zu identifizieren. Die Leber ist der wichtigste Ort für den Kohlenhydratstoffwechsel (Glykolyse und Glykogen-Synthese) sowie Triglycerid-Synthese (Lipogenese). Carbohydrate-responsive element-binding protein (ChREBP) wurden in die Regulation durch ...

  18. Molecular characterization of senescence marker protein-30 gene promoter: Identification of repressor elements and functional nuclear factor binding sites

    Directory of Open Access Journals (Sweden)

    Maruyama Naoki

    2008-04-01

    Full Text Available Abstract Background Senescence marker protein-30 (SMP30, whose expression declines during aging in rat liver, has been proposed as an important aging marker. Besides apoptosis, SMP30 also protects cells against various other injuries by enhancement of membrane calcium-pump activity. The mechanism of this differential gene expression mechanism is not known. DNA-protein interactions, mutation analysis and luciferase reporter assay studies have been performed to elucidate the mechanism of transcriptional regulation of SMP30 gene. Results We have characterized up to -2750 bp of the promoter by DNA-protein interactions studies. Twenty eight transcription factor binding sites have been identified by DNase I footprinting and electrophoretic mobility shift assay (EMSA. Transient transfection of 5' and 3' -deleted promoter-reporter constructs and luciferase assay illustrated the region between -128/+157 bp is sufficient to drive promoter activity. We have mapped an essential regulatory region between -513 to -352 bp which causes a drastic decline of reporter activity. This region contains CdxA, GATA2 and SRY transcription factor binding sites. Individual mutation of these three sites showed increase in reporter activity. Mutation in SRY site (-403/-368 showed maximum increase in reporter activity among these three sites. Therefore, we suggest that SRY like protein may be acting as a strong repressor of SMP30 gene along with CdxA and GATA-2. We also report that mutation of both Sp1 (172/-148 bp and a C/EBPβ (-190/-177 bp transcription binding site located adjacent to each other on SMP30 gene promoter, causes a significant enhancement in reporter activity than individual mutation, thus may be causing the repression of SMP30 promoter activity. Conclusion These studies provide novel insights into the mechanism that regulate SMP30 gene expression.

  19. The cancer-associated CTCFL/BORIS protein targets multiple classes of genomic repeats, with a distinct binding and functional preference for humanoid-specific SVA transposable elements.

    Science.gov (United States)

    Pugacheva, Elena M; Teplyakov, Evgeny; Wu, Qiongfang; Li, Jingjing; Chen, Cheng; Meng, Chengcheng; Liu, Jian; Robinson, Susan; Loukinov, Dmitry; Boukaba, Abdelhalim; Hutchins, Andrew Paul; Lobanenkov, Victor; Strunnikov, Alexander

    2016-01-01

    A common aberration in cancer is the activation of germline-specific proteins. The DNA-binding proteins among them could generate novel chromatin states, not found in normal cells. The germline-specific transcription factor BORIS/CTCFL, a paralog of chromatin architecture protein CTCF, is often erroneously activated in cancers and rewires the epigenome for the germline-like transcription program. Another common feature of malignancies is the changed expression and epigenetic states of genomic repeats, which could alter the transcription of neighboring genes and cause somatic mutations upon transposition. The role of BORIS in transposable elements and other repeats has never been assessed. The investigation of BORIS and CTCF binding to DNA repeats in the K562 cancer cells dependent on BORIS for self-renewal by ChIP-chip and ChIP-seq revealed three classes of occupancy by these proteins: elements cohabited by BORIS and CTCF, CTCF-only bound, or BORIS-only bound. The CTCF-only enrichment is characteristic for evolutionary old and inactive repeat classes, while BORIS and CTCF co-binding predominately occurs at uncharacterized tandem repeats. These repeats form staggered cluster binding sites, which are a prerequisite for CTCF and BORIS co-binding. At the same time, BORIS preferentially occupies a specific subset of the evolutionary young, transcribed, and mobile genomic repeat family, SVA. Unlike CTCF, BORIS prominently binds to the VNTR region of the SVA repeats in vivo. This suggests a role of BORIS in SVA expression regulation. RNA-seq analysis indicates that BORIS largely serves as a repressor of SVA expression, alongside DNA and histone methylation, with the exception of promoter capture by SVA. Thus, BORIS directly binds to, and regulates SVA repeats, which are essentially movable CpG islands, via clusters of BORIS binding sites. This finding uncovers a new function of the global germline-specific transcriptional regulator BORIS in regulating and repressing the

  20. The gene encoding acyl-CoA-binding protein is subject to metabolic regulation by both sterol regulatory element-binding protein and peroxisome proliferator-activated receptor alpha in hepatocytes

    DEFF Research Database (Denmark)

    Sandberg, Maria B; Bloksgaard, Maria; Duran-Sandoval, Daniel

    2005-01-01

    The acyl-CoA-binding protein (ACBP) is a 10-kDa intracellular lipid-binding protein that transports acylCoA esters. The protein is expressed in most cell types at low levels; however, expression is particularly high in cells with a high turnover of fatty acids. Here we confirm a previous observat...

  1. Independent evolution of tetraloop in enterovirus oriL replicative element and its putative binding partners in virus protein 3C

    Science.gov (United States)

    Deviatkin, Andrei A.; Tcelykh, Irina O.; Lukashev, Alexander N.; Gmyl, Anatoly P.

    2017-01-01

    Background Enteroviruses are small non-enveloped viruses with a (+) ssRNA genome with one open reading frame. Enterovirus protein 3C (or 3CD for some species) binds the replicative element oriL to initiate replication. The replication of enteroviruses features a low-fidelity process, which allows the virus to adapt to the changing environment on the one hand, and requires additional mechanisms to maintain the genome stability on the other. Structural disturbances in the apical region of oriL domain d can be compensated by amino acid substitutions in positions 154 or 156 of 3C (amino acid numeration corresponds to poliovirus 3C), thus suggesting the co-evolution of these interacting sequences in nature. The aim of this work was to understand co-evolution patterns of two interacting replication machinery elements in enteroviruses, the apical region of oriL domain d and its putative binding partners in the 3C protein. Methods To evaluate the variability of the domain d loop sequence we retrieved all available full enterovirus sequences (>6, 400 nucleotides), which were present in the NCBI database on February 2017 and analysed the variety and abundance of sequences in domain d of the replicative element oriL and in the protein 3C. Results A total of 2,842 full genome sequences was analysed. The majority of domain d apical loops were tetraloops, which belonged to consensus YNHG (Y = U/C, N = any nucleotide, H = A/C/U). The putative RNA-binding tripeptide 154–156 (Enterovirus C 3C protein numeration) was less diverse than the apical domain d loop region and, in contrast to it, was species-specific. Discussion Despite the suggestion that the RNA-binding tripeptide interacts with the apical region of domain d, they evolve independently in nature. Together, our data indicate the plastic evolution of both interplayers of 3C-oriL recognition. PMID:29018627

  2. A simple promoter containing two Sp1 sites controls the expression of sterol-regulatory-element-binding protein 1a (SREBP-1a)

    OpenAIRE

    Zhang, Chengkang; Shin, Dong-Ju; Osborne, Timothy F.

    2005-01-01

    The mammalian gene for SREBP-1 (sterol-regulatory-element-binding protein 1) contains two promoters that control the production of two proteins, SREBP-1a and -1c, and each contains a unique N-terminal transcriptional activation domain, but they are otherwise identical. The relative level of each mRNA varies from tissue to tissue and they respond differently to regulatory stimuli. SREBP-1c is more abundantly expressed in liver, where its level is also regulated by insulin and liver X receptor ...

  3. Cyclic AMP response element-binding protein in post-mortem brain of teenage suicide victims: specific decrease in the prefrontal cortex but not the hippocampus.

    Science.gov (United States)

    Pandey, Ghanshyam N; Dwivedi, Yogesh; Ren, Xinguo; Rizavi, Hooriyah S; Roberts, Rosalinda C; Conley, Robert R

    2007-10-01

    Abnormalities in both adenylyl cyclase (AC) and phosphoinositide (PI) signalling systems have been observed in the post-mortem brain of suicide victims. Cyclic AMP response element-binding protein (CREB) is a transcription factor that is activated by phosphorylating enzymes such as protein kinase A (PKA) and protein kinase C (PKC), which suggests that both AC and PI signalling systems converge at the level of CREB. CREB is involved in the transcription of many neuronally expressed genes that have been implicated in the pathophysiology of depression and suicide. Since we observed abnormalities of both PKA and PKC in the post-mortem brain of teenage suicide victims, we examined if these abnormalities are also associated with abnormalities of CREB, which is activated by these phosphorylating enzymes. We determined CRE-DNA binding using the gel shift assay, as well as protein expression of CREB using the Western blot technique, and the mRNA expression of CREB using a quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) technique in the prefrontal cortex (PFC), and hippocampus obtained from 17 teenage suicide victims and 17 matched normal control subjects. We observed that the CRE-DNA binding and the protein expression of CREB were significantly decreased in the PFC of teenage suicide victims compared with controls. There was also a significant decrease in mRNA expression of CREB in the PFC of teenage suicide victims compared with control subjects. However, there were no significant differences in CRE-DNA binding or the protein and mRNA expression of CREB in the hippocampus of teenage suicide victims compared with control subjects. These results suggest that the abnormalities of PKA, and of PKC, observed in teenage suicide victims are also associated with abnormalities of the transcription factor CREB, and that this may also cause alterations of important neuronally expressed genes, and provide further support of the signal transduction of abnormalities

  4. Sterol Regulatory Element Binding Protein 1a Regulates Hepatic Fatty Acid Partitioning by Activating Acetyl Coenzyme A Carboxylase 2 ▿ ‡

    OpenAIRE

    Im, Seung-Soon; Hammond, Linda E.; Yousef, Leyla; Nugas-Selby, Cherryl; Shin, Dong-Ju; Seo, Young-Kyo; Fong, Loren G.; Young, Stephen G.; Osborne, Timothy F.

    2009-01-01

    We generated a line of mice in which sterol regulatory element binding protein 1a (SREBP-1a) was specifically inactivated by insertional mutagenesis. Homozygous mutant mice were completely viable despite expressing SREBP-1a mRNA below 5% of normal, and there were minimal effects on expression of either SREBP-1c or -2. Microarray expression studies in liver, where SREBP-1a mRNA is 1/10 the level of the highly similar SREBP-1c, demonstrated that only a few genes were affected. The only downregu...

  5. Treatment with Ginger Ameliorates Fructose-Induced Fatty Liver and Hypertriglyceridemia in Rats: Modulation of the Hepatic Carbohydrate Response Element-Binding Protein-Mediated Pathway

    Directory of Open Access Journals (Sweden)

    Huanqing Gao

    2012-01-01

    Full Text Available Ginger has been demonstrated to improve lipid derangements. However, its underlying triglyceride-lowering mechanisms remain unclear. Fructose overconsumption is associated with increase in hepatic de novo lipogenesis, thereby resulting in lipid derangements. Here we found that coadministration of the alcoholic extract of ginger (50 mg/kg/day, oral gavage, once daily over 5 weeks reversed liquid fructose-induced increase in plasma triglyceride and glucose concentrations and hepatic triglyceride content in rats. Plasma nonesterified fatty acid concentration was also decreased. Attenuation of the increased vacuolization and Oil Red O staining area was evident on histological examination of liver in ginger-treated rats. However, ginger treatment did not affect chow intake and body weight. Further, ginger treatment suppressed fructose-stimulated overexpression of carbohydrate response element-binding protein (ChREBP at the mRNA and protein levels in the liver. Consequently, hepatic expression of the ChREBP-targeted lipogenic genes responsible for fatty acid biosynthesis was also downregulated. In contrast, expression of neither peroxisome proliferator-activated receptor- (PPAR- alpha and its downstream genes, nor PPAR-gamma and sterol regulatory element-binding protein 1c was altered. Thus the present findings suggest that in rats, amelioration of fructose-induced fatty liver and hypertriglyceridemia by ginger treatment involves modulation of the hepatic ChREBP-mediated pathway.

  6. Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

    Science.gov (United States)

    Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

    2013-12-06

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.

  7. Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

    Science.gov (United States)

    Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

    2013-01-01

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

  8. The Regulator of Calcineurin 1 (RCAN1/DSCR1) Activates the cAMP Response Element-binding Protein (CREB) Pathway*

    Science.gov (United States)

    Kim, Seon Sook; Seo, Su Ryeon

    2011-01-01

    cAMP response element-binding protein (CREB) is one of the best known transcription factors in the development and function of the nervous system. In this report, we found that the regulator of calcineurin 1 (RCAN1), which is overexpressed in the brain of patients with Down syndrome, increased the phosphorylation of CREB and cAMP response element-mediated gene transcription in response to the activation of the intracellular cAMP pathway. Furthermore, we found that the increased activation of CREB signaling by RCAN1 depended on the ability of RCAN1 to inhibit calcineurin activity. Our data provide the first evidence that RCAN1 acts as an important regulatory component in the control of CREB signaling. PMID:21890628

  9. The regulator of calcineurin 1 (RCAN1/DSCR1) activates the cAMP response element-binding protein (CREB) pathway.

    Science.gov (United States)

    Kim, Seon Sook; Seo, Su Ryeon

    2011-10-28

    cAMP response element-binding protein (CREB) is one of the best known transcription factors in the development and function of the nervous system. In this report, we found that the regulator of calcineurin 1 (RCAN1), which is overexpressed in the brain of patients with Down syndrome, increased the phosphorylation of CREB and cAMP response element-mediated gene transcription in response to the activation of the intracellular cAMP pathway. Furthermore, we found that the increased activation of CREB signaling by RCAN1 depended on the ability of RCAN1 to inhibit calcineurin activity. Our data provide the first evidence that RCAN1 acts as an important regulatory component in the control of CREB signaling.

  10. Far upstream element-binding protein-1, a novel caspase substrate, acts as a cross-talker between apoptosis and the c-myc oncogene.

    Science.gov (United States)

    Jang, M; Park, B C; Kang, S; Chi, S-W; Cho, S; Chung, S J; Lee, S C; Bae, K-H; Park, S G

    2009-03-26

    Far upstream element-binding protein-1 (FBP-1) binds to an upstream element of the c-myc promoter and regulates the c-myc mRNA level. Earlier, FBP-1 was identified as a candidate substrate of caspase-7. Here, we report that FBP-1 is cleaved by executor caspases, both in vitro and during apoptosis. Cleavage occurs at the caspase consensus site (DQPD(74)) located within the classical bipartite nuclear localization signal sequence. In cells subjected to apoptotic stimuli, the caspase-mediated cleavage of FBP-1 leads to its decreased presence in the nucleus, concomitant with the marked downregulation of c-Myc and its various target proteins. By contrast, cells transfected with a non-cleavable mutant of FBP-1 (D74A) maintain higher levels of c-Myc and are protected from apoptosis. On the basis of these results, we suggest that the oncogenic potential of c-Myc is 'switched off' after apoptosis induction as a consequence of the caspase-mediated cleavage of FBP-1.

  11. Amino Acid Change in the Carbohydrate Response Element Binding Protein is associated with lower triglycerides and myocardial infarction incidence depending on level of adherence to the Mediterranean diet in the PREDIMED trial

    Science.gov (United States)

    A variant (rs3812316, C771G, and Gln241His) in the MLXIPL (Max-like protein X interacting protein-like) gene encoding the carbohydrate response element binding protein has been associated with lower triglycerides. However, its association with cardiovascular diseases and gene-diet interactions modul...

  12. Interaction entropy for protein-protein binding

    Science.gov (United States)

    Sun, Zhaoxi; Yan, Yu N.; Yang, Maoyou; Zhang, John Z. H.

    2017-03-01

    Protein-protein interactions are at the heart of signal transduction and are central to the function of protein machine in biology. The highly specific protein-protein binding is quantitatively characterized by the binding free energy whose accurate calculation from the first principle is a grand challenge in computational biology. In this paper, we show how the interaction entropy approach, which was recently proposed for protein-ligand binding free energy calculation, can be applied to computing the entropic contribution to the protein-protein binding free energy. Explicit theoretical derivation of the interaction entropy approach for protein-protein interaction system is given in detail from the basic definition. Extensive computational studies for a dozen realistic protein-protein interaction systems are carried out using the present approach and comparisons of the results for these protein-protein systems with those from the standard normal mode method are presented. Analysis of the present method for application in protein-protein binding as well as the limitation of the method in numerical computation is discussed. Our study and analysis of the results provided useful information for extracting correct entropic contribution in protein-protein binding from molecular dynamics simulations.

  13. Analysis of sterol-regulatory element-binding protein 1c target genes in mouse liver during aging and high-fat diet.

    Science.gov (United States)

    Capel, Frédéric; Rolland-Valognes, Gaëlle; Dacquet, Catherine; Brun, Manuel; Lonchampt, Michel; Ktorza, Alain; Lockhart, Brian; Galizzi, Jean-Pierre

    2013-01-01

    The sterol regulatory element-binding protein (SREBP) 1c contributes to the transcriptional coordination of cholesterol, fatty acid, and carbohydrate metabolisms. Alterations in these processes accelerate the progression of hepatic steatosis and insulin resistance during aging and obesity. Using an ex vivo chromatin immunoprecipitation coupled to microarray (ChIP-on-chip) technique combined with genome-wide gene expression analysis, we analyzed the transcriptomic adaptations mediated by Srebp-1c binding to gene promoters in the liver of mice fed with a low-fat diet or a high-fat diet (HFD) for either 1 or 12 months. Aging had a higher transcriptional impact than HFD and modified the expression of genes involved in fatty acid oxidation and oxidative stress. HFD was associated with a marked induction of genes involved in lipid and cholesterol metabolism. The prolonged high-fat feeding together with the aging effects stimulates inflammatory pathways. ChIP-on-chip applied to aging and HFD analyses revealed that the binding of SREBP-1c to a series of promoters accompanied a paralleled modification of gene expression. Therefore, SREBP-1c could play a role in aging and high-fat feeding through the regulation of genes involved in lipid metabolism and inflammatory response. This study represents an original ex vivo experiment to elucidate the molecular events involved in metabolic disorders. Copyright © 2013 S. Karger AG, Basel.

  14. Hepatic overexpression of idol increases circulating protein convertase subtilisin/kexin type 9 in mice and hamsters via dual mechanisms: sterol regulatory element-binding protein 2 and low-density lipoprotein receptor-dependent pathways.

    Science.gov (United States)

    Sasaki, Makoto; Terao, Yoshio; Ayaori, Makoto; Uto-Kondo, Harumi; Iizuka, Maki; Yogo, Makiko; Hagisawa, Kosuke; Takiguchi, Shunichi; Yakushiji, Emi; Nakaya, Kazuhiro; Ogura, Masatsune; Komatsu, Tomohiro; Ikewaki, Katsunori

    2014-06-01

    Low-density lipoprotein receptor (LDLR) is degraded by inducible degrader of LDLR (Idol) and protein convertase subtilisin/kexin type 9 (PCSK9), thereby regulating circulating LDL levels. However, it remains unclear whether, and if so how, these LDLR degraders affect each other. We therefore investigated effects of liver-specific expression of Idol on LDL/PCSK9 metabolism in mice and hamsters. Injection of adenoviral vector expressing Idol (Ad-Idol) induced a liver-specific reduction in LDLR expression which, in turn, increased very-low-density lipoprotein/LDL cholesterol levels in wild-type mice because of delayed LDL catabolism. Interestingly, hepatic Idol overexpression markedly increased plasma PCSK9 levels. In LDLR-deficient mice, plasma PCSK9 levels were already elevated at baseline and unchanged by Idol overexpression, which was comparable with the observation for Ad-Idol-injected wild-type mice, indicating that Idol-induced PCSK9 elevation depended on LDLR. In wild-type mice, but not in LDLR-deficient mice, Ad-Idol enhanced hepatic PCSK9 expression, with activation of sterol regulatory element-binding protein 2 and subsequently increased expression of its target genes. Supporting in vivo findings, Idol transactivated PCSK9/LDLR in sterol regulatory element-binding protein 2/LDLR-dependent manners in vitro. Furthermore, an in vivo kinetic study using (125)I-labeled PCSK9 revealed delayed clearance of circulating PCSK9, which could be another mechanism. Finally, to extend these findings into cholesteryl ester transfer protein-expressing animals, we repeated the above in vivo experiments in hamsters and obtained similar results. A vicious cycle in LDLR degradation might be generated by PCSK9 induced by hepatic Idol overexpression via dual mechanisms: sterol regulatory element-binding protein 2/LDLR. Furthermore, these effects would be independent of cholesteryl ester transfer protein expression. © 2014 American Heart Association, Inc.

  15. Selective role of sterol regulatory element binding protein isoforms in aggregated LDL-induced vascular low density lipoprotein receptor-related protein-1 expression.

    Science.gov (United States)

    Costales, P; Aledo, R; Vérnia, S; Das, A; Shah, V H; Casado, M; Badimon, L; Llorente-Cortés, V

    2010-12-01

    Low density lipoprotein receptor-related protein (LRP1) is upregulated in vascular smooth muscle cells by intravascular aggregated LDL (agLDL) - LDL trapped in the arterial intima and systemic LDL. LRP1 upregulation in hypercholesterolemic aortas is concomitant with SREBP downregulation. However, the specific role of SREBP isoforms in LRP1 transcription and LDL-induced LRP1 upregulation in human vascular smooth muscle cells (VSMC) is unknown. In the present study we report that specific silencing of either SREBP-1 or SREBP-2 enhanced LRP1 whereas overexpression of the active SREBP isoforms decreased LRP1 expression. Gel mobility shift and ChIP assays demonstrated that SREBP-1a, SREBP-1c and SREBP-2 were able to bind to three putative SRE sequences; SRE-A (-1042 to -1028), SRE-B (-115 to -101) and SRE-C (+226 to +234). ChIP assays demonstrated that agLDL (100μg/mL, 24h) significantly and specifically decreased SREBP-2 binding to the LRP1 promoter. Luciferase assays demonstrated that agLDL increased the transcriptional activity of A/B or A/C double mutants but failed to increase that of the double B/C mutant. Our results show that both SREBP-1 and SREBP-2 negatively modulated LRP1 transcription. Furthermore, agLDL exerted an upregulatory effect on LRP1 expression by decreasing SREBP-2 binding to LRP1 promoter. Two SRE-like sequences control the response of LRP1 to agLDL. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  16. Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

    Directory of Open Access Journals (Sweden)

    Tan Wenbin

    2011-11-01

    Full Text Available Abstract Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP. Method RT-PCR and RACE (rapid amplification of cDNA end were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1 has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain. Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens.

  17. Hyper conserved elements in vertebrate mRNA 3'-UTRs reveal a translational network of RNA-binding proteins controlled by HuR.

    Science.gov (United States)

    Dassi, Erik; Zuccotti, Paola; Leo, Sara; Provenzani, Alessandro; Assfalg, Michael; D'Onofrio, Mariapina; Riva, Paola; Quattrone, Alessandro

    2013-03-01

    Little is known regarding the post-transcriptional networks that control gene expression in eukaryotes. Additionally, we still need to understand how these networks evolve, and the relative role played in them by their sequence-dependent regulatory factors, non-coding RNAs (ncRNAs) and RNA-binding proteins (RBPs). Here, we used an approach that relied on both phylogenetic sequence sharing and conservation in the whole mapped 3'-untranslated regions (3'-UTRs) of vertebrate species to gain knowledge on core post-transcriptional networks. The identified human hyper conserved elements (HCEs) were predicted to be preferred binding sites for RBPs and not for ncRNAs, namely microRNAs and long ncRNAs. We found that the HCE map identified a well-known network that post-transcriptionally regulates histone mRNAs. We were then able to discover and experimentally confirm a translational network composed of RNA Recognition Motif (RRM)-type RBP mRNAs that are positively controlled by HuR, another RRM-type RBP. HuR shows a preference for these RBP mRNAs bound in stem-loop motifs, confirming its role as a 'regulator of regulators'. Analysis of the transcriptome-wide HCE distribution revealed a profile of prevalently small clusters separated by unconserved intercluster RNA stretches, which predicts the formation of discrete small ribonucleoprotein complexes in the 3'-UTRs.

  18. A protein binding AT-rich sequence in the soybean leghemoglobin c3 promoter is a general cis element that requires proximal DNA elements to stimulate transcription

    DEFF Research Database (Denmark)

    Laursen, N B; Larsen, K; Knudsen, J Y

    1994-01-01

    A nodule nuclear factor, NAT2, interacts with two AT-rich binding sites (NAT2 BS1 and NAT2 BS2) in the soybean leghemoglobin (lb) c3 promoter. In transgenic Lotus corniculatus nodules, an oligonucleotide containing NAT2 BS1 activated an inactive -159 lbc3 promoter when placed immediately upstream...

  19. Arabidopsis miR171-targeted scarecrow-like proteins bind to GT cis-elements and mediate gibberellin-regulated chlorophyll biosynthesis under light conditions.

    Directory of Open Access Journals (Sweden)

    Zhaoxue Ma

    2014-08-01

    Full Text Available An extraordinarily precise regulation of chlorophyll biosynthesis is essential for plant growth and development. However, our knowledge on the complex regulatory mechanisms of chlorophyll biosynthesis is very limited. Previous studies have demonstrated that miR171-targeted scarecrow-like proteins (SCL6/22/27 negatively regulate chlorophyll biosynthesis via an unknown mechanism. Here we showed that SCLs inhibit the expression of the key gene encoding protochlorophyllide oxidoreductase (POR in light-grown plants, but have no significant effect on protochlorophyllide biosynthesis in etiolated seedlings. Histochemical analysis of β-glucuronidase (GUS activity in transgenic plants expressing pSCL27::rSCL27-GUS revealed that SCL27-GUS accumulates at high levels and suppresses chlorophyll biosynthesis at the leaf basal proliferation region during leaf development. Transient gene expression assays showed that the promoter activity of PORC is indeed regulated by SCL27. Consistently, chromatin immunoprecipitation and quantitative PCR assays showed that SCL27 binds to the promoter region of PORC in vivo. An electrophoretic mobility shift assay revealed that SCL27 is directly interacted with G(A/G(A/TAA(A/TGT cis-elements of the PORC promoter. Furthermore, genetic analysis showed that gibberellin (GA-regulated chlorophyll biosynthesis is mediated, at least in part, by SCLs. We demonstrated that SCL27 interacts with DELLA proteins in vitro and in vivo by yeast-two-hybrid and coimmunoprecipitation analysis and found that their interaction reduces the binding activity of SCL27 to the PORC promoter. Additionally, we showed that SCL27 activates MIR171 gene expression, forming a feedback regulatory loop. Taken together, our data suggest that the miR171-SCL module is critical for mediating GA-DELLA signaling in the coordinate regulation of chlorophyll biosynthesis and leaf growth in light.

  20. Arabidopsis miR171-Targeted Scarecrow-Like Proteins Bind to GT cis-Elements and Mediate Gibberellin-Regulated Chlorophyll Biosynthesis under Light Conditions

    Science.gov (United States)

    Ma, Zhaoxue; Hu, Xupeng; Cai, Wenjuan; Huang, Weihua; Zhou, Xin; Luo, Qian; Yang, Hongquan; Wang, Jiawei; Huang, Jirong

    2014-01-01

    An extraordinarily precise regulation of chlorophyll biosynthesis is essential for plant growth and development. However, our knowledge on the complex regulatory mechanisms of chlorophyll biosynthesis is very limited. Previous studies have demonstrated that miR171-targeted scarecrow-like proteins (SCL6/22/27) negatively regulate chlorophyll biosynthesis via an unknown mechanism. Here we showed that SCLs inhibit the expression of the key gene encoding protochlorophyllide oxidoreductase (POR) in light-grown plants, but have no significant effect on protochlorophyllide biosynthesis in etiolated seedlings. Histochemical analysis of β-glucuronidase (GUS) activity in transgenic plants expressing pSCL27::rSCL27-GUS revealed that SCL27-GUS accumulates at high levels and suppresses chlorophyll biosynthesis at the leaf basal proliferation region during leaf development. Transient gene expression assays showed that the promoter activity of PORC is indeed regulated by SCL27. Consistently, chromatin immunoprecipitation and quantitative PCR assays showed that SCL27 binds to the promoter region of PORC in vivo. An electrophoretic mobility shift assay revealed that SCL27 is directly interacted with G(A/G)(A/T)AA(A/T)GT cis-elements of the PORC promoter. Furthermore, genetic analysis showed that gibberellin (GA)-regulated chlorophyll biosynthesis is mediated, at least in part, by SCLs. We demonstrated that SCL27 interacts with DELLA proteins in vitro and in vivo by yeast-two-hybrid and coimmunoprecipitation analysis and found that their interaction reduces the binding activity of SCL27 to the PORC promoter. Additionally, we showed that SCL27 activates MIR171 gene expression, forming a feedback regulatory loop. Taken together, our data suggest that the miR171-SCL module is critical for mediating GA-DELLA signaling in the coordinate regulation of chlorophyll biosynthesis and leaf growth in light. PMID:25101599

  1. Alterations in phosphorylated cAMP response element-binding protein (pCREB) signaling: an endophenotype of lithium-responsive bipolar disorder?

    Science.gov (United States)

    Alda, Martin; Shao, Li; Wang, Jun-Feng; Lopez de Lara, Catalina; Jaitovich-Groisman, Iris; Lebel, Veronique; Sun, Xiujun; Duffy, Anne; Grof, Paul; Rouleau, Guy A; Turecki, Gustavo; Young, L Trevor

    2013-12-01

    Abnormalities of signal transduction are considered among the susceptibility factors for bipolar disorder (BD). These include changes in G-protein-mediated signaling and subsequent modification of gene expression via transcription factors such as cAMP response element-binding protein (CREB). We investigated levels of CREB in lymphoblasts from patients with BD, all responders to lithium prophylaxis (n = 13), and healthy control subjects (n = 15). Phosphorylated CREB (pCREB) was measured by immunoblotting in subjects with BD (n = 15) as well as in their affected (n = 17) and unaffected (n = 18) relatives, and healthy controls (n = 16). Basal CREB levels were comparable in patients and control subjects and were not changed by lithium treatment. pCREB levels were increased in both patients and their relatives compared to controls (p = 0.003). Forskolin stimulation led to a 24% increase in pCREB levels in cells from healthy subjects (p = 0.002) but not in the other three groups. When using basal and stimulated pCREB levels as a biochemical phenotype in a preliminary linkage study, we found the strongest support for linkage in regions largely overlapping with those showing linkage with the clinical phenotype (3p, 6p, 16p, 17q, 19q, and 21q). Abnormal pCREB signaling could be considered a biochemical phenotype for lithium-responsive BD. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. A sterol-regulatory element binding protein is required for cell polarity, hypoxia adaptation, azole drug resistance, and virulence in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Sven D Willger

    2008-11-01

    Full Text Available At the site of microbial infections, the significant influx of immune effector cells and the necrosis of tissue by the invading pathogen generate hypoxic microenvironments in which both the pathogen and host cells must survive. Currently, whether hypoxia adaptation is an important virulence attribute of opportunistic pathogenic molds is unknown. Here we report the characterization of a sterol-regulatory element binding protein, SrbA, in the opportunistic pathogenic mold, Aspergillus fumigatus. Loss of SrbA results in a mutant strain of the fungus that is incapable of growth in a hypoxic environment and consequently incapable of causing disease in two distinct murine models of invasive pulmonary aspergillosis (IPA. Transcriptional profiling revealed 87 genes that are affected by loss of SrbA function. Annotation of these genes implicated SrbA in maintaining sterol biosynthesis and hyphal morphology. Further examination of the SrbA null mutant consequently revealed that SrbA plays a critical role in ergosterol biosynthesis, resistance to the azole class of antifungal drugs, and in maintenance of cell polarity in A. fumigatus. Significantly, the SrbA null mutant was highly susceptible to fluconazole and voriconazole. Thus, these findings present a new function of SREBP proteins in filamentous fungi, and demonstrate for the first time that hypoxia adaptation is likely an important virulence attribute of pathogenic molds.

  3. Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1 Expression by Orphan Nuclear Receptor Nr4a1

    Directory of Open Access Journals (Sweden)

    Michael P. Greenwood

    2017-12-01

    Full Text Available Cyclic AMP (cAMP inducible transcription factor cAMP responsive element binding protein 3 like 1 (Creb3l1 is strongly activated in the hypothalamus in response to hyperosmotic cues such as dehydration (DH. We have recently shown that Creb3l1 expression is upregulated by cAMP pathways in vitro, however the exact mechanisms are not known. Here we show that increasing Creb3l1 transcription by raising cAMP levels in mouse pituitary AtT20 cells automatically initiates cleavage of Creb3l1, leading to a greater abundance of the transcriptionally active N-terminal portion. Inhibiting protein synthesis indicated that de novo protein synthesis of an intermediary transcription factor was required for Creb3l1 induction. Strategic mining of our microarray data from dehydrated rodent hypothalamus revealed four candidates, reduced to two by analysis of acute hyperosmotic-induced transcriptional activation profiles in the hypothalamus, and one, orphan nuclear receptor Nr4a1, by direct shRNA mediated silencing in AtT20 cells. We show that activation of Creb3l1 transcription by Nr4a1 involves interaction with a single NBRE site in the promoter region. The ability to activate Creb3l1 transcription by this pathway in vitro is dictated by the level of methylation of a CpG island within the proximal promoter/5′UTR of this gene. We thus identify a novel cAMP-Nr4a1-Creb3l1 transcriptional pathway in AtT20 cells and also, our evidence would suggest, in the hypothalamus.

  4. Transcriptional control of adrenal steroidogenesis: novel connection between Janus kinase (JAK) 2 protein and protein kinase A (PKA) through stabilization of cAMP response element-binding protein (CREB) transcription factor.

    Science.gov (United States)

    Lefrancois-Martinez, Anne-Marie; Blondet-Trichard, Antonine; Binart, Nadine; Val, Pierre; Chambon, Céline; Sahut-Barnola, Isabelle; Pointud, Jean-Christophe; Martinez, Antoine

    2011-09-23

    In the adrenal gland, adrenocorticotropin (ACTH) acting through the cAMP protein kinase (PKA) transduction pathway is the main regulator of genes involved in glucocorticoid synthesis. The prolactin (PRL) receptor is expressed in the adrenal cortex of most mammals, but experimental proof that PRL ensures direct control on glucocorticoid synthesis in rodents remains elusive. To unravel the physiological importance of PRL in adrenocortical functions, we measured steroidogenic capacity of Prlr-deficient mice (Prlr(-/-)) and explored the influence of JAK/STAT signaling, the major PRL transduction pathway, on the steroidogenic activity of adrenocortical cell cultures. We demonstrate that lack of Prlr does not affect basal (nor stress-induced) corticosterone levels in mice. PRL triggers JAK2/STAT5-dependent transcription in adrenal cells, but this does not influence corticosterone release. In contrast, pharmacological or siRNA-mediated inhibition of JAK2 reveals its essential role in both basal and ACTH/cAMP-induced steroidogenesis. We demonstrate that nuclear JAK2 regulates the amount of active transcription factor CREB (cAMP response element-binding protein) through tyrosine phosphorylation and prevention of proteasomal degradation, which in turn leads to transcriptional activation of the rate-limiting steroidogenic Star gene. Hence, we describe a novel link between PKA and JAK2 by which nuclear JAK2 signaling controls adrenal steroidogenesis by increasing the stability of CREB.

  5. Progesterone stimulates adipocyte determination and differentiation 1/sterol regulatory element-binding protein 1c gene expression. potential mechanism for the lipogenic effect of progesterone in adipose tissue.

    Science.gov (United States)

    Lacasa, D; Le Liepvre, X; Ferre, P; Dugail, I

    2001-04-13

    Fatty acid synthase (FAS), a nutritionally regulated lipogenic enzyme, is transcriptionally controlled by ADD1/SREBP1c (adipocyte determination and differentiation 1/sterol regulatory element-binding protein 1c), through insulin-mediated stimulation of ADD1/SREBP1c expression. Progesterone exerts lipogenic effects on adipocytes, and FAS is highly induced in breast tumor cell lines upon progesterone treatment. We show here that progesterone up-regulates ADD1/SREBP1c expression in the MCF7 breast cancer cell line and the primary cultured preadipocyte from rat parametrial adipose tissue. In MCF7, progesterone induced ADD1/SREBP1c and Metallothionein II (a well known progesterone-regulated gene) mRNAs, with comparable potency. In preadipocytes, progesterone increased ADD1/SREBP1c mRNA dose-dependently, but not SREBP1a or SREBP2. Run-on experiments demonstrated that progesterone action on ADD1/SREBP1c was primarily at the transcriptional level. The membrane-bound and mature nuclear forms of ADD1/SREBP1 protein accumulated in preadipocytes cultured with progesterone, and FAS induction could be abolished by adenovirus-mediated overexpression of a dominant negative form of ADD1/SREBP1 in these cells. Finally, in the presence of insulin, progesterone was unable to up-regulate ADD1/SREBP1c mRNA in preadipocytes, whereas its effect was restored after 24 h of insulin deprivation. Together these results demonstrate that ADD1/SREBP1c is controlled by progesterone, which, like insulin, acts by increasing ADD1/SREBP1c gene transcription. This provides a potential mechanism for the lipogenic actions of progesterone on adipose tissue.

  6. The Steroid Hormone 20-Hydroxyecdysone Enhances Gene Transcription through the cAMP Response Element-binding Protein (CREB) Signaling Pathway*

    OpenAIRE

    Jing, Yu-Pu; Wang, Di; Han, Xiao-Lin; Dong, Du-Juan; Wang, Jin-Xing; Zhao, Xiao-Fan

    2016-01-01

    Animal steroid hormones regulate gene transcription through genomic pathways by binding to nuclear receptors. These steroid hormones also rapidly increase intracellular calcium and cyclic adenosine monophosphate (cAMP) levels and activate the protein kinase C (PKC) and protein kinase A (PKA) nongenomic pathways. However, the function and mechanism of the nongenomic pathways of the steroid hormones are unclear, and the relationship between the PKC and PKA pathways is also unclear. We propose t...

  7. Ginsenoside F2 reduces hair loss by controlling apoptosis through the sterol regulatory element-binding protein cleavage activating protein and transforming growth factor-β pathways in a dihydrotestosterone-induced mouse model.

    Science.gov (United States)

    Shin, Heon-Sub; Park, Sang-Yong; Hwang, Eun-Son; Lee, Don-Gil; Mavlonov, Gafurjon Turdalievich; Yi, Tae-Hoo

    2014-01-01

    This study was conducted to test whether ginsenoside F2 can reduce hair loss by influencing sterol regulatory element-binding protein (SREBP) cleavage-activating protein (SCAP) and the transforming growth factor beta (TGF-β) pathway of apoptosis in dihydrotestosterone (DHT)-treated hair cells and in a DHT-induced hair loss model in mice. Results for ginsenoside F2 were compared with finasteride. DHT inhibits proliferation of hair cells and induces androgenetic alopecia and was shown to activate an apoptosis signal pathway both in vitro and in vivo. The cell-based 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay showed that the proliferation rates of DHT-treated human hair dermal papilla cells (HHDPCs) and HaCaTs increased by 48% in the ginsenoside F2-treated group and by 12% in the finasteride-treated group. Western blot analysis showed that ginsenoside F2 decreased expression of TGF-β2 related factors involved in hair loss. The present study suggested a hair loss related pathway by changing SCAP related apoptosis pathway, which has been known to control cholesterol metabolism. SCAP, sterol regulatory element-binding protein (SREBP) and caspase-12 expression in the ginsenoside F2-treated group were decreased compared to the DHT and finasteride-treated group. C57BL/6 mice were also prepared by injection with DHT and then treated with ginsenoside F2 or finasteride. Hair growth rate, density, thickness measurements and tissue histotological analysis in these groups suggested that ginsenoside F2 suppressed hair cell apoptosis and premature entry to catagen more effectively than finasteride. Our results indicated that ginsenoside F2 decreased the expression of TGF-β2 and SCAP proteins, which have been suggested to be involved in apoptosis and entry into catagen. This study provides evidence those factors in the SCAP pathway could be targets for hair loss prevention drugs.

  8. Bidirectional Regulation of the Cyclic-AMP Response Element Binding Protein Encodes Spatial Map Alignment in Prism-Adapting Barn Owls

    Science.gov (United States)

    Nichols, Grant S; DeBello, William M

    2012-01-01

    The barn owl midbrain contains mutually aligned maps of auditory and visual space. Throughout life, map alignment is maintained through the actions of an instructive signal that encodes the magnitude of auditory-visual mismatch. The intracellular signaling pathways activated by this signal are unknown. Here we tested the hypothesis that CREB (cAMP response element binding protein) provides a cell-specific readout of instructive information. Owls were fitted with prismatic or control spectacles and provided rich auditory-visual experience - hunting live mice. CREB activation was analyzed within 30 minutes of hunting using phosphorylation state-specific (pCREB) and CREB antibodies, confocal imaging and immunofluorescence measurements at individual cell nuclei. In control owls or prism-adapted owls, which experience small instructive signals, the frequency distributions of pCREB/CREB values obtained for cell nuclei within the external nucleus of the inferior colliculus (ICX) were unimodal. In contrast, in owls adapting to prisms or re-adapting to normal conditions, the distributions were bimodal: certain cells had received a signal that positively regulated CREB, and by extension, transcription of CREB-dependent genes, while others a signal that negatively regulated it. These changes were restricted to the sub-region of the inferior colliculus that received optically displaced input, the rostral ICX, and not evident in the caudal ICX or central nucleus. Finally, the topographic pattern of CREB regulation was patchy, not continuous, as expected from the actions of a topographically precise signal encoding discrete events. These results support a model in which the magnitude of CREB activation within individual cells provides a readout of the instructive signal that guides plasticity and learning. PMID:18829948

  9. Prognostic value of coexistence of abnormal expression of micro-RNA-200b and cyclic adenosine monophosphate-responsive element-binding protein 1 in human astrocytoma.

    Science.gov (United States)

    Zhang, Jun-qing; Yao, Qing-he; Kuang, Yong-qin; Ma, Yuan; Yang, Li-bin; Huang, Hai-dong; Cheng, Jing-ming; Yang, Tao; Liu, En-yu; Liang, Liang; Fan, Ke-xia; Zhao, Kai; Xia, Xun; Gu, Jian-wen

    2014-10-01

    Our aim was to investigate the expression of micro-RNA-200b (miR-200b) and cAMP-responsive element-binding protein 1 (CREB-1) in astrocytoma and its efficacy for predicting outcome. Both miR-200b and CREB-1 messenger RNA expression was measured in 122 astrocytomas and 30 nonneoplastic brain specimens by quantitative real-time polymerase chain reaction. Expression of miR-200b was significantly lower in astrocytoma than in nonneoplastic brain (P RNA expression was significantly elevated in the tumors (P < .001). Both miR-200b down-regulation and CREB-1 up-regulation were significantly associated with advanced pathologic grade (P = .002 and P = .006, respectively). Low miR-200b expression correlated negatively with Karnofsky performance score (P = .03), and high CREB-1 expression correlated positively with mean tumor diameter (P = .03). By Kaplan-Meier analysis, low miR-200b, high CREB-1, and coexistence of abnormal miR-200b and CREB-1 expression (low miR-200b/high CREB-1) were predictive of shorter progression-free survival and overall survival in both grade III and grade IV astrocytoma. By multivariate analysis, only low miR-200b/high CREB-1 expression was an independent prognostic factor for poor prognosis in astrocytoma of advanced grade. Both miR-200b and CREB-1 may play important cooperative roles in the progression of human astrocytoma. The efficacy of miR-200b and CREB-1 together as a predictor of prognosis in astrocytoma patients is shown for the first time. Copyright © 2014. Published by Elsevier Inc.

  10. Expression of Sterol Regulatory Element-Binding Proteins in epicardial adipose tissue in patients with coronary artery disease and diabetes mellitus: preliminary study

    Science.gov (United States)

    Pérez-Belmonte, Luis M.; Moreno-Santos, Inmaculada; Cabrera-Bueno, Fernando; Sánchez-Espín, Gemma; Castellano, Daniel; Such, Miguel; Crespo-Leiro, María G; Carrasco-Chinchilla, Fernando; Alonso-Pulpón, Luis; López-Garrido, Miguel; Ruiz-Salas, Amalio; Becerra-Muñoz, Víctor M.; Gómez-Doblas, Juan J.; de Teresa-Galván, Eduardo; Jiménez-Navarro, Manuel

    2017-01-01

    Objectives: Sterol regulatory element-binding proteins (SREBP) genes are crucial in lipid biosynthesis and cardiovascular homeostasis. Their expression in epicardial adipose tissue (EAT) and their influence in the development of coronary artery disease (CAD) and type-2 diabetes mellitus remain to be determined. The aim of our study was to evaluate the expression of SREBP genes in EAT in patients with CAD according to diabetes status and its association with clinical and biochemical data. Methods: SREBP-1 and SREBP-2 mRNA expression levels were measured in EAT from 49 patients with CAD (26 with diabetes) and 23 controls without CAD or diabetes. Results: Both SREBPs mRNA expression were significantly higher in patients with CAD and diabetes (pcardiovascular risk factor for coronary artery disease in patients with type-2 diabetes (SREBP-1: OR 1.7, 95%CI 1.1-2.5, p=0.02; SREBP-2: OR 1.6, 95%CI 1.2-3, p=0.02) and were independently associated with the presence of multivessel CAD, left main and anterior descending artery stenosis, and higher total and LDL cholesterol levels, and lower HDL cholesterol levels, in patients with CAD and diabetes. Conclusions: SREBP genes are expressed in EAT and were higher in CAD patients with diabetes than those patients without CAD or diabetes. SREBP expression was associated as cardiovascular risk factor for the severity of CAD and the poor lipid control. In this preliminary study we suggest the importance of EAT in the lipid metabolism and cardiovascular homeostasis for coronary atherosclerosis of patients with diabetes and highlight a future novel therapeutic target. PMID:28367087

  11. Sterol Regulatory Element-Binding Protein-1c Regulates Inflammasome Activation in Gingival Fibroblasts Infected with High-Glucose-Treated Porphyromonas gingivalis.

    Science.gov (United States)

    Kuo, Hsing-Chun; Chang, Li-Ching; Chen, Te-Chuan; Lee, Ko-Chao; Lee, Kam-Fai; Chen, Cheng-Nan; Yu, Hong-Ren

    2016-01-01

    Background:Porphyromonas gingivalis is a major bacterial species implicated in the progression of periodontal disease, which is recognized as a common complication of diabetes. The interleukin (IL)-1β, processed by the NLR family pyrin domain containing 3 (NLRP3) inflammasome, has been identified as a target for pathogenic infection of the inflammatory response. However, the effect of P. gingivalis in a high-glucose situation in the modulation of inflammasome activation in human gingival fibroblasts (HGFs) is not well-understood. Methods:P. gingivalis strain CCUG25226 was used to study the mechanisms underlying the regulation of HGF NLRP3 expression by the infection of high-glucose-treated P. gingivalis (HGPg). Results: HGF infection with HGPg increases the expression of IL-1β and NLRP3. We further demonstrated that the upregulation of sterol regulatory element-binding protein (SREBP)-1c by activation of the Akt and p70S6K pathways is critical for HGPg-induced NLRP3 expression. We showed that the inhibition of Janus kinase 2 (JAK2) blocks the Akt- and p70S6K-mediated SREBP-1c, NLRP3, and IL-1β expression. The effect of HGPg on HGF signaling and NLRP3 expression is mediated by β1 integrin. In addition, gingival tissues from diabetic patients with periodontal disease exhibited higher NLRP3 and SREBP-1c expression. Conclusions: Our findings identify the molecular pathways underlying HGPg-dependent NLRP3 inflammasome expression in HGFs, providing insight into the effect of P. gingivalis invasion in HGFs.

  12. Erythropoietin activates the phosporylated cAMP [adenosine 3'5' cyclic monophosphate] response element-binding protein pathway and attenuates delayed paraplegia after ischemia-reperfusion injury.

    Science.gov (United States)

    Mares, Joshua M; Foley, Lisa S; Bell, Marshall T; Bennett, Daine T; Freeman, Kirsten A; Meng, Xianzhong; Weyant, Michael J; Cleveland, Joseph C; Fullerton, David A; Puskas, Ferenc; Reece, Thomas Brett

    2015-03-01

    Paraplegia remains a devastating complication of complex aortic surgery. Erythropoietin (EPO) has been shown to prevent paraplegia after ischemia reperfusion, but the protective mechanism remains poorly described in the spinal cord. We hypothesized that EPO induces the CREB (cAMP [adenosine 3'5' cyclic monophosphate] response element-binding protein) pathway and neurotrophin production in the murine spinal cord, attenuating functional and cellular injury. Adult male mice were subjected to 4 minutes of spinal cord ischemia via an aortic and left subclavian cross-clamp. Experimental groups included EPO treatment 4 hours before incision (n = 7), ischemic control (n = 7), and shams (n = 4). Hind-limb function was assessed using the Basso motor score for 48 hours after reperfusion. Spinal cords were harvested and analyzed for neuronal viability using histology and staining with a fluorescein derivative. Expression of phosphorylated (p)AKT (a serine/threonine-specific kinase), pCREB, B-cell lymphoma 2, and brain-derived neurotrophic factor were determined using immunoblotting. By 36 hours of reperfusion, EPO significantly preserved hind-limb function after ischemia-reperfusion injury (P < .01). Histology demonstrated preserved cytoarchitecture in the EPO treatment group. Cords treated with EPO expressed significant increases in pAKT (P = .021) and pCREB (P = .038). Treatment with EPO induced expression of both of the neurotrophins, B-cell lymphoma 2, and brain-derived neurotrophic factor, beginning at 12 hours. Erythropoietin-mediated induction of the CREB pathway and production of neurotrophins is associated with improved neurologic function and increased neuronal viability following spinal cord ischemia reperfusion. Further elucidation of EPO-derived neuroprotection will allow for expansion of adjunct mechanisms for spinal cord protection in high-risk thoracoabdominal aortic intervention. Copyright © 2015 The American Association for Thoracic Surgery. Published by

  13. Protein binding assay for hyaluronate

    Energy Technology Data Exchange (ETDEWEB)

    Lacy, B.E.; Underhill, C.B.

    1986-11-01

    A relatively quick and simple assay for hyaluronate was developed using the specific binding protein, hyaluronectin. The hyaluronectin was obtained by homogenizing the brains of Sprague-Dawley rats, and then centrifuging the homogenate. The resulting supernatant was used as a source of crude hyaluronectin. In the binding assay, the hyaluronectin was mixed with (/sup 3/H)hyaluronate, followed by an equal volume of saturated (NH/sub 4/)/sub 2/SO/sub 4/, which precipitated the hyaluronectin and any (/sup 3/H)hyaluronate associated with it, but left free (/sup 3/H)hyaluronate in solution. The mixture was then centrifuged, and the amount of bound (/sup 3/H)hyaluronate in the precipitate was determined. Using this assay, the authors found that hyaluronectin specifically bound hyaluronate, since other glycosaminoglycans failed to compete for the binding protein. In addition, the interaction between hyaluronectin and hyaluronate was of relatively high affinity, and the size of the hyaluronate did not appear to substantially alter the amount of binding. To determine the amount of hyaluronate in an unknown sample, they used a competition assay in which the binding of a set amount of (/sup 3/H)hyaluronate was blocked by the addition of unlabeled hyaluronate. By comparing the degree of competition of the unknown samples with that of known amounts of hyaluronate, it was possible to determine the amount of hyaluronate in the unknowns. They have found that this method is sensitive to 1 ..mu..g or less of hyaluronate, and is unaffected by the presence of proteins.

  14. Beta2-microglobulin promotes the growth of human renal cell carcinoma through the activation of the protein kinase A, cyclic AMP-responsive element-binding protein, and vascular endothelial growth factor axis.

    Science.gov (United States)

    Nomura, Takeo; Huang, Wen-Chin; Zhau, Haiyen E; Wu, Daqing; Xie, Zhihui; Mimata, Hiromitsu; Zayzafoon, Majd; Young, Andrew N; Marshall, Fray F; Weitzmann, M Neale; Chung, Leland W K

    2006-12-15

    Beta(2)-microglobulin (beta2M), a soluble protein secreted by cancer and host inflammatory cells, has various biological functions, including antigen presentation. Because aberrant expression of beta2M has been reported in human renal cell carcinoma, we investigated the effects of beta2M overexpression on cancer cell growth and analyzed its molecular signaling pathway. We established clonal cell lines that overexpressed beta2M in human renal cell carcinoma (SN12C) cells and then examined cell growth in vitro and in vivo and studied the beta2M-mediated downstream cell signaling pathway. Our results showed that beta2M expression positively correlates with (a) in vitro growth on plastic dishes and as Matrigel colonies, (b) cell invasion and migration in Boyden chambers, and (c) vascular endothelial growth factor (VEGF) expression and secretion by cells. We found, in addition, that beta2M mediates its action through increased phosphorylation of cyclic AMP-responsive element-binding protein (CREB) via the protein kinase A-CREB axis, resulting in increased VEGF expression and secretion. In convergence with this signal axis, beta2M overexpression also activated both phosphatidylinositol 3-kinase/Akt and mitogen-activated protein kinase pathways. Beta2M overexpression induced accelerated growth of SN12C in mouse subcutis and bone. Interrupting the beta2M signaling pathway using small interfering RNA led to apoptosis with increased activation of caspase-3 and caspase-9 and cleaved poly(ADP-ribose) polymerase. Our results showed for the first time that the beta2M-protein kinase A-CREB-VEGF signaling axis plays a crucial role in support of renal cell carcinoma growth and progression and reveals a novel therapeutic target.

  15. Extracellular receptor kinase and cAMP response element binding protein activation in the neonatal rat heart after perinatal cocaine exposure.

    Science.gov (United States)

    Sun, Lena S; Quamina, Aaron

    2004-12-01

    Prenatal exposure to cocaine has been shown to induce an increase in the myocardial expression and activation of the cAMP response binding protein (CREB), a transcriptional factor that has been shown to regulate gene expression. Several different kinases, including protein kinase A, calcium calmodulin kinase II, and mitogen-activated protein kinase can induce phosphorylation of CREB at serine 133, a necessary step for CREB activation. We examined whether the mitogen-activated protein kinase-extracellular receptor kinase (ERK) pathway may be involved in mediating the serine 133 CREB phosphorylation in cardiac nuclei after perinatal cocaine exposure. Pregnant rats were treated daily with saline or cocaine at 60 mg/kg (C60) by intragastric administration during the entire gestational period, and treatment was continued in the nursing dams after delivery until the time of the study. Nuclear extracts were isolated from hearts of 1-d- and 7-d-old neonatal rats. We performed immunoblotting experiments using an antibody that recognized CREB with phosphorylation specifically at the serine 133 site and an antibody that recognized both the phosphorylated and the unphosphorylated forms of CREB, as well as antibodies for total ERK, phospho-ERK, total ribosomal S6 kinase 1 (RSK1), RSK2, and phospho-RSK. We assessed the interaction of RSK with CREB or CREB-binding protein by performing co-immunoprecipitation experiments. We found that perinatal cocaine exposure increased both phospho-ERK and phospho-RSK expression, indicative of an increased activity of these two enzymes. Furthermore, we demonstrated that phospho-RSK was immunoprecipitated with CREB in all neonatal cardiac nuclei and that the greatest interaction was found in day 7 hearts after perinatal cocaine exposure. Our results thus illustrate that the ERK-RSK pathway was active in the postnatal rat heart at 1 and 7 d of age and that this pathway may mediate the increase in myocardial CREB activation after perinatal cocaine

  16. Calmodulin-dependent Protein Kinase II/cAMP Response Element-binding Protein/Wnt/β-Catenin Signaling Cascade Regulates Angiotensin II-induced Podocyte Injury and Albuminuria*

    Science.gov (United States)

    Jiang, Lei; Xu, Lingling; Song, Yuxian; Li, Jianzhong; Mao, Junhua; Zhao, Allan Zijian; He, Weichun; Yang, Junwei; Dai, Chunsun

    2013-01-01

    Angiotensin II (Ang II) plays a pivotal role in promoting podocyte dysfunction and albuminuria, however, the underlying mechanisms have not been fully delineated. In this study, we found that Ang II induced Wnt1 expression and β-catenin nuclear translocation in cultured mouse podocytes. Blocking Wnt signaling with Dickkopf-1 (Dkk1) or β-catenin siRNA attenuated Ang II-induced podocyte injury. Ang II could also induce the phosphorylation of calmodulin-dependent protein kinase (CaMK) II and cAMP response element-binding protein (CREB) in cultured podocytes. Blockade of this pathway with CK59 or CREB siRNA could significantly inhibit Ang II-induced Wnt/β-catenin signaling and podocyte injury. In in vivo studies, administration of Ang II promoted Wnt/β-catenin signaling, aggregated podocyte damage, and albuminuria in mice. CK59 could remarkably ameliorate Ang II-induced podocyte injury and albuminuria. Furthermore, ectopic expression of exogenous Dkk1 also attenuated Ang II-induced podocytopathy in mice. Taken together, this study demonstrates that the CaMK II/CREB/Wnt/β-catenin signaling cascade plays an important role in regulating Ang II-induced podocytopathy. Targeting this signaling pathway may offer renal protection against the development of proteinuric kidney diseases. PMID:23803607

  17. Human plasminogen binding protein tetranectin

    DEFF Research Database (Denmark)

    Kastrup, J S; Rasmussen, H; Nielsen, B B

    1997-01-01

    The recombinant human plasminogen binding protein tetranectin (TN) and the C-type lectin CRD of this protein (TN3) have been crystallized. TN3 crystallizes in the tetragonal space group P4(2)2(1)2 with cell dimensions a = b = 64.0, c = 75.7 A and with one molecule per asymmetric unit. The crystals...... to at least 2.5 A. A full data set has been collected to 3.0 A. The asymmetric unit contains one monomer of TN. Molecular replacement solutions for TN3 and TN have been obtained using the structure of the C-type lectin CRD of rat mannose-binding protein as search model. The rhombohedral space group indicates...... diffract X-rays to at least 2.0 A resolution. A complete diffraction data set has been collected to 2.7 A resolution. The crystals of TN, obtained by the vapour-diffusion reverse salting-in method at 280 K, are rhombohedral, space group R3, with the hexagonal axes a = b = 89.1, c = 75.8 A, and diffract...

  18. Identification of a Bipartite Jasmonate-Responsive Promoter Element in the Catharanthus roseus ORCA3 Transcription Factor Gene That Interacts Specifically with AT-Hook DNA-Binding Proteins1[W

    Science.gov (United States)

    Vom Endt, Débora; Soares e Silva, Marina; Kijne, Jan W.; Pasquali, Giancarlo; Memelink, Johan

    2007-01-01

    Jasmonates are plant signaling molecules that play key roles in defense against certain pathogens and insects, among others, by controlling the biosynthesis of protective secondary metabolites. In Catharanthus roseus, the APETALA2-domain transcription factor ORCA3 is involved in the jasmonate-responsive activation of terpenoid indole alkaloid biosynthetic genes. ORCA3 gene expression is itself induced by jasmonate. By loss- and gain-of-function experiments, we located a 74-bp region within the ORCA3 promoter, which contains an autonomous jasmonate-responsive element (JRE). The ORCA3 JRE is composed of two important sequences: a quantitative sequence responsible for a high level of expression and a qualitative sequence that appears to act as an on/off switch in response to methyl jasmonate. We isolated 12 different DNA-binding proteins having one of four different types of DNA-binding domains, using the ORCA3 JRE as bait in a yeast (Saccharomyces cerevisiae) one-hybrid transcription factor screening. The binding of one class of proteins bearing a single AT-hook DNA-binding motif was affected by mutations in the quantitative sequence within the JRE. Two of the AT-hook proteins tested had a weak activating effect on JRE-mediated reporter gene expression, suggesting that AT-hook family members may be involved in determining the level of expression of ORCA3 in response to jasmonate. PMID:17496112

  19. Oxygen-binding haem proteins.

    Science.gov (United States)

    Wilson, Michael T; Reeder, Brandon J

    2008-01-01

    Myoglobin and haemoglobin, the respiratory pigments of mammals and some molluscs, annelids and arthropods, belong to an ancient superfamily of haem-associated globin proteins. Members of this family share common structural and spectral features. They also share some general functional characteristics, such as the ability to bind ligands, e.g. O2, CO and NO, at the iron atom and to undergo redox changes. These properties are used in vivo to perform a wide range of biochemical and physiological roles. While it is acknowledged that the major role of haemoglobin is to bind oxygen reversibly and deliver it to the tissues, this is not its only function, while the often-stated role of myoglobin as an oxygen storage protein is possibly a misconception. Furthermore, haemoglobin and myoglobin express enzymic activities that are important to their function, e.g. NO dioxygenase activity or peroxidatic activity that may be partly responsible for pathophysiology following haemorrhage. Evidence for these functions is described, and the discussion extended to include proteins that have recently been discovered and that are expressed at low levels within the cell. These proteins are hexaco-ordinate, unlike haemoglobin and myoglobin, and are widely distributed throughout the animal kingdom (e.g. neuroglobins and cytoglobins). They may have specialist roles in oxygen delivery to particular sites within the cell but may also perform roles associated with O2 sensing and signalling and in responses to stress, e.g. protection from reactive oxygen and nitrogen species. Haemoglobins are also widespread in plants and bacteria and may serve similar protective functions.

  20. Acyl-coenzyme A binding protein (ACBP)

    DEFF Research Database (Denmark)

    Kragelund, B B; Knudsen, J; Poulsen, F M

    1999-01-01

    Acyl-coenzyme A binding proteins are known from a large group of eukaryote species and to bind a long chain length acyl-CoA ester with very high affinity. Detailed biochemical mapping of ligand binding properties has been obtained as well as in-depth structural studies on the bovine apo-protein a...

  1. Engineering RNA-binding proteins for biology.

    Science.gov (United States)

    Chen, Yu; Varani, Gabriele

    2013-08-01

    RNA-binding proteins play essential roles in the regulation of gene expression. Many have modular structures and combine relatively few common domains in various arrangements to recognize RNA sequences and/or structures. Recent progress in engineering the specificity of the PUF class RNA-binding proteins has shown that RNA-binding domains may be combined with various effector or functional domains to regulate the metabolism of targeted RNAs. Designer RNA-binding proteins with tailored sequence specificity will provide valuable tools for biochemical research as well as potential therapeutic applications. In this review, we discuss the suitability of various RNA-binding domains for engineering RNA-binding specificity, based on the structural basis for their recognition. We also compare various protein engineering and design methods applied to RNA-binding proteins, and discuss future applications of these proteins. © 2013 FEBS.

  2. Megalin binds and mediates cellular internalization of folate binding protein

    DEFF Research Database (Denmark)

    Birn, Henrik; Zhai, Xiaoyue; Holm, Jan

    2005-01-01

    and semen. The function and significance of FBPs are unresolved, however, it has been suggested that they may facilitate folate uptake, e.g. during suckling. The present study shows that megalin, a large, multiligand endocytic receptor and member of the low-density lipoprotein-receptor family, is able...... to bind and mediate cellular uptake of FBP. Surface plasmon resonance analysis shows binding of bovine and human milk FBP to immobilized megalin, but not to low density lipoprotein receptor related protein. Binding of (125)I-labeled folate binding protein (FBP) to sections of kidney proximal tubule, known...

  3. Plasmodium vivax Duffy binding protein peptides specifically bind to reticulocytes.

    Science.gov (United States)

    Ocampo, Marisol; Vera, Ricardo; Eduardo Rodriguez, Luis; Curtidor, Hernando; Urquiza, Mauricio; Suarez, Jorge; Garcia, Javier; Puentes, Alvaro; Lopez, Ramsés; Trujillo, Mary; Torres, Elizabeth; Patarroyo, Manuel Elkin

    2002-01-01

    Plasmodium vivax Duffy Binding Protein (Pv-DBP) is essential during merozoite invasion of reticulocytes. Reticulocyte binding region identification is important for understanding Pv-DBP reticulocyte recognition. Fifty 20 mer non-overlapping peptides, spanning Pv-DBP sequences, were tested in erythrocyte and reticulocyte binding assays. Ten HARBPs, mainly located in region II (Kd 50-130 nM), were High Activity Reticulocyte Binding Peptides (HARBPs); one bound to erythrocytes. Reticulocyte trypsin-, chymotrypsin- or neuraminidase- treatment affects HARBP binding differently, suggesting that these peptides have different reticulocyte-binding-sites. Some peptides bound to a Coomasie non-stainable 40 Kda band. Some HARBPs were able to block recombinant PvRII binding (Pv-DBP region II) to Duffy positive reticulocytes.

  4. Retinoid-binding proteins: similar protein architectures bind similar ligands via completely different ways.

    Directory of Open Access Journals (Sweden)

    Yu-Ru Zhang

    Full Text Available BACKGROUND: Retinoids are a class of compounds that are chemically related to vitamin A, which is an essential nutrient that plays a key role in vision, cell growth and differentiation. In vivo, retinoids must bind with specific proteins to perform their necessary functions. Plasma retinol-binding protein (RBP and epididymal retinoic acid binding protein (ERABP carry retinoids in bodily fluids, while cellular retinol-binding proteins (CRBPs and cellular retinoic acid-binding proteins (CRABPs carry retinoids within cells. Interestingly, although all of these transport proteins possess similar structures, the modes of binding for the different retinoid ligands with their carrier proteins are different. METHODOLOGY/PRINCIPAL FINDINGS: In this work, we analyzed the various retinoid transport mechanisms using structure and sequence comparisons, binding site analyses and molecular dynamics simulations. Our results show that in the same family of proteins and subcellular location, the orientation of a retinoid molecule within a binding protein is same, whereas when different families of proteins are considered, the orientation of the bound retinoid is completely different. In addition, none of the amino acid residues involved in ligand binding is conserved between the transport proteins. However, for each specific binding protein, the amino acids involved in the ligand binding are conserved. The results of this study allow us to propose a possible transport model for retinoids. CONCLUSIONS/SIGNIFICANCE: Our results reveal the differences in the binding modes between the different retinoid-binding proteins.

  5. binding protein gene from Dasypyrum Villosum

    African Journals Online (AJOL)

    Jane

    2011-07-20

    Jul 20, 2011 ... common wheat. Blue copper-binding protein (BCB) can bind a single copper atom (Ryden and Hunt, 1993). The copper binding sites consist of two ..... Moerschbacher BM, Noll U, Gorrichon L, Reisener HJ (1990). Specific inhibition of lignification breaks hypersensitive resistance of wheat to stem rust.

  6. Fractal aspects of calcium binding protein structures

    Energy Technology Data Exchange (ETDEWEB)

    Isvoran, Adriana [West University of Timisoara, Department of Chemistry, Pestalozzi 16, 300115 Timisoara (Romania)], E-mail: aisvoran@cbg.uvt.ro; Pitulice, Laura [West University of Timisoara, Department of Chemistry, Pestalozzi 16, 300115 Timisoara (Romania); Craescu, Constantin T. [INSERM U759/Institute Curie-Recherche, Centre Universitaire Paris-Sud, Batiment 112, 91405 Orsay (France); Chiriac, Adrian [West University of Timisoara, Department of Chemistry, Pestalozzi 16, 300115 Timisoara (Romania)

    2008-03-15

    The structures of EF-hand calcium binding proteins may be classified into two distinct groups: extended and compact structures. In this paper we studied 20 different structures of calcium binding proteins using the fractal analysis. Nine structures show extended shapes, one is semi-compact and the other 10 have compact shapes. Our study reveals different fractal characteristics for protein backbones belonging to different structural classes and these observations may be correlated to the physicochemical forces governing the protein folding.

  7. Dietary fiber prevents obesity-related liver lipotoxicity by modulating sterol-regulatory element binding protein pathway in C57BL/6J mice fed a high-fat/cholesterol diet.

    Science.gov (United States)

    Han, Shufen; Jiao, Jun; Zhang, Wei; Xu, Jiaying; Wan, Zhongxiao; Zhang, Weiguo; Gao, Xiaoran; Qin, Liqiang

    2015-10-29

    Adequate intake of dietary fibers has proven metabolic and cardiovascular benefits, molecular mechanisms remain still limited. This study was aimed to investigate the effects of cereal dietary fiber on obesity-related liver lipotoxicity in C57BL/6J mice fed a high-fat/cholesterol (HFC) diet and underlying mechanism. Forty-eight adult male C57BL/6J mice were randomly given a reference chow diet, or a high fat/cholesterol (HFC) diet supplemented with or without oat fiber or wheat bran fiber for 24 weeks. Our results showed mice fed oat or wheat bran fiber exhibited lower weight gain, lipid profiles and insulin resistance, compared with HFC diet. The two cereal dietary fibers potently decreased protein expressions of sterol regulatory element binding protein-1 and key factors involved in lipogenesis, including fatty acid synthase and acetyl-CoA carboxylase in target tissues. At molecular level, the two cereal dietary fibers augmented protein expressions of peroxisome proliferator-activated receptor alpha and gamma, liver X receptor alpha, and ATP-binding cassette transporter A1 in target tissues. Our findings indicated that cereal dietary fiber supplementation abrogated obesity-related liver lipotoxicity and dyslipidemia in C57BL/6J mice fed a HFC diet. In addition, the efficacy of oat fiber is greater than wheat bran fiber in normalizing these metabolic disorders and pathological profiles.

  8. The complexity of minocycline serum protein binding.

    Science.gov (United States)

    Zhou, Jian; Tran, Brian T; Tam, Vincent H

    2017-06-01

    Serum protein binding is critical for understanding the pharmacology of antimicrobial agents. Tigecycline and eravacycline were previously reported to have atypical non-linear protein binding; the percentage of free fraction decreased with increasing total concentration. In this study, we extended the investigation to other tetracyclines and examined the factors that might impact protein binding. Different minocycline concentrations (0.5-50 mg/L) and perfusion media (saline, 0.1 M HEPES buffer and 0.1 and 1 M PBS) were examined by in vitro microdialysis. After equilibration, two dialysate samples were taken from each experiment and the respective antimicrobial agent concentrations were analysed by validated LC-MS/MS methods. For comparison, the serum protein bindings of doxycycline and levofloxacin were also determined. The free fraction of minocycline decreased with increasing total concentration, and the results depended on the perfusion media used. The trends of minocycline protein binding in mouse and human sera were similar. In addition, serum protein binding of doxycycline showed the same concentration-dependent trend as minocycline, while the results of levofloxacin were concentration independent. The serum protein bindings of minocycline and doxycycline are negatively correlated with their total concentrations. It is possible that all tetracyclines share the same pharmacological property. Moreover, the specific perfusion media used could also impact the results of microdialysis. Additional studies are warranted to understand the mechanism(s) and clinical implications of serum protein binding of tetracyclines.

  9. Plasmonic nanosensors for simultaneous quantification of multiple protein-protein binding affinities.

    Science.gov (United States)

    Ahijado-Guzmán, Rubén; Prasad, Janak; Rosman, Christina; Henkel, Andreas; Tome, Lydia; Schneider, Dirk; Rivas, Germán; Sönnichsen, Carsten

    2014-10-08

    Most of current techniques used for the quantification of protein-protein interactions require the analysis of one pair of binding partners at a time. Herein we present a label-free, simple, fast, and cost-effective route to characterize binding affinities between multiple macromolecular partners simultaneously, using optical dark-field spectroscopy and individual protein-functionalized gold nanorods as sensing elements. Our NanoSPR method could easily become a simple and standard tool in biological, biochemical, and medical laboratories.

  10. Adenovirus DNA binding protein: helix destabilising properties.

    OpenAIRE

    Monaghan, A; Webster, A; Hay, R T

    1994-01-01

    Adenovirus DNA binding protein is a multifunctional protein essential for viral DNA replication. To investigate the role of the DNA binding protein in this process its interaction with partial DNA duplexes was examined. Duplex regions of DNA, created when a short DNA strand is annealed to its complementary sequence present in the single stranded form of M13 phage DNA, were efficiently unwound by DNA binding protein in a reaction that required neither ATP nor MgCl2. The unwinding activity of D...

  11. Computational Prediction of RNA-Binding Proteins and Binding Sites

    Directory of Open Access Journals (Sweden)

    Jingna Si

    2015-11-01

    Full Text Available Proteins and RNA interaction have vital roles in many cellular processes such as protein synthesis, sequence encoding, RNA transfer, and gene regulation at the transcriptional and post-transcriptional levels. Approximately 6%–8% of all proteins are RNA-binding proteins (RBPs. Distinguishing these RBPs or their binding residues is a major aim of structural biology. Previously, a number of experimental methods were developed for the determination of protein–RNA interactions. However, these experimental methods are expensive, time-consuming, and labor-intensive. Alternatively, researchers have developed many computational approaches to predict RBPs and protein–RNA binding sites, by combining various machine learning methods and abundant sequence and/or structural features. There are three kinds of computational approaches, which are prediction from protein sequence, prediction from protein structure, and protein-RNA docking. In this paper, we review all existing studies of predictions of RNA-binding sites and RBPs and complexes, including data sets used in different approaches, sequence and structural features used in several predictors, prediction method classifications, performance comparisons, evaluation methods, and future directions.

  12. Drosophila DNA-Binding Proteins in Polycomb Repression

    Directory of Open Access Journals (Sweden)

    Maksim Erokhin

    2018-01-01

    Full Text Available The formation of individual gene expression patterns in different cell types is required during differentiation and development of multicellular organisms. Polycomb group (PcG proteins are key epigenetic regulators responsible for gene repression, and dysregulation of their activities leads to developmental abnormalities and diseases. PcG proteins were first identified in Drosophila, which still remains the most convenient system for studying PcG-dependent repression. In the Drosophila genome, these proteins bind to DNA regions called Polycomb response elements (PREs. A major role in the recruitment of PcG proteins to PREs is played by DNA-binding factors, several of which have been characterized in detail. However, current knowledge is insufficient for comprehensively describing the mechanism of this process. In this review, we summarize and discuss the available data on the role of DNA-binding proteins in PcG recruitment to chromatin.

  13. Functions of Intracellular Retinoid Binding-Proteins.

    Science.gov (United States)

    Napoli, Joseph L

    Multiple binding and transport proteins facilitate many aspects of retinoid biology through effects on retinoid transport, cellular uptake, metabolism, and nuclear delivery. These include the serum retinol binding protein sRBP (aka Rbp4), the plasma membrane sRBP receptor Stra6, and the intracellular retinoid binding-proteins such as cellular retinol-binding proteins (CRBP) and cellular retinoic acid binding-proteins (CRABP). sRBP transports the highly lipophilic retinol through an aqueous medium. The major intracellular retinol-binding protein, CRBP1, likely enhances efficient retinoid use by providing a sink to facilitate retinol uptake from sRBP through the plasma membrane or via Stra6, delivering retinol or retinal to select enzymes that generate retinyl esters or retinoic acid, and protecting retinol/retinal from excess catabolism or opportunistic metabolism. Intracellular retinoic acid binding-proteins (CRABP1 and 2, and FABP5) seem to have more diverse functions distinctive to each, such as directing retinoic acid to catabolism, delivering retinoic acid to specific nuclear receptors, and generating non-canonical actions. Gene ablation of intracellular retinoid binding-proteins does not cause embryonic lethality or gross morphological defects. Metabolic and functional defects manifested in knockouts of CRBP1, CRBP2 and CRBP3, however, illustrate their essentiality to health, and in the case of CRBP2, to survival during limited dietary vitamin A. Future studies should continue to address the specific molecular interactions that occur between retinoid binding-proteins and their targets and their precise physiologic contributions to retinoid homeostasis and function.

  14. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins

    Directory of Open Access Journals (Sweden)

    Elisa E. Figueroa-Angulo

    2015-11-01

    Full Text Available Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs that interact with an iron responsive element (IRE located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis.

  15. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins.

    Science.gov (United States)

    Figueroa-Angulo, Elisa E; Calla-Choque, Jaeson S; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-11-26

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis.

  16. SVOP is a nucleotide binding protein.

    Directory of Open Access Journals (Sweden)

    Jia Yao

    Full Text Available BACKGROUND: Synaptic Vesicle Protein 2 (SV2 and SV2-related protein (SVOP are transporter-like proteins that localize to neurotransmitter-containing vesicles. Both proteins share structural similarity with the major facilitator (MF family of small molecule transporters. We recently reported that SV2 binds nucleotides, a feature that has also been reported for another MF family member, the human glucose transporter 1 (Glut1. In the case of Glut1, nucleotide binding affects transport activity. In this study, we determined if SVOP also binds nucleotides and assessed its nucleotide binding properties. METHODOLOGY/PRINCIPAL FINDINGS: We performed in vitro photoaffinity labeling experiments with the photoreactive ATP analogue, 8-azido-ATP[gamma] biotin and purified recombinant SVOP-FLAG fusion protein. We found that SVOP is a nucleotide-binding protein, although both its substrate specificity and binding site differ from that of SV2. Within the nucleotides tested, ATP, GTP and NAD show same level of inhibition on SVOP-FLAG labeling. Dose dependent studies indicated that SVOP demonstrates the highest affinity for NAD, in contrast to SV2, which binds both NAD and ATP with equal affinity. Mapping of the binding site revealed a single region spanning transmembrane domains 9-12, which contrasts to the two binding sites in the large cytoplasmic domains in SV2A. CONCLUSIONS/SIGNIFICANCE: SVOP is the third MF family member to be found to bind nucleotides. Given that the binding sites are unique in SVOP, SV2 and Glut1, this feature appears to have arisen separately.

  17. 3'UTR AU-Rich Elements (AREs) and the RNA-Binding Protein Tristetraprolin (TTP) Are Not Required for the LPS-Mediated Destabilization of Phospholipase-Cβ-2 mRNA in Murine Macrophages.

    Science.gov (United States)

    Shukla, Smita; Elson, Genie; Blackshear, Perry J; Lutz, Carol S; Leibovich, S Joseph

    2017-04-01

    We have shown previously that bacterial lipopolysaccharide (LPS)-mediated suppression of phospholipase-Cβ-2 (PLCβ-2) expression is involved in M1 (inflammatory) to M2-like (wound healing) phenotypic switching of macrophages triggered by adenosine. This suppression is mediated post-transcriptionally by destabilization of PLCβ-2 mRNA (messenger ribonucleic acid). To investigate the mechanism of this LPS-mediated destabilization, we examined the roles of RNA-binding agents including microRNAs and RNA-binding proteins that are involved in regulating stability of mRNAs encoding growth factors, inflammatory mediators, and proto-oncogenes. Adenylate and uridylate (AU)-rich elements (AREs) in 3'UTRs are specific recognition sites for RNA-binding proteins including tristetraprolin (TTP), HuR, and AUF1 and for microRNAs that are involved in regulating mRNA stability. In this study, we investigated the role of TTP and AREs in regulating PLCβ-2 mRNA stability. The 3'UTR of the PLCβ-2 gene was inserted into the pLightswitch luciferase reporter plasmid and transfected into RAW264.7 cells. LPS suppressed luciferase expression from this reporter. Luciferase expression from mutant 3'UTR constructs lacking AREs was similarly downregulated, suggesting that these regions are not required for LPS-mediated suppression of PLCβ-2. TTP was rapidly upregulated in both primary murine macrophages and RAW264.7 cells in response to LPS. Suppression of PLCβ-2 by LPS was examined using macrophages from mice lacking TTP (TTP(-/-)). LPS suppressed PLCβ-2 expression to the same extent in wild type (WT) and TTP(-/-) macrophages. Also, the rate of decay of PLCβ-2 mRNA in LPS-treated macrophages following transcriptional blockade was similar in WT and TTP(-/-) macrophages, clearly indicating that TTP is not involved in LPS-mediated destabilization of PLCβ-2 mRNA in macrophages.

  18. CAP binding proteins associated with the nucleus.

    Science.gov (United States)

    Patzelt, E; Blaas, D; Kuechler, E

    1983-01-01

    Cap binding proteins of HeLa cells were identified by photo-affinity labelling using the cap analogue gamma-[32P]-[4-(benzoyl-phenyl)methylamido]-7-methylguanosine-5'- triphosphate. Photoreaction with whole cell homogenates resulted in specific labelling of five major polypeptides. The small molecular weight polypeptide appeared to be identical to the 24 000 to 26 000 dalton cap binding protein previously identified in initiation factors. A cap binding protein of 37 000 dalton was found in initiation factors as well as in preparations of crude nuclei. It was released from nuclei by washing with buffer of moderate salt concentration. Three high molecular weight cap binding proteins (approximately 120 000, approximately 89 000, approximately 80 000 dalton) were found in the nuclear fraction and were only partly released upon nuclease digestion and high salt extraction. Images PMID:6889136

  19. Timing of transcription during the cell cycle: Protein complexes binding to E2F, E2F/CLE, CDE/CHR, or CHR promoter elements define early and late cell cycle gene expression.

    Science.gov (United States)

    Müller, Gerd A; Stangner, Konstanze; Schmitt, Thomas; Wintsche, Axel; Engeland, Kurt

    2017-11-17

    A central question in cell cycle control is how differential gene expression is regulated. Timing of expression is important for correct progression through the cell cycle. E2F, CDE, and CHR promoter sites have been linked to transcriptional repression in resting cells and activation during the cell cycle. Further, the DREAM complex binds CHR or CDE/CHR elements of G2/M genes resulting in repression during G0/G1. Here, we show that DREAM also binds to E2F sites of S phase genes in quiescence and upon p53 activation. Furthermore, we describe a novel class of promoter sites, the CHR-like elements (CLE), which can support binding of DREAM to E2F elements. Activation of such S phase genes is achieved through binding of E2F1-3/DP complexes to E2F sites. In contrast, the activating MuvB complexes MMB and FOXM1-MuvB bind to CHR elements and mediate peak expression in G2/M. In conclusion, data presented here in combination with earlier results leads us to propose a model that explains how DREAM can repress early cell cycle genes through E2F or E2F/CLE sites and late genes through CHR or CDE/CHR elements. Also p53-dependent indirect transcriptional repression through the p53-p21-Cyclin/CDK-DREAM-E2F/CLE/CDE/CHR pathway requires DREAM binding to E2F or E2F/CLE sites in early cell cycle genes and binding of DREAM to CHR or CDE/CHR elements of late cell cycle genes. Specific timing of activation is achieved through binding of E2F1-3/DP to E2F sites and MMB or FOXM1-MuvB complexes to CHR elements.

  20. Binding pocket optimization by computational protein design.

    Directory of Open Access Journals (Sweden)

    Christoph Malisi

    Full Text Available Engineering specific interactions between proteins and small molecules is extremely useful for biological studies, as these interactions are essential for molecular recognition. Furthermore, many biotechnological applications are made possible by such an engineering approach, ranging from biosensors to the design of custom enzyme catalysts. Here, we present a novel method for the computational design of protein-small ligand binding named PocketOptimizer. The program can be used to modify protein binding pocket residues to improve or establish binding of a small molecule. It is a modular pipeline based on a number of customizable molecular modeling tools to predict mutations that alter the affinity of a target protein to its ligand. At its heart it uses a receptor-ligand scoring function to estimate the binding free energy between protein and ligand. We compiled a benchmark set that we used to systematically assess the performance of our method. It consists of proteins for which mutational variants with different binding affinities for their ligands and experimentally determined structures exist. Within this test set PocketOptimizer correctly predicts the mutant with the higher affinity in about 69% of the cases. A detailed analysis of the results reveals that the strengths of PocketOptimizer lie in the correct introduction of stabilizing hydrogen bonds to the ligand, as well as in the improved geometric complemetarity between ligand and binding pocket. Apart from the novel method for binding pocket design we also introduce a much needed benchmark data set for the comparison of affinities of mutant binding pockets, and that we use to asses programs for in silico design of ligand binding.

  1. Structural Elements Regulating AAA+ Protein Quality Control Machines

    Directory of Open Access Journals (Sweden)

    Chiung-Wen Chang

    2017-05-01

    Full Text Available Members of the ATPases Associated with various cellular Activities (AAA+ superfamily participate in essential and diverse cellular pathways in all kingdoms of life by harnessing the energy of ATP binding and hydrolysis to drive their biological functions. Although most AAA+ proteins share a ring-shaped architecture, AAA+ proteins have evolved distinct structural elements that are fine-tuned to their specific functions. A central question in the field is how ATP binding and hydrolysis are coupled to substrate translocation through the central channel of ring-forming AAA+ proteins. In this mini-review, we will discuss structural elements present in AAA+ proteins involved in protein quality control, drawing similarities to their known role in substrate interaction by AAA+ proteins involved in DNA translocation. Elements to be discussed include the pore loop-1, the Inter-Subunit Signaling (ISS motif, and the Pre-Sensor I insert (PS-I motif. Lastly, we will summarize our current understanding on the inter-relationship of those structural elements and propose a model how ATP binding and hydrolysis might be coupled to polypeptide translocation in protein quality control machines.

  2. Recombinant Trichomonas vaginalis eIF-5A protein expressed from a eukaryotic system binds specifically to mammalian and putative trichomonal eIF-5A response elements (EREs).

    Science.gov (United States)

    Carvajal-Gamez, Bertha Isabel; Carrillo, Laura Vázquez; Torres-Romero, Julio César; Camacho-Nuez, Minerva; Ponce-Regalado, María Dolores; Camarillo, César López; Alvarez-Sánchez, María Elizbeth

    2016-12-01

    Trichomonas vaginalis eIF-5A-like protein (TveIF-5A) belongs to the highly conserved eIF-5A family of proteins that contains a unique polyamine-derived amino acid, hypusine. Recently, we determined that the polyamine putrescine is required for tveif-5a mRNA stability, and it is necessary for stability and maturation of the TveIF-5A protein. Eukaryotic eIF-5A is known to be involved in mRNA turnover and is capable of sequence-specific RNA binding to eIF-5A response elements (EREs). These ERE sequences are present in diverse mammalian mRNAs, including human cyclooxygenase-2 (cox-2). Here, we cloned the complete coding sequence of TveIF-5A and overexpressed it in a eukaryotic system. The recombinant protein (rTveIF-5A) was purified in soluble form using size-exclusion chromatography. Because of the polyamine-dependent regulation of TvCP39 (a protease of T. vaginalis) at the protein and RNA messenger (mRNA) levels, we looked for an ERE-like structure in the 3' region of tvcp39 mRNA. In RNA gel-shift assays, rTveIF-5A bound to transcripts at the EREs of cox-2 or tvcp39 mRNAs. This work shows the eIF-5A/ERE-like interaction in T. vaginalis. Copyright © 2016. Published by Elsevier Ireland Ltd.

  3. Telomere-binding proteins of Arabidopsis thaliana.

    Science.gov (United States)

    Zentgraf, U

    1995-02-01

    The nucleoprotein structure of Arabidopsis thaliana telomeres was investigated. A protein specifically binding to telomeric sequences was characterized by gel mobility shift assays with synthetic oligonucleotides consisting of four 7 bp telomeric repeats of Arabidopsis (TTTAGGG) and crude nuclear protein extracts of Arabidopsis leaves. These DNA-protein binding studies revealed that the binding affinity of this telomere-binding protein to the G-rich single-strand as well as to the double-stranded telomeric DNA is much higher than to the C-rich single-strand. The molecular mass of the protein was identified by SDS-PAGE to be 67 kDa. The isoelectric points were determined to be 5.0, 4.85 and 4.7, respectively, indicating that either one protein with different modifications or three slightly different proteins have been isolated. An RNA component, possibly serving as a template for reverse transcription of a plant telomerase, does not mediate the DNA-protein contact because the DNA-protein interactions were not RNAse-sensitive.

  4. Lipid binding proteins from parasitic platyhelminthes

    Science.gov (United States)

    Alvite, Gabriela; Esteves, Adriana

    2012-01-01

    Two main families of lipid binding proteins have been identified in parasitic Platyhelminthes: hydrophobic ligand binding proteins (HLBPs) and fatty acid binding proteins (FABPs). Members of the former family of proteins are specific to the Cestoda class, while FABPs are conserved across a wide range of animal species. Because Platyhelminthes are unable to synthesize their own lipids, these lipid-binding proteins are important molecules in these organisms. HLBPs are a high molecular mass complex of proteins and lipids. They are composed of subunits of low molecular mass proteins and a wide array of lipid molecules ranging from CoA esters to cholesterol. These proteins are excretory-secretory molecules and are key serological tools for diagnosis of diseases caused by cestodes. FABPs are mainly intracellular proteins of low molecular weight. They are also vaccine candidates. Despite that the knowledge of their function is scarce, the differences in their molecular organization, ligand preferences, intra/extracellular localization, evolution, and phylogenetic distribution, suggest that platyhelminths HLBPs and FABPs should play different functions. FABPs might be involved in the removal of fatty acids from the inner surface of the cell membrane and in their subsequent targeting to specific cellular destinations. In contrast, HLBPs might be involved in fatty acid uptake from the host environment. PMID:22988444

  5. Lipid Binding Proteins from Parasitic Platyhelmithes

    Directory of Open Access Journals (Sweden)

    Gabriela eAlvite

    2012-09-01

    Full Text Available Two main families of lipid binding proteins have been identified in parasitic Platyhelminthes: hydrophobic ligand binding proteins (HLBPs and fatty acid binding proteins (FABPs. Members of the former family of proteins are specific to the Cestoda class, while FABPs are conserved across a wide range of animal species. Because Platyhelminthes are unable to synthesise their own lipids, these lipid-binding proteins are important molecules in these organisms.HLBPs are a high molecular mass complex of proteins and lipids. They are composed of subunits of low molecular mass proteins and a wide array of lipid molecules ranging from CoA esters to cholesterol. These proteins are excretory-secretory molecules and are key serological tools for diagnosis of diseases caused by cestodes. FABPs are mainly intracellular proteins of low molecular weight. They are also vaccine candidates.Despite that the knowledge of their function is scarce, the differences in their molecular organisation, ligand preferences, intra/extracellular localisation, evolution, and phylogenetic distribution, suggest that platyhelminths HLBPs and FABPs should play different functions. FABPs might be involved in the removal of fatty acids from the inner surface of the cell membrane and in their subsequent targeting to specific cellular destinations. In contrast, HLBPs might be involved in fatty acid uptake from the host environment.

  6. SREBP-2, a second basic-helix-loop-helix-leucine zipper protein that stimulates transcription by binding to a sterol regulatory element.

    OpenAIRE

    Hua, X; Yokoyama, C; Wu, J; Briggs, M R; Brown, M S; Goldstein, J L; Wang, X

    1993-01-01

    We report the cDNA cloning of SREBP-2, the second member of a family of basic-helix-loop-helix-leucine zipper (bHLH-Zip) transcription factors that recognize sterol regulatory element 1 (SRE-1). SRE-1, a conditional enhancer in the promoters for the low density lipoprotein receptor and 3-hydroxy-3-methylglutaryl-coenzyme A synthase genes, increases transcription in the absence of sterols and is inactivated when sterols accumulate. Human SREBP-2 contains 1141 amino acids and is 47% identical t...

  7. Association of MMP7 -181A→G Promoter Polymorphism with Gastric Cancer Risk: INFLUENCE OF NICOTINE IN DIFFERENTIAL ALLELE-SPECIFIC TRANSCRIPTION VIA INCREASED PHOSPHORYLATION OF cAMP-RESPONSE ELEMENT-BINDING PROTEIN (CREB).

    Science.gov (United States)

    Kesh, Kousik; Subramanian, Lakshmi; Ghosh, Nillu; Gupta, Vinayak; Gupta, Arnab; Bhattacharya, Samir; Mahapatra, Nitish R; Swarnakar, Snehasikta

    2015-06-05

    Elevated expression of matrix metalloproteinase7 (MMP7) has been demonstrated to play a pivotal role in cancer invasion. The -181A→G (rs11568818) polymorphism in the MMP7 promoter modulates gene expression and possibly affects cancer progression. Here, we evaluated the impact of -181A→G polymorphism on MMP7 promoter activity and its association with gastric cancer risk in eastern Indian case-control cohorts (n = 520). The GG genotype as compared with the AA genotype was predisposed (p = 0.02; odds ratio = 1.9, 95% confidence interval = 1.1-3.3) to gastric cancer risk. Stratification analysis showed that tobacco addiction enhanced gastric cancer risk in GG subjects when compared with AA subjects (p = 0.03, odds ratio = 2.46, and 95% confidence interval = 1.07-5.68). Meta-analysis revealed that tobacco enhanced the risk for cancer more markedly in AG and GG carriers. Activity and expression of MMP7 were significantly higher in GG than in AA carriers. In support, MMP7 promoter-reporter assays showed greater transcriptional activity toward A to G transition under basal/nicotine-induced/cAMP-response element-binding protein (CREB) overexpressed conditions in gastric adenocarcinoma cells. Moreover, nicotine (a major component of tobacco) treatment significantly up-regulated MMP7 expression due to enhanced CREB phosphorylation followed by its nuclear translocation in gastric adenocarcinoma cells. Furthermore, chromatin immunoprecipitation experiments revealed higher binding of phosphorylated CREB with the -181G than the -181A allele. Altogether, specific binding of phosphorylated CREB to the G allele-carrying promoter enhances MMP7 gene expression that is further augmented by nicotine due to increased CREB phosphorylation and thereby increases the risk for gastric cancer. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. A sugar beet chlorophyll a/b binding protein promoter void of G-box like elements confers strong and leaf specific reporter gene expression in transgenic sugar beet

    Directory of Open Access Journals (Sweden)

    Kloos Dorothee U

    2004-12-01

    Full Text Available Abstract Background Modification of leaf traits in sugar beet requires a strong leaf specific promoter. With such a promoter, expression in taproots can be avoided which may otherwise take away available energy resources for sugar accumulation. Results Suppression Subtractive Hybridization (SSH was utilized to generate an enriched and equalized cDNA library for leaf expressed genes from sugar beet. Fourteen cDNA fragments corresponding to thirteen different genes were isolated. Northern blot analysis indicates the desired tissue specificity of these genes. The promoters for two chlorophyll a/b binding protein genes (Bvcab11 and Bvcab12 were isolated, linked to reporter genes, and transformed into sugar beet using promoter reporter gene fusions. Transient and transgenic analysis indicate that both promoters direct leaf specific gene expression. A bioinformatic analysis revealed that the Bvcab11 promoter is void of G-box like regulatory elements with a palindromic ACGT core sequence. The data indicate that the presence of a G-box element is not a prerequisite for leaf specific and light induced gene expression in sugar beet. Conclusions This work shows that SSH can be successfully employed for the identification and subsequent isolation of tissue specific sugar beet promoters. These promoters are shown to drive strong leaf specific gene expression in transgenic sugar beet. The application of these promoters for expressing resistance improving genes against foliar diseases is discussed.

  9. Haptenation: Chemical Reactivity and Protein Binding

    Directory of Open Access Journals (Sweden)

    Itai Chipinda

    2011-01-01

    Full Text Available Low molecular weight chemical (LMW allergens are commonly referred to as haptens. Haptens must complex with proteins to be recognized by the immune system. The majority of occupationally related haptens are reactive, electrophilic chemicals, or are metabolized to reactive metabolites that form covalent bonds with nucleophilic centers on proteins. Nonelectrophilic protein binding may occur through disulfide exchange, coordinate covalent binding onto metal ions on metalloproteins or of metal allergens, themselves, to the major histocompatibility complex. Recent chemical reactivity kinetic studies suggest that the rate of protein binding is a major determinant of allergenic potency; however, electrophilic strength does not seem to predict the ability of a hapten to skew the response between Th1 and Th2. Modern proteomic mass spectrometry methods that allow detailed delineation of potential differences in protein binding sites may be valuable in predicting if a chemical will stimulate an immediate or delayed hypersensitivity. Chemical aspects related to both reactivity and protein-specific binding are discussed.

  10. Cyclic AMP-Responsive Element-Binding Protein (CREB is Critical in Autoimmunity by Promoting Th17 but Inhibiting Treg Cell Differentiation

    Directory of Open Access Journals (Sweden)

    Xiaohu Wang

    2017-11-01

    Full Text Available The molecular mechanisms that govern differential T cell development into pro-inflammatory Th17 vs. regulatory T (Treg cells remain unclear. Here, we show that selective deletion of CREB in T cells or Th17 cells impaired Th17 cell differentiation in vitro and in vivo, and led to resistance to autoimmune diseases. Mechanistically, CREB, activated by CD3-PKC-ϴ signaling, plays a key role in regulating Th17 cell differentiation, at least in part through directly binding to the Il17-Il17f gene locus. Unexpectedly, although dispensable for FOXP3 expression and for the homeostasis and suppressive function of thymus-derived Treg cells, CREB negatively regulates the survival of TGF-β-induced Treg cells, and deletion of CREB resulted in increased FOXP3+ Treg cells in the intestine and protection in a colitis model. Thus, CREB is critical in autoimmune diseases by promoting Th17 cell and inhibiting de novo Treg cell generation.

  11. A novel sterol regulatory element-binding protein gene (sreA identified in penicillium digitatum is required for prochloraz resistance, full virulence and erg11 (cyp51 regulation.

    Directory of Open Access Journals (Sweden)

    Jing Liu

    Full Text Available Penicillium digitatum is the most destructive postharvest pathogen of citrus fruits, causing fruit decay and economic loss. Additionally, control of the disease is further complicated by the emergence of drug-resistant strains due to the extensive use of triazole antifungal drugs. In this work, an orthologus gene encoding a putative sterol regulatory element-binding protein (SREBP was identified in the genome of P. digitatum and named sreA. The putative SreA protein contains a conserved domain of unknown function (DUF2014 at its carboxyl terminus and a helix-loop-helix (HLH leucine zipper DNA binding domain at its amino terminus, domains that are functionally associated with SREBP transcription factors. The deletion of sreA (ΔsreA in a prochloraz-resistant strain (PdHS-F6 by Agrobacterium tumefaciens-mediated transformation led to increased susceptibility to prochloraz and a significantly lower EC50 value compared with the HS-F6 wild-type or complementation strain (COsreA. A virulence assay showed that the ΔsreA strain was defective in virulence towards citrus fruits, while the complementation of sreA could restore the virulence to a large extent. Further analysis by quantitative real-time PCR demonstrated that prochloraz-induced expression of cyp51A and cyp51B in PdHS-F6 was completely abolished in the ΔsreA strain. These results demonstrate that sreA is a critical transcription factor gene required for prochloraz resistance and full virulence in P. digitatum and is involved in the regulation of cyp51 expression.

  12. Binding interactions of niclosamide with serum proteins

    Directory of Open Access Journals (Sweden)

    Esra Maltas

    2014-12-01

    Full Text Available A study of the binding of niclosamide (NC to serum proteins such as human serum albumin, hemoglobin, and globulin was carried out using fluorescence and UV-visible spectroscopy. Interactions between NC and these proteins were estimated by Stern–Volmer and van't Hoff equations. The binding constants and the thermodynamic parameters, ΔH, ΔS, and ΔG at different temperatures were also determined by using these equations. Data showed that NC may exhibit a static quenching mechanism with all proteins. The thermodynamic parameters were calculated. Data showed that van der Waals interactions and hydrogen bonds are the main forces for human serum albumin and hemoglobin. Globulin, however, bound to NC via hydrophobic interaction. The spectral changes of synchronous fluorescence suggested that both the microenvironment of NC and the conformation of the proteins changed in relation to their concentrations during NC's binding.

  13. CLIPZ: a database and analysis environment for experimentally determined binding sites of RNA-binding proteins.

    Science.gov (United States)

    Khorshid, Mohsen; Rodak, Christoph; Zavolan, Mihaela

    2011-01-01

    The stability, localization and translation rate of mRNAs are regulated by a multitude of RNA-binding proteins (RBPs) that find their targets directly or with the help of guide RNAs. Among the experimental methods for mapping RBP binding sites, cross-linking and immunoprecipitation (CLIP) coupled with deep sequencing provides transcriptome-wide coverage as well as high resolution. However, partly due to their vast volume, the data that were so far generated in CLIP experiments have not been put in a form that enables fast and interactive exploration of binding sites. To address this need, we have developed the CLIPZ database and analysis environment. Binding site data for RBPs such as Argonaute 1-4, Insulin-like growth factor II mRNA-binding protein 1-3, TNRC6 proteins A-C, Pumilio 2, Quaking and Polypyrimidine tract binding protein can be visualized at the level of the genome and of individual transcripts. Individual users can upload their own sequence data sets while being able to limit the access to these data to specific users, and analyses of the public and private data sets can be performed interactively. CLIPZ, available at http://www.clipz.unibas.ch, aims to provide an open access repository of information for post-transcriptional regulatory elements.

  14. Insulin-like growth factor-1 (IGF-1 induces the activation/phosphorylation of Akt kinase and cAMP response element-binding protein (CREB by activating different signaling pathways in PC12 cells

    Directory of Open Access Journals (Sweden)

    Zheng Wen-Hua

    2006-06-01

    Full Text Available Abstract Background Insulin-like growth factor-1 (IGF-1 is a polypeptide growth factor with a variety of functions in both neuronal and non-neuronal cells. IGF-1 plays anti-apoptotic and other functions by activating multiple signaling pathways including Akt kinase, a serine/threonine kinase essential for cell survival. The nuclear transcription factor cAMP response element-binding protein (CREB may also be involved although relationships between these two proteins in IGF-1 receptor signaling and protection is not clear, especially in neuronal cells. Results IGF-1, in a concentration- and time-dependent manner, induces the activation/phosphorylation of Akt and CREB in PC12 cells by activating different signaling pathways. IGF-1 induced a sustained phosphorylation of Akt while only a transient one was seen for CREB. The phosphorylation of Akt is mediated by the PI3 kinase pathway while that of CREB is dependent on the activation of both MAPK kinase and p38 MAPK. Moreover, the stimulation of PKC attenuated the phosphorylation of Akt induced by IGF-1 while enhancing that of CREB. Survival assays with various kinase inhibitors suggested that the activation/phosphorylation of both Akt and CREB contributes to IGF-1 mediated cell survival in PC12 cells. Conclusion These data suggest that IGF-1 induced the activation of Akt and CREB using distinct pathways in PC12 cells.

  15. Computational search for aflatoxin binding proteins

    Science.gov (United States)

    Wang, Ying; Liu, Jinfeng; Zhang, Lujia; He, Xiao; Zhang, John Z. H.

    2017-10-01

    Aflatoxin is one of the mycotoxins that contaminate various food products. Among various aflatoxin types (B1, B2, G1, G2 and M1), aflatoxin B1 is the most important and the most toxic one. In this study, through computational screening, we found that several proteins may bind specifically with different type of aflatoxins. Combination of theoretical methods including target fishing, molecular docking, molecular dynamics (MD) simulation, MM/PBSA calculation were utilized to search for new aflatoxin B1 binding proteins. A recently developed method for calculating entropic contribution to binding free energy called interaction entropy (IE) was employed to compute the binding free energy between the protein and aflatoxin B1. Through comprehensive comparison, three proteins, namely, trihydroxynaphthalene reductase, GSK-3b, and Pim-1 were eventually selected as potent aflatoxin B1 binding proteins. GSK-3b and Pim-1 are drug targets of cancers or neurological diseases. GSK-3b is the strongest binder for aflatoxin B1.

  16. RNA-Binding Proteins in Female Reproductive Pathologies.

    Science.gov (United States)

    Khalaj, Kasra; Miller, Jessica E; Fenn, Christian R; Ahn, SooHyun; Luna, Rayana L; Symons, Lindsey; Monsanto, Stephany P; Koti, Madhuri; Tayade, Chandrakant

    2017-06-01

    RNA-binding proteins are key regulatory molecules involved primarily in post-transcriptional gene regulation of RNAs. Post-transcriptional gene regulation is critical for adequate cellular growth and survival. Recent reports have shown key interactions between these RNA-binding proteins and other regulatory elements, such as miRNAs and long noncoding RNAs, either enhancing or diminishing their response to RNA stabilization. Many RNA-binding proteins have been reported to play a functional role in mediation of cytokines involved in inflammation and immune dysfunction, and some have been classified as global post-transcriptional regulators of inflammation. The ubiquitous expression of RNA-binding proteins in a wide variety of cell types and their unique mechanisms of degradative action provide evidence that they are involved in reproductive tract pathologies. Aberrant inflammation and immune dysfunction are major contributors to the pathogenesis and disease pathophysiology of many reproductive pathologies, including ovarian and endometrial cancers in the female reproductive tract. Herein, we discuss various RNA-binding proteins and their unique contributions to female reproductive pathologies with a focus on those mediated by aberrant inflammation and immune dysfunction. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  17. Glucose adsorption to chitosan membranes increases proliferation of human chondrocyte via mammalian target of rapamycin complex 1 and sterol regulatory element-binding protein-1 signaling.

    Science.gov (United States)

    Chang, Shun-Fu; Huang, Kuo-Chin; Cheng, Chin-Chang; Su, Yu-Ping; Lee, Ko-Chao; Chen, Cheng-Nan; Chang, Hsin-I

    2017-10-01

    Osteoarthritis (OA) is currently still an irreversible degenerative disease of the articular cartilage. Recent, dextrose (d-glucose) intraarticular injection prolotherapy for OA patients has been reported to benefit the chondrogenic stimulation of damaged cartilage. However, the detailed mechanism of glucose's effect on cartilage repair remains unclear. Chitosan, a naturally derived polysaccharide, has recently been investigated as a surgical or dental dressing to control breeding. Therefore, in this study, glucose was adsorbed to chitosan membranes (CTS-Glc), and the study aimed to investigate whether CTS-Glc complex membranes could regulate the proliferation of human OA chondrocytes and to explore the underlying mechanism. Human OA and SW1353 chondrocytes were used in this study. The experiments involving the transfection of cells used SW1353 chondrocytes. A specific inhibitor and siRNAs were used to investigate the mechanism underlying the CTS-Glc-regulated proliferation of human chondrocytes. We found that CTS-Glc significantly increased the proliferation of both human OA and SW1353 chondrocytes comparable to glucose- or chitosan-only stimulation. The role of mammalian target of rapamycin complex 1 (mTORC1) signaling, including mTOR, raptor, and S6k proteins, has been demonstrated in the regulation of CTS-Glc-increased human chondrocyte proliferation. mTORC1 signaling increased the expression levels of maturated SREBP-1 and FASN and then induced the expressions of cell cycle regulators, that is, cyclin D, cyclin-dependent kinase-4 and -6 in human chondrocytes. This study elucidates the detailed mechanism behind the effect of CTS-Glc complex membranes in promoting chondrocyte proliferation and proposes a possible clinical application of the CTS-Glc complex in the dextrose intraarticular injection of OA prolotherapy in the future to attenuate the pain and discomfort of OA patients. © 2017 Wiley Periodicals, Inc.

  18. The cAMP Response Element Binding protein (CREB) is activated by Insulin-like Growth Factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast

    Energy Technology Data Exchange (ETDEWEB)

    Zuloaga, R. [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Fuentes, E.N.; Molina, A. [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Interdisciplinary Center for Aquaculture Research (INCAR), Víctor Lamas 1290, PO Box 160-C, Concepción (Chile); Valdés, J.A., E-mail: jvaldes@unab.cl [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Interdisciplinary Center for Aquaculture Research (INCAR), Víctor Lamas 1290, PO Box 160-C, Concepción (Chile)

    2013-10-18

    Highlights: •IGF-1 induces the activation of CREB via IGF-1R/PI3K/PLC signaling pathway. •Calcium dependent signaling pathways regulate myostatin gene expression. •IGF-1 regulates myostatin gene expression via CREB transcription in skeletal myoblast. -- Abstract: Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP{sub 3}/calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1 during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA–CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation.

  19. Improved mapping of protein binding sites

    Science.gov (United States)

    Kortvelyesi, Tamas; Silberstein, Michael; Dennis, Sheldon; Vajda, Sandor

    2003-02-01

    Computational mapping methods place molecular probes - small molecules or functional groups - on a protein surface in order to identify the most favorable binding positions by calculating an interaction potential. Mapping is an important step in a number of flexible docking and drug design algorithms. We have developed improved algorithms for mapping protein surfaces using small organic molecules as molecular probes. The calculations reproduce the binding of eight organic solvents to lysozyme as observed by NMR, as well as the binding of four solvents to thermolysin, in good agreement with x-ray data. Application to protein tyrosine phosphatase 1B shows that the information provided by the mapping can be very useful for drug design. We also studied why the organic solvents bind in the active site of proteins, in spite of the availability of alternative pockets that can very tightly accommodate some of the probes. A possible explanation is that the binding in the relatively large active site retains a number of rotational states, and hence leads to smaller entropy loss than the binding elsewhere else. Indeed, the mapping reveals that the clusters of the ligand molecules in the protein's active site contain different rotational-translational conformers, which represent different local minima of the free energy surface. In order to study the transitions between different conformers, reaction path and molecular dynamics calculations were performed. Results show that most of the rotational states are separated by low free energy barriers at the experimental temperature, and hence the entropy of binding in the active site is expected to be high.

  20. Binding characteristics of galectin-3 fusion proteins.

    Science.gov (United States)

    Böcker, Sophia; Elling, Lothar

    2017-05-01

    Galectin-3 modulates cell adhesion and signaling events by specific binding and cross-linking galactoside containing carbohydrate ligands. Proteolytic cleavage by metalloproteinases yields in vivo N-terminally truncated galectin-3 still bearing the carbohydrate recognition domain. Truncated galectin-3 has been demonstrated to act in vivo as a negative inhibitor of galectin-3 due to higher affinity for carbohydrate ligands. We here present our studies on a series of 12 human galectin-3 protein constructs. Truncated galectin-3 (∆1-62 and ∆1-116) and fusions with SNAP-tag and/or yellow fluorescent protein (YFP) display altered binding efficiencies (ratio of maximum binding signal and apparent affinity constant Kd) to asialofetuin (ASF) in solid-phase enzyme-linked immunosorbent assay (ELISA) and surface plasmon resonance (SPR) binding assays. Galectin-3(Δ1-62) and full-length (native) galectin-3 have highest affinity to ASF in ELISA and SPR experiments, respectively, whereas galectin-3(Δ1-116) shows only weak binding. We demonstrate here for the first time that SNAP-tag and YFP fusions of galectin-3 and truncated galectin-3 proteins improve binding efficiencies to ASF. SNAP-tagged galectin-3, galectin-3(Δ1-62) and galectin-3(Δ1-116) are found with significant (3- to 6-fold) higher binding efficiencies in SPR when compared with native galectin-3. Fusion of truncated galectin-3 with YFP renders binding properties similar to native galectin-3, whereas in combination with SNAP-tag improved binding characteristics are obtained. Our results emphasize the importance of the N-terminal domain of human galectin-3 for ligand binding. Most importantly, in combination with fusion proteins suitable for the design of diagnostic and therapeutic tools binding properties can be beneficially tuned. The resulting novel protein tools may be advantageous for potential galectin-3 directed applications in tumor diagnostics and therapy. © The Author 2017. Published by Oxford

  1. Cyclic AMP responsive element-binding protein induces metastatic renal cell carcinoma by mediating the expression of matrix metallopeptidase-2/9 and proteins associated with epithelial-mesenchymal transition.

    Science.gov (United States)

    Wang, Xue; Cui, Hui; Lou, Zhongguan; Huang, Shuaishuai; Ren, Yu; Wang, Ping; Weng, Guobin

    2017-06-01

    Renal cell carcinoma (RCC) is the most frequently occurring malignancy of the kidney worldwide. Anti-angiogenic targeted therapies inhibit the progression of RCC, however, limited effects on the invasion or metastasis of tumor cells have been observed. Cyclic AMP responsive element‑binding protein (CREB) is a serine/threonine kinase that has been implicated in the regulation of cell proliferation, apoptosis, cycle progression and metastasis, amongst others. Our previous research demonstrated that phosphorylated CREB (pCREB) was upregulated in human renal cancer cell lines and tissues, and decreased pCREB at the Ser133 site inhibited the growth and metastatic activity of OS‑RC‑2 cells. However, the role of CREB in RCC metastasis requires further investigation. Thus, the present study further investigated the role of CREB in RCC metastasis. The present study demonstrated that knockdown of CREB using small interfering RNA (siRNA) that targeted CREB (siCREB) significantly inhibited the migration and invasion of 786‑O and OS‑RC‑2 cells, however, the opposite effect was observed in ACHN cells. In addition, knockdown of CREB suppressed the expression of matrix metallopeptidase (MMP)‑2/9 and proteins associated with epithelial‑mesenchymal transition (EMT) in 786‑O and OS‑RC‑2 cells, and promoted expression in ACHN cells. Furthermore, the chromatin immunoprecipitation assay indicated that pCREB (Ser133) had a direct interaction with the fibronectin promoter, however, pCREB (Ser133) did not target the vimentin promoter in RCC. Therefore, the results of the present study indicate that CREB regulated metastatic RCC by mediating the expression of MMP‑2/9 and EMT‑associated proteins, however, CREB‑mediated MMP‑2/9 and EMT‑associated protein expression may be induced by different pathways in different RCC cells.

  2. AUXIN BINDING PROTEIN1: The Outsider

    Science.gov (United States)

    Sauer, Michael; Kleine-Vehn, Jürgen

    2011-01-01

    AUXIN BINDING PROTEIN1 (ABP1) is one of the first characterized proteins that bind auxin and has been implied as a receptor for a number of auxin responses. Early studies characterized its auxin binding properties and focused on rapid electrophysiological and cell expansion responses, while subsequent work indicated a role in cell cycle and cell division control. Very recently, ABP1 has been ascribed a role in modulating endocytic events at the plasma membrane and RHO OF PLANTS-mediated cytoskeletal rearrangements during asymmetric cell expansion. The exact molecular function of ABP1 is still unresolved, but its main activity apparently lies in influencing events at the plasma membrane. This review aims to connect the novel findings with the more classical literature on ABP1 and to point out the many open questions that still separate us from a comprehensive model of ABP1 action, almost 40 years after the first reports of its existence. PMID:21719690

  3. ALG-2, a multifunctional calcium binding protein?

    DEFF Research Database (Denmark)

    Tarabykina, Svetlana; Mollerup, Jens; Winding Gojkovic, P.

    2004-01-01

    ALG-2 was originally discovered as a pro-apoptotic protein in a genetic screen. Due to its ability to bind calcium with high affinity it was postulated to provide a link between the known effect of calcium in programmed cell death and the molecular death execution machinery. This review article...

  4. Protein-Protein Interactions: Structurally Conserved Residues Distinguish between Binding Sites and Exposed Protein Surfaces

    National Research Council Canada - National Science Library

    Buyong Ma; Tal Elkayam; Haim Wolfson; Ruth Nussinov

    2003-01-01

    Polar residue hot spots have been observed at protein-protein binding sites. Here we show that hot spots occur predominantly at the interfaces of macromolecular complexes, distinguishing binding sites from the remainder of the surface...

  5. Quantifying drug-protein binding in vivo.

    Energy Technology Data Exchange (ETDEWEB)

    Buchholz, B; Bench, G; Keating III, G; Palmblad, M; Vogel, J; Grant, P G; Hillegonds, D

    2004-02-17

    Accelerator mass spectrometry (AMS) provides precise quantitation of isotope labeled compounds that are bound to biological macromolecules such as DNA or proteins. The sensitivity is high enough to allow for sub-pharmacological (''micro-'') dosing to determine macromolecular targets without inducing toxicities or altering the system under study, whether it is healthy or diseased. We demonstrated an application of AMS in quantifying the physiologic effects of one dosed chemical compound upon the binding level of another compound in vivo at sub-toxic doses [4].We are using tissues left from this study to develop protocols for quantifying specific binding to isolated and identified proteins. We also developed a new technique to quantify nanogram to milligram amounts of isolated protein at precisions that are comparable to those for quantifying the bound compound by AMS.

  6. End binding proteins are obligatory dimers.

    Directory of Open Access Journals (Sweden)

    Indrani Sen

    Full Text Available End binding (EB proteins are responsible for the recruitment of an array of microtubule plus-end tracking proteins (+TIPs to growing microtubules ends. EBs encompass an N-terminal calponin homology domain that confers microtubule tip tracking activity to the protein. The C-terminal domain of EBs contains a coiled coil that mediates the parallel dimerization of EB monomers. This part of the protein is also responsible for partner binding. While dimerization is not essential for microtubule tip tracking by EBs it is a prerequisite for +TIP partner binding. The concentration of EBs in cells has been estimated to be in the range of hundreds of nanomoles. In contrast, in in vitro single molecule experiments EB concentrations of subnanomoles are employed. From a mechanistic point of view it is important to assess the oligomerization state of EBs at physiologically and experimentally relevant protein concentrations, in particular if the goal of a study is to model the behavior of EB-dependent dynamic +TIP networks. Here we have determined the stability of the EB1 and EB3 dimers using multi-angle light scattering and fluorescence analytical ultracentrifugation. We show that these EBs form stable dimers and do not dissociate even at very low nanomolar concentrations. The dimers remained stable at both room temperature as well as at the physiologically relevant temperature of 37°C. Together, our results reveal that EBs are obligatory dimers, a conclusion that has implications for the mechanistic understanding of these key proteins involved in the orchestration of dynamic protein networks at growing microtubule ends.

  7. A structural classification of substrate-binding proteins

    NARCIS (Netherlands)

    Berntsson, Ronnie P. -A.; Smits, Sander H. J.; Schmitt, Lutz; Slotboom, Dirk-Jan; Poolman, Bert

    2010-01-01

    Substrate-binding proteins (SBP) are associated with a wide variety of protein complexes. The proteins are part of ATP-binding cassette transporters for substrate uptake, ion gradient driven transporters, DNA-binding proteins, as well as channels and receptors from both pro-and eukaryotes. A wealth

  8. Endogenous 5-HT2C Receptors Phosphorylate the cAMP Response Element Binding Protein via Protein Kinase C-Promoted Activation of Extracellular-Regulated Kinases-1/2 in Hypothalamic mHypoA-2/10 Cells.

    Science.gov (United States)

    Lauffer, Lisa; Glas, Evi; Gudermann, Thomas; Breit, Andreas

    2016-07-01

    Serotonin 5-HT2C receptors (5-HT2CR) activate Gq proteins and are expressed in the central nervous system (CNS). 5-HT2CR regulate emotion, feeding, reward, or cognition and may serve as promising drug targets to treat psychiatric disorders or obesity. Owing to technical difficulties in isolating cells from the CNS and the lack of suitable cell lines endogenously expressing 5-HT2CR, our knowledge about this receptor subtype in native environments is rather limited. The hypothalamic mHypoA-2/10 cell line was recently established and resembles appetite-regulating hypothalamic neurons of the paraventricular nucleus (PVN), where 5-HT2CR have been detected in vivo. Therefore, we tested mHypoA-2/10 cells for endogenous 5-HT2CR expression. Serotonin or the 5-HT2CR preferential agonist WAY-161,503 initiated cAMP response element (CRE)-dependent gene transcription with EC50 values of 15.5 ± 9.8 and 1.1 ± 0.9 nM, respectively. Both responses were blocked by two unrelated 5-HT2CR-selective antagonists (SB-242,084, RS-102,221) but not by a 5-HT2AR (EMD-281,014) or 5-HT2BR (RS-127,455) antagonists. By single-cell calcium imaging, we found that serotonin and WAY-161,503 induced robust calcium transients, which were also blunted by both 5-HT2CR antagonists. Additionally we revealed, first, that 5-HT2CR induced CRE activation via protein kinase C (PKC)-mediated engagement of extracellular-regulated kinases-1/2 and, second, that intrinsic activity of WAY-161,503 was in the range of 0.3-0.5 compared with serotonin, defining the frequently used 5-HT2CR agonist as a partial agonist of endogenous 5-HT2CR. In conclusion, we have shown that hypothalamic mHypoA-2/10 cells endogenously express 5-HT2CR and thus are the first cell line in which to analyze 5-HT2CR pharmacology, signaling, and regulation in its natural environment. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  9. Automatic Generation of Matrix Element Derivatives for Tight Binding Models

    OpenAIRE

    Alin M. Elena; Meister, Matthias

    2005-01-01

    Tight binding (TB) models are one approach to the quantum mechanical many particle problem. An important role in TB models is played by hopping and overlap matrix elements between the orbitals on two atoms, which of course depend on the relative positions of the atoms involved. This dependence can be expressed with the help of Slater-Koster parameters, which are usually taken from tables. Recently, a way to generate these tables automatically was published. If TB approaches are applied to sim...

  10. Alcohol binding to the odorant binding protein LUSH: multiple factors affecting binding affinities.

    Science.gov (United States)

    Ader, Lauren; Jones, David N M; Lin, Hai

    2010-07-27

    Density function theory (DFT) calculations have been carried out to investigate the binding of alcohols to the odorant binding protein LUSH from Drosophila melanogaster. LUSH is one of the few proteins known to bind to ethanol at physiologically relevant concentrations and where high-resolution structural information is available for the protein bound to alcohol at these concentrations. The structures of the LUSH-alcohol complexes identify a set of specific hydrogen-bonding interactions as critical for optimal binding of ethanol. A set of truncated models based on the structure of the LUSH-butanol complex were constructed for the wild-type and mutant (T57S, S52A, and T57A) proteins in complexes with a series of n-alcohols and for the apoprotein bound to water and for the ligand-free protein. Using both gas-phase calculations and continuum solvation model calculations, we found that the widely used DFT model, B3LYP, failed to reproduce the experimentally observed trend of increasing binding affinity with the increasing length of the alkyl chain in the alcohol. In contrast, the recently developed M05-2X DFT model successfully reproduced this subtle trend. Analysis of the results indicated that multiple factors contribute to the differences in alcohol binding affinity: the H-bonding with Thr57 and Ser52 (4-5 kcal/mol per H-bond), the desolvation contribution (4-6 kcal/mol for alcohols and 8-10 kcal/mol for water), and the other noncovalent interaction (1.2 kcal/mol per CH(2) group of the alcohol alkyl chain). These results reveal the outstanding potential for using the M05-2X model in calculations of protein-substrate complexes where noncovalent interactions are important.

  11. Lead(II) Binding in Natural and Artificial Proteins.

    Science.gov (United States)

    Cangelosi, Virginia; Ruckthong, Leela; Pecoraro, Vincent L

    2017-04-10

    This article describes recent attempts to understand the biological chemistry of lead using a synthetic biology approach. Lead binds to a variety of different biomolecules ranging from enzymes to regulatory and signaling proteins to bone matrix. We have focused on the interactions of this element in thiolate-rich sites that are found in metalloregulatory proteins such as Pbr, Znt, and CadC and in enzymes such as δ-aminolevulinic acid dehydratase (ALAD). In these proteins, Pb(II) is often found as a homoleptic and hemidirectic Pb(II)(SR)3- complex. Using first principles of biophysics, we have developed relatively short peptides that can associate into three-stranded coiled coils (3SCCs), in which a cysteine group is incorporated into the hydrophobic core to generate a (cysteine)3 binding site. We describe how lead may be sequestered into these sites, the characteristic spectral features may be observed for such systems and we provide crystallographic insight on metal binding. The Pb(II)(SR)3- that is revealed within these α-helical assemblies forms a trigonal pyramidal structure (having an endo orientation) with distinct conformations than are also found in natural proteins (having an exo conformation). This structural insight, combined with 207Pb NMR spectroscopy, suggests that while Pb(II) prefers hemidirected Pb(II)(SR)3- scaffolds regardless of the protein fold, the way this is achieved within α-helical systems is different than in β-sheet or loop regions of proteins. These interactions between metal coordination preference and protein structural preference undoubtedly are exploited in natural systems to allow for protein conformation changes that define function. Thus, using a design approach that separates the numerous factors that lead to stable natural proteins allows us to extract fundamental concepts on how metals behave in biological systems.

  12. molecular interactions of the TATA-binding protein

    Indian Academy of Sciences (India)

    Unknown

    Binding characteristics of yeast TATA-binding protein (yTBP) over five oligomers having different TATA variants and lacking a UASGAL, ..... Effect of GAL4-VP16 on binding characteristics of yTBP to DNA. Equilibrium dissociation ..... binding protein from Saccharomyces cerevisiae oligomerizes in solution at micromolar ...

  13. Maximizing binding capacity for protein A chromatography.

    Science.gov (United States)

    Ghose, Sanchayita; Zhang, Jennifer; Conley, Lynn; Caple, Ryan; Williams, Kevin P; Cecchini, Douglas

    2014-01-01

    Advances in cell culture expression levels in the last two decades have resulted in monoclonal antibody titers of ≥10 g/L to be purified downstream. A high capacity capture step is crucial to prevent purification from being the bottleneck in the manufacturing process. Despite its high cost and other disadvantages, Protein A chromatography still remains the optimal choice for antibody capture due to the excellent selectivity provided by this step. A dual flow loading strategy was used in conjunction with a new generation high capacity Protein A resin to maximize binding capacity without significantly increasing processing time. Optimum conditions were established using a simple empirical Design of Experiment (DOE) based model and verified with a wide panel of antibodies. Dynamic binding capacities of >65 g/L could be achieved under these new conditions, significantly higher by more than one and half times the values that have been typically achieved with Protein A in the past. Furthermore, comparable process performance and product quality was demonstrated for the Protein A step at the increased loading. © 2014 American Institute of Chemical Engineers.

  14. A Crayfish Insulin-like-binding Protein

    Science.gov (United States)

    Rosen, Ohad; Weil, Simy; Manor, Rivka; Roth, Ziv; Khalaila, Isam; Sagi, Amir

    2013-01-01

    Across the animal kingdom, the involvement of insulin-like peptide (ILP) signaling in sex-related differentiation processes is attracting increasing attention. Recently, a gender-specific ILP was identified as the androgenic sex hormone in Crustacea. However, moieties modulating the actions of this androgenic insulin-like growth factor were yet to be revealed. Through molecular screening of an androgenic gland (AG) cDNA library prepared from the crayfish Cherax quadricarinatus, we have identified a novel insulin-like growth factor-binding protein (IGFBP) termed Cq-IGFBP. Based on bioinformatics analyses, the deduced Cq-IGFBP was shown to share high sequence homology with IGFBP family members from both invertebrates and vertebrates. The protein also includes a sequence determinant proven crucial for ligand binding, which according to three-dimensional modeling is assigned to the exposed outer surface of the protein. Recombinant Cq-IGFBP (rCq-IGFBP) protein was produced and, using a “pulldown” methodology, was shown to specifically interact with the insulin-like AG hormone of the crayfish (Cq-IAG). Particularly, using both mass spectral analysis and an immunological tool, rCq-IGFBP was shown to bind the Cq-IAG prohormone. Furthermore, a peptide corresponding to residues 23–38 of the Cq-IAG A-chain was found sufficient for in vitro recognition by rCq-IGFBP. Cq-IGFBP is the first IGFBP family member shown to specifically interact with a gender-specific ILP. Unlike their ILP ligands, IGFBPs are highly conserved across evolution, from ancient arthropods, like crustaceans, to humans. Such conservation places ILP signaling at the center of sex-related phenomena in early animal development. PMID:23775079

  15. DNA and RNA Quadruplex-Binding Proteins

    Directory of Open Access Journals (Sweden)

    Václav Brázda

    2014-09-01

    Full Text Available Four-stranded DNA structures were structurally characterized in vitro by NMR, X-ray and Circular Dichroism spectroscopy in detail. Among the different types of quadruplexes (i-Motifs, minor groove quadruplexes, G-quadruplexes, etc., the best described are G-quadruplexes which are featured by Hoogsteen base-paring. Sequences with the potential to form quadruplexes are widely present in genome of all organisms. They are found often in repetitive sequences such as telomeric ones, and also in promoter regions and 5' non-coding sequences. Recently, many proteins with binding affinity to G-quadruplexes have been identified. One of the initially portrayed G-rich regions, the human telomeric sequence (TTAGGGn, is recognized by many proteins which can modulate telomerase activity. Sequences with the potential to form G-quadruplexes are often located in promoter regions of various oncogenes. The NHE III1 region of the c-MYC promoter has been shown to interact with nucleolin protein as well as other G-quadruplex-binding proteins. A number of G-rich sequences are also present in promoter region of estrogen receptor alpha. In addition to DNA quadruplexes, RNA quadruplexes, which are critical in translational regulation, have also been predicted and observed. For example, the RNA quadruplex formation in telomere-repeat-containing RNA is involved in interaction with TRF2 (telomere repeat binding factor 2 and plays key role in telomere regulation. All these fundamental examples suggest the importance of quadruplex structures in cell processes and their understanding may provide better insight into aging and disease development.

  16. Cation specific binding with protein surface charges.

    Science.gov (United States)

    Hess, Berk; van der Vegt, Nico F A

    2009-08-11

    Biological organization depends on a sensitive balance of noncovalent interactions, in particular also those involving interactions between ions. Ion-pairing is qualitatively described by the law of "matching water affinities." This law predicts that cations and anions (with equal valence) form stable contact ion pairs if their sizes match. We show that this simple physical model fails to describe the interaction of cations with (molecular) anions of weak carboxylic acids, which are present on the surfaces of many intra- and extracellular proteins. We performed molecular simulations with quantitatively accurate models and observed that the order K(+) < Na(+) < Li(+) of increasing binding affinity with carboxylate ions is caused by a stronger preference for forming weak solvent-shared ion pairs. The relative insignificance of contact pair interactions with protein surfaces indicates that thermodynamic stability and interactions between proteins in alkali salt solutions is governed by interactions mediated through hydration water molecules.

  17. Acyl-CoA-binding protein/diazepam-binding inhibitor gene and pseudogenes

    DEFF Research Database (Denmark)

    Mandrup, S; Hummel, R; Ravn, S

    1992-01-01

    Acyl-CoA-binding protein (ACBP) is a 10 kDa protein isolated from bovine liver by virtue of its ability to bind and induce the synthesis of medium-chain acyl-CoA esters. Surprisingly, it turned out to be identical to a protein named diazepam-binding Inhibitor (DBI) claimed to be an endogenous...

  18. A novel human polycomb binding site acts as a functional polycomb response element in Drosophila.

    Directory of Open Access Journals (Sweden)

    Suresh Cuddapah

    Full Text Available Polycomb group (PcG proteins are key chromatin regulators implicated in multiple processes including embryonic development, tissue homeostasis, genomic imprinting, X-chromosome inactivation, and germ cell differentiation. The PcG proteins recognize target genomic loci through cis DNA sequences known as Polycomb Response Elements (PREs, which are well characterized in Drosophila. However, mammalian PREs have been elusive until two groups reported putative mammalian PREs recently. Consistent with the existence of mammalian PREs, here we report the identification and characterization of a potential PRE from human T cells. The putative human PRE has enriched binding of PcG proteins, and such binding is dependent on a key PcG component SUZ12. We demonstrate that the putative human PRE carries both genetic and molecular features of Drosophila PRE in transgenic flies, implying that not only the trans PcG proteins but also certain features of the cis PREs are conserved between mammals and Drosophila.

  19. Competitive protein binding assay for piritrexim

    Energy Technology Data Exchange (ETDEWEB)

    Woolley, J.L. Jr.; Ringstad, J.L.; Sigel, C.W. (Wellcome Research Laboratories, Research Triangle Park, NC (USA))

    1989-09-01

    A competitive protein binding assay for piritrexim (PTX, 1) that makes use of a commercially available radioassay kit for methotrexate has been developed. After it is selectively extracted from plasma, PTX competes with ({sup 125}I)methotrexate for binding to dihydrofolate reductase isolated from Lactobacillus casei. Free drug is separated from bound drug by adsorption to dextran-coated charcoal. Piritrexim is measurable over a range of 0.01 to 10.0 micrograms/mL in plasma with a coefficient of variation less than 15%. The limit of sensitivity of the assay is approximately 2 ng/mL. An excellent correlation between this assay and a previously published HPLC method was found.

  20. Cobalamin and its binding protein in rat milk

    DEFF Research Database (Denmark)

    Raaberg, Lasse; Nexø, Ebba; Poulsen, Steen Seier

    1989-01-01

    Cobalamin and its binding protein, haptocorrin, are present in rat milk throughout the lactation period. The concentration of cobalamin is approximately 0.3-times the concentration of the unsaturated binding protein. The concentration of the unsaturated cobalamin-binding protein varies between 18...... nmol l-1 and 16 nmol l-1. The binding protein has a Stokes radius of 2.49 nm when saturated with cobalamin and 2.61 nm when unsaturated. It binds cobalamin over a broad range of pH and is able to bind cobinamide also. With immunohistochemistry, we find haptocorrin immunoreactivity in the mammary glands...

  1. Measuring Binding Affinity of Protein-Ligand Interaction Using Spectrophotometry: Binding of Neutral Red to Riboflavin-Binding Protein

    Science.gov (United States)

    Chenprakhon, Pirom; Sucharitakul, Jeerus; Panijpan, Bhinyo; Chaiyen, Pimchai

    2010-01-01

    The dissociation constant, K[subscript d], of the binding of riboflavin-binding protein (RP) with neutral red (NR) can be determined by titrating RP to a fixed concentration of NR. Upon adding RP to the NR solution, the maximum absorption peak of NR shifts to 545 nm from 450 nm for the free NR. The change of the absorption can be used to determine…

  2. Expression of sterol regulatory element-binding transcription factor (SREBF 2 and SREBF cleavage-activating protein (SCAP in human atheroma and the association of their allelic variants with sudden cardiac death

    Directory of Open Access Journals (Sweden)

    Kytömäki Leena

    2008-12-01

    Full Text Available Abstract Background Disturbed cellular cholesterol homeostasis may lead to accumulation of cholesterol in human atheroma plaques. Cellular cholesterol homeostasis is controlled by the sterol regulatory element-binding transcription factor 2 (SREBF-2 and the SREBF cleavage-activating protein (SCAP. We investigated whole genome expression in a series of human atherosclerotic samples from different vascular territories and studied whether the non-synonymous coding variants in the interacting domains of two genes, SREBF-2 1784G>C (rs2228314 and SCAP 2386A>G, are related to the progression of coronary atherosclerosis and the risk of pre-hospital sudden cardiac death (SCD. Methods Whole genome expression profiling was completed in twenty vascular samples from carotid, aortic and femoral atherosclerotic plaques and six control samples from internal mammary arteries. Three hundred sudden pre-hospital deaths of middle-aged (33–69 years Caucasian Finnish men were subjected to detailed autopsy in the Helsinki Sudden Death Study. Coronary narrowing and areas of coronary wall covered with fatty streaks or fibrotic, calcified or complicated lesions were measured and related to the SREBF-2 and SCAP genotypes. Results Whole genome expression profiling showed a significant (p = 0.02 down-regulation of SREBF-2 in atherosclerotic carotid plaques (types IV-V, but not in the aorta or femoral arteries (p = NS for both, as compared with the histologically confirmed non-atherosclerotic tissues. In logistic regression analysis, a significant interaction between the SREBF-2 1784G>C and the SCAP 2386A>G genotype was observed on the risk of SCD (p = 0.046. Men with the SREBF-2 C allele and the SCAP G allele had a significantly increased risk of SCD (OR 2.68, 95% CI 1.07–6.71, compared to SCAP AA homologous subjects carrying the SREBF-2 C allele. Furthermore, similar trends for having complicated lesions and for the occurrence of thrombosis were found, although the

  3. Comparative footprinting of DNA-binding proteins.

    Science.gov (United States)

    Contreras-Moreira, Bruno; Collado-Vides, Julio

    2006-07-15

    Comparative modelling is a computational method used to tackle a variety of problems in molecular biology and biotechnology. Traditionally it has been applied to model the structure of proteins on their own or bound to small ligands, although more recently it has also been used to model protein-protein interfaces. This work is the first to systematically analyze whether comparative models of protein-DNA complexes could be built and be useful for predicting DNA binding sites. First, we describe the structural and evolutionary conservation of protein-DNA interfaces, and the limits they impose on modelling accuracy. Second, we find that side-chains from contacting residues can be reasonably modeled and therefore used to identify contacting nucleotides. Third, the DNASITE protocol is implemented and different parameters are benchmarked on a set of 85 regulators from Escherichia coli. Results show that comparative footprinting can make useful predictions based solely on structural data, depending primarily on the interface identity with respect to the template used. DNASITE code available on request from the authors.

  4. Identification of actin binding protein, ABP-280, as a binding partner of human Lnk adaptor protein.

    Science.gov (United States)

    He, X; Li, Y; Schembri-King, J; Jakes, S; Hayashi, J

    2000-08-01

    Human Lnk (hLnk) is an adaptor protein with multiple functional domains that regulates T cell activation signaling. In order to identify cellular Lnk binding partners, a yeast two-hybrid screening of human spleen cDNA library was carried out using human hLnk as bait. A polypeptide sequence identical to the C-terminal segment of the actin binding protein (ABP-280) was identified as a hLnk binding protein. The expressed hLnk and the FLAG tagged C-terminal 673 amino acid residues of ABP-280 or the endogenous ABP-280 in COS-7 cells could be co-immunoprecipitated using antibodies either to hLnk, FLAG or ABP-280, respectively. Furthermore, immunofluorescence confocal microscope showed that hLnk and ABP-280 co-localized at the plasma membrane and at juxtanuclear region of COS-7 cells. In Jurkat cells, the endogenous hLnk also associates with the endogenous ABP-280 indicating that the association of these two proteins is physiological. The interacting domains of both proteins were mapped using yeast two-hybrid assays. Our results indicate that hLnk binds to the residues 2006-2454 (repeats 19-23C) of ABP-280. The domain in hLnk that associates with ABP-280 was mapped to an interdomain region of 56 amino acids between pleckstrin homology and Src homology 2 domains. These results suggest that hLnk may exert its regulatory role through its association with ABP-280.

  5. Replacing antibodies: engineering new binding proteins.

    Science.gov (United States)

    Banta, Scott; Dooley, Kevin; Shur, Oren

    2013-01-01

    Nature's reliance on proteins to carry out nearly all biological processes has led to the evolution of biomolecules that exhibit a seemingly endless range of functions. Much research has been devoted toward advancing this process in the laboratory in order to create new proteins with improved or unique capabilities. The protein-engineering field has rapidly evolved from pioneering studies in engineering protein stability and activity to an application-driven powerhouse on the forefront of emerging technologies in biomedical engineering and biotechnology. A classic protein-engineering technique in the medical field has focused on manipulating antibodies and antibody fragments for various applications. New classes of alternative scaffolds have recently challenged this paradigm, and these structures have been successfully engineered for applications including targeted cancer therapy, regulated drug delivery, in vivo imaging, and a host of others. This review aims to capture recent advances in the engineering of nonimmunoglobulin scaffolds as well as some of the applications for these molecular recognition elements in the biomedical field.

  6. RNA-Binding Proteins: Splicing Factors and Disease

    Directory of Open Access Journals (Sweden)

    Alger M. Fredericks

    2015-05-01

    Full Text Available Pre-mRNA splicing is mediated by interactions of the Core Spliceosome and an array of accessory RNA binding proteins with cis-sequence elements. Splicing is a major regulatory component in higher eukaryotes. Disruptions in splicing are a major contributor to human disease. One in three hereditary disease alleles are believed to cause aberrant splicing. Hereditary disease alleles can alter splicing by disrupting a splicing element, creating a toxic RNA, or affecting splicing factors. One of the challenges of medical genetics is identifying causal variants from the thousands of possibilities discovered in a clinical sequencing experiment. Here we review the basic biochemistry of splicing, the mechanisms of splicing mutations, the methods for identifying splicing mutants, and the potential of therapeutic interventions.

  7. Vitamin D Binding Protein and Bone Health

    Directory of Open Access Journals (Sweden)

    Ishir Bhan

    2014-01-01

    Full Text Available Vitamin D binding protein (DBP is the major carrier protein of 25-hydroxyvitamin D (25(OH D in the circulation, where it may serve roles in maintaining stable levels during times of decreased 25(OH availability and in regulating delivery of 25(OH D to target tissues. Several genetic polymorphisms of DBP have been described that lead to phenotypic changes in the protein that may affect affinity, activity, and concentration. These polymorphisms have been linked with alterations in bone density in several populations. One of the mechanisms by which DBP may alter bone health involves regulating vitamin D bioavailability. DBP-bound vitamin is thought to be relatively unavailable to target tissues, and thus alterations in DBP levels or affinity could lead to changes in vitamin D bioactivity. As a result, functional vitamin D status may differ greatly between individuals with similar total 25(OH D levels. Additionally, DBP may have independent roles on macrophage and osteoclast activation. This review will summarize recent findings about DBP with respect to measures of bone density and health.

  8. Glycan masking of Plasmodium vivax Duffy Binding Protein for probing protein binding function and vaccine development.

    Directory of Open Access Journals (Sweden)

    Sowmya Sampath

    Full Text Available Glycan masking is an emerging vaccine design strategy to focus antibody responses to specific epitopes, but it has mostly been evaluated on the already heavily glycosylated HIV gp120 envelope glycoprotein. Here this approach was used to investigate the binding interaction of Plasmodium vivax Duffy Binding Protein (PvDBP and the Duffy Antigen Receptor for Chemokines (DARC and to evaluate if glycan-masked PvDBPII immunogens would focus the antibody response on key interaction surfaces. Four variants of PVDBPII were generated and probed for function and immunogenicity. Whereas two PvDBPII glycosylation variants with increased glycan surface coverage distant from predicted interaction sites had equivalent binding activity to wild-type protein, one of them elicited slightly better DARC-binding-inhibitory activity than wild-type immunogen. Conversely, the addition of an N-glycosylation site adjacent to a predicted PvDBP interaction site both abolished its interaction with DARC and resulted in weaker inhibitory antibody responses. PvDBP is composed of three subdomains and is thought to function as a dimer; a meta-analysis of published PvDBP mutants and the new DBPII glycosylation variants indicates that critical DARC binding residues are concentrated at the dimer interface and along a relatively flat surface spanning portions of two subdomains. Our findings suggest that DARC-binding-inhibitory antibody epitope(s lie close to the predicted DARC interaction site, and that addition of N-glycan sites distant from this site may augment inhibitory antibodies. Thus, glycan resurfacing is an attractive and feasible tool to investigate protein structure-function, and glycan-masked PvDBPII immunogens might contribute to P. vivax vaccine development.

  9. Ice-Binding Proteins in Plants

    Directory of Open Access Journals (Sweden)

    Melissa Bredow

    2017-12-01

    Full Text Available Sub-zero temperatures put plants at risk of damage associated with the formation of ice crystals in the apoplast. Some freeze-tolerant plants mitigate this risk by expressing ice-binding proteins (IBPs, that adsorb to ice crystals and modify their growth. IBPs are found across several biological kingdoms, with their ice-binding activity and function uniquely suited to the lifestyle they have evolved to protect, be it in fishes, insects or plants. While IBPs from freeze-avoidant species significantly depress the freezing point, plant IBPs typically have a reduced ability to lower the freezing temperature. Nevertheless, they have a superior ability to inhibit the recrystallization of formed ice. This latter activity prevents ice crystals from growing larger at temperatures close to melting. Attempts to engineer frost-hardy plants by the controlled transfer of IBPs from freeze-avoiding fish and insects have been largely unsuccessful. In contrast, the expression of recombinant IBP sequences from freeze-tolerant plants significantly reduced electrolyte leakage and enhanced freezing survival in freeze-sensitive plants. These promising results have spurred additional investigations into plant IBP localization and post-translational modifications, as well as a re-evaluation of IBPs as part of the anti-stress and anti-pathogen axis of freeze-tolerant plants. Here we present an overview of plant freezing stress and adaptation mechanisms and discuss the potential utility of IBPs for the generation of freeze-tolerant crops.

  10. Apolipoprotein B is a calcium binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Dashti, N.; Lee, D.M.; Mok, T.

    1986-05-29

    Human hepatocarcinoma Hep G2 cells were grown in culture medium containing (/sup 45/Ca/sup 2 +/). The secreted lipoproteins of d < 1.063 g/ml and d 1.063-1.21 g/ml were isolated from the culture media and analyzed by 3.3% and 7% SDS-polyacrylamide gel electrophoresis. Radioactivity profiles of (/sup 45/Ca) from the gels showed that the peak of radioactivity corresponded to the apolipoprotein B band. The molar ratio of the incorporated (/sup 45/Ca/sup 2 +/) and apolipoprotein B was close to unity. No radioactivity was found associated with any other secreted apolipoproteins. To confirm these findings, apolipoprotein B-containing lipoproteins were precipitated with anti-apolipoprotein B and high density lipoproteins were precipitated with anti-apolipoprotein A-I. Only the former precipitate was radioactive. These results suggest that apolipoprotein B is a calcium binding protein.

  11. STRUCTURAL FEATURES OF PLANT CHITINASES AND CHITIN-BINDING PROTEINS

    NARCIS (Netherlands)

    BEINTEMA, JJ

    1994-01-01

    Structural features of plant chitinases and chitin-binding proteins are discussed. Many of these proteins consist of multiple domains,of which the chitin-binding hevein domain is a predominant one. X-ray and NMR structures of representatives of the major classes of these proteins are available now,

  12. Rapid identification of DNA-binding proteins by mass spectrometry

    DEFF Research Database (Denmark)

    Nordhoff, E; Krogsdam, A M; Jorgensen, H F

    1999-01-01

    We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

  13. Diverse p53/DNA binding modes expand the repertoire of p53 response elements.

    Science.gov (United States)

    Vyas, Pratik; Beno, Itai; Xi, Zhiqun; Stein, Yan; Golovenko, Dmitrij; Kessler, Naama; Rotter, Varda; Shakked, Zippora; Haran, Tali E

    2017-10-03

    The tumor suppressor protein p53 acts as a transcription factor, binding sequence-specifically to defined DNA sites, thereby activating the expression of genes leading to diverse cellular outcomes. Canonical p53 response elements (REs) are made of two decameric half-sites separated by a variable number of base pairs (spacers). Fifty percent of all validated p53 REs contain spacers between 1 and 18 bp; however, their functional significance is unclear at present. Here, we show that p53 forms two different tetrameric complexes with consensus or natural REs, both with long spacers: a fully specific complex where two p53 dimers bind to two specific half-sites, and a hemispecific complex where one dimer binds to a specific half-site and the second binds to an adjacent spacer sequence. The two types of complexes have comparable binding affinity and specificity, as judged from binding competition against bulk genomic DNA. Structural analysis of the p53 REs in solution shows that these sites are not bent in both their free and p53-bound states when the two half-sites are either abutting or separated by spacers. Cell-based assay supports the physiological relevance of our findings. We propose that p53 REs with long spacers comprise separate specific half-sites that can lead to several different tetrameric complexes. This finding expands the universe of p53 binding sites and demonstrates that even isolated p53 half-sites can form tetrameric complexes. Moreover, it explains the manner in which p53 binds to clusters of more than one canonical binding site, common in many natural REs.

  14. Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

    Energy Technology Data Exchange (ETDEWEB)

    Gangi Setty, Thanuja [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Cho, Christine [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Govindappa, Sowmya [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Apicella, Michael A. [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Ramaswamy, S., E-mail: ramas@instem.res.in [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India)

    2014-07-01

    Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.

  15. Consideration on some hormone binding proteins patterns during pregnancy.

    Science.gov (United States)

    Hassan, M A; Miller, N J; Hamdi, I M; el-Adawi, S A; al-Zaid, M; al-Awqati, M A

    1991-02-01

    Serum concentrations of sex hormone binding globulin, transcortin, thyroxine binding globulin, transthyretin together with retinol binding protein, ceruloplasmin, transferrin and albumin were measured sequentially in pregnant women in order to derive more definite suppositions relating to the prime function of hormone binding proteins. Thus, the fact that except for transthyretin all other specific hormone binding proteins exhibited appreciable but significantly variable increases would suggest: a) the apparent existence of more complex mechanisms regulating protein metabolism during pregnancy than hitherto postulated (i.e. the general notion of an integrated estrogen influence); b) a major and distinctive role for each of the hormone binding proteins is plausible since alterations in hormonal requirements by the fetus as pregnancy progresses can not be provided by the almost constant transplacental transfer rate of the "free" hormone moiety.

  16. Plant RNA binding proteins for control of RNA virus infection

    Directory of Open Access Journals (Sweden)

    Sung Un eHuh

    2013-12-01

    Full Text Available Plant RNA viruses have effective strategies to infect host plants through either direct or indirect interactions with various host proteins, thus suppressing the host immune system. When plant RNA viruses enter host cells exposed RNAs of viruses are recognized by the host immune system through processes such as siRNA-dependent silencing. Interestingly, some host RNA binding proteins have been involved in the inhibition of RNA virus replication, movement, and translation through RNA-specific binding. Host plants intensively use RNA binding proteins for defense against viral infections in nature. In this mini review, we will summarize the function of some host RNA binding proteins which act in a sequence-specific binding manner to the infecting virus RNA. It is important to understand how plants effectively suppresses RNA virus infections via RNA binding proteins, and this defense system can be potentially developed as a synthetic virus defense strategy for use in crop engineering.

  17. Exploring NMR ensembles of calcium binding proteins: Perspectives to design inhibitors of protein-protein interactions

    Directory of Open Access Journals (Sweden)

    Craescu Constantin T

    2011-05-01

    Full Text Available Abstract Background Disrupting protein-protein interactions by small organic molecules is nowadays a promising strategy employed to block protein targets involved in different pathologies. However, structural changes occurring at the binding interfaces make difficult drug discovery processes using structure-based drug design/virtual screening approaches. Here we focused on two homologous calcium binding proteins, calmodulin and human centrin 2, involved in different cellular functions via protein-protein interactions, and known to undergo important conformational changes upon ligand binding. Results In order to find suitable protein conformations of calmodulin and centrin for further structure-based drug design/virtual screening, we performed in silico structural/energetic analysis and molecular docking of terphenyl (a mimicking alpha-helical molecule known to inhibit protein-protein interactions of calmodulin into X-ray and NMR ensembles of calmodulin and centrin. We employed several scoring methods in order to find the best protein conformations. Our results show that docking on NMR structures of calmodulin and centrin can be very helpful to take into account conformational changes occurring at protein-protein interfaces. Conclusions NMR structures of protein-protein complexes nowadays available could efficiently be exploited for further structure-based drug design/virtual screening processes employed to design small molecule inhibitors of protein-protein interactions.

  18. Thermodynamics of ligand binding to acyl-coenzyme A binding protein studied by titration calorimetry

    DEFF Research Database (Denmark)

    Færgeman, Nils J.; Sigurskjold, B W; Kragelund, B B

    1996-01-01

    Ligand binding to recombinant bovine acyl-CoA binding protein (ACBP) was examined using isothermal microcalorimetry. Microcalorimetric measurements confirm that the binding affinity of acyl-CoA esters for ACBP is strongly dependent on the length of the acyl chain with a clear preference for acyl-...

  19. The Cobalamin-binding Protein in Zebrafish is an Intermediate Between the Three Cobalamin-binding Proteins in Human

    DEFF Research Database (Denmark)

    Greibe, Eva Holm; Fedosov, Sergey; Nexø, Ebba

    2012-01-01

    knowledge concerning the phylogenetic evolution of kindred proteins. We identified a cobalamin binding capacity in zebrafish protein extracts (8.2 pmol/fish) and ambient water (13.5 pmol/fish) associated with a single protein. The protein showed resistance toward degradation by trypsin and chymotrypsin......In humans, three soluble extracellular cobalamin-binding proteins; transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are involved in the uptake and transport of cobalamin. In this study, we investigate a cobalamin-binding protein from zebrafish (Danio rerio) and summarize current...... with human IF. The absorbance spectrum of the purified protein in complex with hydroxo-cobalamin resembled those of human HC and IF, but not TC. We searched available databases to further explore the phylogenies of the three cobalamin-binding proteins in higher vertebrates. Apparently, TC-like proteins...

  20. Interleukin-18 and interleukin-18 Binding Protein

    Directory of Open Access Journals (Sweden)

    Charles eDinarello

    2013-10-01

    Full Text Available Interleukin-18 (IL 18 is a member of the IL 1 family of cytokines. Increasing reports have expanded the role of IL 18 in mediating inflammation in animal models of disease using IL 18 deficient mice, neutralization of IL 18 or deficiency in the IL 18 receptor alpha chain. Similar to IL 1β, IL 18 is synthesized as an inactive precursor requiering processing by caspase 1 into an active cytokine but unlike IL 1β, the IL 18 precursor is constitutively present in nearly all cells in healthy humans and animals. The activity of IL 18 is balanced by the presence of a high-affinity naturally occuring IL 18 binding protein (IL 18BP. In humans, disease increased disease severity can be associated with an imbalance of IL 18 to IL 18BP such that the levels of free IL 18 are elevated in the circulation. A role for IL 18 has been implicated in several autoimmune diseases, myocardial function, emphysema, metabolic syndromes, psoriasis, inflammatory bowel disease, hemophagocytic syndromes, macrophage activation syndrome, sepsis and acute kidney injury, although in some diseases, IL 18 is protective. IL 18 plays a major role in the production of interferon-g from natural killer cells. The IL 18BP has been used safely in humans and clinical trials of IL 18BP as well as neutralizing anti-IL 18 antibodies are in clinical trials. This review updates the biology of IL 18 as well as its role in human disease

  1. IGF Binding Protein-5 Induces Cell Senescence

    Directory of Open Access Journals (Sweden)

    Fumihiro Sanada

    2018-02-01

    Full Text Available Cellular senescence is the complex process of deterioration that drives the aging of an organism, resulting in the progressive loss of organ function and eventually phenotypic aging. Senescent cells undergo irreversible growth arrest, usually by inducing telomere shortening. Alternatively, senescence may also occur prematurely in response to various stress stimuli, such as oxidative stress, DNA damage, or activated oncogenes. Recently, it has been shown that IGF binding protein-5 (IGFBP-5 with the induction of the tumor suppressor p53 is upregulated during cellular senescence. This mechanism mediates interleukin-6/gp130-induced premature senescence in human fibroblasts, irradiation-induced premature senescence in human endothelial cells (ECs, and replicative senescence in human ECs independent of insulin-like growth factor I (IGF-I and IGF-II. Additionally, a link between IGFBP-5, hyper-coagulation, and inflammation, which occur with age, has been implicated. Thus, IGFBP-5 seems to play decisive roles in controlling cell senescence and cell inflammation. In this review, we describe the accumulating evidence for this role of IGFBP-5 including our new finding.

  2. Informing the Human Plasma Protein Binding of ...

    Science.gov (United States)

    The free fraction of a xenobiotic in plasma (Fub) is an important determinant of chemical adsorption, distribution, metabolism, elimination, and toxicity, yet experimental plasma protein binding data is scarce for environmentally relevant chemicals. The presented work explores the merit of utilizing available pharmaceutical data to predict Fub for environmentally relevant chemicals via machine learning techniques. Quantitative structure-activity relationship (QSAR) models were constructed with k nearest neighbors (kNN), support vector machines (SVM), and random forest (RF) machine learning algorithms from a training set of 1045 pharmaceuticals. The models were then evaluated with independent test sets of pharmaceuticals (200 compounds) and environmentally relevant ToxCast chemicals (406 total, in two groups of 238 and 168 compounds). The selection of a minimal feature set of 10-15 2D molecular descriptors allowed for both informative feature interpretation and practical applicability domain assessment via a bounded box of descriptor ranges and principal component analysis. The diverse pharmaceutical and environmental chemical sets exhibit similarities in terms of chemical space (99-82% overlap), as well as comparable bias and variance in constructed learning curves. All the models exhibit significant predictability with mean absolute errors (MAE) in the range of 0.10-0.18 Fub. The models performed best for highly bound chemicals (MAE 0.07-0.12), neutrals (MAE 0

  3. SONAR Discovers RNA-Binding Proteins from Analysis of Large-Scale Protein-Protein Interactomes.

    Science.gov (United States)

    Brannan, Kristopher W; Jin, Wenhao; Huelga, Stephanie C; Banks, Charles A S; Gilmore, Joshua M; Florens, Laurence; Washburn, Michael P; Van Nostrand, Eric L; Pratt, Gabriel A; Schwinn, Marie K; Daniels, Danette L; Yeo, Gene W

    2016-10-20

    RNA metabolism is controlled by an expanding, yet incomplete, catalog of RNA-binding proteins (RBPs), many of which lack characterized RNA binding domains. Approaches to expand the RBP repertoire to discover non-canonical RBPs are currently needed. Here, HaloTag fusion pull down of 12 nuclear and cytoplasmic RBPs followed by quantitative mass spectrometry (MS) demonstrates that proteins interacting with multiple RBPs in an RNA-dependent manner are enriched for RBPs. This motivated SONAR, a computational approach that predicts RNA binding activity by analyzing large-scale affinity precipitation-MS protein-protein interactomes. Without relying on sequence or structure information, SONAR identifies 1,923 human, 489 fly, and 745 yeast RBPs, including over 100 human candidate RBPs that contain zinc finger domains. Enhanced CLIP confirms RNA binding activity and identifies transcriptome-wide RNA binding sites for SONAR-predicted RBPs, revealing unexpected RNA binding activity for disease-relevant proteins and DNA binding proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Helical propensity in an intrinsically disordered protein accelerates ligand binding

    DEFF Research Database (Denmark)

    Iesmantavicius, Vytautas; Dogan, Jakob; Jemth, Per

    2014-01-01

    Many intrinsically disordered proteins fold upon binding to other macromolecules. The secondary structure present in the well-ordered complex is often formed transiently in the unbound state. The consequence of such transient structure for the binding process is, however, not clear. The activatio...... the notion of preformed secondary structure as an important determinant for molecular recognition in intrinsically disordered proteins....

  5. SCOWLP classification: Structural comparison and analysis of protein binding regions

    Directory of Open Access Journals (Sweden)

    Anders Gerd

    2008-01-01

    Full Text Available Abstract Background Detailed information about protein interactions is critical for our understanding of the principles governing protein recognition mechanisms. The structures of many proteins have been experimentally determined in complex with different ligands bound either in the same or different binding regions. Thus, the structural interactome requires the development of tools to classify protein binding regions. A proper classification may provide a general view of the regions that a protein uses to bind others and also facilitate a detailed comparative analysis of the interacting information for specific protein binding regions at atomic level. Such classification might be of potential use for deciphering protein interaction networks, understanding protein function, rational engineering and design. Description Protein binding regions (PBRs might be ideally described as well-defined separated regions that share no interacting residues one another. However, PBRs are often irregular, discontinuous and can share a wide range of interacting residues among them. The criteria to define an individual binding region can be often arbitrary and may differ from other binding regions within a protein family. Therefore, the rational behind protein interface classification should aim to fulfil the requirements of the analysis to be performed. We extract detailed interaction information of protein domains, peptides and interfacial solvent from the SCOWLP database and we classify the PBRs of each domain family. For this purpose, we define a similarity index based on the overlapping of interacting residues mapped in pair-wise structural alignments. We perform our classification with agglomerative hierarchical clustering using the complete-linkage method. Our classification is calculated at different similarity cut-offs to allow flexibility in the analysis of PBRs, feature especially interesting for those protein families with conflictive binding regions

  6. Quantitative analysis of pheromone-binding protein specificity

    OpenAIRE

    Katti, S.; Lokhande, N.; González, D.; Cassill, A.; Renthal, R.

    2012-01-01

    Many pheromones have very low water solubility, posing experimental difficulties for quantitative binding measurements. A new method is presented for determining thermodynamically valid dissociation constants for ligands binding to pheromone-binding proteins (OBPs), using β-cyclodextrin as a solubilizer and transfer agent. The method is applied to LUSH, a Drosophila OBP that binds the pheromone 11-cis vaccenyl acetate (cVA). Refolding of LUSH expressed in E. coli was assessed by measuring N-p...

  7. Accurate prediction of peptide binding sites on protein surfaces.

    Directory of Open Access Journals (Sweden)

    Evangelia Petsalaki

    2009-03-01

    Full Text Available Many important protein-protein interactions are mediated by the binding of a short peptide stretch in one protein to a large globular segment in another. Recent efforts have provided hundreds of examples of new peptides binding to proteins for which a three-dimensional structure is available (either known experimentally or readily modeled but where no structure of the protein-peptide complex is known. To address this gap, we present an approach that can accurately predict peptide binding sites on protein surfaces. For peptides known to bind a particular protein, the method predicts binding sites with great accuracy, and the specificity of the approach means that it can also be used to predict whether or not a putative or predicted peptide partner will bind. We used known protein-peptide complexes to derive preferences, in the form of spatial position specific scoring matrices, which describe the binding-site environment in globular proteins for each type of amino acid in bound peptides. We then scan the surface of a putative binding protein for sites for each of the amino acids present in a peptide partner and search for combinations of high-scoring amino acid sites that satisfy constraints deduced from the peptide sequence. The method performed well in a benchmark and largely agreed with experimental data mapping binding sites for several recently discovered interactions mediated by peptides, including RG-rich proteins with SMN domains, Epstein-Barr virus LMP1 with TRADD domains, DBC1 with Sir2, and the Ago hook with Argonaute PIWI domain. The method, and associated statistics, is an excellent tool for predicting and studying binding sites for newly discovered peptides mediating critical events in biology.

  8. RNA-Binding Proteins Impacting on Internal Initiation of Translation

    Directory of Open Access Journals (Sweden)

    Rosa Diaz

    2013-11-01

    Full Text Available RNA-binding proteins (RBPs are pivotal regulators of all the steps of gene expression. RBPs govern gene regulation at the post-transcriptional level by virtue of their capacity to assemble ribonucleoprotein complexes on certain RNA structural elements, both in normal cells and in response to various environmental stresses. A rapid cellular response to stress conditions is triggered at the step of translation initiation. Two basic mechanisms govern translation initiation in eukaryotic mRNAs, the cap-dependent initiation mechanism that operates in most mRNAs, and the internal ribosome entry site (IRES-dependent mechanism activated under conditions that compromise the general translation pathway. IRES elements are cis-acting RNA sequences that recruit the translation machinery using a cap-independent mechanism often assisted by a subset of translation initiation factors and various RBPs. IRES-dependent initiation appears to use different strategies to recruit the translation machinery depending on the RNA organization of the region and the network of RBPs interacting with the element. In this review we discuss recent advances in understanding the implications of RBPs on IRES-dependent translation initiation.

  9. RNA-binding proteins impacting on internal initiation of translation.

    Science.gov (United States)

    Martínez-Salas, Encarnación; Lozano, Gloria; Fernandez-Chamorro, Javier; Francisco-Velilla, Rosario; Galan, Alfonso; Diaz, Rosa

    2013-11-01

    RNA-binding proteins (RBPs) are pivotal regulators of all the steps of gene expression. RBPs govern gene regulation at the post-transcriptional level by virtue of their capacity to assemble ribonucleoprotein complexes on certain RNA structural elements, both in normal cells and in response to various environmental stresses. A rapid cellular response to stress conditions is triggered at the step of translation initiation. Two basic mechanisms govern translation initiation in eukaryotic mRNAs, the cap-dependent initiation mechanism that operates in most mRNAs, and the internal ribosome entry site (IRES)-dependent mechanism activated under conditions that compromise the general translation pathway. IRES elements are cis-acting RNA sequences that recruit the translation machinery using a cap-independent mechanism often assisted by a subset of translation initiation factors and various RBPs. IRES-dependent initiation appears to use different strategies to recruit the translation machinery depending on the RNA organization of the region and the network of RBPs interacting with the element. In this review we discuss recent advances in understanding the implications of RBPs on IRES-dependent translation initiation.

  10. Calcium-binding proteins from human platelets

    Energy Technology Data Exchange (ETDEWEB)

    Gogstad, G.O.; Krutnes, M.B.; Solum, N.O.

    1983-06-01

    Calcium-binding platelet proteins were examined by crossed immunoelectrophoresis of solubilized platelets against antibodies to whole platelets followed by incubation of the immunoplates with /sup 45/Ca/sup 2 +/ and autoradiography. When the immunoplates had been pretreated with EDTA at pH 9.0 in order to remove divalent cations, three immunoprecipitates were markedly labelled with /sup 45/Ca/sup 2 +/. These corresponded to the glycoprotein IIb-IIIa complex, glycoprotein Ia and a presently unidentified antigen termed G18. These antigens were membrane-bound and surface-oriented. When an excess of EDTA was introduced in the incubation media the results revealed that the glycoprotein IIb-IIIa complex and antigen G18, but not glycoprotein Ia, contained sites with a stronger affinity for calcium than has EDTA at pH 7.4. Immunoprecipitates of the separate glycoproteins IIb and IIIa both bound calcium in the same manner as the glycoprotein IIb-IIIa complex. As another approach, platelet-rich plasma was incubated with /sup 45/Ca/sup 2 +/ prior to crossed immunoelectrophoresis of the solubilized platelets. A single immunoprecipitate was weakly labelled. This did not correspond to any of the immunoprecipitates which were visible after staining with Coomassie blue. The labelling of this antigen was markedly increased when the platelet-rich plasma had been preincubated with EDTA and in this case a weak labelling of the glycoprotein IIB-IIIa precipitate also became apparent. No increased incorporation of calcium occured in any of these immunoprecipitates when the platelets were aggregated with ADP in the presence of /sup 45/Ca/sup 2 +/.

  11. Characterization of the comparative drug binding to intra- (liver fatty acid binding protein) and extra- (human serum albumin) cellular proteins.

    Science.gov (United States)

    Rowland, Andrew; Hallifax, David; Nussio, Matthew R; Shapter, Joseph G; Mackenzie, Peter I; Brian Houston, J; Knights, Kathleen M; Miners, John O

    2015-01-01

    1. This study compared the extent, affinity, and kinetics of drug binding to human serum albumin (HSA) and liver fatty acid binding protein (LFABP) using ultrafiltration and surface plasmon resonance (SPR). 2. Binding of basic and neutral drugs to both HSA and LFABP was typically negligible. Binding of acidic drugs ranged from minor (fu > 0.8) to extensive (fu transport mechanisms for drugs bound moderately or extensively to HSA and LFABP.

  12. Roles of Copper-Binding Proteins in Breast Cancer.

    Science.gov (United States)

    Blockhuys, Stéphanie; Wittung-Stafshede, Pernilla

    2017-04-20

    Copper ions are needed in several steps of cancer progression. However, the underlying mechanisms, and involved copper-binding proteins, are mainly elusive. Since most copper ions in the body (in and outside cells) are protein-bound, it is important to investigate what copper-binding proteins participate and, for these, how they are loaded with copper by copper transport proteins. Mechanistic information for how some copper-binding proteins, such as extracellular lysyl oxidase (LOX), play roles in cancer have been elucidated but there is still much to learn from a biophysical molecular viewpoint. Here we provide a summary of copper-binding proteins and discuss ones reported to have roles in cancer. We specifically focus on how copper-binding proteins such as mediator of cell motility 1 (MEMO1), LOX, LOX-like proteins, and secreted protein acidic and rich in cysteine (SPARC) modulate breast cancer from molecular and clinical aspects. Because of the importance of copper for invasion/migration processes, which are key components of cancer metastasis, further insights into the actions of copper-binding proteins may provide new targets to combat cancer.

  13. Post-Translational Modifications and RNA-Binding Proteins.

    Science.gov (United States)

    Lovci, Michael T; Bengtson, Mario H; Massirer, Katlin B

    RNA-binding proteins affect cellular metabolic programs through development and in response to cellular stimuli. Though much work has been done to elucidate the roles of a handful of RNA-binding proteins and their effect on RNA metabolism, the progress of studies to understand the effects of post-translational modifications of this class of proteins is far from complete. This chapter summarizes the work that has been done to identify the consequence of post-translational modifications to some RNA-binding proteins. The effects of these modifications have been shown to increase the panoply of functions that a given RNA-binding protein can assume. We will survey the experimental methods that are used to identify the presence of several protein modifications and methods that attempt to discern the consequence of these modifications.

  14. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    Science.gov (United States)

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  15. Further biochemical characterization of Mycobacterium leprae laminin-binding proteins

    Directory of Open Access Journals (Sweden)

    M.A.M. Marques

    2001-04-01

    Full Text Available It has been demonstrated that the alpha2 chain of laminin-2 present on the surface of Schwann cells is involved in the process of attachment of Mycobacterium leprae to these cells. Searching for M. leprae laminin-binding molecules, in a previous study we isolated and characterized the cationic proteins histone-like protein (Hlp and ribosomal proteins S4 and S5 as potential adhesins involved in M. leprae-Schwann cell interaction. Hlp was shown to bind alpha2-laminins and to greatly enhance the attachment of mycobacteria to ST88-14 Schwann cells. In the present study, we investigated the laminin-binding capacity of the ribosomal proteins S4 and S5. The genes coding for these proteins were PCR amplified and their recombinant products were shown to bind alpha2-laminins in overlay assays. However, when tested in ELISA-based assays and in adhesion assays with ST88-14 cells, in contrast to Hlp, S4 and S5 failed to bind laminin and act as adhesins. The laminin-binding property and adhesin capacity of two basic host-derived proteins were also tested, and only histones, but not cytochrome c, were able to increase bacterial attachment to ST88-14 cells. Our data suggest that the alanine/lysine-rich sequences shared by Hlp and eukaryotic H1 histones might be involved in the binding of these cationic proteins to laminin.

  16. Identification of IgE-binding proteins in soy lecithin.

    Science.gov (United States)

    Gu, X; Beardslee, T; Zeece, M; Sarath, G; Markwell, J

    2001-11-01

    Soy lecithin is widely used as an emulsifier in processed foods, pharmaceuticals and cosmetics. Soy lecithin is composed principally of phospholipids; however, it has also been shown to contain IgE-binding proteins, albeit at a low level. A few clinical cases involving allergic reactions to soy lecithin have been reported. The purpose of this investigation is to better characterize the IgE-binding proteins typically found in lecithin. Soy lecithin proteins were isolated following solvent extraction of lipid components and then separated on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The separated lecithin proteins were immunoblotted with sera from soy-sensitive individuals to determine the pattern of IgE-binding proteins. The identity of IgE-reactive bands was determined from their N-terminal sequence. The level of protein in six lecithin samples obtained from commercial suppliers ranged from 100 to 1,400 ppm. Lecithin samples showed similar protein patterns when examined by SDS-PAGE. Immunoblotting with sera from soy-sensitive individuals showed IgE binding to bands corresponding to 7, 12, 20, 39 and 57 kD. N-terminal analysis of these IgE-binding bands resulted in sequences for 3 components. The 12-kD band was identified as a methionine-rich protein (MRP) and a member of the 2S albumin class of soy proteins. The 20-kD band was found to be soybean Kunitz trypsin inhibitor. The 39-kD band was matched to a soy protein with unknown function. Soy lecithin contains a number of IgE-binding proteins; thus, it might represent a source of hidden allergens. These allergens are a more significant concern for soy-allergic individuals consuming lecithin products as a health supplement. In addition, the MRP and the 39-kD protein identified in this study represent newly identified IgE-binding proteins. Copyright 2001 S. Karger AG, Basel

  17. STRUCTURAL CHARACTERIZATION OF THE RNA BINDING DOMAIN OF HUMAN STEM LOOP BINDING PROTEIN

    Directory of Open Access Journals (Sweden)

    Maruthi Kashyap

    2013-12-01

    Full Text Available A gene encoding the RNA binding domain (RBD of human stem loop binding protein (SLBP was cloned in pET 28a vector and over-expressed in E. coli codon plus cells. The over-expressed SLBP-RBD carried no tag and aggregated as inclusion bodies in the cell lysate. Inclusion bodies were semi-purified to >85% purity by establishing a method involving detergent washing and subsequently denatured in 8 M urea. Refolding of the denatured RBD was carried out by step dialysis in decreasing concentrations of urea and L-arginine. Refolded SLBP-RBD was analyzed using size exclusion chromatography that revealed its monomeric nature and folded state. Uniformly 15N and 15N,13C labeled SLBP-RBD was prepared at concentrations for solution NMR studies. Approximately, 60% of the sequence specific backbone resonance assignments have been achieved through standard triple resonance NMR experiments. Analyses of secondary chemical shifts reveal presence of a small helical secondary structural elements and large intrinsically disordered regions.

  18. Sequence and structural features of binding site residues in protein-protein complexes: comparison with protein-nucleic acid complexes

    Directory of Open Access Journals (Sweden)

    Selvaraj S

    2011-10-01

    Full Text Available Abstract Background Protein-protein interactions are important for several cellular processes. Understanding the mechanism of protein-protein recognition and predicting the binding sites in protein-protein complexes are long standing goals in molecular and computational biology. Methods We have developed an energy based approach for identifying the binding site residues in protein–protein complexes. The binding site residues have been analyzed with sequence and structure based parameters such as binding propensity, neighboring residues in the vicinity of binding sites, conservation score and conformational switching. Results We observed that the binding propensities of amino acid residues are specific for protein-protein complexes. Further, typical dipeptides and tripeptides showed high preference for binding, which is unique to protein-protein complexes. Most of the binding site residues are highly conserved among homologous sequences. Our analysis showed that 7% of residues changed their conformations upon protein-protein complex formation and it is 9.2% and 6.6% in the binding and non-binding sites, respectively. Specifically, the residues Glu, Lys, Leu and Ser changed their conformation from coil to helix/strand and from helix to coil/strand. Leu, Ser, Thr and Val prefer to change their conformation from strand to coil/helix. Conclusions The results obtained in this study will be helpful for understanding and predicting the binding sites in protein-protein complexes.

  19. Library of binding protein scaffolds (LibBP): a computational platform for selection of binding protein scaffolds.

    Science.gov (United States)

    Hong, Seungpyo; Kim, Dongsup

    2016-06-01

    Developments in biotechnology have enabled the in vitro evolution of binding proteins. The emerging limitations of antibodies in binding protein engineering have led to suggestions for other proteins as alternative binding protein scaffolds. Most of these proteins were selected based on human intuition rather than systematic analysis of the available data. To improve this strategy, we developed a computational framework for finding desirable binding protein scaffolds by utilizing protein structure and sequence information. For each protein, its structure and the sequences of evolutionarily-related proteins were analyzed, and spatially contiguous regions composed of highly variable residues were identified. A large number of proteins have these regions, but leucine rich repeats (LRRs), histidine kinase domains and immunoglobulin domains are predominant among them. The candidates suggested as new binding protein scaffolds include histidine kinase, LRR, titin and pentapeptide repeat protein. The database and web-service are accessible via http://bcbl.kaist.ac.kr/LibBP CONTACT: kds@kaist.ac.krSupplementary data: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. Guardian of Genetic Messenger-RNA-Binding Proteins

    Directory of Open Access Journals (Sweden)

    Antje Anji

    2016-01-01

    Full Text Available RNA in cells is always associated with RNA-binding proteins that regulate all aspects of RNA metabolism including RNA splicing, export from the nucleus, RNA localization, mRNA turn-over as well as translation. Given their diverse functions, cells express a variety of RNA-binding proteins, which play important roles in the pathologies of a number of diseases. In this review we focus on the effect of alcohol on different RNA-binding proteins and their possible contribution to alcohol-related disorders, and discuss the role of these proteins in the development of neurological diseases and cancer. We further discuss the conventional methods and newer techniques that are employed to identify RNA-binding proteins.

  1. A linear model for transcription factor binding affinity prediction in protein binding microarrays.

    Directory of Open Access Journals (Sweden)

    Matti Annala

    Full Text Available Protein binding microarrays (PBM are a high throughput technology used to characterize protein-DNA binding. The arrays measure a protein's affinity toward thousands of double-stranded DNA sequences at once, producing a comprehensive binding specificity catalog. We present a linear model for predicting the binding affinity of a protein toward DNA sequences based on PBM data. Our model represents the measured intensity of an individual probe as a sum of the binding affinity contributions of the probe's subsequences. These subsequences characterize a DNA binding motif and can be used to predict the intensity of protein binding against arbitrary DNA sequences. Our method was the best performer in the Dialogue for Reverse Engineering Assessments and Methods 5 (DREAM5 transcription factor/DNA motif recognition challenge. For the DREAM5 bonus challenge, we also developed an approach for the identification of transcription factors based on their PBM binding profiles. Our approach for TF identification achieved the best performance in the bonus challenge.

  2. A method to assay penicillin-binding proteins.

    Science.gov (United States)

    Pucci, Michael J; Dougherty, Thomas J

    2008-01-01

    Key enzymes that assemble the bacterial cell wall are also the target of the Beta-lactam class of antibiotics. The covalent binding of labeled penicillin to these proteins has been used in numerous studies in drug discovery, antibiotic mechanisms of action and resistance, and cell wall physiology. Methods to label and measure penicillin binding proteins in two prototypical organisms, a Gram-negative (Escherichia coli) and Gram-positive (Staphylococcus aureus), are described. The methods discussed include identifying penicillin-binding proteins in both intact cells (in vivo measurements) and isolated cell membranes.

  3. New binding mode to TNF-alpha revealed by ubiquitin-based artificial binding protein.

    Directory of Open Access Journals (Sweden)

    Andreas Hoffmann

    Full Text Available A variety of approaches have been employed to generate binding proteins from non-antibody scaffolds. Utilizing a beta-sheet of the human ubiquitin for paratope creation we obtained binding proteins against tumor necrosis factor (TNF-alpha. The bioactive form of this validated pharmacological target protein is a non-covalently linked homo-trimer. This structural feature leads to the observation of a certain heterogeneity concerning the binding mode of TNF-alpha binding molecules, for instance in terms of monomer/trimer specificity. We analyzed a ubiquitin-based TNF-alpha binder, selected by ribosome display, with a particular focus on its mode of interaction. Using enzyme-linked immunosorbent assays, specific binding to TNF-alpha with nanomolar affinity was observed. In isothermal titration calorimetry we obtained comparable results regarding the affinity and detected an exothermic reaction with one ubiquitin-derived binding molecule binding one TNF-alpha trimer. Using NMR spectroscopy and other analytical methods the 1:3 stoichiometry could be confirmed. Detailed binding analysis showed that the interaction is affected by the detergent Tween-20. Previously, this phenomenon was reported only for one other type of alternative scaffold-derived binding proteins--designed ankyrin repeat proteins--without further investigation. As demonstrated by size exclusion chromatography and NMR spectroscopy, the presence of the detergent increases the association rate significantly. Since the special architecture of TNF-alpha is known to be modulated by detergents, the access to the recognized epitope is indicated to be restricted by conformational transitions within the target protein. Our results suggest that the ubiquitin-derived binding protein targets a new epitope on TNF-alpha, which differs from the epitopes recognized by TNF-alpha neutralizing antibodies.

  4. Predicting nucleic acid binding interfaces from structural models of proteins

    Science.gov (United States)

    Dror, Iris; Shazman, Shula; Mukherjee, Srayanta; Zhang, Yang; Glaser, Fabian; Mandel-Gutfreund, Yael

    2011-01-01

    The function of DNA- and RNA-binding proteins can be inferred from the characterization and accurate prediction of their binding interfaces. However the main pitfall of various structure-based methods for predicting nucleic acid binding function is that they are all limited to a relatively small number of proteins for which high-resolution three dimensional structures are available. In this study, we developed a pipeline for extracting functional electrostatic patches from surfaces of protein structural models, obtained using the I-TASSER protein structure predictor. The largest positive patches are extracted from the protein surface using the patchfinder algorithm. We show that functional electrostatic patches extracted from an ensemble of structural models highly overlap the patches extracted from high-resolution structures. Furthermore, by testing our pipeline on a set of 55 known nucleic acid binding proteins for which I-TASSER produces high-quality models, we show that the method accurately identifies the nucleic acids binding interface on structural models of proteins. Employing a combined patch approach we show that patches extracted from an ensemble of models better predicts the real nucleic acid binding interfaces compared to patches extracted from independent models. Overall, these results suggest that combining information from a collection of low-resolution structural models could be a valuable approach for functional annotation. We suggest that our method will be further applicable for predicting other functional surfaces of proteins with unknown structure. PMID:22086767

  5. Predicting nucleic acid binding interfaces from structural models of proteins.

    Science.gov (United States)

    Dror, Iris; Shazman, Shula; Mukherjee, Srayanta; Zhang, Yang; Glaser, Fabian; Mandel-Gutfreund, Yael

    2012-02-01

    The function of DNA- and RNA-binding proteins can be inferred from the characterization and accurate prediction of their binding interfaces. However, the main pitfall of various structure-based methods for predicting nucleic acid binding function is that they are all limited to a relatively small number of proteins for which high-resolution three-dimensional structures are available. In this study, we developed a pipeline for extracting functional electrostatic patches from surfaces of protein structural models, obtained using the I-TASSER protein structure predictor. The largest positive patches are extracted from the protein surface using the patchfinder algorithm. We show that functional electrostatic patches extracted from an ensemble of structural models highly overlap the patches extracted from high-resolution structures. Furthermore, by testing our pipeline on a set of 55 known nucleic acid binding proteins for which I-TASSER produces high-quality models, we show that the method accurately identifies the nucleic acids binding interface on structural models of proteins. Employing a combined patch approach we show that patches extracted from an ensemble of models better predicts the real nucleic acid binding interfaces compared with patches extracted from independent models. Overall, these results suggest that combining information from a collection of low-resolution structural models could be a valuable approach for functional annotation. We suggest that our method will be further applicable for predicting other functional surfaces of proteins with unknown structure. Copyright © 2011 Wiley Periodicals, Inc.

  6. Thioredoxin binding protein (TBP)-2/Txnip and α-arrestin proteins in cancer and diabetes mellitus

    Science.gov (United States)

    Masutani, Hiroshi; Yoshihara, Eiji; Masaki, So; Chen, Zhe; Yodoi, Junji

    2012-01-01

    Thioredoxin binding protein −2/ thioredoxin interacting protein is an α-arrestin protein that has attracted much attention as a multifunctional regulator. Thioredoxin binding protein −2 expression is downregulated in tumor cells and the level of thioredoxin binding protein is correlated with clinical stage of cancer. Mice with mutations or knockout of the thioredoxin binding protein −2 gene are much more susceptible to carcinogenesis than wild-type mice, indicating a role for thioredoxin binding protein −2 in cancer suppression. Studies have also revealed roles for thioredoxin binding protein −2 in metabolic control. Enhancement of thioredoxin binding protein −2 expression causes impairment of insulin sensitivity and glucose-induced insulin secretion, and β-cell apoptosis. These changes are important characteristics of type 2 diabetes mellitus. Thioredoxin binding protein −2 regulates transcription of metabolic regulating genes. Thioredoxin binding protein −2-like inducible membrane protein/ arrestin domain containing 3 regulates endocytosis of receptors such as the β2-adrenergic receptor. The α-arrestin family possesses PPXY motifs and may function as an adaptor/scaffold for NEDD family ubiquitin ligases. Elucidation of the molecular mechanisms of α-arrestin proteins would provide a new pharmacological basis for developing approaches against cancer and type 2 diabetes mellitus. PMID:22247597

  7. Analysis of the ligand binding properties of recombinant bovine liver-type fatty acid binding protein

    DEFF Research Database (Denmark)

    Rolf, B; Oudenampsen-Krüger, E; Börchers, T

    1995-01-01

    The coding part of the cDNA for bovine liver-type fatty acid binding protein (L-FABP) has been amplified by RT-PCR, cloned and used for the construction of an Escherichia coli (E. coli) expression system. The recombinant protein made up to 25% of the soluble E. coli proteins and could be isolated...

  8. Nature and function of insulator protein binding sites in the Drosophila genome.

    Science.gov (United States)

    Schwartz, Yuri B; Linder-Basso, Daniela; Kharchenko, Peter V; Tolstorukov, Michael Y; Kim, Maria; Li, Hua-Bing; Gorchakov, Andrey A; Minoda, Aki; Shanower, Gregory; Alekseyenko, Artyom A; Riddle, Nicole C; Jung, Youngsook L; Gu, Tingting; Plachetka, Annette; Elgin, Sarah C R; Kuroda, Mitzi I; Park, Peter J; Savitsky, Mikhail; Karpen, Gary H; Pirrotta, Vincenzo

    2012-11-01

    Chromatin insulator elements and associated proteins have been proposed to partition eukaryotic genomes into sets of independently regulated domains. Here we test this hypothesis by quantitative genome-wide analysis of insulator protein binding to Drosophila chromatin. We find distinct combinatorial binding of insulator proteins to different classes of sites and uncover a novel type of insulator element that binds CP190 but not any other known insulator proteins. Functional characterization of different classes of binding sites indicates that only a small fraction act as robust insulators in standard enhancer-blocking assays. We show that insulators restrict the spreading of the H3K27me3 mark but only at a small number of Polycomb target regions and only to prevent repressive histone methylation within adjacent genes that are already transcriptionally inactive. RNAi knockdown of insulator proteins in cultured cells does not lead to major alterations in genome expression. Taken together, these observations argue against the concept of a genome partitioned by specialized boundary elements and suggest that insulators are reserved for specific regulation of selected genes.

  9. Nature and function of insulator protein binding sites in the Drosophila genome

    Science.gov (United States)

    Schwartz, Yuri B.; Linder-Basso, Daniela; Kharchenko, Peter V.; Tolstorukov, Michael Y.; Kim, Maria; Li, Hua-Bing; Gorchakov, Andrey A.; Minoda, Aki; Shanower, Gregory; Alekseyenko, Artyom A.; Riddle, Nicole C.; Jung, Youngsook L.; Gu, Tingting; Plachetka, Annette; Elgin, Sarah C.R.; Kuroda, Mitzi I.; Park, Peter J.; Savitsky, Mikhail; Karpen, Gary H.; Pirrotta, Vincenzo

    2012-01-01

    Chromatin insulator elements and associated proteins have been proposed to partition eukaryotic genomes into sets of independently regulated domains. Here we test this hypothesis by quantitative genome-wide analysis of insulator protein binding to Drosophila chromatin. We find distinct combinatorial binding of insulator proteins to different classes of sites and uncover a novel type of insulator element that binds CP190 but not any other known insulator proteins. Functional characterization of different classes of binding sites indicates that only a small fraction act as robust insulators in standard enhancer-blocking assays. We show that insulators restrict the spreading of the H3K27me3 mark but only at a small number of Polycomb target regions and only to prevent repressive histone methylation within adjacent genes that are already transcriptionally inactive. RNAi knockdown of insulator proteins in cultured cells does not lead to major alterations in genome expression. Taken together, these observations argue against the concept of a genome partitioned by specialized boundary elements and suggest that insulators are reserved for specific regulation of selected genes. PMID:22767387

  10. The Art of Compiling Protein Binding Site Ensembles.

    Science.gov (United States)

    Bietz, Stefan; Fährrolfes, Rainer; Rarey, Matthias

    2016-12-01

    Structure-based drug design starts with the collection, preparation, and initial analysis of protein structures. With more than 115,000 structures publically available in the Protein Data Bank (PDB), fully automated processes reliably performing these important preprocessing steps are needed. Several tools are available for these tasks, however, most of them do not address the special needs of scientists interested in protein-ligand interactions. In this paper, we summarize our research activities towards an automated processing pipeline from raw PDB data towards ready-to-use protein binding site ensembles. Starting from a single protein structure, the pipeline covers the following phases: Extracting structurally related binding sites from the PDB, aligning disconnected binding site sequences, resolving tautomeric forms and protonation, orienting hydrogens and flippable side-chains, structurally aligning the multitude of binding sites, and performing a reasonable reduction of ensemble structures. The pipeline, named SIENA, creates protein-structural ensembles for the analysis of protein flexibility, molecular design efforts like docking or de novo design within seconds. For the first time, we are able to process the whole PDB in order to create a large collection of protein binding site ensembles. SIENA is available as part of the ZBH ProteinsPlus webserver under http://proteinsplus.zbh.uni-hamburg.de. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Pleiotropic virulence factor - Streptococcus pyogenes fibronectin-binding proteins.

    Science.gov (United States)

    Yamaguchi, Masaya; Terao, Yutaka; Kawabata, Shigetada

    2013-04-01

    Streptococcus pyogenes causes a broad spectrum of infectious diseases, including pharyngitis, skin infections and invasive necrotizing fasciitis. The initial phase of infection involves colonization, followed by intimate contact with the host cells, thus promoting bacterial uptake by them. S. pyogenes recognizes fibronectin (Fn) through its own Fn-binding proteins to obtain access to epithelial and endothelial cells in host tissue. Fn-binding proteins bind to Fn to form a bridge to α5 β1 -integrins, which leads to rearrangement of cytoskeletal actin in host cells and uptake of invading S. pyogenes. Recently, several structural analyses of the invasion mechanism showed molecular interactions by which Fn converts from a compact plasma protein to a fibrillar component of the extracellular matrix. After colonization, S. pyogenes must evade the host innate immune system to spread into blood vessels and deeper organs. Some Fn-binding proteins contribute to evasion of host innate immunity, such as the complement system and phagocytosis. In addition, Fn-binding proteins have received focus as non-M protein vaccine candidates, because of their localization and conservation among different M serotypes.Here, we review the roles of Fn-binding proteins in the pathogenesis and speculate regarding possible vaccine antigen candidates. © 2012 Blackwell Publishing Ltd.

  12. De-novo protein function prediction using DNA binding and RNA binding proteins as a test case.

    Science.gov (United States)

    Peled, Sapir; Leiderman, Olga; Charar, Rotem; Efroni, Gilat; Shav-Tal, Yaron; Ofran, Yanay

    2016-11-21

    Of the currently identified protein sequences, 99.6% have never been observed in the laboratory as proteins and their molecular function has not been established experimentally. Predicting the function of such proteins relies mostly on annotated homologs. However, this has resulted in some erroneous annotations, and many proteins have no annotated homologs. Here we propose a de-novo function prediction approach based on identifying biophysical features that underlie function. Using our approach, we discover DNA and RNA binding proteins that cannot be identified based on homology and validate these predictions experimentally. For example, FGF14, which belongs to a family of secreted growth factors was predicted to bind DNA. We verify this experimentally and also show that FGF14 is localized to the nucleus. Mutating the predicted binding site on FGF14 abrogated DNA binding. These results demonstrate the feasibility of automated de-novo function prediction based on identifying function-related biophysical features.

  13. The interaction of membrane DNA-binding protein with DNA

    Science.gov (United States)

    Gabrielyan, A. G.; Arakhelyan, H. H.; Zakharyan, R. A.

    1994-07-01

    A 31-kDa protein specifically binding to double-stranded DNA (ds-DNA) was isolated from plasmatic membranes of rat liver cells by means of affinity chromatography and high performance liquid chromatography (HPLC). Some of the properties of this protein were determined. Judging by the UV and circular dichroism spectroscopic data, the protein forms a complex with DNA, stabilizing its native structure, mainly in the regions rich in AT pairs. The 31-kDa protein-pAO3 plasmid DNA binding constant was determined by nitrocellulose filter analysis of protein labelled DNA complexes. The results obtained correspond to cooperative binding with DNA molecules of extended interacting ligands, having AT specificity. A possible role of the 31-kDa protein in DNA transmembrane transition processes is discussed.

  14. The interrelationship between ligand binding and self-association of the folate binding protein

    DEFF Research Database (Denmark)

    Holm, Jan; Schou, Christian; Babol, Linnea N.

    2011-01-01

    The folate binding protein (FBP) regulates homeostasis and intracellular trafficking of folic acid, a vitamin of decisive importance in cell division and growth. We analyzed whether interrelationship between ligand binding and self-association of FBP plays a significant role in the physiology...

  15. RNA-binding specificity of Y-box protein 1.

    Science.gov (United States)

    Dong, Jinjiang; Akcakanat, Argun; Stivers, David N; Zhang, Jiexin; Kim, Doyil; Meric-Bernstam, Funda

    2009-01-01

    Y-box protein 1 (YB-1) is a multifunctional DNA/RNA-binding protein that regulates transcription and translation. The specificity of YB-1's RNA binding and its consequences are unknown. Because expression and subcellular localization of YB-1 have been reported to be important in breast cancer, we determined the specificity and functional impact of YB-1 mRNA-binding in MCF7 breast cancer cells. We used YB-1 antibodies to immunoprecipitate YB-1 and microarray profiling to compare YB-1-bound and total poly(A) RNA. We demonstrated that YB-1 mRNA-binding was preferential. Transcript sequences significantly associated with this binding had high GC content. Selected YB-1 mRNA-binding targets were confirmed by QRT-PCR. However, downregulation of YB-1 levels by siRNA did not affect their RNA or protein expression. Thus, YB-1 has RNA-binding specificity; however, YB-1 binding does not necessarily regulate the stability or translation of its mRNA targets. Further study is needed to determine the functional consequences of selective YB-1 mRNA binding.

  16. Proteomic analysis of heparin-binding proteins from human seminal ...

    Indian Academy of Sciences (India)

    Heparin-binding proteins (HBPs) are essential constituents of human seminal fluid, which bind to sperm lipids containing the phosphorylcholine group and mediate the fertilization process. We utilized a proteomic set-up consisting of affinity chromatography, isoelectric focusing (IEF) coupled with matrix-assisted laser ...

  17. Polymorphic AP-1 binding site in bovine CSN1S1 shows quantitative differences in protein binding associated with milk protein expression.

    Science.gov (United States)

    Kuss, A W; Gogol, J; Bartenschlager, H; Geldermann, H

    2005-06-01

    Polymorphisms in 5'-flanking regions of milk protein encoding genes can influence the binding activity of the affected response elements and thus have an impact on the expression of the gene products. However, precise quantitative data concerning the binding properties of such variable response elements have so far not been described. In this study we present the results of a quantitative fluorescent electromobility shift assay comparing the allelic variants of a polymorphic activator protein-1 binding site in the promoter region of the bovine alphas1-casein encoding gene (CSN1S1), which is affected by an A-->G exchange at -175 bp (CSN1S1(-175bp)). A supershift assay using a commercial c-jun antibody was carried out to verify the specificity of protein binding. The gel shift analysis revealed specific and significantly reduced protein binding of oligonucleotides containing the G variant of the CSN1S1(-175bp) binding site. Further investigations comprised genotyping of the variable CSN1S1(-175bp) activator protein-1 element by an NmuCl restriction fragment length polymorphism in 62 cows of the breed Simmental and 80 cows of the breed German Holstein. Single milk proteins from at least 4 milk samples per cow were quantified by alkaline urea polyacrylamide gel electrophoresis. Homozygotes for CSN1S1(-175bp)*G were not observed, and the allele frequencies were 0.19 in Simmental and 0.05 in German Holstein. Carriers of CSN1S1(-175bp)*G showed higher content (%) as well as quantity (g/d) of alphas1-casein than CSN1S1(-175bp)*A homozygotes, independent of breed. We assume that the positive association of the CSN1S1(-175bp)*G variant with CSN1S1 expression is likely to be caused by a reduced affinity of the affected response element to a c-jun-containing CSN1S1 dimer with repressor properties.

  18. Synergistic inhibition of the intrinsic factor X activation by protein S and C4b-binding protein

    NARCIS (Netherlands)

    Koppelman, S.J.

    1995-01-01

    The complement protein C4b-binding protein plays an important role in the regulation of the protein C anticoagulant pathway. C4b-binding protein can bind to protein S, thereby inhibiting the cofactor activity of protein S for activated protein C. In this report, we describe a new role for

  19. Identification of Putative Vero Cell Protein(s) that Bind Specifically to ...

    African Journals Online (AJOL)

    Results: The 45 KDa, 43 KDa and 30 KDa plasma membrane proteins were identified as viral envelope targets. Competitive binding assay showed these proteins competing with dengue virus binding. MTT assay indicate that viability of vero cells increases in cultures pretreated with 45 KDa, 43 KDa and 30 KDa proteins ...

  20. How to use not-always-reliable binding site information in protein-protein docking prediction.

    Science.gov (United States)

    Li, Lin; Huang, Yanzhao; Xiao, Yi

    2013-01-01

    In many protein-protein docking algorithms, binding site information is used to help predicting the protein complex structures. Using correct and accurate binding site information can increase protein-protein docking success rate significantly. On the other hand, using wrong binding sites information should lead to a failed prediction, or, at least decrease the success rate. Recently, various successful theoretical methods have been proposed to predict the binding sites of proteins. However, the predicted binding site information is not always reliable, sometimes wrong binding site information could be given. Hence there is a high risk to use the predicted binding site information in current docking algorithms. In this paper, a softly restricting method (SRM) is developed to solve this problem. By utilizing predicted binding site information in a proper way, the SRM algorithm is sensitive to the correct binding site information but insensitive to wrong information, which decreases the risk of using predicted binding site information. This SRM is tested on benchmark 3.0 using purely predicted binding site information. The result shows that when the predicted information is correct, SRM increases the success rate significantly; however, even if the predicted information is completely wrong, SRM only decreases success rate slightly, which indicates that the SRM is suitable for utilizing predicted binding site information.

  1. Fe-nitrilotriacetic acid--binding proteins associated with rat liver plasma membranes.

    Science.gov (United States)

    Barisani, D; Wessling-Resnick, M

    1996-10-01

    The uptake of nontransferrin-bound iron by hepatocytes is known to occur and may contribute to the deposition of iron and resulting injury during hemochromatosis. To examine the proteins that may function in the transport of nontransferrin-bound iron, the properties of FeNTA-binding to rat liver basolateral plasma membranes were characterized. The binding of 55FeNTA to purified liver basolateral plasma membranes was measured using a simple centrifugation assay. The binding activity could be solubilized with 0.1% octylglucoside; apparent molecular weight Mapp approximately 210 kd for the binding complex was determined by gel filtration chromatography. Immobilized metal affinity chromatography was used to further purify binding protein(s) from rat liver plasma membranes and at least six polypeptides were identified by silver staining. If associated in a stoichiometric complex, the molecular mass of these proteins would predict a size of approximately 227 kd in fairly close agreement with the gel filtration experiments. The characterization of FeNTA-binding proteins associated with basolateral membranes is the first step towards understanding elements responsible for the uptake of nontransferrin-bound iron by the liver.

  2. Anchored clathrate waters bind antifreeze proteins to ice

    OpenAIRE

    Garnham, Christopher P; Campbell, Robert L.; Davies, Peter L.

    2011-01-01

    The mechanism by which antifreeze proteins (AFPs) irreversibly bind to ice has not yet been resolved. The ice-binding site of an AFP is relatively hydrophobic, but also contains many potential hydrogen bond donors/acceptors. The extent to which hydrogen bonding and the hydrophobic effect contribute to ice binding has been debated for over 30 years. Here we have elucidated the ice-binding mechanism through solving the first crystal structure of an Antarctic bacterial AFP. This 34-kDa domain, t...

  3. Water-binding of protein particles

    NARCIS (Netherlands)

    Peters, J.P.C.M.

    2016-01-01

    As overweight and obesity become more prevalent in society, the demand for food products that can help maintain body weight increases. One way to make such products is by decreasing the protein and fat content through increasing the water content. This thesis describes the potential of protein

  4. Engineering a periplasmic binding protein for amino acid sensors with improved binding properties.

    Science.gov (United States)

    Ko, Wooseok; Kim, Sanggil; Lee, Hyun Soo

    2017-10-25

    Periplasmic binding proteins (PBPs) are members of a widely distributed protein superfamily found in bacteria and archaea, and are involved in the cellular uptake of solutes. In this report, a leucine-binding PBP was engineered to detect l-Leu based on a fluorescence resonance energy transfer (FRET) change upon ligand binding. A fluorescent unnatural amino acid, l-(7-hydroxycoumarin-4-yl)ethylglycine (CouA), was genetically incorporated into the protein as a FRET donor, and a yellow fluorescent protein (YFP) was fused with its N-terminus as a FRET acceptor. When CouA was incorporated into position 178, the sensor protein showed a 2.5-fold increase in the FRET ratio. Protein engineering significantly improved its substrate specificity, showing minimal changes in the FRET ratio with the other 19 natural amino acids and d-Leu. Further modification increased the sensitivity of the sensor protein (14-fold) towards l-Leu, and it recognized l-Met as well with moderate binding affinity. Selected mutant sensors were used to measure concentrations of l-Leu in a biological sample (fetal bovine serum) and to determine the optical purity of Leu and Met. This FRET-based sensor design strategy allowed us to easily manipulate the natural receptor to improve its binding affinity and specificity and to recognize other natural molecules, which are not recognized by the wild-type receptor. The design strategy can be applied to other natural receptors, enabling engineering receptors that sense biochemically interesting molecules.

  5. Quantitative analysis of pheromone-binding protein specificity.

    Science.gov (United States)

    Katti, S; Lokhande, N; González, D; Cassill, A; Renthal, R

    2013-02-01

    Many pheromones have very low water solubility, posing experimental difficulties for quantitative binding measurements. A new method is presented for determining thermodynamically valid dissociation constants for ligands binding to pheromone-binding proteins, using β-cyclodextrin as a solubilizer and transfer agent. The method is applied to LUSH, a Drosophila odorant-binding protein that binds the pheromone 11-cis vaccenyl acetate (cVA). Refolding of LUSH expressed in Escherichia coli was assessed by measuring N-phenyl-1-naphthylamine (NPN) binding and Förster resonance energy transfer between LUSH tryptophan 123 (W123) and NPN. Binding of cVA was measured from quenching of W123 fluorescence as a function of cVA concentration. The equilibrium constant for transfer of cVA between β-cyclodextrin and LUSH was determined from a linked equilibria model. This constant, multiplied by the β-cyclodextrin-cVA dissociation constant, gives the LUSH-cVA dissociation constant: ∼100 nM. It was also found that other ligands quench W123 fluorescence. The LUSH-ligand dissociation constants were determined to be ∼200 nM for the silk moth pheromone bombykol and ∼90 nM for methyl oleate. The results indicate that the ligand-binding cavity of LUSH can accommodate a variety ligands with strong binding interactions. Implications of this for the Laughlin, Ha, Jones and Smith model of pheromone reception are discussed. © 2012 Royal Entomological Society.

  6. Metal-binding proteins as metal pollution indicators

    Energy Technology Data Exchange (ETDEWEB)

    Hennig, H.F.

    1986-03-01

    The fact that metal-binding proteins are a consequence of elevated metal concentration in organisms is well known. What has been overlooked is that the presence of these proteins provides a unique opportunity to reformulate the criteria of metal pollution. The detoxification effect of metal-binding proteins in animals from polluted areas has been cited, but there have been only very few studies relating metal-binding proteins to pollution. This lack is due partly to the design of most experiments, which were aimed at isolation of metal-binding proteins and hence were of too short duration to allow for correlation to adverse physiological effects on the organism. In this study metal-binding proteins were isolated and characterized from five different marine animals (rock lobster, Jasus lalandii; hermit crab, Diogenes brevirostris; sandshrimp, Palaemon pacificus; black mussel, Choromytilus meridionalis; and limpet, Patella granularis). These animals were kept under identical metal-enriched conditions, hence eliminating differences in method and seasons. The study animals belonged to different phyla; varied in size, mass, age, behavior, food requirements and life stages; and accumulated metals at different rates. It is possible to link unseasonal moulting in crustacea, a known physiological effect due to a metal-enriched environment, to the production of the metal-binding protein without evidence of obvious metal body burden. Thus a new concept of pollution is defined: the presence of metal-binding proteins confirms toxic metal pollution. This concept was then tested under field conditions in the whelk Bullia digitalis and in metal-enriched grass.

  7. Plasmodium falciparum normocyte binding protein (PfNBP-1) peptides bind specifically to human erythrocytes.

    Science.gov (United States)

    Valbuena, John Jairo; Vera, Ricardo; García, Javier; Puentes, Alvaro; Curtidor, Hernando; Ocampo, Marisol; Urquiza, Mauricio; Rivera, Zuly; Guzmán, Fanny; Torres, Elizabeth; Patarroyo, Manuel Elkin

    2003-07-01

    Plasmodium falciparum normocyte binding protein-1 (PfNBP-1), a Plasmodium vivax RBP-1 orthologue is expressed in the apical merozoite area. PfNBP-1 binds directly to human erythrocyte membrane in a sialic acid-dependent but trypsin-resistant way. Erythrocyte binding assays were done with synthetic peptides covering the sequence reported as PfNBP-1. Two specific erythrocyte high activity binding peptides were found: 101VFINDLDTYQYEYFYEWNQ(120), peptide 26332, and 181NTKETYLKELNKKKMLQNKK(200), peptide 26336. These two peptides' binding was saturable and presenting nanomolar affinity constants. The critical binding residues (those residues underlined and highlighted in bold) were determined by competition assays with glycine-scan analogue peptides. These peptides were able to block merozoite in vitro invasion of erythrocytes.

  8. Biochemical identification of new proteins involved in splicing repression at the Drosophila P-element exonic splicing silencer

    Science.gov (United States)

    Horan, Lucas; Yasuhara, Jiro C.; Kohlstaedt, Lori A.; Rio, Donald C.

    2015-01-01

    Splicing of the Drosophila P-element third intron (IVS3) is repressed in somatic tissues due to the function of an exonic splicing silencer (ESS) complex present on the 5′ exon RNA. To comprehensively characterize the mechanisms of this alternative splicing regulation, we used biochemical fractionation and affinity purification to isolate the silencer complex assembled in vitro and identify the constituent proteins by mass spectrometry. Functional assays using splicing reporter minigenes identified the proteins hrp36 and hrp38 and the cytoplasmic poly(A)-binding protein PABPC1 as novel functional components of the splicing silencer. hrp48, PSI, and PABPC1 have high-affinity RNA-binding sites on the P-element IVS3 5′ exon, whereas hrp36 and hrp38 proteins bind with low affinity to the P-element silencer RNA. RNA pull-down and immobilized protein assays showed that hrp48 protein binding to the silencer RNA can recruit hrp36 and hrp38. These studies identified additional components that function at the P-element ESS and indicated that proteins with low-affinity RNA-binding sites can be recruited in a functional manner through interactions with a protein bound to RNA at a high-affinity binding site. These studies have implications for the role of heterogeneous nuclear ribonucleoproteins (hnRNPs) in the control of alternative splicing at cis-acting regulatory sites. PMID:26545814

  9. Zeatin-binding proteins in barley leaves

    Energy Technology Data Exchange (ETDEWEB)

    Romanov, G.A.; Kulaeva, O.N.; Taryan, V.Y.

    1986-01-01

    Highly labelled tritium-zeatin was used in the work to clarify for the first time a protein factor that is present in cytokinin-sensitive vegetative organs of plants (barley leaves) and which possesses the properties of a cytokinin receptor. Aliquots of tritium-zeatin were mixed with a solution of protein and incubated for several hours in buffer. Following incubation, protein was precipitated by ammonium sulfate at 90% of saturation, and radioactivity of the precipitate was checked in a dioxane scintillator with an efficiency of about 35%. It is shown that the characteristics of interaction of the clarified specific protein sites with cytokinins in regard to a number of criteria correspond to the characteristics expected of receptors of these phytohormones.

  10. Relating the shape of protein binding sites to binding affinity profiles: is there an association?

    Directory of Open Access Journals (Sweden)

    Bitter István

    2010-10-01

    Full Text Available Abstract Background Various pattern-based methods exist that use in vitro or in silico affinity profiles for classification and functional examination of proteins. Nevertheless, the connection between the protein affinity profiles and the structural characteristics of the binding sites is still unclear. Our aim was to investigate the association between virtual drug screening results (calculated binding free energy values and the geometry of protein binding sites. Molecular Affinity Fingerprints (MAFs were determined for 154 proteins based on their molecular docking energy results for 1,255 FDA-approved drugs. Protein binding site geometries were characterized by 420 PocketPicker descriptors. The basic underlying component structure of MAFs and binding site geometries, respectively, were examined by principal component analysis; association between principal components extracted from these two sets of variables was then investigated by canonical correlation and redundancy analyses. Results PCA analysis of the MAF variables provided 30 factors which explained 71.4% of the total variance of the energy values while 13 factors were obtained from the PocketPicker descriptors which cumulatively explained 94.1% of the total variance. Canonical correlation analysis resulted in 3 statistically significant canonical factor pairs with correlation values of 0.87, 0.84 and 0.77, respectively. Redundancy analysis indicated that PocketPicker descriptor factors explain 6.9% of the variance of the MAF factor set while MAF factors explain 15.9% of the total variance of PocketPicker descriptor factors. Based on the salient structures of the factor pairs, we identified a clear-cut association between the shape and bulkiness of the drug molecules and the protein binding site descriptors. Conclusions This is the first study to investigate complex multivariate associations between affinity profiles and the geometric properties of protein binding sites. We found that

  11. Evolutionary history of selenocysteine incorporation from the perspective of SECIS binding proteins

    Directory of Open Access Journals (Sweden)

    Copeland Paul R

    2009-09-01

    Full Text Available Abstract Background The co-translational incorporation of selenocysteine into nascent polypeptides by recoding the UGA stop codon occurs in all domains of life. In eukaryotes, this event requires at least three specific factors: SECIS binding protein 2 (SBP2, a specific translation elongation factor (eEFSec, selenocysteinyl tRNA, and a cis-acting selenocysteine insertion sequence (SECIS element in selenoprotein mRNAs. While the phylogenetic relationships of selenoprotein families and the evolution of selenocysteine usage are well documented, the evolutionary history of SECIS binding proteins has not been explored. Results In this report we present a phylogeny of the eukaryotic SECIS binding protein family which includes SBP2 and a related protein we herein term SBP2L. Here we show that SBP2L is an SBP2 paralogue in vertebrates and is the only form of SECIS binding protein in invertebrate deuterostomes, suggesting a key role in Sec incorporation in these organisms, but an SBP2/SBP2L fusion protein is unable to support Sec incorporation in vitro. An in-depth phylogenetic analysis of the conserved L7Ae RNA binding domain suggests an ancestral relationship with ribosomal protein L30. In addition, we describe the emergence of a motif upstream of the SBP2 RNA binding domain that shares significant similarity with a motif within the pseudouridine synthase Cbf5. Conclusion Our analysis suggests that SECIS binding proteins arose once in evolution but diverged significantly in multiple lineages. In addition, likely due to a gene duplication event in the early vertebrate lineage, SBP2 and SBP2L are paralogous in vertebrates.

  12. Solid-binding Proteins for Modification of Inorganic Substrates

    Science.gov (United States)

    Coyle, Brandon Laurence

    Robust and simple strategies to directly functionalize graphene- and diamond-based nanostructures with proteins are of considerable interest for biologically driven manufacturing, biosensing and bioimaging. In this work, we identify a new set of carbon binding peptides that vary in overall hydrophobicity and charge, and engineer two of these sequences (Car9 and Car15) within the framework of various proteins to exploit their binding ability. In addition, we conducted a detailed analysis of the mechanisms that underpin the interaction of the fusion proteins with carbon and silicon surfaces. Through these insights, we were able to develop proteins suitable for dispersing graphene flakes and carbon nanotubes in aqueous solutions, while retaining protein activity. Additionally, our investigation into the mechanisms of adhesion for our carbon binding peptides inspired a cheap, disposable protein purification system that is more than 10x cheaper than commonly used His-tag protein purification. Our results emphasize the importance of understanding both bulk and molecular recognition events when exploiting the adhesive properties of solid-binding peptides and proteins in technological applications.

  13. Prediction of DNA-binding specificity in zinc finger proteins

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... Zinc finger proteins interact via their individual fingers to three base pair subsites on the target DNA. The four key ... [Roy S, Dutta S, Khanna K, Singla S and Sundar D 2012 Prediction of DNA-binding specificity in zinc finger proteins. J. Biosci. .... well as protection from HIV infection (Reynolds, et al. 2003).

  14. Myosin Binding Protein C Interaction with Actin: CHARACTERIZATION AND MAPPING OF THE BINDING SITE*

    OpenAIRE

    Rybakova, Inna N.; Greaser, Marion L.; Moss, Richard L.

    2010-01-01

    Myosin binding protein C (MyBPC) is a multidomain protein associated with the thick filaments of striated muscle. Although both structural and regulatory roles have been proposed for MyBPC, its interactions with other sarcomeric proteins remain obscure. The current study was designed to examine the actin-binding properties of MyBPC and to define MyBPC domain regions involved in actin interaction. Here, we have expressed full-length mouse cardiac MyBPC (cMyBPC) in a baculovirus system and show...

  15. Sequence analysis of cytoplasmic mRNA-binding proteins of Xenopus oocytes identifies a family of RNA-binding proteins.

    Science.gov (United States)

    Murray, M T; Schiller, D L; Franke, W W

    1992-01-01

    Storage of maternal mRNAs as nontranslated ribonucleoprotein (RNP) complexes is an adaptive strategy in various vertebrate and invertebrate oocytes, for rapid translational recruitment during embryonic development. Previously, we showed that Xenopus laevis oocytes have a soluble cytoplasmic pool of mRNA-binding proteins and particles competent for messenger RNP assembly in vitro. Here we report the isolation of cDNAs for the most abundant messenger RNPs, the 54- and 56-kDa polypeptide (p54/p56) components of the approximately 6S mRNA-binding particle, from an ovarian expression library. The nucleotide sequence of p56 cDNA is almost identical to that recently reported for the putative Xenopus transcription factor FRG Y2. p54 and p56 are highly homologous and are smaller than expected by SDS/PAGE (36 kDa and 37 kDa) due to anomalous electrophoretic mobility. They lack the "RNP consensus motif" but contain four arginine-rich "basic/aromatic islands" that are similar to the RNA-binding domain of bacteriophage mRNA antiterminator proteins and of tat protein of human immunodeficiency virus. The basic/aromatic regions and a second conspicuous 100-amino acid "domain C" of p54 and p56 are conserved in the following DNA-binding proteins: human proteins dpbA, dpbB, and YB-1, rat protein EFIA, and Xenopus protein FRG Y1, all reported to bind to DNA; domain C is homologous to the major Escherichia coli cold-stress-response protein reportedly involved in translational control. Antibodies raised against a peptide of domain C have identified similar proteins in Xenopus somatic cells and in some mammalian cells and tissues. We conclude that p54 and p56 define a family of RNA-binding proteins, at least some of which may be involved in translational regulation.

  16. A finite element model for protein transport in vivo

    Directory of Open Access Journals (Sweden)

    Montas Hubert J

    2007-06-01

    Full Text Available Abstract Background Biological mass transport processes determine the behavior and function of cells, regulate interactions between synthetic agents and recipient targets, and are key elements in the design and use of biosensors. Accurately predicting the outcomes of such processes is crucial to both enhancing our understanding of how these systems function, enabling the design of effective strategies to control their function, and verifying that engineered solutions perform according to plan. Methods A Galerkin-based finite element model was developed and implemented to solve a system of two coupled partial differential equations governing biomolecule transport and reaction in live cells. The simulator was coupled, in the framework of an inverse modeling strategy, with an optimization algorithm and an experimental time series, obtained by the Fluorescence Recovery after Photobleaching (FRAP technique, to estimate biomolecule mass transport and reaction rate parameters. In the inverse algorithm, an adaptive method was implemented to calculate sensitivity matrix. A multi-criteria termination rule was developed to stop the inverse code at the solution. The applicability of the model was illustrated by simulating the mobility and binding of GFP-tagged glucocorticoid receptor in the nucleoplasm of mouse adenocarcinoma. Results The numerical simulator shows excellent agreement with the analytic solutions and experimental FRAP data. Detailed residual analysis indicates that residuals have zero mean and constant variance and are normally distributed and uncorrelated. Therefore, the necessary and sufficient criteria for least square parameter optimization, which was used in this study, were met. Conclusion The developed strategy is an efficient approach to extract as much physiochemical information from the FRAP protocol as possible. Well-posedness analysis of the inverse problem, however, indicates that the FRAP protocol provides insufficient

  17. Building an automated classification of DNA-binding protein domains.

    Science.gov (United States)

    Ponomarenko, Julia V; Bourne, Philip E; Shindyalov, Ilya N

    2002-01-01

    Intensive growth in 3D structure data on DNA-protein complexes as reflected in the Protein Data Bank (PDB) demands new approaches to the annotation and characterization of these data and will lead to a new understanding of critical biological processes involving these data. These data and those from other protein structure classifications will become increasingly important for the modeling of complete proteomes. We propose a fully automated classification of DNA-binding protein domains based on existing 3D-structures from the PDB. The classification, by domain, relies on the Protein Domain Parser (PDP) and the Combinatorial Extension (CE) algorithm for structural alignment. The approach involves the analysis of 3D-interaction patterns in DNA-protein interfaces, assignment of structural domains interacting with DNA, clustering of domains based on structural similarity and DNA-interacting patterns. Comparison with existing resources on describing structural and functional classifications of DNA-binding proteins was used to validate and improve the approach proposed here. In the course of our study we defined a set of criteria and heuristics allowing us to automatically build a biologically meaningful classification and define classes of functionally related protein domains. It was shown that taking into consideration interactions between protein domains and DNA considerably improves the classification accuracy. Our approach provides a high-throughput and up-to-date annotation of DNA-binding protein families which can be found at http://spdc.sdsc.edu.

  18. Ubiquitin-binding proteins: similar, but different

    DEFF Research Database (Denmark)

    Andersen, Katrine M; Hofmann, Kay; Hartmann-Petersen, Rasmus

    2005-01-01

    described. UBA (ubiquitin-associated) domain-containing proteins is the largest family and includes members involved in different cell processes. The smaller groups of UIM (ubiquitin-interacting motif), GAT [GGA (Golgi-associated gamma-adaptin homologous) and Tom1 (target of Myb 1)], CUE (coupling......Covalent modification of proteins with ubiquitin is a common regulatory mechanism in eukaryotic cells. Typically, ubiquitinated proteins are targeted for degradation by the 26 S proteasome. However, more recently the ubiquitin signal has also been connected with many other cell processes, including...... endocytosis, vesicle fusion, DNA repair and transcriptional silencing. Hence ubiquitination may be comparable with phosphorylation in its importance as an intracellular switch, controlling various signal-transduction pathways. Similar to the regulation of the extent of phosphorylation by kinases...

  19. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    Science.gov (United States)

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor

  20. Differential binding of heavy chain variable domain 3 antigen binding fragments to protein A chromatography resins.

    Science.gov (United States)

    Bach, Julia; Lewis, Nathaniel; Maggiora, Kathy; Gillespie, Alison J; Connell-Crowley, Lisa

    2015-08-28

    This work examines the binding of 15 different VH3 IgGs and their corresponding F(ab')2 fragments to two different protein A chromatography resins: MabSelect(®), which utilizes a recombinant protein A ligand, and MabSelect SuRe(®) (SuRe), which utilizes a tetrameric Z domain ligand. The results show that VH3 F(ab')2 fragments can exhibit a variety of binding behaviours for the two resins. Contrary to previously published data, a subset of these molecules show strong interaction with the Z domain of SuRe(®). Furthermore, the results show that sequence variability of residue 57 in the VH3 heavy chain CDR2 domain correlates with binding behaviour on MabSelect(®) and SuRe(®). Site-directed mutagenesis of this residue confers gain or loss of VH3 F(ab')2 binding to these resins in 3 mAbs, demonstrating that it plays a key role in both recombinant protein A and Z domain interaction. A fourth mAb with a longer CDR2 loop was not affected by mutation of residue 57, indicating that CDR2 domain length may alter the binding interface and lead to the involvement of other residues in protein A binding. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. X-linked sideroblastic anemia due to ALAS2 intron 1 enhancer element GATA-binding site mutations

    OpenAIRE

    Campagna, D.R.; Bie, C.I. De; Schmitz-Abe, K.; Sweeney, M.; Sendamarai, A.K.; Schmidt, P.J.; Heeney, M.M.; Yntema, H.G.; Kannengiesser, C.; Grandchamp, B.; Niemeyer, C.M.; Knoers, N.V.A.M.; Swart, S.; Marron, G.; Wijk, R. van

    2014-01-01

    X-linked sideroblastic anemia (XLSA) is the most common form of congenital sideroblastic anemia. In affected males, it is uniformly associated with partial loss-of-function missense mutations in the erythroid-specific heme biosynthesis protein 5-aminolevulinate synthase 2 (ALAS2). Here, we report five families with XLSA owing to mutations in a GATA transcription factor binding site located in a transcriptional enhancer element in intron 1 of the ALAS2 gene. As such, this study defines a new c...

  2. Method for estimating protein binding capacity of polymeric systems

    Directory of Open Access Journals (Sweden)

    Vaibhav Sharma

    2015-01-01

    Full Text Available Composite biomaterials made from synthetic and protein-based polymers are extensively researched in tissue engineering. To successfully fabricate a protein-polymer composite, it is critical to understand how strongly the protein binds to the synthetic polymer, which occurs through protein adsorption. Currently, there is no cost-effective and simple method for characterizing this interfacial binding. To characterize this interfacial binding, we introduce a simple three-step method that involves: 1 synthetic polymer surface characterisation, 2 a quick, inexpensive and robust novel immuno-based assay that uses protein extraction compounds to characterize protein binding strength followed by 3 an in vitro 2D model of cell culture to confirm the results of the immuno-based assay. Fibrinogen, precursor of fibrin, was adsorbed (test protein on three different polymeric surfaces: silicone, poly(acrylic acid-coated silicone and poly(allylamine-coated silicone. Polystyrene surface was used as a reference. Characterisation of the different surfaces revealed different chemistry and roughness. The novel immuno-based assay showed significantly stronger binding of fibrinogen to both poly(acrylic acid and poly(allylamine coated silicone. Finally, cell studies showed that the strength of the interaction between the protein and the polymer had an effect on cell growth. This novel immuno-based assay is a valuable tool in developing composite biomaterials of synthetic and protein-based polymers with the potential to be applied in other fields of research where protein adsorption onto surfaces plays an important role.

  3. Computational design of binding proteins to EGFR domain II.

    Directory of Open Access Journals (Sweden)

    Yoon Sup Choi

    Full Text Available We developed a process to produce novel interactions between two previously unrelated proteins. This process selects protein scaffolds and designs protein interfaces that bind to a surface patch of interest on a target protein. Scaffolds with shapes complementary to the target surface patch were screened using an exhaustive computational search of the human proteome and optimized by directed evolution using phage display. This method was applied to successfully design scaffolds that bind to epidermal growth factor receptor (EGFR domain II, the interface of EGFR dimerization, with high reactivity toward the target surface patch of EGFR domain II. One potential application of these tailor-made protein interactions is the development of therapeutic agents against specific protein targets.

  4. TATA-binding protein and the retinoblastoma gene product bind to overlapping epitopes on c-Myc and adenovirus E1A protein

    NARCIS (Netherlands)

    Hateboer, G.; Timmers, H.T.M.; Rustgi, A.K.; Billaud, Marc; Veer, L.J. Van 't; Bernards, R.A.

    1993-01-01

    Using a protein binding assay, we show that the amino-teminal 204 amino acids of the c-Myc protein interact di y with a key component of the basal p tdon factor TFID, the TATA box-binding protein (TBP). Essentialy the same region of the c-Myc protein alo binds the product of the retinoblatoma

  5. Natural history of S-adenosylmethionine-binding proteins

    Directory of Open Access Journals (Sweden)

    Mushegian Arcady R

    2005-10-01

    Full Text Available Abstract Background S-adenosylmethionine is a source of diverse chemical groups used in biosynthesis and modification of virtually every class of biomolecules. The most notable reaction requiring S-adenosylmethionine, transfer of methyl group, is performed by a large class of enzymes, S-adenosylmethionine-dependent methyltransferases, which have been the focus of considerable structure-function studies. Evolutionary trajectories of these enzymes, and especially of other classes of S-adenosylmethionine-binding proteins, nevertheless, remain poorly understood. We addressed this issue by computational comparison of sequences and structures of various S-adenosylmethionine-binding proteins. Results Two widespread folds, Rossmann fold and TIM barrel, have been repeatedly used in evolution for diverse types of S-adenosylmethionine conversion. There were also cases of recruitment of other relatively common folds for S-adenosylmethionine binding. Several classes of proteins have unique unrelated folds, specialized for just one type of chemistry and unified by the theme of internal domain duplications. In several cases, functional divergence is evident, when evolutionarily related enzymes have changed the mode of binding and the type of chemical transformation of S-adenosylmethionine. There are also instances of functional convergence, when biochemically similar processes are performed by drastically different classes of S-adenosylmethionine-binding proteins. Comparison of remote sequence similarities and analysis of phyletic patterns suggests that the last universal common ancestor of cellular life had between 10 and 20 S-adenosylmethionine-binding proteins from at least 5 fold classes, providing for S-adenosylmethionine formation, polyamine biosynthesis, and methylation of several substrates, including nucleic acids and peptide chain release factor. Conclusion We have observed several novel relationships between families that were not known to be

  6. SCM, the M Protein of Streptococcus canis Binds Immunoglobulin G.

    Science.gov (United States)

    Bergmann, Simone; Eichhorn, Inga; Kohler, Thomas P; Hammerschmidt, Sven; Goldmann, Oliver; Rohde, Manfred; Fulde, Marcus

    2017-01-01

    The M protein of Streptococcus canis (SCM) is a virulence factor and serves as a surface-associated receptor with a particular affinity for mini-plasminogen, a cleavage product of the broad-spectrum serine protease plasmin. Here, we report that SCM has an additional high-affinity immunoglobulin G (IgG) binding activity. The ability of a particular S. canis isolate to bind to IgG significantly correlates with a scm-positive phenotype, suggesting a dominant role of SCM as an IgG receptor. Subsequent heterologous expression of SCM in non-IgG binding S. gordonii and Western Blot analysis with purified recombinant SCM proteins confirmed its IgG receptor function. As expected for a zoonotic agent, the SCM-IgG interaction is species-unspecific, with a particular affinity of SCM for IgGs derived from human, cats, dogs, horses, mice, and rabbits, but not from cows and goats. Similar to other streptococcal IgG-binding proteins, the interaction between SCM and IgG occurs via the conserved Fc domain and is, therefore, non-opsonic. Interestingly, the interaction between SCM and IgG-Fc on the bacterial surface specifically prevents opsonization by C1q, which might constitute another anti-phagocytic mechanism of SCM. Extensive binding analyses with a variety of different truncated SCM fragments defined a region of 52 amino acids located in the central part of the mature SCM protein which is important for IgG binding. This binding region is highly conserved among SCM proteins derived from different S. canis isolates but differs significantly from IgG-Fc receptors of S. pyogenes and S. dysgalactiae sub. equisimilis, respectively. In summary, we present an additional role of SCM in the pathogen-host interaction of S. canis. The detailed analysis of the SCM-IgG interaction should contribute to a better understanding of the complex roles of M proteins in streptococcal pathogenesis.

  7. Quantitative analysis of EGR proteins binding to DNA: assessing additivity in both the binding site and the protein

    Directory of Open Access Journals (Sweden)

    Stormo Gary D

    2005-07-01

    Full Text Available Abstract Background Recognition codes for protein-DNA interactions typically assume that the interacting positions contribute additively to the binding energy. While this is known to not be precisely true, an additive model over the DNA positions can be a good approximation, at least for some proteins. Much less information is available about whether the protein positions contribute additively to the interaction. Results Using EGR zinc finger proteins, we measure the binding affinity of six different variants of the protein to each of six different variants of the consensus binding site. Both the protein and binding site variants include single and double mutations that allow us to assess how well additive models can account for the data. For each protein and DNA alone we find that additive models are good approximations, but over the combined set of data there are context effects that limit their accuracy. However, a small modification to the purely additive model, with only three additional parameters, improves the fit significantly. Conclusion The additive model holds very well for every DNA site and every protein included in this study, but clear context dependence in the interactions was detected. A simple modification to the independent model provides a better fit to the complete data.

  8. A cell-based method for screening RNA-protein interactions: identification of constitutive transport element-interacting proteins.

    Directory of Open Access Journals (Sweden)

    Robert L Nakamura

    Full Text Available We have developed a mammalian cell-based screening platform to identify proteins that assemble into RNA-protein complexes. Based on Tat-mediated activation of the HIV LTR, proteins that interact with an RNA target elicit expression of a GFP reporter and are captured by fluorescence activated cell sorting. This "Tat-hybrid" screening platform was used to identify proteins that interact with the Mason Pfizer monkey virus (MPMV constitutive transport element (CTE, a structured RNA hairpin that mediates the transport of unspliced viral mRNAs from the nucleus to the cytoplasm. Several hnRNP-like proteins, including hnRNP A1, were identified and shown to interact with the CTE with selectivity in the reporter system comparable to Tap, a known CTE-binding protein. In vitro gel shift and pull-down assays showed that hnRNP A1 is able to form a complex with the CTE and Tap and that the RGG domain of hnRNP A1 mediates binding to Tap. These results suggest that hnRNP-like proteins may be part of larger export-competent RNA-protein complexes and that the RGG domains of these proteins play an important role in directing these binding events. The results also demonstrate the utility of the screening platform for identifying and characterizing new components of RNA-protein complexes.

  9. A cell-based method for screening RNA-protein interactions: identification of constitutive transport element-interacting proteins.

    Science.gov (United States)

    Nakamura, Robert L; Landt, Stephen G; Mai, Emily; Nejim, Jemiel; Chen, Lily; Frankel, Alan D

    2012-01-01

    We have developed a mammalian cell-based screening platform to identify proteins that assemble into RNA-protein complexes. Based on Tat-mediated activation of the HIV LTR, proteins that interact with an RNA target elicit expression of a GFP reporter and are captured by fluorescence activated cell sorting. This "Tat-hybrid" screening platform was used to identify proteins that interact with the Mason Pfizer monkey virus (MPMV) constitutive transport element (CTE), a structured RNA hairpin that mediates the transport of unspliced viral mRNAs from the nucleus to the cytoplasm. Several hnRNP-like proteins, including hnRNP A1, were identified and shown to interact with the CTE with selectivity in the reporter system comparable to Tap, a known CTE-binding protein. In vitro gel shift and pull-down assays showed that hnRNP A1 is able to form a complex with the CTE and Tap and that the RGG domain of hnRNP A1 mediates binding to Tap. These results suggest that hnRNP-like proteins may be part of larger export-competent RNA-protein complexes and that the RGG domains of these proteins play an important role in directing these binding events. The results also demonstrate the utility of the screening platform for identifying and characterizing new components of RNA-protein complexes.

  10. Retinoblastoma-binding Protein 1 Has an Interdigitated Double Tudor Domain with DNA Binding Activity*

    Science.gov (United States)

    Gong, Weibin; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang

    2014-01-01

    Retinoblastoma-binding protein 1 (RBBP1) is a tumor and leukemia suppressor that binds both methylated histone tails and DNA. Our previous studies indicated that RBBP1 possesses a Tudor domain, which cannot bind histone marks. In order to clarify the function of the Tudor domain, the solution structure of the RBBP1 Tudor domain was determined by NMR and is presented here. Although the proteins are unrelated, the RBBP1 Tudor domain forms an interdigitated double Tudor structure similar to the Tudor domain of JMJD2A, which is an epigenetic mark reader. This indicates the functional diversity of Tudor domains. The RBBP1 Tudor domain structure has a significant area of positively charged surface, which reveals a capability of the RBBP1 Tudor domain to bind nucleic acids. NMR titration and isothermal titration calorimetry experiments indicate that the RBBP1 Tudor domain binds both double- and single-stranded DNA with an affinity of 10–100 μm; no apparent DNA sequence specificity was detected. The DNA binding mode and key interaction residues were analyzed in detail based on a model structure of the Tudor domain-dsDNA complex, built by HADDOCK docking using the NMR data. Electrostatic interactions mediate the binding of the Tudor domain with DNA, which is consistent with NMR experiments performed at high salt concentration. The DNA-binding residues are conserved in Tudor domains of the RBBP1 protein family, resulting in conservation of the DNA-binding function in the RBBP1 Tudor domains. Our results provide further insights into the structure and function of RBBP1. PMID:24379399

  11. Retinoblastoma-binding protein 1 has an interdigitated double Tudor domain with DNA binding activity.

    Science.gov (United States)

    Gong, Weibin; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang

    2014-02-21

    Retinoblastoma-binding protein 1 (RBBP1) is a tumor and leukemia suppressor that binds both methylated histone tails and DNA. Our previous studies indicated that RBBP1 possesses a Tudor domain, which cannot bind histone marks. In order to clarify the function of the Tudor domain, the solution structure of the RBBP1 Tudor domain was determined by NMR and is presented here. Although the proteins are unrelated, the RBBP1 Tudor domain forms an interdigitated double Tudor structure similar to the Tudor domain of JMJD2A, which is an epigenetic mark reader. This indicates the functional diversity of Tudor domains. The RBBP1 Tudor domain structure has a significant area of positively charged surface, which reveals a capability of the RBBP1 Tudor domain to bind nucleic acids. NMR titration and isothermal titration calorimetry experiments indicate that the RBBP1 Tudor domain binds both double- and single-stranded DNA with an affinity of 10-100 μM; no apparent DNA sequence specificity was detected. The DNA binding mode and key interaction residues were analyzed in detail based on a model structure of the Tudor domain-dsDNA complex, built by HADDOCK docking using the NMR data. Electrostatic interactions mediate the binding of the Tudor domain with DNA, which is consistent with NMR experiments performed at high salt concentration. The DNA-binding residues are conserved in Tudor domains of the RBBP1 protein family, resulting in conservation of the DNA-binding function in the RBBP1 Tudor domains. Our results provide further insights into the structure and function of RBBP1.

  12. Binding dynamics of single-stranded DNA binding proteins to fluctuating bubbles in breathing DNA

    Energy Technology Data Exchange (ETDEWEB)

    Ambjoernsson, Tobias; Metzler, Ralf [NORDITA-Nordic Institute for Theoretical Physics, Blegdamsvej 17, DK-2100 Copenhagen Oe (Denmark)

    2005-05-25

    We investigate the dynamics of a single local denaturation zone in a DNA molecule, a so-called DNA bubble, in the presence of single-stranded DNA binding proteins (SSBs). In particular, we develop a dynamical description of the process in terms of a two-dimensional master equation for the time evolution of the probability distribution of having a bubble of size m with n bound SSBs, for the case when m and n are the slowest variables in the system. We derive explicit expressions for the equilibrium statistical weights for a given m and n, which depend on the statistical weight u associated with breaking a base-pair interaction, the loop closure exponent c, the cooperativity parameter {sigma}{sub 0}, the SSB size {lambda}, and binding strength {kappa}. These statistical weights determine, through the detailed balance condition, the transfer coefficient in the master equation. For the case of slow and fast binding dynamics the problem can be reduced to one-dimensional master equations. In the latter case, we perform explicitly the adiabatic elimination of the fast variable n. Furthermore, we find that for the case that the loop closure is neglected and the binding dynamics is vanishing (but with arbitrary {sigma}{sub 0}) the eigenvalues and the eigenvectors of the master equation can be obtained analytically, using an orthogonal polynomial approach. We solve the general case numerically (i.e., including SSB binding and the loop closure) as a function of statistical weight u, binding protein size {lambda}, and binding strength {kappa}, and compare to the fast and slow binding limits. In particular, we find that the presence of SSBs in general increases the relaxation time, compared to the case when no binding proteins are present. By tuning the parameters, we can drive the system from regular bubble fluctuation in the absence of SSBs to full denaturation, reflecting experimental and in vivo situations.

  13. Characterization of DNA-binding proteins from pea mitochondria

    DEFF Research Database (Denmark)

    Hatzack, F.A.; Dombrowski, S.; Brennicke, A.

    1998-01-01

    We studied transcription initiation in the mitochondria of higher plants, with particular respect to promoter structures. Conserved elements of these promoters have been successfully identified by in vitro transcription systems in different species, whereas the involved protein components are still...

  14. Chromate Binding and Removal by the Molybdate-Binding Protein ModA.

    Science.gov (United States)

    Karpus, Jason; Bosscher, Michael; Ajiboye, Ifedayo; Zhang, Liang; He, Chuan

    2017-04-04

    Effective and cheap methods and techniques for the safe removal of hexavalent chromate from the environment are in increasingly high demand. High concentrations of hexavalent chromate have been shown to have numerous harmful effects on human biology. We show that the E. coli molybdate-binding protein ModA is a genetically encoded tool capable of removing chromate from aqueous solutions. Although previously reported to not bind chromate, we show that ModA binds chromate tightly and is capable of removing chromate to levels well below current US federal standards. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. STRUCTURAL INSIGHT INTO THE FORMIN BINDING PROPERTY OF HUMAN FORMIN BINDING PROTEIN 4

    Directory of Open Access Journals (Sweden)

    Amit Das

    2013-12-01

    Full Text Available Formin mediated dynamic regulation of actin cytoskeleton is involved in numerous cellular processes, organism growth and development and different diseases. The cellular formin-actin network is further fine tuned by different formin binding proteins (FNBPs. Four such FNBPs which were initially discovered as formin poly proline rich FH1 domain binding; were found to contain tandem WW domains as their formin interacting module. Despite the fact that WW domains are the smallest known protein module that is involved in multi-protein interactions, the interaction of formins and WW domain containing FNBPs were rarely explored and their interactions under physiological contexts became doubtful. However different studies continuously provided indications of greater cellular impacts of these interactions. We have used computational techniques (homology modeling and molecular docking to investigate the ligand binding, especially formin binding properties of human FNBP4 WW domains. We have found that the triple β sheet structure of the 1st WW domain of FNBP4 can bind to the proline rich FH1 region of formin mDia1. However the FNBP4 second WW domain was found to be unable to bind to mDia1 FH1 region. Detailed investigation showed the importance of sequence variations of FNBP4 WW domains in specifying their interactions with formins

  16. Interactome-Wide Prediction of Protein-Protein Binding Sites Reveals Effects of Protein Sequence Variation in Arabidopsis thaliana

    NARCIS (Netherlands)

    Valentim, F.L.; Neven, F.; Boyen, P.; Dijk, van A.D.J.

    2012-01-01

    The specificity of protein-protein interactions is encoded in those parts of the sequence that compose the binding interface. Therefore, understanding how changes in protein sequence influence interaction specificity, and possibly the phenotype, requires knowing the location of binding sites in

  17. Identification and functional characterization of a Smad binding element (SBE) in the JunB promoter that acts as a transforming growth factor-beta, activin, and bone morphogenetic protein-inducible enhancer

    NARCIS (Netherlands)

    Jonk, LJC; Itoh, S; Heldin, CH; ten Dijke, P; Kruijer, W

    1998-01-01

    Smad proteins have been identified as mediators of intracellular signal transduction by members of the transforming growth factor-beta (TGF-beta) superfamily, which affect cell proliferation, differentiation, as well as pattern formation during early vertebrate development. Following receptor

  18. Toxic Elements in Food: Occurrence, Binding, and Reduction Approaches

    DEFF Research Database (Denmark)

    Hajeb, P.; Sloth, Jens Jørgen; Shakibazadeh, Sh

    2014-01-01

    of their entry into the human body. Numerous studies have been performed to examine the effects of common food processing procedures on the levels of toxic elements in food. While some studies have reported negative effects of processing, several have shown that processing practices may have a positive effect...

  19. Solvation structure of ice-binding antifreeze proteins

    Science.gov (United States)

    Hansen-Goos, Hendrik; Wettlaufer, John

    2009-03-01

    Antifreeze proteins (AFPs) can be found in organisms which survive at subzero temperatures. They were first discovered in polar fishes since the 1950's [1] and have been isolated meanwhile also from insects, plants, and bacteria. While AFPs shift the freezing point of water below the bulk melting point and hence can prevent recrystallization; the effect is non-colligative and there is a pronounced hysteresis between freezing and melting. For many AFPs it is generally accepted that they function through an irreversible binding to the ice-water interface which leads to a piecewise convex growth front with a lower nonequilibrium freezing point due to the Kelvin effect. Recent molecular dynamics simulations of the AFP from Choristoneura fumiferana reveal that the solvation structures of water at ice-binding and non-ice-binding faces of the protein are crucial for understanding how the AFP binds to the ice surface and how it is protected from being overgrown [2]. We use density functional theory of classical fluids in order to assess the microscopic solvent structure in the vicinity of protein faces with different surface properties. With our method, binding energies of different protein faces to the water-ice-interface can be computed efficiently in a simplified model. [1] Y. Yeh and R.E. Feeney, Chem. Rev. 96, 601 (1996). [2] D.R. Nutt and J.C. Smith, J. Am. Chem. Soc. 130, 13066 (2008).

  20. Holo- And Apo- Structures of Bacterial Periplasmic Heme Binding Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Ho, W.W.; Li, H.; Eakanunkul, S.; Tong, Y.; Wilks, A.; Guo, M.; Poulos, T.L.

    2009-06-01

    An essential component of heme transport in Gram-negative bacterial pathogens is the periplasmic protein that shuttles heme between outer and inner membranes. We have solved the first crystal structures of two such proteins, ShuT from Shigella dysenteriae and PhuT from Pseudomonas aeruginosa. Both share a common architecture typical of Class III periplasmic binding proteins. The heme binds in a narrow cleft between the N- and C-terminal binding domains and is coordinated by a Tyr residue. A comparison of the heme-free (apo) and -bound (holo) structures indicates little change in structure other than minor alterations in the heme pocket and movement of the Tyr heme ligand from an 'in' position where it can coordinate the heme iron to an 'out' orientation where it points away from the heme pocket. The detailed architecture of the heme pocket is quite different in ShuT and PhuT. Although Arg{sup 228} in PhuT H-bonds with a heme propionate, in ShuT a peptide loop partially takes up the space occupied by Arg{sup 228}, and there is no Lys or Arg H-bonding with the heme propionates. A comparison of PhuT/ShuT with the vitamin B{sub 12}-binding protein BtuF and the hydroxamic-type siderophore-binding protein FhuD, the only two other structurally characterized Class III periplasmic binding proteins, demonstrates that PhuT/ShuT more closely resembles BtuF, which reflects the closer similarity in ligands, heme and B{sub 12}, compared with ligands for FhuD, a peptide siderophore.

  1. RNA-binding proteins in mouse male germline stem cells: a mammalian perspective

    Directory of Open Access Journals (Sweden)

    Huayu Qi

    2016-01-01

    Full Text Available Adult stem cells that reside in particular types of tissues are responsible for tissue homeostasis and regeneration. Cellular functions of adult stem cells are intricately related to the gene expression programs in those cells. Past research has demonstrated that regulation of gene expression at the transcriptional level can decisively alter cell fate of stem cells. However, cellular contents of mRNAs are sometimes not equivalent to proteins, the functional units of cells. It is increasingly realized that post-transcriptional and translational regulation of gene expression are also fundamental for stem cell functions. Compared to differentiated somatic cells, effects on cellular status manifested by varied expression of RNA-binding proteins and global protein synthesis have been demonstrated in several stem cell systems. Through the cooperation of both cis-elements of mRNAs and trans-acting RNA-binding proteins that are intimately associated with them, regulation of localization, stability, and translational status of mRNAs directly influences the self-renewal and differentiation of stem cells. Previous studies have uncovered some of the molecular mechanisms that underlie the functions of RNA-binding proteins in stem cells in invertebrate species. However, their roles in adult stem cells in mammals are just beginning to be unveiled. This review highlights some of the RNA-binding proteins that play important functions during the maintenance and differentiation of mouse male germline stem cells, the adult stem cells in the male reproductive organ.

  2. Recognition of anesthetic barbiturates by a protein binding site: a high resolution structural analysis.

    Directory of Open Access Journals (Sweden)

    Simon Oakley

    Full Text Available Barbiturates potentiate GABA actions at the GABA(A receptor and act as central nervous system depressants that can induce effects ranging from sedation to general anesthesia. No structural information has been available about how barbiturates are recognized by their protein targets. For this reason, we tested whether these drugs were able to bind specifically to horse spleen apoferritin, a model protein that has previously been shown to bind many anesthetic agents with affinities that are closely correlated with anesthetic potency. Thiopental, pentobarbital, and phenobarbital were all found to bind to apoferritin with affinities ranging from 10-500 µM, approximately matching the concentrations required to produce anesthetic and GABAergic responses. X-ray crystal structures were determined for the complexes of apoferritin with thiopental and pentobarbital at resolutions of 1.9 and 2.0 Å, respectively. These structures reveal that the barbiturates bind to a cavity in the apoferritin shell that also binds haloalkanes, halogenated ethers, and propofol. Unlike these other general anesthetics, however, which rely entirely upon van der Waals interactions and the hydrophobic effect for recognition, the barbiturates are recognized in the apoferritin site using a mixture of both polar and nonpolar interactions. These results suggest that any protein binding site that is able to recognize and respond to the chemically and structurally diverse set of compounds used as general anesthetics is likely to include a versatile mixture of both polar and hydrophobic elements.

  3. Isolation and N-terminal sequencing of a novel cadmium-binding protein from Boletus edulis

    Science.gov (United States)

    Collin-Hansen, C.; Andersen, R. A.; Steinnes, E.

    2003-05-01

    A Cd-binding protein was isolated from the popular edible mushroom Boletus edulis, which is a hyperaccumulator of both Cd and Hg. Wild-growing samples of B. edulis were collected from soils rich in Cd. Cd radiotracer was added to the crude protein preparation obtained from ethanol precipitation of heat-treated cytosol. Proteins were then further separated in two consecutive steps; gel filtration and anion exchange chromatography. In both steps the Cd radiotracer profile showed only one distinct peak, which corresponded well with the profiles of endogenous Cd obtained by atomic absorption spectrophotometry (AAS). Concentrations of the essential elements Cu and Zn were low in the protein fractions high in Cd. N-terminal sequencing performed on the Cd-binding protein fractions revealed a protein with a novel amino acid sequence, which contained aromatic amino acids as well as proline. Both the N-terminal sequencing and spectrofluorimetric analysis with EDTA and ABD-F (4-aminosulfonyl-7-fluoro-2, 1, 3-benzoxadiazole) failed to detect cysteine in the Cd-binding fractions. These findings conclude that the novel protein does not belong to the metallothionein family. The results suggest a role for the protein in Cd transport and storage, and they are of importance in view of toxicology and food chemistry, but also for environmental protection.

  4. Co-operative intra-protein structural response due to protein-protein complexation revealed through thermodynamic quantification: study of MDM2-p53 binding

    Science.gov (United States)

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-09-01

    The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (β1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.

  5. Co-operative intra-protein structural response due to protein-protein complexation revealed through thermodynamic quantification: study of MDM2-p53 binding.

    Science.gov (United States)

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-10-01

    The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (β1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.

  6. Co-operative intra-protein structural response due to protein-protein complexation revealed through thermodynamic quantification: study of MDM2-p53 binding

    Science.gov (United States)

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-10-01

    The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (β1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.

  7. TAK1-binding protein 1 is a pseudophosphatase

    Science.gov (United States)

    Conner, Sarah H.; Kular, Gursant; Peggie, Mark; Shepherd, Sharon; Schüttelkopf, Alexander W.; Cohen, Philip; Van Aalten, Daan M. F.

    2006-01-01

    TAB1 [TAK1 (transforming growth factor-β-activated kinase 1)-binding protein 1] is one of the regulatory subunits of TAK1, a protein kinase that lies at the head of three pro-inflammatory kinase cascades. In the current study we report the crystal structure of the N-terminal domain of TAB1. Surprisingly, TAB1 possesses a fold closely related to that of the PPM (Mg2+- or Mn2+-dependent protein phosphatase) family as demonstrated by the close structural similarity with protein phosphatase 2Cα. However, we were unable to detect any phosphatase activity for TAB1 using a phosphopeptide or p-nitrophenyl phosphate as substrate. Although the overall protein phosphatase 2Cα fold is conserved in TAB1, detailed structural analyses and mutagenesis studies show that several key residues required for dual metal-binding and catalysis are not present in TAB1, although binding of a single metal is supported by soaking experiments with manganese and isothermal titration calorimetry. Thus, it appears that TAB1 is a ‘pseudophosphatase’, possibly binding to and regulating accessibility of phosphorylated residues on substrates downstream of TAK1 or on the TAK1 complex itself. PMID:16879102

  8. The RNA-binding protein repertoire of Arabidopsis thaliana

    KAUST Repository

    Marondedze, Claudius

    2016-07-11

    RNA-binding proteins (RBPs) have essential roles in determining the fate of RNA from synthesis to decay and have been studied on a protein-by-protein basis, or computationally based on a number of well-characterised RNA-binding domains. Recently, high-throughput methods enabled the capture of mammalian RNA-binding proteomes. To gain insight into the role of Arabidopsis thaliana RBPs at the systems level, we have employed interactome capture techniques using cells from different ecotypes grown in cultures and leaves. In vivo UV-crosslinking of RNA to RBPs, oligo(dT) capture and mass spectrometry yielded 1,145 different proteins including 550 RBPs that either belong to the functional category ‘RNA-binding’, have known RNA-binding domains or have orthologs identified in mammals, C. elegans, or S. cerevisiae in addition to 595 novel candidate RBPs. We noted specific subsets of RBPs in cultured cells and leaves and a comparison of Arabidopsis, mammalian, C. elegans, and S. cerevisiae RBPs reveals a common set of proteins with a role in intermediate metabolism, as well as distinct differences suggesting that RBPs are also species and tissue specific. This study provides a foundation for studies that will advance our understanding of the biological significance of RBPs in plant developmental and stimulus specific responses.

  9. RBPPred: predicting RNA-binding proteins from sequence using SVM.

    Science.gov (United States)

    Zhang, Xiaoli; Liu, Shiyong

    2017-03-15

    Detection of RNA-binding proteins (RBPs) is essential since the RNA-binding proteins play critical roles in post-transcriptional regulation and have diverse roles in various biological processes. Moreover, identifying RBPs by computational prediction is much more efficient than experimental methods and may have guiding significance on the experiment design. In this study, we present the RBPPred (an RNA-binding protein predictor), a new method based on the support vector machine, to predict whether a protein binds RNAs, based on a comprehensive feature representation. By integrating the physicochemical properties with the evolutionary information of protein sequences, the new approach RBPPred performed much better than state-of-the-art methods. The results show that RBPPred correctly predicted 83% of 2780 RBPs and 96% out of 7093 non-RBPs with MCC of 0.808 using the 10-fold cross validation. Furthermore, we achieved a sensitivity of 84%, specificity of 97% and MCC of 0.788 on the testing set of human proteome. In addition we tested the capability of RBPPred to identify new RBPs, which further confirmed the practicability and predictability of the method. RBPPred program can be accessed at: http://rnabinding.com/RBPPred.html . liushiyong@gmail.com. Supplementary data are available at Bioinformatics online.

  10. Lamins and lamin-binding proteins in functional chromatin organization.

    Science.gov (United States)

    Gotzmann, J; Foisner, R

    1999-01-01

    Lamins are the major components of the nuclear lamina, a two-dimensional filamentous network at the periphery of the nucleus in higher eukaryotes, directly underlying the inner nuclear membrane. Several integral proteins of the inner nuclear membrane bind to lamins and may link the nuclear membrane to the core lamina network. The lamins and the lamin-binding proteins lamina-associated polypeptide (LAP)2beta and lamin B receptor (LBR) have been described to bind to DNA or to interact with chromatin via histones, BAF-1, and HP1 chromodomain proteins, respectively, and may provide anchorage sites for chromatin fibers at the nuclear periphery. In addition, lamin A structures on intranuclear filaments, or lamin B in replication foci have been described in the nuclear interior, but their specific roles remain unclear. An isoform of the LAP2 protein family, LAP2alpha, has been found to colocalize with A-type lamins in the nucleoplasm and might be involved in intranuclear structure organization. In the course of cell-cycle-dependent dynamics of the nucleus in higher eukaryotes, lamins as well as lamin-binding proteins seem to possess important functions during various steps of post-mitotic nuclear reassembly, including cross-linking of chromatides, nuclear membrane targeting, nuclear lamina assembly, and the formation of a replication-competent nucleus.

  11. Selectivity determinants of GPCR-G-protein binding

    DEFF Research Database (Denmark)

    Flock, Tilman; Hauser, Alexander S; Lund, Nadia

    2017-01-01

    The selective coupling of G-protein-coupled receptors (GPCRs) to specific G proteins is critical to trigger the appropriate physiological response. However, the determinants of selective binding have remained elusive. Here we reveal the existence of a selectivity barcode (that is, patterns of amino...... of the G-protein barcode through distinct residues, like multiple keys (receptors) opening the same lock (G protein) using non-identical cuts. Considering the evolutionary history of GPCRs allows the identification of these selectivity-determining residues. These findings lay the foundation...

  12. Solution properties of the archaeal CRISPR DNA repeat-binding homeodomain protein Cbp2

    DEFF Research Database (Denmark)

    Kenchappa, Chandra; Heiðarsson, Pétur Orri; Kragelund, Birthe

    2013-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) form the basis of diverse adaptive immune systems directed primarily against invading genetic elements of archaea and bacteria. Cbp1 of the crenarchaeal thermoacidophilic order Sulfolobales, carrying three imperfect repeats, binds...... specifically to CRISPR DNA repeats and has been implicated in facilitating production of long transcripts from CRISPR loci. Here, a second related class of CRISPR DNA repeat-binding protein, denoted Cbp2, is characterized that contains two imperfect repeats and is found amongst members of the crenarchaeal...... in facilitating high affinity DNA binding of Cbp2 by tethering the two domains. Structural studies on mutant proteins provide support for Cys(7) and Cys(28) enhancing high thermal stability of Cbp2(Hb) through disulphide bridge formation. Consistent with their proposed CRISPR transcriptional regulatory role, Cbp2...

  13. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    Directory of Open Access Journals (Sweden)

    Sleumer Monica C

    2012-08-01

    Full Text Available Abstract Background Ribosomal protein genes (RPGs are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from

  14. The gene encoding the Acyl-CoA-binding protein is activated by peroxisome proliferator-activated receptor gamma through an intronic response element functionally conserved between humans and rodents

    DEFF Research Database (Denmark)

    Helledie, Torben; Grøntved, Lars; Jensen, Søren S

    2002-01-01

    metabolic and regulatory purposes. The protein is particularly abundant in cells with a high level of lipogenesis and de novo fatty acid synthesis and is significantly induced during adipocyte differentiation. However, the molecular mechanisms underlying the regulation of ACBP expression in mammalian cells...

  15. Lupin peptides lower low-density lipoprotein (LDL) cholesterol through an up-regulation of the LDL receptor/sterol regulatory element binding protein 2 (SREBP2) pathway at HepG2 cell line.

    Science.gov (United States)

    Lammi, Carmen; Zanoni, Chiara; Scigliuolo, Graziana M; D'Amato, Alfonsina; Arnoldi, Anna

    2014-07-23

    Previous experiments in suitable animal models and in mild hypercholesterolemic individuals have shown that the consumption of lupin proteins may be useful for controlling total and low-density lipoprotein (LDL) cholesterol levels. With the objective of providing evidence that peptides deriving from the hydrolysis of lupin proteins may be responsible of the observed activities and for investigating the mechanism of action, HepG2 cells were treated with lupin peptides obtained by either pepsin (P) or trypsin (T) hydrolysis, and molecular and functional investigations were performed on the LDL receptor/SREBP2 pathway. For the first time, this paper provides experimental evidence that lupin peptides are able to interfere with the HMGCoAR activity, up-regulating the LDL receptor (136 and 84% vs the control for P and T peptides, respectively, at 1 mg/mL) and SREBP2 proteins (148 and 73% vs the control for P and T peptides, respectively, at 1 mg/mL) via the activation of PI3K/Akt/GSK3β pathways and increasing the LDL uptake at HepG2 cell line (40 and 50% vs the control for P and T peptides, respectively, at 1 mg/mL). These results may be useful in explaining the activities observed in vivo in animals and humans treated with lupin protein.

  16. Tritium NMR spectroscopy of ligand binding to maltose-binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Gehring, K.; Williams, P.G.; Pelton, J.G.; Morimoto, H.; Wemmer, D.E. (Lawrence Berkeley Lab., CA (United States))

    1991-06-04

    Tritium-labeled {alpha}- and {beta}-maltodextrins have been used to study their complexes with maltose-binding protein (MBP), a 40-kDa bacterial protein. Five substrates, from maltose to maltohexaose, were labeled at their reducing ends and their binding studied. Tritium NMR specctroscopy of the labeled sugars showed large upfield chamical shift changes upon binding and strong anomeric specficity. At 10{degrees}C, MBP bound {alpha}-maltose with 2.7 {plus minus} 0.5-fold higher affinity than {beta}-maltose, and, for longer maltodextrins, the ratio of affinities was even larger. The maximum chemical shift change was 2.2 ppm, suggesting that the reducing end of bound {alpha}-maltodextrin makes close contact with an aromatic residue in the MBP-binding site. Experiments with maltotriose (and longer maltodextrins) also revealed the presence of two bound {beta}-maltotriose resonances in rapid exchange. The authors interpret these two resonances as arising from two distinct sugar-protein complexes. In one complex, the {beta}-maltodextrin is bound by its reducing end, and, in the other complex, the {beta}-maltodextrin is bound by the middle glucose residue(s). This interpretation also suggests how MBP is able to bind both linear and circular maltodextrins.

  17. Structure of Osh3 reveals a conserved mode of phosphoinositide binding in oxysterol-binding proteins.

    Science.gov (United States)

    Tong, Junsen; Yang, Huiseon; Yang, Hongyuan; Eom, Soo Hyun; Im, Young Jun

    2013-07-02

    The oxysterol-binding protein (OSBP)-related proteins (ORPs) are conserved from yeast to humans, and implicated in the regulation of lipid homeostasis and in signaling pathways. Saccharomyces cerevisiae has seven ORPs (Osh1-Osh7) that share one unknown essential function. Here, we report the 1.5-2.3 Å structures of the PH domain and ORD (OSBP-related domain) of yeast Osh3 in apo-form or in complex with phosphatidylinositol 4-phosphate (PI[4]P). Osh3 recognizes PI(4)P by the highly conserved residues in the tunnel of ORD whereas it lacks sterol binding due to the narrow hydrophobic tunnel. Yeast complementation tests suggest that PI(4)P binding to PH and ORD is essential for function. This study suggests that the unifying feature in all ORP homologs is the binding of PI(4)P to ORD and sterol binding is additional to certain homologs. Structural modeling of full-length Osh3 is consistent with the concept that Osh3 is a lipid transfer protein or regulator in membrane contact sites. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Fluorescence properties of porcine odorant binding protein Trp 16 residue

    Energy Technology Data Exchange (ETDEWEB)

    Albani, Jihad Rene, E-mail: Jihad-Rene.Albani@univ-lille1.f [Laboratoire de Biophysique Moleculaire, Universite des Sciences et Technologies de Lille, F-59655 Villeneuve d' Ascq Cedex (France)

    2010-11-15

    Summary: The present work deals with fluorescence studies of adult porcine odorant binding protein at pH=7.5. At this pH, the protein is a dimer, each monomer contains one tryptophan residue. Our results show that tryptophan residue displays significant motions and emits with three fluorescence lifetimes. Decay associated spectra showed that the three lifetime's components emanate from sub-structures surrounded by the same microenvironment.

  19. Cooperative interactions between odorant-binding proteins of Anopheles gambiae.

    Science.gov (United States)

    Qiao, Huili; He, Xiaoli; Schymura, Danuta; Ban, Liping; Field, Linda; Dani, Francesca Romana; Michelucci, Elena; Caputo, Beniamino; della Torre, Alessandra; Iatrou, Kostas; Zhou, Jing-Jiang; Krieger, Jürgen; Pelosi, Paolo

    2011-05-01

    To understand olfactory discrimination in Anopheles gambiae, we made six purified recombinant OBPs and investigated their ligand-binding properties. All OBPs were expressed in bacteria with additional production of OBP47 in the yeast Kluveromyces lactis. Ligand-binding experiments, performed with a diverse set of organic compounds, revealed marked differences between the OBPs. Using the fluorescent probe N-phenyl-1-naphthylamine, we also measured the binding curves for binary mixtures of OBPs and obtained, in some cases, unexpected behaviour, which could only be explained by the OBPs forming heterodimers with binding characteristics different from those of the component proteins. This shows that OBPs in mosquitoes can form complexes with novel ligand specificities, thus amplifying the repertoire of OBPs and the number of semiochemicals that can be discriminated. Confirmation of the likely role of heterodimers was demonstrated by in situ hybridisation, suggesting that OBP1 and OBP4 are co-expressed in some antennal sensilla of A. gambiae.

  20. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins

    Science.gov (United States)

    Lambert, Nicole; Robertson, Alex; Jangi, Mohini; McGeary, Sean; Sharp, Phillip A.; Burge, Christopher B.

    2014-01-01

    Summary Specific protein-RNA interactions guide post-transcriptional gene regulation. Here we describe RNA Bind-n-Seq (RBNS), a method that comprehensively characterizes sequence and structural specificity of RNA binding proteins (RBPs), and its application to the developmental alternative splicing factors RBFOX2, CELF1/CUGBP1 and MBNL1. For each factor, we recovered both canonical motifs and additional near-optimal binding motifs. RNA secondary structure inhibits binding of RBFOX2 and CELF1, while MBNL1 favors unpaired Us but tolerates C/G pairing in motifs containing UGC and/or GCU. Dissociation constants calculated from RBNS data using a novel algorithm correlated highly with values measured by surface plasmon resonance. Motifs identified by RBNS were conserved, were bound and active in vivo, and distinguished the subset of motifs enriched by CLIP-Seq that had regulatory activity. Together, our data demonstrate that RBNS complements crosslinking-based methods and show that in vivo binding and activity of these splicing factors is driven largely by intrinsic RNA affinity. PMID:24837674

  1. Flexibility of PCNA-protein interface accommodates differential binding partners.

    Science.gov (United States)

    Pedley, Anthony M; Lill, Markus A; Davisson, V Jo

    2014-01-01

    The expanding roles of PCNA in functional assembly of DNA replication and repair complexes motivated investigation of the structural and dynamic properties guiding specificity of PCNA-protein interactions. A series of biochemical and computational analyses were combined to evaluate the PIP Box recognition features impacting complex formation. The results indicate subtle differences in topological and molecular descriptors distinguishing both affinity and stoichiometry of binding among PCNA-peptide complexes through cooperative effects. These features were validated using peptide mimics of p85α and Akt, two previously unreported PCNA binding partners. This study characterizes for the first time a reverse PIP Box interaction with PCNA. Small molecule ligand binding at the PIP Box interaction site confirmed the adaptive nature of the protein in dictating overall shape and implicates allosterism in transmitting biological effects.

  2. Flexibility of PCNA-protein interface accommodates differential binding partners.

    Directory of Open Access Journals (Sweden)

    Anthony M Pedley

    Full Text Available The expanding roles of PCNA in functional assembly of DNA replication and repair complexes motivated investigation of the structural and dynamic properties guiding specificity of PCNA-protein interactions. A series of biochemical and computational analyses were combined to evaluate the PIP Box recognition features impacting complex formation. The results indicate subtle differences in topological and molecular descriptors distinguishing both affinity and stoichiometry of binding among PCNA-peptide complexes through cooperative effects. These features were validated using peptide mimics of p85α and Akt, two previously unreported PCNA binding partners. This study characterizes for the first time a reverse PIP Box interaction with PCNA. Small molecule ligand binding at the PIP Box interaction site confirmed the adaptive nature of the protein in dictating overall shape and implicates allosterism in transmitting biological effects.

  3. T3: Targeted Proteomics of DNA-Binding Proteins

    Science.gov (United States)

    Nagore, Linda I.; Jarrett, Harry W.

    2015-01-01

    A technique that allows the inclusion of a specific DNA to enrich and direct proteomic identification of transcription factors (TF) while providing a route for high throughput screening on a single platform would be valuable in investigations of gene expression and regulation. Polyvinylpyrrolidone binds DNA avidly while binding negligible amounts of protein. This observation is used in a proof-of-concept method to enrich for TF by combining nuclear extract with a specific DNA sequence and immobilizing the DNA-protein complex on a PVP-coated MALDI plate. Any unbound proteins are washed away and further processed for analysis in a MALDI-TOF/TOF mass spectrometer. Enrichment on a PVP-coated plate gives the unique advantage of purification, enzymatic digestion and analysis on a single platform. The method is termed T3 as it combines Targeted purification on a Target plate with Targeted proteomics. Validation was achieved in model experiments with a chimeric fusion protein, green fluorescent protein-CAAT enhancer binding protein (GFP-C/EBP) with an oligonucleotide containing the CAAT sequence. Both domains were identified with an expectation value of less than 10−15 and over 15% sequence coverage. The same oligonucleotide mixed with HEK293 cell nuclear extract allowed the unambiguous identification of native human C/EBP alpha with 24.3% sequence coverage. PMID:25644705

  4. Genome-wide regulation of TATA-binding protein activity

    NARCIS (Netherlands)

    van Werven, F.J.

    2009-01-01

    Transcription, the synthesis of RNA from a DNA template, is a well-controlled process. TATA binding protein (TBP) recruitment to promoters is essential for transcription by all three RNA polymerases, and often is the rate-limiting step of transcription initiation. TBP is incorporated into different

  5. Controlling transcription fidelity via TATA-binding protein dynamics

    NARCIS (Netherlands)

    Koster, M.J.E.

    2015-01-01

    Transcription underlies all cellular processes and responses to internal and external cues. Deregulation of transcription has implications for the fitness of the cell or organism. During my PhD I have investigated the importance of proper TATA-binding protein (TBP) regulation as a mechanism to

  6. QSAR models for the prediction of plasma protein binding.

    Science.gov (United States)

    Ghafourian, Taravat; Amin, Zeshan

    2013-01-01

    The prediction of plasma protein binding (ppb) is of paramount importance in the pharmacokinetics characterization of drugs, as it causes significant changes in volume of distribution, clearance and drug half life. This study utilized Quantitative Structure - Activity Relationships (QSAR) for the prediction of plasma protein binding. Protein binding values for 794 compounds were collated from literature. The data was partitioned into a training set of 662 compounds and an external validation set of 132 compounds. Physicochemical and molecular descriptors were calculated for each compound using ACD labs/logD, MOE (Chemical Computing Group) and Symyx QSAR software packages. Several data mining tools were employed for the construction of models. These included stepwise regression analysis, Classification and Regression Trees (CART), Boosted trees and Random Forest. Several predictive models were identified; however, one model in particular produced significantly superior prediction accuracy for the external validation set as measured using mean absolute error and correlation coefficient. The selected model was a boosted regression tree model which had the mean absolute error for training set of 13.25 and for validation set of 14.96. Plasma protein binding can be modeled using simple regression trees or multiple linear regressions with reasonable model accuracies. These interpretable models were able to identify the governing molecular factors for a high ppb that included hydrophobicity, van der Waals surface area parameters, and aromaticity. On the other hand, the more complicated ensemble method of boosted regression trees produced the most accurate ppb estimations for the external validation set.

  7. Capacitance-modulated transistor detects odorant binding protein chiral interactions

    Science.gov (United States)

    Mulla, Mohammad Yusuf; Tuccori, Elena; Magliulo, Maria; Lattanzi, Gianluca; Palazzo, Gerardo; Persaud, Krishna; Torsi, Luisa

    2015-01-01

    Peripheral events in olfaction involve odorant binding proteins (OBPs) whose role in the recognition of different volatile chemicals is yet unclear. Here we report on the sensitive and quantitative measurement of the weak interactions associated with neutral enantiomers differentially binding to OBPs immobilized through a self-assembled monolayer to the gate of an organic bio-electronic transistor. The transduction is remarkably sensitive as the transistor output current is governed by the small capacitance of the protein layer undergoing minute changes as the ligand-protein complex is formed. Accurate determination of the free-energy balances and of the capacitance changes associated with the binding process allows derivation of the free-energy components as well as of the occurrence of conformational events associated with OBP ligand binding. Capacitance-modulated transistors open a new pathway for the study of ultra-weak molecular interactions in surface-bound protein-ligand complexes through an approach that combines bio-chemical and electronic thermodynamic parameters.

  8. Immunoglobulin classes, metal binding proteins, and trace metals in ...

    African Journals Online (AJOL)

    , IgA and IgM), metal binding proteins (Transferrin, Caeruloplasmin, Alpha-2- Macroglobulin and Haptoglobin) and nutritionally essential trace metals/heavy metals (Zn, Fe, Se, Cu, Mg, Cd and Pb) in Nigerian cassava processors using single ...

  9. Damage-specific DNA-binding proteins from human cells

    Energy Technology Data Exchange (ETDEWEB)

    Kanjilal, S.

    1992-01-01

    The primary objective of the study was to detect and characterize factors from human cells that bind DNA damaged by ultraviolet radiation. An application of the gel-shift assay was devised in which a DNA probe was UV-irradiated and compared with non-irradiated probe DNA for the ability to bind to such factors in cell extracts. UV-dose dependent binding proteins were identified. Formation of the DNA-protein complexes was independent of the specific sequence, form or source of the DNA. There was a marked preference for lesions on double stranded DNA over those on single stranded DNA. DNA irradiated with gamma rays did not compete with UV-irradiated DNA for the binding activities. Cell lines from patients with genetic diseases associated with disorders of the DNA repair system were screened for the presence of damaged-DNA-binding activities. Simultaneous occurrence of the clinical symptoms of some of these diseases had been previously documented and possible links between the syndromes proposed. However, supporting biochemical or molecular evidence for such associations were lacking. The data from the present investigations indicate that some cases of Xeroderma Pigmentosum group A, Cockayne's Syndrome, Bloom's Syndrome and Ataxia Telangiectasia, all of which exhibit sensitivity to UV or gamma radiation, share an aberrant damaged-DNA-binding factor. These findings support the hypothesis that some of the repair disorder diseases are closely related and may have arisen from a common defect. Partial purification of the binding activities from HeLa cells was achieved. Size-exclusion chromatography resolved the activities into various peaks, one of which was less damage-specific than the others as determined by competition studies using native or UV-irradiated DNA. Some of the activities were further separated by ion-exchange chromatography. On using affinity chromatography methods, the major damage-binding factor could be eluted in the presence of 2 M KCl and 1

  10. Human ribosomal protein L7 binds RNA with an alpha-helical arginine-rich and lysine-rich domain.

    Science.gov (United States)

    Hemmerich, P; Bosbach, S; von Mikecz, A; Krawinkel, U

    1997-05-01

    In this study we mapped the RNA-binding domain of human ribosomal protein L7 and characterized its conformation-dependent RNA-binding specificity. Binding competition assays demonstrated preferential binding of L7 to mRNAs and rRNA, but not to tRNA. The ribohomopolymer poly(G) is bound with high affinity whereas poly(U), poly(C), or poly(A) show low affinity to L7. Furthermore, L7 binds to double-stranded but not to single-stranded DNA. Deletion mapping showed that the RNA-binding domain of L7 is represented by an arginine-rich and lysine-rich oligopeptide (ELKIKRLRKKFAQKMLRKARRK), which is reminiscent of the arginine-rich motif (ARM) found in one family of RNA-binding proteins. The isolated RNA-binding domain is capable of high-affinity binding to the Rev-responsive element (RRE) of human immunodeficiency virus type 1 in vitro. Circular dichroic studies demonstrated a concentration-dependent and ligand-induced alpha-helical transition of a synthetic peptide carrying the arginine-lysine-rich RNA-binding domain of protein L7. Peptides carrying a mutation that destroys the alpha-helical conformation do not bind RNA.

  11. Sampling and energy evaluation challenges in ligand binding protein design.

    Science.gov (United States)

    Dou, Jiayi; Doyle, Lindsey; Jr Greisen, Per; Schena, Alberto; Park, Hahnbeom; Johnsson, Kai; Stoddard, Barry L; Baker, David

    2017-12-01

    The steroid hormone 17α-hydroxylprogesterone (17-OHP) is a biomarker for congenital adrenal hyperplasia and hence there is considerable interest in development of sensors for this compound. We used computational protein design to generate protein models with binding sites for 17-OHP containing an extended, nonpolar, shape-complementary binding pocket for the four-ring core of the compound, and hydrogen bonding residues at the base of the pocket to interact with carbonyl and hydroxyl groups at the more polar end of the ligand. Eight of 16 designed proteins experimentally tested bind 17-OHP with micromolar affinity. A co-crystal structure of one of the designs revealed that 17-OHP is rotated 180° around a pseudo-two-fold axis in the compound and displays multiple binding modes within the pocket, while still interacting with all of the designed residues in the engineered site. Subsequent rounds of mutagenesis and binding selection improved the ligand affinity to nanomolar range, while appearing to constrain the ligand to a single bound conformation that maintains the same "flipped" orientation relative to the original design. We trace the discrepancy in the design calculations to two sources: first, a failure to model subtle backbone changes which alter the distribution of sidechain rotameric states and second, an underestimation of the energetic cost of desolvating the carbonyl and hydroxyl groups of the ligand. The difference between design model and crystal structure thus arises from both sampling limitations and energy function inaccuracies that are exacerbated by the near two-fold symmetry of the molecule. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.

  12. Deoxyribonucleic-binding homeobox proteins are augmented in human cancer

    DEFF Research Database (Denmark)

    Wewer, U M; Mercurio, A M; Chung, S Y

    1990-01-01

    the highly conserved 60 amino acid homeodomain. This peptide antiserum recognized a protein species of molecular weight 63,000 in immunoblots of nuclear extracts obtained from several tumor cell lines. The predominant molecular weight 63,000 nuclear protein recognized by the peptide antiserum...... the same patients exhibited little immunoreactivity. Both the peptide antiserum and the polyclonal antiserum against the native protein immunoblotted a molecular weight 63,000 protein in nuclear extracts of tumor tissue, but not significantly in extracts of normal tissue. At the molecular level......Homeobox genes encode sequence-specific DNA-binding proteins that are involved in the regulation of gene expression during embryonic development. In this study, we examined the expression of homeobox proteins in human cancer. Antiserum was obtained against a synthetic peptide derived from...

  13. Lactoferrin, an iron-binding protein in neutrophilic leukocytes.

    Science.gov (United States)

    Masson, P L; Heremans, J F; Schonne, E

    1969-09-01

    Lactoferrin, an iron-binding protein previously shown to occur in many external secretions, is identified as one of the major proteins present in human and guinea pig neutrophilic polymorphonuclear leukocytes. The identification of this protein in leukocyte extracts was based upon a comparison of its electrophoretic, antigenic, and iron-combining properties with the corresponding properties of the same protein isolated from human and guinea pig milk. Immunochemical quantitations showed that lactoferrin occurs in human neutrophilic leukocytes at the concentration of 3 microg per 10(6) cells. Tissue cultures from guinea pig bone marrow and spleen actively synthesized the protein, as shown both by net production of lactoferrin and incorporation of labeled amino acids into the protein. Immunohistochemical data indicate that lactoferrin first appears in myeloid cells at the stage of the promyelocyte.

  14. Estradiol up-regulates L-type Ca2+channels via membrane-bound estrogen receptor / Phosphoinositide-3kinase / Akt / cAMP response element-binding protein signaling pathway.

    Science.gov (United States)

    Yang, Xiaoyan; Mao, Xiaofang; Xu, Gao; Xing, Shasha; Chattopadhyay, Ansuman; Jin, Si; Salama, Guy

    2018-01-09

    In long QT type-2 (LQT2), women are more prone to lethal arrhythmias called Torsade de Pointes (TdP) than men. We previously reported that 17-β-estradiol (E2) upregulates L-type Ca 2+ -channels and current (I Ca,L ) (∼30%) in rabbit ventricular myocytes by a classical genomic-mechanism mediated by estrogen-receptor-α (ER)α. In LQT2 ( I Kr -blockade or bradycardia), the higher Ca 2+ influx via I Ca,L , causes Ca 2+ -overload, spontaneous sarcoplasmic reticulum Ca 2+ -release, and re-activation of I Ca,L that trigger early afterdepolarizations (EADs) and TdP. The molecular mechanisms whereby E2 upregulates I Ca,L are poorly understood and are now investigated. H9C2 and rat myocytes were incubated with E2, ±ER antagonist, or inhibitors of downstream transcription factors 24 hours, followed by Western blots of Cav1.2α1C and voltage-clamp measurements of I Ca,L . Incubation of H9C2 cells with E2 (10∼100 nM) increased I Ca,L density and Cav1.2α1C expression which were suppressed by the ER-antagonist ICI-182,780 (1μM). Enhanced I Ca,L and Cav1.2α1C expression by E2 was suppressed by inhibitors of Pi3K (LY294002=30μM; pL via plasma-membrane ER, and activating a Pi3K, Akt and CREB signaling. The promoter regions of CACNA1C gene (human-rabbit-rat) contain adjacent/overlapping binding-sites for p-CREB and ERα which suggest a synergistic regulation by these pathways. Copyright © 2018. Published by Elsevier Inc.

  15. Treponema pallidum receptor binding proteins interact with fibronectin

    Energy Technology Data Exchange (ETDEWEB)

    Peterson, K.M.; Baseman, J.B.; Alderete, J.F.

    1983-06-01

    Analysis of plasma proteins avidly bound to T. pallidum surfaces revealed the ability of T. pallidum to acquire numerous host macromolecules. No acquisition was evident by the avirulent spirochete, T. phagedenis biotype Reiter. Western blotting technology using hyperimmune antifibronectin serum as a probe revealed the ability of virulent treponemes to avidly bind fibronectin from a complex medium such as plasma. The specificity of the tiplike adherence of motile T. pallidum to fibronectin-coated glass surfaces and to fibronectin on HEp-2 cells was reinforced by the observation that pretreatment of coverslips or cell monolayers with monospecific antiserum against fibronectin substantially reduced T. pallidum attachment. The stoichiometric binding of T. pallidum to fibronectin-coated coverslips and the inability of unlabeled or /sup 35/S-radiolabeled treponemes to interact with glass surfaces treated with other plasma proteins further established the specific nature of the interaction between virulent T. pallidum and fibronectin. The avid association between three outer envelope proteins of T. pallidum and fibronectin was also demonstrated. These treponemal surface proteins have been previously identified as putative receptor-binding proteins responsible for T. pallidum parasitism of host cells. The data suggest that surface fibronectin mediates tip-oriented attachment of T. pallidum to host cells via a receptor-ligand mechanism of recognition.

  16. TAK1-binding protein 1 is a pseudophosphatase

    OpenAIRE

    Conner, Sarah H; Kular, Gursant; Peggie, Mark; Shepherd, Sharon; Schüttelkopf, Alexander W; Cohen, Philip; van Aalten, Daan M.F.

    2006-01-01

    Abstract TAB1 (TAK1-binding protein 1) is one of the regulatory subunits of TGF{beta}-activated kinase 1 (TAK1), a protein kinase that lies at the head of three pro-inflammatory kinase cascades. Here we report the crystal structure of the N-terminal domain of TAB1. Surprisingly, TAB1 possesses a fold closely related to that of the PPM phosphatase family as demonstrated by the close structural similarity with protein phosphatase 2C{alpha}. However, we were unable to detect any phosp...

  17. Engineering periplasmic ligand binding proteins as glucose nanosensors

    Directory of Open Access Journals (Sweden)

    Constance J. Jeffery

    2011-01-01

    Full Text Available Diabetes affects over 100 million people worldwide. Better methods for monitoring blood glucose levels are needed for improving disease management. Several labs have previously made glucose nanosensors by modifying members of the periplasmic ligand binding protein superfamily. This minireview summarizes recent developments in constructing new versions of these proteins that are responsive within the physiological range of blood glucose levels, employ new reporter groups, and/or are more robust. These experiments are important steps in the development of novel proteins that have the characteristics needed for an implantable glucose nanosensor for diabetes management: specificity for glucose, rapid response, sensitivity within the physiological range of glucose concentrations, reproducibility, and robustness.

  18. New fluorescent probes for ligand-binding assays of odorant-binding proteins.

    Science.gov (United States)

    Mastrogiacomo, Rosa; Iovinella, Immacolata; Napolitano, Elio

    2014-03-28

    Fluorescence-linked binding assays allow determination of dissociation constants at equilibrium and have recently become increasingly popular, thanks to their ease of operation. Currently used probes, such as 1-aminoanthracene and N-phenyl-1-naphthylamine, are excited and emit in the ultraviolet region, but alternative ligands operating in the visible spectrum would be highly desirable for applications in biosensing devices. Based on the two above structures, we have designed and synthesised six new fluorescent probes to be used in ligand-binding assays. The compounds are derivatives of naphatalene, anthracene and fluoranthene and present two aromatic moieties linked by an amine nitrogen. We have measured the emission spectra of the new probes and their binding to three odorant-binding proteins. The probes bind the tested proteins with different affinities, generally with dissociation constants about one order of magnitude lower than the parent compounds. The extended aromatic systems present in the new compounds produced a shift of both excitation and emission peaks at higher wavelength, close or within the visible spectrum, thus facilitating measurements in biosensors for odorants and small organic molecules using optical devices. Copyright © 2014. Published by Elsevier Inc.

  19. Thermal unfolding of a Ca- and Lanthanide-binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Fahmy, Karim [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). Biophysics; Goettfert, M. [Technische Univ. Dresden (Germany); Knoeppel, J.

    2017-06-01

    The MIIA (metal ion-induced autocleavage)-domain of the protein Vic001052 from the pathogen Vibrio coralliilyticus, comprises 173 amino acids and exhibits Ca-dependent autoproteolytic activity. It shows homology to nodulation proteins which are secreted by Rhizobiacea into plant host cells where they exert Ca-dependent functions. We have studied the structural and energetic aspects of metal protein interactions of the MIIA domain which appear attractive for engineering metal-binding synthetic peptides. Using a non-cleavable MIIA domain construct, we detected very similar structural changes upon binding to Ca{sup 2+} and Eu{sup 3+}. The thermal denaturation of the Ca-bound state was studied by circular dichroism spectroscopy. The metal-bound folded state unfolds reversibly into an unstructured metal-free state similar to the metal-free state at room temperature.

  20. Factors Affecting the Binding of a Recombinant Heavy Metal-Binding Domain (CXXC motif) Protein to Heavy Metals

    OpenAIRE

    Kamala Boonyodying; Thanakorn Watcharasupat; Waranan Yotpanya; Thawatchai Kitti; Wanna Kawang; Duangkamol Kunthalert; Sutthirat Sitthisak

    2012-01-01

    A number of heavy metal-binding proteins have been used to study bioremediation. CXXC motif, a metal binding domain containing Cys-X-X-Cys motif, has been identified in various organisms. These proteins are capable of binding various types of heavy metals. In this study, heavy metal binding domain (CXXC motif) recombinant protein encoded from mcsA gene of S. aureus were cloned and overexpressed in Escherichia coli. The factors involved in the metal-binding activity were determined in order to...

  1. Protein-folding location can regulate manganese-binding versus copper- or zinc-binding.

    Science.gov (United States)

    Tottey, Steve; Waldron, Kevin J; Firbank, Susan J; Reale, Brian; Bessant, Conrad; Sato, Katsuko; Cheek, Timothy R; Gray, Joe; Banfield, Mark J; Dennison, Christopher; Robinson, Nigel J

    2008-10-23

    Metals are needed by at least one-quarter of all proteins. Although metallochaperones insert the correct metal into some proteins, they have not been found for the vast majority, and the view is that most metalloproteins acquire their metals directly from cellular pools. However, some metals form more stable complexes with proteins than do others. For instance, as described in the Irving-Williams series, Cu(2+) and Zn(2+) typically form more stable complexes than Mn(2+). Thus it is unclear what cellular mechanisms manage metal acquisition by most nascent proteins. To investigate this question, we identified the most abundant Cu(2+)-protein, CucA (Cu(2+)-cupin A), and the most abundant Mn(2+)-protein, MncA (Mn(2+)-cupin A), in the periplasm of the cyanobacterium Synechocystis PCC 6803. Each of these newly identified proteins binds its respective metal via identical ligands within a cupin fold. Consistent with the Irving-Williams series, MncA only binds Mn(2+) after folding in solutions containing at least a 10(4) times molar excess of Mn(2+) over Cu(2+) or Zn(2+). However once MncA has bound Mn(2+), the metal does not exchange with Cu(2+). MncA and CucA have signal peptides for different export pathways into the periplasm, Tat and Sec respectively. Export by the Tat pathway allows MncA to fold in the cytoplasm, which contains only tightly bound copper or Zn(2+) (refs 10-12) but micromolar Mn(2+) (ref. 13). In contrast, CucA folds in the periplasm to acquire Cu(2+). These results reveal a mechanism whereby the compartment in which a protein folds overrides its binding preference to control its metal content. They explain why the cytoplasm must contain only tightly bound and buffered copper and Zn(2+).

  2. New Insights into Functional Roles of the Polypyrimidine Tract-Binding Protein

    Directory of Open Access Journals (Sweden)

    Maria Grazia Romanelli

    2013-11-01

    Full Text Available Polypyrimidine Tract Binding Protein (PTB is an intensely studied RNA binding protein involved in several post-transcriptional regulatory events of gene expression. Initially described as a pre-mRNA splicing regulator, PTB is now widely accepted as a multifunctional protein shuttling between nucleus and cytoplasm. Accordingly, PTB can interact with selected RNA targets, structural elements and proteins. There is increasing evidence that PTB and its paralog PTBP2 play a major role as repressors of alternatively spliced exons, whose transcription is tissue-regulated. In addition to alternative splicing, PTB is involved in almost all steps of mRNA metabolism, including polyadenylation, mRNA stability and initiation of protein translation. Furthermore, it is well established that PTB recruitment in internal ribosome entry site (IRES activates the translation of picornaviral and cellular proteins. Detailed studies of the structural properties of PTB have contributed to our understanding of the mechanism of RNA binding by RNA Recognition Motif (RRM domains. In the present review, we will describe the structural properties of PTB, its paralogs and co-factors, the role in post-transcriptional regulation and actions in cell differentiation and pathogenesis. Defining the multifunctional roles of PTB will contribute to the understanding of key regulatory events in gene expression.

  3. Gemin5: A Multitasking RNA-Binding Protein Involved in Translation Control

    Directory of Open Access Journals (Sweden)

    David Piñeiro

    2015-04-01

    Full Text Available Gemin5 is a RNA-binding protein (RBP that was first identified as a peripheral component of the survival of motor neurons (SMN complex. This predominantly cytoplasmic protein recognises the small nuclear RNAs (snRNAs through its WD repeat domains, allowing assembly of the SMN complex into small nuclear ribonucleoproteins (snRNPs. Additionally, the amino-terminal end of the protein has been reported to possess cap-binding capacity and to interact with the eukaryotic initiation factor 4E (eIF4E. Gemin5 was also shown to downregulate translation, to be a substrate of the picornavirus L protease and to interact with viral internal ribosome entry site (IRES elements via a bipartite non-canonical RNA-binding site located at its carboxy-terminal end. These features link Gemin5 with translation control events. Thus, beyond its role in snRNPs biogenesis, Gemin5 appears to be a multitasking protein cooperating in various RNA-guided processes. In this review, we will summarise current knowledge of Gemin5 functions. We will discuss the involvement of the protein on translation control and propose a model to explain how the proteolysis fragments of this RBP in picornavirus-infected cells could modulate protein synthesis.

  4. A mosquito hemolymph odorant-binding protein family member specifically binds juvenile hormone

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Il Hwan; Pham, Van; Jablonka, Willy; Goodman, Walter G.; Ribeiro, José M. C.; Andersen, John F.

    2017-07-27

    Juvenile hormone (JH) is a key regulator of insect development and reproduction. In adult mosquitoes, it is essential for maturation of the ovary and normal male reproductive behavior, but how JH distribution and activity is regulated after secretion is unclear. Here, we report a new type of specific JH-binding protein, given the name mosquito juvenile hormone-binding protein (mJHBP), which circulates in the hemolymph of pupal and adult Aedes aegypti males and females. mJHBP is a member of the odorant-binding protein (OBP) family, and orthologs are present in the genomes of Aedes, Culex, and Anopheles mosquito species. Using isothermal titration calorimetry, we show that mJHBP specifically binds JH II and JH III but not eicosanoids or JH derivatives. mJHBP was crystallized in the presence of JH III and found to have a double OBP domain structure reminiscent of salivary “long” D7 proteins of mosquitoes. We observed that a single JH III molecule is contained in the N-terminal domain binding pocket that is closed in an apparent conformational change by a C-terminal domain-derived α-helix. The electron density for the ligand indicated a high occupancy of the natural 10R enantiomer of JH III. Of note, mJHBP is structurally unrelated to hemolymph JHBP from lepidopteran insects. A low level of expression of mJHBP in Ae. aegypti larvae suggests that it is primarily active during the adult stage where it could potentially influence the effects of JH on egg development, mating behavior, feeding, or other processes.

  5. Milk proteins interact with goat Binder of SPerm (BSP) proteins and decrease their binding to sperm.

    Science.gov (United States)

    de Menezes, Erika Bezerra; van Tilburg, Mauricio; Plante, Geneviève; de Oliveira, Rodrigo V; Moura, Arlindo A; Manjunath, Puttaswamy

    2016-11-01

    Seminal plasma Binder of SPerm (BSP) proteins bind to sperm at ejaculation and promote capacitation. When in excess, however, BSP proteins damage the sperm membrane. It has been suggested that milk components of semen extenders associate with BSP proteins, potentially protecting sperm. Thus, this study was conducted to investigate if milk proteins interact with BSP proteins and reduce BSP binding to goat sperm. Using gel filtration chromatography, milk was incubated with goat seminal plasma proteins and loaded onto columns with and without calcium. Milk was also fractionated into parts containing mostly whey proteins or mostly caseins, incubated with seminal plasma proteins and subjected to gel filtration. Eluted fractions were evaluated by immunoblot using anti-goat BSP antibodies, confirming milk protein-BSP protein interactions. As determined by ELISA, milk proteins coated on polystyrene wells bound to increasing of goat BSP proteins. Far-western dot blots confirmed that BSP proteins bound to caseins and β-lactoglobulin in a concentration-dependent manner. Then, cauda epididymal sperm from five goats was incubated with seminal plasma; seminal plasma followed by milk; and milk followed by seminal plasma. Sperm membrane proteins were extracted and evaluated by immunoblotting. The pattern of BSP binding to sperm membrane proteins was reduced by 59.3 % when epididymal sperm were incubated with seminal plasma and then with skimmed milk (p sperm were treated with milk followed by seminal plasma, coating of sperm with BSP proteins was not significantly reduced (57.6 %; p > 0.05). In conclusion, goat BSP proteins have an affinity for caseins and whey proteins. Milk reduces BSP binding to goat sperm, depending whether or not sperm had been previously exposed to seminal plasma. Such events may explain the protective effect of milk during goat sperm preservation.

  6. Biomass, Mineral Elements and Protein Contents of Six Freshwater ...

    African Journals Online (AJOL)

    Biomass, Mineral Elements and Protein Contents of Six Freshwater Macrophytes from Ghana. ... Ghana Journal of Science ... The fresh and dry weights of the plants were measured and the concentration of six elements: calcium, magnesium, nitrogen, phosphorus, potassium and sodium in the tissues of the plants were ...

  7. Physicochemical characteristics of structurally determined metabolite-protein and drug-protein binding events with respect to binding specificity.

    Science.gov (United States)

    Korkuć, Paula; Walther, Dirk

    2015-01-01

    To better understand and ultimately predict both the metabolic activities as well as the signaling functions of metabolites, a detailed understanding of the physical interactions of metabolites with proteins is highly desirable. Focusing in particular on protein binding specificity vs. promiscuity, we performed a comprehensive analysis of the physicochemical properties of compound-protein binding events as reported in the Protein Data Bank (PDB). We compared the molecular and structural characteristics obtained for metabolites to those of the well-studied interactions of drug compounds with proteins. Promiscuously binding metabolites and drugs are characterized by low molecular weight and high structural flexibility. Unlike reported for drug compounds, low rather than high hydrophobicity appears associated, albeit weakly, with promiscuous binding for the metabolite set investigated in this study. Across several physicochemical properties, drug compounds exhibit characteristic binding propensities that are distinguishable from those associated with metabolites. Prediction of target diversity and compound promiscuity using physicochemical properties was possible at modest accuracy levels only, but was consistently better for drugs than for metabolites. Compound properties capturing structural flexibility and hydrogen-bond formation descriptors proved most informative in PLS-based prediction models. With regard to diversity of enzymatic activities of the respective metabolite target enzymes, the metabolites benzylsuccinate, hypoxanthine, trimethylamine N-oxide, oleoylglycerol, and resorcinol showed very narrow process involvement, while glycine, imidazole, tryptophan, succinate, and glutathione were identified to possess broad enzymatic reaction scopes. Promiscuous metabolites were found to mainly serve as general energy currency compounds, but were identified to also be involved in signaling processes and to appear in diverse organismal systems (digestive and nervous

  8. Physicochemical characteristics of structurally determined metabolite-protein and drug-protein binding events with respect to binding specificity

    Science.gov (United States)

    Korkuć, Paula; Walther, Dirk

    2015-01-01

    To better understand and ultimately predict both the metabolic activities as well as the signaling functions of metabolites, a detailed understanding of the physical interactions of metabolites with proteins is highly desirable. Focusing in particular on protein binding specificity vs. promiscuity, we performed a comprehensive analysis of the physicochemical properties of compound-protein binding events as reported in the Protein Data Bank (PDB). We compared the molecular and structural characteristics obtained for metabolites to those of the well-studied interactions of drug compounds with proteins. Promiscuously binding metabolites and drugs are characterized by low molecular weight and high structural flexibility. Unlike reported for drug compounds, low rather than high hydrophobicity appears associated, albeit weakly, with promiscuous binding for the metabolite set investigated in this study. Across several physicochemical properties, drug compounds exhibit characteristic binding propensities that are distinguishable from those associated with metabolites. Prediction of target diversity and compound promiscuity using physicochemical properties was possible at modest accuracy levels only, but was consistently better for drugs than for metabolites. Compound properties capturing structural flexibility and hydrogen-bond formation descriptors proved most informative in PLS-based prediction models. With regard to diversity of enzymatic activities of the respective metabolite target enzymes, the metabolites benzylsuccinate, hypoxanthine, trimethylamine N-oxide, oleoylglycerol, and resorcinol showed very narrow process involvement, while glycine, imidazole, tryptophan, succinate, and glutathione were identified to possess broad enzymatic reaction scopes. Promiscuous metabolites were found to mainly serve as general energy currency compounds, but were identified to also be involved in signaling processes and to appear in diverse organismal systems (digestive and nervous

  9. ASC Pyrin Domain Self-associates and Binds NLRP3 Protein Using Equivalent Binding Interfaces *

    Science.gov (United States)

    Oroz, Javier; Barrera-Vilarmau, Susana; Alfonso, Carlos; Rivas, Germán; de Alba, Eva

    2016-01-01

    Death domain superfamily members typically act as adaptors mediating in the assembly of supramolecular complexes with critical apoptosis and inflammation functions. These modular proteins consist of death domains, death effector domains, caspase recruitment domains, and pyrin domains (PYD). Despite the high structural similarity among them, only homotypic interactions participate in complex formation, suggesting that subtle factors differentiate each interaction type. It is thus critical to identify these factors as an essential step toward the understanding of the molecular basis of apoptosis and inflammation. The proteins apoptosis-associated speck-like protein containing a CARD (ASC) and NLRP3 play key roles in the regulation of apoptosis and inflammation through self-association and protein-protein interactions mediated by their PYDs. To better understand the molecular basis of their function, we have characterized ASC and NLRP3 PYD self-association and their intermolecular interaction by solution NMR spectroscopy and analytical ultracentrifugation. We found that ASC self-associates and binds NLRP3 PYD through equivalent protein regions, with higher binding affinity for the latter. These regions are located at opposite sides of the protein allowing multimeric complex formation previously shown in ASC PYD fibril assemblies. We show that NLRP3 PYD coexists in solution as a monomer and highly populated large-order oligomerized species. Despite this, we determined its monomeric three-dimensional solution structure by NMR and characterized its binding to ASC PYD. Using our novel structural data, we propose molecular models of ASC·ASC and ASC·NLRP3 PYD early supramolecular complexes, providing new insights into the molecular mechanisms of inflammasome and apoptosis signaling. PMID:27432880

  10. A novel zinc finger-containing RNA-binding protein conserved from fruitflies to humans

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, F.R. [Tufts Univ. School of Medicine, Boston, MA (United States)]|[Worcester Foundation for Biomedical Research, Shrewbury, MA (United States); Banfi, S.; Guffanti, A. [Telethon Institute of Genetics and Medicine (TIGEM), Milan (Italy)] [and others

    1997-05-01

    The Drosophila lark gene encodes an essential RNA-binding protein of the RNA recognition motif (RRM) class that is required during embryonic development. Genetic analysis demonstrates that it also functions as a molecular element of a circadian clock output pathway, mediating the temporal regulation of adult emergence in the fruitfly. We now report the molecular characterization of a human gene with significant similarity to lark. Based on fluorescence in situ hybridization and radiation hybrid mapping, the human gene has been localized to chromosome region 11q13; it is closely linked to several identified genes including the locus of Bardet-Biedl syndrome type 1. The lark-homologous human gene expresses a single 1.8-kb size class of mRNA in most or all tissues including brain. Additional database searches have identified a mouse counterpart that is virtually identical to the human protein. Similar to lark protein, both mammalian proteins contain two copies of the RRM-type consensus RNA-binding motif. Unlike most RRM family members, however, the Drosophila and mammalian proteins also contain a retroviral-type (RT) zinc finger that is situated 43 residues C-terminal to the second RRM element. Within a 184-residue segment spanning the RRM elements and the RT zinc finger, the human and mouse proteins are 61% similar to the Drosophila lark sequence. These common sequence features and comparisons among a large collection of RRM proteins suggest that the human and mouse proteins represent homologues of Drosophila lark. 44 refs., 5 figs.

  11. Yersinia enterocolitica serum resistance proteins YadA and ail bind the complement regulator C4b-binding protein.

    Directory of Open Access Journals (Sweden)

    Vesa Kirjavainen

    Full Text Available Many pathogens are equipped with factors providing resistance against the bactericidal action of complement. Yersinia enterocolitica, a Gram-negative enteric pathogen with invasive properties, efficiently resists the deleterious action of human complement. The major Y. enterocolitica serum resistance determinants include outer membrane proteins YadA and Ail. Lipopolysaccharide (LPS O-antigen (O-ag and outer core (OC do not contribute directly to complement resistance. The aim of this study was to analyze a possible mechanism whereby Y. enterocolitica could inhibit the antibody-mediated classical pathway of complement activation. We show that Y. enterocolitica serotypes O:3, O:8, and O:9 bind C4b-binding protein (C4bp, an inhibitor of both the classical and lectin pathways of complement. To identify the C4bp receptors on Y. enterocolitica serotype O:3 surface, a set of mutants expressing YadA, Ail, O-ag, and OC in different combinations was tested for the ability to bind C4bp. The studies showed that both YadA and Ail acted as C4bp receptors. Ail-mediated C4bp binding, however, was blocked by the O-ag and OC, and could be observed only with mutants lacking these LPS structures. C4bp bound to Y. enterocolitica was functionally active and participated in the factor I-mediated degradation of C4b. These findings show that Y. enterocolitica uses two proteins, YadA and Ail, to bind C4bp. Binding of C4bp could help Y. enterocolitica to evade complement-mediated clearance in the human host.

  12. Regulation of IGF binding protein proteolysis by pregnancy-associated plasma protein-ARegulation of IGF binding protein proteolysis by pregnancy-associated plasma protein-A

    DEFF Research Database (Denmark)

    Gaidamauskas, Ervinas

    During his PhD studies, Ervinas Gaidamauskas researched the proteins pregnancy-associated plasma protein-A (PAPP-A) and its homologue PAPP-A2 in vitro. As suggested by its name, PAPP-A plays an important role in pregnancy and fetal development. Additionally, recent studies indicate a newly...... recognised role for PAPP-A in ageing and in the development of age-related disease. PAPP-A is a secreted metalloproteinase that cleaves insulin-like growth factor binding proteins (IGFBPs). Ervinas Gaidamauskas studied the mechanism of IGF-modulated proteolysis of IGFBPs by PAPP-A and the structural...... determinants for cleavage. Using small-angle X-ray scattering (SAXS), he also analysed the intermodular structural organisation of the C-terminal domain of PAPP-A involved in substrate binding. Detailed knowledge of interactions between PAPP-A and its substrates is required to understand the modulatory role...

  13. Sampling and energy evaluation challenges in ligand binding protein design

    Science.gov (United States)

    Dou, Jiayi; Doyle, Lindsey; Jr. Greisen, Per; Schena, Alberto; Park, Hahnbeom; Johnsson, Kai; Stoddard, Barry L.

    2017-01-01

    Abstract The steroid hormone 17α‐hydroxylprogesterone (17‐OHP) is a biomarker for congenital adrenal hyperplasia and hence there is considerable interest in development of sensors for this compound. We used computational protein design to generate protein models with binding sites for 17‐OHP containing an extended, nonpolar, shape‐complementary binding pocket for the four‐ring core of the compound, and hydrogen bonding residues at the base of the pocket to interact with carbonyl and hydroxyl groups at the more polar end of the ligand. Eight of 16 designed proteins experimentally tested bind 17‐OHP with micromolar affinity. A co‐crystal structure of one of the designs revealed that 17‐OHP is rotated 180° around a pseudo‐two‐fold axis in the compound and displays multiple binding modes within the pocket, while still interacting with all of the designed residues in the engineered site. Subsequent rounds of mutagenesis and binding selection improved the ligand affinity to nanomolar range, while appearing to constrain the ligand to a single bound conformation that maintains the same “flipped” orientation relative to the original design. We trace the discrepancy in the design calculations to two sources: first, a failure to model subtle backbone changes which alter the distribution of sidechain rotameric states and second, an underestimation of the energetic cost of desolvating the carbonyl and hydroxyl groups of the ligand. The difference between design model and crystal structure thus arises from both sampling limitations and energy function inaccuracies that are exacerbated by the near two‐fold symmetry of the molecule. PMID:28980354

  14. Competition between Ski and CREB-binding protein for binding to Smad proteins in transforming growth factor-beta signaling.

    Science.gov (United States)

    Chen, Weijun; Lam, Suvana S; Srinath, Hema; Schiffer, Celia A; Royer, William E; Lin, Kai

    2007-04-13

    The family of Smad proteins mediates transforming growth factor-beta (TGF-beta) signaling in cell growth and differentiation. Smads repress or activate TGF-beta signaling by interacting with corepressors (e.g. Ski) or coactivators (e.g. CREB-binding protein (CBP)), respectively. Specifically, Ski has been shown to interfere with the interaction between Smad3 and CBP. However, it is unclear whether Ski competes with CBP for binding to Smads and whether they can interact with Smad3 at the same binding surface on Smad3. We investigated the interactions among purified constructs of Smad, Ski, and CBP in vitro by size-exclusion chromatography, isothermal titration calorimetry, and mutational studies. Here, we show that Ski-(16-192) interacted directly with a homotrimer of receptor-regulated Smad protein (R-Smad), e.g. Smad2 or Smad3, to form a hexamer; Ski-(16-192) interacted with an R-Smad.Smad4 heterotrimer to form a pentamer. CBP-(1941-1992) was also found to interact directly with an R-Smad homotrimer to form a hexamer and with an R-Smad.Smad4 heterotrimer to form a pentamer. Moreover, these domains of Ski and CBP competed with each other for binding to Smad3. Our mutational studies revealed that domains of Ski and CBP interacted with Smad3 at a portion of the binding surface of the Smad anchor for receptor activation. Our results suggest that Ski negatively regulates TGF-beta signaling by replacing CBP in R-Smad complexes. Our working model suggests that Smad protein activity is delicately balanced by Ski and CBP in the TGF-beta pathway.

  15. Structural and binding studies of SAP-1 protein with heparin.

    Science.gov (United States)

    Yadav, Vikash K; Mandal, Rahul S; Puniya, Bhanwar L; Kumar, Rahul; Dey, Sharmistha; Singh, Sarman; Yadav, Savita

    2015-03-01

    SAP-1 is a low molecular weight cysteine protease inhibitor (CPI) which belongs to type-2 cystatins family. SAP-1 protein purified from human seminal plasma (HuSP) has been shown to inhibit cysteine and serine proteases and exhibit interesting biological properties, including high temperature and pH stability. Heparin is a naturally occurring glycosaminoglycan (with varied chain length) which interacts with a number of proteins and regulates multiple steps in different biological processes. As an anticoagulant, heparin enhances inhibition of thrombin by the serpin antithrombin III. Therefore, we have employed surface plasmon resonance (SPR) to improve our understanding of the binding interaction between heparin and SAP-1 (protease inhibitor). SPR data suggest that SAP-1 binds to heparin with a significant affinity (KD = 158 nm). SPR solution competition studies using heparin oligosaccharides showed that the binding of SAP-1 to heparin is dependent on chain length. Large oligosaccharides show strong binding affinity for SAP-1. Further to get insight into the structural aspect of interactions between SAP-1 and heparin, we used modelled structure of the SAP-1 and docked with heparin and heparin-derived polysaccharides. The results suggest that a positively charged residue lysine plays important role in these interactions. Such information should improve our understanding of how heparin, present in the reproductive tract, regulates cystatins activity. © 2014 John Wiley & Sons A/S.

  16. [Liquid chromatography frontal analysis of the protein binding of glimepiride].

    Science.gov (United States)

    Zhou, Da-wei; Wang, Huai-feng; Li, Fa-mei

    2005-01-01

    To study the protein binding of glimepiride. An HPLC-FA method is performed by using Pinkerton GFF II-S5-80 internal-surface reversed-phase silica support (150 mm x 4.6 mm ID, 5 microm) at pH 7.4 in a 67 mmol x L(-1) isotonic sodium phosphate buffer at 37 degree C. Other conditions included flow rate of 0.2 mL x min(-1), UV detection at wavelength 230 nm and injection volume 900 microL. Nonlinear regression parameter estimation was used for the association constant measurement of glimepiride to both primary and secondary sites, which were 5.1 (micromol x L(-1)-1 and 1 for K1 and n1, and 0.017 (micromol x L(-1))-1 and 7 for K2 and n2, respectively. The method is shown to be suitable for investigation of protein binding of glimepiride.

  17. Fragile X mental retardation protein: A paradigm for translational control by RNA-binding proteins.

    Science.gov (United States)

    Chen, Eileen; Joseph, Simpson

    2015-07-01

    Translational control is a common mechanism used to regulate gene expression and occur in bacteria to mammals. Typically in translational control, an RNA-binding protein binds to a unique sequence in the mRNA to regulate protein synthesis by the ribosomes. Alternatively, a protein may bind to or modify a translation factor to globally regulate protein synthesis by the cell. Here, we review translational control by the fragile X mental retardation protein (FMRP), the absence of which causes the neurological disease, fragile X syndrome (FXS). Copyright © 2015 Elsevier B.V. and Société française de biochimie et biologie Moléculaire (SFBBM). All rights reserved.

  18. RNA-binding proteins with prion-like domains in health and disease.

    Science.gov (United States)

    Harrison, Alice Ford; Shorter, James

    2017-04-07

    Approximately 70 human RNA-binding proteins (RBPs) contain a prion-like domain (PrLD). PrLDs are low-complexity domains that possess a similar amino acid composition to prion domains in yeast, which enable several proteins, including Sup35 and Rnq1, to form infectious conformers, termed prions. In humans, PrLDs contribute to RBP function and enable RBPs to undergo liquid-liquid phase transitions that underlie the biogenesis of various membraneless organelles. However, this activity appears to render RBPs prone to misfolding and aggregation connected to neurodegenerative disease. Indeed, numerous RBPs with PrLDs, including TDP-43 (transactivation response element DNA-binding protein 43), FUS (fused in sarcoma), TAF15 (TATA-binding protein-associated factor 15), EWSR1 (Ewing sarcoma breakpoint region 1), and heterogeneous nuclear ribonucleoproteins A1 and A2 (hnRNPA1 and hnRNPA2), have now been connected via pathology and genetics to the etiology of several neurodegenerative diseases, including amyotrophic lateral sclerosis, frontotemporal dementia, and multisystem proteinopathy. Here, we review the physiological and pathological roles of the most prominent RBPs with PrLDs. We also highlight the potential of protein disaggregases, including Hsp104, as a therapeutic strategy to combat the aberrant phase transitions of RBPs with PrLDs that likely underpin neurodegeneration. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  19. Unusual binding of ursodeoxycholic acid to ileal bile acid binding protein: role in activation of FXRα.

    Science.gov (United States)

    Fang, Changming; Filipp, Fabian V; Smith, Jeffrey W

    2012-04-01

    Ursodeoxycholic acid (UDCA, ursodiol) is used to prevent damage to the liver in patients with primary biliary cirrhosis. The drug also prevents the progression of colorectal cancer and the recurrence of high-grade colonic dysplasia. However, the molecular mechanism by which UDCA elicits its beneficial effects is not entirely understood. The aim of this study was to determine whether ileal bile acid binding protein (IBABP) has a role in mediating the effects of UDCA. We find that UDCA binds to a single site on IBABP and increases the affinity for major human bile acids at a second binding site. As UDCA occupies one of the bile acid binding sites on IBABP, it reduces the cooperative binding that is often observed for the major human bile acids. Furthermore, IBABP is necessary for the full activation of farnesoid X receptor α (FXRα) by bile acids, including UDCA. These observations suggest that IBABP may have a role in mediating some of the intestinal effects of UDCA.

  20. QSAR Models for the Prediction of Plasma Protein Binding

    Directory of Open Access Journals (Sweden)

    Zeshan Amin

    2013-02-01

    Full Text Available Introduction: The prediction of plasma protein binding (ppb is of paramount importance in the pharmacokinetics characterization of drugs, as it causes significant changes in volume of distribution, clearance and drug half life. This study utilized Quantitative Structure – Activity Relationships (QSAR for the prediction of plasma protein binding. Methods: Protein binding values for 794 compounds were collated from literature. The data was partitioned into a training set of 662 compounds and an external validation set of 132 compounds. Physicochemical and molecular descriptors were calculated for each compound using ACD labs/logD, MOE (Chemical Computing Group and Symyx QSAR software packages. Several data mining tools were employed for the construction of models. These included stepwise regression analysis, Classification and Regression Trees (CART, Boosted trees and Random Forest. Results: Several predictive models were identified; however, one model in particular produced significantly superior prediction accuracy for the external validation set as measured using mean absolute error and correlation coefficient. The selected model was a boosted regression tree model which had the mean absolute error for training set of 13.25 and for validation set of 14.96. Conclusion: Plasma protein binding can be modeled using simple regression trees or multiple linear regressions with reasonable model accuracies. These interpretable models were able to identify the governing molecular factors for a high ppb that included hydrophobicity, van der Waals surface area parameters, and aromaticity. On the other hand, the more complicated ensemble method of boosted regression trees produced the most accurate ppb estimations for the external validation set.

  1. Effect of paracetamol on the plasma protein binding of quinine ...

    African Journals Online (AJOL)

    This study was done to investigate if the co-administration of quinine and paracetamol could have an effect on the protein binding of quinine. Exactly 5ml of plasma contained in a dialysis sack was placed into 20ml of varying concentrations (2 -10µg/ml) of test sample at 37oC. 2ml of the dialysate was basified with ...

  2. Characterization of auxin-binding proteins from zucchini plasma membrane

    Science.gov (United States)

    Hicks, G. R.; Rice, M. S.; Lomax, T. L.

    1993-01-01

    We have previously identified two auxin-binding polypeptides in plasma membrane (PM) preparations from zucchini (Cucurbita pepo L.) (Hicks et al. 1989, Proc. Natl. Acad. Sci. USA 86, 4948-4952). These polypeptides have molecular weights of 40 kDa and 42 kDa and label specifically with the photoaffinity auxin analog 5-N3-7-3H-IAA (azido-IAA). Azido-IAA permits both the covalent and radioactive tagging of auxin-binding proteins and has allowed us to characterize further the 40-kDa and 42-kDa polypeptides, including the nature of their attachment to the PM, their relationship to each other, and their potential function. The azido-IAA-labeled polypeptides remain in the pelleted membrane fraction following high-salt and detergent washes, which indicates a tight and possibly integral association with the PM. Two-dimensional electrophoresis of partially purified azido-IAA-labeled protein demonstrates that, in addition to the major isoforms of the 40-kDa and 42-kDa polypeptides, which possess isoelectric points (pIs) of 8.2 and 7.2, respectively, several less abundant isoforms that display unique pIs are apparent at both molecular masses. Tryptic and chymotryptic digestion of the auxin-binding proteins indicates that the 40-kDa and 42-kDa polypeptides are closely related or are modifications of the same polypeptide. Phase extraction with the nonionic detergent Triton X-114 results in partitioning of the azido-IAA-labeled polypeptides into the aqueous (hydrophilic) phase. This apparently paradoxical behavior is also exhibited by certain integral membrane proteins that aggregate to form channels. The results of gel filtration indicate that the auxin-binding proteins do indeed aggregate strongly and that the polypeptides associate to form a dimer or multimeric complex in vivo. These characteristics are consistent with the hypothesis that the 40-kDa and 42-kDa polypeptides are subunits of a multimeric integral membrane protein which has an auxin-binding site, and which may

  3. Spatial Analysis and Quantification of the Thermodynamic Driving Forces in Protein-Ligand Binding: Binding Site Variability

    Science.gov (United States)

    Raman, E. Prabhu; MacKerell, Alexander D.

    2015-01-01

    The thermodynamic driving forces behind small molecule-protein binding are still not well understood, including the variability of those forces associated with different types of ligands in different binding pockets. To better understand these phenomena we calculate spatially resolved thermodynamic contributions of the different molecular degrees of freedom for the binding of propane and methanol to multiple pockets on the proteins Factor Xa and p38 MAP kinase. Binding thermodynamics are computed using a statistical thermodynamics based end-point method applied on a canonical ensemble comprising the protein-ligand complexes and the corresponding free states in an explicit solvent environment. Energetic and entropic contributions of water and ligand degrees of freedom computed from the configurational ensemble provides an unprecedented level of detail into the mechanisms of binding. Direct protein-ligand interaction energies play a significant role in both non-polar and polar binding, which is comparable to water reorganization energy. Loss of interactions with water upon binding strongly compensates these contributions leading to relatively small binding enthalpies. For both solutes, the entropy of water reorganization is found to favor binding in agreement with the classical view of the “hydrophobic effect”. Depending on the specifics of the binding pocket, both energy-entropy compensation and reinforcement mechanisms are observed. Notable is the ability to visualize the spatial distribution of the thermodynamic contributions to binding at atomic resolution showing significant differences in the thermodynamic contributions of water to the binding of propane versus methanol. PMID:25625202

  4. Folate and folate-binding protein content in dairy products.

    Science.gov (United States)

    Wigertz, K; Svensson, U K; Jägerstad, M

    1997-05-01

    Recent findings suggest a protective role for folates in the reduction of neural tube defects and possibly also coronary heart disease and cancer. Consequently, an increase in the daily intake of folates is warranted, which emphasizes the need for quantitative as well as qualitative measurements of dietary folates. Milk plays an important part in the food chain in many Western countries today. Several studies suggest that folate-binding proteins might have an impact on folate absorption and therefore their concentrations are also important. The mean concentration of the predominant form of folate, 5-methyltetrahydrofolate (5-CH3THF), was determined using HPLC in thirteen selected dairy products; skim milk powder, two pasteurized milks, UHT milk, two fermented milks, three whey products and four different cheeses. All results were corrected for recovery by spiking the samples with 5-CH3THF. Effects of storage of dairy products on 5-CH3THF concentrations were also investigated; generally small and insignificant fluctuations were found, except for hard cheese, in which 5-CH3THF decreased significantly. There was a significant seasonal variation in the folate concentration of pasteurized milk which peaked in the summer months. The concentrations of folate-binding protein in skim milk powder and pasteurized milk analysed using an enzyme-linked immunosorbent assay were similar. UHT milk and fermented milk, both of which are processed at temperatures > 90 degrees C, contained significantly lower concentrations of folate-binding protein.

  5. Phyletic distribution of fatty acid-binding protein genes.

    Directory of Open Access Journals (Sweden)

    Yadong Zheng

    Full Text Available Fatty acid-binding proteins (FABPs are a family of fatty acid-binding small proteins essential for lipid trafficking, energy storage and gene regulation. Although they have 20 to 70% amino acid sequence identity, these proteins share a conserved tertiary structure comprised of ten beta sheets and two alpha helixes. Availability of the complete genomes of 34 invertebrates, together with transcriptomes and ESTs, allowed us to systematically investigate the gene structure and alternative splicing of FABP genes over a wide range of phyla. Only in genomes of two cnidarian species could FABP genes not be identified. The genomic loci for FABP genes were diverse and their genomic structure varied. In particular, the intronless FABP genes, in most of which the key residues involved in fatty acid binding varied, were common in five phyla. Interestingly, several species including one trematode, one nematode and four arthropods generated FABP mRNA variants via alternative splicing. These results demonstrate that both gene duplication and post-transcriptional modifications are used to generate diverse FABPs in species studied.

  6. Structural Insights into RNA Recognition by the Alternate-Splicing Regulator CUG-Binding Protein 1

    Energy Technology Data Exchange (ETDEWEB)

    M Teplova; J Song; H Gaw; A Teplov; D Patel

    2011-12-31

    CUG-binding protein 1 (CUGBP1) regulates multiple aspects of nuclear and cytoplasmic mRNA processing, with implications for onset of myotonic dystrophy. CUGBP1 harbors three RRM domains and preferentially targets UGU-rich mRNA elements. We describe crystal structures of CUGBP1 RRM1 and tandem RRM1/2 domains bound to RNAs containing tandem UGU(U/G) elements. Both RRM1 in RRM1-RNA and RRM2 in RRM1/2-RNA complexes use similar principles to target UGU(U/G) elements, with recognition mediated by face-to-edge stacking and water-mediated hydrogen-bonding networks. The UG step adopts a left-handed Z-RNA conformation, with the syn guanine recognized through Hoogsteen edge-protein backbone hydrogen-bonding interactions. NMR studies on the RRM1/2-RNA complex establish that both RRM domains target tandem UGUU motifs in solution, whereas filter-binding assays identify a preference for recognition of GU over AU or GC steps. We discuss the implications of CUGBP1-mediated targeting and sequestration of UGU(U/G) elements on pre-mRNA alternative-splicing regulation, translational regulation, and mRNA decay.

  7. p38 Mitogen-activated protein kinase stabilizes SMN mRNA through RNA binding protein HuR.

    Science.gov (United States)

    Farooq, Faraz; Balabanian, Sylvia; Liu, Xuejun; Holcik, Martin; MacKenzie, Alex

    2009-11-01

    Spinal muscle atrophy (SMA) is an autosomal recessive neurodegenerative disease which is characterized by the loss of alpha motor neurons resulting in progressive muscle atrophy. Reduced amount of functional survival motor neuron (SMN) protein due to mutations or deletion in the SMN1 gene is the cause of SMA. A potential treatment strategy for SMA is to upregulate levels of SMN protein originating from the SMN2 gene compensating in part for the absence of functional SMN1 gene. Although there exists a sizeable literature on SMN2 inducing compounds, there is comparatively less known about the signaling pathways which modulate SMN levels. Here, we report a significant induction in SMN mRNA and protein following p38 activation by Anisomycin. We demonstrate that Anisomycin activation of p38 causes a rapid cytoplasmic accumulation of HuR, a RNA binding protein which binds to and stabilizes the AU-rich element within the SMN transcript. The stabilization of SMN mRNA, rather than transcriptional induction results in an increase in SMN protein. Our demonstration of SMN protein regulation through the p38 pathway and the role of HuR in this modulation may help in the identification and characterization of p38 pathway activators as potential therapeutic compounds for the treatment of SMA.

  8. X-linked sideroblastic anemia due to ALAS2 intron 1 enhancer element GATA-binding site mutations.

    Science.gov (United States)

    Campagna, Dean R; de Bie, Charlotte I; Schmitz-Abe, Klaus; Sweeney, Marion; Sendamarai, Anoop K; Schmidt, Paul J; Heeney, Matthew M; Yntema, Helger G; Kannengiesser, Caroline; Grandchamp, Bernard; Niemeyer, Charlotte M; Knoers, Nine V A M; Swart, Sonia; Marron, Gordon; van Wijk, Richard; Raymakers, Reinier A; May, Alison; Markianos, Kyriacos; Bottomley, Sylvia S; Swinkels, Dorine W; Fleming, Mark D

    2014-03-01

    X-linked sideroblastic anemia (XLSA) is the most common form of congenital sideroblastic anemia. In affected males, it is uniformly associated with partial loss-of-function missense mutations in the erythroid-specific heme biosynthesis protein 5-aminolevulinate synthase 2 (ALAS2). Here, we report five families with XLSA owing to mutations in a GATA transcription factor binding site located in a transcriptional enhancer element in intron 1 of the ALAS2 gene. As such, this study defines a new class of mutations that should be evaluated in patients undergoing genetic testing for a suspected diagnosis of XLSA. Copyright © 2013 Wiley Periodicals, Inc.

  9. X-linked sideroblastic anemia due to ALAS2 intron 1 enhancer element GATA binding site mutations

    Science.gov (United States)

    Campagna, Dean R.; de Bie, Charlotte I.; Schmitz-Abe, Klaus; Sweeney, Marion; Sendamarai, Anoop K.; Schmidt, Paul J.; Heeney, Matthew M.; Yntema, Helger G.; Kannengiesser, Caroline; Grandchamp, Bernard; Niemeyer, Charlotte M.; Knoers, Nine V.A.M.; Swart, Sonia; Marron, Gordon; van Wijk, Richard; Raymakers, Reinier A.; May, Alison; Markianos, Kyriacos; Bottomley, Sylvia S.; Swinkels, Dorine W.; Fleming, Mark D.

    2014-01-01

    X-linked sideroblastic anemia (XLSA) is the most common form of congenital sideroblastic anemia. In affected males, it is uniformly associated with partial loss-of-function missense mutations in the erythroid-specific heme biosynthesis protein 5-aminolevulinate synthase 2 (ALAS2). Here, we report five families with XLSA due to mutations in a GATA transcription factor binding site located in a transcriptional enhancer element in intron 1 of the ALAS2 gene. As such, this study defines a new class of mutations that should be evaluated in patients undergoing genetic testing for a suspected diagnosis of XLSA. PMID:24166784

  10. Distribution of interstitial retinol-binding protein (IRBP) in the vertebrates.

    Science.gov (United States)

    Bridges, C D; Liou, G I; Alvarez, R A; Landers, R A; Landry, A M; Fong, S L

    1986-09-01

    Immunoblots of interphotoreceptor matrix preparations from 20 species belonging to six vertebrate classes were probed with antibodies against bovine interstitial retinol-binding protein (b-IRBP). Each preparation displayed an immunoreactive protein band. In the Osteichthyes, the apparent Mr of this band was 67,600 +/- 2,700 (mean +/- SD, n = 8). In two of the Osteichthyes, the band was resolved into a closely spaced doublet. Including previously published data for five mammals and one amphibian, species from the other classes (Chondrichthyes, one species; Amphibia, four species; Reptilia, one species; Aves, one species; Mammalia, nine species) had IRBPs with Mr that averaged 2.0 times that of the Osteichthyes, namely 134,200 +/- 8,600 (mean +/- SD, n = 17). Frog IRBP was very similar to mammalian IRBP in terms of its immunohistochemical distribution (determined with rabbit anti-frog IRBP antibodies), its molecular weight (sodium dodecyl sulfate polyacrylamide gel electrophoresis and gel-filtration chromatography), retinol- and concanavalin A-binding ability, and because it was synthesized and secreted in vitro by the isolated retina but not by the pigmented layers of eye. Goldfish IRBP apparently binds exogenous (3H)-retinol but does not bind concanavalin A and has about half the Mr of frog IRBP. The occurrence of IRBP-like proteins cross-reacting with anti b-IRBP antibodies in the interphotoreceptor matrix of all six major vertebrate classes is consistent with the hypothesis that IRBP is an important element in the vertebrate visual cycle.

  11. Characterization of microtubule-binding and dimerization activity of Giardia lamblia end-binding 1 protein.

    Science.gov (United States)

    Kim, Juri; Nagami, Sara; Lee, Kyu-Ho; Park, Soon-Jung

    2014-01-01

    End-binding 1 (EB1) proteins are evolutionarily conserved components of microtubule (MT) plus-end tracking protein that regulate MT dynamics. Giardia lamblia, with two nuclei and cytoskeletal structures, requires accurate MT distribution for division. In this study, we show that a single EB1 homolog gene of G. lamblia regulates MT dynamics in mitosis. The haemagglutinin-tagged G. lamblia EB1 (GlEB1) localizes to the nuclear envelopes and median bodies, and is transiently present in mitotic spindles of dividing cells. Knockdown of GlEB1 expression using the morpholinos-based anti-EB1 oligonucleotides, resulted in a significant defect in mitosis of Giardia trophozoites. The MT-binding assays using recombinant GlEB1 (rGlEB1) proteins demonstrated that rGlEB1102-238, but not rGlEB11-184, maintains an MT-binding ability comparable with that of the full length protein, rGlEB11-238. Size exclusion chromatography showed that rGlEB1 is present as a dimer formed by its C-terminal domain and a disulfide bond. In vitro-mutagenesis of GlEB1 indicated that an intermolecular disulfide bond is made between cysteine #13 of the two monomers. Complementation assay using the BIM1 knockout mutant yeast, the yeast homolog of mammalian EB1, indicated that expression of the C13S mutant GlEB1 protein cannot rescue the mitotic defect of the BIM1 mutant yeast. These results suggest that dimerization of GlEB1 via the 13th cysteine residues plays a role during mitosis in Giardia.

  12. Characterization of Microtubule-Binding and Dimerization Activity of Giardia lamblia End-Binding 1 Protein

    Science.gov (United States)

    Kim, Juri; Nagami, Sara; Lee, Kyu-Ho; Park, Soon-Jung

    2014-01-01

    End-binding 1 (EB1) proteins are evolutionarily conserved components of microtubule (MT) plus-end tracking protein that regulate MT dynamics. Giardia lamblia, with two nuclei and cytoskeletal structures, requires accurate MT distribution for division. In this study, we show that a single EB1 homolog gene of G. lamblia regulates MT dynamics in mitosis. The haemagglutinin-tagged G. lamblia EB1 (GlEB1) localizes to the nuclear envelopes and median bodies, and is transiently present in mitotic spindles of dividing cells. Knockdown of GlEB1 expression using the morpholinos-based anti-EB1 oligonucleotides, resulted in a significant defect in mitosis of Giardia trophozoites. The MT-binding assays using recombinant GlEB1 (rGlEB1) proteins demonstrated that rGlEB1102–238, but not rGlEB11–184, maintains an MT-binding ability comparable with that of the full length protein, rGlEB11–238. Size exclusion chromatography showed that rGlEB1 is present as a dimer formed by its C-terminal domain and a disulfide bond. In vitro-mutagenesis of GlEB1 indicated that an intermolecular disulfide bond is made between cysteine #13 of the two monomers. Complementation assay using the BIM1 knockout mutant yeast, the yeast homolog of mammalian EB1, indicated that expression of the C13S mutant GlEB1 protein cannot rescue the mitotic defect of the BIM1 mutant yeast. These results suggest that dimerization of GlEB1 via the 13th cysteine residues plays a role during mitosis in Giardia. PMID:24828878

  13. Co-suppression of sterol-regulatory element binding protein ...

    African Journals Online (AJOL)

    Arabidopsis plants were transformed with a chimeric construct containing expression cassettes for GFP election marker and CaMV 35S promoter-driven At5g35220 cDNA, via Agro bacterium-mediated method. Two transformants produced pigmentation deficient phenotype. Analysis revealed the decrease of chlorophyll in ...

  14. Cyclic AMP response element binding protein and brain-derived ...

    Indian Academy of Sciences (India)

    ... brain-derived neurotrophic factor (BDNF) are targets of diverse classes of antidepressants and are known to be regulated in animal models and in patients suffering from depression. Given their role in neuronal plasticity, CREB and BDNF have emerged as molecules that may play an important role in modulating mood.

  15. Co-suppression of sterol-regulatory element binding protein ...

    African Journals Online (AJOL)

    Administrator

    2011-06-22

    Jun 22, 2011 ... 2College of Horticulture and Landscape, Hunan Agricultural University, Changsha 410128, China. 3Hunan Provincial Key Laboratory of Crop Germplasm Innovation and Utilization, Hunan Agricultural. University, Changsha ... RT-PCR showed that, total At5g35220 mRNA levels were greatly inhibited in ...

  16. Mannan-binding protein forms complexes with alpha-2-macroglobulin. A protein model for the interaction

    DEFF Research Database (Denmark)

    Storgaard, P; Holm Nielsen, E; Skriver, E

    1995-01-01

    We report that alpha-2-macroglobulin (alpha 2M) can form complexes with a high molecular weight porcine mannan-binding protein (pMBP-28). The alpha 2M/pMBP-28 complexes was isolated by PEG-precipitation and affinity chromatography on mannan-Sepharose, protein A-Sepharose and anti-IgM Sepharose...

  17. Haptoglobin-related protein is a high-affinity hemoglobin-binding plasma protein

    DEFF Research Database (Denmark)

    Nielsen, Marianne Jensby; Petersen, Steen Vang; Jacobsen, Christian

    2006-01-01

    Haptoglobin-related protein (Hpr) is a primate-specific plasma protein associated with apolipoprotein L-I (apoL-I)-containing high-density lipoprotein (HDL) particles shown to be a part of the innate immune defense. Despite the assumption hitherto that Hpr does not bind to hemoglobin, the present...

  18. Binding among Select Episodic Elements Is Altered via Active Short-Term Retrieval

    Science.gov (United States)

    Bridge, Donna J.; Voss, Joel L.

    2015-01-01

    Of the many elements that comprise an episode, are any disproportionately bound to the others? We tested whether active short-term retrieval selectively increases binding. Individual objects from multiobject displays were retrieved after brief delays. Memory was later tested for the other objects. Cueing with actively retrieved objects facilitated…

  19. A Venom Gland Extracellular Chitin-Binding-Like Protein from Pupal Endoparasitoid Wasps, Pteromalus Puparum, Selectively Binds Chitin

    Science.gov (United States)

    Chitin-binding proteins (CBPs) existed in various species and involved in different biology processes. In the present study, we cloned a full length cDNA of chitin-binding protein-like (PpCBP-like) from Pteromalus puparum, a pupal endoparasitoid of Pieris rapae. PpCBP-like encoded a 96 putative amin...

  20. Fatty acid- and retinoid-binding proteins have distinct binding pockets for the two types of cargo

    NARCIS (Netherlands)

    Jordanova, Rositsa; Groves, Matthew R.; Kostova, Elena; Woltersdorf, Christian; Liebau, Eva; Tucker, Paul A.

    2009-01-01

    Parasitic nematodes cause serious diseases in humans, animals, and plants. They have limited lipid metabolism and are reliant on lipid-binding proteins to acquire these metabolites from their hosts. Several structurally novel families of lipid-binding proteins in nematodes have been described,

  1. Human pentraxin 3 binds to the complement regulator c4b-binding protein.

    Directory of Open Access Journals (Sweden)

    Anne Braunschweig

    Full Text Available The long pentraxin 3 (PTX3 is a soluble recognition molecule with multiple functions including innate immune defense against certain microbes and the clearance of apoptotic cells. PTX3 interacts with recognition molecules of the classical and lectin complement pathways and thus initiates complement activation. In addition, binding of PTX3 to the alternative complement pathway regulator factor H was shown. Here, we show that PTX3 binds to the classical and lectin pathway regulator C4b-binding protein (C4BP. A PTX3-binding site was identified within short consensus repeats 1-3 of the C4BP α-chain. PTX3 did not interfere with the cofactor activity of C4BP in the fluid phase and C4BP maintained its complement regulatory activity when bound to PTX3 on surfaces. While C4BP and factor H did not compete for PTX3 binding, the interaction of C4BP with PTX3 was inhibited by C1q and by L-ficolin. PTX3 bound to human fibroblast- and endothelial cell-derived extracellular matrices and recruited functionally active C4BP to these surfaces. Whereas PTX3 enhanced the activation of the classical/lectin pathway and caused enhanced C3 deposition on extracellular matrix, deposition of terminal pathway components and the generation of the inflammatory mediator C5a were not increased. Furthermore, PTX3 enhanced the binding of C4BP to late apoptotic cells, which resulted in an increased rate of inactivation of cell surface bound C4b and a reduction in the deposition of C5b-9. Thus, in addition to complement activators, PTX3 interacts with complement inhibitors including C4BP. This balanced interaction on extracellular matrix and on apoptotic cells may prevent excessive local complement activation that would otherwise lead to inflammation and host tissue damage.

  2. Protein Affinity Chromatography with Purified Yeast DNA Polymerase α Detects Proteins that Bind to DNA Polymerase

    Science.gov (United States)

    Miles, Jeff; Formosa, Tim

    1992-02-01

    We have overexpressed the POL1 gene of the yeast Saccharomyces cerevisiae and purified the resulting DNA polymerase α polypeptide in an apparently intact form. We attached the purified DNA polymerase covalently to an agarose matrix and used this matrix to chromatograph extracts prepared from yeast cells. At least six proteins bound to the yeast DNA polymerase α matrix that did not bind to a control matrix. We speculate that these proteins might be DNA polymerase α accessory proteins. Consistent with this interpretation, one of the binding proteins, which we have named POB1 (polymerase one binding), is required for normal chromosome transmission. Mutations in this gene cause increased chromosome loss and an abnormal cell morphology, phenotypes that also occur in the presence of mutations in the yeast α or δ polymerase genes. These results suggest that the interactions detected by polymerase affinity chromatography are biologically relevant and may help to illuminate the architecture of the eukaryotic DNA replication machinery.

  3. A machine learning strategy to identify candidate binding sites in human protein-coding sequence

    Directory of Open Access Journals (Sweden)

    Leong Bernard

    2006-09-01

    Full Text Available Abstract Background The splicing of RNA transcripts is thought to be partly promoted and regulated by sequences embedded within exons. Known sequences include binding sites for SR proteins, which are thought to mediate interactions between splicing factors bound to the 5' and 3' splice sites. It would be useful to identify further candidate sequences, however identifying them computationally is hard since exon sequences are also constrained by their functional role in coding for proteins. Results This strategy identified a collection of motifs including several previously reported splice enhancer elements. Although only trained on coding exons, the model discriminates both coding and non-coding exons from intragenic sequence. Conclusion We have trained a computational model able to detect signals in coding exons which seem to be orthogonal to the sequences' primary function of coding for proteins. We believe that many of the motifs detected here represent binding sites for both previously unrecognized proteins which influence RNA splicing as well as other regulatory elements.

  4. Activation of Sterol Regulatory Element Binding Factors by Fenofibrate and Gemfibrozil Stimulate Myelination in Zebrafish

    Directory of Open Access Journals (Sweden)

    Yuhei Nishimura

    2016-07-01

    Full Text Available Oligodendrocytes are major myelin-producing cells and play essential roles in the function of a healthy nervous system. However, they are also one of the most vulnerable neural cell types in the central nervous system (CNS, and myelin abnormalities in the CNS are found in a wide variety of neurological disorders, including multiple sclerosis, adrenoleukodystrophy, and schizophrenia. There is an urgent need to identify small molecular weight compounds that can stimulate myelination. In this study, we performed comparative transcriptome analysis to identify pharmacodynamic effects common to miconazole and clobetasol, which have been shown to stimulate myelination by mouse oligodendrocyte progenitor cells (OPCs. Of the genes differentially expressed in both miconazole- and clobetasol-treated mouse OPCs compared with untreated cells, we identified differentially expressed genes (DEGs common to both drug treatments. Gene ontology analysis revealed that these DEGs are significantly associated with the sterol biosynthetic pathway, and further bioinformatics analysis suggested that sterol regulatory element binding factors (SREBFs might be key upstream regulators of the DEGs. In silico screening of a public database for chemicals associated with SREBF activation identified fenofibrate, a peroxisome proliferator-activated receptor α (PPARα agonist, as a drug that increases the expression of known SREBF targets, raising the possibility that fenofibrate may also stimulate myelination. To test this, we performed in vivo imaging of zebrafish expressing a fluorescent reporter protein under the control of the myelin basic protein (mbp promoter. Treatment of zebrafish with fenofibrate significantly increased expression of the fluorescent reporter compared with untreated zebrafish. This increase was attenuated by co-treatment with fatostatin, a specific inhibitor of SREBFs, confirming that the fenofibrate effect was mediated via SREBFs. Furthermore, incubation

  5. Cloud computing for protein-ligand binding site comparison.

    Science.gov (United States)

    Hung, Che-Lun; Hua, Guan-Jie

    2013-01-01

    The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery.

  6. Cloud Computing for Protein-Ligand Binding Site Comparison

    Directory of Open Access Journals (Sweden)

    Che-Lun Hung

    2013-01-01

    Full Text Available The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery.

  7. Cloud Computing for Protein-Ligand Binding Site Comparison

    Science.gov (United States)

    2013-01-01

    The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery. PMID:23762824

  8. Collagen-binding proteins of Streptococcus mutans and related streptococci.

    Science.gov (United States)

    Avilés-Reyes, A; Miller, J H; Lemos, J A; Abranches, J

    2017-04-01

    The ability of Streptococcus mutans to interact with collagen through the expression of collagen-binding proteins (CBPs) bestows this oral pathogen with an alternative to the sucrose-dependent mechanism of colonization classically attributed to caries development. Based on the abundance and distribution of collagen throughout the human body, stringent adherence to this molecule grants S. mutans with the opportunity to establish infection at different host sites. Surface proteins, such as SpaP, WapA, Cnm and Cbm, have been shown to bind collagen in vitro, and it has been suggested that these molecules play a role in colonization of oral and extra-oral tissues. However, robust collagen binding is not achieved by all strains of S. mutans, particularly those that lack Cnm or Cbm. These observations merit careful dissection of the contribution from these different CBPs towards tissue colonization and virulence. In this review, we will discuss the current understanding of mechanisms used by S. mutans and related streptococci to colonize collagenous tissues, and the possible contribution of CBPs to infections in different sites of the host. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. The telomere binding protein TRF2 induces chromatin compaction.

    Science.gov (United States)

    Baker, Asmaa M; Fu, Qiang; Hayward, William; Victoria, Samuel; Pedroso, Ilene M; Lindsay, Stuart M; Fletcher, Terace M

    2011-04-19

    Mammalian telomeres are specialized chromatin structures that require the telomere binding protein, TRF2, for maintaining chromosome stability. In addition to its ability to modulate DNA repair activities, TRF2 also has direct effects on DNA structure and topology. Given that mammalian telomeric chromatin includes nucleosomes, we investigated the effect of this protein on chromatin structure. TRF2 bound to reconstituted telomeric nucleosomal fibers through both its basic N-terminus and its C-terminal DNA binding domain. Analytical agarose gel electrophoresis (AAGE) studies showed that TRF2 promoted the folding of nucleosomal arrays into more compact structures by neutralizing negative surface charge. A construct containing the N-terminal and TRFH domains together altered the charge and radius of nucleosomal arrays similarly to full-length TRF2 suggesting that TRF2-driven changes in global chromatin structure were largely due to these regions. However, the most compact chromatin structures were induced by the isolated basic N-terminal region, as judged by both AAGE and atomic force microscopy. Although the N-terminal region condensed nucleosomal array fibers, the TRFH domain, known to alter DNA topology, was required for stimulation of a strand invasion-like reaction with nucleosomal arrays. Optimal strand invasion also required the C-terminal DNA binding domain. Furthermore, the reaction was not stimulated on linear histone-free DNA. Our data suggest that nucleosomal chromatin has the ability to facilitate this activity of TRF2 which is thought to be involved in stabilizing looped telomere structures.

  10. The clinical significance of fatty acid binding proteins

    Directory of Open Access Journals (Sweden)

    Barbara Choromańska

    2011-11-01

    Full Text Available Excessive levels of free fatty acids are toxic to cells. The human body has evolved a defense mechanism in the form of small cytoplasmic proteins called fatty acid binding proteins (FABPs that bind long-chain fatty acids (LCFA, and then refer them to appropriate intracellular disposal sites (oxidation in mitochondria and peroxisomes or storage in the endoplasmic reticulum. So far, nine types of these proteins have been described, and their name refers to the place in which they were first identified or where they can be found in the greatest concentration. The most important FABPs were isolated from the liver (L-FABP, heart (H-FABP, intestine (I-FABP, brain (B-FABP, epidermis (E-FABP and adipocytes (A-FABP. Determination of H-FABP is used in the diagnosis of myocardial infarction, and L-FABP in kidney lesions of different etiologies. It is postulated that FABPs play an important role in the pathogenesis of metabolic diseases. Elevated levels of A-FABP have been found in the pericardial fat tissue and were associated with cardiac dysfunction in obese people. A rise in A-FABP has been observed in patients with type II diabetes. I-FABP is known as a marker of cell damage in the small intestine. Increased concentration of B-FABP has been associated with human brain tumors such as glioblastoma and astrocytoma, as well as with neurodegenerative diseases (Alzheimer’s, Parkinson’s and other disorders of cognitive function. The aim of this work was to present current data on the clinical significance of fatty acid binding proteins.

  11. Translational regulation of viral secretory proteins by the 5' coding regions and a viral RNA-binding protein.

    Science.gov (United States)

    Nordholm, Johan; Petitou, Jeanne; Östbye, Henrik; da Silva, Diogo V; Dou, Dan; Wang, Hao; Daniels, Robert

    2017-08-07

    A primary function of 5' regions in many secretory protein mRNAs is to encode an endoplasmic reticulum (ER) targeting sequence. In this study, we show how the regions coding for the ER-targeting sequences of the influenza glycoproteins NA and HA also function as translational regulatory elements that are controlled by the viral RNA-binding protein (RBP) NS1. The translational increase depends on the nucleotide composition and 5' positioning of the ER-targeting sequence coding regions and is facilitated by the RNA-binding domain of NS1, which can associate with ER membranes. Inserting the ER-targeting sequence coding region of NA into different 5' UTRs confirmed that NS1 can promote the translation of secretory protein mRNAs based on the nucleotides within this region rather than the resulting amino acids. By analyzing human protein mRNA sequences, we found evidence that this mechanism of using 5' coding regions and particular RBPs to achieve gene-specific regulation may extend to human-secreted proteins. © 2017 Nordholm et al.

  12. Shrimp arginine kinase being a binding protein of WSSV envelope protein VP31

    Science.gov (United States)

    Ma, Cuiyan; Gao, Qiang; Liang, Yan; Li, Chen; Liu, Chao; Huang, Jie

    2016-11-01

    Viral entry into the host is the earliest stage of infection in the viral life cycle in which attachment proteins play a key role. VP31 (WSV340/WSSV396), an envelope protein of white spot syndrome virus (WSSV), contains an Arg-Gly-Asp (RGD) peptide domain known as a cellular attachment site. At present, the process of VP31 interacting with shrimp host cells has not been explored. Therefore, the VP31 gene was cloned into pET30a (+), expressed in Escherichia coli strain BL21 and purified with immobilized metal ion affinity chromatography. Four gill cellular proteins of shrimp ( Fenneropenaeus chinensis) were pulled down by an affinity column coupled with recombinant VP31 (rVP31), and the amino acid sequences were identified with MALDI-TOF/TOF mass spectrometry. Hemocyanin, beta-actin, arginine kinase (AK), and an unknown protein were suggested as the putative VP31 receptor proteins. SDS-PAGE showed that AK is the predominant binding protein of VP31. An i n vitro binding activity experiment indicated that recombinant AK's (rAK) binding activity with rVP31 is comparable to that with the same amount of WSSV. These results suggested that AK, as a member of the phosphagen kinase family, plays a role in WSSV infection. This is the first evidence showing that AK is a binding protein of VP31. Further studies on this topic will elucidate WSSV infection mechanism in the future.

  13. DMPD: LPS-binding proteins and receptors. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 9665271 LPS-binding proteins and receptors. Fenton MJ, Golenbock DT. J Leukoc Biol.... 1998 Jul;64(1):25-32. (.png) (.svg) (.html) (.csml) Show LPS-binding proteins and receptors. PubmedID 9665271 Title LPS-binding prot...eins and receptors. Authors Fenton MJ, Golenbock DT. Publication J Leukoc Biol. 199

  14. Binding proteins enhance specific uptake rate by increasing the substrate-transporter encounter rate.

    NARCIS (Netherlands)

    Bosdriesz, E.; Magnúsdóttir, S.; Bruggeman, F.J.; Teusink, B.; Molenaar, D.

    2015-01-01

    Microorganisms rely on binding-protein assisted, active transport systems to scavenge for scarce nutrients. Several advantages of using binding proteins in such uptake systems have been proposed. However, a systematic, rigorous and quantitative analysis of the function of binding proteins is

  15. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  16. A unique bivalent binding and inhibition mechanism by the yatapoxvirus interleukin 18 binding protein.

    Directory of Open Access Journals (Sweden)

    Brian Krumm

    Full Text Available Interleukin 18 (IL18 is a cytokine that plays an important role in inflammation as well as host defense against microbes. Mammals encode a soluble inhibitor of IL18 termed IL18 binding protein (IL18BP that modulates IL18 activity through a negative feedback mechanism. Many poxviruses encode homologous IL18BPs, which contribute to virulence. Previous structural and functional studies on IL18 and IL18BPs revealed an essential binding hot spot involving a lysine on IL18 and two aromatic residues on IL18BPs. The aromatic residues are conserved among the very diverse mammalian and poxviruses IL18BPs with the notable exception of yatapoxvirus IL18BPs, which lack a critical phenylalanine residue. To understand the mechanism by which yatapoxvirus IL18BPs neutralize IL18, we solved the crystal structure of the Yaba-Like Disease Virus (YLDV IL18BP and IL18 complex at 1.75 Å resolution. YLDV-IL18BP forms a disulfide bonded homo-dimer engaging IL18 in a 2∶2 stoichiometry, in contrast to the 1∶1 complex of ectromelia virus (ECTV IL18BP and IL18. Disruption of the dimer interface resulted in a functional monomer, however with a 3-fold decrease in binding affinity. The overall architecture of the YLDV-IL18BP:IL18 complex is similar to that observed in the ECTV-IL18BP:IL18 complex, despite lacking the critical lysine-phenylalanine interaction. Through structural and mutagenesis studies, contact residues that are unique to the YLDV-IL18BP:IL18 binding interface were identified, including Q67, P116 of YLDV-IL18BP and Y1, S105 and D110 of IL18. Overall, our studies show that YLDV-IL18BP is unique among the diverse family of mammalian and poxvirus IL-18BPs in that it uses a bivalent binding mode and a unique set of interacting residues for binding IL18. However, despite this extensive divergence, YLDV-IL18BP binds to the same surface of IL18 used by other IL18BPs, suggesting that all IL18BPs use a conserved inhibitory mechanism by blocking a putative receptor-binding

  17. Alkane-induced expression, substrate binding profile, and immunolocalization of a cytochrome P450 encoded on the nifD excision element of Anabaena 7120

    Directory of Open Access Journals (Sweden)

    Fjetland Conrad R

    2005-03-01

    Full Text Available Abstract Background Alkanes have been hypothesized to act as universal inducers of bacterial cytochrome P450 gene expression. We tested this hypothesis on an unusual P450 gene (cyp110 found on a conserved 11 kilobase episomal DNA element of unknown function found in filamentous cyanobacteria. We also monitored the binding of potential substrates to the P450 protein and explored the distribution of P450 protein in vegetative cells and nitrogen-fixing heterocysts using immuno-electron microscopy. Results Hexadecane treatments resulted in a two-fold increase in mRNA, and a four-fold increase in P450 protein levels relative to control cultures. Hexane, octane and dodecane were toxic and induced substantial changes in membrane morphology. Long-chain saturated and unsaturated fatty acids were shown to bind the CYP110 protein using a spectroscopic spin-shift assay, but alkanes did not bind. CYP110 protein was detected in vegetative cells but not in differentiated heterocysts where nitrogen fixation occurs. Conclusion Hexadecane treatment was an effective inducer of CYP110 expression in cyanobacteria. Based on substrate binding profiles and amino acid sequence similarities it is hypothesized that CYP110 is a fatty acid ω-hydroxylase in photosynthetic cells. CYP110 was found associated with membrane fractions unlike other soluble microbial P450 proteins, and in this regard CYP110 more closely resembles eukarytotic P450s. Substrate stablization is an unlikely mechanism for alkane induction because alkanes did not bind to purified CYP110 protein.

  18. Novel surface layer protein genes in Bacillus sphaericus associated with unusual insertion elements.

    Science.gov (United States)

    Pollmann, Katrin; Raff, Johannes; Schnorpfeil, Michaela; Radeva, Galina; Selenska-Pobell, Sonja

    2005-09-01

    The surface layer (S-layer) protein genes of the uranium mining waste pile isolate Bacillus sphaericus JG-A12 and of its relative B. sphaericus NCTC 9602 were analysed. The almost identical N-termini of the two S-layer proteins possess a unique structure, comprising three N-terminal S-layer homologous (SLH) domains. The central parts of the proteins share a high homology and are related to the S-layer proteins of B. sphaericus CCM 2177 and P-1. In contrast, the C-terminal parts of the S-layer proteins of JG-A12 and NCTC 9602 differ significantly between each other. Surprisingly, the C-terminal part of the S-layer protein of JG-A12 shares a high identity with that of the S-layer protein of B. sphaericus CCM 2177. In both JG-A12 and NCTC 9602 the chromosomal S-layer protein genes are followed by a newly identified putative insertion element comprising three ORFs, which encode a putative transposase, a putative integrase/recombinase and a putative protein containing a DNA binding helix-turn-helix motif, and the S-layer-protein-like gene copies sllA (9602) or sllB (JG-A12). Interestingly, both B. sphaericus strains studied were found to contain an additional, plasmid-located and silent S-layer protein gene with the same sequence as sllA and sllB. The primary structures of the corresponding putative proteins are almost identical in both strains. The N-terminal and central parts of these S-layer proteins share a high identity with those of the chromosomally encoded functional S-layer proteins. Their C-terminal parts, however, differ significantly. These results strongly suggest that the S-layer protein genes have evolved via horizontal transfer of genetic information followed by DNA rearrangements mediated by mobile elements.

  19. The Movable Type Method Applied to Protein-Ligand Binding.

    Science.gov (United States)

    Zheng, Zheng; Ucisik, Melek N; Merz, Kenneth M

    2013-12-10

    Accurately computing the free energy for biological processes like protein folding or protein-ligand association remains a challenging problem. Both describing the complex intermolecular forces involved and sampling the requisite configuration space make understanding these processes innately difficult. Herein, we address the sampling problem using a novel methodology we term "movable type". Conceptually it can be understood by analogy with the evolution of printing and, hence, the name movable type. For example, a common approach to the study of protein-ligand complexation involves taking a database of intact drug-like molecules and exhaustively docking them into a binding pocket. This is reminiscent of early woodblock printing where each page had to be laboriously created prior to printing a book. However, printing evolved to an approach where a database of symbols (letters, numerals, etc.) was created and then assembled using a movable type system, which allowed for the creation of all possible combinations of symbols on a given page, thereby, revolutionizing the dissemination of knowledge. Our movable type (MT) method involves the identification of all atom pairs seen in protein-ligand complexes and then creating two databases: one with their associated pairwise distant dependent energies and another associated with the probability of how these pairs can combine in terms of bonds, angles, dihedrals and non-bonded interactions. Combining these two databases coupled with the principles of statistical mechanics allows us to accurately estimate binding free energies as well as the pose of a ligand in a receptor. This method, by its mathematical construction, samples all of configuration space of a selected region (the protein active site here) in one shot without resorting to brute force sampling schemes involving Monte Carlo, genetic algorithms or molecular dynamics simulations making the methodology extremely efficient. Importantly, this method explores the free

  20. Integrating protein structures and precomputed genealogies in the Magnum database: Examples with cellular retinoid binding proteins

    Directory of Open Access Journals (Sweden)

    Bradley Michael E

    2006-02-01

    Full Text Available Abstract Background When accurate models for the divergent evolution of protein sequences are integrated with complementary biological information, such as folded protein structures, analyses of the combined data often lead to new hypotheses about molecular physiology. This represents an excellent example of how bioinformatics can be used to guide experimental research. However, progress in this direction has been slowed by the lack of a publicly available resource suitable for general use. Results The precomputed Magnum database offers a solution to this problem for ca. 1,800 full-length protein families with at least one crystal structure. The Magnum deliverables include 1 multiple sequence alignments, 2 mapping of alignment sites to crystal structure sites, 3 phylogenetic trees, 4 inferred ancestral sequences at internal tree nodes, and 5 amino acid replacements along tree branches. Comprehensive evaluations revealed that the automated procedures used to construct Magnum produced accurate models of how proteins divergently evolve, or genealogies, and correctly integrated these with the structural data. To demonstrate Magnum's capabilities, we asked for amino acid replacements requiring three nucleotide substitutions, located at internal protein structure sites, and occurring on short phylogenetic tree branches. In the cellular retinoid binding protein family a site that potentially modulates ligand binding affinity was discovered. Recruitment of cellular retinol binding protein to function as a lens crystallin in the diurnal gecko afforded another opportunity to showcase the predictive value of a browsable database containing branch replacement patterns integrated with protein structures. Conclusion We integrated two areas of protein science, evolution and structure, on a large scale and created a precomputed database, known as Magnum, which is the first freely available resource of its kind. Magnum provides evolutionary and structural

  1. Factors Affecting the Binding of a Recombinant Heavy Metal-Binding Domain (CXXC motif Protein to Heavy Metals

    Directory of Open Access Journals (Sweden)

    Kamala Boonyodying

    2012-06-01

    Full Text Available A number of heavy metal-binding proteins have been used to study bioremediation. CXXC motif, a metal binding domain containing Cys-X-X-Cys motif, has been identified in various organisms. These proteins are capable of binding various types of heavy metals. In this study, heavy metal binding domain (CXXC motif recombinant protein encoded from mcsA gene of S. aureus were cloned and overexpressed in Escherichia coli. The factors involved in the metal-binding activity were determined in order to analyze the potential of recombinant protein for bioremediation. A recombinant protein can be bound to Cd2+, Co2+, Cu2+ and Zn2+. The thermal stability of a recombinant protein was tested, and the results showed that the metal binding activity to Cu2+ and Zn2+ still exist after treating the protein at 85ºC for 30 min. The temperature and pH that affected the metal binding activity was tested and the results showed that recombinant protein was still bound to Cu2+ at 65ºC, whereas a pH of 3-7 did not affect the metal binding E. coli harboring a pRset with a heavy metal-binding domain CXXC motif increased the resistance of heavy metals against CuCl2 and CdCl2. This study shows that metal binding domain (CXXC motif recombinant protein can be effectively bound to various types of heavy metals and may be used as a potential tool for studying bioremediation.

  2. High-resolution analysis of four efficient yeast replication origins reveals new insights into the ORC and putative MCM binding elements.

    Science.gov (United States)

    Chang, Fujung; May, Caitlin D; Hoggard, Timothy; Miller, Jeremy; Fox, Catherine A; Weinreich, Michael

    2011-08-01

    In budding yeast, the eukaryotic initiator protein ORC (origin recognition complex) binds to a bipartite sequence consisting of an 11 bp ACS element and an adjacent B1 element. However, the genome contains many more matches to this consensus than actually bind ORC or function as origins in vivo. Although ORC-dependent loading of the replicative MCM helicase at origins is enhanced by a distal B2 element, less is known about this element. Here, we analyzed four highly active origins (ARS309, ARS319, ARS606 and ARS607) by linker scanning mutagenesis and found that sequences adjacent to the ACS contributed substantially to origin activity and ORC binding. Using the sequences of four additional B2 elements we generated a B2 multiple sequence alignment and identified a shared, degenerate 8 bp sequence that was enriched within 228 known origins. In addition, our high-resolution analysis revealed that not all origins exist within nucleosome free regions: a class of Sir2-regulated origins has a stably positioned nucleosome overlapping or near B2. This study illustrates the conserved yet flexible nature of yeast origin architecture to promote ORC binding and origin activity, and helps explain why a strong match to the ORC binding site is insufficient to identify origins within the genome.

  3. Repetitive N-WASP-binding elements of the enterohemorrhagic Escherichia coli effector EspF(U synergistically activate actin assembly.

    Directory of Open Access Journals (Sweden)

    Kenneth G Campellone

    2008-10-01

    Full Text Available Enterohemorrhagic Escherichia coli (EHEC generate F-actin-rich adhesion pedestals by delivering effector proteins into mammalian cells. These effectors include the translocated receptor Tir, along with EspF(U, a protein that associates indirectly with Tir and contains multiple peptide repeats that stimulate actin polymerization. In vitro, the EspF(U repeat region is capable of binding and activating recombinant derivatives of N-WASP, a host actin nucleation-promoting factor. In spite of the identification of these important bacterial and host factors, the underlying mechanisms of how EHEC so potently exploits the native actin assembly machinery have not been clearly defined. Here we show that Tir and EspF(U are sufficient for actin pedestal formation in cultured cells. Experimental clustering of Tir-EspF(U fusion proteins indicates that the central role of the cytoplasmic portion of Tir is to promote clustering of the repeat region of EspF(U. Whereas clustering of a single EspF(U repeat is sufficient to bind N-WASP and generate pedestals on cultured cells, multi-repeat EspF(U derivatives promote actin assembly more efficiently. Moreover, the EspF(U repeats activate a protein complex containing N-WASP and the actin-binding protein WIP in a synergistic fashion in vitro, further suggesting that the repeats cooperate to stimulate actin polymerization in vivo. One explanation for repeat synergy is that simultaneous engagement of multiple N-WASP molecules can enhance its ability to interact with the actin nucleating Arp2/3 complex. These findings define the minimal set of bacterial effectors required for pedestal formation and the elements within those effectors that contribute to actin assembly via N-WASP-Arp2/3-mediated signaling pathways.

  4. Control of nuclear organization by F-actin binding proteins.

    Science.gov (United States)

    Pfisterer, Karin; Jayo, Asier; Parsons, Maddy

    2017-03-04

    The regulation of nuclear shape and deformability is a key factor in controlling diverse events from embryonic development to cancer cell metastasis, but the mechanisms governing this process are still unclear. Our recent study demonstrated an unexpected role for the F-actin bundling protein fascin in controlling nuclear plasticity through a direct interaction with Nesprin-2. Nesprin-2 is a component of the LINC complex that is known to couple the F-actin cytoskeleton to the nuclear envelope. We demonstrated that fascin, which is predominantly associated with peripheral F-actin rich filopodia, binds directly to Nesprin-2 at the nuclear envelope in a range of cell types. Depleting fascin or specifically blocking the fascin-Nesprin-2 complex leads to defects in nuclear polarization, movement and cell invasion. These studies reveal a novel role for an F-actin bundling protein in control of nuclear plasticity and underline the importance of defining nuclear-associated roles for F-actin binding proteins in future.

  5. Rbfox2 controls autoregulation in RNA-binding protein networks.

    Science.gov (United States)

    Jangi, Mohini; Boutz, Paul L; Paul, Prakriti; Sharp, Phillip A

    2014-03-15

    The tight regulation of splicing networks is critical for organismal development. To maintain robust splicing patterns, many splicing factors autoregulate their expression through alternative splicing-coupled nonsense-mediated decay (AS-NMD). However, as negative autoregulation results in a self-limiting window of splicing factor expression, it is unknown how variations in steady-state protein levels can arise in different physiological contexts. Here, we demonstrate that Rbfox2 cross-regulates AS-NMD events within RNA-binding proteins to alter their expression. Using individual nucleotide-resolution cross-linking immunoprecipitation coupled to high-throughput sequencing (iCLIP) and mRNA sequencing, we identified >200 AS-NMD splicing events that are bound by Rbfox2 in mouse embryonic stem cells. These "silent" events are characterized by minimal apparent splicing changes but appreciable changes in gene expression upon Rbfox2 knockdown due to degradation of the NMD-inducing isoform. Nearly 70 of these AS-NMD events fall within genes encoding RNA-binding proteins, many of which are autoregulated. As with the coding splicing events that we found to be regulated by Rbfox2, silent splicing events are evolutionarily conserved and frequently contain the Rbfox2 consensus UGCAUG. Our findings uncover an unexpectedly broad and multilayer regulatory network controlled by Rbfox2 and offer an explanation for how autoregulatory splicing networks are tuned.

  6. Neutralizing the function of a β-globin-associated cis-regulatory DNA element using an artificial zinc finger DNA-binding domain.

    Science.gov (United States)

    Barrow, Joeva J; Masannat, Jude; Bungert, Jörg

    2012-10-30

    Gene expression is primarily regulated by cis-regulatory DNA elements and trans-interacting proteins. Transcription factors bind in a DNA sequence-specific manner and recruit activities that modulate the association and activity of transcription complexes at specific genes. Often, transcription factors belong to families of related proteins that interact with similar DNA sequences. Furthermore, genes are regulated by multiple, sometimes redundant, cis-regulatory elements. Thus, the analysis of the role of a specific DNA regulatory sequence and the interacting proteins in the context of intact cells is challenging. In this study, we designed and functionally characterized an artificial DNA-binding domain that neutralizes the function of a cis-regulatory DNA element associated with adult β-globin gene expression. The zinc finger DNA-binding domain (ZF-DBD), comprising six ZFs, interacted specifically with a CACCC site located 90 bp upstream of the transcription start site (-90 β-ZF-DBD), which is normally occupied by KLF1, a major regulator of adult β-globin gene expression. Stable expression of the -90 β-ZF-DBD in mouse erythroleukemia cells reduced the binding of KLF1 with the β-globin gene, but not with locus control region element HS2, and led to reduced transcription. Transient transgenic embryos expressing the -90 β-ZF-DBD developed normally but revealed reduced expression of the adult β-globin gene. These results demonstrate that artificial DNA-binding proteins lacking effector domains are useful tools for studying and modulating the function of cis-regulatory DNA elements.

  7. Coupled binding-bending-folding: The complex conformational dynamics of protein-DNA binding studied by atomistic molecular dynamics simulations.

    Science.gov (United States)

    van der Vaart, Arjan

    2015-05-01

    Protein-DNA binding often involves dramatic conformational changes such as protein folding and DNA bending. While thermodynamic aspects of this behavior are understood, and its biological function is often known, the mechanism by which the conformational changes occur is generally unclear. By providing detailed structural and energetic data, molecular dynamics simulations have been helpful in elucidating and rationalizing protein-DNA binding. This review will summarize recent atomistic molecular dynamics simulations of the conformational dynamics of DNA and protein-DNA binding. A brief overview of recent developments in DNA force fields is given as well. Simulations have been crucial in rationalizing the intrinsic flexibility of DNA, and have been instrumental in identifying the sequence of binding events, the triggers for the conformational motion, and the mechanism of binding for a number of important DNA-binding proteins. Molecular dynamics simulations are an important tool for understanding the complex binding behavior of DNA-binding proteins. With recent advances in force fields and rapid increases in simulation time scales, simulations will become even more important for future studies. This article is part of a Special Issue entitled Recent developments of molecular dynamics. Copyright © 2014. Published by Elsevier B.V.

  8. Conjugation Dependent Interaction of Folic Acid with Folate Binding Protein.

    Science.gov (United States)

    Merzel, Rachel L; Frey, Carolina; Chen, Junjie; Garn, Rachel; van Dongen, Mallory; Dougherty, Casey A; Kandaluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M

    2017-09-20

    Serum proteins play a critical role in the transport, uptake, and efficacy of targeted drug therapies, and here we investigate the interactions between folic acid-polymer conjugates and serum folate binding protein (FBP), the soluble form of the cellular membrane-bound folate receptor. We demonstrate that both choice of polymer and method of ligand conjugation affect the interactions between folic acid-polymer conjugates and serum FBP, resulting in changes in the folic acid-induced protein aggregation process. We have previously demonstrated that individual FBP molecules self-aggregate into nanoparticles at physiological concentrations. When poly(amidoamine) dendrimer-folic acid conjugates bound to FBP, the distribution of nanoparticles was preserved. However, the dendritic conjugates produced larger nanoparticles than those formed in the presence of physiologically normal human levels of folic acid, and the conjugation method affected particle size distribution. In contrast, poly(ethylene glycol)-folic acid conjugates demonstrated substantially reduced binding to FBP, did not cause folic acid-induced aggregation, and fully disrupted FBP self-aggregation. On the basis of these results, we discuss the potential implications for biodistribution, trafficking, and therapeutic efficacy of targeted nanoscale therapeutics, especially considering the widespread clinical use of poly(ethylene glycol) conjugates. We highlight the importance of considering specific serum protein interactions in the rational design of similar nanocarrier systems. Our results suggest that prebinding therapeutic nanocarriers to serum FBP may allow folate-specific metabolic pathways to be exploited for delivery while also affording benefits of utilizing an endogenous protein as a vector.

  9. Structural and binding properties of two paralogous fatty acid binding proteins of Taenia solium metacestode.

    Directory of Open Access Journals (Sweden)

    Seon-Hee Kim

    Full Text Available BACKGROUND: Fatty acid (FA binding proteins (FABPs of helminths are implicated in acquisition and utilization of host-derived hydrophobic substances, as well as in signaling and cellular interactions. We previously demonstrated that secretory hydrophobic ligand binding proteins (HLBPs of Taenia solium metacestode (TsM, a causative agent of neurocysticercosis (NC, shuttle FAs in the surrounding host tissues and inwardly transport the FAs across the parasite syncytial membrane. However, the protein molecules responsible for the intracellular trafficking and assimilation of FAs have remained elusive. METHODOLOGY/PRINCIPAL FINDINGS: We isolated two novel TsMFABP genes (TsMFABP1 and TsMFABP2, which encoded 133- and 136-amino acid polypeptides with predicted molecular masses of 14.3 and 14.8 kDa, respectively. They shared 45% sequence identity with each other and 15-95% with other related-members. Homology modeling demonstrated a characteristic β-barrel composed of 10 anti-parallel β-strands and two α-helices. TsMFABP2 harbored two additional loops between β-strands two and three, and β-strands six and seven, respectively. TsMFABP1 was secreted into cyst fluid and surrounding environments, whereas TsMFABP2 was intracellularly confined. Partially purified native proteins migrated to 15 kDa with different isoelectric points of 9.2 (TsMFABP1 and 8.4 (TsMFABP2. Both native and recombinant proteins bound to 11-([5-dimethylaminonaphthalene-1-sulfonyl]aminoundecannoic acid, dansyl-DL-α-amino-caprylic acid, cis-parinaric acid and retinol, which were competitively inhibited by oleic acid. TsMFABP1 exhibited high affinity toward FA analogs. TsMFABPs showed weak binding activity to retinol, but TsMFABP2 showed relatively high affinity. Isolation of two distinct genes from an individual genome strongly suggested their paralogous nature. Abundant expression of TsMFABP1 and TsMFABP2 in the canal region of worm matched well with the histological distributions

  10. Serum lipopolysaccharide-binding protein as a marker of atherosclerosis.

    Science.gov (United States)

    Serrano, Marta; Moreno-Navarrete, José María; Puig, Josep; Moreno, María; Guerra, Ester; Ortega, Francisco; Xifra, Gemma; Ricart, Wifredo; Fernández-Real, José Manuel

    2013-10-01

    Recently, serum lipopolysaccharide-binding protein (LBP) has been closely associated with coronary artery disease. Here, we aimed to investigate the possible relationship between serum LBP and markers of atherosclerosis. Serum LBP and carotid intima media thickness (C-IMT) were measured in 332 subjects (101 men and 231 women) who were recruited from an ongoing multicenter project. Serum LBP was significantly associated with obesity [BMI, fat mass and waist circumference (r > 0.38, p atherosclerosis marker, reveals serum LBP as a putative factor related to atherosclerosis. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  11. Cellular retinol binding protein 1 could be a tumor suppressor gene in cervical cancer

    OpenAIRE

    Mendoza-Rodriguez, Mónica; Arreola, Hugo; Valdivia, Alejandra; Peralta, Raúl; Serna, Humberto,; Villegas, Vanessa; Romero, Pablo; Alvarado-Hernández, Beatriz; Paniagua, Lucero; Marrero-Rodríguez, Daniel; Meraz, Marco A; Salcedo,Mauricio

    2013-01-01

    Aims: Cervical Cancer (CC) is one of the most important health problems in women. It frequently presents genetic changes at chromosome region 3q21. This region contains the Cellular Retinol Binding Protein 1 gene (CRBP1) which has been implicated as an important element in the development of other types of cancer. The main goal of the present work was to determine the molecular alterations of CRBP1 and its relationship to CC. Methods: To determine the molecular alterations of CRBP1 gene in CC...

  12. Combinatorial Control of mRNA Fates by RNA-Binding Proteins and Non-Coding RNAs

    Directory of Open Access Journals (Sweden)

    Valentina Iadevaia

    2015-09-01

    Full Text Available Post-transcriptional control of gene expression is mediated by RNA-binding proteins (RBPs and small non-coding RNAs (e.g., microRNAs that bind to distinct elements in their mRNA targets. Here, we review recent examples describing the synergistic and/or antagonistic effects mediated by RBPs and miRNAs to determine the localisation, stability and translation of mRNAs in mammalian cells. From these studies, it is becoming increasingly apparent that dynamic rearrangements of RNA-protein complexes could have profound implications in human cancer, in synaptic plasticity, and in cellular differentiation.

  13. Interaction of the anaphase-promoting complex/cyclosome and proteasome protein complexes with multiubiquitin chain-binding proteins

    DEFF Research Database (Denmark)

    Seeger, Michael; Hartmann-Petersen, Rasmus; Wilkinson, Caroline R M

    2003-01-01

    Fission yeast Rhp23 and Pus1 represent two families of multiubiquitin chain-binding proteins that associate with the proteasome. We show that both proteins bind to different regions of the proteasome subunit Mts4. The binding site for Pus1 was mapped to a cluster of repetitive sequences also foun...

  14. Prediction of RNA-Binding Proteins by Voting Systems

    Directory of Open Access Journals (Sweden)

    C. R. Peng

    2011-01-01

    Full Text Available It is important to identify which proteins can interact with RNA for the purpose of protein annotation, since interactions between RNA and proteins influence the structure of the ribosome and play important roles in gene expression. This paper tries to identify proteins that can interact with RNA using voting systems. Firstly through Weka, 34 learning algorithms are chosen for investigation. Then simple majority voting system (SMVS is used for the prediction of RNA-binding proteins, achieving average ACC (overall prediction accuracy value of 79.72% and MCC (Matthew’s correlation coefficient value of 59.77% for the independent testing dataset. Then mRMR (minimum redundancy maximum relevance strategy is used, which is transferred into algorithm selection. In addition, the MCC value of each classifier is assigned to be the weight of the classifier’s vote. As a result, best average MCC values are attained when 22 algorithms are selected and integrated through weighted votes, which are 64.70% for the independent testing dataset, and ACC value is 82.04% at this moment.

  15. RNA binding protein CPEB1 remodels host and viral RNA landscapes

    Science.gov (United States)

    Batra, Ranjan; Stark, Thomas J.; Clark, Elizabeth; Belzile, Jean-Philippe; Wheeler, Emily C.; Yee, Brian A.; Huang, Hui; Gelboin-Burkhart, Chelsea; Huelga, Stephanie C.; Aigner, Stefan; Roberts, Brett T.; Bos, Tomas J.; Sathe, Shashank; Donohue, John Paul; Rigo, Frank; Ares, Manuel; Spector, Deborah H.; Yeo, Gene W.

    2016-01-01

    Host and virus interactions at the post-transcriptional level are critical for infection but remain poorly understood. Human cytomegalovirus (HCMV) is a prevalent herpesvirus family member that causes severe complications in immunocompromised patients and newborns. Here, we perform comprehensive transcriptome-wide analyses revealing that HCMV infection results in widespread alternative splicing (AS), shorter 3′-untranslated regions (3′UTRs) and polyA tail lengthening in host genes. The host RNA binding protein cytoplasmic polyadenylation element binding protein 1 (CPEB1) is highly induced upon infection and ectopic expression of CPEB1 in non-infected cells recapitulates infection-related post-transcriptional changes. CPEB1 is also required for polyA-tail lengthening of viral RNAs important for productive infection. Strikingly, depletion of CPEB1 reverses infection-related cytopathology and post-transcriptional changes, and decreases productive HCMV titers. Host RNA processing is also altered in herpes simplex virus-2 (HSV-2) infected cells, indicating a common theme among herpesvirus infections. Our work is a starting point for therapeutic targeting of host RNA binding proteins in herpesvirus infections. PMID:27775709

  16. Light-activated DNA binding in a designed allosteric protein

    Energy Technology Data Exchange (ETDEWEB)

    Strickland, Devin; Moffat, Keith; Sosnick, Tobin R. (UC)

    2008-09-03

    An understanding of how allostery, the conformational coupling of distant functional sites, arises in highly evolvable systems is of considerable interest in areas ranging from cell biology to protein design and signaling networks. We reasoned that the rigidity and defined geometry of an {alpha}-helical domain linker would make it effective as a conduit for allosteric signals. To test this idea, we rationally designed 12 fusions between the naturally photoactive LOV2 domain from Avena sativa phototropin 1 and the Escherichia coli trp repressor. When illuminated, one of the fusions selectively binds operator DNA and protects it from nuclease digestion. The ready success of our rational design strategy suggests that the helical 'allosteric lever arm' is a general scheme for coupling the function of two proteins.

  17. The Role of Microtubule End Binding (EB) Proteins in Ciliogenesis

    DEFF Research Database (Denmark)

    Schrøder, Jacob Morville

    centrosomal MT array and abnormally long centriole-associated rootlet filaments. Cells lacking EB1 also had stumpy cilia and a disorganized centrosomal MT array, but rootlet filaments appeared normal. Further, live imaging revealed increased release frequency of MTs from the centrosome upon EB1 or EB3......EB1 is a small microtubule (MT)-binding protein that associates preferentially with MT plus ends. EB1 plays a role in regulating MT dynamics, localizing other MT-associated proteins to the plus end, and in regulating interactions of MTs with the cell cortex, mitotic kinetochores and different......, are required for assembly of primary cilia in cultured human cells. The EB3 - siRNA ciliary phenotype could be rescued by GFP-EB1 expression, and GFP-EB3 over expression resulted in elongated cilia. Transmission electron microscopy (TEM) revealed that EB3-depleted cells possess stumpy cilia, a disorganized...

  18. Mapping protein binding sites on the biomolecular corona of nanoparticles

    Science.gov (United States)

    Kelly, Philip M.; Åberg, Christoffer; Polo, Ester; O'Connell, Ann; Cookman, Jennifer; Fallon, Jonathan; Krpetić, Željka; Dawson, Kenneth A.

    2015-05-01

    Nanoparticles in a biological milieu are known to form a sufficiently long-lived and well-organized ‘corona’ of biomolecules to confer a biological identity to the particle. Because this nanoparticle-biomolecule complex interacts with cells and biological barriers, potentially engaging with different biological pathways, it is important to clarify the presentation of functional biomolecular motifs at its interface. Here, we demonstrate that by using antibody-labelled gold nanoparticles, differential centrifugal sedimentation and various imaging techniques it is possible to identify the spatial location of proteins, their functional motifs and their binding sites. We show that for transferrin-coated polystyrene nanoparticles only a minority of adsorbed proteins exhibit functional motifs and the spatial organization appears random, which is consistent, overall, with a stochastic and irreversible adsorption process. Our methods are applicable to a wide array of nanoparticles and can offer a microscopic molecular description of the biological identity of nanoparticles.

  19. Comparison of entropic contributions to binding in a "hydrophilic" versus "hydrophobic" ligand-protein interaction.

    Science.gov (United States)

    Syme, Neil R; Dennis, Caitriona; Bronowska, Agnieszka; Paesen, Guido C; Homans, Steve W

    2010-06-30

    In the present study we characterize the thermodynamics of binding of histamine to recombinant histamine-binding protein (rRaHBP2), a member of the lipocalin family isolated from the brown-ear tick Rhipicephalus appendiculatus. The binding pocket of this protein contains a number of charged residues, consistent with histamine binding, and is thus a typical example of a "hydrophilic" binder. In contrast, a second member of the lipocalin family, the recombinant major urinary protein (rMUP), binds small hydrophobic ligands, with a similar overall entropy of binding in comparison with rRaHBP2. Having extensively studied ligand binding thermodynamics for rMUP previously, the data we obtained in the present study for HBP enables a comparison of the driving forces for binding between these classically distinct binding processes in terms of entropic contributions from ligand, protein, and solvent. In the case of rRaHBP2, we find favorable entropic contributions to binding from desolvation of the ligand; however, the overall entropy of binding is unfavorable due to a dominant unfavorable contribution arising from the loss of ligand degrees of freedom, together with the sequestration of solvent water molecules into the binding pocket in the complex. This contrasts with binding in rMUP where desolvation of the protein binding pocket makes a minor contribution to the overall entropy of binding given that the pocket is substantially desolvated prior to binding.

  20. Immobilized sialyloligo-macroligand and its protein binding specificity.

    Science.gov (United States)

    Narla, Satya Nandana; Sun, Xue-Long

    2012-05-14

    We report a chemoenzymatic synthesis of chain-end functionalized sialyllactose-containing glycopolymers with different linkages and their oriented immobilization for glycoarray and SPR-based glyco-biosensor applications. Specifically, O-cyanate chain-end functionalized sialyllactose-containing glycopolymers were synthesized by enzymatic α2,3- and α2,6-sialylation of a lactose-containing glycopolymer that was synthesized by cyanoxyl-mediated free radical polymerization. (1)H NMR showed almost quantitative α2,3- and α2,6-sialylation. The O-cyanate chain-end functionalized sialyllactose-containing glycopolymers were printed onto amine-functionalized glass slides via isourea bond formation for glycoarray formation. Specific protein binding activity of the arrays was confirmed with α2,3- and α2,6-sialyl specific binding lectins together with inhibition assays. Further, immobilizing O-cyanate chain-end functionalized sialyllactose-containing glycopolymers onto amine-modified SPR chip via isourea bond formation afforded SPR-based glyco-biosensor, which showed specific binding activity for lectins and influenza viral hemagglutinins (HA). These sialyloligo-macroligand derived glycoarray and SPR-based glyco-biosensor are closely to mimic 3D nature presentation of sialyloligosaccharides and will provide important high-throughput tools for virus diagnosis and potential antiviral drug candidates screening applications.

  1. Protein-protein binding before and after photo-modification of albumin

    Science.gov (United States)

    Rozinek, Sarah C.; Glickman, Randolph D.; Thomas, Robert J.; Brancaleon, Lorenzo

    2016-03-01

    Bioeffects of directed-optical-energy encompass a wide range of applications. One aspect of photochemical interactions involves irradiating a photosensitizer with visible light in order to induce protein unfolding and consequent changes in function. In the past, irradiation of several dye-protein combinations has revealed effects on protein structure. Beta lactoglobulin, human serum albumin (HSA) and tubulin have all been photo-modified with meso-tetrakis(4- sulfonatophenyl)porphyrin (TSPP) bound, but only in the case of tubulin has binding caused a verified loss of biological function (loss of ability to form microtubules) as a result of this light-induced structural change. The current work questions if the photo-induced structural changes that occur to HSA, are sufficient to disable its biological function of binding to osteonectin. The albumin-binding protein, osteonectin, is about half the molecular weight of HSA, so the two proteins and their bound product can be separated and quantified by size exclusion high performance liquid chromatography. TSPP was first bound to HSA and irradiated, photo-modifying the structure of HSA. Then native HSA or photo-modified HSA (both with TSPP bound) were compared, to assess loss in HSA's innate binding ability as a result of light-induced structure modification.

  2. Efficient purification of recombinant proteins fused to maltose-binding protein by mixed-mode chromatography.

    Science.gov (United States)

    Cabanne, Charlotte; Pezzini, Jérôme; Joucla, Gilles; Hocquellet, Agnès; Barbot, Caroline; Garbay, Bertrand; Santarelli, Xavier

    2009-05-15

    Two mixed-mode resins were evaluated as an alternative to conventional affinity resins for the purification of recombinant proteins fused to maltose-binding protein (MPB). We purified recombinant MBP, MBP-LacZ and MBP-Leap2 from crude Escherichia coli extracts. Mixed-mode resins allowed the efficient purification of MBP-fused proteins. Indeed, the quantity of purified proteins was significantly higher with mixed-mode resins, and their purity was equivalent to that obtained with affinity resins. By using purified MBP, MBP-LacZ and MBP-Leap2, the dynamic binding capacity of mixed-mode resins was 5-fold higher than that of affinity resins. Moreover, the recovery for the three proteins studied was in the 50-60% range for affinity resins, and in the 80-85% range for mixed-mode resins. Mixed-mode resins thus represent a powerful alternative to the classical amylose or dextrin resins for the purification of recombinant proteins fused to maltose-binding protein.

  3. DNA synthesis determines the binding mode of the human mitochondrial single-stranded DNA-binding protein.

    Science.gov (United States)

    Morin, José A; Cerrón, Fernando; Jarillo, Javier; Beltran-Heredia, Elena; Ciesielski, Grzegorz L; Arias-Gonzalez, J Ricardo; Kaguni, Laurie S; Cao, Francisco J; Ibarra, Borja

    2017-07-07

    Single-stranded DNA-binding proteins (SSBs) play a key role in genome maintenance, binding and organizing single-stranded DNA (ssDNA) intermediates. Multimeric SSBs, such as the human mitochondrial SSB (HmtSSB), present multiple sites to interact with ssDNA, which has been shown in vitro to enable them to bind a variable number of single-stranded nucleotides depending on the salt and protein concentration. It has long been suggested that different binding modes might be used selectively for different functions. To study this possibility, we used optical tweezers to determine and compare the structure and energetics of long, individual HmtSSB-DNA complexes assembled on preformed ssDNA and on ssDNA generated gradually during 'in situ' DNA synthesis. We show that HmtSSB binds to preformed ssDNA in two major modes, depending on salt and protein concentration. However, when protein binding was coupled to strand-displacement DNA synthesis, only one of the two binding modes was observed under all experimental conditions. Our results reveal a key role for the gradual generation of ssDNA in modulating the binding mode of a multimeric SSB protein and consequently, in generating the appropriate nucleoprotein structure for DNA synthetic reactions required for genome maintenance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Identification of Actin-Binding Proteins from Maize Pollen

    Energy Technology Data Exchange (ETDEWEB)

    Staiger, C.J.

    2004-01-13

    Specific Aims--The goal of this project was to gain an understanding of how actin filament organization and dynamics are controlled in flowering plants. Specifically, we proposed to identify unique proteins with novel functions by investigating biochemical strategies for the isolation and characterization of actin-binding proteins (ABPs). In particular, our hunt was designed to identify capping proteins and nucleation factors. The specific aims included: (1) to use F-actin affinity chromatography (FAAC) as a general strategy to isolate pollen ABPs (2) to produce polyclonal antisera and perform subcellular localization in pollen tubes (3) to isolate cDNA clones for the most promising ABPs (4) to further purify and characterize ABP interactions with actin in vitro. Summary of Progress By employing affinity chromatography on F-actin or DNase I columns, we have identified at least two novel ABPs from pollen, PrABP80 (gelsolin-like) and ZmABP30, We have also cloned and expressed recombinant protein, as well as generated polyclonal antisera, for 6 interesting ABPs from Arabidopsis (fimbrin AtFIM1, capping protein a/b (AtCP), adenylyl cyclase-associated protein (AtCAP), AtCapG & AtVLN1). We performed quantitative analyses of the biochemical properties for two of these previously uncharacterized ABPs (fimbrin and capping protein). Our studies provide the first evidence for fimbrin activity in plants, demonstrate the existence of barbed-end capping factors and a gelsolin-like severing activity, and provide the quantitative data necessary to establish and test models of F-actin organization and dynamics in plant cells.

  5. Evolving Transcription Factor Binding Site Models From Protein Binding Microarray Data

    KAUST Repository

    Wong, Ka-Chun

    2016-02-02

    Protein binding microarray (PBM) is a high-throughput platform that can measure the DNA binding preference of a protein in a comprehensive and unbiased manner. In this paper, we describe the PBM motif model building problem. We apply several evolutionary computation methods and compare their performance with the interior point method, demonstrating their performance advantages. In addition, given the PBM domain knowledge, we propose and describe a novel method called kmerGA which makes domain-specific assumptions to exploit PBM data properties to build more accurate models than the other models built. The effectiveness and robustness of kmerGA is supported by comprehensive performance benchmarking on more than 200 datasets, time complexity analysis, convergence analysis, parameter analysis, and case studies. To demonstrate its utility further, kmerGA is applied to two real world applications: 1) PBM rotation testing and 2) ChIP-Seq peak sequence prediction. The results support the biological relevance of the models learned by kmerGA, and thus its real world applicability.

  6. Binding affinities and interactions among different heat shock element types and heat shock factors in rice (Oryza sativa L.).

    Science.gov (United States)

    Mittal, Dheeraj; Enoki, Yasuaki; Lavania, Dhruv; Singh, Amanjot; Sakurai, Hiroshi; Grover, Anil

    2011-09-01

    Binding of heat shock factors (Hsfs) to heat shock elements (HSEs) leads to transcriptional regulation of heat shock genes. Genome-wide, 953 rice genes contain perfect-type, 695 genes gap-type and 1584 genes step-type HSE sequences in their 1-kb promoter region. The rice genome contains 13 class A, eight class B and four class C Hsfs (OsHsfs) and has OsHsf26 (which is of variant type) genes. Chemical cross-linking analysis of in vitro synthesized OsHsf polypeptides showed formation of homotrimers of OsHsfA2c, OsHsfA9 and OsHsfB4b proteins. Binding analysis of polypeptides with oligonucleotide probes containing perfect-, gap-, and step-type HSE sequences showed that OsHsfA2c, OsHsfA9 and OsHsfB4b differentially recognize various model HSEs as a function of varying reaction temperatures. The homomeric form of OsHsfA2c and OsHsfB4b proteins was further noted by the bimolecular fluorescence complementation approach in onion epidermal cells. In yeast two-hybrid assays, OsHsfB4b showed homomeric interaction as well as distinct heteromeric interactions with OsHsfA2a, OsHsfA7, OsHsfB4c and OsHsf26. Transactivation activity was noted in OsHsfA2c, OsHsfA2d, OsHsfA9, OsHsfC1a and OsHsfC1b in yeast cells. These differential patterns pertaining to binding with HSEs and protein-protein interactions may have a bearing on the cellular functioning of OsHsfs under a range of different physiological and environmental conditions. © 2011 The Authors Journal compilation © 2011 FEBS.

  7. Activated macrophage survival is coordinated by TAK1 binding proteins.

    Directory of Open Access Journals (Sweden)

    September R Mihaly

    Full Text Available Macrophages play diverse roles in tissue homeostasis and immunity, and canonically activated macrophages are critically associated with acute inflammatory responses. It is known that activated macrophages undergo cell death after transient activation in some settings, and the viability of macrophages impacts on inflammatory status. Here we report that TGFβ- activated kinase (TAK1 activators, TAK1-binding protein 1 (TAB1 and TAK1-binding protein 2 (TAB2, are critical molecules in the regulation of activated macrophage survival. While deletion of Tak1 induced cell death in bone marrow derived macrophages even without activation, Tab1 or Tab2 deletion alone did not profoundly affect survival of naïve macrophages. However, in lipopolysaccharide (LPS-activated macrophages, even single deletion of Tab1 or Tab2 resulted in macrophage death with both necrotic and apoptotic features. We show that TAB1 and TAB2 were redundantly involved in LPS-induced TAK1 activation in macrophages. These results demonstrate that TAK1 activity is the key to activated macrophage survival. Finally, in an in vivo setting, Tab1 deficiency impaired increase of peritoneal macrophages upon LPS challenge, suggesting that TAK1 complex regulation of macrophages may participate in in vivo macrophage homeostasis. Our results demonstrate that TAB1 and TAB2 are required for activated macrophages, making TAB1 and TAB2 effective targets to control inflammation by modulating macrophage survival.

  8. Melanocortin receptor binding determinants in the agouti protein.

    Science.gov (United States)

    Kiefer, L L; Veal, J M; Mountjoy, K G; Wilkison, W O

    1998-01-27

    The agouti protein plays an important role in the development of diabetes and obesity in rodents and has been shown to be a potent antagonist of melanocortin receptors. For this reason alanine-scanning mutagenesis was performed on the agouti protein carboxyl terminus to locate residues important for melanocortin receptor binding inhibition. When agouti residues Arg116 and Phe118 are changed to alanine, very large decreases in agouti affinity for melanocortin receptor 1, 3, and 4 result. Mutation of Phe117 to alanine causes a similar increase in agouti KI app at melanocortin receptor 4. Substitution of agouti residue Asp108 with alanine results in large increases in KI app for all three melanocortin receptors examined. All of these residues are conserved in the agouti-related transcript, ART, whose expression is up-regulated in animal models of obesity. The three-dimensional structure of the agouti carboxyl terminus was modeled, and residues which decrease receptor binding by a factor of > or = 15 when mutated to alanine localize to one side of the structure. These agouti variants with altered receptor selectivity may be useful in determining the role of melanocortin receptors in diabetes and obesity.

  9. Simulation of Reversible Protein–Protein Binding and Calculation of Binding Free Energies Using Perturbed Distance Restraints

    Science.gov (United States)

    2017-01-01

    Virtually all biological processes depend on the interaction between proteins at some point. The correct prediction of biomolecular binding free-energies has many interesting applications in both basic and applied pharmaceutical research. While recent advances in the field of molecular dynamics (MD) simulations have proven the feasibility of the calculation of protein–protein binding free energies, the large conformational freedom of proteins and complex free energy landscapes of binding processes make such calculations a difficult task. Moreover, convergence and reversibility of resulting free-energy values remain poorly described. In this work, an easy-to-use, yet robust approach for the calculation of standard-state protein–protein binding free energies using perturbed distance restraints is described. In the binding process the conformations of the proteins were restrained, as suggested earlier. Two approaches to avoid end-state problems upon release of the conformational restraints were compared. The method was evaluated by practical application to a small model complex of ubiquitin and the very flexible ubiquitin-binding domain of human DNA polymerase ι (UBM2). All computed free energy differences were closely monitored for convergence, and the calculated binding free energies had a mean unsigned deviation of only 1.4 or 2.5 kJ·mol–1 from experimental values. Statistical error estimates were in the order of thermal noise. We conclude that the presented method has promising potential for broad applicability to quantitatively describe protein–protein and various other kinds of complex formation. PMID:28898077

  10. The telomere binding protein TRF2 induces chromatin compaction.

    Directory of Open Access Journals (Sweden)

    Asmaa M Baker

    2011-04-01

    Full Text Available Mammalian telomeres are specialized chromatin structures that require the telomere binding protein, TRF2, for maintaining chromosome stability. In addition to its ability to modulate DNA repair activities, TRF2 also has direct effects on DNA structure and topology. Given that mammalian telomeric chromatin includes nucleosomes, we investigated the effect of this protein on chromatin structure. TRF2 bound to reconstituted telomeric nucleosomal fibers through both its basic N-terminus and its C-terminal DNA binding domain. Analytical agarose gel electrophoresis (AAGE studies showed that TRF2 promoted the folding of nucleosomal arrays into more compact structures by neutralizing negative surface charge. A construct containing the N-terminal and TRFH domains together altered the charge and radius of nucleosomal arrays similarly to full-length TRF2 suggesting that TRF2-driven changes in global chromatin structure were largely due to these regions. However, the most compact chromatin structures were induced by the isolated basic N-terminal region, as judged by both AAGE and atomic force microscopy. Although the N-terminal region condensed nucleosomal array fibers, the TRFH domain, known to alter DNA topology, was required for stimulation of a strand invasion-like reaction with nucleosomal arrays. Optimal strand invasion also required the C-terminal DNA binding domain. Furthermore, the reaction was not stimulated on linear histone-free DNA. Our data suggest that nucleosomal chromatin has the ability to facilitate this activity of TRF2 which is thought to be involved in stabilizing looped telomere structures.

  11. Modulation of CRISPR locus transcription by the repeat-binding protein Cbp1 in Sulfolobus

    DEFF Research Database (Denmark)

    Deng, Ling; Kenchappa, Chandra Shekar; Peng, Xu

    2012-01-01

    CRISPR loci are essential components of the adaptive immune system of archaea and bacteria. They consist of long arrays of repeats separated by DNA spacers encoding guide RNAs (crRNA), which target foreign genetic elements. Cbp1 (CRISPR DNA repeat binding protein) binds specifically to the multiple...... direct repeats of CRISPR loci of members of the acidothermophilic, crenarchaeal order Sulfolobales. cbp1 gene deletion from Sulfolobus islandicus REY15A produced a strong reduction in pre-crRNA yields from CRISPR loci but did not inhibit the foreign DNA targeting capacity of the CRISPR/Cas system....... Conversely, overexpression of Cbp1 in S. islandicus generated an increase in pre-crRNA yields while the level of reverse strand transcripts from CRISPR loci remained unchanged. It is proposed that Cbp1 modulates production of longer pre-crRNA transcripts from CRISPR loci. A possible mechanism...

  12. RNA-binding protein hnRNPLL as a critical regulator of lymphocyte homeostasis and differentiation.

    Science.gov (United States)

    Chang, Xing

    2016-05-01

    RNA-binding proteins orchestrate posttranscriptional regulation of gene expression, such as messenger RNA (mRNA) splicing, RNA stability regulation, and translation regulation. Heterogeneous nuclear RNA-binding proteins (hnRNPs) refer to a collection of unrelated RNA-binding proteins predominantly located in the nucleus (Han et al. Biochem J 2010, 430:379-392). Although canonical functions of hnRNPs are to promote pre-mRNA splicing, they are involved in all the processes of RNA metabolism through recognizing specific cis-elements on RNA (Dreyfuss et al. Annu Rev Biochem 1993, 62:289-321; Huelga et al. Cell Rep 2012, 1:167-178; Krecic and Swanson. Curr Opin Cell Biol 1999, 11:363-371). Heterogeneous nuclear RNA-binding protein L like (hnRNPLL) is a tissue-specific hnRNP, which was identified as a regulator of CD45RA to CD45RO switching during memory T-cell development (Oberdoerffer et al. Science 2008, 321:686-691; Topp et al. RNA 2008, 14:2038-2049; Wu et al. Immunity 2008, 29:863-875). Since then, hnRNPLL has emerged as a critical regulator of lymphocyte homeostasis and terminal differentiation, controlling alternative splicing or expression of critical genes for the lymphocytes development (Wu et al. Immunity 2008, 29:863-875; Chang et al. Proc Natl Acad Sci USA 2015, 112:E1888-E1897). This review will summarize recent advances in understanding the functions of hnRNPLL, focusing on its biochemical functions and physiological roles in lymphocyte differentiation and homeostasis. WIREs RNA 2016, 7:295-302. doi: 10.1002/wrna.1335 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.

  13. A sequence-based dynamic ensemble learning system for protein ligand-binding site prediction

    KAUST Repository

    Chen, Peng

    2015-12-03

    Background: Proteins have the fundamental ability to selectively bind to other molecules and perform specific functions through such interactions, such as protein-ligand binding. Accurate prediction of protein residues that physically bind to ligands is important for drug design and protein docking studies. Most of the successful protein-ligand binding predictions were based on known structures. However, structural information is not largely available in practice due to the huge gap between the number of known protein sequences and that of experimentally solved structures

  14. Grizzly bear corticosteroid binding globulin: Cloning and serum protein expression.

    Science.gov (United States)

    Chow, Brian A; Hamilton, Jason; Alsop, Derek; Cattet, Marc R L; Stenhouse, Gordon; Vijayan, Mathilakath M

    2010-06-01

    Serum corticosteroid levels are routinely measured as markers of stress in wild animals. However, corticosteroid levels rise rapidly in response to the acute stress of capture and restraint for sampling, limiting its use as an indicator of chronic stress. We hypothesized that serum corticosteroid binding globulin (CBG), the primary transport protein for corticosteroids in circulation, may be a better marker of the stress status prior to capture in grizzly bears (Ursus arctos). To test this, a full-length CBG cDNA was cloned and sequenced from grizzly bear testis and polyclonal antibodies were generated for detection of this protein in bear sera. The deduced nucleotide and protein sequences were 1218 bp and 405 amino acids, respectively. Multiple sequence alignments showed that grizzly bear CBG (gbCBG) was 90% and 83% identical to the dog CBG nucleotide and amino acid sequences, respectively. The affinity purified rabbit gbCBG antiserum detected grizzly bear but not human CBG. There were no sex differences in serum total cortisol concentration, while CBG expression was significantly higher in adult females compared to males. Serum cortisol levels were significantly higher in bears captured by leg-hold snare compared to those captured by remote drug delivery from helicopter. However, serum CBG expression between these two groups did not differ significantly. Overall, serum CBG levels may be a better marker of chronic stress, especially because this protein is not modulated by the stress of capture and restraint in grizzly bears. Copyright 2010 Elsevier Inc. All rights reserved.

  15. The function of DNA binding protein nucleophosmin in AAV replication.

    Science.gov (United States)

    Satkunanathan, Stifani; Thorpe, Robin; Zhao, Yuan

    2017-10-01

    Adeno-associated viruses (AAV) contain minimal viral proteins necessary for their replication. During virus assembly, AAV acquire, inherently and submissively, various cellular proteins. Our previous studies identified the association of AAV vectors with the DNA binding protein nucleophosmin (NPM1). Nucleophosmin has been reported to enhance AAV infection by mobilizing AAV capsids into and out of the nucleolus, indicating the importance of NPM1 in the AAV life cycle; however the role of NPM1 in AAV production remains unknown. In this study, we systematically investigated NPM1 function on AAV production using NPM1 knockdown cells and revealing for the first time the presence of G-quadruplex DNA sequences (GQRS) in the AAV genome, the synergistic NPM1-GQRS function in AAV production and the significant enhancement of NPM1 gene knockdown on AAV vector production. Understanding the role of cellular proteins in the AAV life cycle will greatly facilitate high titre production of AAV vectors for clinical use. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.

  16. Direct protein-protein interactions and substrate channelling between cellular retinoic acid binding proteins and CYP26B1

    Science.gov (United States)

    Nelson, Cara H; Peng, Chi-Chi; Lutz, Justin D.; Yeung, Catherine K.; Zelter, Alex; Isoherranen, Nina

    2016-01-01

    Cellular retinoic acid binding proteins (CRABPs) bind all-trans-retinoic acid (atRA) tightly. This study aimed to determine whether atRA is channeled directly to cytochrome P450 (CYP) CYP26B1 by CRABPs, and whether CRABPs interact directly with CYP26B1. atRA bound to CRABPs (holo-CRABP) was efficiently metabolized by CYP26B1. Isotope dilution experiments showed that delivery of atRA to CYP26B1 in solution was similar with or without CRABP. Holo-CRABPs had higher affinity for CYP26B1 than free atRA, but both apo-CRABPs inhibited the formation of 4-OH-RA by CYP26B1. Similar protein-protein interactions between soluble binding proteins and CYPs may be important for other lipophilic CYP substrates. PMID:27416800

  17. Novel approach for selecting the best predictor for identifying the binding sites in DNA binding proteins.

    Science.gov (United States)

    Nagarajan, R; Ahmad, Shandar; Gromiha, M Michael

    2013-09-01

    Protein-DNA complexes play vital roles in many cellular processes by the interactions of amino acids with DNA. Several computational methods have been developed for predicting the interacting residues in DNA-binding proteins using sequence and/or structural information. These methods showed different levels of accuracies, which may depend on the choice of data sets used in training, the feature sets selected for developing a predictive model, the ability of the models to capture information useful for prediction or a combination of these factors. In many cases, different methods are likely to produce similar results, whereas in others, the predictors may return contradictory predictions. In this situation, a priori estimates of prediction performance applicable to the system being investigated would be helpful for biologists to choose the best method for designing their experiments. In this work, we have constructed unbiased, stringent and diverse data sets for DNA-binding proteins based on various biologically relevant considerations: (i) seven structural classes, (ii) 86 folds, (iii) 106 superfamilies, (iv) 194 families, (v) 15 binding motifs, (vi) single/double-stranded DNA, (vii) DNA conformation (A, B, Z, etc.), (viii) three functions and (ix) disordered regions. These data sets were culled as non-redundant with sequence identities of 25 and 40% and used to evaluate the performance of 11 different methods in which online services or standalone programs are available. We observed that the best performing methods for each of the data sets showed significant biases toward the data sets selected for their benchmark. Our analysis revealed important data set features, which could be used to estimate these context-specific biases and hence suggest the best method to be used for a given problem. We have developed a web server, which considers these features on demand and displays the best method that the investigator should use. The web server is freely available at

  18. The Xis2d protein of CTnDOT binds to the intergenic region between the mob and tra operons.

    Science.gov (United States)

    Hopp, Crystal M; Gardner, Jeffrey F; Salyers, Abigail A

    2015-09-01

    CTnDOT is a 65kbp integrative and conjugative element (ICE) that carries genes encoding both tetracycline and erythromycin resistances. The excision operon of this element encodes Xis2c, Xis2d, and Exc proteins involved in the excision of CTnDOT from host chromosomes. These proteins are also required in the complex transcriptional regulation of the divergently transcribed transfer (tra) and mobilization (mob) operons of CTnDOT. Transcription of the tra operon is positively regulated by Xis2c and Xis2d, whereas, transcription of the mob operon is positively regulated by Xis2d and Exc. Xis2d is the only protein that is involved in the excision reaction, as well as the transcriptional regulation of both the mob and tra operons. This paper helps establish how Xis2d binds the DNA in the mob and tra region. Unlike other excisionase proteins, Xis2d binds a region of dyad symmetry. The binding site is located in the intergenic region between the mob and tra promoters, and once bound Xis2d induces a bend in the DNA. Xis2d binding to this region could be the preliminary step for the activation of both operons. Then the other proteins, like Exc, can interact with Xis2d and form higher order complexes. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Binding site prediction for protein-protein interactions and novel motif discovery using re-occurring polypeptide sequences.

    Science.gov (United States)

    Amos-Binks, Adam; Patulea, Catalin; Pitre, Sylvain; Schoenrock, Andrew; Gui, Yuan; Green, James R; Golshani, Ashkan; Dehne, Frank

    2011-06-02

    While there are many methods for predicting protein-protein interaction, very few can determine the specific site of interaction on each protein. Characterization of the specific sequence regions mediating interaction (binding sites) is crucial for an understanding of cellular pathways. Experimental methods often report false binding sites due to experimental limitations, while computational methods tend to require data which is not available at the proteome-scale. Here we present PIPE-Sites, a novel method of protein specific binding site prediction based on pairs of re-occurring polypeptide sequences, which have been previously shown to accurately predict protein-protein interactions. PIPE-Sites operates at high specificity and requires only the sequences of query proteins and a database of known binary interactions with no binding site data, making it applicable to binding site prediction at the proteome-scale. PIPE-Sites was evaluated using a dataset of 265 yeast and 423 human interacting proteins pairs with experimentally-determined binding sites. We found that PIPE-Sites predictions were closer to the confirmed binding site than those of two existing binding site prediction methods based on domain-domain interactions, when applied to the same dataset. Finally, we applied PIPE-Sites to two datasets of 2347 yeast and 14,438 human novel interacting protein pairs predicted to interact with high confidence. An analysis of the predicted interaction sites revealed a number of protein subsequences which are highly re-occurring in binding sites and which may represent novel binding motifs. PIPE-Sites is an accurate method for predicting protein binding sites and is applicable to the proteome-scale. Thus, PIPE-Sites could be useful for exhaustive analysis of protein binding patterns in whole proteomes as well as discovery of novel binding motifs. PIPE-Sites is available online at http://pipe-sites.cgmlab.org/.

  20. AUH, a gene encoding an AU-specific RNA binding protein with intrinsic enoyl-CoA hydratase activity.

    Science.gov (United States)

    Nakagawa, J; Waldner, H; Meyer-Monard, S; Hofsteenge, J; Jenö, P; Moroni, C

    1995-01-01

    AU-rich elements within the 3' untranslated region of transcripts of lymphokines and some protooncogenes serve as signal for rapid mRNA degradation. By using an AUUUA matrix, we have affinity-purified a 32-kDa protein, microsequenced it, and cloned the corresponding cDNA. In vitro, the recombinant protein bound specifically to AU-rich transcripts, including those for interleukin 3, granulocyte/macrophage colony-stimulating factor, c-fos, and c-myc. Sequence analysis revealed an unexpected homology to enoyl-CoA hydratase (EC 4.2.1.17), and the recombinant protein showed a low degree of the enzymatic activity. Thus, this gene, designated AUH, encodes an RNA binding protein with intrinsic enzymatic activity. Protein immobilized on an AUUUA matrix was enzymatically active, suggesting that hydratase and AU-binding functions are located on distinct domains within a single polypeptide. Images Fig. 1 Fig. 3 Fig. 5 PMID:7892223

  1. Translation-competent 48S complex formation on HCV IRES requires the RNA-binding protein NSAP1.

    Science.gov (United States)

    Park, Sung Mi; Paek, Ki Young; Hong, Ka Young; Jang, Christopher J; Cho, Sungchan; Park, Ji Hoon; Kim, Jong Heon; Jan, Eric; Jang, Sung Key

    2011-09-01

    Translation of many cellular and viral mRNAs is directed by internal ribosomal entry sites (IRESs). Several proteins that enhance IRES activity through interactions with IRES elements have been discovered. However, the molecular basis for the IRES-activating function of the IRES-binding proteins remains unknown. Here, we report that NS1-associated protein 1 (NSAP1), which augments several cellular and viral IRES activities, enhances hepatitis C viral (HCV) IRES function by facilitating the formation of translation-competent 48S ribosome-mRNA complex. NSAP1, which is associated with the solvent side of the 40S ribosomal subunit, enhances 80S complex formation through correct positioning of HCV mRNA on the 40S ribosomal subunit. NSAP1 seems to accomplish this positioning function by directly binding to both a specific site in the mRNA downstream of the initiation codon and a 40S ribosomal protein (or proteins).

  2. OB protein binds specifically to the choroid plexus of mice and rats.

    Science.gov (United States)

    Devos, R; Richards, J G; Campfield, L A; Tartaglia, L A; Guisez, Y; van der Heyden, J; Travernier, J; Plaetinck, G; Burn, P

    1996-05-28

    Binding studies were conducted to identify the anatomical location of brain target sites for OB protein, the ob gene product. 125I-labeled recombinant mouse OB protein or alkaline phosphatase-OB fusion proteins were used for in vitro and in vivo binding studies. Coronal brain sections or fresh tissue from lean, obese ob/ob, and obese db/db mice as well as lean and obese Zucker rats were probed to identify potential central OB protein-binding sites. We report here that recombinant OB protein binds specifically to the choroid plexus. The binding of OB protein (either radiolabeled or the alkaline phosphatase-OB fusion protein) and its displacement by unlabeled OB protein was similar in lean, obese ob/ob, and obese db/db mice as well as lean and obese Zucker rats. These findings suggest that OB protein binds with high affinity to a specific receptor in the choroid plexus. After binding to the choroid plexus receptor, OB protein may then be transported across the blood-brain barrier into the cerebrospinal fluid. Alternatively, binding of OB protein to a specific receptor in the choroid plexus may activate afferent neural inputs to the neural network that regulates feeding behavior and energy balance or may result in the clearance or degradation of OB protein. The identification of the choroid plexus as a brain binding site for OB protein will provide the basis for the construction of expression libraries and facilitate the rapid cloning of the choroid plexus OB receptor.

  3. Differential dissociation micromethod for the investigation of binding of metandrostenolone (Nerobol) to plasma proteins

    Energy Technology Data Exchange (ETDEWEB)

    Bojadzsieva, M.; Kocsar, L. (Orszagos Frederic Joliot-Curie Sugarbiologiai es Sugaregeszseguegyi Kutato Intezet, Budapest (Hungary)); Kremmer, T. (Orszagos Onkologiai Intezet, Budapest (Hungary))

    1985-01-01

    A micromethod was developed to determine the binding of anabolic steroids to plasma proteins. The new procedure combines precipitation with ammonium sulphate and differential dissociation. The binding parameters (association constant, specific binding capacity) are calculated on the basis of dissociation curves of sup(3)H-metandrostenolone from the precipitated sexual binding globuline.

  4. Growth hormone-binding proteins in high-speed cytosols of multiple tissues of the rabbit.

    Science.gov (United States)

    Herington, A C; Ymer, S; Roupas, P; Stevenson, J

    1986-04-11

    Soluble, specific binding protein(s) for growth hormone (GH) have been identified and partially characterized in high-speed cytosolic preparations from a number of rabbit tissues. The binding of 125I-labelled human GH to proteins in liver, heart, adipose tissue, skeletal muscle and kidney cytosols was dependent on time and cytosolic protein concentration. By Scatchard analysis, the binding affinities (KA: (2-7) X 10(9) M-1) were somewhat higher than those generally reported for membrane GH receptors. The binding proteins had a greater specificity for somatotrophic hormones than lactogenic hormones, although the kidney appeared to have, in addition, a lactogen-binding protein. By gel filtration, the Mr of the cytosolic GH-binding protein was approximately 100 000 in all tissues. None of the binding proteins was detectable by the poly(ethylene glycol) precipitation method used widely for soluble hormone receptors. The cytosolic GH-binding proteins also cross-reacted with a monoclonal antibody to the rabbit liver membrane GH receptor. These results indicate the ubiquitous presence of apparently naturally soluble GH-binding proteins in the cytosolic fractions of several tissues in the rabbit. Of great interest is their presence in muscle, where GH receptors or binding proteins have not previously been detected, despite muscle being recognized as a classical GH target tissue.

  5. CCAAT/enhancer binding protein homologous protein (DDIT3) induces osteoblastic cell differentiation.

    Science.gov (United States)

    Pereira, Renata C; Delany, Anne M; Canalis, Ernesto

    2004-04-01

    CCAAT/enhancer binding protein (C/EBP) homologous protein (CHOP/DDIT3), a member of the C/EBP family of transcription factors, plays a role in cell survival and differentiation. CHOP/DDIT3 binds to C/EBPs to form heterodimers that do not bind to consensus Cebp sequences, acting as a dominant-negative inhibitor. CHOP/DDIT3 blocks adipogenesis, and we postulated it could induce osteoblastogenesis. We investigated the effects of constitutive CHOP/DDIT3 overexpression in murine ST-2 stromal cells transduced with retroviral vectors. ST-2 cells differentiated toward osteoblasts, and CHOP/DDIT3 accelerated and enhanced the appearance of mineralized nodules, and the expression of osteocalcin and alkaline phosphatase mRNAs, particularly in the presence of bone morphogenetic protein-2. CHOP/DDIT3 overexpression opposed adipogenesis, and did not cause substantial changes in cell number. CHOP/DDIT3 overexpression did not modify C/EBPalpha or -beta mRNA levels but decreased C/EBPdelta after 24 d of culture. Electrophoretic mobility shift and supershift assays demonstrated that overexpression of CHOP/DDIT3 decreased the binding of C/EBPs to their consensus sequence by interacting with C/EBPalpha and -beta, confirming its dominant-negative role. In addition, CHOP/DDIT3 enhanced bone morphogenetic protein-2/Smad signaling. In conclusion, CHOP/DDIT3 enhances osteoblastic differentiation of stromal cells, in part by interacting with C/EBPalpha and -beta and also by enhancing Smad signaling.

  6. Interacting protein partners of Arabidopsis RNA binding protein AtRBP45b

    Science.gov (United States)

    RNA binding proteins (RBPs) are important players in post-transcriptional gene regulation and shown to play an important role in normal development and in response to environmental perturbations. Arabidopsis RBP, AtRBP45b with triple RNA recognition motifs (RRMs) have are closely related to the yeas...

  7. Acyl-CoA binding protein is an essential protein in mammalian cell lines

    DEFF Research Database (Denmark)

    Knudsen, Jens; Færgeman, Nils J.

    2002-01-01

    In the present work, small interference RNA was used to knock-down acyl-CoA binding protein (ACBP) in HeLa, HepG2 and Chang cells. Transfection with ACBP-specific siRNA stopped growth, detached cells from the growth surface and blocked thymidine and acetate incorporation. The results show that de...

  8. Down modulation of HIV-1 gene expression using a procaryotic RNA-binding protein

    NARCIS (Netherlands)

    Berkhout, B.; Jeang, K. T.

    1990-01-01

    The coat protein of the single stranded RNA bacteriophages acts as a translational repressor by binding with high affinity to a target RNA that encompasses the ribosomal binding site of the replicase gene. We have expressed this procaryotic RNA-binding protein in mammalian cells. Using the coat

  9. A single rainbow trout cobalamin-binding protein stands in for three human binders

    DEFF Research Database (Denmark)

    Greibe, Eva; Fedosov, Sergey; Sorensen, Boe S

    2012-01-01

    -binding proteins of the rainbow trout (Oncorhynchus mykiss) and to compare their properties with those of the three human cobalamin-binding proteins. High cobalamin-binding capacity was found in trout stomach (210 pmol/g), roe (400 pmol/g), roe fluid (390 nmol/liter), and plasma (2500 nmol/liter). In all cases...... affinity for the cobalamin analog cobinamide. Like haptocorrin and transcobalamin, the trout cobalamin-binding protein was present in plasma and recognized ligands with altered nucleotide moiety. Like intrinsic factors, the trout cobalamin-binding protein was present in the stomach and resisted degradation...

  10. Value of heart-type fatty acid-binding protein (H-FABP) for ...

    African Journals Online (AJOL)

    Key Words: heart-type fatty acid-binding protein, acute coronary syndrome, biomarker. DOI: http://dx.doi.org/10.4314/ahs.v14i3.36 ... weight (14.5 kDa) protein, which contains 132 amino acid residues (3). Fatty acid-binding proteins ..... injury by assessment of the plasma ratio of my- oglobin over fatty acid binding protein.

  11. Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements.

    Science.gov (United States)

    Chen, Chen; Gorlatova, Natalia; Kelman, Zvi; Herzberg, Osnat

    2011-04-19

    Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 μM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.

  12. Characterization of a Single-Stranded DNA-Binding-Like Protein from Nanoarchaeum equitans--A Nucleic Acid Binding Protein with Broad Substrate Specificity.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available SSB (single-stranded DNA-binding proteins play an essential role in all living cells and viruses, as they are involved in processes connected with ssDNA metabolism. There has recently been an increasing interest in SSBs, since they can be applied in molecular biology techniques and analytical methods. Nanoarchaeum equitans, the only known representative of Archaea phylum Nanoarchaeota, is a hyperthermophilic, nanosized, obligatory parasite/symbiont of Ignicoccus hospitalis.This paper reports on the ssb-like gene cloning, gene expression and characterization of a novel nucleic acid binding protein from Nanoarchaeum equitans archaeon (NeqSSB-like protein. This protein consists of 243 amino acid residues and one OB fold per monomer. It is biologically active as a monomer like as SSBs from some viruses. The NeqSSB-like protein displays a low sequence similarity to the Escherichia coli SSB, namely 10% identity and 29% similarity, and is the most similar to the Sulfolobus solfataricus SSB (14% identity and 32% similarity. The NeqSSB-like protein binds to ssDNA, although it can also bind mRNA and, surprisingly, various dsDNA forms, with no structure-dependent preferences as evidenced by gel mobility shift assays. The size of the ssDNA binding site, which was estimated using fluorescence spectroscopy, is 7 ± 1 nt. No salt-dependent binding mode transition was observed. NeqSSB-like protein probably utilizes a different model for ssDNA binding than the SSB proteins studied so far. This protein is highly thermostable; the half-life of the ssDNA binding activity is 5 min at 100 °C and melting temperature (T(m is 100.2 °C as shown by differential scanning calorimetry (DSC analysis.NeqSSB-like protein is a novel highly thermostable protein which possesses a unique broad substrate specificity and is able to bind all types of nucleic acids.

  13. Accuracy of protein-protein binding sites in high-throughput template-based modeling.

    Directory of Open Access Journals (Sweden)

    Petras J Kundrotas

    2010-04-01

    Full Text Available The accuracy of protein structures, particularly their binding sites, is essential for the success of modeling protein complexes. Computationally inexpensive methodology is required for genome-wide modeling of such structures. For systematic evaluation of potential accuracy in high-throughput modeling of binding sites, a statistical analysis of target-template sequence alignments was performed for a representative set of protein complexes. For most of the complexes, alignments containing all residues of the interface were found. The full interface alignments were obtained even in the case of poor alignments where a relatively small part of the target sequence (as low as 40% aligned to the template sequence, with a low overall alignment identity (<30%. Although such poor overall alignments might be considered inadequate for modeling of whole proteins, the alignment of the interfaces was strong enough for docking. In the set of homology models built on these alignments, one third of those ranked 1 by a simple sequence identity criteria had RMSD<5 A, the accuracy suitable for low-resolution template free docking. Such models corresponded to multi-domain target proteins, whereas for single-domain proteins the best models had 5 Aprotein-protein complexes.

  14. The surface protein Shr of Streptococcus pyogenes binds heme and transfers it to the streptococcal heme-binding protein Shp

    Directory of Open Access Journals (Sweden)

    Lei Benfang

    2008-01-01

    Full Text Available Abstract Background The heme acquisition machinery in Streptococcus pyogenes is believed to consist of the surface proteins, Shr and Shp, and heme-specific ATP-binding cassette transporter HtsABC. Shp has been shown to rapidly transfer its heme to the lipoprotein component, HtsA, of HtsABC. The function of Shr and the heme source of Shp have not been established. Results The objective of this study was to determine whether Shr binds heme and is a heme source of Shp. To achieve the objective, recombinant Shr protein was prepared. The purified Shr displays a spectrum typical of hemoproteins, indicating that Shr binds heme and acquires heme from Escherichia coli hemoproteins in vivo. Spectral analysis of Shr and Shp isolated from a mixture of Shr and heme-free Shp (apoShp indicates that Shr and apoShp lost and gained heme, respectively; whereas Shr did not efficiently lose its heme in incubation with apoHtsA under the identical conditions. These results suggest that Shr directly transfers its heme to Shp. In addition, the rates of heme transfer from human hemoglobin to apoShp are close to those of simple ferric heme dissociation from hemoglobin, suggesting that methemoglobin does not directly transfer its heme to apoShp. Conclusion We have demonstrated that recombinant Shr can acquire heme from E. coli hemoproteins in vivo and appears to directly transfer its heme to Shp and that Shp appears not to directly acquire heme from human methemoglobin. These results suggest the possibility that Shr is a source of heme for Shp and that the Shr-to-Shp heme transfer is a step of the heme acquisition process in S. pyogenes. Further characterization of the Shr/Shp/HtsA system would advance our understanding of the mechanism of heme acquisition in S. pyogenes.

  15. Application of immunoglobulin-binding proteins a, g, l in the affinity chromatography

    OpenAIRE

    Sviatenko, О.; Gorbatiuk, O.; Vasylchenko, О.

    2014-01-01

    Proteins A, G and L are native or recombinant proteins of microbial origin that bind to mammalian immunoglobulins. Preferably recombinant variants of proteins A, G, L are used in biotechnology for affinity sorbents production. Сomparative characteristics of proteins A, G, L and affinity sorbents on the basis of them, advantages and disadvantages of these proteins application as ligands in the affinity chromatography are done. Analysis of proteins A, G, L properties is presented. Binding speci...

  16. Nonequilibrium synthesis and assembly of hybrid inorganic-protein nanostructures using an engineered DNA binding protein.

    Science.gov (United States)

    Dai, Haixia; Choe, Woo-Seok; Thai, Corrine K; Sarikaya, Mehmet; Traxler, Beth A; Baneyx, François; Schwartz, Daniel T

    2005-11-09

    We show that a protein with no intrinsic inorganic synthesis activity can be endowed with the ability to control the formation of inorganic nanostructures under thermodynamically unfavorable (nonequilibrium) conditions, reproducing a key feature of biological hard-tissue growth and assembly. The nonequilibrium synthesis of Cu(2)O nanoparticles is accomplished using an engineered derivative of the DNA-binding protein TraI in a room-temperature precursor electrolyte. The functional TraI derivative (TraIi1753::CN225) is engineered to possess a cysteine-constrained 12-residue Cu(2)O binding sequence, designated CN225, that is inserted into a permissive site in TraI. When TraIi1753::CN225 is included in the precursor electrolyte, stable Cu(2)O nanoparticles form, even though the concentrations of [Cu(+)] and [OH(-)] are at 5% of the solubility product (K(sp,Cu2O)). Negative control experiments verify that Cu(2)O formation is controlled by inclusion of the CN225 binding sequence. Transmission electron microscopy and electron diffraction reveal a core-shell structure for the nonequilibrium nanoparticles: a 2 nm Cu(2)O core is surrounded by an adsorbed protein shell. Quantitative protein adsorption studies show that the unexpected stability of Cu(2)O is imparted by the nanomolar surface binding affinity of TraIi1753::CN225 for Cu(2)O (K(d) = 1.2 x 10(-)(8) M), which provides favorable interfacial energetics (-45 kJ/mol) for the core-shell configuration. The protein shell retains the DNA-binding traits of TraI, as evidenced by the spontaneous organization of nanoparticles onto circular double-stranded DNA.

  17. A bioinformatic survey of RNA-binding proteins in Plasmodium.

    Science.gov (United States)

    Reddy, B P Niranjan; Shrestha, Sony; Hart, Kevin J; Liang, Xiaoying; Kemirembe, Karen; Cui, Liwang; Lindner, Scott E

    2015-11-02

    The malaria parasites in the genus Plasmodium have a very complicated life cycle involving an invertebrate vector and a vertebrate host. RNA-binding proteins (RBPs) are critical factors involved in every aspect of the development of these parasites. However, very few RBPs have been functionally characterized to date in the human parasite Plasmodium falciparum. Using different bioinformatic methods and tools we searched P. falciparum genome to list and annotate RBPs. A representative 3D models for each of the RBD domain identified in P. falciparum was created using I-TESSAR and SWISS-MODEL. Microarray and RNAseq data analysis pertaining PfRBPs was performed using MeV software. Finally, Cytoscape was used to create protein-protein interaction network for CITH-Dozi and Caf1-CCR4-Not complexes. We report the identification of 189 putative RBP genes belonging to 13 different families in Plasmodium, which comprise 3.5% of all annotated genes. Almost 90% (169/189) of these genes belong to six prominent RBP classes, namely RNA recognition motifs, DEAD/H-box RNA helicases, K homology, Zinc finger, Puf and Alba gene families. Interestingly, almost all of the identified RNA-binding helicases and KH genes have cognate homologs in model species, suggesting their evolutionary conservation. Exploration of the existing P. falciparum blood-stage transcriptomes revealed that most RBPs have peak mRNA expression levels early during the intraerythrocytic development cycle, which taper off in later stages. Nearly 27% of RBPs have elevated expression in gametocytes, while 47 and 24% have elevated mRNA expression in ookinete and asexual stages. Comparative interactome analyses using human and Plasmodium protein-protein interaction datasets suggest extensive conservation of the PfCITH/PfDOZI and PfCaf1-CCR4-NOT complexes. The Plasmodium parasites possess a large number of putative RBPs belonging to most of RBP families identified so far, suggesting the presence of extensive post

  18. IRBP-like proteins in the eyes of six cephalopod species--immunochemical relationship to vertebrate interstitial retinol-binding protein (IRBP) and cephalopod retinal-binding protein.

    Science.gov (United States)

    Fong, S L; Lee, P G; Ozaki, K; Hara, R; Hara, T; Bridges, C D

    1988-01-01

    SDS polyacrylamide gel electrophoresis and immunoblotting were used to examine soluble proteins from the eyes of six species of cephalopods i.e. Lolliguncula brevis, Sepia officinalis, Octopus maya, Octopus bimaculoides, Rossia pacifica and Loligo opalescens. All species had a protein ("IRBP") with molecular weight virtually identical with vertebrate interstitial retinol-binding protein (IRBP) averaging 132,400 +/- 700 (n = 6). "IRBP" reacted on nitrocellulose blot transfers with rabbit antibovine IRBP and rabbit antifrog IRBP antibodies. Unlike vertebrate IRBP, cephalopod "IRBP" (from L. brevis) did not bind exogenous retinol or concanavalin A. The N-terminal amino acid appeared to be blocked in samples electroeluted from SDS gels. The antifrog IRBP antibodies also reacted with a series of proteins with molecular weights between 46,000 and 47,000, identified as retinal-binding protein (RALBP) with anti-RALBP antibodies. Anti-IRBP also reacted with pure RALBP prepared from Todarodes pacificus. Occasionally, anti-RALBP antibodies were seen to react weakly with "IRBP" in some cephalopods. We conclude that RALBP, cephalopod "IRBP" and vertebrate IRBP share a common but distant ancestry, and that a protein resembling IRBP appeared before the vertebrates diverged from the invertebrates. Both RALBP and IRBP appear to have analogous functions in shuttling retinoids between rhodopsin and the corresponding isomerizing system, retinochrome in the cephalopods and retinol isomerase in the vertebrates. The function of cephalopod "IRBP" is unknown.

  19. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  20. Facile manipulation of protein localization in fission yeast through binding of GFP-binding protein to GFP.

    Science.gov (United States)

    Chen, Ying-Hui; Wang, Gao-Yuan; Hao, Hao-Chao; Chao, Chun-Jiang; Wang, Yamei; Jin, Quan-Wen

    2017-03-01

    GFP-binding protein (or GBP) has been recently developed in various systems and organisms as an efficient tool to purify GFP-fusion proteins. Due to the high affinity between GBP and GFP or GFP variants, this GBP-based approach is also ideally suited to alter the localization of functional proteins in live cells. In order to facilitate the wide use of the GBP-targeting approach in the fission yeast Schizosaccharomyces pombe, we developed a set of pFA6a-, pJK148- and pUC119-based vectors containing GBP- or GBP-mCherry-coding sequences and variants of inducible nmt1 or constitutive adh1 promoters that result in different levels of expression. The GBP or GBP-mCherry fragments can serve as cassettes for N- or C-terminal genomic tagging of genes of interest. We illustrated the application of these vectors in the construction of yeast strains with Dma1 or Cdc7 tagged with GBP-mCherry and efficient targeting of Dma1- or Cdc7-GBP-mCherry to the spindle pole body by Sid4-GFP. This series of vectors should help to facilitate the application of the GBP-targeting approach in manipulating protein localization and the analysis of gene function in fission yeast, at the level of single genes, as well as at a systematic scale. © 2017. Published by The Company of Biologists Ltd.

  1. An RNA element in human interleukin 6 confers escape from degradation by the gammaherpesvirus SOX protein.

    Science.gov (United States)

    Hutin, Stephanie; Lee, Yeon; Glaunsinger, Britt A

    2013-04-01

    Several viruses express factors to silence host gene expression via widespread mRNA degradation. This phenotype is the result of the coordinated activity of the viral endonuclease SOX and the cellular RNA degradation enzyme Xrn1 during lytic Kaposi's sarcoma-associated herpesvirus (KSHV) infection. While most cellular transcripts are highly downregulated, a subset of host mRNA escapes turnover via unknown mechanisms. One of the most prominent escapees is the interleukin 6 (IL-6) mRNA, which accumulates robustly during KSHV lytic infection and is not subjected to SOX-induced degradation. Here we reveal that the IL-6 mRNA contains a dominant, cis-acting ∼100-nucleotide element within its 3' untranslated region (UTR) that renders it directly refractory to cleavage by SOX. This element specifically interacts with a cellular protein complex both in SOX-transfected cells and in KSHV-infected B cells. Using a directed RNA pulldown approach, we identified two components of this complex to be the AU-rich element (ARE) binding proteins AUF1 and HuR. Depletion of these proteins significantly reduced the protective capacity of the IL-6 RNA element in SOX-expressing cells. These findings suggest that SOX activity may be directly counteracted by select RNA regulatory complexes and reveal a novel mechanism contributing to the robust expression of IL-6 during KSHV replication.

  2. A Venom Gland Extracellular Chitin-Binding-Like Protein from Pupal Endoparasitoid Wasps, Pteromalus Puparum, Selectively Binds Chitin

    Directory of Open Access Journals (Sweden)

    Yu Zhu

    2015-11-01

    Full Text Available Chitin-binding proteins (CBPs are present in many species and they act in a variety of biological processes. We analyzed a Pteromalus puparum venom apparatus proteome and transcriptome and identified a partial gene encoding a possible CBP. Here, we report cloning a full-length cDNA of a sequence encoding a chitin-binding-like protein (PpCBP from P. puparum, a pupal endoparasitoid of Pieris rapae. The cDNA encoded a 96-amino-acid protein, including a secretory signal peptide and a chitin-binding peritrophin-A domain. Phylogenetic analysis of chitin binding domains (CBDs of cuticle proteins and peritrophic matrix proteins in selected insects revealed that the CBD of PpCBP clustered with the CBD of Nasonia vitripennis. The PpCBP is specifically expressed in the venom apparatus of P. puparum, mostly in the venom gland. PpCBP expression was highest at day one after adult eclosion and much lower for the following five days. We produced a recombinant PpCBP and binding assays showed the recombinant protein selectively binds chitin but not cellulose in vitro. We infer that PpCBP serves a structural role in the venom reservoir, or may be injected into the host to help wound healing of the host exoskeleton.

  3. Growth hormone receptor/binding protein: physiology and function.

    Science.gov (United States)

    Herington, A C; Ymer, S I; Stevenson, J L; Roupas, P

    1994-07-01

    Soluble truncated forms of the growth hormone receptor (GHR) are present in the circulation of many species and are also produced by many tissues/cell types. The major high-affinity forms of these GH-binding proteins (GHBP) are derived by alternative splicing of GHR mRNA in rodents, but probably by proteolytic cleavage in other species. Questions still remain with respect to the origins, native molecular form(s), physiology, and function of the GHBPs, however. The observation that GH induces dimerization of the soluble GHBP and membrane GHR, and that dimerization of GHR appears to be critical for GH bioactivity suggests that the presentation of GH to target cells, in an unbound form or as a monomeric or dimeric complex with GHBP, may have significant implications for the ability of GH to activate specific postreceptor signaling pathways (tyrosine kinase, protein kinase C, G-protein pathways) known to be utilized by GH for its diverse biological effects. This minireview addresses some of these aspects and highlights several new questions which have arisen as a result of recent advances in our understanding of the structure, function, and signaling mechanisms of the membrane bound GHR.

  4. Growth hormone receptor/binding protein: Physiology and function

    Energy Technology Data Exchange (ETDEWEB)

    Herington, A.C.; Ymer, S.I.; Stevenson, J.L.; Roupas, P. [Royal Children`s Hospital, Melbourne (Australia)

    1994-12-31

    Soluble truncated forms of the growth hormone receptor (GHR) are present in the circulation of many species and are also produced by many tissues/cell types. The major high-affinity forms of these GH-binding proteins (GHBP) are derived by alternative splicing of GHR mRNA in rodents, but probably by proteolytic cleavage in other species. Questions still remain with respect to the origins, native molecular forms(s), physiology, and function of the GHBPs, however. The observation that GH induces dimerization of the soluble GHBP and a membrane GHR, and that dimerization of GHR appears to be critical for GH bioactivity suggests that the presentation of GH to target cells, in an unbound form or as a monomeric or dimeric complex with GHBP, may have significant implications for the ability of GH to activate specific postreceptor signaling pathways (tyrosine kinase, protein kinase C, G-protein pathways) known to be utilized by GH for its diverse biological effects. This minireview addresses some of these aspects and highlights several new questions which have arisen as a result of recent advances in our understanding of the structure, function, and signaling mechanisms of the membrane bound GHR. 43 refs.

  5. Characterization of the Raf kinase inhibitory protein (RKIP binding pocket: NMR-based screening identifies small-molecule ligands.

    Directory of Open Access Journals (Sweden)

    Anne N Shemon

    Full Text Available BACKGROUND: Raf kinase inhibitory protein (RKIP, also known as phoshaptidylethanolamine binding protein (PEBP, has been shown to inhibit Raf and thereby negatively regulate growth factor signaling by the Raf/MAP kinase pathway. RKIP has also been shown to suppress metastasis. We have previously demonstrated that RKIP/Raf interaction is regulated by two mechanisms: phosphorylation of RKIP at Ser-153, and occupation of RKIP's conserved ligand binding domain with a phospholipid (2-dihexanoyl-sn-glycero-3-phosphoethanolamine; DHPE. In addition to phospholipids, other ligands have been reported to bind this domain; however their binding properties remain uncharacterized. METHODS/FINDINGS: In this study, we used high-resolution heteronuclear NMR spectroscopy to screen a chemical library and assay a number of potential RKIP ligands for binding to the protein. Surprisingly, many compounds previously postulated as RKIP ligands showed no detectable binding in near-physiological solution conditions even at millimolar concentrations. In contrast, we found three novel ligands for RKIP that specifically bind to the RKIP pocket. Interestingly, unlike the phospholipid, DHPE, these newly identified ligands did not affect RKIP binding to Raf-1 or RKIP phosphorylation. One out of the three ligands displayed off target biological effects, impairing EGF-induced MAPK and metabolic activity. CONCLUSIONS/SIGNIFICANCE: This work defines the binding properties of RKIP ligands under near physiological conditions, establishing RKIP's affinity for hydrophobic ligands and the importance of bulky aliphatic chains for inhibiting its function. The common structural elements of these compounds defines a minimal requirement for RKIP binding and thus they can be used as lead compounds for future design of RKIP ligands with therapeutic potential.

  6. Covalent binding of acetaldehyde to proteins: participation of lysine residues.

    Science.gov (United States)

    Tuma, D J; Newman, M R; Donohue, T M; Sorrell, M F

    1987-12-01

    The results of this study demonstrate that lysine is the major amino acid participating in the binding of acetaldehyde to proteins. The formation of both stable and unstable acetaldehyde-albumin adducts was shown to occur via the reaction of acetaldehyde with lysine residues. This conclusion was based on the following experimental evidence: (a) the ratio of stable to unstable adducts of bovine serum albumin was similar to that observed for polylysine; (b) acetylation of albumin markedly reduced acetaldehyde binding; (c) the radio-activity profiles (obtained by high-performance liquid chromatographic analysis) of [14C]acetaldehyde modified amino acids hydrolyzed from total and stable adducts of albumin were nearly identical to those of polylysine or alpha-t-boc-lysine. Analysis of stable adducts of albumin indicated two major modified lysine residues; one residue was much more acidic and the other more basic than unmodified lysine. Unstable adducts were shown to be Schiff bases since NaBH4 treatment resulted in the formation of N-ethyllysine residues. The reducing agents, NaCNBH3 and ascorbic acid, both increased stable adduct formation via increased binding to lysine residues; however, a different elution profile of modified lysine residues was observed for these reducing agents. NaCNBH3 increased the formation of N-ethyllysine residues exclusively, whereas ascorbate increased the formation of the acidic adduct of lysine and also caused the formation of an additional modified lysine residue which was present only in the ascorbate-treated polypeptides. In addition to their detection by radioactivity measurements, the acetaldehyde-lysine adducts could also be detected by the fluorescence of their ophthalaldehyde derivatives.(ABSTRACT TRUNCATED AT 250 WORDS)

  7. Ku80 facilitates chromatin binding of the telomere binding protein, TRF2.

    Science.gov (United States)

    Fink, Lauren S; Lerner, Chad A; Torres, Paulina F; Sell, Christian

    2010-09-15

    The Ku70/80 heterodimer is central to non-homologous end joining repair of DNA double-strand breaks and the Ku80 gene appears to be essential for human but not rodent cell survival. The Ku70/80 heterodimer is located at telomeres but its precise function in telomere maintenance is not known. In order to examine the role of Ku80 beyond DNA repair in more detail, we have taken a knockdown approach using a human fibroblast strain. Following targeted Ku80 knockdown, telomere defects are observed and the steady state levels of the TRF2 protein are reduced. Inhibitor studies indicate that this loss of TRF2 is mediated by the proteasome and degradation of TRF2 following Ku depletion appears to involve a decrease in chromatin binding of TRF2, suggesting that the Ku heterodimer enhances TRF2 chromatin association and that non-chromatin bound TRF2 is targeted to the proteasome.

  8. Convolutional neural network architectures for predicting DNA–protein binding

    Science.gov (United States)

    Zeng, Haoyang; Edwards, Matthew D.; Liu, Ge; Gifford, David K.

    2016-01-01

    Motivation: Convolutional neural networks (CNN) have outperformed conventional methods in modeling the sequence specificity of DNA–protein binding. Yet inappropriate CNN architectures can yield poorer performance than simpler models. Thus an in-depth understanding of how to match CNN architecture to a given task is needed to fully harness the power of CNNs for computational biology applications. Results: We present a systematic exploration of CNN architectures for predicting DNA sequence binding using a large compendium of transcription factor datasets. We identify the best-performing architectures by varying CNN width, depth and pooling designs. We find that adding convolutional kernels to a network is important for motif-based tasks. We show the benefits of CNNs in learning rich higher-order sequence features, such as secondary motifs and local sequence context, by comparing network performance on multiple modeling tasks ranging in difficulty. We also demonstrate how careful construction of sequence benchmark datasets, using approaches that control potentially confounding effects like positional or motif strength bias, is critical in making fair comparisons between competing methods. We explore how to establish the sufficiency of training data for these learning tasks, and we have created a flexible cloud-based framework that permits the rapid exploration of alternative neural network architectures for problems in computational biology. Availability and Implementation: All the models analyzed are available at http://cnn.csail.mit.edu. Contact: gifford@mit.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27307608

  9. Convolutional neural network architectures for predicting DNA-protein binding.

    Science.gov (United States)

    Zeng, Haoyang; Edwards, Matthew D; Liu, Ge; Gifford, David K

    2016-06-15

    Convolutional neural networks (CNN) have outperformed conventional methods in modeling the sequence specificity of DNA-protein binding. Yet inappropriate CNN architectures can yield poorer performance than simpler models. Thus an in-depth understanding of how to match CNN architecture to a given task is needed to fully harness the power of CNNs for computational biology applications. We present a systematic exploration of CNN architectures for predicting DNA sequence binding using a large compendium of transcription factor datasets. We identify the best-performing architectures by varying CNN width, depth and pooling designs. We find that adding convolutional kernels to a network is important for motif-based tasks. We show the benefits of CNNs in learning rich higher-order sequence features, such as secondary motifs and local sequence context, by comparing network performance on multiple modeling tasks ranging in difficulty. We also demonstrate how careful construction of sequence benchmark datasets, using approaches that control potentially confounding effects like positional or motif strength bias, is critical in making fair comparisons between competing methods. We explore how to establish the sufficiency of training data for these learning tasks, and we have created a flexible cloud-based framework that permits the rapid exploration of alternative neural network architectures for problems in computational biology. All the models analyzed are available at http://cnn.csail.mit.edu gifford@mit.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  10. Methods and systems for identifying ligand-protein binding sites

    KAUST Repository

    Gao, Xin

    2016-05-06

    The invention provides a novel integrated structure and system-based approach for drug target prediction that enables the large-scale discovery of new targets for existing drugs Novel computer-readable storage media and computer systems are also provided. Methods and systems of the invention use novel sequence order-independent structure alignment, hierarchical clustering, and probabilistic sequence similarity techniques to construct a probabilistic pocket ensemble (PPE) that captures even promiscuous structural features of different binding sites for a drug on known targets. The drug\\'s PPE is combined with an approximation of the drug delivery profile to facilitate large-scale prediction of novel drug- protein interactions with several applications to biological research and drug development.

  11. Novel RNA-binding properties of the MTG chromatin regulatory proteins

    Directory of Open Access Journals (Sweden)

    Sacchi Nicoletta

    2008-10-01

    Full Text Available Abstract Background The myeloid translocation gene (MTG proteins are non-DNA-binding transcriptional regulators capable of interacting with chromatin modifying proteins. As a consequence of leukemia-associated chromosomal translocations, two of the MTG proteins, MTG8 and MTG16, are fused to the DNA-binding domain of AML1, a transcriptional activator crucial for hematopoiesis. The AML1-MTG fusion proteins, as the wild type MTGs, display four conserved homology regions (NHR1-4 related to the Drosophila nervy protein. Structural protein analyses led us to test the hypothesis that specific MTG domains may mediate RNA binding. Results By using an RNA-binding assay based on synthetic RNA homopolymers and a panel of MTG deletion mutants, here we show that all the MTG proteins can bind RNA. The RNA-binding properties can be traced to two regions: the Zinc finger domains in the NHR4, which mediate Zinc-dependent RNA binding, and a novel short basic region (SBR upstream of the NHR2, which mediates Zinc-independent RNA binding. The two AML1-MTG fusion proteins, retaining both the Zinc fingers domains and the SBR, also display RNA-binding properties. Conclusion Evidence has been accumulating that RNA plays a role in transcriptional control. Both wild type MTGs and chimeric AML1-MTG proteins display in vitro RNA-binding properties, thus opening new perspectives on the possible involvement of an RNA component in MTG-mediated chromatin regulation.

  12. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    Science.gov (United States)

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  13. Essential dynamics of the cellular retinol-binding protein - Evidence for ligand-induced conformational changes

    NARCIS (Netherlands)

    van Aalten, D.M.F.; Findlay, J.B.C.; Amadei, A; Berendsen, H.J.C.

    1995-01-01

    The cellular retinol-binding protein (CRBP) is an intracellular retinol carrier protein belonging to a family of hydrophobic ligand-binding proteins, It transports retinol to specific locations in the cell where, for instance, it is esterified for storage, Recently solved crystallographic structures

  14. A Sequence-Based Dynamic Ensemble Learning System for Protein Ligand-Binding Site Prediction.

    Science.gov (United States)

    Chen, Peng; Hu, ShanShan; Zhang, Jun; Gao, Xin; Li, Jinyan; Xia, Junfeng; Wang, Bing

    2016-01-01

    Proteins have the fundamental ability to selectively bind to other molecules and perform specific functions through such interactions, such as protein-ligand binding. Accurate prediction of protein residues that physically bind to ligands is important for drug design and protein docking studies. Most of the successful protein-ligand binding predictions were based on known structures. However, structural information is not largely available in practice due to the huge gap between the number of known protein sequences and that of experimentally solved structures. This paper proposes a dynamic ensemble approach to identify protein-ligand binding residues by using sequence information only. To avoid problems resulting from highly imbalanced samples between the ligand-binding sites and non ligand-binding sites, we constructed several balanced data sets and we trained a random forest classifier for each of them. We dynamically selected a subset of classifiers according to the similarity between the target protein and the proteins in the training data set. The combination of the predictions of the classifier subset to each query protein target yielded the final predictions. The ensemble of these classifiers formed a sequence-based predictor to identify protein-ligand binding sites. Experimental results on two Critical Assessment of protein Structure Prediction datasets and the ccPDB dataset demonstrated that of our proposed method compared favorably with the state-of-the-art. http://www2.ahu.edu.cn/pchen/web/LigandDSES.htm.

  15. [Determination of plasma protein binding rate of arctiin and arctigenin with ultrafiltration].

    Science.gov (United States)

    Han, Xue-Ying; Wang, Wei; Tan, Ri-Qiu; Dou, De-Qiang

    2013-02-01

    To determine the plasma protein binding rate of arctiin and arctigenin. The ultrafiltration combined with HPLC was employed to determine the plasma protein binding rate of arctiin and arctigenin as well as rat plasma and healthy human plasma proteins. The plasma protein binding rate of arctiin with rat plasma at the concentrations of 64. 29, 32.14, 16.07 mg x L(-1) were (71.2 +/- 2.0)%, (73.4 +/- 0.61)%, (78.2 +/- 1.9)%, respectively; while the plasma protein binding rate of arctiin with healthy human plasma at the above concentrations were (64.8 +/- 3.1)%, (64.5 +/- 2.5)%, (77.5 +/- 1.7)%, respectively. The plasma protein binding rate of arctigenin with rat plasma at the concentrations of 77.42, 38.71, 19.36 mg x L(-1) were (96.7 +/- 0.41)%, (96.8 +/- 1.6)%, (97.3 +/- 0.46)%, respectively; while the plasma protein binding rate of arctigenin with normal human plasma at the above concentrations were (94.7 +/- 3.1)%, (96.8 +/- 1.6)%, (97.9 +/- 1.3)%, respectively. The binding rate of arctiin with rat plasma protein was moderate, which is slightly higher than the binding rate of arctiin with healthy human plasma protein. The plasma protein binding rates of arctigenin with both rat plasma and healthy human plasma are very high.

  16. A tool for calculating binding-site residues on proteins from PDB structures

    Directory of Open Access Journals (Sweden)

    Hu Jing

    2009-08-01

    Full Text Available Abstract Background In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB that consists of the protein of interest and its interacting partner(s and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. Results In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. Conclusion The developed tool is very useful for the research on protein binding site analysis and prediction.

  17. A tool for calculating binding-site residues on proteins from PDB structures.

    Science.gov (United States)

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  18. Proteomic analysis of egg white heparin-binding proteins: towards the identification of natural antibacterial molecules

    OpenAIRE

    Guyot, Nicolas; Labas, Valérie; Harichaux, Grégoire; Chessé, Magali; Poirier, Jean-Claude; Nys, Yves; Rehault-Godbert, Sophie

    2016-01-01

    The chicken egg resists most environmental microbes suggesting that it potentially contains efficient antimicrobial molecules. Considering that some heparin-binding proteins in mammals are antibacterial, we investigated the presence and the antimicrobial activity of heparin-binding proteins from chicken egg white. Mass spectrometry analysis of the proteins recovered after heparin-affinity chromatography, revealed 20 proteins, including known antimicrobial proteins (avidin, lysozyme, TENP, ova...

  19. Versatile protein microarray based on carbohydrate-binding modules.

    Science.gov (United States)

    Ofir, Keren; Berdichevsky, Yevgeny; Benhar, Itai; Azriel-Rosenfeld, Ronit; Lamed, Raphael; Barak, Yoav; Bayer, Edward A; Morag, Ely

    2005-05-01

    Non-DNA microarrays, such as protein, peptide and small molecule microarrays, can potentially revolutionize the high-throughput screening tools currently used in basic and pharmaceutical research. However, fundamental obstacles remain that limit their rapid and widespread implementation as an alternative bioanalytical approach. These include the prerequisite for numerous proteins in active and purified form, ineffectual immobilization strategies and inadequate means for quality control of the considerable numbers of multiple reagents. This study describes a simple yet efficient strategy for the production of non-DNA microarrays, based on the tenacious affinity of a carbohydrate-binding module (CBM) for its three-dimensional substrate, i.e., cellulose. Various microarray formats are described, e.g., conventional and single-chain antibody microarrays and peptide microarrays for serodiagnosis of human immunodeficiency virus patients. CBM-based microarray technology overcomes many of the previous obstacles that have hindered fabrication of non-DNA microarrays and provides a technically simple but effective alternative to conventional microarray technology.

  20. Microarray-based study of carbohydrate-protein binding.

    Science.gov (United States)

    Wang, Zhenxin; Gao, Jingqing

    2010-01-01

    To develop a novel high-throughput tool for monitoring carbohydrate-protein interactions, carbohydrate or glycoprotein microarrays have been prepared for binding with lectins. The interaction events are marked by attachment of fluorescent dyes and gold nanoparticles. The attachment of the fluorescent dyes and gold nanoparticles is achieved by standard avidin-biotin chemistry. The detection principle is fluorescence or resonance light scattering (RLS). The electroless deposition of silver onto the gold particles has been employed for RLS signal enhancement. Well-defined recognition systems, three monosaccharides (Man-alpha, Glc-beta, and Gal-beta) or three glycoproteins (Asf, RNase A, and RNase B) with two lectins (ConA and RCA120), are chosen here to establish the microarray-based assay, respectively. Highly selective recognition of carbohydrate-protein down to 25.6 pg/mL for RCA120 in solution and 8 microM for Gal-beta and 32 ng/mL for Asf on the microarray spots is demonstrated.

  1. QM/MM Molecular Dynamics Studies of Metal Binding Proteins

    Directory of Open Access Journals (Sweden)

    Pietro Vidossich

    2014-07-01

    Full Text Available Mixed quantum-classical (quantum mechanical/molecular mechanical (QM/MM simulations have strongly contributed to providing insights into the understanding of several structural and mechanistic aspects of biological molecules. They played a particularly important role in metal binding proteins, where the electronic effects of transition metals have to be explicitly taken into account for the correct representation of the underlying biochemical process. In this review, after a brief description of the basic concepts of the QM/MM method, we provide an overview of its capabilities using selected examples taken from our work. Specifically, we will focus on heme peroxidases, metallo-β-lactamases, α-synuclein and ligase ribozymes to show how this approach is capable of describing the catalytic and/or structural role played by transition (Fe, Zn or Cu and main group (Mg metals. Applications will reveal how metal ions influence the formation and reduction of high redox intermediates in catalytic cycles and enhance drug metabolism, amyloidogenic aggregate formation and nucleic acid synthesis. In turn, it will become manifest that the protein frame directs and modulates the properties and reactivity of the metal ions.

  2. RNA binding proteins in the regulation of heart development.

    Science.gov (United States)

    Blech-Hermoni, Yotam; Ladd, Andrea N

    2013-11-01

    In vivo, RNA molecules are constantly accompanied by RNA binding proteins (RBPs), which are intimately involved in every step of RNA biology, including transcription, editing, splicing, transport and localization, stability, and translation. RBPs therefore have opportunities to shape gene expression at multiple levels. This capacity is particularly important during development, when dynamic chemical and physical changes give rise to complex organs and tissues. This review discusses RBPs in the context of heart development. Since the targets and functions of most RBPs--in the heart and at large--are not fully understood, this review focuses on the expression and roles of RBPs that have been implicated in specific stages of heart development or developmental pathology. RBPs are involved in nearly every stage of cardiogenesis, including the formation, morphogenesis, and maturation of the heart. A fuller understanding of the roles and substrates of these proteins could ultimately provide attractive targets for the design of therapies for congenital heart defects, cardiovascular disease, or cardiac tissue repair. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Is vitamin D binding protein a novel predictor of labour?

    Directory of Open Access Journals (Sweden)

    Stella Liong

    Full Text Available Vitamin D binding protein (VDBP has previously been identified in the amniotic fluid and cervicovaginal fluid (CVF of pregnant women. The biological functions of VDBP include acting as a carrier protein for vitamin D metabolites, the clearance of actin that is released during tissue injury and the augmentation of the pro-inflammatory response. This longitudinal observational study was conducted on 221 healthy pregnant women who spontaneously laboured and delivered either at term or preterm. Serial CVF samples were collected and VDBP was measured by ELISA. Binary logistic regression analysis was performed to assess the utility of VDBP as a predictor of labour. VDBP in the CVF did not change between 20 and 35 weeks' gestation. VDBP measured in-labour was significantly increased 4.2 to 7.4-fold compared to 4-7, 8-14 and 15-28 days before labour (P<0.05. VDBP concentration was 4.3-fold significantly higher at 0-3 days compared to 15-28 days pre-labour (P<0.05. The efficacy of VDBP to predict spontaneous labour onset within 3 days provided a positive and negative predictive value of 82.8% and 95.3% respectively (area under receiver operator characteristic curve  = 0.974. This longitudinal study of pregnant women suggests that VDBP in the CVF may be a useful predictor of labour.

  4. Mass spectrometry for identification of proteins that specifically bind to a distal enhancer of the Oct4 gene

    Science.gov (United States)

    Bakhmet, E. I.; Nazarov, I. B.; Artamonova, T. O.; Khodorkovsky, M. A.; Tomilin, A. N.

    2017-11-01

    Transcription factor Oct4 is a marker of pluripotent stem cells and has a significant role in their self-renewal. Oct4 gene is controlled by three cis-regulatory elements – proximal promoter, proximal enhancer and distal enhancer. All of these elements are targets for binding of regulatory proteins. Distal enhancer is in our research focus because of its activity in early stages of embryonic development. There are two main sequences called site 2A and site 2B that are presented in distal enhancer. For this moment proteins which bind to a site 2A (CCCCTCCCCCC) remain unknown. Using combination of in vitro method electrophoretic mobility shift assay (EMSA) and mass spectromery we identified several candidates that can regulate Oct4 gene expression through site 2A.

  5. The effects of GH and hormone replacement therapy on serum concentrations of mannan-binding lectin, surfactant protein D and vitamin D binding protein in Turner syndrome

    DEFF Research Database (Denmark)

    Gravholt, Claus Højbjerg; Leth-Larsen, Rikke; Lauridsen, Anna Lis

    2004-01-01

    function. In the present study we examined whether GH or hormone replacement therapy (HRT) in Turner syndrome (TS) influence the serum concentrations of MBL and two other proteins partaking in the innate immune defence, surfactant protein D (SP-D) and vitamin D binding protein (DBP). DESIGN: Study 1...

  6. The Puf family of RNA-binding proteins in plants: phylogeny, structural modeling, activity and subcellular localization

    Directory of Open Access Journals (Sweden)

    Tam Michael WC

    2010-03-01

    Full Text Available Abstract Background Puf proteins have important roles in controlling gene expression at the post-transcriptional level by promoting RNA decay and repressing translation. The Pumilio homology domain (PUM-HD is a conserved region within Puf proteins that binds to RNA with sequence specificity. Although Puf proteins have been well characterized in animal and fungal systems, little is known about the structural and functional characteristics of Puf-like proteins in plants. Results The Arabidopsis and rice genomes code for 26 and 19 Puf-like proteins, respectively, each possessing eight or fewer Puf repeats in their PUM-HD. Key amino acids in the PUM-HD of several of these proteins are conserved with those of animal and fungal homologs, whereas other plant Puf proteins demonstrate extensive variability in these amino acids. Three-dimensional modeling revealed that the predicted structure of this domain in plant Puf proteins provides a suitable surface for binding RNA. Electrophoretic gel mobility shift experiments showed that the Arabidopsis AtPum2 PUM-HD binds with high affinity to BoxB of the Drosophila Nanos Response Element I (NRE1 RNA, whereas a point mutation in the core of the NRE1 resulted in a significant reduction in binding affinity. Transient expression of several of the Arabidopsis Puf proteins as fluorescent protein fusions revealed a dynamic, punctate cytoplasmic pattern of localization for most of these proteins. The presence of predicted nuclear export signals and accumulation of AtPuf proteins in the nucleus after treatment of cells with leptomycin B demonstrated that shuttling of these proteins between the cytosol and nucleus is common among these proteins. In addition to the cytoplasmically enriched AtPum proteins, two AtPum proteins showed nuclear targeting with enrichment in the nucleolus. Conclusions The Puf family of RNA-binding proteins in plants consists of a greater number of members than any other model species studied to

  7. Penicillin binding proteins as danger signals: meningococcal penicillin binding protein 2 activates dendritic cells through Toll-like receptor 4.

    Directory of Open Access Journals (Sweden)

    Marcelo Hill

    Full Text Available Neisseria meningitidis is a human pathogen responsible for life-threatening inflammatory diseases. Meningococcal penicillin-binding proteins (PBPs and particularly PBP2 are involved in bacterial resistance to β-lactams. Here we describe a novel function for PBP2 that activates human and mouse dendritic cells (DC in a time and dose-dependent manner. PBP2 induces MHC II (LOGEC50 = 4.7 µg/ml ± 0.1, CD80 (LOGEC50 = 4.88 µg/ml ± 0.15 and CD86 (LOGEC50 = 5.36 µg/ml ± 0.1. This effect was abolished when DCs were co-treated with anti-PBP2 antibodies. PBP2-treated DCs displayed enhanced immunogenic properties in vitro and in vivo. Furthermore, proteins co-purified with PBP2 showed no effect on DC maturation. We show through different in vivo and in vitro approaches that this effect is not due to endotoxin contamination. At the mechanistic level, PBP2 induces nuclear localization of p65 NF-kB of 70.7 ± 5.1% cells versus 12 ± 2.6% in untreated DCs and needs TLR4 expression to mature DCs. Immunoprecipitation and blocking experiments showed thatPBP2 binds TLR4. In conclusion, we describe a novel function of meningococcal PBP2 as a pathogen associated molecular pattern (PAMP at the host-pathogen interface that could be recognized by the immune system as a danger signal, promoting the development of immune responses.

  8. Penicillin binding proteins as danger signals: meningococcal penicillin binding protein 2 activates dendritic cells through Toll-like receptor 4.

    Science.gov (United States)

    Hill, Marcelo; Deghmane, Ala-Eddine; Segovia, Mercedes; Zarantonelli, Maria Leticia; Tilly, Gaëlle; Blancou, Philippe; Bériou, Gaëlle; Josien, Régis; Anegon, Ignacio; Hong, Eva; Ruckly, Corinne; Antignac, Aude; El Ghachi, Meriem; Boneca, Ivo Gomperts; Taha, Muhamed-Kheir; Cuturi, Maria Cristina

    2011-01-01

    Neisseria meningitidis is a human pathogen responsible for life-threatening inflammatory diseases. Meningococcal penicillin-binding proteins (PBPs) and particularly PBP2 are involved in bacterial resistance to β-lactams. Here we describe a novel function for PBP2 that activates human and mouse dendritic cells (DC) in a time and dose-dependent manner. PBP2 induces MHC II (LOGEC50 = 4.7 µg/ml ± 0.1), CD80 (LOGEC50 = 4.88 µg/ml ± 0.15) and CD86 (LOGEC50 = 5.36 µg/ml ± 0.1). This effect was abolished when DCs were co-treated with anti-PBP2 antibodies. PBP2-treated DCs displayed enhanced immunogenic properties in vitro and in vivo. Furthermore, proteins co-purified with PBP2 showed no effect on DC maturation. We show through different in vivo and in vitro approaches that this effect is not due to endotoxin contamination. At the mechanistic level, PBP2 induces nuclear localization of p65 NF-kB of 70.7 ± 5.1% cells versus 12 ± 2.6% in untreated DCs and needs TLR4 expression to mature DCs. Immunoprecipitation and blocking experiments showed thatPBP2 binds TLR4. In conclusion, we describe a novel function of meningococcal PBP2 as a pathogen associated molecular pattern (PAMP) at the host-pathogen interface that could be recognized by the immune system as a danger signal, promoting the development of immune responses.

  9. Nuclear Factor 90, a cellular dsRNA binding protein inhibits the HIV Rev-export function

    Directory of Open Access Journals (Sweden)

    St-Laurent Georges

    2006-11-01

    Full Text Available Abstract Background The HIV Rev protein is known to facilitate export of incompletely spliced and unspliced viral transcripts to the cytoplasm, a necessary step in virus life cycle. The Rev-mediated nucleo-cytoplasmic transport of nascent viral transcripts, dependents on interaction of Rev with the RRE RNA structural element present in the target RNAs. The C-terminal variant of dsRNA-binding nuclear protein 90 (NF90ctv has been shown to markedly attenuate viral replication in stably transduced HIV-1 target cell line. Here we examined a mechanism of interference of viral life cycle involving Rev-NF90ctv interaction. Results Since Rev:RRE complex formations depend on protein:RNA and protein:protein interactions, we investigated whether the expression of NF90ctv might interfere with Rev-mediated export of RRE-containing transcripts. When HeLa cells expressed both NF90ctv and Rev protein, we observed that NF90ctv inhibited the Rev-mediated RNA transport. In particular, three regions of NF90ctv protein are involved in blocking Rev function. Moreover, interaction of NF90ctv with the RRE RNA resulted in the expression of a reporter protein coding sequences linked to the RRE structure. Moreover, Rev influenced the subcellular localization of NF90ctv, and this process is leptomycin B sensitive. Conclusion The dsRNA binding protein, NF90ctv competes with HIV Rev function at two levels, by competitive protein:protein interaction involving Rev binding to specific domains of NF90ctv, as well as by its binding to the RRE-RNA structure. Our results are consistent with a model of Rev-mediated HIV-1 RNA export that envisions Rev-multimerization, a process interrupted by NF90ctv.

  10. The conserved domain in MORF proteins has distinct affinities to the PPR and E elements in PPR RNA editing factors.

    Science.gov (United States)

    Bayer-Császár, Eszter; Haag, Sascha; Jörg, Anja; Glass, Franziska; Härtel, Barbara; Obata, Toshihiro; Meyer, Etienne H; Brennicke, Axel; Takenaka, Mizuki

    2017-08-01

    In plant organelles specific nucleotide motifs at C to U RNA editing sites are recognized by the PLS-class of pentatricopeptide repeat (PPR) proteins, which are additionally characterized by a C-terminal E domain. The PPR elements bind the nucleotides in the target RNA, while the function of the E domain has remained unknown. At most sites RNA editing also requires multiple organellar RNA editing factor (MORF) proteins. To understand how these two types of proteins are involved in RNA editing complexes, we systematically analyzed their protein-protein interactions. In vivo pull-down and yeast two-hybrid assays show that MORF proteins connect with selected PPR proteins. In a loss of function mutant of MORF1, a single amino acid alteration in the conserved MORF domain abrogates interactions with many PLS-class PPR proteins, implying the requirement of direct interaction to PPR proteins for the RNA editing function of MORF1. Subfragment analyses show that predominantly the N-terminal/central regions of the MORF domain in MORF1 and MORF3 bind the PPR proteins. Within the PPR proteins, the E domains in addition to PPR elements contact MORF proteins. In chimeric PPR proteins, different E domains alter the specificity of the interaction with MORF proteins. The selective interactions between E domain containing PPR and MORF proteins suggest that the E domains and MORF proteins play a key role for specific protein complexes to assemble at different RNA editing sites. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Identification of pheromone components and their binding affinity to the odorant binding protein CcapOBP83a-2 of the Mediterranean fruit fly, Ceratitis capitata

    Czech Academy of Sciences Publication Activity Database

    Siciliano, P.; He, X. L.; Woodcock, C.; Pickett, J. A.; Field, L. M.; Birkett, M. A.; Kalinová, Blanka; Gomulski, L. M.; Scolari, F.; Gasperi, G.; Malacrida, A. R.; Zhou, J. J.

    2014-01-01

    Roč. 48, May (2014), s. 51-62 ISSN 0965-1748 Institutional support: RVO:61388963 Keywords : medfly * Ceratitis capitata * olfaction * odorant binding protein * pheromone binding protein * pheromone * binding studies * protein expression * electroantennography * GC-EAG * fluorescence displacement Subject RIV: CE - Biochemistry Impact factor: 3.450, year: 2014

  12. The Structure, Stability and Pheromone Binding of the Male Mouse Protein Sex Pheromone Darcin: e108415

    National Research Council Canada - National Science Library

    Marie M Phelan; Lynn McLean; Stuart D Armstrong; Jane L Hurst; Robert J Beynon; Lu-Yun Lian

    2014-01-01

      Mouse urine contains highly polymorphic major urinary proteins that have multiple functions in scent communication through their abilities to bind, transport and release hydrophobic volatile pheromones...

  13. The structure, stability and pheromone binding of the male mouse protein sex pheromone darcin

    National Research Council Canada - National Science Library

    Phelan, Marie M; McLean, Lynn; Armstrong, Stuart D; Hurst, Jane L; Beynon, Robert J; Lian, Lu-Yun

    2014-01-01

    Mouse urine contains highly polymorphic major urinary proteins that have multiple functions in scent communication through their abilities to bind, transport and release hydrophobic volatile pheromones...

  14. Surfactant protein D binds to human immunodeficiency virus (HIV) envelope protein gp120 and inhibits HIV replication

    DEFF Research Database (Denmark)

    Meschi, Joseph; Crouch, Erika C; Skolnik, Paul

    2005-01-01

    The envelope protein (gp120) of human immunodeficiency virus (HIV) contains highly conserved mannosylated oligosaccharides. These glycoconjugates contribute to resistance to antibody neutralization, and binding to cell surface lectins on macrophages and dendritic cells. Mannose-binding lectin (MBL......) binds to gp120 and plays a role in defence against the virus. In this study it is demonstrated that surfactant protein D (SP-D) binds to gp120 and inhibits HIV infectivity at significantly lower concentrations than MBL. The binding of SP-D was mediated by its calcium-dependent carbohydrate...... defence against HIV. A chimeric protein containing the N-terminal and collagen domains of SP-D linked to the neck and carbohydrate-recognition domains of MBL (called SP-D/MBL(neck+CRD)) had greater ability to bind to gp120 and inhibit virus replication than either SP-D or MBL. The enhanced binding of SP...

  15. Complement proteins bind to nanoparticle protein corona and undergo dynamic exchange in vivo

    Science.gov (United States)

    Chen, Fangfang; Wang, Guankui; Griffin, James I.; Brenneman, Barbara; Banda, Nirmal K.; Holers, V. Michael; Backos, Donald S.; Wu, Linping; Moghimi, Seyed Moein; Simberg, Dmitri

    2017-05-01

    When nanoparticles are intravenously injected into the body, complement proteins deposit on the surface of nanoparticles in a process called opsonization. These proteins prime the particle for removal by immune cells and may contribute toward infusion-related adverse effects such as allergic responses. The ways complement proteins assemble on nanoparticles have remained unclear. Here, we show that dextran-coated superparamagnetic iron oxide core-shell nanoworms incubated in human serum and plasma are rapidly opsonized with the third complement component (C3) via the alternative pathway. Serum and plasma proteins bound to the nanoworms are mostly intercalated into the nanoworm shell. We show that C3 covalently binds to these absorbed proteins rather than the dextran shell and the protein-bound C3 undergoes dynamic exchange in vitro. Surface-bound proteins accelerate the assembly of the complement components of the alternative pathway on the nanoworm surface. When nanoworms pre-coated with human plasma were injected into mice, C3 and other adsorbed proteins undergo rapid loss. Our results provide important insight into dynamics of protein adsorption and complement opsonization of nanomedicines.

  16. Ligand-binding properties of the carboxyl-terminal repeat domain of Streptococcus mutans glucan-binding protein A.

    Science.gov (United States)

    Haas, W; Banas, J A

    2000-02-01

    Streptococcus mutans glucan-binding protein A (GbpA) has sequence similarity in its carboxyl-terminal domain with glucosyltransferases (GTFs), the enzymes responsible for catalyzing the synthesis of the glucans to which GbpA and GTFs can bind and which promote S. mutans attachment to and accumulation on the tooth surface. It was predicted that this C-terminal region, comprised of what have been termed YG repeats, represents the GbpA glucan-binding domain (GBD). In an effort to test this hypothesis and to quantitate the ligand-binding specificities of the GbpA GBD, several fusion proteins were generated and tested by affinity electrophoresis or by precipitation of protein-ligand complexes, allowing the determination of binding constants. It was determined that the 16 YG repeats in GbpA comprise its GBD and that GbpA has a greater affinity for dextran (a water-soluble form of glucan) than for mutan (a water-insoluble form of glucan). Placement of the GBD at the carboxyl terminus was necessary for maximum glucan binding, and deletion of as few as two YG repeats from either end of the GBD reduced the affinity for dextran by over 10-fold. Interestingly, the binding constant of GbpA for dextran was 34-fold higher than that calculated for the GBDs of two S. mutans GTFs, one of which catalyzes the synthesis of water-soluble glucan and the other of which catalyzes the synthesis of water-insoluble glucan.

  17. Adsorption of DNA binding proteins to functionalized carbon nanotube surfaces with and without DNA wrapping.

    Science.gov (United States)

    Ishibashi, Yu; Oura, Shusuke; Umemura, Kazuo

    2017-09-01

    We examined the adsorption of DNA binding proteins on functionalized, single-walled carbon nanotubes (SWNTs). When SWNTs were functionalized with polyethylene glycol (PEG-SWNT), moderate adsorption of protein molecules was observed. In contrast, nanotubes functionalized with CONH 2 groups (CONH 2 -SWNT) exhibited very strong interactions between the CONH 2 -SWNT and DNA binding proteins. Instead, when these SWNT surfaces were wrapped with DNA molecules (thymine 30-mers), protein binding was a little decreased. Our results revealed that DNA wrapped PEG-SWNT was one of the most promising candidates to realize DNA nanodevices involving protein reactions on DNA-SWNT surfaces. In addition, the DNA binding protein RecA was more adhesive than single-stranded DNA binding proteins to the functionalized SWNT surfaces.

  18. Analyzing the Folding and Binding Steps of an Intrinsically Disordered Protein by Protein Engineering.

    Science.gov (United States)

    Bonetti, Daniela; Troilo, Francesca; Toto, Angelo; Brunori, Maurizio; Longhi, Sonia; Gianni, Stefano

    2017-07-25

    Intrinsically disordered proteins (IDPs) are functionally active despite lacking a well-defined three-dimensional structure. Such proteins often undergo a disorder-to-order transition, or induced folding, when binding to their specific physiological partner. Because of cooperativity, the folding and binding steps typically appear as a single event, and therefore, induced folding is extremely difficult to characterize experimentally. In this perspective, the interaction between the disordered C-terminal domain of the measles virus nucleoprotein NTAIL and the folded X domain of the viral phosphoprotein (XD) is particularly interesting because the inherent complexity of the observed kinetics allows characterization of the binding and folding steps individually. Here we present a detailed structural description of the folding and binding events occurring in the recognition between NTAIL and XD. This result was achieved by measuring the effect of single-amino acid substitutions in NTAIL on the reaction mechanism. Analysis of the experimental data allowed us (i) to identify the key residues involved in the initial recognition between the two molecules and (ii) to depict the general features of the folding pathway of NTAIL. Furthermore, an analysis of the changes in stability obtained for the whole set of variants highlights how the sequence of this IDP has not been selected during evolution to fold efficiently. This feature might be a consequence of the weakly funneled nature of the energy landscape of IDPs in their unbound state and represents a plausible explanation of their highly dynamic nature even in the bound state, typically defined as "fuzziness".

  19. Multicopper manganese oxidase accessory proteins bind Cu and heme.

    Science.gov (United States)

    Butterfield, Cristina N; Tao, Lizhi; Chacón, Kelly N; Spiro, Thomas G; Blackburn, Ninian J; Casey, William H; Britt, R David; Tebo, Bradley M

    2015-12-01

    Multicopper oxidases (MCOs) catalyze the oxidation of a diverse group of metal ions and organic substrates by successive single-electron transfers to O2 via four bound Cu ions. MnxG, which catalyzes MnO2 mineralization by oxidizing both Mn(II) and Mn(III), is unique among multicopper oxidases in that it carries out two energetically distinct electron transfers and is tightly bound to accessory proteins. There are two of these, MnxE and MnxF, both approximately 12kDa. Although their sequences are similar to those found in the genomes of several Mn-oxidizing Bacillus species, they are dissimilar to those of proteins with known function. Here, MnxE and MnxF are co-expressed independent of MnxG and are found to oligomerize into a higher order stoichiometry, likely a hexamer. They bind copper and heme, which have been characterized by electron paramagnetic resonance (EPR), X-ray absorption spectroscopy (XAS), and UV-visible (UV-vis) spectrophotometry. Cu is found in two distinct type 2 (T2) copper centers, one of which appears to be novel; heme is bound as a low-spin species, implying coordination by two axial ligands. MnxE and MnxF do not oxidize Mn in the absence of MnxG and are the first accessory proteins to be required by an MCO. This may indicate that Cu and heme play roles in electron transfer and/or Cu trafficking. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Modeling nucleic acid structure in the presence of single-stranded binding proteins

    Science.gov (United States)

    Forties, Robert; Bundschuh, Ralf

    2009-03-01

    There are many important proteins which bind single-stranded nucleic acids, such as the nucleocapsid protein in HIV, the RecA DNA repair protein in bacteria, and all proteins involved in mRNA splicing and translation. We extend the Vienna Package for quantitatively modeling the secondary structure of nucleic acids to include proteins which bind to unpaired portions of the nucleic acid. All parameters needed to model nucleic acid secondary structures in the absence of proteins have been previously measured. This leaves the footprint and sequence dependent binding affinity of the protein as adjustable parameters of our model. Using this model we are able to predict the probability of the protein binding at any position in the nucleic acid sequence, the impact of the protein on nucleic acid base pairing, the end-to-end distance distribution for the nucleic acid, and FRET distributions for fluorophores attached to the nucleic acid.

  1. Two different proteins that compete for binding to thrombin have opposite kinetic and thermodynamic profiles.

    Science.gov (United States)

    Baerga-Ortiz, Abel; Bergqvist, Simon; Mandell, Jeffrey G; Komives, Elizabeth A

    2004-01-01

    Thrombin binds thrombomodulin (TM) at anion binding exosite 1, an allosteric site far from the thrombin active site. A monoclonal antibody (mAb) has been isolated that competes with TM for binding to thrombin. Complete binding kinetic and thermodynamic profiles for these two protein-protein interactions have been generated. Binding kinetics were measured by Biacore. Although both interactions have similar K(D)s, TM binding is rapid and reversible while binding of the mAb is slow and nearly irreversible. The enthalpic contribution to the DeltaG(bind) was measured by isothermal titration calorimetry and van't Hoff analysis. The contribution to the DeltaG(bind) from electrostatic steering was assessed from the dependence of the k(a) on ionic strength. Release of solvent H(2)O molecules from the interface was assessed by monitoring the decrease in amide solvent accessibility at the interface upon protein-protein binding. The mAb binding is enthalpy driven and has a slow k(d). TM binding appears to be entropy driven and has a fast k(a). The favorable entropy of the thrombin-TM interaction seems to be derived from electrostatic steering and a contribution from solvent release. The two interactions have remarkably different thermodynamic driving forces for competing reactions. The possibility that optimization of binding kinetics for a particular function may be reflected in different thermodynamic driving forces is discussed.

  2. The superfamily of C3b/C4b-binding proteins

    DEFF Research Database (Denmark)

    Kristensen, Torsten; D'Eustachio, P; Ogata, R T

    1987-01-01

    The determination of primary structures by amino acid and nucleotide sequencing for the C3b-and/or C4b-binding proteins H, C4BP, CR1, B, and C2 has revealed the presence of a common structural element. This element is approximately 60 amino acids long and is repeated in a tandem fashion, commencing...... at the amino-terminal end of each molecule. Two other complement components, C1r and C1s, have two of these repeating units in the carboxy-terminal region of their noncatalytic A chains. Three noncomplement proteins, beta 2-glycoprotein I (beta 2I), the interleukin 2 receptor (IL 2 receptor), and the b chain...... of factor XIII, have 4, 2 and 10 of these repeating units, respectively. These proteins obviously belong to the above family, although there is no evidence that they interact with C3b and/or C4b. Human haptoglobin and rat leukocyte common antigen also contain two and three repeating units, respectively...

  3. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    Science.gov (United States)

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-05-11

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Fc-Binding Ligands of Immunoglobulin G: An Overview of High Affinity Proteins and Peptides

    Directory of Open Access Journals (Sweden)

    Weonu Choe

    2016-12-01

    Full Text Available The rapidly increasing application of antibodies has inspired the development of several novel methods to isolate and target antibodies using smart biomaterials that mimic the binding of Fc-receptors to antibodies. The Fc-binding domain of antibodies is the primary binding site for e.g., effector proteins and secondary antibodies, whereas antigens bind to the Fab region. Protein A, G, and L, surface proteins expressed by pathogenic bacteria, are well known to bind immunoglobulin and have been widely exploited in antibody purification strategies. Several difficulties are encountered when bacterial proteins are used in antibody research and application. One of the major obstacles hampering the use of bacterial proteins is sample contamination with trace amounts of these proteins, which can invoke an immune response in the host. Many research groups actively develop synthetic ligands that are able to selectively and strongly bind to antibodies. Among the reported ligands, peptides that bind to the Fc-domain of antibodies are attractive tools in antibody research. Besides their use as high affinity ligands in antibody purification chromatography, Fc-binding peptides are applied e.g., to localize antibodies on nanomaterials and to increase the half-life of proteins in serum. In this review, recent developments of Fc-binding peptides are presented and their binding characteristics and diverse applications are discussed.

  5. Analysis and classification of DNA-binding sites in single-stranded and double-stranded DNA-binding proteins using protein information.

    Science.gov (United States)

    Wang, Wei; Liu, Juan; Xiong, Yi; Zhu, Lida; Zhou, Xionghui

    2014-08-01

    Single-stranded DNA-bin