DEHYDRATION OF EDIBLE MUSHROOMS (PLEUROTUS OSTREATUS)
Salas de la Torre, N.; Bazán, D.; Osorio, A.; Cornejo, O.; Carrero, E.
2014-01-01
The edible mushroom Pleurotus ostreatus have been subjected to thermal, chemical and thermal-chemical treatment. The results show that the chemical treatment produces a more effective enzymatic inactivation compared to the other two treatments. Also, the experimental study of fungi dehydration carried out at 55 ° C reveals that the critical moisture content is 10.4 kg water / kg dry solids, the equilibrium moisture is 0.22 kg water / kg of solid . Los hongos comestibles Pleurotus ostreatus...
Cultivation of Pleurotus ostreatus and other edible mushrooms.
Sánchez, Carmen
2010-02-01
Pleurotus ostreatus is the second most cultivated edible mushroom worldwide after Agaricus bisporus. It has economic and ecological values and medicinal properties. Mushroom culture has moved toward diversification with the production of other mushrooms. Edible mushrooms are able to colonize and degrade a large variety of lignocellulosic substrates and other wastes which are produced primarily through the activities of the agricultural, forest, and food-processing industries. Particularly, P. ostreatus requires a shorter growth time in comparison to other edible mushrooms. The substrate used for their cultivation does not require sterilization, only pasteurization, which is less expensive. Growing oyster mushrooms convert a high percentage of the substrate to fruiting bodies, increasing profitability. P. ostreatus demands few environmental controls, and their fruiting bodies are not often attacked by diseases and pests, and they can be cultivated in a simple and cheap way. All this makes P. ostreatus cultivation an excellent alternative for production of mushrooms when compared to other mushrooms.
Effect of Edible Mushroom (Pleurotus ostreatus on Type-2 Diabetics
Directory of Open Access Journals (Sweden)
M. Abu Sayeed
2014-01-01
Full Text Available The prevalence of non-communicable diseases (NCD like diabetes, hypertension, dyslipidemia and atherosclerotic cardiovascular diseases (CVD are on the increase globally and predominantly in the South East Asian Region (SEAR. The increasing NCD and its complications burdened the health cost of Bangladesh. The available literatures suggest that edible mushrooms are effective in controlling metabolic risks like hyperglycemia and hypercholesterolemia. The study addressed the metabolic effects of edible oyster mushroom (Pleurotus ostreatus in diabetic individuals and to assess the undesirable effects of mushroom. A total of 5000 newly registered diabetic women were screened for eligible participants (urban housewives, age 30 – 50y, BMI 22 – 27, FBG 8 – 12 mmol/l; free from complications or systemic illnesses and agreed to adhere to the study for 360 days. The investigations included weight and height for BMI, waist- and hip-girth for WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine starting from the day 0 (baseline and each subsequent follow-up days: 60, 120, 180, 240, 300 and 360 for comparison between placebo and mushroom groups and also within group (baseline vs. follow up days, individually for placebo and mushroom. The daily intake of mushroom was 200g for the mushroom group and an equivalent calorie of vegetables for the placebo group. Overall, 73 diabetic housewives (mushroom / placebo = 43 /30 volunteered. The mean (with SEM values of BMI, WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine of the placebo group were compared with the mushroom group. Compared with the placebo, the mushroom group showed significant reductions of FBG (p<0.001, 2ABF (p<0.001, T-chol (p<0.001, TG (p=0.03 and LDL (p<0.001; whereas, no difference was observed for BMI, SBP, DBP, HDL, Hb, creatinine and ALT. The comparison within groups (baseline vs. follow-up there were significant reduction of these variables in mushroom but not in the
International Nuclear Information System (INIS)
Sugiyama, Hideo; Terada, Hiroshi; Shibata, Hisashi; Morita, Yohoji; Kato, Fumio
2000-01-01
Mushrooms collected from a sub-alpine forest of Mt. Fuji and some other locations in Japan in 1996 were analyzed for radiocesium. The 137 Cs concentrations in 37 mushrooms varied widely from 1.6 to 783 Bqkg -1 fresh wt. The characteristics of Cs accumulation were analyzed by culturing fruiting bodies of the edible mushroom Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus Y-1). The 137 Cs and stable Cs accumulation expressed as the concentration ratio (CR, 137 Cs or Cs concentration in the dried fruiting body/ 137 Cs or Cs concentration in the fresh medium) were in good agreement, indicating similar migration. The CR of Cs grown on medium containing both 0.1% Cs and 0.1% K, 10.2, showed a decrease of about 30 percent as compared with that containing 0.1% Cs only. These CR values suggested that Cs accumulation by the fruiting bodies of P. ostreatus Y-1 is affected by the presence of K similarly to previous observations in the mycelia. The 133 Cs-NMR spectra from the fruiting bodies of P. ostreatus Y-1 showed two resonance signals, whereas those from the media after harvesting of fruiting bodies showed only one signal. Just before growth of the fruiting bodies, bunches consisting of many mycelia were observed by scanning electron microscopy (SEM). No significant differences in the elemental distribution (Cs, K, P and C) were detected in the mycelium surface by SEM equipped with an energy dispersive X-ray microanalyzer. (author)
Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii
Directory of Open Access Journals (Sweden)
Sharon Avni
2017-07-01
Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.
Sivolapova, A.B.; Shnyreva, A.V.; Sonnenberg, A.S.M.; Baars, J.J.P.
2012-01-01
Fungi of the genus Pleurotus, in particular, species Pleurotus ostreatus (common oyster mushroom) are among most cultivated fungi in the world. Due to intense rates of development of studies in this field, efficient breeding programs are highly required in the search for new P. ostreatus strains.
International Nuclear Information System (INIS)
Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.
2017-01-01
The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)
DEFF Research Database (Denmark)
Conte, Anna Del; Læssøe, Thomas
A gourmet's guide to foraging and cooking mushrooms. It helps readers find out how to forage, prepare and cook mushrooms that are wild, fresh and free. It features photographs, which show edible mushrooms in their natural habitats.......A gourmet's guide to foraging and cooking mushrooms. It helps readers find out how to forage, prepare and cook mushrooms that are wild, fresh and free. It features photographs, which show edible mushrooms in their natural habitats....
Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Wang, Wen-Zhao; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei
2016-05-01
One new perhydrobenzannulated 5,5-spiroketal sesquiterpene, pleurospiroketal F (1), as well as six new modified bisabolene sesquiterpenes pleurotins A-F (2-7) were isolated from solid-state fermentation of Pleurotus citrinopileatus. The structures of compounds 1-7 were determined by NMR and MS spectroscopic analysis. The absolute configuration of 1 was determined by X-ray diffraction analysis, while the absolute configurations of 3-7 were assigned using the in situ dimolybdenum circular dichroism method and circular dichroism data comparison. Protein tyrosine phosphatase 1B plays a crucial role as a negative regulator of the insulin-dependent signal cascades. Therefore, the protein tyrosine phosphatase 1B inhibitor can be used for treating type 2 diabetes mellitus and obesity. Compounds 2 and 6 showed moderate inhibitory effects on protein tyrosine phosphatase 1B with IC50 s of 32.1 µM and 30.5 µM, respectively. The kinetic study confirmed compound 2 to be a noncompetitive inhibitor. Compounds 1-7 did not show cytotoxic activity against cancer cell lines (IC50 > 50 µM). Georg Thieme Verlag KG Stuttgart · New York.
Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei
2016-06-01
Nine new sesquiterpenoids, clitocybulol derivatives, clitocybulols G-O (1-9) and three known sesquiterpenoids, clitocybulols C-E (10-12), were isolated from the solid culture of the edible fungus Pleurotus cystidiosus. The structures of compounds 1-12 were determined by spectroscopic methods. The absolute configurations of compounds 1-9 were assigned via the circular dichroism (CD) data analysis. Compounds 1, 6 and 10 showed moderate inhibitory activity against protein tyrosine phosphatase-1B (PTP1B) with IC50 values of 49.5, 38.1 and 36.0μM, respectively. Copyright © 2016. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Chia-Wei Phan
2014-01-01
Full Text Available Two strains of Pleurotus giganteus (commercial and wild were tested for their ability to induce neurite outgrowth in rat pheochromocytoma (PC12 and mouse neuroblastoma-2a (N2a cells. Treatment with the mushroom extracts resulted in neuronal differentiation and neuronal elongation, but not nerve growth factor (NGF production. Linoleic acid (4.5–5.0%, w/w which is a major fatty acid present in the ethanol extract promoted NGF biosynthesis when augmented with low concentration of NGF (5 ng/mL. The two strains of mushroom were found to be high in protein (154–192 g kg−1, total polysaccharides, phenolics, and flavonoids as well as vitamins B1, B2, and B3. The total phenolics present in the mushroom extracts were positively correlated to the antioxidant activity (free radical scavenging, ferric reducing power, and lipid peroxidation inhibition. To conclude, P. giganteus could potentially be used in well-balanced diet and as a source of dietary antioxidant to promote neuronal health.
Diversity of edible mushrooms in pakistan
International Nuclear Information System (INIS)
Sultana, K.; Shinwari, Z.K.; Iftikhar, F.
2007-01-01
Fifty six edible species of mushrooms are reported from Pakistan including four from Balochistan, three from Sindh, five from Punjab and 44 from NWFP and Azad Kashmir. Some of species being commercially exploited in the world are Agaricus bisporus, Auricularia spp. Coprinus comatus, Flammulina vellutipes, Lentinus edodes, Phellorina inquinans, Pleurotus ostreatus, Stropharia rugosoannulata, Volvariella volvacea. Because of over collection, urbanization and deforestation, some of species are threatened of extinction. (author)
Antioxidants of Edible Mushrooms
Directory of Open Access Journals (Sweden)
Maja Kozarski
2015-10-01
Full Text Available Oxidative stress caused by an imbalanced metabolism and an excess of reactive oxygen species (ROS lead to a range of health disorders in humans. Our endogenous antioxidant defense mechanisms and our dietary intake of antioxidants potentially regulate our oxidative homeostasis. Numerous synthetic antioxidants can effectively improve defense mechanisms, but because of their adverse toxic effects under certain conditions, preference is given to natural compounds. Consequently, the requirements for natural, alternative sources of antioxidant foods identified in edible mushrooms, as well as the mechanistic action involved in their antioxidant properties, have increased rapidly. Chemical composition and antioxidant potential of mushrooms have been intensively studied. Edible mushrooms might be used directly in enhancement of antioxidant defenses through dietary supplementation to reduce the level of oxidative stress. Wild or cultivated, they have been related to significant antioxidant properties due to their bioactive compounds, such as polyphenols, polysaccharides, vitamins, carotenoids and minerals. Antioxidant and health benefits, observed in edible mushrooms, seem an additional reason for their traditional use as a popular delicacy food. This review discusses the consumption of edible mushrooms as a powerful instrument in maintaining health, longevity and life quality.
Falandysz, Jerzy
2008-01-01
Selenium is vital to human health. This article is a compendium of virtually all the published data on total selenium concentrations, its distribution in fruitbody, bioconcentration factors, and chemical forms in wild-grown, cultivated, and selenium-enriched mushrooms worldwide. Of the 190 species reviewed (belonging to 21 families and 56 genera), most are considered edible, and a few selected data relate to inedible mushrooms. Most of edible mushroom species examined until now are selenium-poor (cesarea, A. campestris, A. edulis, A. macrosporus, and A. silvaticus. A particularly rich source of selenium could be obtained from selenium-enriched mushrooms that are cultivated on a substrate fortified with selenium (as inorganic salt or selenized-yeast). The Se-enriched Champignon Mushroom could contain up to 30 or 110 microg Se/g dw, while the Varnished Polypore (Ganoderma lucidum) could contain up to 72 microg Se/g dw. An increasingly growing database on chemical forms of selenium of mushrooms indicates that the seleno-compounds identified in carpophore include selenocysteine, selenomethionine, Se-methylselenocysteine, selenite, and several unidentified seleno-compounds; their proportions vary widely. Some aspects of environmental selenium occurrence and human body pharmacokinetics and nutritional needs will also be briefly discussed in this review.
Electrical stimulation in white oyster mushroom (Pleurotus florida) production
Roshita, I.; Nurfazira, K. M. P.; Fern, C. Shi; Ain, M. S. Nur
2017-09-01
White oyster mushroom (Pleurotus florida) is an edible mushroom that gained popularity due to its nutritional values, low production cost and ease of cultivation. There are several research reported on the mushroom fruiting bodies which were actively developed when applying electrical shock treatment. This study was aimed to investigate the effects of different electrical voltages on the growth and yield of white oyster mushroom (Pleurotus florida). Five different electrical voltages had been applied during spawning period which were 6V, 9V, 12V, 15V and mushroom bags without any treatment served as control. Treatment at 6V showed the highest rate for mycelium growth while 15V took the shortest time for fruiting body formation. However, no significant different (P>0.05) among all the treatments was observed for the time taken for the mycelium to fill-up the bag and pinhead emergence. The total fresh weight and percentage of biological efficiency for treatment at 9V showed higher values compared to control. Treatment at 9V also showed the largest pileus diameter and the most firm in the pileus texture. Meanwhile, treatment at 6V showed the highest a* value (redness). In addition, different electrical voltage treatments applied did not show any significant effect on substrate utilization efficiency, colour L* and b* values. In conclusion, among all the electrical treatments applied, 9V could be considered as the best treatment to enhance the yield of white oyster mushroom.
Diseases and pests noxious to Pleurotus spp. mushroom crops.
Bellettini, Marcelo B; Bellettini, Sebastião; Fiorda, Fernanda A; Pedro, Alessandra C; Bach, Fabiane; Fabela-Morón, Miriam F; Hoffmann-Ribani, Rosemary
The Pleurotus genus is one of most extensively studied white-rot fungi due to its exceptional ligninolytic properties. It is an edible mushroom that possesses biological effects, as it contains important bioactive molecules. It is a rich source of nutrients, particularly proteins, minerals as well as vitamins B, C and D. In basidiomycete fungi, intensive cultivations of edible mushrooms can often be affected by some bacterial, mold and virus diseases that rather frequently cause dramatic production loss. These infections are facilitated by the particular conditions under which mushroom cultivation is commonly carried out such as warm temperatures, humidity, carbon dioxide (CO 2 ) levels and presence of pests. There is not much bibliographic information related to pests of mushrooms and their substrates. The updated review presents a practical checklist of diseases and pests of the Pleurotus genus, providing useful information that may help different users. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
ANTAGONISTIC EFFECT OF EDIBLE MUSHROOM EXTRACT ON CANDIDA ALBICANS GROWTH
Directory of Open Access Journals (Sweden)
Paccola Edneia A. de Souza
2001-01-01
Full Text Available Five species of edible mushrooms, Lentinula edodes, Pleurotus ostreatus, Pholiota nameko, Macrolepiota bonaerensis and Agaricus blazei, were tested for their potential to inhibit the in vitro growth of the pathogenic yeast Candida albicans. Only L. edodes had a fungistatic effect on this human pathogen. The inhibitory compound was produced intra and extracellularly in submersed L. edodes culture, and was also present in fresh and dehydrated mushroom basidiocarps. The fungistatic compound was heat sensitive and lost activity after 72 hours.
Mintesnot, Birara; Ayalew, Amare; Kebede, Ameha
2014-01-15
This study assessed the bioconversion of Agriculture wastes like invasive weeds species (Lantana camara, Prosopis juliflora, Parthenium hysterophorus) as a substrate for oyster mushroom (Pleurotus species) cultivation together with wheat straw as a control. The experiment was laid out in factorial combination of substrates and three edible oyster mushroom species in a Completely Randomized Design (CRD) with three replications. Pleurotus ostreatus gave significantly (p mushroom cultivation could contribute to alleviating ecological impact of invasive weed species while offering practical option to mitigating hunger and malnutrition in areas where the invasive weeds became dominant.
Antioxidant capacity and mineral contents of edible wild Australian mushrooms.
Zeng, X; Suwandi, J; Fuller, J; Doronila, A; Ng, K
2012-08-01
Five selected edible wild Australian mushrooms, Morchella elata, Suillus luteus, Pleurotus eryngii, Cyttaria gunnii, and Flammulina velutipes, were evaluated for their antioxidant capacity and mineral contents. The antioxidant capacities of the methanolic extracts of the dried caps of the mushrooms were determined using a number of different chemical reactions in evaluating multi-mechanistic antioxidant activities. These included the Trolox equivalent antioxidant capacity, ferric ion reducing antioxidant power, and ferrous ion chelating activity. Mineral contents of the dried caps of the mushrooms were also determined by inductively coupled plasma-optical emission spectroscopy. The results indicated that these edible wild mushrooms have a high antioxidant capacity and all, except C. gunnii, have a high level of several essential micro-nutrients such as copper, magnesium, and zinc. It can be concluded that these edible wild mushrooms are good sources of nutritional antioxidants and a number of mineral elements.
Essential trace elements in edible mushrooms by Neutron Activation Analysis
Energy Technology Data Exchange (ETDEWEB)
Moura, Patricia L.C.; Maihara, Vera A.; Castro, Lilian P. de [Instituto de Pesquisa e Energetica e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)]. E-mail: patricialandim@ig.com.br; vmaihara@ipen.br; lilian.Pavanelli@terra.com.br; Figueira, Rubens C.L. [Universidade Cruzeiro do Sul, Sao Paulo, SP (Brazil)]. E-mail: figueiraru@yahoo.com.br
2007-07-01
Mushrooms are excellent nutritional sources since they provide proteins, fibers and mineral, such as K, P, Fe. They have also been the focus of medical research. In Brazil mushrooms are not consumed in large quantities by the general population since people know little about the nutritional and medicinal benefits that mushrooms offer. Hence, this study intends to contribute to a better understanding of the essential element content in edible mushrooms, which are currently commercialized in Sao Paulo state. Br Fe, K, Na and Zn concentrations were determined by Instrumental Neutron Activation Analysis in the following mushroom species: Shitake (Lentinus edodes), Shimeji (Pleurotus ssp), Paris Champignon (Agaricus bisporus), Hiratake ( Pleurotus ssp) and Eringue (Pleurotus Eryngu. The mushroom samples were acquired from commercial establishments in the city of Sao Paulo and directly from the producers. Essential element contents in mushrooms varied between Br 0.03 to 4.1 mg/kg; Fe 20 to 267 mg/kg; K 1.2 to 5.3 g/kg, Na 10 to 582 mg/kg and Zn 60 to 120 mg/kg. The results confirm that mushrooms can be considered a good source of K, Fe and Zn. The low Na level is a good nutritional benefit for the consumer. (author)
Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on ...
African Journals Online (AJOL)
Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on petroleum ... of chains of hydrocarbon in a petroleum-hydrocarbon-contaminated substrate over time. ... Keywords: Mycoremediation, Mycelia, Contaminated Soil, Oyster Mushroom ...
WILD EDIBLE MUSHROOMS OF MEGHALAYA
Barua, Paran; Adhikary, R.K; Kalita, Pabitra; Bordoloi, Dalimi; Gogoi, P.; Singh, R.S.; Ghosh, A.C.
1998-01-01
Different flesh mushrooms grow widely in Meghalaya. Altogether fie edible species were collected and identified which were found abundantly in forest and are known to be consumed by local people for time immemorial, The species identified are lentinus edodes (Berk) Sing., Boletus edulis Bull ex Fr., Clavaria cinerea (Fr.) Schroet, Clavaria aurea (F) Quet and cantharellus floccosus Juss. PMID:22556840
Chemical Composition and Bioactive Compounds of Some Wild Edible Mushrooms
Directory of Open Access Journals (Sweden)
Melinda NAGY
2017-05-01
Full Text Available Over the last decades, the consumption of mushrooms has significantly increased due to the scientific evidence of their ability to help the organism in the combat and prevention of several diseases (Kalac, 2009. Fruiting bodies of mushrooms are consumed as a delicacy for their texture and flavour, but also for their nutritional properties that makes them even more attractable (Heleno S. 2015. In this paper data were collected from several scientific studies with the aim to characterize the chemical composition and content of bioactive compounds of various mushrooms species: Agaricus bisporus, Boletus edulis, Cantharellus cibarius, Pleurotus ostreatus, Lactarius piperatus. The chemical composition of 5 wild edible studied mushrooms, including moisture, ash, total carbohydrates, total sugars, crude fat, crude protein and energy were determined according to AOAC procedures.
Usage of Edible Mushrooms in Various Food Products
Directory of Open Access Journals (Sweden)
Özge Süfer
2016-03-01
Full Text Available Using of edible mushrooms which are generally consumed in houses in dried form is based on mainly instant soup and sauce formulations. Recently, the cultivations of Agaricus bisporus and Pleurotus ostreatus species have become widespread. Utilization of these cultivated mushrooms in recipes would bring added value to related food products. For this purpose, Agaricus bisporus and Pleurotus ostreatus species farmed in Osmaniye Korkut Ata University Mushroom House were dried and then pulverized. Firstly, a snack was prepared with Agaricus bisporus powder. Agaricus bisporus powder was substituted for wheat flour at the rates of 5 %, 10 %, 20 % and 30 % and thus the potential of food product which had relatively lower carbohydrate and fat level and higher fiber content was investigated. In the second part of the study, either 5 %, 10 % of Agaricus bisporus powder or 5 %, 10 % of Pleurotus ostreatus powder were added into traditional Turkish meatball (beef mince, salt which was cooked in conventional oven, so meat flavor could be replaced by herbal flavor coming from mushroom. This property mat obey the purpose that, the created new product will be consumed fondly especially by children. Sensory and physical (colour and texture analysis were performed in both snack and meatball samples and the results were evaluated statistically.
Fatty Acid Compositions of Six Wild Edible Mushroom Species
Günç Ergönül, Pelin; Akata, Ilgaz; Kalyoncu, Fatih; Ergönül, Bülent
2013-01-01
The fatty acids of six wild edible mushroom species (Boletus reticulatus, Flammulina velutipes var. velutipes, Lactarius salmonicolor, Pleurotus ostreatus, Polyporus squamosus, and Russula anthracina) collected from different regions from Anatolia were determined. The fatty acids were identified and quantified by gas chromatography and studied using fruit bodies. Fatty acid composition varied among species. The dominant fatty acid in fruit bodies of all mushrooms was cis-linoleic acid (18 : 2). Percentage of cis-linoleic acid in species varied from 22.39% to 65.29%. The other major fatty acids were, respectively, cis-oleic, palmitic, and stearic acids. Fatty acids analysis of the mushrooms showed that the unsaturated fatty acids were at higher concentrations than saturated fatty acids. PMID:23844377
Fatty Acid Compositions of Six Wild Edible Mushroom Species
Directory of Open Access Journals (Sweden)
Pelin Günç Ergönül
2013-01-01
Full Text Available The fatty acids of six wild edible mushroom species (Boletus reticulatus, Flammulina velutipes var. velutipes, Lactarius salmonicolor, Pleurotus ostreatus, Polyporus squamosus, and Russula anthracina collected from different regions from Anatolia were determined. The fatty acids were identified and quantified by gas chromatography and studied using fruit bodies. Fatty acid composition varied among species. The dominant fatty acid in fruit bodies of all mushrooms was cis-linoleic acid (18 : 2. Percentage of cis-linoleic acid in species varied from 22.39% to 65.29%. The other major fatty acids were, respectively, cis-oleic, palmitic, and stearic acids. Fatty acids analysis of the mushrooms showed that the unsaturated fatty acids were at higher concentrations than saturated fatty acids.
International Nuclear Information System (INIS)
Rosnani Abdul Rashid; Mat Rasol Awang; Hassan Hamdani Hassan Mutaat; Meswan Maskom
2006-01-01
This paper aimed at comparing the mushroom yield of Pleurotus sajor caju and Pleurotus florida which was harvested in five flushes. The γ-irradiated empty fruit bunch (EFB) at 25kGy was used as cultivation substrate. About 1 to 2% liquid seed of P. sajor caju and P. florida was inoculated into cultivation substrate. After 30 days, the inoculated substrate was opened for fruiting. For both species, the maximum mushroom yield was obtained in first flush and the lowest yield from the fifth flush. This show the mushroom yield is affected by number of flush. From analysis, the mushroom yield of P. florida was much better compared to P. sajor caju for all flushes. (Author)
Cultivation of mushroom ( Pleurotus ostreatus ) using corn cobs and ...
African Journals Online (AJOL)
An investigation was carried out on the cultivation of mushroom (Pleurotus ostreatus) using corn cobs and saw dust as the main substrates. Lignocellulosic wastes such as corn cobs and saw dust were packaged inside heat – resistant polythene bags and pasteurized before being seeded with 7.5% w/w millet spawn of ...
Effect of mushroom ( Pleurotus tuber-regium ) inoculums on crude ...
African Journals Online (AJOL)
Pollution of soils by crude oil in Niger-Delta of Nigeria has brought untold hardship to the inhabitants of the region. This study was carried out in 2010/2011 and 2011/2012 to determine the effect of Pleurotus tuber-regium (mushroom) inoculums on crude oil polluted soil on stover and grain yields and as well as cob length ...
Mineral Composition of Four Edible Mushrooms
Directory of Open Access Journals (Sweden)
S. E. Mallikarjuna
2013-01-01
Full Text Available Two cultivated mushroom species, namely, Lentinula edodes and Pleurotus florida and two wild growing species Lentinus cladopus and Pleurotus djamor were studied for their mineral contents such as Ca, Mg, Na, K, Fe, Zn, Mn, Cu, Ni, Se, Pb, and Cd by Inductive Coupled Plasma Atomic Emission Spectroscopy (ICP-AES and also Atomic Absorption Spectroscopy, (AAS. Phosphorus was estimated by spectrophotometric method. K, Ca, Na, and P were in higher concentrations ranging from 59.3 mg to 3634 mg, 8.27 mg–174.9 mg, 22.2 mg–327.4 mg, and 100.5 mg–769.9 mg/100 g dry weight respectively in the four mushroom species studied. Fe, Zn, Mg and Se were ranging from 6.27 mg to 35.3 mg, 1.58 mg–9.44 mg, 21.1 mg–40.7 mg and 0.048 mg–0.182 mg/100 g dry weight, respectively, amongst the mushroom species analyzed. However, Ni, Cu, and Mn contents showed relatively lower concentrations, whereas Pb and Cd were below detectable level. The mushrooms were safe for consumption, in accordance with the permissible tolerance limits of the estimated toxic metals. Implications of the mineral contents on mushroom nutritional value are highlighted.
Edible wild mushrooms of the Western Ghats: Data on the ethnic knowledge
Directory of Open Access Journals (Sweden)
Namera C. Karun
2017-10-01
Full Text Available The edible wild mushrooms are most important in food security of ethnic groups and tribals throughout the world. Various indigenous strategies are followed to trace wild mushrooms suitable for human consumption. Data presented in this article projects ethnic knowledge on 51 edible wild mushrooms (in 23 genera in the Western Ghats region of India. Information collected with support of ethnic groups/tribals pertains to habitats, substrates, mutualistic association, extent of availability, extent of edibility and method of processing of wild mushrooms. Extensive field visits and interactions with ethnic groups were performed to collect the data on each mushroom. Initially, most of these mushrooms were identified based on the indigenous methods and designated with vernacular names (Are-Gowda, Kodava and Tulu. Based on macromorphology (in field and micromorphology (in laboratory, each mushroom was identified with its systematic name. Among the 51 wild mushrooms irrespective of extent of availability, the most preferred include Astraeus hygrometricus, Clitocybe infundibuliformis, Fistulina hepatica, Lentinus sajor-caju, Pleurotus (5 spp. and Scleroderma citrinum and Termitomyces (18 spp.. This data forecasts the importance of documentation of traditional knowledge, protection of habitats, management of resources (tree species and substrates and sustainable exploitation of wild mushrooms.
Antinociceptive effect of Pleurotus ostreatus (Oyster Mushroom ...
African Journals Online (AJOL)
PROF HORSFALL
pattern by comparing it with a standard drug and a control using the hot water based flick tail test. Thirty five ... groups two, three and four were treated with 100, 200 and 400 mg/kg of Pleurotus ostreatus aqueous ... Abnormalities in the nervous system may also cause ... During this period, they were covered with wire gauze,.
Food, medicinal and environmental values of mushrooms Pleurotus ostreatus
Directory of Open Access Journals (Sweden)
O. M. Alekseenko
2010-07-01
Full Text Available We present the literature review describing food, medicinal and ecological properties of the fungus Pleurotus ostreatus (oyster mushroom. It is shown that the mushroom is adequate foodstuff for human beings. It provides with proteins, carbohydrates, fats, vitamins and mineral salts. Protein of the oyster mushrooms’ mycothallus contains 18 amino acids, eight of which were essential (isoleucine, leucine, lysine, methionine, phenylalanine, tryptophan, threonine, and valine. Therapeutic value of the mushroom is characterised by a content of water-soluble (thiamine B1, riboflavin B2, niacin, B5, PP, pyridoxine B6, biotin B7, ascorbic and pantothenic acid and liposoluble (calciferol, ergosterol, tocopherol vitamins. The considerable gains from the farm wastes use for the mushrooms raising with subsequent application of the substrate in plant cultivation and animal husbandry are stated.
Molecular and Antibacterial Profile of Edible Oyster Mushrooms ...
African Journals Online (AJOL)
2012r
2014-09-24
Sep 24, 2014 ... Phenol/Chloroform DNA extraction protocol and the DNA was ... DNA from oyster mushroom fermentation broth, mycelia or fruiting bodies. .... Sample preparation: The different strains of Pleurotus were obtained in test- tubes.
Proximate and mineral composition of four edible mushroom species
African Journals Online (AJOL)
Owner
Key words: Edible mushrooms; food composition. INTRODUCTION. Mushrooms are saprophytes. ... riboflavin, biotin and thiamine (Chang and Buswell,. 1996). Ogundana and Fagade (1981) indicated that ... Four edible mushroom species were analyzed for food composition according to the Association of Official Analytical ...
Recycling of Date-Palm Fiber to Produce Pleurotus Cornucopiae Var. Citrinopileatus Mushroom
Directory of Open Access Journals (Sweden)
Mustafa Nadhim Owaid
2017-01-01
Full Text Available In this study, some local available organic matters, which are including wheat straw (Triticum aestivum, sawdust, and fiber of date palm (Phoenix dactylifera L., were used for growing and cultivating of bright yellow oyster mushroom Pleurotus cornucopiae var. citrinopileatus. The possibility of using date palm fiber (in mixtures with other organic residues as a substrate for the cultivation and production of fruiting bodies of P. cornucopiae var. citrinopileatus was investigated. This mushroom is capable of biorecycling and utilization of some mixtures of lignocellulosic substrates successfully, especially the mixture S3 (50% wheat straw, 30% sawdust, and 20% date palm fiber. The lower mycelia completion time was 17 days, that shown in bags of the S3 substrate. Date-palm fiber substrate exhibited best growth intensity level (moderate significantly (p<0.05. The total yield and biological efficiency percent recorded approx. 90 g and 23% on the S3 substrate respectively, as a higher percent significantly (p<0.05, while sawdust substrate alone was an unsuitable medium for cultivation and production of this mushroom. Finally, the use of date-palm fibers in mixtures is usefulness in producing a fresh edible and medicinal mushroom.INTERNATIONAL JOURNAL OF ENVIRONMENTVolume-5, Issue-4, Sep-Nov 2016, page: 56-65
Directory of Open Access Journals (Sweden)
Amporn Srikram
2016-11-01
Full Text Available Mushrooms are known as an excellent source of nutrients including macronutrients and bioactive compounds. Nutritional values were investigated involving proximate analysis, total antioxidant capacity (TAC, total phenol content (TPC and total flavonoid content (TFC of 10 edible wild mushroom species—Amanita calyptroderma Ark. et al., Amanita princeps Corner et Bas, A., Astraeus odoratus, Heimiella retispora (Pat. et. Bak. Boedijn., Mycoamaranthus cambodgensis (Pat. Trappe, Russula alboareolata Hongo, Russula cyanoxantha Schaeff.ex.Fr., Russula emetic (Schaeff. ex Fr. S.F.Gray., Russula virescens (Schaeff. fr., Termitomyces clypeatus Heim—and five cultivated mushroom species—Auricularia auricula-judae, Lentinus polychrous Lev., Lentinus squarrosulus Mont., Pleurotus sajor-caju (Fr. Sing, Volvariella vovacea (Bull. Ex.Fr. Sing. From the proximate analysis, the moisture contents of both wild and cultivated mushrooms ranged from 84.15% fresh weight (FW to 90.21% FW. The ash, crude protein, fat, crude fiber and carbohydrate contents of both wild and cultivated mushrooms were in the dry weight ranges 2.56–13.96%, 11.16–50.29%, 1.43–21.94%, 2.11–38.11% and 9.56–59.73%, respectively, and the contents of macronutrients in the mushrooms varied by variety. Wild mushrooms had a high fiber content compared to cultivated mushrooms. The contents of biologically active compounds of both wild and cultivated mushrooms also varied depending on the variety. Values for the TAC, TPC and TFC of wild mushrooms were higher than those of cultivated mushrooms. In conclusion, the proximate analysis for both wild and cultivated mushrooms was variety dependent and wild mushrooms contained a higher fiber content and more biologically active compounds than cultivated mushrooms.
Directory of Open Access Journals (Sweden)
javad janpoor
2018-03-01
Full Text Available Introduction: King oyster mushroom (Pleurotus eryngii belongs to Basidiomycota division, Agaricomycetes class and Pleurotaceae family. This mushroom generally grows on wood wastes of Apiaceae family. The Pleurotus eryngii is found in pastures, meadows, gardens and seldom in grassy forest clearings and hilly areas. The Pleurotus of the Umbellifers occupy an area in the Northern hemisphere between the 30 and 50º N. These species are mainly found in the subtropical regions of the Mediterranean, Central Europe, Russia, Ukraine, Central Asia and Iran. The P. eryngii sensulato is the only taxon within the genus, which grows in association with plants. P. eryngii has distinguishable characteristics such as coherent texture, unique form, favorable taste and high durability. Mushroom cultivation represents the only current economically viable biotechnology process for the conversion of waste plant residues from forests and agriculture. The species of these genera show much diversity in their adaptation the varying agro-climatic condition which makes more cultivated species than other mushrooms. Special ability of Pleurotus family is growing in lingocellulosic plant or agricultural wastes without needing to prepared compost and casing soil. Pleurotus is an efficient lignin- degrading mushroom and can grow and yield well on different types of lignocellulolosic materials. Type of substrates for mushroom growing depends on available plant or agricultural wastes. In Europe, wheat straw is used for mushroom growing; whereas in Asian South-East countries sawdust is more popular. Different materials for cultivating of P. eryngii have been suggested in different regions of the world; but a few studies have been done on suitability of various lignocellulosic affordable wastes for P. eryngii production in Iran. Therefore, the current study aims to evaluate effects of various locally available agro wastes on the growth characteristics of King oyster mushroom (P
Biological effects and ISSR analysis of 60Co γ-irradiation on edible mushroom mycelia
International Nuclear Information System (INIS)
Cai Weiming; Feng Weilin; Jin Qunli; Fan Lijun; Wu Yongzhi
2009-01-01
Mycelia of Agaricus bitorquis, Flammulina velutipes and Pleurotus eryngii were irradiated by 60 Co γ-rays at the dose of 0, 200, 500 and 800 Gy. The results showed that irradiation inhibited their mycelia growth positively. Of the three edible mushroom, Agaricus bitorquis was the most sensitive one to irradiation, its mycelia died at the dose of 800 Gy. Germination rate, growth rate and vigor of all mycelia irradiated with un-lethal doses increased along with the times of transfer of culture. Electrical conductivity (EC) analysis showed that irradiation increased EC of leaching solution of mycelia positively. The EC of leaching solution of mycelia of Flammulina velutipes and Pleurotus eryngii irradiated with 500 Gy, Agaricus bitorquis irradiated with 200 Gy, were significantly higher than CK. ISSR analysis revealed that 60 Co γ irradiation effect on DNA variation of Agaricus bitorquis, Flammulina velutipes and pleurotus eryngii mycelia in varying degrees. Number of polymorphic bands changed after irradiation. Flawing bands and increasing bands were observed in amplified bands of 14 selected ISSR primers. The ISSR variation rates of Agaricus bitorquis for 200 Gy and 599 Gy treatments were 33.3% and 50.5%; the ISSR variation rates of Flammulina velutipes for 200 Gy, 500 Gy and 800 Gy treatments were 2.3%, 2.3% and 3.1%, that of Pleurotus eryngii were 8.6%, 13.4% and 20.0%. It is possible to use 60 Co γ irradiation as a mutagen to screen new mushroom varieties. (authors)
Essential and toxic element determination in edible mushrooms by neutron activation analysis
International Nuclear Information System (INIS)
Moura, Patricia Landim da Costa
2008-01-01
In this study concentrations of As, Br, Co, Cr, Cs, Fe, K, Na, Rb, Se and Zn were determined in edible mushrooms acquired from commercial establishments in the city of Sao Paulo and directly from Mogi das Cruzes, Suzano, Juquitiba and Mirandopolis producers. The analytical technique used for determining these elements in edible mushrooms was Instrumental Neutron Activation Analysis (INAA). Species of the Agaricus, Lentinus and Pleurotus genera were acquired during the period from November, 2006 to March, 2007. About 150 to 200 mg of freeze-dried mushrooms were irradiated in a neutron flux of 1012 cm -2 s -1 for 8 hours in the IEA-R1 nuclear research reactor at IPEN-CNEN-SP. In order to evaluate the precision and accuracy of the methodology, four reference materials: INCT-MPH-2 Mixed Polish Herbs and INCT-TL-1 Tea Leaves, NIST SRM 1577b Bovine Liver, and the material Mushroom from IAEA were analyzed. Results showed some variation in the element concentrations among the different genera. In some samples, arsenic was found but in low concentrations. Arsenic is probably derived from the contamination from pesticides used in the cultivation, in their the substrates where mushrooms uptake their nutrients. Although there are element concentration variations, mushrooms can still be considered a very rich nutritional source, mainly because of their low concentrations of Na, and due to the good source of K, Fe and Zn. (author)
Proximate and mineral analysis of some wild edible mushrooms
African Journals Online (AJOL)
israelikk
2012-04-12
Apr 12, 2012 ... Key words: Edible mushroom, mineral composition, proximate analysis. ... than beef, pork and chicken that contain similar nutrients. .... legumes and meat. In earlier studies, Gruen and Wong. (1982) indicated that edible mushrooms were highly nutritional and compared favourably with meat, egg and milk.
Czech Academy of Sciences Publication Activity Database
Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.
2009-01-01
Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009
Decolourisation of mushroom farm wastewater by Pleurotus ostreatus.
Rodríguez Pérez, Suyén; García Oduardo, Nora; Bermúdez Savón, Rosa C; Fernández Boizán, Maikel; Augur, Christopher
2008-07-01
Mushroom production on coffee pulp as substrate generates an intense black residual liquid, which requires suitable treatment. In the present study, Pleurotus ostreatus growth in wastewater from mushroom farm was evaluated as a potential biological treatment process for decolourisation as well as to obtain biomass (liquid inoculum). Culture medium components affecting mycelial growth were determined, evaluating colour removal. Laccase activity was monitored during the process. P. ostreatus was able to grow in non diluted WCP. Highest biomass yield was obtained when glucose (10 g/l) was added. The addition of this carbon source was necessary for efficient decolourisation. Agitation of the culture improved biodegradation of WCP as well as fungal biomass production. Laccase and manganese-independent peroxidase activities were detected during fungal treatment of the WCP by P. ostreatus CCEBI 3024. The laccase enzyme showed good correlation with colour loss. Both wastewater colour and pollution load (as chemical oxygen demand) decreased more than 50% after 10 days of culture. Phenols were reduced by 92%.
Polluting macrophytes Colombian lake Fúquene used as substrate by edible fungus Pleurotus ostreatus.
Martínez-Nieto, Patricia; García-Gómez, Gustavo; Mora-Ortiz, Laura; Robles-Camargo, George
2014-01-01
Invasive aquatic plants from Lake Fúquene (Cundinamarca, Colombia), water hyacinth (Eichhornia crassipes C. Mart.) and Brazilian elodea (Egeria densa Planch.) have been removed mechanically from the lake and can be used for edible mushrooms production. The growth of the oyster mushroom (Pleurotus ostreatus) on these aquatic macrophytes was investigated in order to evaluate the possible use of fruiting bodies and spent biomass in food production for human and animal nutrition, respectively. Treatments included: water hyacinth, Brazilian elodea, sawdust, rice hulls and their combinations, inoculated with P. ostreatus at 3%. Water hyacinth mixed with sawdust stimulated significantly fruiting bodies production (P = 3.3 × 10(-7)) with 71% biological efficacy, followed by water hyacinth with rice husk (55%) and elodea with rice husk (48%), all of these have protein contents between 26 and 47%. Loss of lignin (0.9-21.6%), cellulose (3.7-58.3%) and hemicellulose (1.9-53.8%) and increment in vitro digestibility (16.7-139.3%) and reducing sugars (73.4-838.4%) were observed in most treatments. Treatments spent biomass presented Relative Forage Values (RFV) from 46.1 to 232.4%. The results demonstrated the fungus degrading ability and its potential use in aquatic macrophytes conversion biomass into digestible ruminant feed as added value to the fruiting bodies production for human nutrition.
Bioremediation of aflatoxin B1-contaminated maize by king oyster mushroom (Pleurotus eryngii.
Directory of Open Access Journals (Sweden)
Maria Teresa Branà
Full Text Available Aflatoxin B1 (AFB1 is the most harmful mycotoxin that occurs as natural contaminant of agricultural commodities, particularly maize. Practical solutions for detoxification of contaminated staples and reduction of agricultural wastes are scarce. We investigated the capability of the white-rot and edible fungus Plerotus eryngii (king oyster mushroom to degrade AFB1 both in vitro and in a laboratory-scale mushroom cultivation, using a substrate similar to that routinely used in mushroom farms. In malt extract broth, degradation of AFB1 (500 ng/mL by nine isolates of P. eryngii ranged from 81 to 99% after 10 days growth, and reached 100% for all isolates after 30 days. The growth of P. eryngii on solid medium (malt extract-agar, MEA was significantly reduced at concentrations of AFB1 500 ng/mL or higher. However, the addition of 5% wheat straw to the culture medium increased the tolerance of P. eryngii to AFB1 and no inhibition was observed at a AFB1 content of 500 ng/mL; degradation of AFB1 in MEA supplemented with 5% wheat straw and 2.5% (w/v maize flour was 71-94% after 30 days of growth. Further, AFB1 degradation by P. eryngii strain ITEM 13681 was tested in a laboratory-scale mushroom cultivation. The mushroom growth medium contained 25% (w/w of maize spiked with AFB1 to the final content of 128 μg/kg. Pleurotus eryngii degraded up to 86% of the AFB1 in 28 days, with no significant reduction of either biological efficiency or mushroom yield. Neither the biomass produced on the mushroom substrate nor the mature basidiocarps contained detectable levels of AFB1 or its metabolite aflatoxicol, thus ruling out the translocation of these toxins through the fungal thallus. These findings make a contribution towards the development of a novel technology for remediation of AFB1- contaminated corn through the exploitation of the degradative capability of P. eryngii and its bioconversion into high nutritional value material intended for feed production.
Antioxidant activities of extracts from five edible mushrooms using different extractants
Directory of Open Access Journals (Sweden)
Suphaphit Boonsong
2016-03-01
Full Text Available Extractions were performed of the total phenolic and flavonoid contents and antioxidant properties of five edible mushroom samples—Lentinus edodes, Volvariella volvacea, Pleurotus eous, Pleurotus sajor-caju and Auricularia auricular—using three different extractants. Among the three different extractants, 50% (volume per volume; v/v ethanol was the most suitable for antioxidant extraction from the mushroom samples. The 50% (v/v ethanolic extract of dried L. edodes contained higher total phenolic and flavonoid contents than in the other mushroom extract samples. The antioxidant activities of 50% (v/v ethanolic extract of dried L. edodes showed the strongest 2,2-diphenyl-1-picrylhydrazyl radical-scavenging assay (64.34% compared to butylated hydroxyanisole (BHA and α-tocopherol at 500 μg/mL. The ethanolic extract showed a lower reducing power of 0.10 compared to BHA and α-tocopherol at 500 μg/mL. Moreover, the L. edodes ethanolic extract also had the highest chelating ability (66.28% which was lower than for ethylenediaminetetraacetic acid at 500 μg/mL and showed the strongest superoxide radical-scavenging activity (64.17% compared to BHA and α-tocopherol. Therefore, the 50% (v/v ethanolic extract of L. edodes could be used as a potential natural antioxidative source or as an ingredient in the fish and fishery product industries.
Recycling of Vineyard and Winery Wastes as Nutritive Composts for Edible Mushroom Cultivation
Petre, Marian; Teodorescu, Alexandru
2011-01-01
Every year, in Romania huge amounts of wine and vine wastes cause serious environmental damages in vineyards as well as nearby winery factories, for instance, by their burning on the soil surface or their incorporation inside soil matrix. The optimal and efficient way to solve these problems is to recycle these biomass wastes as main ingredients in nutritive composts preparation that could be used for edible mushrooms cultivation. In this respect, the main aim of this work was to establish the best biotechnology of winery and vine wastes recycling by using them as appropriate growth substrata for edible and medicinal mushrooms. According to this purpose, two mushroom species of Basidiomycetes, namely Lentinula edodes as well as Pleurotus ostreatus were used as pure mushroom cultures in experiments. The experiments of inoculum preparation were set up under the following conditions: constant temperature, 23° C; agitation speed, 90-120 rev min-1 pH level, 5.0-6.0. All mycelia mushroom cultures were incubated for 120-168 h. In the next stage of experiments, the culture composts for mushroom growing were prepared from the lignocellulose wastes as vine cuttings and marc of grapes in order to be used as substrata in mycelia development and fruit body formation. The tested culture variants were monitored continuously to keep constant the temperature during the incubation as well as air humidity, air pressure and a balanced ratio of the molecular oxygen and carbon dioxide. In every mushroom culture cycle all the physical and chemical parameters that could influence the mycelia growing as well as fruit body formation of L. edodes and P. ostreatus were compared to the same fungal cultures that were grown on poplar logs used as control samples.
analysis of edible mushroom marketing in three villages in central
African Journals Online (AJOL)
BARTH
Furthermore, extension agents should monitor beneficiaries of such loans to ensure ... Mushrooms belong to a group of living things ... environment, knowledge of simple and low cost .... =Taxes (naira) ... Inheritance ... Table 7 revealed that Alesi marketers made profit margin of N 60,000.00 per .... Guide to Edible Mushroom.
Indigenous knowledge and utilization of edible mushrooms in parts ...
African Journals Online (AJOL)
Heim and Coprinus disseminatus (Pers.: Fr.) S. F. Gray. Among the local people, names of edible mushrooms are based on the substrates on which they grow, their association with insects, and unrelated taxa are given collective names. Rural people believe mushrooms have medicinal values and can serve as blood tonic, ...
137Cs content in edible mushrooms of the Transcarpathian region
Directory of Open Access Journals (Sweden)
O. O. Parlag
2013-03-01
Full Text Available Edible mushrooms (Boletus edulis Bull.: Fr. and Leccinum scabrum (Bull.: Fr. S.F.Gray of Transcarpathian region were analyzed on content of 137Cs. Specific activity of 137Cs in collected mushrooms did not exceed 354 ± 53 Bq/kg (dry substance. Estimation of the contribution into internal exposure dose of population for the condi-tion of 1 kg of mushrooms consumption is carried out.
Misharina, T A; Mukhutdinova, S M; Zharikova, G G; Terenina, M B; Krikunova, N I
2009-01-01
The composition of aroma compounds in cooked and canned cepe (Boletus edulis) and in cooked oyster mushrooms (Pleurotus ostreatus) is studied using capillary gas chromatography and chromatography-mass spectrometry. It is found that unsaturated alcohols and ketones containing eight atoms of carbon determine the aroma of raw mushrooms and take part in the formation of the aroma of cooked mushrooms as well. The content of these compounds was the highest in canned cepes. In oyster mushrooms, the concentration of these alcohols and ketones was lower in comparison with cepes. The content of aliphatic and aromatic aldehydes was much higher in oyster mushrooms. Volatile aliphatic and heterocyclic Maillard reaction products and isomeric octenols and octenones formed the aroma of cooked and canned mushrooms.
Shelf-life increase of fresh mushrooms Pleurotus sajor-caju using gamma radiation
International Nuclear Information System (INIS)
Moda, Evelise Moncaio
2008-01-01
The production and consumption of edible mushrooms has been increasing in the last years due to its nutritional composition and sensory quality. The irradiation of mushrooms has been used with the purpose of maintaining the fresh product characteristics during shelf-life. The present study evaluated the effect of different radiation doses on the conservation of mushrooms Pleurotus sajor-caju, through by chemical, physical, microbiological and sensorial parameters. The packaging consisted on polystyrene trays with 250 g of sample, wrapped in polyvinyl chloride (PVC). The mushrooms were irradiated with doses of 125, 250, 500 and 750 Gy in a Gamma cell 220 type irradiator, and stored at 4 ± 1 deg C and 90% UR for 10 days. The proximate composition (moisture, crude fibre, total protein, total fat and ash), total soluble solids, pH, texture, color (L, a, b, Chroma and ho), enzymatic activity (polyphenoloxidase and peroxidase), microbiological (total coliform, Escherichia coli and total psychotropic bacteria) and sensory evaluation (color, taste and appearance) were determined in the 1st, 5th and 10th storage days. For the respiratory rate analysis, 30 g of sample were placed in jars and stored at 4 ± 1 deg C and 90% UR for 8 days. CO 2 was analyzed every day using a gaseous chromatograph. The results were submitted to variance analysis and average test using the SAS statistical package. The total protein and total fat values did not differ significantly between treatments or storage periods, while the moisture, crude fibre and ash values differ between treatments and periods. The dose of 750 Gy darkness the mushroom in the last evaluation, and texture was better in control during the storage period. The color (L, a), texture and proximate composition values did not differ significantly between treatments or storage periods. A significant increase was observed for soluble solids, b * and enzymatic activity values in all treatments at the end of the storage period
Oyster mushroom (Pleurotus spp.) cultivation technique using re ...
African Journals Online (AJOL)
SARAH
2014-08-31
Aug 31, 2014 ... using re-usable substrate containers and comparison of ... oyster mushrooms in combination with other vegetables complements availability of various essential ..... higher than from oyster mushrooms produced from any.
Cultivation of oyster mushroom ( Pleurotus spp.) on palm oil ...
African Journals Online (AJOL)
Oyster mushroom is a popular mushroom due to its nutritional, medicinal and potential commercial value. In Malaysia, the fungus is currently cultivated on sawdust and rice husk. In this study, the efficiency of cultivating oyster mushroom was assessed using palm oil mesocarp fibre as a substrate. The experiment consisted ...
Directory of Open Access Journals (Sweden)
Jaylei Monteiro Gonçalves
2014-05-01
Full Text Available The concentrations of twenty-five elements (Al, As, Ba, Bi, Ca, Cd, Cr, Cu, Fe, Ga, K, Li, Mg, Mn, Mo, Na, Ni, Pb, Rb , Sb, Se, Sn, Sr, V and Zn were determined in three edible mushrooms, Shiitake (Lentinula edodes, Black Shimeji (Pleurotus ostreatusi and Cardoncello (Pleurotus eryngyii from Petrópolis, Rio de Janeiro, Brazil. Samples were collected along the year 2010 and their preparations were made after drying, milling, an acid pre-digestion and a decomposition procedure in a muffle furnace. The analytical techniques employed for the elements determination were Mass Spectrometry with Inductively Coupled Plasma and Flame Atomic Absorption Spectrometry. Two certified reference materials, Apple Leaves and Mussel Tissue, were used for the evaluation of the analytical procedure and recovery values around 98% were obtained. The results showed that the analyzed mushrooms have high levels of Cu, Fe, K, Mg, Mn and Zn containing more than 30% the recommended daily intake for these nutrients according to Brazilian legislation. These mushrooms presented a very low ratio Na/K. Regarding the levels of some contaminants, the mushrooms had concentrations of Cd, Pb and As below the recommended maximum limits allowed by Brazilian legislation.
International Nuclear Information System (INIS)
Schlecht, Martin Thomas; Säumel, Ina
2015-01-01
Health effects by consuming urban garden products are discussed controversially due to high urban pollution loads. We sampled wild edible mushrooms of different habitats and commercial mushroom cultivars exposed to high traffic areas within Berlin, Germany. We determined the content of cadmium and lead in the fruiting bodies and analysed how the local setting shaped the concentration patterns. EU standards for cultivated mushrooms were exceeded by 86% of the wild mushroom samples for lead and by 54% for cadmium but not by mushroom cultures. We revealed significant differences in trace metal content depending on species, trophic status, habitat and local traffic burden. Higher overall traffic burden increased trace metal content in the biomass of wild mushrooms, whereas cultivated mushrooms exposed to inner city high traffic areas had significantly lower trace metal contents. Based on these we discuss the consequences for the consumption of mushrooms originating from urban areas. - Highlights: • Popular edible mushrooms display large variations in Cd and Pb content. • Low accumulating species are Sparassis crispa, Boletus luridus, or Boletus badius. • High accumulating species are Agaricus ssp., Russula vesca, or Calvatia gigantea. • Cd and Pb content in wild growing edible mushrooms were mostly above EU limits for cultivated mushrooms. • Cd and Pb content in commercial mushrooms cultures were regularly below EU limits for cultivated mushrooms. - Commercial mushroom cultures can be integrated into ‘Edible City’ approaches, but majority of wild growing mushroom samples highly accumulate trace metals
Natural radionuclides and 137Cs in commercialized edible mushrooms in Sao Paulo-Brazil
International Nuclear Information System (INIS)
Castro, Lilian Pavanelli de
2008-01-01
Artificial and natural radionuclides are commonly found in several compartments of the earth's crust. Some mushroom species have a high capacity to absorb radionuclides and toxic elements from the soil. Diet is considered as one of the main routes of radioactive contamination. Therefore, radioactivity measurements in the environment and in food are extremely important to monitor the radiation levels that human can be exposed to either directly or indirectly. Environmental bio monitoring has demonstrated that diverse organisms such as crustaceans, fish and mushrooms are useful when evaluating both the contamination and the quality of the ecosystems. There are actually several radionuclides that can be accumulated in mushrooms, including 40 K, 137 Cs, 232 Th and 238 U. There are few studies in the Southern hemisphere countries, on the natural and artificial radioactivity levels in mushrooms. The present study evaluated 40 K, 137 Cs, 232 Th and 238 U in commercialized edible mushrooms in the state of Sao Paulo, Brazil. The edible mushroom samples were acquired in different commercial establishments in the Sao Paulo metropolitan region, specifically in Municipal Markets. Some samples were acquired directly from producers located in the cities of Mogi das Cruzes, Mirandopolis, Suzano and Juquitiba. About 400g were collected for each edible mushroom species, which included Agaricus sp, Pleurotus sp and Lentinula sp species. All the samples were prepared and stored in polyethylene bottles for approximately 35 days, so that secular equilibrium could be established before counting. The 40 K, 137 Cs, 232 Th and 238 U gamma activities were measured by gamma spectrometry. The equipment consisted of a Hyper pure Germanium detector connected to an electronic system. The detector efficiency was obtained from measurements of reference materials: IAEA-300, IAEA-327 and IAEA-375. The results for the specific activities in edible mushrooms samples ranged fi-om 461 to 1535 Bq kg -1
Analysis of Edible Mushroom Marketing in Three Villages in Central ...
African Journals Online (AJOL)
This study examined the marketing of edible mushroom in three villages (Alesi, Ekukunela ... The socio-economic characteristics of sellers, profit margin and marketing ... One hundred and twenty respondents were interviewed at three different markets in three selected ... The concentration of sellers is low while entry is free.
Antifatigue Functions and Mechanisms of Edible and Medicinal Mushrooms
Directory of Open Access Journals (Sweden)
Ping Geng
2017-01-01
Full Text Available Fatigue is the symptom of tiredness caused by physical and/or psychological stresses. As fatigue is becoming a serious problem in the modern society affecting human health, work efficiency, and quality of life, effective antifatigue remedies other than pharmacological drugs or therapies are highly needed. Mushrooms have been widely used as health foods, because of their various bioactive constituents such as polysaccharides, proteins, vitamins, minerals, and dietary fiber. This paper reviews the major findings from previous studies on the antifatigue effects, the active components of mushrooms, and the possible mechanisms. Many studies have demonstrated the antifatigue effects of edible and medicinal mushrooms. These mushrooms probably mitigate human fatigue through effects on the functional systems, including the muscular, cardiovascular, hormone, and immune system. The bioactive constituents that contribute to the antifatigue effects of mushrooms may include polysaccharides, peptides, nucleosides, phenolic compounds, and triterpenoids. Further research is still needed to identify the active ingredients and to investigate their mechanism of action on the antifatigue effects. Since most previous studies have been carried out in animal models, more human trials should be performed to verify the antifatigue function of edible and medicinal mushrooms.
Bioconcentration of artificial radionuclides in edible mushrooms: in situ and in vitro studies
Energy Technology Data Exchange (ETDEWEB)
Dementyev, Dmitry V.; Manukovsky, Nikolai S.; Bolsunovsky, Alexander Ya.; Alexandrova, Yuliyana V. [Institute of Biophysics, Siberian Branch of the Russian Academy of Sciences, 660036, Krasnoyarsk (Russian Federation)
2014-07-01
Some areas of the Yenisei River basin are affected by the operation of the Mining-and-Chemical Combine (MCC), producing weapons-grade plutonium. Flood plain soils of the Yenisei contain a wide range of artificial radionuclides, including transuranium elements, which can be accumulated by living organisms. Concentrations of artificial radionuclides and heavy metals accumulated by mushrooms may be several orders of magnitude higher than those accumulated by plants, and, thus, mushrooms may be used as bio-concentrators of radionuclides and heavy metals for bioremediation of contaminated areas. The purposes of this study were to investigate 1) species specificity of accumulation of artificial radionuclides by edible mushrooms in radioactively contaminated areas of the Yenisei River flood plain and 2) accumulation rates of artificial radionuclides, including transuranium elements, in mushrooms under laboratory conditions. Species specificity of accumulation of artificial radionuclides and uranium by mushrooms was analyzed for 12 species of edible mushrooms. The study was performed at the sites affected by MCC operation, which were divided into two groups: 1) the sites only affected by aerosol-bound radionuclides and 2) the sites that also received waterborne radionuclides. Field studies showed great interspecific variations in Cs-137 accumulation by mushrooms. Activity concentrations of Cs-137 in bioindicator species Suillus granulatus and S. Luteus reached 10 kBq/kg dry weight. S. granulatus and S. luteus are concentrators of Cs-137, as suggested by the analysis of concentration factors (CFs), which reached 0.7-16 for these mushroom species. The CF of U-238 in fruiting bodies of the mushrooms was no greater than 0.11. Yenisei flood plain soils contain a wide range of transuranium elements, which can accumulate in environmental objects. Laboratory experiments on accumulation of Am-241 from solution by mycelium and Am-241 accumulation by fruiting bodies of mushrooms
Narh Mensah, Deborah L; Addo, Peter; Dzomeku, Matilda; Obodai, Mary
2018-03-01
Pineapple rind is a by-product of the pineapple processing industry and contains nutrients and other compounds which must be utilized as a bioresource for socio-economic benefits while preventing the potential problems of improper agroindustrial biomass disposal methods. Pleurotus ostreatus is an edible oyster mushroom with medicinal properties and can be cultivated on various agroindustrial biomass, including sawdust containing supplements. Pineapple rind was powdered and used as a supplement of composted sawdust at 2%, 5%, 10%, 12%, 15%, and 20% (w/w) on dry weight basis. A control treatment consisted of composted sawdust supplemented with rice bran at 12% (the most utilized composition in Ghana). P. ostreatus strain EM-1 was cultivated on these treatments. Factors investigated included the spawn run period, yield, fruiting body weight and size, biological efficiency, and nutritional composition (proximate composition and Copper, Zinc and Lead content) of fruiting bodies harvested from selected high-yielding treatments and the control treatment. Full colonization of all treatments occurred by the 34th day of incubation. Enhanced yield, fruiting body weight and size, and biological efficiency were generally recorded with supplementation at lower concentrations (2% and 5%) compared to treatments supplemented at higher concentrations. There was also a supplement concentration-dependent alteration of the nutritional composition of the mushroom. Powdered pineapple rind can be utilized as an organic supplement at relatively low concentrations in composted sawdust for P. ostreatus strain EM-1 cultivation. The use of lower concentrations of powdered pineapple rind in composted sawdust is advantageous as relatively less input will be required to produce higher P. ostreatus strain EM-1 yields. Utilization of pineapple rind for mushroom cultivation will extend the pineapple plant value chain, intensify mushroom production in a sustainable way, and minimize agricultural
Biotechnology for in vitro growing of edible and medicinal mushrooms on wood wastes
Directory of Open Access Journals (Sweden)
Marian Petre
2009-11-01
Full Text Available The aim of this work was focused on finding out the best way to convert the wood wastes into useful food supplements, such as mushroom fruit bodies, by using them as growing sources for the edible and medicinal mushrooms. According to this purpose, three fungal species from Basidiomycetes, namely Ganoderma lucidum (Curt.:Fr. P. Karst, Lentinus edodes (Berkeley Pegler and Pleurotus ostreatus (Jacquin ex Fries Kummer were tested to determine their biological potential to grow on substrates made of wood wastes (sawdusts as well as shavings which could be used in this way as main ingredients for preparation of natural culture composts.The experiments were achieved by in vitro growing of all these fungal species in special rooms, where the main culture parameters were kept at optimal levels in order to get the highest production of mushroom fruit bodies. The effects of culture compost composition (carbon, nitrogen and mineral sources as well as other physical and chemical factors (such as: temperature, inoculum amount, pH level and incubation time, etc. on mycelial net formation and especially on fruit body induction, were investigated. From all these fungal species tested in our experiments, P. ostreatus was registered as the fastest mushroom culture, then L. edodes and finally, G. lucidum asthe longest mushroom culture. During the experiments, different logs of the same species were used as control samples for each culture compost variants. Applying such biotechnology, the environmental problems generated by the plant wastes accumulation in wood industry could be solved only by using biological means for theirvalorising, simultaneously with food supplements producing having high nutritive values as well as healing effects by increasing the consumers` health.
Biotechnology for in vitro growing of edible and medicinal mushrooms on wood wastes
Directory of Open Access Journals (Sweden)
Marian Petre
2009-12-01
Full Text Available The aim of this work was focused on finding out the best way to convert the wood wastes into useful food supplements, such as mushroom fruit bodies, by using them as growing sources for the edible and medicinal mushrooms. According to this purpose, three fungal species from Basidiomycetes, namely Ganoderma lucidum (Curt.:Fr. P. Karst, Lentinus edodes (Berkeley Pegler and Pleurotus ostreatus (Jacquin ex Fries Kummer were tested to determine their biological potential to grow on substrates made of wood wastes (sawdusts as well as shavings which could be used in this way as main ingredients for preparation of natural culture composts. The experiments were achieved by in vitro growing of all these fungal species in special rooms, where the main culture parameters were kept at optimal levels in order to get the highest production of mushroom fruit bodies. The effects of culture compost composition (carbon, nitrogen and mineral sources as well as other physical and chemical factors (such as: temperature, inoculum amount, pH level and incubation time, etc. on mycelial net formation and especially on fruit body induction, were investigated. From all these fungal species tested in our experiments, P. ostreatus was registered as the fastest mushroom culture, then L. edodes and finally, G. lucidum as the longest mushroom culture. During the experiments, different logs of the same species were used as control samples for each culture compost variants. Applying such biotechnology, the environmental problems generated by the plant wastes accumulation in wood industry could be solved only by using biological means for their valorising, simultaneously with food supplements producing having high nutritive values as well as healing effects by increasing the consumers` health.
Wild edible mushrooms are widely consumed in many countries. We successfully cultivated four edible, medicinal Philippine mushrooms in liquid culture. Recently, we identified the molecular species of acylglycerols in the lipid extract of mushroom G. lucidum NRRL66208. One hundred and three molecular...
Utilization following of bioremediation attributes using oyster mushrooms - Pleurotus ostreatus
International Nuclear Information System (INIS)
Galanda, D.; Matel, L.
2007-01-01
The mushrooms are not only rich food products, but also a specific component of forest biogeocenoses playing an important role in their functioning, including radionuclide migration. The reason why fungi work as such good indicators for radioactivity and pollution in general is connected to their structure. Using absorption to obtain their nutrition, fungi lack water-conducting organs like stems and roots. They absorb moisture and nutrients from the soil background through surface cells. Dissolved or airborne materials, which include pollutants, move freely through the compartments of hyphae. What is more, radiation released during nuclear testing or accidents is absorbed, especially in areas where it rained heavily shortly after the incident. The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of 241 Am and 242 Pu. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by alpha-spectrometry. The results of activity 241 Am and 242 Pu in the mushrooms body and residual activity in the support was detected and calculated (authors)
Loss, Edenes; Royer, Andrea Rafaela; Barreto-Rodrigues, Marcio; Barana, Ana Claudia
2009-07-30
This study evaluated the Pleurotus spp. mushroom production process using an effluent from the maize agroindustrial process as a carbon and nitrogen source and as a wetting agent. A complete experimental design based on factorial planning was used to optimize the biological efficiency and evaluate the effect of the concentration of effluent, pH and species of Pleurotus. The results indicated that the effluent affects the biological efficiency for the production of both species of mushrooms at all pH values studied. The maximum biological efficiency predicted by the model (81.36%) corresponded to the point defined by the effluent contents (X(1)=1), pH (X(2)=-1) and fungus species (X(3)=1), specifically 50%, 5.0 and P. floridae, respectively. The results demonstrated that the effluent is a good alternative for the production of Pleurotus mushrooms.
Comparative study of wild edible mushrooms as sources of antioxidants.
Witkowska, Anna M; Zujko, Małgorzata E; Mirończuk-Chodakowska, Iwona
2011-01-01
The purpose of the study was to explore sixteen of the most popular edible species of wild-growing mushrooms as potential sources of antioxidants. Among the mushrooms tested, the highest total polyphenol contents, exceeding 100 mg/100 g fresh mass, were found in five mushrooms: Boletus chrysenteron, B. edulis, Leccinum scabrum, L. aurantiacum, and Macrolepiota procera. Antioxidant activity was measured with the FRAP, TEAC, DPPH scavenging ability and ferrous ions chelating ability assays. Results of the study show that wild mushrooms vary according to their antioxidant properties. The highest FRAP potentials, exceeding 1 mmol/100 g, were found in five species ofBoletales: Boletus edulis, B. chrysenteron, Leccinum scabrum, L. aurantiacum, and Suillus grevillei. TEAC values were from 1.07 to 4.01 mmol/100 g fresh mass. High TEAC values (>2.3 mmol/100 g) were found in Leccinum scabrum, L. aurantiacum, Macrolepiota procera, Boletus chrysenteron, and B. edulis. The DPPH radical scavenging effectiveness of mushroom extracts, expressed as EC50 values, was in range 2.91-13.86 mg/mL. Scavenging ability was the highest for B. edulis and B. chrysenteron. The metal chelating ability of mushroom extracts expressed as ECso values of chelating ability on ferrous ions were from 8.02 mg/mL in Cantharellus cibarius to 12.10 mg/mL in Suillus luteus. Among the mushrooms tested, Boletus chrysenteron and B. edulis were characterized by high scores of polyphenol contents and antioxidant activity in the FRAP, TEAC, and DPPH assays. These results place these culinary species of wild-growing mushrooms among products with considerable antioxidant potential.
Directory of Open Access Journals (Sweden)
Abena O. Adjapong
2015-01-01
Full Text Available In the search for alternatives to sawdust as growing media in commercial mushroom cultivation, three organic substrates obtainable as crop residue, maize husk, maize cob, and maize stalk, with each being supplemented with rice bran, were evaluated as growth media for the oyster mushroom, Pleurotus ostreatus (Kummer. For the tested alternatives to sawdust, the harvested weight of fruiting bodies that sprouted on a kilogram maize husk media per crop (32.99 g was the highest. Sawdust media supported significantly (P<0.001 heavier fruiting bodies (42.18 than the maize residues. The peak mushroom harvests for the various substrates were obtained between the first and seventh fruiting body flushes. The biological efficiency of the substrates, which measured usable nutrients indicated that maize stalk supplemented with rice bran, was 39% compared to that of the sawdust media (60%. The maize husk media and the maize cob media had biological efficiencies of 32% and 9.5%, respectively. These results indicate that two of the tested growing media (maize stalk or husk produced mushrooms with yield characteristics that were comparable to the well-used sawdust in the cultivation of oyster mushrooms. The environmental and economic parameters involved in the use and carting of sawdust make these on-farm crop residues a viable alternative for mushroom cultivation in especially nonforest zones of Ghana.
UTILIZATION OF AREN (Arenga pinnata Merr. SAWMILLING WASTE FOR EDIBLE MUSHROOM CULTIVATION MEDIA
Directory of Open Access Journals (Sweden)
Djarwanto
2016-04-01
Full Text Available Aren (Arenga pinnata Merr. is a multipurpose tree that can be utilized for palm sugar, alcoholic drinks, beverages and construction wood. The use of aren sawdust has not been studied intensively. This study examines the utilization of aren sawdust as cultivation media for edible mushrooms. Aren sawdust was mixed with rice bran, CaCO3, gypsum, fertilizers and distilled water before sterilization in 30 minutes pressurized autoclave at 1210C and 1.5atm. The mixed media was inoculated with pure cultures containing four mushrooms species (Pleurotus flabellatus, P. ostreatus, P. sajor-caju and Lentinula edodes and incubated for five weeks to allow mycelium growth producing fruit bodies. The fruit bodies were harvested everyday within four months and examined for its gained mushroom-weight and biological conversion efficiency/BE. The core part of aren trunk was cut into smaller pieces of 10 cm (width by 5 cm (thickness, by 120 cm (length. Each core sample was bored from the surface inward, creating holes with a particular distance apart. Each hole was inoculated with pure cultures containing 6 mushroom species (four species above, P. cystidiosus and Auricularia polytricha. The inoculated samples were slanted on bamboo support, and placed in a bamboo hut. Harvesting was carried out everyday after the fruiting body became mature and examined for its gained mushroom weight. Results show that the use of sawdust supplemented with nutritious material is more likely to improve the mushroom yield than that of aren sawn-timber core. In this case, the BE values with aren-sawdust media were 21.97-89.45% (P. flabellatus, 15.36-105.36% (P. ostreatus, 63.88-76.86% (P. sajor-caju, and up to 62.88% (L. edodes. Meanwhile, the yields (gained mushroom weight with aren sawn-timber media were 210g (P. ostreatus, 368g (P. flabellatus, 331g (P. sajor-caju and 48g (A. polytricha; however, P. cystidiosus and L. edodes inoculated on aren stem core failed to grow.
Performance of oyster mushroom (Pleurotus ostreatus) in different ...
African Journals Online (AJOL)
USER
2012-05-08
May 8, 2012 ... These mixtures were compressed by pressing down with bottle in transparent poly bags ... The bags were then opened after two weeks and left open for mushroom ..... results of this work are within the range they reported.The.
Directory of Open Access Journals (Sweden)
Evelise Moncaio Moda
2005-04-01
Full Text Available Traditionally, the cultivation of Pleurotus sajor-caju is performed on different composted and pasteurized agricultural residues. The objective of this study was to investigate whether traditional composting and pasteurization processes could be replaced by washed and supplemented (mineral or organic sugarcane bagasse. In one experiment, fresh sugarcane bagasse was immersed in hot water at 80°C for two hours (control or washed in fresh water for one hour using an adapted machine for residue treatment. In another experiment, fresh sugarcane bagasse was washed in fresh water (control, and supplemented with corn grits (organic supplementation, or supplemented with nutrient solution (mineral supplementation. In the first experiment, the washed bagasse presented a average biological efficiency (ABE of 19.16% with 44% contamination, and the pasteurized bagasse presented a ABE of 13.86% with 70% contamination. In the second experiment, corn grits presented the poorest performance, with a ABE of 15.66% and 60% contamination, while supplementation with the nutrient solution presented a ABE of 30.03%, whereas the control of 26.62%. Washing fresh sugarcane bagasse could suppress the pasteurized substrate in Pleurotus sajor-caju production, compensating a reduced ABE with a faster process.Tradicionalmente, o cultivo do Pleurotus sajor-caju é realizado utilizando-se diversos resíduos agrícolas, precedido dos processos de compostagem e pasteurização. O presente trabalho teve por objetivo comparar o processo de pasteurização com a lavagem do bagaço de cana-de-açúcar e avaliar formas de suplementação do bagaço, visando aumento na produtividade. No primeiro experimento, os colmos da cana-de-açúcar passaram por moenda para a extração do caldo, sendo em seguida desfibrados. No tratamento controle, o bagaço fresco foi pasteurizado em água a 80°C durante 2 horas e o outro tratamento consistiu na lavagem do bagaço fresco em centrífuga com
Energy Technology Data Exchange (ETDEWEB)
Moura, Patricia Landim da Costa
2008-07-01
In this study concentrations of As, Br, Co, Cr, Cs, Fe, K, Na, Rb, Se and Zn were determined in edible mushrooms acquired from commercial establishments in the city of Sao Paulo and directly from Mogi das Cruzes, Suzano, Juquitiba and Mirandopolis producers. The analytical technique used for determining these elements in edible mushrooms was Instrumental Neutron Activation Analysis (INAA). Species of the Agaricus, Lentinus and Pleurotus genera were acquired during the period from November, 2006 to March, 2007. About 150 to 200 mg of freeze-dried mushrooms were irradiated in a neutron flux of 1012 cm{sup -2} s{sup -1} for 8 hours in the IEA-R1 nuclear research reactor at IPEN-CNEN-SP. In order to evaluate the precision and accuracy of the methodology, four reference materials: INCT-MPH-2 Mixed Polish Herbs and INCT-TL-1 Tea Leaves, NIST SRM 1577b Bovine Liver, and the material Mushroom from IAEA were analyzed. Results showed some variation in the element concentrations among the different genera. In some samples, arsenic was found but in low concentrations. Arsenic is probably derived from the contamination from pesticides used in the cultivation, in their the substrates where mushrooms uptake their nutrients. Although there are element concentration variations, mushrooms can still be considered a very rich nutritional source, mainly because of their low concentrations of Na, and due to the good source of K, Fe and Zn. (author)
[The influence of cooking on radiocaesium contamination of edible mushrooms].
Skibniewska, K A; Smoczyński, S S
1999-01-01
Radiocaesium concentration in some kinds of edible mushrooms collected in October 1990 has been determined to evaluate the radiocaesium activity 5 years after Chernobyl accident. The highest activity was found in Xerocomus subtomentosus (1080.5 Bq/kg of fresh weight), then in Rozites caperata (768.5 Bq/kg) and Xerocomus badius (562.5 Bq/kg); the lowest--in Suillus luteus (52.0 Bq/kg) and Cantharellus cibarius (63.0 Bq/kg). Studies on the influence of cooking on radiocaesium activity revealed that parboiling and boiling of mushrooms led to high, even 85% losses of radiocaesium in the product. Samples of Xerocomus badius collected in various sites of North-East Poland in 1995 averaged to 195.4 +/- 125.5 Bq/kg of fresh weight.
The influence of cooking on radiocesium contamination of edible mushrooms
International Nuclear Information System (INIS)
Skibniewska, K.A.; Smoczynski, S.S.
1999-01-01
Radiocesium concentration in some kinds of edible mushrooms collected in October 1990 has been determined to evaluate the radiocesium activity 5 years after Chernobyl accident. The highest activity was found in Xerocomus subtomentosus (1080.5 Bq/kg of fresh weight), then in Rozites caperata (768.5 Bq/kg) and Xerocomus badius (562.5 Bq/kg); the lowest - in Suillus luteus (52.0 Bq/kg) and Cantharellus cibarius (63.0 Bq/kg). Studies on the influence of cooking on radiocesium activity revealed that parboiling and boiling of mushrooms led to high, even 85% losses of radiocesium in the product. Samples of Xerocomus badius collected in various sites of North-East Poland in 1995 averaged to 195.4 ± 125.5 Bq/kg of fresh weight. (author)
Radical scavenging potential and DNA damage protection of wild edible mushrooms of Kashmir Himalaya
Directory of Open Access Journals (Sweden)
Nowsheen Shameem
2017-10-01
Full Text Available The edible mushrooms Verpa bohemica and Morchella esculenta are locally used for dietary and antioxidant in tribal areas of Kashmir Himalaya. In the present study, sequences of solvents on the basis of their polarity were used for the extraction from selected mushrooms. The comprehensive antioxidant activity of all edible mushroom extracts was evaluated by seven different methods. V. bohemica exhibited significant inhibitory activity of radicals among all the mushrooms while Morchella extracts protected the DNA damage from OH· radicals. This study provides us the substantiation for the use of these mushrooms as antioxidants besides being already eaten as food.
Use of Irradiation to Extend the Shelf Life of Dried White Oyster Mushroom (Pleurotus ostreatus)
International Nuclear Information System (INIS)
Idrus Kadir
2010-01-01
Irradiation is an alternative technology to extend the shelf life of food-stuffs. White oyster mushroom (Pleurotus ostreatus) which is a perishable food stuff having a short shelf life. Effects of gamma irradiation at the dose of 5 kGy on the quality of dried white oyster mushroom during storage was observed. The objective of the experiment was to improve the hygienic quality and to extend the shelf life of dried white oyster mushroom using irradiation technology. Fresh mushroom was cleaned, sorted, washed, and drained. The mushroom was then dried in two ways, namely: sun drying method and electrical oven drying method. Dried mushroom was vacuum packed in polypropylene (PP) pouch then irradiated at a of dose 5 kGy and an unirradiated control was also applied. The vacuum packed samples was stored at low temperature (18-20 o C) with a relative humidity (RH) of 65-70% and observed periodically every month up to 3 months of storage. The samples were analyzed according to the following parameters i.e, : total bacterial count, total mould and yeast count, moisture content, pH, a w , contents of protein, fat, carbohydrate, carotenoid and organoleptic properties, respectively. The results showed that irradiation at the dose of 5 kGy could eliminate significantly microbial growth 2 log cycle in the samples, while there were no changes in physico-chemical and organoleptic properties up to 3 months of storage, while control samples were still acceptable only up to 2 months of storage. (author)
Fang, Yong; Sun, Xinyang; Yang, Wenjian; Ma, Ning; Xin, Zhihong; Fu, Jin; Liu, Xiaochang; Liu, Meng; Mariga, Alfred Mugambi; Zhu, Xuefeng; Hu, Qiuhui
2014-03-15
In this study, four common heavy metals, lead (Pb), cadmium (Cd), arsenic (As) and mercury (Hg) in rice and edible mushrooms of China were studied to evaluate contamination level and edible safety. Ninety two (92) rice samples were collected from the main rice growing regions in China, and 38 fresh and 21 dry edible mushroom samples were collected from typical markets in Nanjing City. The analyzed metal concentrations were significantly different between rice and edible mushroom samples (price samples respectively, were above maximum allowable concentration (MAC). In fresh edible mushroom, Pb and Hg contents in 2.6% samples were above MAC, respectively. However, only Hg content in 4.8% dry edible mushroom samples was above its MAC. Therefore, more than 95% rice and edible mushroom samples in our test had high edible safety. Copyright © 2013 Elsevier Ltd. All rights reserved.
Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N
2017-06-01
Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.
Directory of Open Access Journals (Sweden)
Savic Milena
2012-01-01
Full Text Available The activity of organic selenium against pathogenic molds and its use as a potential selenium source in the production of enriched mushrooms were examined. The effect of commercial selenized yeast on mycelia growth was examined using a method with mycelia disks and a well diffusion method. For mushroom enrichment, different concentrations of selenium were added to a growth substrate. The results presented in this paper suggest that the most suitable concentration of selenized yeast that inhibits the growth of the mycopathogenic molds is 70-100 mg/kg of selenium. With the addition of this concentration to the substrate, mushroom fruit bodies will uptake a high level of selenium, about 100 μg/g for Pleurotus spp., and 200 μg/g for Agaricus bisporus in dry weight of the mushroom. Thereby a double effect in the cultivation of mushrooms is achieved. [Projekat Ministarstva nauke Republike Srbije, br. III 46010 and br. III46001
Mleczek, Mirosław; Siwulski, Marek; Stuper-Szablewska, Kinga; Rissmann, Iwona; Sobieralski, Krzysztof; Goliński, Piotr
2013-01-01
The aim of this study was to evaluate Cd, Co, Cu, Hg, Ni, Pb, Sr and Zn accumulation in six edible mushroom species and to assess their risk and benefits to human consumers. Mushrooms (Leccinium aurantiacum, Xerocomus badius, Lactarius deliciosus, Boletus edulis, Cantharellus cibarius and Suillus luteus) were collected from selected regions of Poland during 1990-2010. The highest diversity between studied mushroom species was observed in terms of Cu and Zn accumulation. Significant differences in the accumulation efficiency were found among the six mushroom species examined. The most efficient were Boletus edulis (Cd and Hg), Suillus luteus (Cu and Sr), and Lactarius deliciosus (Pb and Zn). In the case of Co and Ni, the most effective were Xerocomus badius and Leccinium aurantiacum, respectively. The calculated bioconcentration factor (BCF) values of Cd, Cu, Hg, Sr and Zn were > 1 for all species in this study while Co, Ni and Pb usually were bioexcluded (BCF luteus collected in Poland is safe and this finding largely agrees with results from recent studies by other authors.
Jayakumar, T; Ramesh, E; Geraldine, P
2006-12-01
This study was undertaken to investigate the putative antioxidant activity of the oyster mushroom Pleurotus ostreatus on CCl(4)-induced liver damage in male Wistar rats. Intraperitoneal administration of CCl(4) (2ml/kg) to rats for 4 days resulted in significantly elevated (pSALP) compared to controls. In the liver, significantly elevated levels (pSALP levels reverted to near normal, while the hepatic concentration of GSH, CAT, SOD and Gpx were significantly increased (p<0.05) and that of MDA significantly (p<0.05) lowered, when compared to CCl(4)-exposed untreated rats. Histopathological studies confirmed the hepatoprotective effect conferred by the extract of P. ostreatus. These results suggest that an extract of P. ostreatus is able to significantly alleviate the hepatotoxicity induced by CCl(4) in the rat.
Effects of Crude Oil and Oil Products on Growth of Some Edible ...
African Journals Online (AJOL)
The vegetative growth response of three local edible mushrooms: Pleurotus pulmonarius (Pp), Pleurotus tuber-regium (Pt) and Lentinus squarrosulus (Ls) on different concentrations of Crude oil (COIL), Automotive Gasoline Oil (AGO), Fresh Engine Oil (ENGOIL) and Spent Engine Oil (SENGOIL) was investigated. The result ...
The Most Popular Edible Wild Mushrooms in Vezirköprü District of Samsun Province
Directory of Open Access Journals (Sweden)
Sanem Bulam
2018-03-01
Full Text Available Edible wild mushrooms are becoming more and more important in our diet for their nutritional and pharmacological properties. The aim of this study was to gather information about edible wild mushroom species existed in mycobiota of Vezirköprü district of Samsun province that are economically important and are collected from nature by the villagers and sold in the local markets. The mushroom samples were identified based on their macroscopic and microscopic features. The information, obtained on the collecting time, local names and habitats of the mushrooms was inquired from the sellers, consumers and traders. Cantharellus cibarius, Morchella spp. and Boletus edulis species are not only sold in the Vezirköprü market but also exported. Amanita caesarea, Cantharellus ferruginascens, Craterellus cornucopioides, Clitocybe geotropa, Hydnum repandum, H. rufescens, Lactarius deliciosus, L. semisanguifluus, L. vellereus, L. vinosus, Macrolepiota procera, Ramaria spp., Russula delica and Tricholoma terreum are species of mushrooms with high edible quality and economical importance.
Moonmoon, Mahbuba; Uddin, Md Nazim; Ahmed, Saleh; Shelly, Nasrat Jahan; Khan, Md Asaduzzaman
2010-10-01
Pleurotus eryngii is a popular mushroom due to its excellent consistency of cap and stem, culinary qualities and longer shelf life. In Bangladesh, where Pleurotus mushrooms are very popular, P. eryngii may take position among the consumers, but currently this mushroom is not cultivated in large scale there. In this study, 3 strains of P. eryngii such as Pe-1 (native to Bangladesh), Pe-2 (germplasm collected from China) and Pe-3 (germplasm collected from Japan) were cultivated on saw dust and rice straw and their growth and yield parameters were investigated. Pe-1 on saw dust showed the highest biological yield and efficiency (73.5%) than other strains. Also, the mycelium run rate and number of fruiting bodies were higher in Pe-1 than other two strains. The quality of mushroom strains was near about similar. On saw dust, the yield and efficiency were better than those cultivated on rice straw, however, on straw; the mushroom fruiting bodies were larger in size. This study shows the prospects of P. eryngii cultivation in Bangladesh and suggests further study in controlled environment for higher yield and production.
Energy Technology Data Exchange (ETDEWEB)
Rashid, Rosnani Abdul; Awang, Mat Rasol; Mohamad, Azhar; Mutaat, Hassan Hamdani; Maskom, Mohd Meswan [Bioprocess Group, Agrotechnology and Biosciences Division, Malaysian Nuclear Agency, Bangi 43600, Selangor (Malaysia); Daud, Fauzi; Senafi, Sahidan [School of Bioscience and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Bangi 43600, Selangor (Malaysia)
2014-09-03
Radiosensitive dosage and morphology characterization of irradiated grey oyster mushroom Pleurotus sajor-caju by gamma rays was investigated due to effects of irradiation. In order to establish the effect, mycelium of P. sajor-caju was irradiated by gamma rays at dose 0.1 to 8.0 kGy with dose rate 0.227 Gy sec{sup −1}. The irradiation of mycelia was carried out at the radiation facility in Malaysian Nuclear Agency. The radiosensitivity study was performed by evaluating the percentage of survival irradiated mycelia. The lethal dose of the mycelium P. sajor-caju was determined at 4.0 kGy and LD{sub 50} to be equal at 2.2 kGy. The radiation effects on morphology were evaluated based on growth rate of irradiated mycelia, mycelia types, colonization period on substrate, morphology of fruit bodies and yields. The results shown growth rate of irradiated mycelium was slightly lower than the control and decreased as the dose increased. Irradiation was found can induced the primordia formation on PDA and the BE of irradiated seed is higher than to control. The irradiation is proven to be useful for generating new varieties of mushroom with commercial value to the industry.
Yufidasari, H. S.; Prihanto, A. A.; Nurdiani, R.; Jaziri, A. A.
2018-04-01
Nugget is a processed meat product which has great market demand but need variations to increase its nutritional content. Tuna is rich in omega-3 protein, vitamins, and minerals. White oyster mushrooms have high nutritional content which are about 23-33% protein, 36-68 % carbohydrates and 12-22 % amino acids. The purpose of this research is to evaluate the chemical quality of Tuna nugget (Thunnus albacores) with combination of white oyster mushroom (Pleurotus ostreatus). Complete Randomized Design (RAL) with parameters of Tuna and white oyster mushroom formulation, TJ1 (70 % Tuna: 30 % white oyster mushroom), TJ2 (50 % Tuna: 50 % white oyster mushroom), TJ3 (30 % Tuna: 70 % white oyster mushroom), and Control or K Treatment (100 % Tuna) is used. Results of Tuna nuggets with white oyster mushroom combination showed the highest value of water content in TJ3 50.14 %, protein K 19.6 %, fat TJ3 22.98 %, ash K 3.99 % and 2.47 % crude fiber. From these results, there is a need for further research on fat, ash and coarse fiber content that is used in the manufacture of fish nuggets combined with oyster mushrooms because it failed to meet Indonesian National Standard (SNI).
International Nuclear Information System (INIS)
Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)
Back, Chang-Gi; Lee, Chang-Yun; Seo, Geon-Sik; Jung, Hee-Young
2012-01-01
Four Cladobotryum isolates were collected from four different commercially grown mushroom types infected with cobweb disease in Cheongdo-gun and Chilgok-gun of Gyeongbuk Province, Korea in 2010. The isolates were identified as C. mycophilum from Agaricus bisporus and Pleurotus eryngii, C. varium from Flammulina velutipes and Hypsizygus marmoreus. The cultural characteristics of the four isolates were investigated using potato dextrose agar (PDA) media under nine different temperatures ranging...
Directory of Open Access Journals (Sweden)
Petcharat, V. and
2004-09-01
Full Text Available The objective of this study was to determine the optimum rate of oil palm kernel meal, for an abalone mushroom (Pleurotus cystidiosus cultivation. Different concentrations of oil palm kernel meal (5- 20% were added to pararubber sawdust and used to grow the abalone mushroom in plastic bags. Growth rate of the mycelia, number of days from watering to harvesting and yield were compared to those on 94% sawdust + 5% rice bran + 1% Ca(OH2. The results showed that 10% oil palm kernel meal was the optimum concentration for abalone mushroom cultivation. Yield on 950 g/bag of 89% sawdust + 10% oil palm kernel meal + 1% Ca(OH2 was 202.12 g/bag (B.E. = 60.79% during 120 days of havesting time. Addition of higher concentration of oil palm kernel meal (15-20% did not increase yield of the basidiocarps.
Regula, Julita; Suliburska, Joanna; Siwulski, Marek
2016-01-01
There is a limited number of publications on the bioavailability and digestibility of nutrients contained in macrofungi. The aim of this study was to assess the bioavailability and digestibility of macronutrients using in vivo experiments on laboratory animals. The experiments were conducted with the commercial oyster mushroom Pleurotus ostreatus. Semisynthetic diets were prepared based on the modified AIN-93M diet and were supplemented with 4% and 8% mushroom powder. Between days 4 and 13, apparent digestibility indexes were determined for all animals using the conventional balance method. The hematological indexes-that is, hemoglobin, hematocrit, red blood cells, white blood cells, mean corpuscular volume, mean corpuscular hemoglobin, and mean corpuscular hemoglobin concentration-were determined using a Sysmex K-1000 hematological analyzer. Feeding rats with semisynthetic diets supplemented with dried oyster mushroom had no negative effect on body weight gain or feeding efficiency, expressed in the amount of body weight gain per unit of metabolic energy uptake. Introduction of dried oyster mushroom to the diet resulted in reduced digestibility of the diet and the protein and fat it contained, as well as decreased apparent energy availability. These changes were dependent on the volume of dried mushroom added to the semisynthetic diet. The addition of dried oyster mushroom to the semisynthetic diet considerably reduced passage time through the alimentary tract of rats.
Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia
2016-01-01
An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.
Nguyen, Trung Kien; Im, Kyung Hoan; Choi, Jaehyuk; Shin, Pyung Gyun; Lee, Tae Soo
2016-12-01
Culinary mushroom Pleurotus pulmonarius has been popular in Asian countries. In this study, the anti-oxidant, cholinesterase, and inflammation inhibitory activities of methanol extract (ME) of fruiting bodies of P. pulmonarius were evaluted. The 1,1-diphenyl-2-picryl-hydrazy free radical scavenging activity of ME at 2.0 mg/mL was comparable to that of butylated hydroxytoluene, the standard reference. The ME exhibited significantly higher hydroxyl radical scavenging activity than butylated hydroxytoluene. ME showed slightly lower but moderate inhibitory activity against acetylcholinesterase (AChE) and butyrylcholinesterase than galantamine, a standard AChE inhibitor. It also exhibited protective effect against cytotoxicity to PC-12 cells induced by glutamate (10~100 µg/mL), inhibitory effect on nitric oxide (NO) production and inducible nitric oxide synthase protein expression in lipopolysaccharide-stimulated RAW 264.7 macrophages, and carrageenan-induced paw edema in a rat model. High-performance liquid chromatography analysis revealed the ME of P. pulmonarius contained at least 10 phenolic compounds and some of them were identified by the comparison with known standard phenolics. Taken together, our results demonstrate that fruiting bodies of P. pulmonarius possess antioxidant, anti-cholinesterase, and inflammation inhibitory activities.
Effect of Pleurotus eryngii Mushroom β-Glucan on Quality Characteristics of Common Wheat Pasta.
Kim, SunHee; Lee, Jo-Won; Heo, Yena; Moon, BoKyung
2016-04-01
The objective of this study was to evaluate the effect of β-glucan-rich fractions (BGRFs) from Pleurotus eryngii mushroom powder on the quality, textural properties, and sensory evaluation of common wheat pasta. Pasta was prepared from semolina flour and common wheat flour by replacing common wheat flour at 2%, 4%, and 6% with BGRFs. Semolina flour showed significantly higher viscosities than common wheat flour samples. However, all viscosities, except the breakdown viscosity, were reduced with increasing percentages of BGRFs. Replacement of the common wheat flour with BGRFs resulted in a reddish brown colored pasta with a lower L* value and a higher a* value. The common wheat pastas containing up to 4% BGRFs were not significantly different from semolina pasta with regard to cooking loss. Addition of up to 2% BGRFs had no significant impact on swelling index and water absorption. The addition of BGRFs in common wheat flour had a positive effect on the quality of common wheat pasta and resulted in hardness values similar to those of semolina pasta. In a sensory evaluation, cooked pasta with 2% BGRFs had the highest overall acceptability score. In summary, the results showed that common wheat flour containing 4% BGRFs could be used to produce pasta with an improved quality and texture properties similar to semolina pasta. © 2016 Institute of Food Technologists®
Zhu, Hu; Sun, Jiao; Tian, Baozhen; Wang, Honglin
2015-03-01
In this study, a straight diagonal-pitched blade stirrer was designed, built and characterized in a 5-L fermenter. Compared with the six straight blade Rushton turbine, the power consumption of the new stirrer is lower at a given speed under conditions of no ventilation. The oxygen transference is poorer at the same agitation speed in the cultivation conditions and scales investigated, which confirms that the shear stress of the new stirrer is lower and the gas dispersion is weaker. The new stirrer was installed in a 5-L bioreactor and evaluated in submerged fermentation of the edible fungus Pleurotus ostreatus. The results showed that the maximum dry weight of mycelium is increased by 47 % and reached 7.47 g/L, and the maximum laccase activity is increased by 15 % up to 2,277 U/L. Glucose consumption was also found to be relatively faster. The power consumption is 2.8 % lower than that of the Rushton turbine.
Directory of Open Access Journals (Sweden)
Senzosenkosi Surprise MKHIZE
Full Text Available Abstract Improving the performance of mushroom in terms of high production and fast growth rate is essential in mushroom cultivation. In the present study the performance of Pleurotus ostreatus was evaluated using varying levels of wheat bran (WB and maize flour (MF. The results indicated that Pleurotus ostreatus was highly influenced by different levels of supplementation, with 8% WB, 18% WB and 2% MF having higher contamination rate. The low levels of supplementation gave significantly better mycelial growth rate (MGR and shorter colonisation period as observed that the control had highest MGR whereby 20% MF had lowest MGR. The pinning time (TP was shortest at the first flush with minimum of 3 days (12% MF. The higher levels of supplementation showed maximum biological efficiency (BE such as 14% MF, 12% WB and 14% WB. The yield was also higher at high levels of supplementation such as 20% MF and 8% MF being the exception in the lower levels. Based on the results it was observed that for fast production of oyster mushroom there is no need to supplement the maize stalk substrate but for improved productivity supplements can be added up to certain limits such as 14% MF and 12 WB.
Directory of Open Access Journals (Sweden)
Hamid Akbarirad
2013-06-01
Full Text Available Mushrooms are consider as a nutritional and health beneficial product. Three most cultivated mushrooms worldwide are Agaricus bisporus, Lentinus edodes and Pleurotus spp. Mushrooms are highly perishable. They tend to lose quality after harvest, mainly because of their high respiration rate and the fact that they have no barrier to protect them from water loss. Mushrooms’ shelf-life is limited to a few days under normal refrigeration conditions, which is a constraint on the distribution and marketing of fresh product, making extension of mushroom’s shelf life a constant quest. Modified atmosphere packaging provides an affordable packaging system that partly avoids enzymatic browning, fermentation and other biochemical processes by maintaining a controlled gas atmosphere. However, modified atmosphere packaging conditions should be carefully designed. Inappropriate modified atmosphere conditions may be ineffective or even shorten the shelf life of the product due to damage of tissues. Preservation techniques and specially use of MAP, specifically for Agaricus, Lentinus edodes and Pleurotus, is reviewed.
Shamsi, Sepideh; Seidavi, Alireza; Rahati, Maliheh; G Nieto, José Ángel
2015-01-01
Background: flavophospholipol is an antibiotic growth promoter (AGP). The current ban of AGP in some countries is controversial because their benefits on the environment and economy by saving feed and reducing nitrogen excretion have been overlooked. White button mushrooms have important nutritional properties and the industry discards large quantities of waste that could be fed to animals. Objective: to evaluate the effect of dietary inclusion of five levels of edible mushroom powder (EMP) a...
DNA barcoding of wild edible mushrooms consumed by the ethnic tribes of India.
Khaund, Polashree; Joshi, S R
2014-10-15
Wild edible mushrooms are consumed by the tribes of Meghalaya in the North-Eastern region of India, as part of their ethnic cuisine because of their favored organoleptic characteristics and traditionally known health benefits. Majority of these mushrooms have not yet been characterized in detail and are slowly shrinking in their natural habitats owing to anthropogenic factors and climate change. In the present study, representative specimens of ten morphologically distinct groups of wild edible mushrooms available in the traditional markets and their respective forest habitats, were subjected to multi-loci molecular characterization using SSU, ITS, RPB1 and RPB2 markers. The species identities inferred for the ten mushroom types using the SSU marker matched their morphological description in the case of four morphological groups only whereas the ITS marker successfully resolved the species identity for nine out of the ten mushroom groups under study. Both the protein coding gene markers RPB1 and RPB2 successfully resolved the species identity for three out of the ten morphologically distinct groups. Finally the most likely identity of the wild edible mushrooms under study has been suggested by matching their unique morphological characteristics with the generated DNA barcoding data. The present molecular characterization reveals the ten widely consumed wild mushroom types of Meghalaya, India to be Gomphus floccosus, Lactarius deliciosus, Lactarius volemus, Cantharellus cibarius, Tricholoma viridiolivaceum, Inocybe aff. sphaerospora, Laccaria vinaceoavellanea, Albatrellus ellisii, Ramaria maculatipes and Clavulina cristata. The final species identity generated by the ITS marker matched more accurately with the morphological characteristics/appearance of the specimens indicating the ITS region as a reliable barcode for identifying wild edible mushrooms. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Nam Wai Lun
2017-01-01
Full Text Available Microwave vacuum pyrolysis of waste palm shell (WPS was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus. The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g and a low moisture content (≤ 10 wt%, exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days and the highest yield of Oyster mushroom (550 g was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.
Lun Nam, Wai; Huan Su, Man; Phang, Xue Yee; Chong, Min Yee; Keey Liew, Rock; Ma, Nyuk Ling; Lam, Su Shiung
2017-11-01
Microwave vacuum pyrolysis of waste palm shell (WPS) was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus). The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g) and a low moisture content (≤ 10 wt%), exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria) and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days) and the highest yield of Oyster mushroom (550 g) was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.
Thongsook, T; Kongbangkerd, T
2011-08-01
Supplements of gypsum (calcium source), pumice (silicon source) and pumice sulfate (silicon and calcium source) into substrates for oyster mushrooms (Pleurotus ostreatus) were searched for their effects on production as well as qualities of fresh and canned mushrooms. The addition of pumice up to 30% had no effect on total yield, size distribution and cap diameters. The supplementation of gypsum at 10% decreased the total yield; and although gypsum at 5% did not affect total yield, the treatment increased the proportion of large-sized caps. High content (>10%) of pumice sulfate resulted in the lower yield. Calcium and silicon contents in the fruit bodies were not influenced by supplementations. The centrifugal drip loss values and solid content of fresh mushrooms, and the percentage of weight gained and firmness of canned mushrooms, cultivated in substrates supplemented with gypsum, pumice and pumice sulfate were significantly (p≤0.05) higher than those of the control. Scanning electron micrographs revealed the more compacted hyphae of mushroom stalks supplemented with silicon and/or calcium after heat treatment, compared to the control. Supplementation of P. ostreatus substrates with 20% pumice was the most practical treatment because it showed no effect on yield and the most cost-effective.
Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H
2015-01-01
Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.
Khaund, Polashree; Joshi, S R
2016-03-01
The biodiversity rich state of Meghalaya, India located in the realms of mega-biodiversity hotspots, is home to numerous species of wild edible macrofungi that are used extensively by the mycophillic ethnic population, as a part of their traditional cuisine and medicine systems. However, habitat loss, due to deforestation and climate change, is destroying the natural population of these mushrooms, depleting their availability to the local communities. In the present investigation, a GIS guided habitat search, using Lentinula edodes as a representative species, was used in mapping the habitats of wild edible macrofungi of the study region. Sampling of around 4 000 specimens per distinct morphological type available in the traditional markets and “sacred grove” forests indicated presence of ten common genera, belonging to nine different families of wild edible mushrooms. Nutritional profiling of the representative species Lentinula edodes was carried out by evaluation of its moisture, total fat, crude protein and carbohydrates contents by standard methods. Similarly, bioactive components determination was performed by estimation of total phenols, flavonoids, ascorbic acid, β-carotene and lycopenes. Bioactivity of the mushrooms extracts was studied using the DPPH radical scavenging and Human Red Blood Cell (HRBC) membrane stabilization assays. The present investigation successfully attempted to explore remote sensing technologies and GIS (Geographic Information System) based system to predict the natural habitats of wild edible mushrooms of Meghalaya, India which we believe will lead to the generation of a mushroom specific non-wood forest resource mapping system in the near future. Results of nutritional profiling and biological activity studies on the representative species of wild edible mushrooms from the studied region revealed that it is a rich source of essential nutrients and antioxidants.
Edible Mushrooms: Improving Human Health and Promoting Quality Life
Directory of Open Access Journals (Sweden)
María Elena Valverde
2015-01-01
Full Text Available Mushrooms have been consumed since earliest history; ancient Greeks believed that mushrooms provided strength for warriors in battle, and the Romans perceived them as the “Food of the Gods.” For centuries, the Chinese culture has treasured mushrooms as a health food, an “elixir of life.” They have been part of the human culture for thousands of years and have considerable interest in the most important civilizations in history because of their sensory characteristics; they have been recognized for their attractive culinary attributes. Nowadays, mushrooms are popular valuable foods because they are low in calories, carbohydrates, fat, and sodium: also, they are cholesterol-free. Besides, mushrooms provide important nutrients, including selenium, potassium, riboflavin, niacin, vitamin D, proteins, and fiber. All together with a long history as food source, mushrooms are important for their healing capacities and properties in traditional medicine. It has reported beneficial effects for health and treatment of some diseases. Many nutraceutical properties are described in mushrooms, such as prevention or treatment of Parkinson, Alzheimer, hypertension, and high risk of stroke. They are also utilized to reduce the likelihood of cancer invasion and metastasis due to antitumoral attributes. Mushrooms act as antibacterial, immune system enhancer and cholesterol lowering agents; additionally, they are important sources of bioactive compounds. As a result of these properties, some mushroom extracts are used to promote human health and are found as dietary supplements.
Risk evaluation of radioactive contamination in some species of edible mushrooms
International Nuclear Information System (INIS)
Droujinina, I.; Schinner, F.; Dromp, W.
1998-01-01
Full text of publication follows: edible mushrooms play an important role even in modern society - far beyond their value as food supply. The search for and gathering of edible mushrooms is one of the last possibilities of urbanized man to satisfy his drive as a hunter and collector in nature and thus an important part of the cultural heritage. Deprivation of this recreational activity due to radioactive contamination is considered simply a certain loss of quality of life and thus may have a strong emotional and sociological impact. The accident at the Chernobyl reactor on 26 April 1986 led to considerable amounts of radioactive material being distributed over a large area of Europe with Austria as one of the highest contaminated western countries. 13 years after the accident at Chernobyl, the long-lived isotopes such as cesium 137 (physical half-life of 30.2 years) and others are still of concern. Several publications suggest that the consumption of wild growing mushrooms has to be regarded as risky. The aim of our study is to provide some new investigations on the process of accumulation of radioactive Cs in ecosystems with the focus of attention on fungi, Therefore factors and processes limiting isotope accumulation of edible mushrooms are being determined, using standard microbiological and physical methods. Through a series of experiments and evaluations some factors limiting the accumulation of radionuclides in mycelia and in fruit bodies of selected mushrooms with a main emphasis placed on taxonomic position of each species and type of metabolism are being defined. On this basis careful extrapolation to the industrially cultivated species and to the most popular objects amongst mushroom-collectors is to be achieved. Our approach of assessing the risk of radioactive contamination of edible mushrooms, which is applicable for any assumed scenario, will be discussed. (authors)
Energy Technology Data Exchange (ETDEWEB)
Moda, Evelise Moncaio
2008-07-01
The production and consumption of edible mushrooms has been increasing in the last years due to its nutritional composition and sensory quality. The irradiation of mushrooms has been used with the purpose of maintaining the fresh product characteristics during shelf-life. The present study evaluated the effect of different radiation doses on the conservation of mushrooms Pleurotus sajor-caju, through by chemical, physical, microbiological and sensorial parameters. The packaging consisted on polystyrene trays with 250 g of sample, wrapped in polyvinyl chloride (PVC). The mushrooms were irradiated with doses of 125, 250, 500 and 750 Gy in a Gamma cell 220 type irradiator, and stored at 4 +- 1 deg C and 90% UR for 10 days. The proximate composition (moisture, crude fibre, total protein, total fat and ash), total soluble solids, pH, texture, color (L, a, b, Chroma and ho), enzymatic activity (polyphenoloxidase and peroxidase), microbiological (total coliform, Escherichia coli and total psychotropic bacteria) and sensory evaluation (color, taste and appearance) were determined in the 1st, 5th and 10th storage days. For the respiratory rate analysis, 30 g of sample were placed in jars and stored at 4 +- 1 deg C and 90% UR for 8 days. CO{sub 2} was analyzed every day using a gaseous chromatograph. The results were submitted to variance analysis and average test using the SAS statistical package. The total protein and total fat values did not differ significantly between treatments or storage periods, while the moisture, crude fibre and ash values differ between treatments and periods. The dose of 750 Gy darkness the mushroom in the last evaluation, and texture was better in control during the storage period. The color (L, a), texture and proximate composition values did not differ significantly between treatments or storage periods. A significant increase was observed for soluble solids, b{sup *} and enzymatic activity values in all treatments at the end of the storage
Directory of Open Access Journals (Sweden)
Senzosenkosi Surprise MKHIZE
2017-10-01
Full Text Available Abstract The use of supplemented agricultural waste in mushroom cultivation can be one of the environmentally friendly strategies for poverty alleviation. The study evaluated the performance of Pleurotus pulmonarius mushroom grown on maize stalk supplemented with varying levels of wheat bran (WB and maize flour (MF. A completely random design was used for the experiments. It was observed that Pleurotus pulmonarius was significantly affected by varying levels of supplementation, as 20% WB supplementation encountered higher contamination. The lower supplementation levels gave significantly shorter colonisation period with better mycelial growth rate (MGR. The 2% MF, 2% WB and 4% WB gave significantly higher MGR and faster colonisation. The shortest pinning time (TP was observed at the first flush with the minimum of 2 days. Higher supplementation levels gave maximum yield and biological efficiency (BE. With further increase of supplementation above a 12% WB and 14% MF, the BE and yield declined. Lower supplementation levels resulted in quicker colonisation period and improved growth rate, whereas high supplementation gave better production in terms of yield and BE. Therefore, for the purpose of maximum production, 12% WB and 14% MF may be recommended while for fast production time, 2% MF and 2% WB are recommended.
Directory of Open Access Journals (Sweden)
Wei-Jie Wu
Full Text Available Response surface methodology (RSM was used to determine the optimum vitamin D2 synthesis conditions in oyster mushrooms (Pleurotus ostreatus. Ultraviolet B (UV-B was selected as the most efficient irradiation source for the preliminary experiment, in addition to the levels of three independent variables, which included ambient temperature (25-45°C, exposure time (40-120 min, and irradiation intensity (0.6-1.2 W/m2. The statistical analysis indicated that, for the range which was studied, irradiation intensity was the most critical factor that affected vitamin D2 synthesis in oyster mushrooms. Under optimal conditions (ambient temperature of 28.16°C, UV-B intensity of 1.14 W/m2, and exposure time of 94.28 min, the experimental vitamin D2 content of 239.67 µg/g (dry weight was in very good agreement with the predicted value of 245.49 µg/g, which verified the practicability of this strategy. Compared to fresh mushrooms, the lyophilized mushroom powder can synthesize remarkably higher level of vitamin D2 (498.10 µg/g within much shorter UV-B exposure time (10 min, and thus should receive attention from the food processing industry.
Laccase Enzymes in Inocula Pleurotus spp
Directory of Open Access Journals (Sweden)
Nora García-Oduardo
2017-01-01
Full Text Available The cultivation of edible and medicinal mushrooms Pleurotus has been aimed at promoting alternative management for agricultural products. This basidiomicete has been the subject of numerous studies because of its fruiting body constitutes a food, being a producer of enzymes with industrial interest and for its ability of biotransformation of lignocellulosic substrates. Pleurotus inocula in the established technology for growing edible and medicinal mushrooms in the CEBI Research- Production Plant were performed using sorghum or wheat. However, it is possible to expand the possibilities with other substrates. In this paper, the results of laccase enzymes production in inocula prepared with sorghum, corn and coffee pulp with two strains Pleurotus ostreatus CCEBI 3021 and Pleurotus ostreatus CCEBI 3024 are presented. The period of preparation of seed reaches 15-21 days, the measurements of laccase activity were performed in periods of seven days. Extraction of crude enzyme was performed in aqueous phase, the determination of the laccase enzyme activity, using guaiacol as substrate. The results obtained in this work with studies in previous work using sorghum as inocula are compared. It is found that higher yields are obtained laccase in coffee pulp. This study contributes to the theoretical knowledge and to provide alternatives for securing the production process of the plant.
Intracellular Biosynthesis and Antibacterial Activity of Silver Nanoparticles Using Edible Mushrooms
Directory of Open Access Journals (Sweden)
Sankaran MIRUNALINI
2012-11-01
Full Text Available The process of biosynthesis of silver nanoparticles is a simple, cost effective and eco-friendly approach. Biosynthesis of silver nanoparticles using some commonly available edible mushroom extracts and their antimicrobial activity was demonstrated in the current study. The formation of silver nanoparticles was confirmed by UV, FTIR and SEM and antibacterial activity was tested using disc diffusion method. From the results it is confirmed the successful formation of silver nanoparticles using mushroom extracts; they performed their role as a reducing and capping agent and also exhibited a potent antibacterial activity against S. aureus (gram positive bacteria. Thus the biosynthesis of silver nanoparticles using edible mushroom extract will deserve to be a good candidate as an antibacterial agent.
137Cs and 90Sr distribution in edible mushrooms at the territory of the Lithuanian SSR
International Nuclear Information System (INIS)
Dauskurdis, S.I.; Tamulenajte, O.P.; Nedvetskajte, T.N.
1989-01-01
Results of studying 90 Sr and 137 Cs content in edible mushrooms in Lithuania before and after the Chernobyl accident (1984-1986) are presented. It is shown that after accident release in 1986 mushroom contamination with cesium isotopes increased about 4 times as compared to 1985 and 90 Sr activity preserved the same level. Radioisotope accumulation in mushrooms after the Chernobyl accident is studied depending on the mechanical composition of soil, pH and Ca quantity. It is ascertained that in carbonate, alkaline, reach with Ca and K soils 90 Sr and 137 Cs mobility is reduced and their absorption by mushroom is weakened. In light by mechanical composition (sandy), depleted by Ca soil 90 Sr arrival to mushrooms is 2.4 times higher than in soils with high Ca content. The quantity of water-soluble 90 Sr is maximal in soil with low pH and minimal content of exchange Ca. Radioactive contamination of mushrooms depends on the terrain relief and type of mushrooms. It is shown that radioactive contamination of mushrooms in 1986 did not exceede the admissible standard. 7 refs.; 4 figs.; 2 tabs
Cultivation of three types of indigenous wild edible mushrooms ...
African Journals Online (AJOL)
STORAGESEVER
2008-12-17
Dec 17, 2008 ... effects related to their disposal (Mshandete et al., 2008). Cultivation of mushroom can .... The holes facilitated drainage, aeration (free diffusion of gases and .... sium, iron, copper, manganese, zinc and cobalt) were determined.
The Edibility and Cultivation of the Oyster Mushroom.
Brenneman, James; Guttman, Mark C.
1994-01-01
Describes an enjoyable and fascinating experience that involves the cultivation of oyster mushrooms. By allowing students to participate in this process, the students are able to better understand the biology and utility of fungi. (ZWH)
Directory of Open Access Journals (Sweden)
Simon James
2011-05-01
Full Text Available Abstract Background Mushrooms are well recognized for their culinary properties as well as for their potency to enhance immune response. In the present study, we evaluated anti-inflammatory properties of an edible oyster mushroom (Pleurotus ostreatus in vitro and in vivo. Methods RAW264.7 murine macrophage cell line and murine splenocytes were incubated with the oyster mushroom concentrate (OMC, 0-100 μg/ml in the absence or presence of lipopolysacharide (LPS or concanavalin A (ConA, respectively. Cell proliferation was determined by MTT assay. Expression of cytokines and proteins was measured by ELISA assay and Western blot analysis, respectively. DNA-binding activity was assayed by the gel-shift analysis. Inflammation in mice was induced by intraperitoneal injection of LPS. Results OMC suppressed LPS-induced secretion of tumor necrosis factor-α (TNF-α, interleukin-6 (IL-6, and IL-12p40 from RAW264.7 macrophages. OMC inhibited LPS-induced production of prostaglandin E2 (PGE2 and nitric oxide (NO through the down-regulation of expression of COX-2 and iNOS, respectively. OMC also inhibited LPS-dependent DNA-binding activity of AP-1 and NF-κB in RAW264.7 cells. Oral administration of OMC markedly suppressed secretion of TNF-α and IL-6 in mice challenged with LPS in vivo. Anti-inflammatory activity of OMC was confirmed by the inhibition of proliferation and secretion of interferon-γ (IFN-γ, IL-2, and IL-6 from concanavalin A (ConA-stimulated mouse splenocytes. Conclusions Our study suggests that oyster mushroom possesses anti-inflammatory activities and could be considered a dietary agent against inflammation. The health benefits of the oyster mushroom warrant further clinical studies.
Directory of Open Access Journals (Sweden)
Yan Li
2016-01-01
Full Text Available Nowadays, wild-grown edible mushrooms which are natural, nutritious, and healthy get more and more popular by large consumers. In this paper, UV spectra of different Boletaceae mushrooms with the aid of partial least squares discriminant analysis (PLS-DA and hierarchical cluster analysis (HCA were shown to be a practical and rapid method for discrimination purpose. The specimens of Boletus edulis, Boletus ferrugineus, Boletus tomentipes, Leccinum rugosiceps, and Xerocomus sp. were described based on the UV spectra. From the results, all the specimens were characterized by strong absorption at the wavelengths of 274 and 284 nm and showed the shoulder at 296 nm. However, changes could be seen in the peak heights at the same wavelength for different samples. After analyzing by chemometrics, visual discrimination among samples was presented and the relationships among them were also obtained. This study showed that UV spectroscopy combined with chemometrics methods could be used successfully as a simple and effective approach for characterization of these five wild-grown edible mushrooms at species and genus levels. Meanwhile, this rapid and simple methodology could also provide reference for the discrimination of edible mushrooms.
[Mercury content in edible mushrooms in the Wyzyna Wieluńska region].
Falandysz, J; Hałaczkiewicz, J
1999-01-01
Mercury concentration was determined in the caps and stalks of nine species of edible mushrooms collected at the area of Wieluńska Upland in district of Czestochowa in 1995-96. The mushroom species examined were such as: yellow-cracking bolete Xerocomus subtomentosus, brown birch scaber stalk Leccinum scabrum, slippery Jack Suillus luteus, larch bolete Suillus grevillei, gray knight-cap Tricholoma terreum, parasol mushroom Macrolepiota procera, horse mushroom Agaricus arvensis, fennel funnel cap Clitocybe odora, fairy-ring mushroom Marasmius oreades and tacky green brittle gills Russula aereuginea. The method of mercury measurement was cold-vapour atomic absorption spectroscopy (CV-AAS) after wet digestion of the samples with concentrated nitric acid in a whole glass system. The parasol mushroom and horse mushroom showed a highest mercury concentrations and contained, respectively, 4500 +/- 1700 and 4400 +/- 2400 ng/g dry wt in caps, and 2800 +/- 1300 and 2800 +/- 2100 ng/g dry wt in stalks. In the case of fennel funnel cap and fairy-ring mushroom the mean total mercury concentrations in caps was above 500 ng/g dry wt, and for other species were between 150 +/- 50 and 500 +/- 230 ng/g dry wt. The stalks of the mushroom species examined in all cases showed lower contamination with mercury than caps. The mean total mercury concentrations noted in caps and stalks of mushrooms examined were usually higher than was reported till now in the same species elsewhere in Poland, while a maximum values found in an individual fruiting bodies are within the range of the concentrations noted in specimens collected from an unpolluted areas.
Naraian, Ram; Narayan, Om Prakash; Srivastava, Jatin
2014-01-01
Oyster mushroom Pleurotus florida was cultivated on different combinations of wheat straw (WS) as basal substrate and oyster shell powder (OSP) supplement. The OSP supplementation considerably responded to different cultivation phases. The mycelium grew fast and showed rapid growth rate (8.91 mmd(-1)) in WS + OSP (97 + 3) combination while WS + OSP (92 + 8) showed maximum laccase (3.133 U/g) and Mn peroxidase (MnP) activities (0.091 U/g). The climax level of laccase (5.433 U/g) and MnP (0.097 U/g) was recorded during fruit body initiation in WS + OSP (97 + 3) and WS + OSP (98 + 2) combinations, respectively. The WS + OSP (97 + 3) combination represented the best condition for mushroom cultivation and produced the highest biological efficiency (147%). In addition, protein and lipid contents in fruit bodies were slightly improved in response to OSP. The carbohydrate was significantly increased by raising concentration of OSP. The highest values of protein, carbohydrate, and lipid noted were 31.3 μg/g, 0.0639 (g/g), and 0.373 (g/g) correspondingly. Conclusively it was evident that lower concentrations of OSP acted positively and relatively to higher concentrations and improved nutritional content which may suitably be used to enhance both yield and nutritional values of mushroom.
Phan, Chia-Wei; David, Pamela; Sabaratnam, Vikineswary
2017-01-01
There is an exponential increase in dementia in old age at a global level because of increasing life expectancy. The prevalence of neurodegenerative diseases such as dementia and Alzheimer's disease (AD) will continue to rise steadily, and is expected to reach 42 million cases worldwide in 2020. Despite the advancement of medication, the management of these diseases remains largely ineffective. Therefore, it is vital to explore novel nature-based nutraceuticals to mitigate AD and other age-related neurodegenerative disorders. Mushrooms and their extracts appear to hold many health benefits, including immune-modulating effects. A number of edible mushrooms have been shown to contain rare and exotic compounds that exhibit positive effects on brain cells both in vitro and in vivo. In this review, we summarize the scientific information on edible and culinary mushrooms with regard to their antidementia/AD active compounds and/or pharmacological test results. The bioactive components in these mushrooms and the underlying mechanism of their activities are discussed. In short, these mushrooms may be regarded as functional foods for the mitigation of neurodegenerative diseases.
Elemental profile of edible mushrooms from a forest near a major Romanian city
Directory of Open Access Journals (Sweden)
Zsigmond Andreea R.
2015-12-01
Full Text Available We determined the elemental profile of 16 edible mushroom species from the Făget Forest, near Cluj-Napoca, and of 12 species from the Apuseni Mountains. One-way ANOVA showed no difference in the elemental content of mushrooms when the two regions were compared. Some species accumulated high amounts of trace elements, i.e. Boletus edulis (Ag, S, Zn, Macrolepiota procera (Cu, Lactarius volemus (Co, Russula emetica (Mn, Armillariella mellea, and Chantarellus cibarius (Cr. The cadmium content was the highest in the case of Leccinum scabrum and Boletus edulis. These two species presented elevated risk levels for all age-groups when they are consumed regularly.
Edible Philippine mushrooms including Ganoderma lucidum have many health benefits. We have recently reported the identities and the contents of 77 molecular species of acylglycerols containing hydroxy fatty acids (HFA) in this mushroom. The structures of these HFA were proposed using the electrospra...
Edible Philippine mushrooms including Ganoderma lucidum have many health benefits. Seventy-two molecular species of triacylglycerols and five molecular species of diacylglycerols containing hydroxy fatty acids (FA) in the lipid extract of this mushroom were identified by HPLC and MS. The mono-, di- ...
International Nuclear Information System (INIS)
Urban, P.L.; Bazala, M.A.; Bystrzejewska-Piotrowska, G.; Pianka, D.; Steborowski, R.; Asztemborska, M.; Kowalska, J.; Manjon, J.L.; Kuthan, R.T.
2005-01-01
A model species of saprophytic fungus, king oyster mushroom (Pleurotus eryngii), was cultivated on barley substrate supplied with [Pt(NH 3 ) 4 ](NO 3 ) 2 , under well defined conditions. The samples of the collected fruiting bodies were digested and analyzed for total platinum content by means of ICP-MS. The results proved that platinum is not accumulated in the fruitbodies of Pleurotus eryngii for a wide range of Pt concentrations in the culture substrate (100-1000 ppb Pt in 50 ml of water solution added to ca. 450 g of hydrated barley seeds per container). Observable levels of Pt were only found in the fruitbodies obtained from the medium contaminated with 10000 ppb (10 ppm) platinum solution. This demonstrates significant difference in the effectiveness of platinum extraction in fungi and plants, which are capable to accumulate platinum even when supplied at lower concentration (<500 ppb). It also shows different physiological pathways of platinum and other elements which are easily accumulated in the fruitbodies of the same species. (author)
Fungal and mycotoxin assessment of dried edible mushroom in Nigeria
DEFF Research Database (Denmark)
Ezekiel, C.N.; Sulyok, M.; Frisvad, Jens Christian
2013-01-01
In order to determine whether dried mushrooms are a foodstuff that may be less susceptible to infection by toxigenic molds and consequently to mycotoxin contamination, 34 dried market samples were analyzed. Fungal population was determined in the samples by conventional mycological techniques...
Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon
2016-12-01
Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) were tested for their efficacy in oyster mushroom production. Pure culture of oyster mushroom was obtained from Mycology laboratory, Department of Plant Biology and Biodiversity Management, Addis Ababa University. The pure culture was inoculated on potato dextrose agar for spawn preparation. Then, the spawn containing sorghum was inoculated with the fungal culture for the formation of fruiting bodies on the agricultural wastes. The oyster mushroom cultivation was undertaken under aseptic conditions, and the growth and development of mushroom were monitored daily. Results of the study revealed that oyster mushroom can grow on cotton seed, paper waste, sawdust and wheat straw, with varying growth performances. The highest biological and economic yield, as well as the highest percentage of biological efficiency of oyster mushroom was obtained from cotton seed, while the least was from sawdust. The study recommends cotton seed, followed by paper waste as suitable substrates for the cultivation of oyster mushroom. It also suggests that there is a need for further investigation on various aspects of oyster mushroom cultivation in Ethiopia to promote the industry.
Panjikkaran, Seeja Thomachan; Mathew, Deepu
2013-03-15
The existing protocol for the cultivation of oyster mushroom (Pleurotus florida) in polyethylene bags leads to environmental pollution amounting to 18 g of polyethylene per 450 g of mushroom, which is the average biological efficiency achieved from a bag. Thus the projected annual global pollution amounts to 2 million tones, corresponding to the production of 48 million tones. Experiments were conducted at Kerala Agricultural University, India, to formulate an oyster mushroom cultivation strategy that reduces this pollution level. Pooled results of experiments at the institute's and farmers' units have shown that reusable plastic buckets having perforations of 1.5 cm × 1.0 cm throughout the side walls could be used to substitute polyethylene bags, while following the standard cultivation protocols. Cultivation in perforated buckets has recorded a biological efficiency of 435.69 ± 56.75 g in 47.07 ± 5.22 days against 459.11 ± 53.52 g in 38.05 ± 4.54 days in polyethylene bags. The rate of contamination in buckets was significantly lower than that in bags: 9.28 ± 2.12 and 12.60 ± 3.73% respectively. Reusable plastic buckets with perforations on the side walls could be used to substitute the conventional polyethylene bags in oyster mushroom cultivation, with no significant difference in yield. Losses due to slight increase in crop duration in buckets will be compensated with a lower rate of contamination. For a unit having a daily output of 100 kg, it was estimated that during 10 years of permanent cultivation following this technique, the cost of cultivation could be reduced to one-tenth and the environmental pollution reduced by at least 730 000 non-degradable polyethylene bags. © 2012 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Nualsri, C.
2005-01-01
Full Text Available A total of 174 strains of bacteria antagonistic against the green mold (Trichoderma harzianum, isolated from cultivating bags and fruiting bodies of the mushrooms, were screened for effects on mushroom mycelia and ability to control the green mold disease. Twenty-eight of them promoted the primodia formation of the Pleurotus pulmonarius mycelia on agar plates. Twenty-two isolates were selected and further tested in a mushroom house. Cell suspension of each isolate was prepared and sprayed onto the spawn surface of P. pulmonarius. Fifteen isolates shortened the times required from watering to 2nd and 3rd flushing and increased yield of the basidiocarps by 1.1-34.3% over 30 days. Six isolates of bacteria which showed an inhibitory effect against T. harzianum, enhanced primordia formation and increased yield of P. pulmonarius were selected and used for control testing in a cultivation house. The suspension of each isolate was sprayed onto the spawn surface immediately after exposure to the air in the mushroom house, followed by spore suspension of T. harzianum two days later. The number of infected bags was counted at 30 days after inoculation and the cumulative yield was compared after 60 days. The results showed that bacteria isolate B012-022 was highly effective in suppressing the green mold disease.Only 6.7% of the cultivating bags were found to be infected by T. harzianum when bacteria isolate B012-022 was applied. Cumulative yield obtained from 900 g of 94% sawdust + 5% rice bran + 1% Ca(OH2 was 300.0 g/bag after 60 days, 71.1% higher than the bags infected by the green mold and without bacterial spraying. Identification of the six bacterial isolates showed all to be Bacillus spp.
Effect of ionizing radiations on some organoleptic characteristics of edible mushroom
International Nuclear Information System (INIS)
Kovacs, E.; Vas, K.
1974-01-01
Organoleptic characteristics - colour, odour, flavour and texture - of edible mushrooms (Agaricus bisporus) in different stages of ripeness (half-ripe, ripe) were examined as a function of radiation dose, storage time as well as storage temperature, and humidity (3-5 0 C, 70-90% RH; 16 0 C, 65-75% RH). Immediately after irradiation the mushrooms assumed a slight brownish hue which, however, did not change on further storage. The brown discoloration of untreated mushroom progressed in the course of storage. The colour of the irradiated mushroom scarcely changed with storage time, tested on the 6th, 11th or 13th day. Other properties examined (odour, flavour, texture) were not affected by irradiation, either immediately upon treatment or during further storage. Ionizing radiation was found to exert favourable influence upon the organoleptic properties of picked mushrooms, and to delay the deterioration of these properties. Radiation treatment was found to preserve the characteristic mushroom odour and this is considered an advantage in canning. (F.J.)
Effect of gamma irradiation on the appearance and composition of edible mushrooms
International Nuclear Information System (INIS)
Wahid, M.; Darwish, Y.M.A.
1981-01-01
Fresh edible mushrooms picked with closed caps, and irradiated at 0, 1.0 and 2.5 kGy doses were stored for 8 days at 20+-2 0 C and investigated for the changes in ascorbic acid, protein contents, free alpha-amino N and total phenols. It was observed that during storage free alpha-amino N decreased significantly, while the protein contents remained somewhat constant till 4th day of storage. The ascorbic acid increased in the beginning and then decreased significantly. Total phenols decreased in the beginning and then accumulated during further storage. Irradiation had no effect on the proteins, but decreased ascorbic acid contents of mushrooms. The levels of free alpha-amino N and total phenols were significantly higher in irradiated treatments as compared to unirradiated mushrooms. (author)
Cultivation Techniques and Medicinal Properties of Pleurotus spp.
Directory of Open Access Journals (Sweden)
Andrej Gregori
2007-01-01
Full Text Available The genus Pleurotus (oyster mushroom comprises some most popular edible mushrooms due to their favourable organoleptic and medicinal properties, vigorous growth and undemanding cultivation conditions. It can be cultivated on log and a wide variety of agroforestry (by-products, weeds and wastes for the production of food, feed, enzymes and medicinal compounds, or for waste degradation and detoxification. Many different techniques and substrates have been successfully utilized for mushroom cultivation and biomass production by means of solid-state and submerged liquid fermentation. However, in contrast to submerged liquid fermentation, solid-state fermentation is not often used in large scale due to severe engineering problems. Various Pleurotus species have been shown to possess a number of medicinal properties, such as antitumour, immunomodulatory, antigenotoxic, antioxidant, anti-inflammatory, hypocholesterolaemic, antihypertensive, antiplatelet-aggregating, antihyperglycaemic, antimicrobial and antiviral activities. These therapeutic activities are exhibited by extracts or isolated compounds from Pleurotus spp. fermentation broth, mycelia and fruiting bodies. In particular, polysaccharides appear to be potent antitumour and immuno-enhancing substances, besides possessing other beneficial activities. However, the biochemical mechanisms of these therapeutic activities still remain largely unknown. This review focuses on recent advances in the biotechnology of Pleurotus spp., with emphasis on the production of fruiting bodies, the production of mycelium and bioactive compounds by solid-state and submerged liquid fermentation. The medicinal properties of this mushroom are also outlined.
Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon
2016-01-01
Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) ...
Some Edible Mushrooms of Kop Mountain (Erzurum-Bayburt
Directory of Open Access Journals (Sweden)
Ali Keleş
2016-03-01
Full Text Available The present research was conducted on macrofungi collected from Kop Mountain (Erzurum-Bayburt between the years of 2010 and 2011. The colorful photographs of macrofungi in the natural habitat were taken and their morphological and ecological features were determined and the information on macrofungi given by local people was recorded. According to the field and laboratory studies; 44 edible macrofungi taxa belonging to 14 families and 5 ordos located in Pezizomycetes and Agaricomycetes classes were identified.
Alananbeh, Kholoud M; Bouqellah, Nahla A; Al Kaff, Nadia S
2014-12-01
Promoting the use of agricultural waste is one of the newly prepared water and environment friendly agriculture strategies in the Kingdom of Saudi Arabia (KSA). The objective of this research was to study the efficiency of cultivating oyster mushroom (Pleurotus ostreatus) on date palm wastes mixed with other agricultural wastes available in KSA. Four agricultural wastes were mixed with date palm leaves at different ratios, with two supplements and three spawn rates were used. Wheat straw mixed with date palm at ratio of 25 (date palm): 75 (agro-waste) showed the best results in most of the parameters measured. Corn meal was superior over wheat bran as a supplement in all treatments. Parameter values increased with the increase of the spawn rate of P. ostreatus. Treatments with date palm leave wastes contained higher carbohydrates and fibers. No significant differences were found among the fruiting bodies produced on the different agro-wastes studied for the different proximates analyzed. Analyses of metal concentration showed that potassium was the highest in all the treatments tested followed by Na, Mg, Ca, and Zn. This is the first study that reported the success of growing oyster mushroom on date palm leaf wastes mixed with other agro-wastes obtainable in KSA.
Directory of Open Access Journals (Sweden)
Islam Md. Tariqul
2017-01-01
Full Text Available In this study, grey oyster mushroom (Pleurotus pulmonarius was cultivated in indoor controlled environment to seeking out the possible risks of contamination and ways of treatment to avoid the contamination. For this, mushroom was cultivated in providing artificial humidifying and ventilation system to ensure optimum humidity (80-90% and fresh air recirculation in different ways of treatment. The ways of treatment were included as in position of humidifier, frequency of humidifying, plastic cork of bags opening part and cleaning of humidifier water container. Maximum percentages of bag contamination (2.5-25.30%, cap contamination (5.6-30.75%, stalk contamination (4.75-23.25% and root contamination (2.6-18.45% were found in front to front humidifier position, long humidifying with long interval frequency, without plastic cork, without cleaning and bi-monthly cleaning of humidifier water container treatment but no diseases and pest infection was found. Whereas, very low percentages of contamination (0.1-0.5% were found in surrounding humidifying position, short humidifying duration with short interval frequency, with plastic cork and weekly cleaning of humidifier water container treatment.
Back, Chang-Gi; Lee, Chang-Yun; Seo, Geon-Sik; Jung, Hee-Young
2012-09-01
Four Cladobotryum isolates were collected from four different commercially grown mushroom types infected with cobweb disease in Cheongdo-gun and Chilgok-gun of Gyeongbuk Province, Korea in 2010. The isolates were identified as C. mycophilum from Agaricus bisporus and Pleurotus eryngii, C. varium from Flammulina velutipes and Hypsizygus marmoreus. The cultural characteristics of the four isolates were investigated using potato dextrose agar (PDA) media under nine different temperatures ranging from 5~32℃. Rapid growth of the isolates to colony diameters of 47~82 mm was observed at conditions of 18~22℃. No growth was observed at 32℃. C. mycophilum produced a yellowish red pigment while C. varium produced a cream colored pigment after cultivation for 25 days on PDA. Phylogenetic analysis of the internal transcribed spacer region and partial 28S rDNA from the four isolates confirmed they were C. mycophilum and C. varium. Cross pathogenicity tests revealed that the two isolates of C. mycophilum were highly pathogenic toward three mushroom types, but not toward H. marmoreus. The two isolates of C. varium were less pathogenic than those of C. mycophilum, but were pathogenic toward all mushroom types evaluated.
Vieira, Fabrício Rocha; de Andrade, Meire Cristina Nogueira
2016-11-01
In recent years, oyster mushroom (Pleurotus ostreatus) has become one of the most cultivated mushrooms in the world, mainly in Brazil. Among many factors involved in a mushroom production, substrate preparation is the most critical step, which can be influenced by composting management techniques. Looking forward to optimizing the substrate preparation process, were tested different composting conditions (7 and 14 days of composting with or without conditioning), potential raw materials (decumbens grass, brizantha grass and sugarcane straw) and nitrogen supplementation (with or without wheat bran) on oyster mushroom yield and biological efficiency (BE). The substrate composted for 7 days with conditioning showed higher yield and biological efficiency of mushroom (24.04 and 100.54 %, respectively). Substrates without conditioning (7 and 14 days of composting) showed smaller mushroom yield and biological efficiency. Among the raw materials tested, brizantha grass showed higher mushroom yield followed by decumbens grass, sugarcane straw and wheat straw (28.5, 24.32, 23.5 and 19.27 %, respectively). Brizantha grass also showed higher biological efficiency followed by sugarcane straw, decumbens grass and wheat straw (123.95, 103.70, 96.90 and 86.44 %, respectively). Supplementation with wheat bran improved yield and biological efficiency in all substrate formulations tested; thus, oyster mushroom yield and biological efficiency were influenced by substrate formulation (raw materials), supplementation and composting conditions.
Rice straw addition as sawdust substitution in oyster mushroom (Pleurotus ostreatus) planted media
Utami, Christine Pamardining; Susilawati, Puspita Ratna
2017-08-01
Oyster mushroom is favorite by the people because of the high nutrients. The oyster mushroom cultivation usually using sawdust. The availability of sawdust become difficult to find. It makes difficulties of mushroom cultivation. Rice straw as an agricultural waste can be used as planted media of oyster mushroom because they contain much nutrition needed to the mushroom growth. The aims of this research were to analysis the influence of rice straw addition in a baglog as planted media and to analysis the concentration of rice straw addition which can substitute sawdust in planted media of oyster mushroom. This research used 4 treatment of sawdust and rice straw ratio K = 75 % : 0 %, P1 = 60 % : 15 %, P2 = 40 % : 35 %, P3 = 15 % : 60 %. The same material composition of all baglog was bran 20%, chalk 5%, and water 70%. The parameters used in this research were wet weight, dry weight, moisture content and number of the mushroom fruit body. Data analysis was used ANOVA test with 1 factorial. The results of this research based on statistical analysis showed that there was no influence of rice straw addition in a planted media on the oyster mushroomgrowth. 15% : 60% was the concentrationof rice straw additionwhich can substitute the sawdust in planted media of oyster mushroom.
Rentería-Chávez, María C; Pérez-Moreno, Jesús; Cetina-Alcalá, Víctor M; Ferrera-Cerrato, Ronald; Xoconostle-Cázares, Beatriz
An ectomycorrhiza is a mutualistic symbiosis of paramount importance in forestry and tree production. One of the selection criteria of ectomycorrhizal fungi that has currently gained importance is their edibility due to the economic, ecological and cultural relevance of edible ectomycorrhizal mushrooms as a non-timber forest product. The effect of the inoculation with three edible ectomycorrhizal mushrooms: Laccaria laccata, Laccaria bicolor y Hebeloma leucosarx, which are widely sold in Mexico, on the growth and nutrient contents of Pinus greggii grown in an experimental substrate and a commercial substrate enriched with a slow-release fertilizer, was evaluated. Two years after sowing, differences in terms of shoot and root biomass and macro and micronutrient contents between inoculated and non-inoculated plants, were recorded independently of the fungal species and the substrate. Despite the fact that plants grown in the commercial substrate had higher growth and nutrient contents, their ectomycorrhizal colonization percentages were smaller than those of the plants grown in the experimental substrate. The differences in the nutrient transfer to the inoculated plant shoots among the evaluated fungal species were recorded. Ca mobilization by L. laccata, Na by L. bicolor and Mn by H. leucosarx were observed in the plants growing in the experimental substrate. It has been demonstrated that the selection of substrates constitutes an important factor in the production of ectomycorrhizal plants and that the three evaluated species of edible ectomycorrhizal mushrooms have an enormous potential in the controlled mycorrhization of P. greggii. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Directory of Open Access Journals (Sweden)
Liping Sun
2017-02-01
Full Text Available Thirteen popular wild edible mushroom species in Yunnan Province, Boletus bicolor, Boletus speciosus, Boletus sinicus, Boletus craspedius, Boletus griseus, Boletus ornatipes, Xerocomus, Suillus placidus, Boletinus pinetorus, Tricholoma terreum, Tricholomopsis lividipileata, Termitomyces microcarpus, and Amanita hemibapha, were analyzed for their free amino acid compositions by online pre-column derivazation reversed phase high-performance liquid chromatography (RP-HPLC analysis. Twenty free amino acids, aspartic acid, glutamic acid, serine, glycine, alanine, praline, cysteine, valine, methionine, phenylalanine, isoleucine, leucine, lysine, histidine, threonine, asparagines, glutamine, arginine, tyrosine, and tryptophan, were determined. The total free amino acid (TAA contents ranged from 1462.6 mg/100 g in B. craspedius to 13,106.2 mg/100 g in T. microcarpus. The different species showed distinct free amino acid profiles. The ratio of total essential amino acids (EAA to TAA was 0.13–0.41. All of the analyzed species showed high contents of hydrophobic amino acids, at 33%–54% of TAA. Alanine, cysteine, glutamine, and glutamic acid were among the most abundant amino acids present in all species. The results showed that the analyzed mushrooms possessed significant free amino acid contents, which may be important compounds contributing to the typical mushroom taste, nutritional value, and potent antioxidant properties of these wild edible mushrooms. Furthermore, the principal component analysis (PCA showed that the accumulative variance contribution rate of the first four principal components reached 94.39%. Cluster analysis revealed EAA composition and content might be an important parameter to separate the mushroom species, and T. microcarpus and A. hemibapha showed remarkable EAA content among the 13 species.
Oil palm empty fruit bunch as media for mushroom cultivation
International Nuclear Information System (INIS)
Mat Rasol Awang; Wan Badrin Wan Husin; Tajuddin Osman; Tamikazu Kume; Shinpei Matsuhashi
1998-01-01
The mushroom strains Pleurotus sajor caju(grey oyster mushroom), Pleurotus flavellatus((pink oyster mushroom), Pleurotus cystidiosus(abalone mushroom) and Auricularia polytricha (black jelly mushroom) grow satisfactorily on the EFB media treated with lime. Based on their Biological Efficiency (BE) or yield, the strain Pleurotus sajor caju was selected for further investigation. The BE of the Pleurotus sajor caju was 73.8 %. The lime treatment, aeration and four weeks incubation period was necessary for fruiting
Quiñónez-Martínez, Miroslava; Ruan-Soto, Felipe; Aguilar-Moreno, Ivonne Estela; Garza-Ocañas, Fortunato; Lebgue-Keleng, Toutcha; Lavín-Murcio, Pablo Antonio; Enríquez-Anchondo, Irma Delia
2014-09-17
The Sierra Madre Occidental of Chihuahua in Northern Mexico is inhabited by indigenous Raramuris, mestizos, and other ethnic groups. The territory consists of canyons and ravines with pine, oak and pine-oak forests in the higher plateaus. A great diversity of potentially edible mushrooms is found in forests of the Municipalities of Bocoyna and Urique. Their residents are the only consumers of wild mushrooms in the Northern Mexico; they have a long tradition of collecting and eating these during the "rainy season." However, despite the wide diversity of edible mushrooms that grow in these areas, residents have a selective preference. This paper aims to record evidence of the knowledge and use of wild potentially edible mushroom species by inhabitants of towns in the Sierra Tarahumara of Chihuahua, Mexico. Using a semi-structured technique, we surveyed 197 habitants from seven locations in Urique, Bocoyna, and the Cusarare area from 2010 to 2012. Known fungi, local nomenclature, species consumed, preparation methods, appreciation of taste, forms of preservation, criteria for differentiating toxic and edible fungi, other uses, economic aspects, and traditional teaching were recorded. To identify the recognized species, photographic stimuli of 22 local edible species and two toxic species were used. The respondents reported preference for five species: Amanita rubescens, Agaricus campestris, Ustilago maydis, Hypomyces lactifluorum, and the Amanita caesarea complex. No apparent differences were found between ethnic groups in terms of preference, although mestizos used other species in Bocoyna (Boletus edulis and B. pinophilus). Some different uses of fungi are recognized by respondents, i.e. home decorations, medicine, as food in breeding rams, etc. The studied population shows a great appreciation towards five species, mainly the A. caesarea complex, and an apparent lack of knowledge of nearly 20 species which are used as food in other areas of Mexico. There are no
Directory of Open Access Journals (Sweden)
ibtissem Kacem Jedidi
2016-04-01
Full Text Available In Tunisia, many people collect wild edible mushrooms as pickers for their own consumption. The present work aims at contributing to the determination of the chemical composition, non volatile components content (soluble sugars, free amino acids and minerals and trace elements of three popular Tunisian wild edible mushrooms species collected from the northwest of Tunisia (Agaricus campestris, Boletus edulis and Cantharellus cibarius.All investigated mushrooms revealed that these species are rich sources of proteins (123.70 – 374.10 g kg-1 dry weight (DW and carbohydrates (403.3 – 722.40 g kg-1 DW, and low content of fat (28.2 – 39.9 g kg-1 DW; the highest energetic contribution was guaranteed by C. cibarius (1542.71 kJ / 100 g. A. compestris (33.14 mg/g DW showed the highest concentration of essential amino acids. The composition in individual sugars was also determined, mannitol and trehalose being the most abundant sugars. C. cibarius revealed the highest concentrations of carbohydrates (722.4 g kg-1 DW and A. compestris the lowest concentration (403.3 g kg-1 DW. Potassium (K and sodium (Na are the most abundant minerals in analyzed samples (A. compestris showed the highest concentrations of K and Na, 49141.44 and 9263.886 µg/g DW respectively.
Directory of Open Access Journals (Sweden)
Pei-Long Sun
2012-04-01
Full Text Available Four crude water soluble polysaccharides, CABP, CAAP, CFVP and CLDP, were isolated from common edible mushrooms, including Agaricus bisporus, Auricularia auricula, Flammulina velutipes and Lentinus edodes, and their chemical characteristics and antioxidant properties were determined. Fourier Transform-infrared analysis showed that the four crude polysaccharides were all composed of β-glycoside linkages. The major monosaccharide compositions were D-galactose, D-glucose and D-mannose for CABP, CAAP and CLDP, while CFVP was found to consist of L-arabinose, D-galactose, D-glucose and D-mannose. The main molecular weight distributions of CABP and the other three polysaccharides were 66.0 × 104 Da, respectively. Antioxidant properties of the four polysaccharides were evaluated in in vitro systems and CABP showed the best antioxidant properties. The studied mushroom species could potentially be used in part of well-balanced diets and as a source of antioxidant compounds.
Amino and Fatty Acids of Wild Edible Mushrooms of the Genus Boletus
Directory of Open Access Journals (Sweden)
Dmitri O. Levitsky
2010-10-01
Full Text Available A comparative study on the free amino acids of 15 wild edible mushroom species belonging to the genus Boletus (phylum Basidiomycota was developed. The major amino acids in the fruit bodies were arginine , alanine, glutamine, and glutamic acid. The most abundant fatty acids were oleic ( 9- 18:1, linoleic acid (9,12-18:2 , and palmitic acid (16:0, but a great variation of the ester composition from one to another one was found. Chemical constituents were characterized by GC-MS, and other chemical methods.
International Nuclear Information System (INIS)
Galanda, D.
2006-01-01
The mushrooms are not only rich food products, but also a specific component of forest biogeocenoses playing an important role in their functioning, including radionuclide migration. The reason why fungi work as such good indicators for radioactivity and pollution in general is connected to their structure. Using absorption to obtain their nutrition, fungi lack water-conducting organs like stems and roots. They absorb moisture and nutrients from the soil background through surface cells. Dissolved or airborne materials, which include pollutants, move freely through the compartments of hyphae. What is more, radiation released during nuclear testing or accidents is absorbed, especially in areas where it rained heavily shortly after the incident. The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of 241 Am and 242 Pu. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by ? -spectrometry. The results of activity 241 Am and 242 Pu in the mushrooms body and residual activity in the support was detected and calculated. (author)
Drori, Ariel; Shabat, Yehudit; Ben Ya'acov, Ami; Danay, Ofer; Levanon, Dan; Zolotarov, Lidya; Ilan, Yaron
2016-04-01
Vitamin D has been known for its anti-inflammatory properties. Extracts derived from Lentinula edodes (Shiitake) edible mushroom exert an anti-inflammatory effect. These extracts contain high levels of ergosterol, which converts into ergocalciferol (vitamin D2) following exposure to ultraviolet light, followed by absorption and hydroxylation into the active form 25-hydroxyvitamin D [25(OH)D]. To determine the anti-inflammatory effect of overexpression of vitamin D in edible mushrooms, L. edodes mushrooms were exposed to ultraviolet-B light, freeze-dried, followed by measurement of vitamin D2 contents, in their dry weight. C57B1/6 mice were orally treated with vitamin D2-enriched or nonenriched mushroom extract prior and during concanavalin A-immune-mediated liver injury. Exposure to ultraviolet light increased vitamin D2 content in Shiitake edible mushrooms. Following feeding of vitamin D-enriched mushroom extracts to mice with immune-mediated hepatitis, a significant decrease in liver damage was noted. This was shown by a decrease in alanine aminotransferase and aspartate aminotransferase serum levels, a decrease in proportion of mice with severe liver injury, and by improvement in liver histology. These effects were associated with a decrease in serum interferon gamma levels. A synergistic effect was noted between the anti-inflammatory effect of the mushroom extracts and that of vitamin D. Oral administration of vitamin D-enriched L. edodes edible mushroom exerts a synergistic anti-inflammatory effect in the immune-mediated hepatitis. The data support its potential use as safe immunomodulatory adjuvant for the treatment of HCV and nonalcoholic steatohepatitis.
Koutrotsios, Georgios; Danezis, Georgios P; Georgiou, Constantinos A; Zervakis, Georgios I
2018-04-20
Concentrations of 16 rare earth elements (REEs) and two actinides were determined for the first time both in cultivated mushrooms and in their production substrates by inductively coupled plasma mass spectroscopy. Moreover, the effect of REEs on cultivation parameters and composition of the final product was assessed, together with their potential use for authentication purposes. The concentrations of REEs varied greatly among seven cultivation substrates and correlated with measurements in Cyclocybe cylindracea mushrooms; no such correlation was established in Pleurotus ostreatus. Reduction of hemicellulose, cellulose, and lignin in substrates during P. ostreatus cultivation was positively correlated with REE concentrations, which also affected the production performance depending on the species examined. In all cases, a negative correlation was established between bioconcentration factors (BCF) in mushrooms and REE content in substrates, while the effect of substrate composition on BCF values varied according to the element studied. The estimated daily intake values of REEs through mushroom consumption was at much lower levels than those reported as potentially harmful for human health. The content of REEs in cultivation substrates and in mushrooms revealed that the bioaccumulation of elements differed in each fungus. The nature/origin of substrates seemed to affect the concentration of REEs in mushrooms to a considerable extent. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.
Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun
2015-01-01
The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.
Kikuchi, Takashi; Maekawa, Yukina; Tomio, Arisa; Masumoto, Yuki; Yamamoto, Taishi; In, Yasuko; Yamada, Takeshi; Tanaka, Reiko
2016-11-01
Six new ergostane-type steroids; (22E)-3β,5α,6α,11-tetrahydroxy-9(11)-seco-ergosta-7,22-dien-9-one (1), (22E)-8,14-epoxyergosta-6,22-diene-3β,5α,9α-triol (2), (22E)-4α,5α-epoxyergosta-7,22-diene-3β,6β-diol (3), (22E)-3β,4β,5α-trihydroxyergosta-7,22-dien-6-one (4), (22E)-ergosta-7,22-diene-3β,5β,6α-triol (5), and (22E)-6β-methoxyergosta-7,22-diene-3β,5α-diol 3-O-β-d-glucopyranoside (6) were isolated from the fruiting bodies of king trumpet mushroom (Pleurotus eryngii), along with fourteen known compounds (7-20). All isolated compounds were evaluated for their inhibitory effects on macrophage activation using a nitric oxide production inhibition assay. Copyright © 2016. Published by Elsevier Inc.
Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan
2013-01-01
With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.
Energy Technology Data Exchange (ETDEWEB)
Bystrzejewska-Piotrowska, Grazyna [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)], E-mail: byst@biol.uw.edu.pl; Bazala, Michal A. [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)
2008-07-15
Ex vitro cultures of Pleurotus eryngii were carried out under controlled conditions using sterile medium composed of barley seeds. The influence of alkali and alkaline earth element salts (CsCl, KCl, NaCl, RbCl, and CaCl{sub 2}) and tetraethylammonium chloride on incorporation of cesium, potassium, sodium, rubidium and calcium, and their distribution within fruitbodies, was examined. The results show that incorporation of cesium into fruitbodies was not suppressed by Na{sup +} and Rb{sup +} or tetraethylammonium chloride. However, it was inhibited by Ca{sup 2+} and stimulated by high concentrations of K{sup +}. The inhibition of cesium incorporation by Ca{sup 2+}, lack of influence of tetraethylammonium chloride and stimulation by high K{sup +} concentrations suggest that there may exist two pathways of passive transport of cesium in mycelium: (i) uptake mediated by a non-specific potassium channel localised in plasmalemma (similar to voltage-insensitive cation channel, VICC) followed by diffusive transport inside hyphae and (ii) extracellular transport from the medium through inter-hyphal cavities into fruitbodies. The results highlight distinctiveness of mechanisms responsible for the uptake and incorporation of cesium in mushrooms and plants.
Extension of the shelf-life of fresh oyster mushrooms ( Pleurotus ...
African Journals Online (AJOL)
The objective of this study was to improve the preservation of fresh oyster mushrooms by modified atmosphere packaging (MAP) and chemical treatments. The MAP effects and treatments on organoleptic quality, weight loss, cell permeability, texture changes and polyphenol oxidase (PPO) activity were studied. In addition ...
Correlation between the pattern volatiles and the overall aroma of wild edible mushrooms.
de Pinho, P Guedes; Ribeiro, Bárbara; Gonçalves, Rui F; Baptista, Paula; Valentão, Patrícia; Seabra, Rosa M; Andrade, Paula B
2008-03-12
Volatile and semivolatile components of 11 wild edible mushrooms, Suillus bellini, Suillus luteus, Suillus granulatus, Tricholomopsis rutilans, Hygrophorus agathosmus, Amanita rubescens, Russula cyanoxantha, Boletus edulis, Tricholoma equestre, Fistulina hepatica, and Cantharellus cibarius, were determined by headspace solid-phase microextraction (HS-SPME) and by liquid extraction combined with gas chromatography-mass spectrometry (GC-MS). Fifty volatiles and nonvolatiles components were formally identified and 13 others were tentatively identified. Using sensorial analysis, the descriptors "mushroomlike", "farm-feed", "floral", "honeylike", "hay-herb", and "nutty" were obtained. A correlation between sensory descriptors and volatiles was observed by applying multivariate analysis (principal component analysis and agglomerative hierarchic cluster analysis) to the sensorial and chemical data. The studied edible mushrooms can be divided in three groups. One of them is rich in C8 derivatives, such as 3-octanol, 1-octen-3-ol, trans-2-octen-1-ol, 3-octanone, and 1-octen-3-one; another one is rich in terpenic volatile compounds; and the last one is rich in methional. The presence and contents of these compounds give a considerable contribution to the sensory characteristics of the analyzed species.
Antioxidant capacity and polyphenolic content of dried wild edible mushrooms from Poland.
Radzki, Wojciech; Sławińska, Aneta; Jabłońska-Ryś, Ewa; Gustaw, Waldemar
2014-01-01
In this study 6 species of wild edible mushrooms were evaluated in terms of their total phenolic content and antioxidant activity using 1,1-diphenyl-2-picrylhydrazyl radical and ferric reducing antioxidant power assay methods. The mushrooms, namely Armillaria mellea, Cantharellus cibarius, Lactarius deliciosus, Leccinum aurantiacum, Suillus luteus, and Boletus badius, were dried using both freeze drying and convection drying at 50°C. The amounts of phenolic compounds varied from 3.0 ± 0.1 to 12.8 ± 0.4 mg gallic acid equivalents/g dry weight (for water extracts) and from 2.4 ± 0.1 to 11 ± 0.5 mg gallic acid equivalents/g dry weight (for ethanolic extracts). The species that presented the highest antioxidant potential were B. badius and S. luteus. The impact of hot-air drying on the antioxidant activity of water and ethanolic extracts was evaluated. We demonstrated that hot-air drying may have either a negative or positive influence on phenolics and antioxidant activity, depending on the mushroom species. However, a negative effect was more frequent.
Comparative study on free amino acid composition of wild edible mushroom species.
Ribeiro, Bárbara; Andrade, Paula B; Silva, Branca M; Baptista, Paula; Seabra, Rosa M; Valentão, Patrícia
2008-11-26
A comparative study on the amino acid composition of 11 wild edible mushroom species (Suillus bellini, Suillus luteus, Suillus granulatus, Tricholomopsis rutilans, Hygrophorus agathosmus, Amanita rubescens, Russula cyanoxantha, Boletus edulis, Tricholoma equestre, Fistulina hepatica, and Cantharellus cibarius) was developed. To define the qualitative and quantitative profiles, a derivatization procedure with dabsyl chloride was performed, followed by HPLC-UV-vis analysis. Twenty free amino acids (aspartic acid, glutamic acid, asparagine, glutamine, serine, threonine, glycine, alanine, valine, proline, arginine, isoleucine, leucine, tryptophan, phenylalanine, cysteine, ornithine, lysine, histidine, and tyrosine) were determined. B. edulis and T. equestre were revealed to be the most nutritional species, whereas F. hepatica was the poorest. The different species exhibited distinct free amino acid profiles. The quantification of the identified compounds indicated that, in a general way, alanine was the major amino acid. The results show that the analyzed mushroom species possess moderate amino acid contents, which may be relevant from a nutritional point of view because these compounds are indispensable for human health. A combination of different mushroom species in the diet would offer good amounts of amino acids and a great diversity of palatable sensations.
Directory of Open Access Journals (Sweden)
Daniela Elena ZAVASTIN
2016-12-01
Full Text Available The study evaluated the antioxidant, antihyperglycemic and antimicrobial effects of both ethanolic and hydromethanolic extracts of the fruiting bodies of wild edible mushrooms Boletus edulis (penny bun and Cantharellus cibarius (golden chanterelle sampled in Poiana Stampei (Suceava county, Romania. The total phenolic contents of extracts were also determined. Boletus edulis hydromethanolic extract showed the highest total phenolic content (72.78±0.29 mg/g. This extract was also the most active as scavenger of DPPH and ABTS radicals (EC50=151.44±0.85 and 65.4±0.4 µg/mL, respectively and reducing agent (EC50=46.77±0.34 µg/mL. Cantharellus cibarius ethanolic extract showed high ferrous ion chelating (EC50=82.9±0.6 µg/mL, 15-lipoxygenase (EC50=236.7±1.5 µg/mL and α-glucosidase (EC50=9.77±0.06 μg/mL inhibitory activities. For both mushrooms, the ethanolic extracts were more active against Staphylococcus aureus ATCC 25923 than the hydromethanolic ones. The antioxidant and antihyperglycemic effects revealed in this study support further investigations for a possible valorization of both mushrooms in the dietary supplement and pharmaceutical industries.
A Proinflammatory Effect of the β-Glucan from Pleurotus cornucopiae Mushroom on Macrophage Action
Directory of Open Access Journals (Sweden)
Ken-ichiro Minato
2017-01-01
Full Text Available PCPS from P. citrinopileatus mushroom extract is a β-1,6-glucan possessing a proinflammatory effect on innate immune cells. The PCPS stimulated THP-1 macrophages to secrete significant levels of TNF. Moreover, the mRNA expressions of TNF and IL-1β were significantly enhanced by PCPS treatment. However, the PCPS did not induce to express both IL-12 and IL-10 mRNA in the macrophages. Next, the P. cornucopiae extract (containing mainly PCPS treatment against mice showed significant increases in TNF and IL-1β mRNA expressions in the peritoneal macrophages of them. In this study, the expression levels of IFNγ mRNA in the spleen were almost the same between the extract- (PCPS- treated group and control group. However, the expression of IL-4 mRNA showed a lower level in the extract-treated group than that in the control. Our results suggested that the PCPS could induce proinflammatory action in the immune response. In addition, the proinflammatory effect of the PCPS on THP-1 was enhanced by 5′-GMP-Na, while it was reduced by vitamin D2. These two compounds are majorly contained in the P. citrinopileatus mushroom. Therefore, these results suggested that the P. citrinopileatus mushroom might contain other immune regulative compounds, such as vitamin D2, as well as PCPS.
Directory of Open Access Journals (Sweden)
Mehmet Akyüz
2007-04-01
Full Text Available P. eryngii var. ferulae which is known very well in Eastern Anatolia Region and picked up from the nature in spring months is sold by the side of the roads and in neighbour markets with the name of ‘’ çaşır, çakşır, çaşur, heliz, kırkor, göbek, göbelek and mendik’’ mushroom. As a member of Apiaceae family; Ferulae sp. that preads at the slope of the mountains, grows up naturally on the roots of its species that remained from the previous year especially at the altitude of 1000-2500 meters on high mountains. It is known that local people has benefited from the natural products special to periodic times. It is seen that it is not benefited from alternative natural nourishment resources like cultuıre vegetables and fruit with their important features and effective nutritive value. In our opinion, this article will be useful for mentioning the importance of the mushroom beside the vegetables and fruits which are vital for our life. It will be useful to expose the medical features, nourishment content and effective nutritive valu and effective nutritious features of mushroom. Furthermore, It is determined that it is necessary to describe P. eryngii and its similarities with the identification of scientific facts as species, subspecies, variety, taxa or synonym in our country.
Cadmium determination in Lentinus edodes mushroom species
Directory of Open Access Journals (Sweden)
Vera Akiko Maihara
2012-09-01
Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.
Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh
Directory of Open Access Journals (Sweden)
Mostak Ahmed
2013-02-01
Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.
Directory of Open Access Journals (Sweden)
Pablo de Frutos
2016-11-01
Full Text Available Public demand for harvesting wild edible mushrooms has risen in recent decades and currently affects many forested areas around the world. The idea of introducing permits for users has been conceived as a tool for ecosystem management. The problem is that policy-makers lack the necessary means to help guide them when establishing prices for such harvesting permits. Valuing the recreational benefits which mushroom harvesters derive from harvesting wild edible mushrooms may provide certain guidelines as to how much people would be willing to pay and may also justify future payments levied on harvesters. The aim of the present article is to estimate a model for determining citizens’ willingness to pay for a harvesting permit in a forest in Andalusia (Spain using contingent valuation methods. Results show that mean willingness to pay is 22.61 Euros (USD28.18 per harvester and season. This amount depends on several socioeconomic factors and preferences related to harvesters’ experiences.
Shi, Min; Yang, Yingnan; Li, Yiting; Wang, Yuepeng; Zhang, Zhenya
2011-01-01
A novel approach by utilizing soybean curd residue, to produce polysaccharide from the edible mushroom Pleurotus ostreatus in solid-state culture, was developed. Firstly, the significant effect of fermented conditions on P. ostreatus polysaccharide production were screened out to be inoculum size, moisture content and C/N ratio by using a single factor experiment. Secondly, the three factors were optimized using central composite design in response surface methodology. As results, a quadratic...
Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do
2017-02-01
Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.
[Effect of substrate of edible mushroom on continuously cropping obstacle of Rehmannia glutinosa].
Ru, Rui-Hong; Li, Xuan-Zhen; Hunag, Xiao-Shu; Gao, Feng; Wang, Jian-Ming; Li, Ben-Yin; Zhang, Zhong-Yi
2014-08-01
The continuous cultivation of Rehmannia glutinosa causes the accumulation of phenolic acids in soil. It is supposed to be the reason of the so called "continuously cropping obstacle". In this study, phenolic acids (hydroxybenzoic acid, vanillic acid, eugenol, vanillin and ferulic acid) were degraded by the extracta of all the tested spent mushroom substrate (SMS) and the maximal degradation rate was 75.3%, contributed by extraction of SMS of Pleurotus eryngii. Pot experiment indicated that hydroxybenzoic acid and vanillin in soil were also degraded effectively by SMS of P. eryngii. The employment of SMS enhanced ecophysiology index to near the normal levels, such as crown width, leaves number, leaf length, leaf width and height. At the same time, the fresh and dry weight and total catalpol concentration of tuberous root weight of R. glutinosa was increased to 2.70, 3.66, 2.25 times by employment of SMS, respectively. The increase of bacteria, fungi and actinomycetes numbers in rhizosphere soil were observed after the employment of SMS by microbial counts. The employment of SMS also enhanced the enzyme activity in soils, such as sucrase, cellulase, phosphalase, urease and catelase. These results indicated that the employment of SMS alleviated the continuously cropping obstacle of R. glutinosa in some extent.
Chen, Shih-Yu; Ho, Kung-Jui; Liang, Chih-Hung; Tsai, Ching-Hsuan; Huang, Ling-Yi; Mau, Jeng-Leun
2012-01-01
Pleurotus eryngii (DC. : Fr.) Ouel. was used in solid-state fermentation to develop novel mushroom products with a high amount of ergothioneine. The correlation coefficients between ergothioneine content and biomass were 0.8878 and 0.9206 for fermented adlay and buckwheat, respectively. Using optimal conditions, Pleurotus-fermented adlay and buckwheat (PFA and PFB) with the ergothioneine contents of 795.5 and 786.1 mg/ kg, respectively, were prepared. However, mycelia contained the highest ergothioneine content of 1514.6 mg/kg. As a result of SSF by P. eryngii, PFA and PFB contained more taste components than adlay and buckwheat, as evidenced by higher contents of total sugars and polyols, total free amino acids and monosodium glutamate-like components, and total and flavor 5'-nucleotides. In addition, PFB and buckwheat showed comparable equivalent umami concentration (EUC) values, whereas PFA showed a higher EUC value than adlay. Overall, Pleurotus-fermented products with a high amount of ergothioneine will be a novel functional food.
Neuronal health - can culinary and medicinal mushrooms help?
Sabaratnam, Vikineswary; Kah-Hui, Wong; Naidu, Murali; Rosie David, Pamela
2013-01-01
Hericium erinaceus a culinary and medicinal mushroom is a well established candidate for brain and nerve health. Ganoderma lucidum, Grifola frondosa and Sarcodon scabrosus have been reported to have neurite outgrowth and neuronal health benefits. The number of mushrooms, however, studied for neurohealth activity are few compared to the more than 2 000 species of edible and / or medicinal mushrooms identified. In the on-going search for other potent culinary and / or medicinal mushrooms, indigenous mushrooms used in traditional medicines such as Lignosus rhinocerotis and Ganoderma neo-japonicum are also being investigated. Further, the edible mushroom, Pleurotus giganteus can be a potential candidate, too. Can these edible and medicinal mushrooms be tapped to tackle the health concerns of the aging population which is projected to be more than 80-90 million of people age 65 and above in 2050 who may be affected by age-related neurodegenerative disorders. Scientific validation is needed if these mushrooms are to be considered and this can be achieved by understanding the molecular and biochemical mechanisms involved in the stimulation of neurite outgrowth. Though it is difficult to extrapolate the in vitro studies to what may happen in the human brain, studies have shown that there can be improvement in cognitive abilities of the aged if the mushroom is incorporated in their daily diets.
Neuronal Health – Can Culinary and Medicinal Mushrooms Help?
Sabaratnam, Vikineswary; Kah-Hui, Wong; Naidu, Murali; Rosie David, Pamela
2013-01-01
Hericium erinaceus a culinary and medicinal mushroom is a well established candidate for brain and nerve health. Ganoderma lucidum, Grifola frondosa and Sarcodon scabrosus have been reported to have neurite outgrowth and neuronal health benefits. The number of mushrooms, however, studied for neurohealth activity are few compared to the more than 2 000 species of edible and / or medicinal mushrooms identified. In the on-going search for other potent culinary and / or medicinal mushrooms, indigenous mushrooms used in traditional medicines such as Lignosus rhinocerotis and Ganoderma neo-japonicum are also being investigated. Further, the edible mushroom, Pleurotus giganteus can be a potential candidate, too. Can these edible and medicinal mushrooms be tapped to tackle the health concerns of the aging population which is projected to be more than 80-90 million of people age 65 and above in 2050 who may be affected by age-related neurodegenerative disorders. Scientific validation is needed if these mushrooms are to be considered and this can be achieved by understanding the molecular and biochemical mechanisms involved in the stimulation of neurite outgrowth. Though it is difficult to extrapolate the in vitro studies to what may happen in the human brain, studies have shown that there can be improvement in cognitive abilities of the aged if the mushroom is incorporated in their daily diets. PMID:24716157
Neuronal Health – Can Culinary and Medicinal Mushrooms Help?
Directory of Open Access Journals (Sweden)
Vikineswary Sabaratnam
2013-01-01
Full Text Available Hericium erinaceus a culinary and medicinal mushroom is a well established candidate for brain and nerve health. Ganoderma lucidum, Grifola frondosa and Sarcodon scabrosus have been reported to have neurite outgrowth and neuronal health benefits. The number of mushrooms, however, studied for neurohealth activity are few compared to the more than 2 000 species of edible and / or medicinal mushrooms identified. In the on-going search for other potent culinary and / or medicinal mushrooms, indigenous mushrooms used in traditional medicines such as Lignosus rhinocerotis and Ganoderma neo-japonicum are also being investigated. Further, the edible mushroom, Pleurotus giganteus can be a potential candidate, too. Can these edible and medicinal mushrooms be tapped to tackle the health concerns of the aging population which is projected to be more than 80-90 million of people age 65 and above in 2050 who may be affected by age-related neurodegenerative disorders. Scientific validation is needed if these mushrooms are to be considered and this can be achieved by understanding the molecular and biochemical mechanisms involved in the stimulation of neurite outgrowth. Though it is difficult to extrapolate the in vitro studies to what may happen in the human brain, studies have shown that there can be improvement in cognitive abilities of the aged if the mushroom is incorporated in their daily diets.
Directory of Open Access Journals (Sweden)
Eustáquio Souza Dias
2003-12-01
Full Text Available Diferentes resíduos agrícolas disponíveis na região sul de Minas Gerais foram testados para o cultivo do cogumelo Pleurotus sajor-caju. Foram avaliados os seguintes substratos: palha de feijão pura (PFP, palha de milho pura (PMP, casca de café pura (CCP, palha de feijão enriquecida com 2% de calcário, 2% de gesso e 10% de farelo de trigo (PFE, palha de milho enriquecida (PME e casca de café enriquecida (CCE. Todos os substratos receberam 2% de inoculante e foram incubados a 24°C. Após a colonização, os sacos foram mantidos abertos em ambiente a 24°C e umidade a 80%. PFP, PFE e PME apresentaram os melhores resultados na produção de cogumelos, com uma eficiência biológica de 85,7; 81,4 e 83,4%, respectivamente. A palha de feijão foi considerada o melhor resíduo para a produção do cogumelo P. sajor-caju, porque apresentou a melhor eficiência biológica sem necessidade de enriquecimento.Several agricultural residues available in the South of Minas Gerais were tested for cultivation of the mushroom Pleurotus sajor-caju. The following substrates were investigated: Bean (BS, Corn (CS straws and Coffee husk (CH without nutrient supplementation and straws of bean (BSS, corn (CSS and coffee husk (CHS supplemented with 2% of CaCO3, 2% of gypsum and 10% of wheat flour. All the substrates were inoculated with 2% of spawn and incubated at 24ºC. After the fungi had colonized the substrate, the plastic bags were open and maintained at room temperature with 80% of humidity. BS, BSS and CSS showed higher mushroom production than the others, showing a biological efficiency of 85.7, 81.4 and 83.6% respectively. The beans straw (BS without nutrient supplementation was considered the best residue for the growth and cultivation of the mushroom Pleurotus sajor-caju. This substrate showed higher levels of biological efficiency than the others substrates analysed.
Ribeiro, Barbara; Rangel, Joana; Valentão, Patrícia; Baptista, Paula; Seabra, Rosa M; Andrade, Paula B
2006-11-01
The organic acids and phenolics compositions of nine wild edible mushrooms species (Suillus bellini, Tricholomopsis rutilans, Hygrophorus agathosmus, Amanita rubescens, Russula cyanoxantha, Boletus edulis, Tricholoma equestre, Suillus luteus, and Suillus granulatus) were determined by HPLC-UV and HPLC-DAD, respectively. The antioxidant potential of these species was also assessed by using the DPPH* scavenging assay. The results showed that all of the species presented a profile composed of at least five organic acids: oxalic, citric, malic, quinic, and fumaric acids. In a general way, the pair of malic plus quinic acids were the major compounds. Only very small amounts of two phenolic compounds were found in some of the analyzed species: p-hydroxybenzoic acid (in A. rubescens, R. cyanoxantha, and T. equestre) and quercetin (in S. luteus and S. granulatus). All of the species exhibited a concentration-dependent scavenging ability against DPPH*. T. rutilans revealed the highest antioxidant capacity.
Efficient CRISPR-Cas9 Gene Disruption System in Edible-Medicinal Mushroom Cordyceps militaris
Directory of Open Access Journals (Sweden)
Bai-Xiong Chen
2018-06-01
Full Text Available Cordyceps militaris is a well-known edible medicinal mushroom in East Asia that contains abundant and diverse bioactive compounds. Since traditional genome editing systems in C. militaris were inefficient and complicated, here, we show that the codon-optimized cas9, which was used with the newly reported promoter Pcmlsm3 and terminator Tcmura3, was expressed. Furthermore, with the help of the negative selection marker ura3, a CRISPR-Cas9 system that included the Cas9 DNA endonuclease, RNA presynthesized in vitro and a single-strand DNA template efficiently generated site-specific deletion and insertion. This is the first report of a CRISPR-Cas9 system in C. militaris, and it could accelerate the genome reconstruction of C. militaris to meet the need for rapid development in the fungi industry.
Shameem, Nowsheen; Kamili, Azra N; Ahmad, Mushtaq; Masoodi, F A; Parray, Javid A
2017-04-01
The antimicrobial properties of morel compounds from wild edible mushrooms (Morchella esculenta and Verpa bohemica) from Kashmir valley was investigated against different clinical pathogens. The butanol crude fraction of most popular or true morel M. esculenta showed highest 19 mm IZD against E.coli while as same fraction of Verpa bohemica exhibited 15 mm IZD against same strain. The ethyl acetate and butanol crude fractions of both morels also exhibited good antifungal activity with highest IZD shown against A. fumigates. The three morel compounds showed quite impressive anti bacterial and fungal activities. The Cpd 3 showed highest inhibitory activity almost equivalent to the synthetic antibiotics used as control. The MIC/MBC values revealed the efficiency of isolated compounds against the pathogenic strains. In the current study significant inhibitory activity of morel compounds have been obtained paying the way for their local use from ancient times. Copyright © 2017. Published by Elsevier Ltd.
Zhang, Jin jing; Shi, Liang; Chen, Hui; Sun, Yun qi; Zhao, Ming wen; Ren, Ang; Chen, Ming jie; Wang, Hong; Feng, Zhi yong
2014-01-01
Hypsizygus marmoreus is one of the major edible mushrooms in East Asia. As no efficient transformation method, the molecular and genetics studies were hindered. The glyceraldehyde-3-phosphate dehydrogenase (GPD) gene of H. marmoreus was isolated and its promoter was used to drive the hygromycin B phosphotransferase (HPH) and enhanced green fluorescent protein (EGFP) in H. marmoreus. Agrobacterium tumefaciens-mediated transformation (ATMT) was successfully applied in H. marmoreus. The transformation parameters were optimized, and it was found that co-cultivation of bacteria with protoplast at a ratio of 1000:1 at a temperature of 26 °C in medium containing 0.3 mM acetosyringone resulted in the highest transformation efficiency for Agrobacterium strain. Besides, three plasmids, each carrying a different promoter (from H. marmoreus, Ganoderma lucidum and Lentinula edodes) driving the expression of an antibiotic resistance marker, were also tested. The construct carrying the H. marmoreus gpd promoter produced more transformants than other constructs. Our analysis showed that over 85% of the transformants tested remained mitotically stable even after five successive rounds of subculturing. Putative transformants were analyzed for the presence of hph gene by PCR and Southern blot. Meanwhile, the expression of EGFP in H. marmoreus transformants was detected by fluorescence imaging. This ATMT system increases the transformation efficiency of H. marmoreus and may represent a useful tool for molecular genetic studies in this mushroom species. Copyright © 2014 Elsevier GmbH. All rights reserved.
Elena Fernández-Fueyo; Francisco J Ruiz-Dueñas; María Jesús Martinez; Antonio Romero; Kenneth E Hammel; Francisco Javier Medrano; Angel T. Martínez
2014-01-01
Background: The genome of Pleurotus ostreatus, an important edible mushroom and a model ligninolytic organism of interest in lignocellulose biorefineries due to its ability to delignify agricultural wastes, was sequenced with the purpose of identifying and characterizing the enzymes responsible for lignin degradation. ...
Analysis of several heavy metals in wild edible mushrooms from regions of China.
Chen, Xin-Hua; Zhou, Hong-Bo; Qiu, Guan-Zhou
2009-08-01
The metal (Cu, Ni, Cd, Hg, As, Pb) contents in wild edible mushrooms collected from three different sites in China were determined by atomic absorption spectrometry and atomic fluorescence spectrometry. All element concentrations were determined on a dry weight basis. A total of 11 species was studied, five being from the urban area and six from rural areas in China. The As content ranged from 0.44 to 1.48 mg/kg. The highest As content was seen in Macrolepiota crustosa from the urban area, and the lowest in Russula virescens from rural areas. A high Ni concentration (1.35 mg/kg) was found in Calvatia craniiformis from the urban area. The lowest Ni level was 0.11 mg/kg, for the species R. virescens and Cantharellus cibarius. The Cu content ranged from 39.0 to 181.5 mg/kg. The highest Cu content was seen in Agaricus silvaticus and the lowest in C. cibarius. The Pb content ranged from 1.9 to 10.8 mg/kg. The highest Pb value was found in C. craniiformis. The Cd content ranged from 0.4 to 91.8 mg/kg. The highest Cd value was found in M. crustosa. The Hg content ranged from 0.28 to 3.92 mg/kg. The highest Hg level was found in Agaricus species. The levels of the heavy metals Cd, Pb, and Hg in the studied mushroom species from urban area can be considered high. The metal-to-metal correlation analysis supported they were the same source of contamination. High automobile traffic was identified as the most likely source of the contamination. Based upon the present safety standards, consumption of those mushrooms that grow in the polluted urban area should be avoided.
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Assessment of Genetic Diversity among Pleurotus spp. Isolates from Jordan
Directory of Open Access Journals (Sweden)
Hanan Aref Hasan
2018-04-01
Full Text Available Pleurotus is considered an important genus that belongs to the family Pleurotaceae and includes the edible King Oyster mushroom (Pleurotus eryngii. In the present study, 19 Pleurotus isolates were collected from two locations in the north of Jordan (Tell ar-Rumman and Um-Qais. The morphological characteristics among collected isolates revealed that there was a morphological similarity among the collected isolates. Nucleotide sequence analysis of the internal transcribed spacer (ITS1–5.8S rDNA–ITS4 region and 28S nuclear large subunit (nLSU in the ribosomal DNA gene of the isolated stains showed that all of them share over 98% sequence similarity with P. eryngii. Genetic diversity among the collected strains was assessed using inter simple sequence repeat (ISSR analysis using 18 different primer pairs. Using this approach, 141 out of 196 bands obtained were considered polymorphic and the highest percentage of polymorphism was observed using primer UBC827 (92.3% with an overall Polymorphism Information Content (PIC value of 70.56%. Cluster analysis showed that the Jordanian Pleurotus isolates fall into two main clades with a coefficient of similarity values ranging from 0.59 to 0.74 with a clear clustering based on collection sites. The results of the present study reveal that molecular techniques of ISSR and rDNA sequencing can greatly aid in classification and identification of Pleurotus spp. in Jordan.
Directory of Open Access Journals (Sweden)
Cristina Ramos
2011-01-01
Full Text Available A utilização de substratos vegetais à base de palha tem vindo a assumir uma importância crescente na cultura de cogumelos sapróbios, principalmente do género Pleurotus. Estes cogumelos são considerados muito interessantes do ponto de vista comercial, não só pelas suas características organolépticas e nutricionais, mas também pela sua fácil adaptação e manutenção, crescimento rápido e relativo baixo custo de cultura. No entanto, por se tratar de alimentos perecíveis, devido sobretudo à sua composição e elevada taxa respiratória, podem apresentar reduzido valor comercial, caso a conservação não seja efectuada nas melhores condições. No sentido de minimizar estas alterações, os cogumelos frescos devem ser submetidos a um processamento mínimo com utilização combinada de embalagem em atmosfera modificada, de forma a manter a qualidade e estabilidade no período de conservação. Neste trabalho foram efectuados ensaios de produção de três espécies do género Pleurotus, cultivadas em palha de trigo, com a finalidade de determinar a espécie mais produtiva e avaliar a qualidade dos mesmos durante a conservação quando processados e embalados em atmosfera modificada. Os resultados permitem concluir que a espécie mais produtiva foi a P. ostreatus, seguida da P. sajor-caju e P. eryngii, tendo sido a P. eryngii a que mostrou maior resistência à degradação no período de conservação estabelecido.The use of substrates straw has been increasing importance in mushroom saprophytic species grown, especially of Pleurotus genus. They are considered very interesting from the commercial point of view, not only for its nutritional and organoleptic characteristics, but also for its easy adaptation, rapid growth and relatively low culture cost. Mushrooms have a short shelf life when compared to most vegetables at ambient temperatures mainly due to its composition and high respiration rate. After yield and to reduce losses and
Directory of Open Access Journals (Sweden)
Clenderson Corradi de Mattos Gonçalves
2010-02-01
Full Text Available O resíduo proveniente do beneficiamento do algodão em lixadeiras na indústria têxtil é um material rico em lignocelulose, tem baixa digestibilidade e é pobre em proteínas e minerais, o que dificulta seu uso 'in natura' na alimentação de ruminantes. Neste tarbalho, objetivou-se avaliar a produtividade e eficiência biológica deste resíduo de algodão na produção do cogumelo comestível Pleurotus sajor-caju e avaliar as alterações promovidas no resíduo para alimentação de ruminantes. Foram realizados 5 tratamentos: T1- 80% de serragem de eucalipto + 20% de farelo de trigo (testemunha; T2- 50% de resíduo de algodão + 50% de serragem; T3- 45% de resíduo + 45% serragem + 10% de farelo; T4- 40% de resíduo + 40% serragem + 20% de farelo e T5- 80% de resíduo + 20% de farelo. O T5 apresentou os melhores resultados para produtividade (22,46% e eficiência biológica (71,48% do Pleurotus sajor-caju. O fungo alterou a constituição dos substratos nos estágios de produção do cogumelo, principalmente os constituintes da fibra e agregou N ao substrato. Dessa forma, o uso do resíduo de lixadeira de algodão no cultivo de Pleurotus sajor-caju pode se tornar uma alternativa viável para produção de cogumelo e melhorar a qualidade deste resíduo para alimentação animal.The waste coming from cotton processing in mills in the textile industry is a lignocellulose-rich material, but has low digestibility, and is poor in proteins and minerals, making it inappropriate for ruminant feeding. This study was intended to evaluate the productivity and biologic efficiency of cotton textile mill waste in the production of the edible mushroom Pleurotus sajor-caju, and to evaluate the alterations brought about in the waste for use in ruminant feeding. Five treatments were undertaken in the following manner: T1- 80% eucalyptus sawdust + 20% wheat bran (control; T2- 50% waste + 50% sawdust; T3- 45% waste + 45% sawdust + 10% wheat bran; T4- 40% waste
Brugnari, Tatiane; da Silva, Pedro Henrique Alves; Contato, Alex Graça; Inácio, Fabíola Dorneles; Nolli, Mariene Marques; Kato, Camila Gabriel; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques
2018-01-01
In this study we evaluated the antioxidant capacity, antimicrobial activity, and cytotoxicity of an aqueous extract of the Pleurotus ostreatoroseus mushroom, which was cooked. Fresh basidiocarps were heated and steamed at 100°C and the resulting aqueous extract was assessed before and after in vitro digestion. Cooking reduced the amounts of phenolic compounds in the extract. The antioxidant activity of the extract was evaluated through the use of 4 methods. The lowest half-maximal effective concentration (EC50) against ABTS radicals was 0.057 ± 0.002 mg/mL for the uncooked basidiocarp extract. Cooking and the digestive process led to decreased activity (P > 0.05) against ABTS and DPPH radicals. A significant increase in chelating activity (P > 0.05) occurred after the basidiocarps were cooked (EC50 = 0.279 ± 0.007 mg/mL). The reducing power did not significantly change among the different extracts. The uncooked basidiocarp extract was cytotoxic to Vero cells. After cooking and subsequent in vitro digestion, the cytotoxicity of the extracts decreased (P < 0.05). Bacillus subtilis, Staphylococcus aureus, and Candida albicans were sensitive to the fresh mushroom extract. The data showed that after being cooked and digested, the P. ostreatoroseus mushroom maintains antioxidant activity and has a low cytotoxic effect.
Ko, Han Gyu; Park, Hyuk Gu; Park, Sang Ho; Choi, Chang Won; Kim, Seong Hwan; Park, Won Mok
2005-09-01
The potential of using several agricultural by-products as supplements of sawdust substrate for the production of edible mushroom Hericium was evaluated using seven Hericium species. All the tested supplements (rice bran, wheat bran, barley bran, Chinese cabbage, egg shell, and soybean powder) were found to be suitable for the mycelial growth of all the tested species. In mycelial growth, soybean powder was the best supplement for Hericium americanum, Hericium coralloides, and Hericium erinaceum while barley bran was the best for Hericium alpestre, Hericium laciniatum, and Hericium erinaceus. For Hericium abietis, rice bran and Chinese cabbage was the best. The possibility of mushroom production on oak sawdust substrate with 20% rice bran supplement was demonstrated with H. coralloides, H. americanum, H. erinaceus, and H. erinaceum which showed 26-70% biological efficiency. Our results also showed that strain selection is important to improve biological efficiency and mushroom yield in Hericium cultivation.
Determination of mineral contents of wild Boletus edulis mushroom and its edible safety assessment.
Su, Jiuyan; Zhang, Ji; Li, Jieqing; Li, Tao; Liu, Honggao; Wang, Yuanzhong
2018-04-06
This study aimed to determine the contents of main mineral elements of wild Boletus edulis and to assess its edible safety, which may provide scientific evidence for the utilization of this species. Fourteen mineral contents (Ba, Ca, Cd, Co, Cr, Cu, Fe, Mg, Mn, Na, Ni, Sr, V and Zn) in the caps and stipes of B. edulis as well as the corresponding surface soils collected from nine different geographic regions in Yunnan Province, southwest China were determined. The analyses were performed using inductively coupled plasma atomic emission spectrometer (ICP-AES) after microwave digestion. Measurement data were analyzed using variance and Pearson correlation analysis. Edible safety was evaluated according to the provisionally tolerable weekly intake (PTWI) of heavy metals recommended by United Nations Food and Agriculture Organization and World Health Organization (FAO/WHO). Mineral contents were significantly different with the variance of collection areas. B. edulis showed relative abundant contents of Ca, Fe, Mg and Na, followed by Ba, Cr, Cu, Mn and Zn, and the elements with the lower content less were Cd, Co, Ni, Sr and V. The elements accumulation differed significantly in caps and stipes. Among them, Cd and Zn were bioconcentrated (BCF > 1) while others were bioexcluded (BCF < 1). The mineral contents in B. edulis and its surface soil were positively related, indicating that the elements accumulation level was related to soil background. In addition, from the perspective of food safety, if an adult (60 kg) eats 300 g fresh B. edulis per week, the intake of Cd in most of tested mushrooms were lower than PTWI value whereas the Cd intakes in some other samples were higher than this standard. The results indicated that the main mineral contents in B. edulis were significantly different with respect to geographical distribution, and the Cd intake in a few of regions was higher than the acceptable intakes with a potential risk.
Mating system of five edible species of the mushroom, genus Lentinus
Directory of Open Access Journals (Sweden)
Dhitaphichit, P.
2006-03-01
Full Text Available The aim of this research was to determine the types of mating system of five edible mushrooms in the genus Lentinus, i.e. Lentinus squarrosulus, L. polychrous, L. strigosus, L. giganteus and L. sajor-caju including the well-known edible, medicinal and industrialized species, Lentinula edodes. Lentinus and Lentinula are closely related species. The experiments were carried out by crossing each pair of 12 single spore isolates (SSIs, monokaryons from one single fruiting body of each species in all combinations by placing each pair of the inocula, about 2 cm apart, on a PDA plate at 30oC for 1 week for all species of Lentinus, or on a MEA plate at 25oC for 2-3 weeks for Lentinula edodes, followed by examination of clamp connections on the hyphae at the contact zone. The presence or absence of clamps indicates compatible or incompatible mating, respectively. The ratios of the number of compatible matings to the number of total matings of all the species were determined to be 1:4. This ratio indicated that the sexuality of all the six species is bifactorial (tetrapolar heterothallism. These results indicated to some extent that species belonged to the same or related genus tend to have the same mating type. This is the first report about mating system of Lentinus species except that of Lentinula edodes. The results of the 12 SSIs were also separated into four groups according to their four mating types (i.e. A1B1, A1B2, A2B1 and A2B2.
Identification and characterization of Trichoderma species aggressive to Pleurotus in Italy
Institute of Scientific and Technical Information of China (English)
Woo S L; Di Benedetto P; Senatore M; Abadi K; Gigante S; Soriente I; Ferraioli S; Scala F; Lorito M
2004-01-01
@@ In the late 1980's the development of a severe epidemic of green mold caused by Trichoderma spp.was noted in the commercial production of Agaricus bisporus (champignon) in the United Kingdom,North America, Spain and Holland, which caused extensive economic losses. The parasitic fungi isolated from the edible mushroom belonged to four biotypes, Thl, Th2, Th3 and Th4 of T.harzianum. However, among these biotypes, only Th2 (since classified as T. aggressivum f.europaeum) and Th4 (T. aggressivum f. aggressivum) were identified as the fungi causing problems in Agaricus production. In general, mushroom compost hosts both aggressive and innocuous isolates of Trichoderma, which are not morphologically distinguishable. About four years ago, a problem with green mold became apparent in the production of Pleurotus ostreatus in Northern Italy,which eventually developed to a crisis situation in the South two years later and threatened to seriously compromise the Pleurotus market. This study was initiated to: isolate and identify the aggressive fungi, then morphologically, physiologically and genetically characterize the isolates, determine the source and phases of infection, and study methods of control. Samples were obtained from different phases of compost preparation at the locality of a major producer and supplier of compost to the mushroom industry in Southern Italy, and microbial counts were conducted. Although the presence of Trichoderma was detected in the initial stages of composting, this value was reduced to zero from the phase of pasteurization to seeding with Pleurotus. Trichoderma infestations were noted in the packaged Pleurotus bales at various times during the incubation phase (7-15 days after seeding) and after shipping to the mushroom greenhouses, where the pathogen infestations greatly reduced the quality and quantity of the mushroom yield, as well as the number of potential harvest cycles.Preliminary results from the morphological and genetic
Sriramulu, Mohana; Sumathi, Shanmugam
2017-12-01
Mushroom has been part of the human diet for thousands of years, and in recent times, the amounts consumed have risen greatly, involving a large number of species. Mushrooms used for nutritional and therapeutic purposes. In this study silver nanoparticles were synthesised using an edible mushroom (Agaricus bisporus) and forest mushroom (Ganoderma lucidum) extract. The synthesised nanoparticles were characterised by UV-vis spectroscopy, FTIR, powder XRD and SEM. Silver nanoparticles were synthesised at room temperature and at 60 °C. FTIR results recognised the presence of bioactive functional groups responsible for the reduction of silver nitrate to silver nanoparticles. From the XRD, it was observed that the nanoparticles are silver with an average size of 10-80 nm. The silver nanoparticles are explored for photocatalytic activity and biological activities such as in vitro antioxidant activity, anti-inflammatory activity and antimicrobial activity against Escherichia coli and Staphylococcus aureus organisms. 98% of textile dye (direct blue 71) degradation was noticed under UV light within 150 min for forest mushroom synthesised silver nanoparticles at room temperature.
Mleczek, Mirosław; Siwulski, Marek; Stuper-Szablewska, Kinga; Sobieralski, Krzysztof; Magdziak, Zuzanna; Goliński, Piotr
2013-01-01
The aim of the study was to compare accumulation efficiency of Al, Ba and nutritional elements (Ca, Fe, K, Mg, Mn, Na) exhibited by six edible mushrooms collected in particular regions of Poland during the last 20 years. The studied mushroom species were Boletus edulis, Cantharellus cibarius, Lactarius deliciosus, Leccinum aurantiacum, Suillus luteus and Xerocomus badius. The highest and the lowest concentrations of the elements in tested mushroom species were 11 - 410, 34 - 337, 16785 - 34600, 140 - 607, 12 - 75 and 16 - 143 mg kg(-1)d.m., respectively. The highest average concentrations of Al, Mg and Mn were observed in Suillus luteus fruiting bodies, while for Ba, Ca, K and Na it was in Lactarius deliciosus. BCF >1 was found for K and Mg in all tested mushroom species and additionally for the highest Ca and Na concentrations of all tested mushroom species except for C. cibarius and S. luteus, respectively. For the other tested elements (Al, Ba, Fe and Mn) BCF values < 1 were recorded.
Directory of Open Access Journals (Sweden)
Július Árvay
2015-02-01
Full Text Available In the present paper, we focused on assessment of the contamination levels of five species (n = 33 of edible wild mushrooms (Macrolepiota procera, Boletus reticulatus, Suillus grevillei, Russula xerampelina and Xerocomellus chrysenteron. We collected samples of above-ground parts of the macroscopic fungi species in historical mining and processing area surrounding Banská Bystrica (Central Slovakia in 2014. Within 2 m radius of the samples, we also took samples of underlying substrate. On the basis of the substrate, along with the monitored contaminant – mercury, we calculated bioaccumulation factors for individual species and their anatomical parts (cap and stipe. From the obtained results of the mercury content in the edible mushrooms, we then determined provisionally tolerable weekly intake (PTWI. The limit value for mercury (0.350 mg Hg kg-1 for an individual with average weight of 70 kg is defined by the World Health Organization (WHO. Our results suggest that despite the relatively low level of Hg in the underlying substrate, the species Macrolepiota procera (1.98 mg kg-1 ± 68.2 (0.41 - 3.20 mg kg-1 DW is characterized by extremely high bioaccumulation ability, as confirmed by the bioaccumulation factors (BAFc = 15.3; BAFs = 8.02. PTWI value was exceeded by almost 20%. In case of the other studied edible wild mushroom species, we did not record any increased risk of mercury intake by consumers. Generally it can be stated that consumption of wild mushrooms represents a relatively small but significant risk of negative impact on the consumer´s health.
Directory of Open Access Journals (Sweden)
Lianfu Chen
Full Text Available Lentinula edodes, one of the most popular, edible mushroom species with a high content of proteins and polysaccharides as well as unique aroma, is widely cultivated in many Asian countries, especially in China, Japan and Korea. As a white rot fungus with lignocellulose degradation ability, L. edodes has the potential for application in the utilization of agriculture straw resources. Here, we report its 41.8-Mb genome, encoding 14,889 predicted genes. Through a phylogenetic analysis with model species of fungi, the evolutionary divergence time of L. edodes and Gymnopus luxurians was estimated to be 39 MYA. The carbohydrate-active enzyme genes in L. edodes were compared with those of the other 25 fungal species, and 101 lignocellulolytic enzymes were identified in L. edodes, similar to other white rot fungi. Transcriptome analysis showed that the expression of genes encoding two cellulases and 16 transcription factor was up-regulated when mycelia were cultivated for 120 minutes in cellulose medium versus glucose medium. Our results will foster a better understanding of the molecular mechanism of lignocellulose degradation and provide the basis for partial replacement of wood sawdust with agricultural wastes in L. edodes cultivation.
Xu, Feng; Li, Zhiming; Liu, Yu; Rong, Chengbo; Wang, Shouxian
2016-09-01
In this study, the mycelial growth rate, mycelial colonization time, yield, and biological efficiency of the edible mushroom Oudemansiella canarii were determined, and the effects of different substrate combinations on productivity, chemical contents and amino acids were evaluated. Lignocellulosic wastes, such as cottonseed hull, sawdust, corncob, and their combinations supplemented with 18% wheat bran and 2% lime, were used for the cultivation of O. canarii. The biological efficiency (BE) and essential amino acid content of treatment T1, which consisted of 80% cottonseed hull, were the highest among all the tested treatments. Mixtures that included sawdust, such as treatments T2 (80% sawdust), T4 (40% sawdust + 40% cottonseed hull), and T6 (40% sawdust + 40% corncob), exhibited lower yield and BE. Corncob was good for O. canarii production in terms of yield and BE, whereas the mycelial growth rate and colonization time were lower compared to those on other substrates. Comparing the BE, essential amino acids, and other traits of the six treatments, treatment T1 (80% cottonseed hull) was the best formula for O. canarii cultivation and should be extended in the future.
Chen, Lianfu; Gong, Yuhua; Cai, Yingli; Liu, Wei; Zhou, Yan; Xiao, Yang; Xu, Zhangyi; Liu, Yin; Lei, Xiaoyu; Wang, Gangzheng; Guo, Mengpei; Ma, Xiaolong; Bian, Yinbing
2016-01-01
Lentinula edodes, one of the most popular, edible mushroom species with a high content of proteins and polysaccharides as well as unique aroma, is widely cultivated in many Asian countries, especially in China, Japan and Korea. As a white rot fungus with lignocellulose degradation ability, L. edodes has the potential for application in the utilization of agriculture straw resources. Here, we report its 41.8-Mb genome, encoding 14,889 predicted genes. Through a phylogenetic analysis with model species of fungi, the evolutionary divergence time of L. edodes and Gymnopus luxurians was estimated to be 39 MYA. The carbohydrate-active enzyme genes in L. edodes were compared with those of the other 25 fungal species, and 101 lignocellulolytic enzymes were identified in L. edodes, similar to other white rot fungi. Transcriptome analysis showed that the expression of genes encoding two cellulases and 16 transcription factor was up-regulated when mycelia were cultivated for 120 minutes in cellulose medium versus glucose medium. Our results will foster a better understanding of the molecular mechanism of lignocellulose degradation and provide the basis for partial replacement of wood sawdust with agricultural wastes in L. edodes cultivation. PMID:27500531
Identification of rare 6-deoxy-D-altrose from an edible mushroom (Lactarius lividatus).
Tako, Masakuni; Dobashi, Yahiko; Tamaki, Yukihiro; Konishi, Teruko; Yamada, Masashi; Ishida, Hideharu; Kiso, Makoto
2012-03-01
6-Deoxy-L-altrose is well known as a constituent sugar moiety of lipopolysaccharides in Gram-negative bacteria. However, its isomer, 6-deoxy-D-altrose, is little known. Identification of 6-deoxy-D-altrose isolated from a polysaccharide extracted from an edible mushroom (Lactarius lividatus), its comparison with chemically synthesized 6-deoxy-D-altrose using (1)H and (13)C NMR including COSY, HMQC spectroscopy, and investigation of its specific optical rotation were all conducted in this study. The 6-deoxy-hexose isolated from acid hydrolysate of the polysaccharide extracted from L. lividatus was involved in four anomeric isomers (α-pyranose and β-pyranose, and α-furanose and β-furanose), as was chemically synthesized 6-deoxy-d-altrose in an aqueous solution because of mutarotation. Almost all signals of 1D ((1)H NMR and (13)C NMR) and 2D (COSY and HMQC)-NMR spectra agreed with those of the authentic 6-deoxy-D-altrose. The specific optical rotation [α](589) of 6-deoxy-sugar showed a value of +18.2°, which was in agreement with that of authentic 6-deoxy-D-altrose. Consequently, 6-deoxy-hexose was identified as the 6-deoxy-D-altrose. This work is the first complete identification of 6-deoxy-D-altrose in a natural environment. Copyright © 2012 Elsevier Ltd. All rights reserved.
Carrizo, Maria E; Irazoqui, Fernando J; Lardone, Ricardo D; Nores, Gustavo A; Curtino, Juan A; Capaldi, Stefano; Perduca, Massimiliano; Monaco, Hugo L
2004-04-01
The lectin from the common edible mushroom Agaricus bisporus (ABL) belongs to the group of proteins that have the property of binding the Thomsen-Friedenreich antigen (T-antigen) selectively and with high affinity, but does not show any sequence similarity to the other proteins that share this property. The ABL sequence is instead similar to those of members of the saline-soluble fungal lectins, a protein family with pesticidal properties. The presence of different isoforms has been reported. It has been found that in order to be able to grow diffraction-quality crystals of the lectin, it is essential to separate the isoforms, which was performed by preparative isoelectric focusing. Using standard procedures, it was possible to crystallize the most basic of the forms by either vapour diffusion or equilibrium dialysis, but attempts to grow crystals of the other more acidic forms were unsuccessful. The ABL crystals belong to the orthorhombic space group C222(1), with unit-cell parameters a = 93.06, b = 98.16, c = 76.38 A, and diffract to a resolution of 2.2 A on a conventional source at room temperature. It is expected that the solution of this structure will yield further valuable information on the differences in the T-antigen-binding folds and will perhaps help to clarify the details of the ligand binding to the protein.
Directory of Open Access Journals (Sweden)
Farhan
2016-09-01
Full Text Available Objective: To qualitatively evaluate the phytochemicals and quantitatively determine the heavy metals of three species of edible mushrooms collected from the Karak area of Khyber Pukhtoonkhwa, Pakistan. Methods: The plant sample was subjected to methanolic extraction. The extraction was then concentrated by using rotary evaporator. The methanolic extract was screened for the qualitative study of various phytochemicals and quantitative measurement of heavy metals. Results: A maximum of phytochemicals were confirmed by carring out different tests. Among the different phytochemicals, alkaloids, flavonoids, proteins and carbohydrates were found to be present in the extracts, while saponins and glycosides were not detected. Similarly quantitative study of heavy metals was also conducted on the same extracts of the edible mushrooms. The results suggested that iron was present in maximum concentration than all other metals and nickel was found to be present in little amount when compared with other metals. All the metals were found present. Conclusions: The concentrations of heavy metals were investigated in the samples which were different in all samples. The presence of different phytochemicals in the mushroom is the key for its active biological profile.
Liang, Zeng-Chin; Wu, Kuan-Jzen; Wang, Jinn-Chyi; Lin, Chorng-Horng; Wu, Chiu-Yeh
2011-01-01
Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius, on the stalks of three grass plants, i.e., Panicum repens, Pennisetum purpureum, and Zea mays were investigated. The effects of various combinatorial substrates on mushroom mycelial growth and yield calculated as biological efficiency (BE) were determined. Among 9 experimental substrates, the most suitable substrate for mycelial growth was 45ZMS:45S, followed by 45PRS:45S; their mycelial growth rates were obviously quicker than that of the control substrate. The BEs of all the experimental substrates respectively containing P. repens stalk, P. purpureum stalk and Z. mays stalk were higher than that of the control (39.55%) during the 2.5 months of cultivation period. The best substrate in terms of BE was 60ZMS:30S (58.33%), followed by 45PRS:45S (57.16%), 45ZMS:45S (49.86%), and 30ZMS:60S (47.20%). Based on the BE of the tested substrates, Z mays stalk appeared to be the best alternative material for the production of P. pulmonarius.
Koutrotsios, Georgios; Mountzouris, Konstantinos C; Chatzipavlidis, Iordanis; Zervakis, Georgios I
2014-10-15
Nine agro-industrial and forestry by-products were subjected to solid-state fermentation by Agrocybe cylindracea and Pleurotus ostreatus, and the process and end-products were comparatively evaluated. Grape marc waste plus cotton gin trash was the best performing medium for both fungi, while substrate composition had a marked effect on most cultivation parameters. Biological efficiency was positively correlated with nitrogen, lignin and ash, and negatively with hemicelluloses and carbohydrate content of substrates. Spent substrates demonstrated high reductions in hemicelluloses and cellulose in contrast to lignin; fibre fractions were correlated with nitrogen, fat and ash content of initial materials, while residual mycelial biomass was affected by mushroom productivity. Mushroom proximate analysis revealed significant variations of constituents depending on the substrate. Crude protein and fat were correlated with substrates nitrogen for both species. Alternative cultivation substrates of high potential are proposed, while spent material could be exploited as animal feed due to its upgraded properties. Copyright © 2014 Elsevier Ltd. All rights reserved.
... these mushrooms have effects similar to the drug LSD . Sometimes Called: shrooms, magic mushrooms How It's Used: ... this topic for: Teens Drugs: What to Know LSD Dealing With Addiction Marijuana Bath Salts Depressants GHB ...
International Nuclear Information System (INIS)
Gwynn, Justin P.; Nalbandyan, Anna; Rudolfsen, Geir
2013-01-01
This paper discusses activity concentrations of 210 Po, 210 Pb, 40 K and 137 Cs in edible wild berries and mushrooms collected from Øvre Dividalen national park, Northern Norway and derives committed effective ingestion doses to man based on high consumption rates of these wild foods. Edible wild berries and mushrooms accumulated similar levels of 210 Pb, but mushrooms accumulated higher levels of 210 Po and 40 K than berries. There appears to be a clear difference in the ability of Leccinum spp. of fungi to accumulate 210 Po and/or translocate 210 Po to mushrooms compared to Russula spp. of fungi. Activity concentrations of 137 Cs in edible wild berries and mushrooms from Øvre Dividalen national park reflected the lower levels of fallout of this radionuclide in Northern Norway compared to more central areas following the Chernobyl accident. For mushrooms, ingestion doses are dominated by 210 Po, while for berries, 40 K is typically the main contributor to dose. Based on high consumption rates, ingestion doses arising from the combination of 210 Po, 210 Pb and 40 K were up to 0.05 mSv/a for berries and 0.50 mSv/a for mushrooms. Consumption of such wild foods may result in a significant contribution to total annual doses when consumed in large quantities, particularly when selecting mushrooms species that accumulate high activity concentrations of 210 Po. - Highlights: ► 210 Po/ 210 Pb activity ratios were typically less than one for berries. ► 210 Po/ 210 Pb activity ratios were all greater than one for mushrooms. ► Dose rates from mushrooms were dominated by 210 Po and by 40 K for berries. ► Wild foods can give a significant contribution to total annual ingestion dose.
International Nuclear Information System (INIS)
Mohammed, H.M; Soliman, S.S.A; Shawky, A.S.H; Mahgoub, E.M.I
2013-01-01
The present study aimed to understand the effect of gamma rays on three strains of white oyster mushroom Pleurotus ostreatus and induction of new benefit mutants. Five different doses, i.e., 0.25,0.5,0.75, and 1.00 KGy of gamma rays were used. Twelve morphological criteria were measured. The result confirmed the existence of different response of three strains to different doses of radiation. The 21 strain as a control, the first flush was misshapen, but the second flush gave normal fruit, while mutant Po 21-3 gave excellent growth performance for the shape, colour, fruit diameter and stem length, while slightly decrease in wet and dry total matter per bag and flushes numbers were found.The po 21-2 mutant considered as important mutant because slightly increased in wet and dry total matter than the control, and had short stem length. This mutant Po 21 -2 gave spores, while the control was sporeless. Control of strain 22 possessed good performance for fruit characterization but it forms fruits less than its primordial it formed (semi maturation less strain) per bag, While po 22-l and Po 22-2 appeared good performance, in addition high yielding as wet and dry total matter and faster flushing. The control of strain 66 had a good growth performance, and the four mutants for this strain is very good too they had excellent growth performance; Po 66-1 and Po 66-3 mutants had significant and highly significant values for wet matter than the control (21.04, 21.64 and 12.27) for (Po 66-1, Po 66-4, control). As well as more important criteria there were taken as short fruit stem length and fruit number/bag. These results confirmed the important of Po 66-4 followed by po 66-1 in next breeding and production programs for white oyster mushroom (Pleurotus ostreatus).the RAPD PCR results showed the oligonucleotide OPB-10, OPA-05 and OPC-02 presented the highest percentage of RAPD polymorphism (80⁒, 80⁒, 66.6⁒). The pattern obtained with OPB-10 oligonucleotide for strains
Energy Technology Data Exchange (ETDEWEB)
Bambang Anggoro; Pakpahan, P.M.; Fajar Dwi Kusnoaji; Sirait, K.T. [Bandung Institute of Technology (Indonesia). Faculty of Industrial Technology
1999-07-01
Investigation on effects of electromagnetic fields on different aspects of biological systems has been done by much research. Our present study, which has been carried out under the joint research between the laboratory of High voltage and High current Engineering and the Laboratory of Microbiology of Institut Teknologi Bandung, investigates the influence of 50 Hz magnetic field on the growth of several species of mushroom. In this study, we observed growth of mushroom, from spora up to fully ripped stages, under magnetic field exposure of different intensity from 0,1 mT to 1,7 mT. During exposure the room condition was held constant at a temperature of 20{sup o}C and 95% humidity. We noted that some parameters such as: mushroom growth velocity, shape, dimension, quantity, color and period of mushroom ovary are significantly influenced by magnetic energy absorbed. (author)
Pardo, José E; de Figueirêdo, Vinícius Reis; Alvarez-Ortí, Manuel; Zied, Diego C; Peñaranda, Jesús A; Dias, Eustáquio Souza; Pardo-Giménez, Arturo
2013-09-01
The Hazard analysis and critical control points (HACCP) is a preventive system which seeks to ensure food safety and security. It allows product protection and correction of errors, improves the costs derived from quality defects and reduces the final overcontrol. In this paper, the system is applied to the line of cultivation of mushrooms and other edible cultivated fungi. From all stages of the process, only the reception of covering materials (stage 1) and compost (stage 3), the pre-fruiting and induction (step 6) and the harvest (stage 7) have been considered as critical control point (CCP). The main hazards found were the presence of unauthorized phytosanitary products or above the permitted dose (stages 6 and 7), and the presence of pathogenic bacteria (stages 1 and 3) and/or heavy metals (stage 3). The implementation of this knowledge will allow the self-control of their productions based on the system HACCP to any plant dedicated to mushroom or other edible fungi cultivation.
Sales-Campos, Ceci; Araujo, Lidia M; Minhoni, Marli T A; Andrade, Meire C N
2013-01-01
The centesimal composition and the physical and chemical analyses of Lentinus strigosus, an edible mushroom occurring in the Brazilian Amazon and produced in alternative substrates based on wood and agroindustrial residues, were evaluated. For this purpose, the C, N, pH, soluble solids, water activity, protein, lipids, total fiber, ash, carbohydrate, and energy levels were determined. The substrates were formulated from Simarouba amara Aubl. ("marupá"), Ochroma piramidale Cav. Ex. Lam. ("pau-de-balsa") and Anacardium giganteum ("cajuí") sawdust and Bactris gasipaes Kunth ("pupunheira") stipe and Saccharum officinarum (sugar cane bagasse). The results indicated that the nutritional composition of L. strigosus varied with the substrate of cultivation; the protein levels found in mushrooms grown in the different substrates (18-21.5%) varied with the substrate and was considered high; the soluble solids present in the mushrooms could have a relation with complex B hydrosoluble vitamins. L. strigosus could be considered as important food owing to its nutritional characteristics such as high protein content, metabolizable carbohydrates and fibers, and low lipids and calories content.
Directory of Open Access Journals (Sweden)
CECI SALES-CAMPOS
2013-10-01
Full Text Available The centesimal composition and the physical and chemical analyses of Lentinus strigosus, an edible mushroom occurring in the Brazilian Amazon and produced in alternative substrates based on wood and agroindustrial residues, were evaluated. For this purpose, the C, N, pH, soluble solids, water activity, protein, lipids, total fiber, ash, carbohydrate, and energy levels were determined. The substrates were formulated from Simarouba amara Aubl. (“marupá”, Ochroma piramidale Cav. Ex. Lam. (“pau-de-balsa” and Anacardium giganteum (“cajuí” sawdust and Bactris gasipaes Kunth (“pupunheira” stipe and Saccharum officinarum (sugar cane bagasse. The results indicated that the nutritional composition of L. strigosus varied with the substrate of cultivation; the protein levels found in mushrooms grown in the different substrates (18 – 21.5% varied with the substrate and was considered high; the soluble solids present in the mushrooms could have a relation with complex B hydrosoluble vitamins. L. strigosus could be considered as important food owing to its nutritional characteristics such as high protein content, metabolizable carbohydrates and fibers, and low lipids and calories content.
A Comprehensive Review of Tropical Milky White Mushroom (Calocybe indica P&C).
Subbiah, Krishnamoorthy Akkanna; Balan, Venkatesh
2015-09-01
A compressive description of tropical milky white mushroom (Calocybe indica P&C var. APK2) is provided in this review. This mushroom variety was first identified in the eastern Indian state of West Bengal and can be cultivated on a wide variety of substrates, at a high temperature range (30~38℃). However, no commercial cultivation was made until 1998. Krishnamoorthy 1997 rediscovered the fungus from Tamil Nadu, India and standardized the commercial production techniques for the first time in the world. This edible mushroom has a long shelf life (5~7 days) compared to other commercially available counterparts. A comprehensive and critical review on physiological and nutritional requirements viz., pH, temperature, carbon to nitrogen ratio, best carbon source, best nitrogen source, growth period, growth promoters for mycelia biomass production; substrate preparation; spawn inoculation; different supplementation and casing requirements to increase the yield of mushrooms has been outlined. Innovative and inexpensive methods developed to commercially cultivate milky white mushrooms on different lignocellulosic biomass is also described in this review. The composition profiles of milky white mushroom, its mineral contents and non-enzymatic antioxidants are provided in comparison with button mushroom (Agaricus bisporus) and oyster mushroom (Pleurotus ostreatus). Antioxidant assay results using methanol extract of milky white mushroom has been provided along with the information about the compounds that are responsible for flavor profile both in fresh and dry mushrooms. Milky white mushroom extracts are known to have anti-hyperglycemic effect and anti-lipid peroxidation effect. The advantage of growing at elevated temperature creates newer avenues to explore milky white mushroom cultivation economically around the world, especially, in humid tropical and sub-tropical zones. Because of its incomparable productivity and shelf life to any other cultivated mushrooms in the
Randy Molina; Thomas O' Dell; Daniel Luoma; Michael Amaranthus; Michael Castellano; Kenelm. Russell
1993-01-01
The commercial harvest of edible forest fungi has mushroomed into a multimillion dollar industry with several thousand tons harvested annually. The development of this special forest product industry has raised considerable controversy about how this resource should be managed, especially on public lands. Concerns center around destruction of forest habitat by repeated...
Energy Technology Data Exchange (ETDEWEB)
Rangel Rangel, Maria Elena [Proteccion ambiental, Puebla (Mexico)
2000-12-01
A plant for raising edible mushrooms with residual geothermal energy is a project of the Comision Federal de Electricidad (CFE). The results reflect important achievements in the development of technology for the productions of wholesome and available food with geothermal heat instead of conventional energy sources. The installations have an enormous technological and commercial potential- demonstrated by the cultivation of oyster mushrooms (Pleurotus ostreatus), which success has awakened the interest of research institutions. The Instituto of Ecologia, A.C., has begun a joint project with CFE cultivating shiitake mushrooms (Lentinula edodes) with geothermal energy. These achievements mark a clear trend toward the integral use of facilities, the establishment of a crop with greater economic advantages, and the diffusion of this project. [Spanish] La planta productora de hongos comestibles es un proyecto de la Comision Federal de Electricidad (CFE) para dar un uso alterno a la energia geotermica residual. Los resultados obtenidos hasta el momento reflejan logros importantes en la generacion de tecnologia propia para la produccion de un alimento sano y accesible, sustituyendo la energia proveniente de combustibles convencionales por calor geotermico. Las instalaciones creadas cuentan con un enorme potencial tecnologico y comercial demostrando con el cultivo de las setas (Pleurotus ostreatus) con un exito tal que ha despertado el interes de instituciones dedicadas a la investigacion. Tal es el caso de Instituto de Ecologia, A.C que acualmente se encuentra involucrado en un proyecto conjunto sobre el cultivo del hongo Lentinula edodes (shiitake) utilizando energia geotermica en su proceso productivo. Con lo anterior, se esta marcando una clara tendencia hacia el aprovechamiento integral de las instalaciones, el establecimiento de un cultivo con mayores ventajas economicas y la difusion de este proyecto.
Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad
2015-01-01
The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.
Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun
2013-01-01
The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.
Czech Academy of Sciences Publication Activity Database
Ntougias, S.; Baldrian, Petr; Ehaliotis, C.; Nerud, František; Antoniou, T.; Merhautová, Věra; Zervakis, G.
2012-01-01
Roč. 88, č. 5 (2012), s. 620-626 ISSN 0045-6535 Institutional research plan: CEZ:AV0Z50200510 Keywords : White-rot fungi * Mushroom * Toxicity Subject RIV: EE - Microbiology, Virology Impact factor: 3.137, year: 2012
Hearst, Rachel; Nelson, David; McCollum, Graham; Millar, B Cherie; Maeda, Yasunori; Goldsmith, Colin E; Rooney, Paul J; Loughrey, Anne; Rao, J R; Moore, John E
2009-02-01
Antibiotic agents have been in widespread and largely effective therapeutic use since their discovery in the 20th century. However, the emergence of multi-drug resistant pathogens now presents an increasing global challenge to both human and veterinary medicine. It is now widely acknowledged that there is a need to develop novel antimicrobial agents to minimize the threat of further antimicrobial resistance. With this in mind, a study was undertaken to examine the antimicrobial properties of aqueous extracts of 'exotic' Shiitake and Oyster mushrooms on a range of environmental and clinically important microorganisms. Several batches of Shiitake and oyster mushrooms were purchased fresh from a local supermarket and underwent aqueous extraction of potential antimicrobial components. After reconstitution, aqueous extracts were tested qualitatively against a panel of 29 bacterial and 10 fungal pathogens, for the demonstration of microbial inhibition. Our data quantitatively showed that Shiitake mushroom extract had extensive antimicrobial activity against 85% of the organisms it was tested on, including 50% of the yeast and mould species in the trial. This compared favourably with the results from both the Positive control (Ciprofloxacin) and Oyster mushroom, in terms of the number of species inhibited by the activity of the metabolite(s) inherent to the Shiitake mushroom. This small scale study shows the potential antimicrobial effects of Shitake extracts, however further work to isolate and identify the active compound(s) now requires to be undertaken. Once these have been identified, suitable pharmaceutical delivery systems should be explored to allow concentrated extracts to be prepared and delivered optimally, rather than crude ingestion of raw material, which could promote further bacterial resistance.
Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia
2015-01-01
In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.
Gil-Ramirez, Alicia; Smiderle, Fhernanda R; Morales, Diego; Govers, Coen; Synytsya, Andriy; Wichers, Harry J; Iacomini, Marcello; Soler-Rivas, Cristina
2017-01-01
Water extracts from Pleurotus ostreatus containing no statins showed 3-hydroxy-3-methyl-glutaryl CoA reductase (HMGCR) inhibitory activity (in vitro) that might be due to specific water-soluble polysaccharides (WSPs); when isolated and deproteinized, increasing concentrations of the WSP extract induced higher inhibition. The WSP extract contained mainly β-glucans, mannogalactans, and glycogen (e.g., α-glucans), although derivatives or fragments with lower molecular weights (between 14 and 3.5 kDa) were present and were able to induce the inhibitory activity. The extract contained more β-(1→3)-glucans than β-(11→3),(11→6)-glucans, and they partially survived digestion and managed to pass through Caco2 cell monolayers to the lower compartment after in vitro digestion and transport experiments. The WSP might also modulate Caco2 membrane integrity.
Directory of Open Access Journals (Sweden)
K. J. Gurubel
2017-04-01
Full Text Available In this paper, optimal control strategies for temperature trajectory determination in order to maximize thermophilic bacteria in a fed-batch solid-state fermentation reactor are proposed. This process is modeled by nonlinear differential equations, which has been previously validated experimentally with scale reactor temperature profiles. The dynamic input aeration rate of the reactor is determined to increase microorganisms growth of a selective substrate for edible mushroom cultivation. In industrial practice, the process is comprised of three thermal stages with constant input air flow and three types of microorganisms in a 150-hour lapse. Scytalidium thermophilum and actinobacteria are desired in order to obtain a final biomass composition with acceptable microorganisms concentration. The Steepest Descent gradient algorithm in continuous time and the Gradient Projection algorithm in discrete-time are used for the process optimal control. A comparison of simulation results in the presence of disturbances is presented, where the resulting temperature trajectories exhibit similar tendencies as industrial data.
Wannet, W J; Hermans, J H; van Der Drift, C; Op Den Camp, H J
2000-02-01
A convenient and sensitive method was developed to separate and detect various types of carbohydrates (polyols, mono- and disaccharides, and phosphorylated sugars) simultaneously using high-performance liquid chromatography (HPLC). The method consists of a chromatographic separation on a CarboPac PA1 anion-exchange analytical column followed by pulsed amperometric detection. In a single run (43 min) 13 carbohydrates were readily resolved. Calibration plots were linear over the ranges of 5-25 microM to 1. 0-1.5 mM. The reliable and fast analysis technique, avoiding derivatization steps and long run times, was used to determine the levels of carbohydrates involved in mannitol and trehalose metabolism in the edible mushroom Agaricus bisporus. Moreover, the method was used to study the trehalose phosphorylase reaction.
Energy Technology Data Exchange (ETDEWEB)
Frutos Madrazo, P. de; Martinez Pena, F.; Esteban Laleona, S.
2012-11-01
Edible wild mushroom picking is becoming an important source of income in rural areas. The wide range of activities which add value to mycological production (initial sale, transformation, marketing, etc.) include those related to tourism which can attract visitors to mushroom producing areas, leading to so-called mycological tourism. To date, no research exists quantifying the importance thereof in rural areas endowed with such resources. The present research provides the first model to estimate this activity contribution to the economy of rural areas in the region of Castilla y Leon. The main finding to emerge evidences a close link between influx of visitors, who come principally to pick, and mycological productivity in the region. Based on this relation, we estimate four key variables to determine the impact which said activity has on the regional economy as a whole: the number of overnight stays and trips made by mycological tourists, as well as associated expenditure and employment created. Findings underscore the importance of this activity in the regional tourism industry and point to its significance as a major market niche, particularly during the hotel low season. The need for public administrators to implement a related management policy is also inferred. (Author) 35 refs.
Directory of Open Access Journals (Sweden)
Ivana Potočnik
2015-12-01
Full Text Available The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus, oyster mushroom (Pleurotus sp. and shiitake (Lentinus edodes. Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal agents of dry bubble, wet bubble, and cobweb disease, respectively. Various Trichoderma species, the causal agents of green mould, also affect all three kinds of edible mushrooms. Over the past two decades, green mould caused by T. aggressivum has been the most serious disease of button mushroom. Oyster mushroom is susceptible to T. pleurotum and shiitake to T. harzianum. The bacterial brawn blotch disease, caused by Pseudomonas tolaasii, is distributed globally. Disease control on mushroom farms worldwide is commonly based on the use of fungicides. However, evolution of pathogen resistance to fungicides after frequent application, and host sensitivity to fungicides are serious problems. Only a few fungicides are officially recommended in mushroom production: chlorothalonil and thiabendazol in North America and prochloraz in the EU and some other countries. Even though decreased sensitivity levels of L. fungicola and Cladobotryum mycophilum to prochloraz have been detected, disease control is still mainly provided by that chemical fungicide. Considering such resistance evolution, harmful impact to the environment and human health, special attention should be focused on biofungicides, both microbiological products based on Bacillus species and various natural substances of biological origin, together with good programs of hygiene. Introduction of biofungicides has created new possibilities for crop protection with reduced application of chemicals.
Van Doan, Hien; Doolgindachbaporn, Sompong; Suksri, Amnuaysilpa
2016-10-01
This study was conducted to evaluate the effects of Eryngii mushroom, Pleurotus eryngii (PE), and Lactobacillus plantarum single or combined on growth, innate immune response and disease resistance of the Pangasius catfish, Pangasius bocourti. Two hundred forty fish were divided into four treatments, i.e., 0 g kg(-1) PE (Control, Diet 1), 3 g kg(-1) PE (Diet 2), 10(8) cfu g(-1) L. plantarum (Diet 3) and 3 g kg(-1) PE + 10(8) cfu g(-1) L. plantarum (Diet 4). Fish were culture in glass tanks with water volume approximately of 150 l, and each treatment had four replications with 15 fish per replication. Following 30, 60 and 90 days of the feeding trial, specific growth rate (SGR), feed conversion ratio (FCR), serum lysozyme, phagocytosis and respiratory burst activities were measured. SGR and FCR were significantly improved in fish fed supplemented diets after 90 days of the feeding trial. Serum lysozyme, phagocytosis and respiratory burst activity of fish were significantly stimulated by both PE and L. plantarum diets; however, the highest innate immune response was observed in fish fed synbiotic diet. At the end of the experiment, five fish were randomly selected for a challenge test against Aeromonas hydrophila. The post-challenge survival rate of the fish fed supplemented diets was significantly greater than the control treatment, and the highest post-challenge survival rate was observed in synbiotic diet. The results revealed that dietary supplementation of PE and L. plantarum stimulated growth, immunity and disease resistance of the P. bocourti.
Use of edible and medicinal mushrooms spent compost in remediation of polluted soils
Czech Academy of Sciences Publication Activity Database
Šašek, Václav; Eggen, T.
2001-01-01
Roč. 3, 2-3 (2001), s. 215 ISSN 1521-9437. [Perspectives of Medicinal Mushrooms in Health Care and Nutrition in the 21th Century. 12.09.2001-14.09.2001, Kiev] Institutional research plan: CEZ:AV0Z5020903 Subject RIV: EE - Microbiology, Virology
Yun, Yeo Hong; Koo, Ja Sun
2015-01-01
Phenylalanine ammonia-lyase (PAL) gene is known to be expressed in plants, and is involved in the differentiation, growth and synthesis of secondary metabolites. However, its expression in fungi remains to be explored. To understand its expression in mushroom fungi, the PAL gene of the edible mushroom Flammulina velutipes (Fvpal) was cloned and characterized. The cloned Fvpal consists of 2,175 bp, coding for a polypeptide containing 724 amino acids and having 11 introns. The translated amino acid sequence of Fvpal shares a high identity (66%) with that of ectomycorrhizal fungus Tricholoma matsutake. Distinctively, the Fvpal expression in the mycelium was higher in minimal medium supplemented with L-tyrosine than with other aromatic amino acids. During cultivation of the mushroom on sawdust medium, Fvpal expression in the fruit body correspondingly increased as the mushroom grew. In the fruiting body, Fvpal was expressed more in the stipe than in the pileus. These results suggest that F. velutipes PAL activity differs in the different organs of the mushroom. Overall, this is first report to show that the PAL gene expression is associated with mushroom growth in fungi. PMID:26539050
THE BIOMINERAL CONCENTRATIONS AND ACCUMULATION IN SOME WILD GROWING EDIBLE SPECIES OF MUSHROOMS
Directory of Open Access Journals (Sweden)
Carmen Cristina Elekes
2010-01-01
Full Text Available Many mushrooms species are known to accumulate metals to a higher level than the plants and are considered as a source of proteins, vitamins – riboflavin, biotin and thiamine, fats, carbohydrates, amino acids and minerals. The trace metals concentrations were established by Inductively Coupled Plasma - Atomic Emission Spectrometry method. The aim of this paper is to determinate the minerals content of some wild growing mushrooms, which may be useful in the phytopharmaceutical biotechnologies in order to obtain important quantities of biominerals accessible for the human body. The results are varying with the analyzed species of mushrooms between 11869.85 and 32088.68 mg/kg for potassium, 240.81 to 716.98 mg/kg for calcium and between 0 to 5350 mg/kg for phosphorus. The highest concentration if potassium was founded in B. griseus species, 32088.68 mg/kg. Only two species, Hygrophorus virgineus and Marasmius oreades show a phosphorus concentration in the fruiting body higher than in soil, indicating the accumulation capacity.
Directory of Open Access Journals (Sweden)
Z. Zeković
2010-01-01
Full Text Available Armillaria mellea and Lycoperdon saccatum are two delicious mushrooms growing widely trough all Balkan region. Investigation of A. mellea and L. saccatum antioxidant properties includes preparation of mushrooms extracts, determination of Selenium and Zinc content and evaluation of theirs antioxidant activity involving scavenging activity of ˙O2- radicals, DPPH and reducing power assay. Higher extraction yield of 24.48 % has been achieved for L. saccatum, but higher content of Selenium and Zinc was determined in A. mallea extract, 2.359 mg/kg and 50.380 mg/kg, respectively. The radical scavenging activity was found to exhibit 50 % of inhibition value (IC50 value at the extracts concentration of 0.0161±0.0001 mg/ml for the L. saccatum extract and 0.0108±0.0002 mg/ml for A. mallea extract. The determined relative inhibition of ˙O2- radicals for L. sacatum extract is lower than for A. malea. It was determined that both mushrooms extract posses’ reductive capabilities and thus were capable of reducing iron (III.
This paper highlighted the antioxidant and antibacterial activities of Lentinus tigrinus and Pleurotus djamour. Extracts of mushroom fruiting bodies were obtained using hexane and acetonitrile solvents. Acetonitrile extracts of both mushrooms exhibited higher biological activities than hexane extrac...
Brzezicha-Cirocka, Justyna; Mędyk, Małgorzata; Falandysz, Jerzy; Szefer, Piotr
2016-11-01
In the present study, the composition of bio-elements (K, Na, Mg, Ca, Fe, Cu, Zn) and toxic elements (Ag, Cd) in seven edible mushrooms from the rural and woodland region of Morąg (north-eastern Poland) and the rural and industrial region of the Tarnobrzeska Upland (south-eastern Poland) were investigated using a validated method. The species examined were Boletus edulis, Cantharellus cibarius, Leccinum aurantiacum, Leccinum versipelle, Lycoperdon perlatum, Suillus luteus, and Xerocomus subtomentosus. Final determination was carried out by flame atomic absorption spectroscopy (FAAS) after microwave-assisted decomposition of sample matrices with solutions of concentrated nitric acid in the pressurized polytetrafluoroethylene vessels. The contents of the alkali elements and alkali earth elements were determined in the species surveyed. The alkali elements, earth alkali elements, and transition metals (Ag, Cu, Zn, Fe, and Mn) were at typical concentrations as was determined for the same or similar species elsewhere in Poland and Europe. The results may suggest a lack of local and regional emissions of those metallic elements from industrialization of some sites in the Tarnobrzeska Plain. Cadmium was at elevated concentrations in L. versipelle from the Tarnobrzeska Plain but the reason-pollution or geogenic source-was unknown, while it was at typical concentrations in other species.
The potential of Pleurotus-treated olive mill solid waste as cattle feed.
Shabtay, Ariel; Hadar, Yitzhak; Eitam, Harel; Brosh, Arieh; Orlov, Alla; Tadmor, Yaakov; Izhaki, Ido; Kerem, Zohar
2009-12-01
The aims of the current study were to follow: (1) the capability of the edible mushroom Pleurotus ostreatus to degrade cell wall components and soluble phenols of the olive mill solid waste (OMSW), and improve it for ruminant nutrition (2) the fate of oil and the lipid-soluble compounds tocopherols, squalene and beta-sitosterol in the fermented OMSW. A significant decrease in oil and lipid-soluble compounds with a concomitant shift in the fatty acid profile and degradation of soluble phenols took place already after 14 d. The utilization of lipids by the fungus shifted the degradation of the structural carbohydrates to a later stage, and significantly reduced the metabolizable energy of the OMSW. We propose that edible fungi with reduced lipase activity would preserve the energy and health promoting ingredients of the oil, and force the fungus to degrade structural carbohydrates, thus improving its digestibility.
Directory of Open Access Journals (Sweden)
Mostak Ahmed
2013-02-01
Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.O objetivo deste trabalho foi avaliar a produtividade e a composição química de linhagens de cogumelo‑ostra introduzidas recentemente em Bangladesh. Linhagens de Pleurotus high‑king (linhagem PHK, P. ostreatus (linhagem PO2 e P. geesteranus (linhagens PG1 e PG3 foram avaliadas quanto aos componentes da produção e à composição proximal. Pleurotus ostreatus foi utilizado como controle. Pleurotus high‑king apresentou rápido crescimento de primórdios, mas fluxo moderado de corpos de frutificação efetivos. Pleurotus geesteranus (PG1 apresentou maior produtividade econômica e desempenho biológico, além de melhor composição química, especialmente em termos de conteúdos de proteína e minerais. Pleurotus geesteranus (PG1 apresenta melhor desempenho que P. ostreatus (linhagem PO2, a espécie comestível mais cultivada comercialmente em Bangladesh, e, portanto, deve ser recomendado para plantio comercial.
Directory of Open Access Journals (Sweden)
Emanuel Vamanu
2013-01-01
Full Text Available Boletus edulis is a wild edible mushroom habitually consumed by rural populations. Ethanolic and methanolic extracts was obtained in cold and hot water from dried fruit bodies. The antioxidant activity of freeze-dried extracts from B. edulis were investigated using free radicals scavenging activity, reducing power, metal chelating effect, inhibition of lipid peroxidation, and the identification of antioxidant compounds. The levels of different compounds with antioxidant properties were higher in alcoholic extracts compared with aqueous extracts. Rosmarinic acid was the major phenolic compound, it being identified in a concentration between 7±0.23 and 56±0.15 mg/100 g extract. A positive correlation between the content of total phenols, flavonoids, anthocyanins, and tocopherols, and the antioxidant capacity of the extracts was determined. The results showed that the ethanolic extract of Romanian wild mushroom B. edulis represents a natural source of functional compounds.
Vamanu, Emanuel; Nita, Sultana
2013-01-01
Boletus edulis is a wild edible mushroom habitually consumed by rural populations. Ethanolic and methanolic extracts was obtained in cold and hot water from dried fruit bodies. The antioxidant activity of freeze-dried extracts from B. edulis were investigated using free radicals scavenging activity, reducing power, metal chelating effect, inhibition of lipid peroxidation, and the identification of antioxidant compounds. The levels of different compounds with antioxidant properties were higher in alcoholic extracts compared with aqueous extracts. Rosmarinic acid was the major phenolic compound, it being identified in a concentration between 7 ± 0.23 and 56 ± 0.15 mg/100 g extract. A positive correlation between the content of total phenols, flavonoids, anthocyanins, and tocopherols, and the antioxidant capacity of the extracts was determined. The results showed that the ethanolic extract of Romanian wild mushroom B. edulis represents a natural source of functional compounds.
Current Overview of Mushroom Production in the World
Royse, Daniel J.; Baars, J.J.P.; Tan, Qi
2017-01-01
Edible, medicinal, and wild mushrooms are the three major components of the global mushroom industry. World production of cultivated, edible mushrooms has increased more than 30‐fold since 1978. China is the main producer of cultivated, edible mushrooms. Lentinus edodes is now the world's leading
International Nuclear Information System (INIS)
Shaiful Azuar Mohamad; Mat Rasol Awang
2006-01-01
Numerous polysaccharides and polysaccharides-protein complexes have been isolated from mushrooms and used as a source of therapeutic agents. The mycelium of Pleurotus sajor caju, Pleurotus tuber-regium, black ganoderma, and the fruiting bodies of Pleurotus sajor caju and Pleurotus florida were used to determine the percentage of polysaccharides obtained from the mushroom raw material. Hot water extraction method was used followed by refrigerated centrifuge and lyophilization. The yield from the various species will be compared. (Author)
International Nuclear Information System (INIS)
Tuo Fei; Xu Cuihua; Zhang Jing; Li Wenhong; Zhou Qiang; Zhang Qing; Su Xu
2014-01-01
Objective: To determine the activity concentration of radionuclides for "1"3"7Cs and "4"0K in edible wild mushrooms, and to evaluate the extent of radioactive contamination and ingestion doses to adults from consumption of these wild mushrooms. Methods: A total of 33 samples for 18 edible wild mushroom species were collected from natural forest Mangshi, Yunnan province. The activity concentrations of "1"3"7Cs and "4"0K were analyzed by using high-purity germanium (HPGe) gamma spectrometry. Results: Except for one sample that was below the MDA, "1"3"7Cs artificial radionuclides were detected in other 32 samples, with activity concentration of "1"3"7Cs in the range of 0.45-339.58 Bq/kg (dry weight) and an average of 25.47 Bq/kg (dry weight). In regards to "4"0K in edible mushrooms, all species presented the activity concentrations for this radionuclide and the levels varied from 453.4 to 1882.6 Bq/kg (dry weight), with an average of 815.1 Bq/kg (dry weight). After species of mushroom with only one sample were eliminated, there was significant difference for "1"3"7Cs(F = 21.13, P < 0.05) among 6 species of mushroom named Gomphus floccosus (Schw.) Sing., Boletus edulis bull, Boletus edulis bull, Tylopllus bolloul (Peck) Sing., Lentinus edodes (Berk.) Sing. and Boletus brunneissimus W.F.Chin, but without significant difference for "4"0K. Conclusions: These 6 different mushroom species have different capacity to retain radionuclides of "1"3"7Cs in soil. These wild mushrooms, such as Gomphus floccosus (Schw.) Sing. and Lentinus edodes (Berk.) Sing. have large affinity ability for radionuclides"1"3"7Cs. The effective dose to adults attributable to consuming these kinds of mushrooms is small and below the level that could cause harm. (authors)
Choi, Jun-Hui; Kim, Dae-Won; Kim, Seung; Kim, Sung-Jun
2017-01-01
We investigated the effect of the culinary-medicinal mushroom Pleurotus eryngii var. ferulae DDL01 on oxidative damage in the liver and brain and a high-fat/high-cholesterol-induced hyperlipidemic model. In in vitro studies, the water extracts of the fruiting bodies showed strong scavenging activities of DPPH (139.46 ± 3.2 μg) and hydroxyl (139.46 ± 3.2 μg) radicals. Moreover, the extracts showed Fe2+ chelating and reducing abilities, as well as a large amount of polyphenols and an inhibitory effect on lipid peroxidation in the liver and brain tissues. The rats were fed a pellet diet (7.5 g/rat/day) containing P. eryngii var. ferulae DDL01 (PD) for 3 weeks. In the high-fat/high-cholesterol-induced hyperlipidemic rat model, administration of PD caused a significant decrease (P < 0.05) in the levels of serum triacylglycerols, low-density lipoprotein cholesterol, very-low-density lipoprotein cholesterol, aspartate aminotransferase, and alanine aminotransferase and a significant increase (P < 0.05) in the level of high-density lipoprotein cholesterol. PD administration significantly decreased high-fat/high-cholesterol-induced hepatic lipid accumulation. Treatment with the extracts (up to 500 μg/mL) did not significantly affect the viability of HepG2 and 3T3-L1 cells. Our findings suggest that this mushroom has potential as an antiatherogenic dietary source in the development of therapeutic agents and functional foods.
Dobsikova, Radka; Blahova, Jana; Franc, Ales; Jakubik, Juraj; Mikulikova, Ivana; Modra, Helena; Novotna, Kamila; Svobodova, Zdenka
2012-01-01
Effect of long-term oral administration of three different concentrations (0.5, 1.0, and 2.0%) of micronized β-1.3/1.6-D-glucan derived from oyster mushroom (Pleurotus ostreatus, Hiratake) on biometrical, haematological, biochemical, and immunological indices of half-year-old rainbow trout (Oncorhynchus mykiss) was assessed in the study. Rainbow trout were feed commercial feed pellets containing β-1.3/1.6-D-glucan in the concentrations of 0.5, 1.0, and 2.0% for 85 days. Biometrical indices consisted in total and standard length, body and liver weight, from which derived somatic parameters such as Fulton´s condition factor and hepatosomatic index were calculated. Haematological parameters were evaluated according to unified methods for haematological examination in fish. Plasma biochemical profile was analysed using biochemical analyser Konelab 20i and Easy Lyte Analyzer. A phagocyte cells metabolic activity (induced chemiluminescence of phagocytes) was determined as an immunological parameter by a microplate luminometric method on Immunotech LM-01T. No clinical signs of behavioral, respiratory, or neurologic distress were observed in rainbow trout. Fish showed normal feeding behavior. As for biometric parameters, no significant changes in total and standard length, body weight, liver weight, as well as in condition factor and hepatosomatic index of experimental and control fish were found. In the course of the study, weight gains in rainbow trout were similar and continuous. Shifts in PCV (pglucose, lactate, total protein, cholesterol, calcium, natrium, potassium (all p<0.05), albumins and chlorides (both p<0.01), as well as catalytic activities of ALT and AST (both p<0.05) were changed in the course of the study. A phagocyte cells metabolic activity (luminol-induced chemiluminescence) in rainbow trout was not altered by oyster mushroom β-1.3/1.6-D-glucan administration. After long-term oral administration of three concentrations of micronized β-1.3/1.6-D
Directory of Open Access Journals (Sweden)
Edmond Ahipo Due
2016-08-01
Full Text Available In Sub-Saharan Africa, especially, in Côte d’Ivoire, the wild edible mushroom Termitomyces heimii Natarajan is the most prized and widely consumed for different reasons such as taste, flavour, attractiveness, uses as substitutes for meat or fish and medicinal values. The present study was aimed at evaluating the proximate composition and functional properties of T. heimii flour for further food products formulation. Fresh mushroom T. heimii were obtained from the market of Aboisso (5° 28′ 06″ N and3° 12′ 25″ W in Côte d’Ivoire. The fresh mushrooms were dried and ground to obtain the crude flour. Chemical composition and functional properties were investigated using standard methods. The chemical composition revealed that it contains crude protein about 23.75%, crude fat 3.58%, moisture 11.59 %, ash 7.40%, total carbohydrate 54.70% and energy value of 345.90 kcal/ 100 g. These results suggest that T. heimii can be used in human diet to prevent undernourishment due to protein. Furthermore, the low fat content suggest that it would be an ideal food for obese persons and useful in preventing hypertension and hypercholesterolemia. The functional properties showed that it has high bulk density and water absorption capacity with values of 0.737 g/mL and 315.15 ± 45.74% respectively. This flour exhibited also good foaming properties. All these characteristics make it suitable as good thickeners in food products, useful in foods such as bakery products which require hydration and attractive for products like cakes or whipping topping where foaming is important. The mushroom T. heimii could be utilized for making some low-fat foodstuffs and snacks with considerable protein content. The mushroom flour shows good functional characteristics for use in many food industries.
Yaoqi Zhang; Wei Geng; Yueqin Shen; Yanling Wang; Yu-Cheng Dai
2014-01-01
Mushrooms traditionally collected from forests and now more cultivated have recently become the products of the fifth-largest agricultural sector in China. It was estimated that more than 25 million farmers in China are currently engaged in the collection, cultivation processing and marketing of mushrooms. The total value of mushroom products amounted to 149 billion RMB Yuan (24 billion USD) in 2011. The raw materials have expanded from a few hardwoods to a variety of woods and increasing mor...
Potočnik, Ivana; Stepanović, Miloš; Rekanović, Emil; Todorović, Biljana; Milijašević-Marčić, Svetlana
2015-01-01
The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...
Mleczek, Mirosław; Magdziak, Zuzanna; Gąsecka, Monika; Niedzielski, Przemysław; Kalač, Pavel; Siwulski, Marek; Rzymski, Piotr; Zalicka, Sylwia; Sobieralski, Krzysztof
2016-10-01
The aim of the study was to (i) investigate the potential of edible mushroom Boletus badius (Fr.) Fr. to accumulate 53 elements from unpolluted acidic sandy soil and polluted alkaline flotation tailing sites in Poland, (ii) to estimate the low-molecular-weight organic acid (LMWOA) profile and contents in fruit bodies, and finally (iii) to explore the possible relationship between elements and LMWOA content in mushrooms. The content of most elements in fruiting bodies collected from the flotation tailings was significantly higher than in mushrooms from the unpolluted soils. The occurrence of elements determined in fruiting bodies of B. badius has been varied (from 0.01 mg kg -1 for Eu, Lu, and Te up to 18,932 mg kg -1 for K). The results established the high importance of element contents in substrate. Among ten organic acids, nine have been found in wide range: from below 0.01 mg kg -1 for fumaric acid to 14.8 mg g -1 for lactic acid. Lactic and succinic acids were dominant in both areas, and citric acid was also in high content in polluted area. The correlation between element contents and the individual and total content of LMWOAs was confirmed.
Koutrotsios, Georgios; Larou, Evangelia; Mountzouris, Konstantinos C; Zervakis, Georgios I
2016-09-01
Environmentally acceptable disposal of olive cultivation residues (e.g., olive prunings; olive pruning residues (OLPR)) and olive mill wastes is of paramount importance since they are generated in huge quantities within a short time. Moreover, olive mill wastewater (OMW) or sludge-like effluents ("alperujo"; two-phase olive mill waste (TPOMW)) are highly biotoxic. Hericium erinaceus is a white-rot fungus which produces choice edible mushrooms on substrates rich in lignocellulosics, and its suitability for the treatment of olive by-products was examined for the first time. Fungal growth resulted in a notable reduction of OMW's pollution parameters (i.e., 65 % decolorization, 47 % total phenolic reduction, and 52 % phytotoxicity decrease) and correlated with laccase and manganese peroxidase activities. Solid-state fermentation of various mixtures of OLPR, TPOMW, and beech sawdust (control) by H. erinaceus qualified OLPR in subsequent cultivation experiments, where it exhibited high mushroom yields and biological efficiency (31 %). Analyses of proximate composition and bioactive compound content revealed that mushrooms deriving from OLPR substrates showed significantly higher crude fat, total glucan, β-glucan, total phenolics, and ferric-reducing antioxidant potential values than the control. H. erinaceus demonstrated the potential to detoxify OMW and bioconvert OLPR into high-quality biomass, and hence, this fungus could be successfully exploited for the treatment of such by-products.
Fernandes, Ângela; Antonio, Amilcar L.; Barreira, João C.M.; Botelho, M. Luísa; Oliveira, M.B.P.P.; Martins, Anabela; Ferreira, Isabel C.F.R.
2013-01-01
TThe short shelf-life of mushrooms is an obstacle to the distribution and marketing of the fresh product. There has been extensive research on finding the most appropriate technology for mushrooms preservation and a particular interest arises for wild species. Treatment by irradiation emerges as a possible conservation technique that has been tested successfully in several food products. Herein, the effects of gamma irradiation on Lactarius deliciosus (L. ex Fr.) S. F....
Antioxidants of edible mushrooms
Kozarski, Maja; Klaus, Anita; Jakovljevic, Dragica; Todorovic, Nina; Vunduk, Jovana; Petrović, Predrag; Niksic, Miomir; Vrvic, Miroslav M.; Griensven, Van Leo
2015-01-01
Oxidative stress caused by an imbalanced metabolism and an excess of reactive oxygen species (ROS) lead to a range of health disorders in humans. Our endogenous antioxidant defense mechanisms and our dietary intake of antioxidants potentially regulate our oxidative homeostasis. Numerous synthetic
Directory of Open Access Journals (Sweden)
M. M. Akhtar
2016-08-01
Full Text Available Pleurotusostreatus mushroom was cultivated on cotton gin waste amended with wheat bran in order to judge its growth potential. Two substrates (cotton gin waste and wheat bran were employed alone and with different combinations. Experiment consisted of four treatments T0 (100 % cotton gin waste, T1(97% cotton gin waste + 3% wheat bran, T2(94% cotton gin waste + 6% wheat bran and T3(91% cotton gin waste + 9% wheat bran. Data about time needed for commencement of spawn run, time needed for completion of mycelial growth, time needed for initiation of pinheads, time needed for harvesting of 1st, 2nd and 3rd flush, fresh weight of 1st, 2nd and 3rd flush harvested, total yield, pH of mushroom, total soluble solids of mushroom, acidity and ascorbic acid contents, reducing sugars, non-reducing sugars and total sugars of mushroom, total nitrogen, phosphorus and potassium contents of mushroom was recorded. T0 (100 % cotton gin waste performed better as compared to other treatments.
Interaction of uranium with Pleurotus sp
International Nuclear Information System (INIS)
Ohnuki, Toshihiko; Sakamoto, Fuminori; Kozaki, Naofumi; Ozaki, Takuro; Samadfam, Mohammad
2002-01-01
Uptake of uranium by higher fungi, such as mushroom is little elucidated. We have studied the interaction of uranium with Pleurotus sp. (a mushroom) in pure culture over a wide range of U concentration (50-3000 mg/L). The Pleurotus sp. was cultured in two different media. One was rice bran medium, and the other was agar (yeast extract, peptone and dextrose) medium. The uptake of uranium in Pleurotus sp. was examined by alpha ray autoradiography (A,A), X-ray fluorescence spectroscopy (XRF) and scanning microcopy (SEM) equipped with EDS. In the agar medium, the higher uranium concentration gave lower growth of mycelia, and no fruiting body was observed. In the rice bran medium, the fruiting body was grown at U concentrations up to 1000 mg/L. The AA and XRF analysis showed that uranium taken up in the fruiting body was below the detection limit. The SEM-EDS analysis indicated that U was distributed in the limited region and was not transported to the mycelia far from U containing medium. It is concluded that uranium affects the growth of Pleurotus sp., and little uranium is taken up by Pleurotus sp. during the growth of both mycelia and fruiting body. (author)
Akihisa, Toshihiro; Franzblau, Scott Gary; Tokuda, Harukuni; Tagata, Masaaki; Ukiya, Motohiko; Matsuzawa, Tsunetomo; Metori, Koichi; Kimura, Yumiko; Suzuki, Takashi; Yasukawa, Ken
2005-06-01
Seven sterols (1-7) and eight polyisoprenepolyols (8-15), isolated from the non-saponifiable lipid fraction of the dichloromethane extract of an edible mushroom, Hypsizigus marmoreus (Buna-shimeji), were tested for their antitubercular activity against Mycobacterium tuberculosis strain H37Rv using the Microplate Alamar Blue Assay (MABA). Six sterols (2-7) and two polyisoprenepolyols (8, 12) showed a minimum inhibitory concentration (MIC) in the range of 1-51 microg/ml, while the others (1, 9-11, 13-15) were inactive (MIC>128 microg/ml). The seven sterols (1-7) and three polyisoprenepolyols (8, 10, 12) were further evaluated for their inhibitory effects on Epstein-Barr virus early antigen (EBV-EA) activation induced by the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) in Raji cells. Sterols 6 and 7 showed potent inhibitory effects while preserving the high viability of Raji cells.
Growth and fruit body formation of Pleurotus ostreatus on media supplemented with inorganic selenium
Directory of Open Access Journals (Sweden)
Savić Milena D.
2009-01-01
Full Text Available Selenium is a trace mineral chemically related to sulfur and tellurium. In the body selenium combines with protein molecules to form selenoproteins and it is distributed in low concentrations and unequally in air, soil and water all over the world. Edible mushrooms are known to be selenium accumulators. Since mushrooms contain relatively high protein levels, and they can accumulate large amounts of selenium, it is reasonable to expect that selenium could be incorporated into proteins. The growth of mycelia and fruit body formation of different medicinal mushroom strains of Pleurotus ostreatus (Hk-35 and P70 over the wide range of concentrations of inorganic form of selenium were examined. Mushrooms were cultivated on agar base media and on substrates based on sawdust. Vegetative growths of mycelium were measured as colony diameter in pure cultures supplemented with inorganic form of Se supplements, prepared as Na2SeO4 and Na2SeO3 in concentrations of: 1, 10, 25, 50, 75, 100 and 150 mg/l. Inorganic form of Se supplements, showed stimulation effects (in concentration of 1-50 mg/l and toxic effects in higher concentration. On the standard industrial sawdust based substrate, supplemented with 100 mg/kg Na2SeO4 and Na2SeO3, accumulation of Se in fruit bodies was determined by the method of flameless atomic absorption spectrophotometer. The readings were performed on Varian SpectrAA-10 spectrophotometer equipped with VGA-76. Se as Na2SeO4 and Na2SeO3 was effectively taken up from substrates and accumulated in fruit bodies. Mushrooms accumulated selenium between 120 and 250 mg/kg dry weight. In mushrooms cultivated without Se supplement, Se contents were only about 1 mg/kg and in substrate about 0.1 mg/kg.
International Nuclear Information System (INIS)
Lakshmi, B.; Janardhanan, K.K.; Tilak, J.C.; Devasagayam, T.P.A.; Adhikari, S.
2005-01-01
Exposure to radiation or 2.2' Azobis(2-amidopropane) dihydrochloride (AAPH) induces generation of reactive oxygen species (ROS) especially hydroxyl radical ( . OH) and peroxyl radical (ROO . ), which are capable of inducing lipid peroxidation. Our earlier studies have demonstrated that extracts of the medicinal and edible mushrooms Ganoderma lucidum, Pleurotus florida, Pleurotus sajor-caju and Phellinus rimosus possessed significant antioxidant activity, measured as radical scavenging. In the present study, we examined the protective effect of these mushroom extracts against radiation- and AAPH-induced lipid peroxidation using rat liver and brain mitochondria as model systems. The results obtained showed that the investigated mushroom extracts significantly inhibited the formation of lipid hydroperoxide and thiobarbituric acid reactive substances, indicating membrane protective effects. The finding suggests the profound protective effect of the extracts of the fruiting bodies of G. lucidum, P. florida, P. sajor-caju and P. rimosus against lipid peroxidation by two major forms of ROS capable of inducing this type of damage in a major organelle, the mitochondria from both rat liver and brain. This observation can possibly explain the health benefits of these mushrooms. (author)
African Journals Online (AJOL)
badr
2011-11-07
Nov 7, 2011 ... Evaluation of nutritional substrate and physical stress. (gamma ... cows. Lavi et al. (2010) stated that mushroom poly- saccharides are potent substances that exhibit anti-tumor ...... A brief history of heat, chemical and radiation.
Renata Zawirska-Wojtasiak; Marek Siwulski; Sylwia Mildner-Szkudlarz; Erwin Wąsowicz
2009-01-01
The aroma of several strains of Pleurotus ostreatus, Pleurotus citrinopileatus and Pleurotus djamor was studied by GC/MS. Three main mushrooms aroma constituents: 3-octanol, 3-octanone and 1-octen-3-ol were taken into account for quantitative measurements. The highest amount of 1-octen-3-ol was recorded in P. ostreatus, while considerably lower amounts in P. citrinopileatus. Sensory profile analysis as well as the electronic nose also varied between the three species of Pleurotus. Chiral gas ...
Grogan, Helen M.; Gaze, R. H.
2000-01-01
A survey of fungicide resistance among isolates of the mushroom pathogens Cladobotryum mycophilum and C. dendroides Types I and II was undertaken, with respect to the active ingredients thiabendazole, carbendazim (benzimidazoles) and prochloraz manganese following an epidemic in Britain and Ireland in 1994/95. The majority of isolates (41/57) were strongly resistant to thiabendazole (ED50 > 200 ppm) and were exclusively C. dendroides Type II. All C. mycophilum and C. dendroides Type I isolate...
Suárez Arango, Carolina
2010-01-01
Los macromicetos han sido parte de la cultura humana desde hace miles de años y han sido reportados como alimento humano en las más importantes civilizaciones de la historia. Se han descrito muchísimas propiedades nutricéuticas de los macromicetos, como lo son sus propiedades anticancerígenas y antitumorales, hipocolesterolémicas, antivirales, antibacterianas, inmunomoduladoras, entre otras. Igualmente, han sido descritas sus propiedades nutricionales, tienen un elevado contenido de proteína,...
Wong, Ka-Hing; Cheung, Peter C K; Wu, Jin-Zhong
2003-11-19
The proximate composition of sclerotia of Pleurotus tuber-regium, Polyporus rhinoceros, and Wolfiporia cocos, together with the yield, purity, monosaccharide profile, and microstructure of their insoluble dietary fiber (IDF) and soluble dietary fiber (SDF) fractions prepared from AOAC enzymatic-gravimetric methods were investigated and compared. All three sclerotia were typical carbohydrate rich sclerotia [ranging from 90.5 to 98.1% dry matter (DM)] with an exceptionally low amount of crude lipid content (ranging from 0.02 to 0.14% DM). Besides, all three sclerotia possessed substantial amounts of IDF (ranging from 77.4 to 94.6% DM) with notably high levels of nonstarch polysaccharides (NSP) (89.9-92.2% DM) in which glucose was the predominant sugar residue (90.6-97.2% of NSP DM). On the contrary, both the yield (only ranging from 1.45 to 2.50% DM) and the amount of NSP (ranging from 22.4 to 29.6% DM) of the three sclerotial SDF fractions were very low. Scanning electron micrographs showed fragments of interwoven hyphae and insoluble materials in the three sclerotial IDF fractions, but only an amorphous structure of soluble materials was observed in the SDF fractions. The potential use of these fiber preparations was discussed.
Directory of Open Access Journals (Sweden)
Ricardo Sposina S. Teixeira
2010-01-01
Full Text Available Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR, Drimaren Blue X-BLN (DMBBLN, Drimaren Rubinol X-3LR (DMR, and Drimaren Blue C-R (RBBR. The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid, and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1 h and RBBR (80–90%, 24 h with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1 h and DMBBLN (63–84%, 24 h. The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24 h.
Baskaran, Asweni; Chua, Kek Heng; Sabaratnam, Vikineswary; Ravishankar Ram, Mani; Kuppusamy, Umah Rani
2017-01-13
Pleurotus giganteus (Berk. Karunarathna and K.D. Hyde), has been used as a culinary mushroom and is known to have medicinal properties but its potential as an anti-inflammatory agent to mitigate inflammation triggered diseases is untapped. In this study, the molecular mechanism underlying the protective effect of ethanol extract of P. giganteus (EPG) against lipopolysaccharide (LPS) and combination of LPS and hydrogen peroxide (H 2 O 2 )-induced inflammation on RAW 264.7 macrophages was investigated. The effect of EPG on nitric oxide (NO) production as an indicator of inflammation in RAW 264.7 macrophages was estimated based on Griess reaction that measures nitrite level. The expressions of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), NF-kB activating protein (NKAP), signal transducer and activator of transcription 3 protein (STAT 3) and glutathione peroxidase (GPx) genes were assessed using real time reverse transcription polymerase chain reaction (RT-PCR) approach. EPG (10 μg/ml) showed the highest reduction in the LPS-induced NO production in RAW 264.7 macrophages and significantly suppressed (p < 0.05) the expression iNOS, STAT 3 and COX-2. There was a significant increase (p < 0.05) in combination of LPS and H 2 O 2 - induced iNOS production when compared to the LPS-induced iNOS production in RAW 264.7 macrophages and this concurred with the NO production which was attenuated by EPG at 10 μg/ml. A significant (p < 0.05) down regulation was observed in the combination of LPS and H 2 O 2 -induced iNOS and GPx expression by EPG. Our data suggest that the anti-inflammatory activity of EPG is mediated via the suppression of the STAT 3 and COX-2 pathways and can serve as potential endogenous antioxidant stimulant.
Katya, Kumar; Yun, Yong-hyun; Park, Gunhyun; Lee, Jeong-Yeol; Yoo, Gwangyeol; Bai, Sungchul C.
2014-01-01
The present experiment was conducted to evaluate the efficacy of dietary fermented by-product of mushroom, Pleurotus ostreatus, (FBPM) as a fish meal (FM) replacer in juvenile Amur catfish, Silurus asotus. A total number of 225 fish averaging 5.7±0.1 g (mean±standard deviation) were fed one of the five experimental diets formulated to replace FM with FBPM at 0%, 5%, 10%, 20%, and 30% (FBPM0, FBPM5, FBPM10, FBPM20, and FBPM30, respectively). At the end of eight weeks of the experiment, average weight gain (WG) of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM20 or FBPM30 diets (p<0.05). However, there was no significant differences in WG among the fish fed FBPM0, FBPM5 or FBPM10, and between fish fed FBPM10 or FBPM20, and also between those fed FBPM20 or FBPM30 diets. Lysozyme activity of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM10, FBPM20 or FBPM30 diets (p<0.05). The chemiluminescent response of fish fed FBPM5 was significantly higher than those of fish fed FBPM0, FBPM20 or FBPM30 diets (p<0.05). Broken line regression analysis of WG suggested that the maximal dietary inclusion level for FBPM as a FM replacer could be 6.3% without any adverse effects on whole body composition and on serological characteristics. Therefore, these results may indicate that the maximal dietary inclusion level of FBPM as a FM replacer could be 6.3% in juvenile Amur catfish. PMID:25178300
Huang, Yu-Ting; Onose, Jun-ichi; Abe, Naoki; Yoshikawa, Kunie
2009-04-23
Increasing attention has been focused on food-drug interactions. We have investigated the inhibitory effect of Chinese edible mushrooms, Boletus calopus and Suillus bovinus, on cytochrome P450 (CYP) 1A2, 2C9, 2D6, and 3A4, the main drug-metabolizing enzymes. Three pulvinic acid derivatives, atromentic acid (1), variegatic acid (2), and xerocomic acid (3), isolated from Boletus calopus and Suillus bovinus, revealed nonspecific inhibitory effects on all four CYPs. Using these compounds, the maximum IC50 values obtained with CYP3A4 in vitro were atromentic acid (1), 65.1+/-3.9 microM; variegatic acid (2), 2.2+/-0.1 microM; and xerocomic acid (3), 2.4+/-0.1 microM. Variegatic acid (2) and xerocomic acid (3) were effective inhibitors, comparable to cimetidine, dicoumarol, erythromycin, safrole, and uniconazole. Variegatic acid (2) and xerocomic acid (3) efficiently reduced ferryl myoglobin in CYPs. Reduction of ferryl heme to ferric heme is likely the mechanism of the nonspecific inhibitory effects of these compounds on CYPs.
Czech Academy of Sciences Publication Activity Database
Eggen, T.; Šašek, Václav
2002-01-01
Roč. 4, č. 3 (2002), s. 255-261 ISSN 1521-9437 Grant - others:GA of the Center for Molecular and Gene Biotechnology(XC) LN00B030; Norwegian Research Founding grant(NO) 113788/720 Program:LN Institutional research plan: CEZ:AV0Z5020903 Keywords : biodegradation * bioremediation * contaminated soil Subject RIV: EE - Microbiology, Virology
Directory of Open Access Journals (Sweden)
Nuhu Alam
2011-01-01
Full Text Available Background: Pleurotus ferulae is an edible mushroom has been widely used for nutritional and medicinal purposes. Irrespective of the medicinal importance or therapeutic potentials of P. ferulae, there have not been studies on anti-hyperlipidemic properties. Therefore, the present study investigates the effects of dietary P. ferulae fruiting bodies on plasma and feces biochemical and on the liver histological status in hypercholesterolemic rats. Methods: Six weeks old female Sprague-Dawley albino rats were divided into three groups of 10 rats each. Then biochemical and histological examinations were performed. Results: Feeding of a diet containing 5% P. ferulae fruiting bodies to hypercholesterolemic rat reduced plasma total cholesterol, triglyceride, low-density lipoprotein (LDL, total lipid, phospholipids, and LDL/high-density lipoprotein ratio by 30.02, 49.31, 71.15, 30.23, 21.93, and 65.31%, respectively. Mushroom also significantly reduced body weight in hypercholesterolemic rats. However, it had no adverse effects on plasma albumin, total bilirubin, direct bilirubin, creatinin, blood urea nitrogen, uric acid, glucose, total protein, calcium, sodium, potassium, chloride, inorganic phosphate, magnesium, and enzyme profiles. Feeding mushroom increased total lipid and cholesterol excretion in feces. The plasma lipoprotein fraction, separated by agarose gel electrophoresis, indicated that P. ferulae significantly reduced plasma β and pre-β-lipoprotein, while increased the α-lipoprotein. A histological study of hepatic cells by conventional hematoxylin-eosin and oil red O staining showed normal findings for mushroom-fed hypercholesterolemic rats. Conclusions: The present study suggests that 5% P. ferulae diet supplement provides health benefits, at least partially, by acting on the atherogenic lipid profile in hypercholesterolemic rats.
ANTIMICROBIAL PROPERTIES OF PLEUROTUS ERYNGII AND LENTINUS EDODES HYDRO-ALCOHOLIC EXTRACTS
Directory of Open Access Journals (Sweden)
Gabriela Popa
2016-11-01
Full Text Available Besides superior nutritional values mushrooms posed significant medicinal properties. Hydro-alcoholic extracts of several isolates of Pleurotus eryngii and Lentinus edodes mushroom species were investigated for their antimicrobial activities against pathogenic microorganisms with medicinal importance. Antimicrobial activities of the extracts were evaluated by the agar disk diffusion method. Results revealed that the 70% ethylic alcohol extracts have significant inhibitory activities against Bacillus subtilis var. spizizinii, Escherichia coli and Staphylococcus aureus. The results showed that the 70% ethanol extracts of Pleurotus eryngii and Lentinus edodes mushroom isolates may have biopharmaceutical potentiality.
Biodegradation of endocrine disruptors in urban wastewater using Pleurotus ostreatus bioreactor.
Křesinová, Zdena; Linhartová, Lucie; Filipová, Alena; Ezechiáš, Martin; Mašín, Pavel; Cajthaml, Tomáš
2018-07-25
The white rot fungus Pleurotus ostreatus HK 35, which is also an edible industrial mushroom commonly cultivated in farms, was tested in the degradation of typical representatives of endocrine disrupters (EDCs; bisphenol A, estrone, 17β-estradiol, estriol, 17α-ethinylestradiol, triclosan and 4-n-nonylphenol); its degradation efficiency under model laboratory conditions was greater than 90% within 12 days and better than that of another published strain P. ostreatus 3004. A spent mushroom substrate from a local farm was tested for its applicability in various batch and trickle-bed reactors in degrading EDCs in model fortified and real communal wastewater. The reactors were tested under various regimes including a pilot-scale trickle-bed reactor, which was finally tested at a wastewater treatment plant. The result revealed that the spent substrate is an efficient biodegradation agent, where the fungus was usually able to remove about 95% of EDCs together with suppression of the estrogenic activity of the sample. The results showed the fungus was able to operate in the presence of bacterial microflora in wastewater without any substantial negative effects on the degradation abilities. Finally, a pilot-scale trickle-bed reactor was installed in a wastewater treatment plant and successfully operated for 10days, where the bioreactor was able to remove more than 76% of EDCs present in the wastewater. Copyright © 2017 Elsevier B.V. All rights reserved.
Modification of growth conditions by mm-waves of wood-decaying mushrooms cultures
International Nuclear Information System (INIS)
Avagyan, I.A.
2016-01-01
Basidial macromycetes are not only value food, but can be used as source of such biological active compounds as the genistein, β -glucans, glioxal-oxidase et al. In this work we used different frequencies of extremely high frequency of electromagnetic irradiation (EHF EMI) with the aim of obtaining mushroom cultures with increased fermentative activity by the modulation of its growth conditions during growth on the peptone media. We investigated the influence of the non-thermal extremely high frequency electromagnetic waves in the interval of 45-53 GHz on β-glucosidase activities of two species of wood-decaying mushroom. In this study we examined the most popular edible wood-decaying mushroom Pleurotus ostreatus, which is wide-spread in the forests and commercial mushroom Lentinula edodes, under influence of such an abiotic factor as the extremely high frequency waves in the interval of 45 GHz - 53 GHz during 20 and 40 min on the 7th day of mycelial culture's growth. After the treatment of cultures we continued their growth and on the 3th day we examined the influence of these waves on fermentative activity of mycelial extracts. The some conditions of such treatment led to significant rising of β-glucosidase activities in the extracts of mycelial cultures
International Nuclear Information System (INIS)
Nozaki, Hirofumi; Itonori, Saki; Sugita, Mutsumi; Nakamura, Kimihide; Ohba, Kiyoshi; Suzuki, Akemi; Kushi, Yasunori
2008-01-01
Interferon (IFN)-γ and interleukin (IL)-4 regulate many types of immune responses. Here we report that acidic glycosphingolipids (AGLs) of Hypsizigus marmoreus and Pleurotus eryngii induced secretion of IFN- γ and IL-4 from T cells in a CD11c-positive cell-dependent manner similar to that of α-galactosylceramide (α-GalCer) and isoglobotriaosylceramide (iGb3), although activated T cells by AGLs showed less secretion of cytokine than those activated by α-GalCer. In addition, stimulation of these mushroom AGLs induced proliferation of NK1.1 α/β TCR-double positive cells in splenocytes. Administration of a mixture of α-GalCer and AGLs affected the stimulation of α-GalCer and generally induced a subtle Th1 bias for splenocytes but induced an extreme Th2 bias for thymocytes. These results suggested that edible mushroom AGLs contribute to immunomodulation
Directory of Open Access Journals (Sweden)
Antônio Gilberto Bertechini
2009-08-01
Full Text Available Avaliou-se a adição dietética de um composto exaurido da produção do cogumelo Pleurotus sajor caju sobre o desempenho de frangos de corte nos períodos de um a 21, 22 a 38 e um a 38 dias de idade. Foram utilizados 500 pintos de um dia Ross-308, machos, em delineamento inteiramente casualizado, com cinco tratamentos, obtidos pelos níveis do composto na ração (0; 0,5; 1,0; 1,5 e 2,0% com quatro repetições de 20 aves cada. Foram avaliados ganho de peso, consumo de ração, conversão alimentar, rendimento de carcaça, gordura abdominal e altura das microvilosidades do intestino. A adição do composto não influenciou no consumo da ração e na conversão alimentar. Para o ganho de peso houve efeito positivo somente na fase inicial (um a 21 dias, sendo o valor máximo obtido com a adição de 0,67% do composto. A adição do composto não alterou o rendimento de carcaça e gordura abdominal, porém, alterou a altura das microvilosidades do intestino. A adição de composto exaurido da produção do fungo Pleurotus sajor caju, na concentração de 0,67%, melhora o ganho de peso dos frangos nos primeiros 21 dias de idadeThis research evaluated the effect of the addition of a spent mushroom substrate (SMS Pleurotus sajor caju at different levels on the performance of broiler chicks from 1 to 21, 22 to 38 and 1 to 38 days of age. Five hundred one-day-old Ross-308 chicks were utilized, allocated in a completely randomized design, with five treatments obtained by increased levels of compost on ration (0; 0.5; 1.0; 1.5 and 2.0%, with four replicates of 20 birds per experimental unit. The intake, weight gain, feed conversion, carcass yield, abdominal fat and villus height were evaluated. No effect was observed on intake and feed conversion when the compost was included in the feeding. A positive effect was observed for weight gain from 1 to 21 days of age, with maximum value of 0.67% of SMS, but its addition did not modify the carcass yield and
Energy Technology Data Exchange (ETDEWEB)
Okada, S.; Oide, E.; Oshima, Y.; Tsuji, H. [Obayashi Corp., Tokyo (Japan)
2000-01-10
Bioremediation is a viable and cost effective method for soil contaminated with a variety of chemical pollutants. White-rot fungi, with emitted extracellular free radicals, are known to be able to decompose lignin, which is usually nonbiodegradable by most bacteria. The decomposition mechanism has been shown to be attributed, at least in part, to lignolytic peroxidases. We examined a method that utilizes edible mushroom cultivation waste as the microbial source, and found that these waste materials have high lignolytic peroxidase activity and degradated polyaromatic hydrocarbons in sands. (author)
Directory of Open Access Journals (Sweden)
Verena Weidmann
2013-10-01
Full Text Available Allylic oxidations of olefins to enones allow the efficient synthesis of value-added products from simple olefinic precursors like terpenes or terpenoids. Biocatalytic variants have a large potential for industrial applications, particularly in the pharmaceutical and food industry. Herein we report efficient biocatalytic allylic oxidations of spirocyclic terpenoids by a lyophilisate of the edible fungus Pleurotus sapidus. This ‘’mushroom catalysis’’ is operationally simple and allows the conversion of various unsaturated spirocyclic terpenoids. A number of new spirocyclic enones have thus been obtained with good regio- and chemoselectivity and chiral separation protocols for enantiomeric mixtures have been developed. The oxidations follow a radical mechanism and the regioselectivity of the reaction is mainly determined by bond-dissociation energies of the available allylic CH-bonds and steric accessibility of the oxidation site.
[Biotechnological cultivation of edible macrofungi: an alternative for obtaining nutraceutics].
Suárez Arango, Carolina; Nieto, Ivonne Jeannette
2013-01-03
Macromycetes have been part of the human culture for thousand years, and have been reported as food in the most important civilizations in history. Many nutraceutical properties of macromycetes have been described, such as anti-cancer, anti-tumour, cholesterol lowering, antiviral, antibacterial, or immunomodulatory, among others. Given that production of mushrooms by traditional cultivation and extraction of bioactive metabolites is very difficult in some cases, biotechnology is essential for the development of profitable and productive techniques for obtaining these metabolites. It is the development of this technology, and the ease in which it enables the use of its variables that has allowed mycelium to be cultivated in liquid medium of macrofungi, with a significant reduction in time and an increased production of metabolites. This increased production has led to the study of compounds that have medicinal, nutriceutical and quasi-farmaceutical potential, in the exhausted media and the mycelium. The aim of this review is to provide an overview of the use of liquid-state fermentation as a technological tool for obtaining edible fungi, and the study of these and their metabolites, by describing the different cultivation conditions used in recent years, as well as the results obtained. The relevance of Agaricus, Flammulina, Grifola, Pleurotus and Lentinula genera, will also be discussed, with emphasis on the last one, since Shiitake has been always considered as the ultimate medicinal mushroom. Copyright © 2011 Revista Iberoamericana de Micología. Published by Elsevier España, S.L. All rights reserved.
Characteristics of radiocesium concentration by mushrooms and microorganisms
International Nuclear Information System (INIS)
Sugiyama, Hideo; Terada, Hiroshi; Kuwahara, Chikako; Shibata, Hisashi; Maeda, Yoko; Kato, Fumio
2000-01-01
The 137 Cs values in cultured edible fruiting bodies of Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus) were 2-3 orders of magnitude higher than those in the wild mushrooms. The concentration ratio (CR, 137 Cs or Cs concentration in the dried cultured fruiting bodies or mycelia/ 137 Cs or Cs concentration in the fresh medium) suggested that 137 Cs in the medium actively migrated into the mushroom. The 137 Cs and stable Cs uptake by the cultured fruiting bodies of P. ostreatus were affected by the presence of K the same as the mycelia. Streptomyces lividans TK24 (S.lividans) and Streptomyces sp. TOHO-2 (Streptomyces sp.), one of the soil microorganisms, grown in the presence of Cs showed high accumulation of Cs in the mycelia. Elementary analysis of P. ostreatus and S. lividans were performed using a scanning electron microscopy-energy dispersive X-ray microanalyzer. The ratio of Cs in the stationary phase to that in the proliferation phase at the mycelial root of P. ostreatus formed in the early stage was about five times that at the mycelial tip. S. lividans and Streptomyces sp. grown on the YM agar plate containing CsCl showed white spots locating at a similar intervals. Concentrations of Cs, P, O and Mg in the white spots were higher than those in other regions. (author)
Accumulation of Heavy Metals by Wild Mushrooms in Ibadan, Nigeria
Chinatu Charity Ndimele; Prince Emeka Ndimele; Kanayo Stephen Chukwuka
2017-01-01
Background. Many companies in Nigeria generate industrial effluents, including heavy metals. These metals can be accumulated by biota such as mushrooms, which are then eaten by the populace. Objectives. The present study investigates the metal content of wild mushrooms in order to educate the local population on the safety of their consumption. Methods. Seven different species of wild mushrooms (Cortinarius melliolens, Chlorophyllum brunneum, Pleurotus florida, Volvariella speciosa, Can...
Directory of Open Access Journals (Sweden)
Simone Parola
2017-10-01
Full Text Available Background: Mushrooms produce a large amount of medicinal compounds, and are also an optimal source of fibres, proteins, vitamins (like groups B and D, and other micronutrients including potassium, magnesium, etc. Consequently, mushrooms are commonly considered to be functional foods. Many works report the high biological potentials of medicinal mushrooms involving their antibacterial, hypoglycaemic, anticholesterolemic, radical scavenging, and anti-inflammatory effects. Context and purpose of this study: First off, this work aimed to find strains of Lentinula edodes and Pleurotus ostreatus from a bank of edible mushrooms bought from international strain banks (Table I that could possess health benefit related properties, such as a radical scavenging activity (antioxidant effect, antibacterial effects against common pathogenic bacteria, and being able to produce interesting nutrients and secondary metabolites. As the fungal bank comprises of 20 strains of L. edodes and 20 strains of P. ostreatus, a first screening was made by the selection of 13 strains for each mushroom able to grow in multiple wood types or that were particularly productive and had proved good growth reproducibility over the last 5 years. This work also studied the correlation between culture conditions and mushroom quality in terms of the previously reported properties. Comparison among the selected strains was operated by the assessment of antioxidant and antimicrobial activities after different sample treatments. Furthermore, an initial optimization of the analytic techniques was produced for the direct estimation of important secondary metabolites and nutrients by means of HPLC-MS/MS technique. Further research will encompass an evaluation of transformation processes (drying, freezing, rehydration, cooking, etc. impact on radical scavenging, antibacterial activity, and possible degradation/loss of nutraceutically important substances such as vitamin D2, ergothioneine
Influence of growing conditions on heavy metals content in cultivated mushrooms
International Nuclear Information System (INIS)
Kmitene, L.
1997-01-01
The aim of the research was to investigate the influence of growing terms, microclimate conditions and growing medium on the mushroom harvest and quality. Champignons were grown according to the Polish technology. Pleurotus ostreatus was grown in perforate sacks using chopped wheat straw. Mycelium was sowed in different terms. It was established that the harvest of mushrooms, especially their quality, depends not only on growing conditions, but also on the kind of mushrooms, composte quality, mushroom size (diameter of cap), picking of mushrooms, storage time and other conditions. The technology of mushroom growing will be developed after studying all the factors determining the content of heavy metals and radiation in mushrooms
The Amoebicidal Effect of Ergosterol Peroxide Isolated from Pleurotus ostreatus.
Meza-Menchaca, Thuluz; Suárez-Medellín, Jorge; Del Ángel-Piña, Christian; Trigos, Ángel
2015-12-01
Dysentery is an inflammation of the intestine caused by the protozoan parasite Entamoeba histolytica and is a recurrent health problem affecting millions of people worldwide. Because of the magnitude of this disease, finding novel strategies for treatment that does not affect human cells is necessary. Ergosterol peroxide is a sterol particularly known as a major cytotoxic agent with a wide spectrum of biological activities produced by edible and medicinal mushrooms. The aim of this report is to evaluate the amoebicidal activity of ergosterol peroxide (5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol isolated from 5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol) (Jacq.) P. Kumm. f. sp. Florida. Our results show that ergosterol peroxide produced a strong cytotoxic effect against amoebic growth. The inhibitory concentration IC50 of ergosterol peroxide was evaluated. The interaction between E. histolytica and ergosterol peroxide in vitro resulted in strong amoebicidal activity (IC50 = 4.23 nM) that may be due to the oxidatory effect on the parasitic membrane. We also tested selective toxicity of ergosterol peroxide using a cell line CCL-241, a human epithelial cell line isolated from normal human fetal intestinal tissue. To the best of our knowledge, this is the first report on the cytotoxicity of ergosterol peroxide against E. histolytica, which uncovers a new biological property of the lipidic compound isolated from Pleurotus ostreatus (Jacq.) P. Kumm. f. sp. Florida. Copyright © 2015 John Wiley & Sons, Ltd.
Improving biological efficiency of Oyster mushroom, Pleurotus ...
African Journals Online (AJOL)
International Journal of Biological and Chemical Sciences ... Yield improvement were observed in both pigeon pea and sunflower seed cake supplemented treatments with the highest mycelium vigor (91.65%) and biological ... Keywords: biological efficiency, compost, mycelium vigor, pigeon pea, sunflower seed cake
Decontamination of Fumonisin B1 in maize grain by Pleurotus eryngii and antioxidant enzymes
Directory of Open Access Journals (Sweden)
Miriam HAIDUKOWSKI
2017-05-01
Full Text Available Fumonisin B1 (FB1 is among the most common mycotoxins found in maize kernels and maize products worldwide. The microbiological process of detoxification and transformation of toxic organic pollutants is a promising method for foodstuffs decontamination. Some basidiomycetes, such as the Pleurotus eryngii species complex, include several important commercial edible varieties that can detoxify polycyclic organic compounds and a range of wastes and pollutants. We investigated the potential role of P. eryngii, one of the most consumed mushrooms, in the decontamination of FB1 in maize. In addition, selected antioxidant enzymes, (soluble peroxidase (POD, catalase (CAT and ascorbate peroxidase, primarily involved in control of cell hydrogen peroxide levels, and lignin degradation, were analyzed, to evaluate their contributions to the molecular mechanisms of FB1 by P. eryngii. FB1 decontamination by P. eryngii and involvement of CAT and POD enzymes in the control of toxic decontamination levels of H2O2 were demonstrated. A consistent reduction of FB1 was observed at different incubation times. The average decrease levels of FB1, with respect to the control cultures, ranged from 45 to 61% (RSD < 15%. This study is a possible eco-friendly approach to reducing this mycotoxin in the feed supply chains.
Directory of Open Access Journals (Sweden)
Georgios I. Zervakis
2013-01-01
Full Text Available Two-phase olive mill waste (TPOMW, “alperujo” is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota, that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120–135% for Pleurotus spp. and 125% for A. cylindracea and productivity in subsequent cultivation experiments on substrates supplemented with 20–40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium. Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste.
Zervakis, Georgios I; Koutrotsios, Georgios; Katsaris, Panagiotis
2013-01-01
Two-phase olive mill waste (TPOMW, "alperujo") is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota), that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120-135% for Pleurotus spp. and 125% for A. cylindracea) and productivity in subsequent cultivation experiments on substrates supplemented with 20-40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium). Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste.
Zheng, Shi; Shan, Luying; Zhuang, Yongliang; Shang, Ying
2018-03-01
As a well-known edible fungus rich in nutrients, Pleurotus ostreatus has been used as an alternative to expensive wild edible fungi. Specifically, the fact that using P. ostreatus instead of other expensive wild edible fungi has damaged the rights and interests of consumers. Among the existing methods for detection of food adulteration, the amplification of endogenous reference gene is the most accurate method. However, an ideal endogenous reference gene for P. ostreatus has yet to be developed. In this study, a DNA extraction method for P. ostreatus was optimized, and pyrG was selected as a species-specific gene through sequence alignment. This gene was subsequently subjected to qualitative and quantitative Polymerase Chain Reaction (PCR) assays with 3 different P. ostreatus varieties and 7 other species. A low detection limit of 5 pg/μL was obtained by TaqMan quantitative PCR, and no pyrG amplification product was observed in the 7 other species. No allelic variation was detected in P. ostreatus varieties. These experiments confirmed that pyrG was an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus. This method was also suitable for the examination of processed P. ostreatus samples and determination of adulteration in wild mushrooms. The pyrG gene was chosen as an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus, and the detection limit was 5 pg/μL for the quantification. This method is used not only for raw materials but also for processed P. ostreatus products and other processed mushroom foods. © 2018 Institute of Food Technologists®.
Falandysz, Jerzy; Zhang, Ji; Zalewska, Tamara
2017-03-01
This study, for the first time, presents the results of activity concentration determinations for 137 Cs and 40 K in a high number (21 species, 87 composite samples, and 807 fruiting bodies) of mushrooms of the genus Boletus from across Yunnan in 2011-2014 and Sichuan (Boletus tomentipes) using high-resolution high-purity germanium detector. Activity concentrations of 137 Cs demonstrated some variability and range from Boletus species from different sampling sites. No activity concentrations from 134 Cs were detected in any mushrooms. Internal dose rates estimated were from intake of 1 kg of mushrooms per annum for 137 Cs range for species and regions from around Boletus species.
Phat, Chanvorleak; Moon, BoKyung; Lee, Chan
2016-02-01
Seventeen edible mushrooms commercially available in Korea were analysed for their umami taste compounds (5'-nucleotides: AMP, GMP, IMP, UMP, XMP; free amino acids: aspartic, glutamic acid) and subjected to human sensory evaluation and electronic tongue measurements. Amanita virgineoides featured the highest total 5'-nucleotide content (36.9 ± 1.50 mg/g), while monosodium glutamate-like components (42.4 ± 6.90 mg/g) were highest in Agaricus bisporus. The equivalent umami concentration (EUC) ranged from 1.51 ± 0.42 to 3890 ± 833 mg MSG/g dry weight; most mushrooms exhibited a high umami taste. Pleurotus ostreatus scored the highest in the human sensory evaluation, while Flammulina velutipes obtained the maximum score in the electronic tongue measurement. The EUC and the sensory score from the electronic tongue test were highly correlated, and also showed significant correlation with the human sensory evaluation score. These results suggest that the electronic tongue is suitable to determine the characteristic umami taste of mushrooms. Copyright © 2015 Elsevier Ltd. All rights reserved.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Symbiosis and synergy: Can mushrooms and timber be managed together?
Sally. Duncan
2000-01-01
Recreational and tribal use of mushrooms has been historically important, and during the last two decades, commercial demand for mushrooms has burgeoned. A large nontimber forest product market in the Pacific Northwest is for various species of wild edible mushrooms. Many of these species grow symbiotically with forest trees by forming nutrient exchange structures...
Soler-Rivas, C.; Garcia-Rosado, A.; Polonia, I.; Junca-Blanch, G.; Marin, F.R.; Wichers, H.J.
2006-01-01
When olive mill wastes (OMWs) and vegetation waters (VWs) obtained during the manufacture of olive oil were added as substrate supplements for the cultivation of Pleurotus pulmonarius the material modified growth of the mushroom and the endemic microbiota of the substrate, in particular the
International Nuclear Information System (INIS)
Inam-ul-Haq, M.; Khan, M.N.; Khan, M.A.; Khan, M.A.; Javed, N.; Binyamin, R.; Irshad, G.
2010-01-01
Different of concentration of four medicinal plants viz., Eucalyptus camaldulensis, Azadirachta indica, Citrus lemon, Cymbopogon marginatus were investigated for the effect of certain active components in their parts, capable of increasing mushroom yield and controlling mushrooms pathogenic microbes which cause great loss in mushroom yield. Four strains of Oyster mushroom were selected on the basis of their well mycelial growth on MEA. For selection of best compost simple composts were also prepared without any medicinal plant products i.e., cotton, wheat, paddy straw. Corn stover composts and cotton compost gave the maximum yield. The dried leaves of the Citrus lemons, lemon grass and Neem cake (dried) were crushed, and the sawdust of the logs of Eucalyptus were incorporated with different doses of 2%, 3%, 4%, 5% w/w of substrates with cotton substrate before compost fermentation. Each of the compost bag having specific medicinal plant product with specific concentration were spawned with selected four strains of Oyster mushroom i.e., two local strain Pleurotus florida (P-17), Pleurotus ostreatus (P- 19) and two exotic strains Pleurotus (florida) ostreatus (WC536), Pleurotus ostreatus (WC-522). Spawn running and mushroom fruitification were allowed to develop under optimum environmental condition. The mushroom yield data of compost bags with different concentration of medicinal plant products plants were calculated. The results showed that presence of Neem cake and Citrus lemon in the substrate increased the yield of Oyster mushroom strains i.e. Pleurotus florida) ostreatus (WC-536) followed by P. ostreatus (WC-522) strain. Neem cake and Citrus lemon were more promising in improving yield of mushroom. These results led to the conclusion that addition of specific medicinal plants concentration to compost increases the yield of Oyster mushroom by reducing the incidence of microbes and is more preferable than chemicals due to their lethal effects during human
Molecular identification and artificial cultivation of a wild isolate of oyster mushroom in Albania
Directory of Open Access Journals (Sweden)
Jordan Merkuri
2016-03-01
Full Text Available Basidiomata of a wild mushroom macroscopically recognised as Pleurotus ostreatus were observed on an oak trunk in a mixed wood of northern Albania. Pure cultures of the fungus were then obtained on potato-dextrose-agar medium. Molecular analyses of genomic DNA of the fungus confirmed its identification. The rDNA ITS region nucleotide sequence of the studied Pleurotacea matched at 99% those of two P. ostreatus strains already present in NCBI GenBank database. The rDNA ITS nucelotide sequences of two pure cultures of the Albanian P. ostreatus were deposited in EMBL database under the accession numbers LN849458 and LN849459. One of the fungus isolates was subsequently cultivated under protected and semi-natural conditions. Productivity and biological efficiency of the Albanian P. ostreatus ranged from about 10% to 16% and from 33 to 53.33%, respectively. This seems to be the first report on the artificial cultivation of P. ostreatus in Albania and could have, in the next future, a high economic impact on development and diffusion of this important edible mushroom over the country.
Selenium content of mushrooms.
Stijve, T
1977-07-29
The selenium contents of 83 species of wild mushrooms were determined by oxygen combustion of the sample, followed by conversion of selenite to bromopiazselenol and final estimation by electron capture gas-liquid chromatography. Selenium concentration were found to range from 0.012-20.0 mg/kg dry weight. Selenium content was species-dependent. High concentrations were found in Agaricaceae and in certain Boletaceae of the genus Tubiporus, whereas in Russulaceae, Amanitaceae and Cantharellaceae selenium-rich species were absent or rare. Ascomycetes and all mushrooms growing on wood had a very low selenium content. The highest selenium concentrations (up to 20 ppm) were found in Boletus (Tubiporus) edulis, a most popular edible mushroom. Analyses of various parts of carpophores of B. edulis, Suillus luteus and Amanita muscaria indicate that in all three species the stalk contains less selenium than the fleshy part of the cap. In Boletus and Suillus the highest selenium content was found in the tubes.
African Journals Online (AJOL)
Administrator
The influence of fungus treatment on the biochemical composition and degradation patter of sawdust and cotton plant by-products (cotton burns and cotton gin trash) by Pleurotus sajor caju were evaluated. Lignin degradation increased as the incubation period progressed while the highest loss of hemicellulose, cellulose ...
Determination of Cr, Cu, Fe, Ni, Pb and Zn by ICP-OES in mushroom samples from Sakarya, Turkey
Directory of Open Access Journals (Sweden)
Esra Altıntığ
2017-06-01
Full Text Available Russula cyanoxantha, Russula delica, Lactarius salmonicolor, Lactarius deliciosus, Pleurotus eryngii, Pleurotus ostreatus, Agaricus bisporus, Suillus luteus, Pleurotus spp and Boletus edulis were collected from Sakarya-Turkey respectively. Also canned food in the form of the Pleurotus eryngii, Pleurotus ostreatus, and Lactarius salmonicolor mushrooms were used for the examination. Trace metal concentrations found in these mushrooms were determined inductively using coupled plasma optic emission spectrometry microwave processes. The results were obtained for (Cr 0.3-26.65, (Cu 17.38-132.75, (Fe 26.3-225.40, (Ni 2.57-39.28, (Pb 11.52-185.20, and (Zn 22.86-126.84 mg/kg. The accuracy of the method was checked by the standard reference material; tea leaves (INCY-TL-1 and tomato leaves (1573a.
Directory of Open Access Journals (Sweden)
Rosa María Espinosa-Valdemar
2015-05-01
Full Text Available Waste with high biomass content generated in cities in developing countries is sent to landfills or open dumps. This research aims to degrade biomass content in urban waste through cultivation, at pilot scale, of the edible mushroom Pleurotus ostreatus. First, the number of diapers used by one baby per week was measured with a survey in day care facilities. Then, cellulose content of diapers was assessed. Finally, cultivation of P. ostreatus was carried out using as substrate a mixture of diapers with gardening waste, a co-substrate readily available at urban settings. The factors assessed were strain of P. ostreatus (grey BPR-81, white BPR-5, conditioning of the substrate (diapers with and without plastic and co-substrate (wheat straw, grass, and withered leaves. Results show that diapers are a valuable source of biomass, as generation of diapers with urine is 15.3 kg/child/month and they contain 50.2% by weight of cellulose. The highest reductions in dry weight and volume (>64% of substrates was achieved with the substrate diaper without plastic and co-substrate wheat straw. Although diapers with plastic and grass and leaves showed lower degradation, they achieved efficiencies that make them suitable as a co-substrate (>40%, considering that their biomass is currently confined in landfills.
Krügener, Sven; Krings, Ulrich; Zorn, Holger; Berger, Ralf G
2010-01-01
A selective and highly efficient allylic oxidation of the sesquiterpene (+)-valencene to the grapefruit flavour compound (+)-nootkatone was achieved with lyophilisate of the edible mushroom Pleurotus sapidus. The catalytic reaction sequence was elucidated through the identification of intermediate, (+)-valencene derived hydroperoxides. A specific staining of hydroperoxides allowed the semi-preparative isolation of two secondary (+)-valencene hydroperoxides, 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-4(S)-yl-hydroperoxide and 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-2(R)-yl-hydroperoxide. Chemical reduction of the biotransformation products yielded a tertiary alcohol identified as 2(R)-Isopropenyl-8(R),8a(S)-dimethyl-1,3,4,7,8,8a-hexahydro-2H-naphthalen-4a(R)-ol. This suggested a lipoxygenase-type oxidation of (+)-valencene via secondary and tertiary hydroperoxides and confirmed homology data of the key enzyme obtained previously from amino acid sequencing.
Concentration of radiocesium in cultivated mushrooms and substrates
International Nuclear Information System (INIS)
Miyake, Sadaaki; Higasa, Mamoru; Urabe, Ken-ichi; Haraguchi, Masato; Omura, Toshitaka
2008-01-01
Concentrations of 134 Cs, 137 Cs and 40 K in mushrooms cultivated in Saitama prefecture and those substrates were measured by gamma-ray spectrometry. In all mushrooms and substrates, 134 Cs was not detected. Concentrations of 137 Cs in mushrooms were in the range of 0.012 - 2.1 Bq/kg·fresh, and those in substrates were in the range of 0.080 - 1.8 Bq/kg·dry. Concentrations of 137 Cs in mushrooms varied widely with mushroom species, and the average concentration of 137 Cs in Lentinus edodes (Shiitake) was over 30 times higher than that in Pleurotus ostreatus (Hiratake). Mushroom-to-substrate concentration ratios of 137 Cs (fresh/dry) were 0.11-0.53. They were higher than the reported transfer factors for common agricultural plants. (author)
Sarikurkcu, Cengiz; Tepe, Bektas; Yamac, Mustafa
2008-09-01
The methanolic extracts of Lactarius deterrimus, Suillus collitinus, Boletus edulis, Xerocomus chrysenteron were analyzed for their antioxidant activities in different test systems namely beta-carotene/linoleic acid, DPPH free radical scavenging, reducing power and metal chelating activities in addition to their total phenolic and flavonoid contents. In beta-carotene/linoleic acid and DPPH systems, L. deterrimus and B. edulis showed the strongest activity patterns. Their activities were as strong as the positive controls. The reducing power of the species was excellent. Chelating capacity of the extracts was increased with the increasing concentration. On the other hand, B. edulis found to have the highest phenolic content. Total flavonoid content of S. collitinus found the superior to the other mushrooms.
Directory of Open Access Journals (Sweden)
Xueran Geng
2015-06-01
Full Text Available An 86-kDa homodimeric angiotensin I-converting enzyme (ACE inhibitory protein designated as LTP was isolated from fruit bodies of the mushroom Leucopaxillus tricolor. The isolation procedure involved ultrafiltration through a membrane with a molecular weight cutoff of 10-kDa, ion exchange chromatography on Q-Sepharose, and finally fast protein liquid chromatography-gel filtration on Superdex 75. LTP exhibited an IC50 value of 1.64 mg∙mL−1 for its ACE inhibitory activity. The unique N-terminal amino acid sequence of LTP was disclosed by Edman degradation to be DGPTMHRQAVADFKQ. In addition, seven internal sequences of LTP were elucidated by liquid chromatography-tandem mass spectrometry (LC-MS/MS analysis. Results of the Lineweaver-Burk plot suggested that LTP competitively inhibited ACE. Both LTP and the water extract of L. tricolor exhibited a clear antihypertensive effect on spontaneously hypertensive rats.
Kim, Kyung-Hee; Kang, Young Min; Im, Chak Han; Ali, Asjad; Kim, Sun Young; Je, Hee-Jeong; Kim, Min-Keun; Rho, Hyun Su; Lee, Hyun Sook; Kong, Won-Sik; Ryu, Jae-San
2014-01-01
Pleurotus eryngii has recently become a major cultivated mushroom; it uses tetrapolar heterothallism as a part of its reproductive process. Sexual development progresses only when the A and B mating types are compatible. Such mating incompatibility occasionally limits the efficiency of breeding programs in which crossing within loci-shared strains or backcrossing strategies are employed. Therefore, understanding the mating system in edible mushroom fungi will help provide a short cut in the development of new strains. We isolated and identified pheromone and receptor genes in the B3 locus of P. eryngii and performed a functional analysis of the genes in the mating process by transformation. A genomic DNA library was constructed to map the entire mating-type locus. The B3 locus was found to contain four pheromone precursor genes and four receptor genes. Remarkably, receptor PESTE3.3.1 has just 34 amino acid residues in its C-terminal cytoplasmic region; therefore, it seems likely to be a receptor-like gene. Real-time quantitative RT-PCR (real-time qRT-PCR) revealed that most pheromone and receptor genes showed significantly higher expression in monokaryotic cells than dikaryotic cells. The pheromone genes PEphb3.1 and PEphb3.3 and the receptor gene PESTE3.3.1 were transformed into P5 (A3B4). The transformants were mated with a tester strain (A4B4), and the progeny showed clamp connections and a normal fruiting body, which indicates the proposed role of these genes in mating and fruiting processes. This result also confirms that PESTE3.3.1 is a receptor gene. In this study, we identified pheromone and receptor genes in the B3 locus of P. eryngii and found that some of those genes appear to play a role in the mating and fruiting processes. These results might help elucidate the mechanism of fruiting differentiation and improve breeding efficiency.
Researches on Pleurotus ostreatus mushroom’s quality cultivated on coffee grounds
Directory of Open Access Journals (Sweden)
Sorina Ropciuc
2016-10-01
Full Text Available The objectives of this work were to evaluate the possibility of using coffee grounds for cultivating Pleurotus ostreatus mushrooms and determine the nutritional composition of Pleurotus ostreatus mushrooms produced on coffee grounds substrate. The results revealed a good fruiting of the fungus on coffee grounds and the biological effectiveness (weight of fresh mushroom reached about 97% after 30 days. We determined the total protein content in vitamin C, the total polyphenols and the activity of Polyphenol oxidases (PPOs enzyme on 32 samples of fresh Pleurotus ostreatus mushroom (top and bottom and subjected to heat treatments (blanching, boiling and freezing. The protein content was ranged between the values of 16.9 and 25.1g/ 100g and the Vitamin C content within the range of values presented 64.32-564.95 mg/100g. The polyphenol content results varied significantly in the analyzed samples varying between 1.887 – 7.667 mg GAE / 100 g vegetable product. The determination of the polyphenol oxidase enzyme responsible for enzymatically blackening of the fungus presented values in the range 0.274- 0.610mg / 100g.
Mycelial growth observation of Pleurotus eryngii (Higher Basidiomycota In Vitro
Directory of Open Access Journals (Sweden)
Mustafa Nadhim Owaid
2016-09-01
Full Text Available Five agro-substrates including date palm fibers (fibrillum, wheat straw, white sawdust and their combinations were investigated to grow Pleurotus eryngii. The longer mycelium complete time within bags was 20 days on sawdust (S4, in contrast, the shorter time for mycelium overgrew was completed after 15 days on date palm fiber (S5. In significant (p<0.05, S5 showed the higher growth intensity level (vigorous growth than other substrates. Thus use of date palm wastes (S5 medium may be useful for successfully cultivation king oyster mushroom in farm.International Journal of Environment Vol.5(3 2016, pp.1-10
Directory of Open Access Journals (Sweden)
Vera Akiko Maihara
2012-09-01
Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.Muitos estudos têm encontrado elementos tóxicos em cogumelos. Sabe-se que algumas espécies de cogumelos comestíveis acumulam elevados níveis de contaminantes inorgânicos, como cádmio, mercúrio e chumbo. Há cerca de duas mil espécies de cogumelos comestíveis, mas apenas 25 espécies são cultivadas e usadas como alimentos. No Brasil, as espécies mais comercializadas e consumidas são Agaricus bisporus, conhecida como Champignon de Paris; Lentinus edodes ou Shitake, e Pleurotus sp, também chamada de Shimeji ou Hiratake. Neste trabalho, o cádmio (Cd foi determinado em amostras de cogumelos da espécie Lentinus edodes cultivadas em diversas cidades do Estado de São Paulo e algumas amostras importadas do Japão e da China. O cádmio foi determinado por espectrometria de absor
Directory of Open Access Journals (Sweden)
Chaozhong Guo
2015-12-01
Full Text Available The development of highly stable and efficient electrocatalysts for sluggish oxygen reduction reaction (ORR is exceedingly significant for the commercialization of fuel cells but remains a challenge. We here synthesize a new nitrogen-doped biocarbon composite material (N-BC@CNP-900 as a nitrogen-containing carbon-based electrocatalyst for the ORR via facile all-solid-state multi-step pyrolysis of bioprotein-enriched enoki mushroom as a starting material, and inexpensive carbon nanoparticles as the inserting matrix and conducting agent at controlled temperatures. Results show that the N-BC@CNP-900 catalyst exhibits the best ORR electrocatalytic activity with an onset potential of 0.94 V (versus reversible hydrogen electrode, RHE and high stability. Meanwhile, this catalyst significantly exhibits good selectivity of the four-electron reaction pathway in an alkaline electrolyte. It is notable that pyridinic- and graphtic-nitrogen groups that play a key role in the enhancement of the ORR activity may be the catalytically active structures for the ORR. We further propose that the pyridinic-nitrogen species can mainly stabilize the ORR activity and the graphitic-nitrogen species can largely enhance the ORR activity. Besides, the addition of carbon support also plays an important role in the pyrolysis process, promoting the ORR electrocatalytic activity.
Guo, Chaozhong; Sun, Lingtao; Liao, Wenli; Li, Zhongbin
2015-12-23
The development of highly stable and efficient electrocatalysts for sluggish oxygen reduction reaction (ORR) is exceedingly significant for the commercialization of fuel cells but remains a challenge. We here synthesize a new nitrogen-doped biocarbon composite material (N-BC@CNP-900) as a nitrogen-containing carbon-based electrocatalyst for the ORR via facile all-solid-state multi-step pyrolysis of bioprotein-enriched enoki mushroom as a starting material, and inexpensive carbon nanoparticles as the inserting matrix and conducting agent at controlled temperatures. Results show that the N-BC@CNP-900 catalyst exhibits the best ORR electrocatalytic activity with an onset potential of 0.94 V ( versus reversible hydrogen electrode, RHE) and high stability. Meanwhile, this catalyst significantly exhibits good selectivity of the four-electron reaction pathway in an alkaline electrolyte. It is notable that pyridinic- and graphtic-nitrogen groups that play a key role in the enhancement of the ORR activity may be the catalytically active structures for the ORR. We further propose that the pyridinic-nitrogen species can mainly stabilize the ORR activity and the graphitic-nitrogen species can largely enhance the ORR activity. Besides, the addition of carbon support also plays an important role in the pyrolysis process, promoting the ORR electrocatalytic activity.
Radiopasteurization of sawdust media used in propagation of mushrooms
International Nuclear Information System (INIS)
Ito, Hitoshi; Sato, Tomotaro
1975-01-01
In our country, cultivation of mushrooms such as Pleurotus ostreatus, Kuehneromyces nameko, and Lentinus edodes (Cortinellus shiitake) are expanding, and has reached considerable amounts. These mushrooms are cultivated generally on decaying logs of broad leaf trees. Recently, these mushrooms are also cultivated artificially on the sawdust-media containing rice bran and other nutrient in the room of which temperature is controlled. However, these artificial culture media must be germicidated for 2 or 6 hours at 100 to 120 0 C before inoculation of mushroom spawn. In this study, attempts were made to cultivate Pleurotus ostreatus on the sawdust-media pasteurized by ionizing radiation. Inhibition of mushrooms growth were caused mainly by multiplication of Citrobacter and Fusarium, and these organisms were eliminated by a dose of 0.5 Mrad gamma irradiation. A surprising result was that many of sawdust media subjected to 0.5, 1.0 and 2.0 Mrad increased mycelial growth rates more than heat treatments, and also mushroom yields were enhanced. The multiplication of remaining microorganisms such as Bacillus and yeasts after irradiation with a dose of 0.5 Mrad or 1.0 Mrad did not inhibit the mycelial growth of mushrooms. (auth.)
Directory of Open Access Journals (Sweden)
Yongxiang Kang
2012-12-01
Full Text Available The aim of the study was to investigate knowledge and use of wild food plants and fungi in Han (i.e. Chinese nationality villages in central China, including famine plants used in the respondents' childhood. A valley adjacent to the extremely species-rich temperate forest vegetation of the Taibai Nature Reserve was chosen. Eighty-two people from 5 villages took part in the study. Altogether, 159 wild food plant species and 13 fungi folk taxa were mentioned by informants. The mean number of freelisted wild foods was very high (24.8; median – 21.5. An average respondent listed many species of wild vegetables (mean – 17, me- dian – 14.5, a few wild fruits (mean – 5.9 and median – 6 and very few fungi (mean – 1.9, median – 1, which they had eaten. Over 50% of respondents mentioned gathering the young shoots or leaves of Celastrus orbiculatus, Staphylea bumalda and S. holocapra, Caryopteris divaricata, Helwingia japonica, Pteridium aquilinum, Pimpinella sp., Amaranthus spp., Matteucia struthiopteris, Allium spp., Cardamine macrophylla and Chenopodium album. Only one species of fruits (Schisandra sphenanthera and none of the mushrooms were mentioned by over half of the respondents. Although very diverse, it can be noted that the use of wild vegetables has decreased compared to the second half of the 20th century, as informants listed several plants which they had stopped using (e.g. Abelia engleriana due to the availability of cultivated vegetables and other foodstuffs. On the other hand, the collection of the most well-known wild vegetables is maintained by selling them to tourists visiting agritourist farms, and restaurants.
Directory of Open Access Journals (Sweden)
Marcelo José Silveira Ruegger
2001-10-01
Full Text Available The edible mushroom Oudemansiella canarii (Jungh. Höhn is common in the Brazilian territory, being found in different biomas, where they colonize several plant species. In this study, the O. canarii cultivation was evaluated in polypropilene bags containing sugar-cane bagasse (200 g or eucalyptus sawdust (200 g supplemented with wheat bran (50 g. The composts were sterilized at 121ºC for 1 hour, after cooling they were inoculated with 3 g of spawn and then remained incubated at 25ºC until the basidiomata primordia formation. The mushrooms, harvested after the pilei opening, presented varied sizes reaching 9 cm of diameter and 10 cm of height. The fresh mushrooms presented mild taste and soft consistency. When kept at 4ºC, they maintained good appearance and good consistency for 7 days. In a period of 60 days, the largest basidiomata production was obtained in the compost with sugar-cane bagasse, showing greater productivity (4.47% ± 1.34, biological efficiency (55.66% ± 20.41 and compost consumption (38.78% ± 4.59 averages. Wilcoxon's non-parametric statistical analysis used to compare the biomass production in the two composts, showed significant differences at 5% significance level.O cogumelo comestível Oudemansiella canarii (Jungh. Höhn., é comum no território brasileiro, sendo encontrado em diferentes biomas, onde colonizam várias espécies vegetais. Neste estudo, o cultivo deste basidiomiceto foi realizado em sacos plásticos contendo bagaço de cana-de-açúcar (200 g ou serragem de eucalipto (200 g suplementados com farelo de trigo (50 g. Os substratos foram esterilizados a 121ºC por 1 hora, inoculados com 3 g de grãos de trigo colonizados por micélio do fungo e permaneceram incubados a 25ºC até a formação dos primórdios dos basidiomas. Os cogumelos, colhidos após a abertura do píleo, apresentaram tamanhos variados chegando a atingir 9 cm de diâmetro por 10 cm de altura. Os cogumelos frescos apresentaram paladar
Potential applications of the white rot fungus Pleurotus in bioregenerative life support systems
Manukovsky, N. S.; Kovalev, V. S.; Yu, Ch.; Gurevich, Yu. L.; Liu, H.
Earlier we demonstrated the possibility of using soil-like substrate SLS for plant cultivation in bioregenerative life support systems BLSS We suggest dividing the process of SLS bioregeneration at BLSS conditions into two stages At the first stage plant residues should be used for growing of white rot fungus Pleurotus ostreatus Pleurotus florida etc The fruit bodies could be used as food Spent mushroom compost is carried in SLS and treated by microorganisms and worms at the second stage The possibility of extension of human food ration is only one of the reasons for realization of the suggested two-stage SLS regeneration scheme people s daily consumption of mushrooms is limited to 200 -250 g of wet weight or 20 -25 g of dry weight Multiple tests showed what is more important is that inclusion of mushrooms into the system cycle scheme contributes through various mechanisms to the more stable functioning of vegetative cenosis in general Taking into account the given experimental data we determined the scheme of mushroom module material balance The technological peculiarities of mushroom cultivation at BLSS conditions are being discussed
Directory of Open Access Journals (Sweden)
Marcel Golian
2015-02-01
Full Text Available According to influence of population increasing followed by agricultural soils decreasing there is noticed a necessity of individual food commodities production intensification. There is also needed to think about some new unconventional and alternative sort of food-stuff. An edible mushroom growing is one of the relatively new agricultural branches, whereby on a large scale there are grown species which belong to saprophytic group. The aim of task was the building – technological and equipment – technological proposal of oyster (Pleurotus ostreatus, Jacq. P. Kumm production unit with taking account to its specific agro technical requirements and valid legislative. In the next part of task there were evaluated and compared qualitative and quantitative parameters of sporocarps from two variants which were collected in the first growth wave and accuracy of the proposed oyster production unit. In case of variant A there were used sacks with substrates, which have been exposed to cold shock by 6°C temperature for 4 days and in variant B were used substrates without cold shock. According to reached results the cold shock had almost neither influence on production quantity. There was found out an important fact that crop height from first growth wave wasn´t identical with well-known literature sources. The low crop is connected with high CO2 content in oyster production unit room, according to our opinion. Other equipment aimed to air humidity regulation, air temperature regulation and room lights was designed correctly.
Omarini, Alejandra; Dambolena, José Sebastián; Lucini, Enrique; Jaramillo Mejía, Santiago; Albertó, Edgardo; Zygadlo, Julio A
2016-03-01
Biotechnological conversion of low-cost agro-industrial by-products, such as industrial waste or terpenes from the distillation of essential oils from plants into more valuable oxygenated derivatives, can be achieved by using microbial cells or enzymes. In Argentina, the essential oil industry produces several tons of waste each year that could be used as raw materials in the production of industrially relevant and value-added compounds. In this study, 1,8-cineole, one of the components remaining in the spent leaves of the Eucalyptus cinerea waste, was transformed by solid-state fermentation (SSF) using the two edible mushrooms Pleurotus ostreatus and Favolus tenuiculus. As a result, two new oxygenated derivatives of 1,8-cineole were identified: 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-ol and 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-one. Additionally, changes in the relative percentages of other aroma compounds present in the substrate were observed during SSF. Both fungal strains have the ability to produce aroma compounds with potential applications in the food and pharmaceutical industries.
Mleczek, Mirosław; Niedzielski, Przemysław; Kalač, Pavel; Siwulski, Marek; Rzymski, Piotr; Gąsecka, Monika
2016-01-01
Due to limited data-describing abilities of mushrooms to accumulate platinum group elements (PGEs) and rare-earth elements (REEs), the aim of this study was to determine, by inductively coupled plasma optical emission spectrometry followed by microwave-assisted sample digestion by nitric acid, the content of these elements in 20 mushroom species (10 above ground and 10 growing on wood), mostly edible, collected near a busy trunk road. The highest content of PGEs in above-ground mushroom species was observed in Lepista gilva and Suillus bovinus fruit bodies (0.38 ± 0.05 and 0.37 ± 0.03 mg kg(-1) DW, respectively), while in mushrooms growing on wood, the highest content was observed in Pleurotus ostreatus (0.35 ± 0.04 mg kg(-1) DW). The mean content of PGEs for both these groups was 0.23 ± 0.08 and 0.26 ± 0.07 mg kg(-1) DW, respectively. The highest content of REEs in Suillus luteus and Tricholoma equestra was 5.03 ± 0.50 and 2.18 ± 0.56 mg kg(-1) DW, respectively, but within mushrooms growing on wood in Ganoderma applanatum fruiting bodies it was 4.19 ± 0.78 mg kg(-1) DW. Mean contents of REEs were 1.39 ± 1.21 and 1.61 ± 0.97 mg kg(-1) DW in above-ground species and species growing on wood, respectively. Generally, the group of mushroom species growing on wood was capable of slightly higher accumulation of both REEs and PGEs. No limits have been established for both the groups until now.
Radioactive cesium in Finnish mushrooms
International Nuclear Information System (INIS)
Kostiainen, E.; Ylipieti, J.
2010-02-01
Surveillance of radioactive cesium in Finnish mushrooms was started in 1986 at STUK. Results of the surveillance programs carried out in Lapland and other parts of Finland are given in this report. More than 2000 samples of edible mushrooms have been analysed during 1986-2008. The 137 Cs detected in the mushrooms mainly originates from the 137 Cs deposition due to the accident at the Chernobyl nuclear power plant in 1986. The 137 Cs concentrations of mushrooms in the end of 1970s and in the beginning of 1980s varied from some ten to two hundred becquerels per kilogram originating from the nuclear weapon test period. The uneven division of the Chernobyl fallout is seen in the areal variation of 137 Cs concentrations of mushrooms, the 137 Cs concentrations being about tenfold in the areas with the highest deposition compared to those where the deposition was lowest. After the Chernobyl accident the maximum values in the 137 Cs concentrations were reached during 1987-88 among most species of mushrooms. The 137 Cs concentrations have decreased slowly, being in 2008 about 40 per cent of the maximum values. The 137 Cs concentrations may be tenfold in the mushroom species with high uptake of cesium (Rozites caperatus, Hygrophorus camarophyllus, Lactarius trivialis) compared to the species with low uptake (Albatrellus ovinus, Leccinum sp.) picked in the same area. The 137 Cs contents in certain species of commercial mushrooms in Finland still exceed the maximum permitted level, 600 Bq/kg, recommended to be respected when placing wild game, wild berries, wild mushrooms and lake fish on the market (Commission recommendation 2003/274/Euratom). Therefore, the 137 Cs concentrations of mushrooms should be measured before placing them on the market in the areas of the highest 137 Cs deposition, except for Albatrellus ovinus, Boletus sp. and Cantharellus cibarius. The 137 Cs concentrations of common commercial mushroom species, Cantharellus tubaeformis and Craterellus
Radiocesium uptake mechanisms in wild and culture mushrooms
International Nuclear Information System (INIS)
Sugiyama, Hideo; Terada, Hiroshi; Isomura, Kimio; Tsukada, Hirofumi; Shibata, Hisashi.
1993-01-01
Concentrations of 137 Cs and stable Cs in wild mushrooms, cultivated mushrooms and those substrates were measured by gamma-ray spectrometry and neutron activation analysis. The average concentration of 137 Cs in 80 wild mushrooms in Japan was 87.5 Bq/kg (wet wt.), and concentration of 137 Cs in mycorrhizal mushrooms was higher than that of saprophytic mushrooms. High concentrations of 137 Cs were found in Pleurotus ostreatus (Fr.) Kummer Y-1, saprophytic mushrooms, cultivated in culture substrates containing high 137 Cs. Clear correlations with 5% level of significance were found between wild mushroom-to-substrate ratios (wet/dry) of 137 Cs concentration and those of stable Cs. Cultivated P. ostreatus-to-culture substrate ratios (wet/wet) of 137 Cs concentration were stable in the order of 10 0 when the culture substrate was containing 10 000 Bq/kg (wet wt.) of 137 Cs or 1 000 mg/kg (wet wt.) of stable Cs. The ratios of 137 Cs concentration in cultivated mushrooms were about equal to those in wild mushrooms. Higher concentration of 137 Cs in culture substrate after sampling P. ostreatus was observed at the upper layer where mycelium density was high. (author)
The first report on mushroom green mould disease in Croatia.
Hatvani, Lóránt; Sabolić, Petra; Kocsubé, Sándor; Kredics, László; Czifra, Dorina; Vágvölgyi, Csaba; Kaliterna, Joško; Ivić, Dario; Đermić, Edyta; Kosalec, Ivan
2012-12-01
Green mould disease, caused by Trichoderma species, is a severe problem for mushroom growers worldwide, including Croatia. Trichoderma strains were isolated from green mould-affected Agaricus bisporus (button or common mushroom) compost and Pleurotus ostreatus (oyster mushroom) substrate samples collected from Croatian mushroom farms. The causal agents of green mould disease in the oyster mushroom were T. pleurotum and T. pleuroticola, similar to other countries. At the same time, the pathogen of A. bisporus was exclusively the species T. harzianum, which is different from earlier findings and indicates that the range of mushroom pathogens is widening. The temperature profiles of the isolates and their hosts overlapped, thus no range was found that would allow optimal growth of the mushrooms without mould contamination. Ferulic acid and certain phenolic compounds, such as thymol showed remarkable fungistatic effect on the Trichoderma isolates, but inhibited the host mushrooms as well. However, commercial fungicides prochloraz and carbendazim were effective agents for pest management. This is the first report on green mould disease of cultivated mushrooms in Croatia.
Reingardiene, Dagmara; Vilcinskaite, Jolita; Lazauskas, Robertas
2005-01-01
The group of hallucinogenic mushrooms (species of the genera Conocybe, Gymnopilus, Panaeolus, Pluteus, Psilocybe, and Stropharia) is psilocybin-containing mushrooms. These "magic", psychoactive fungi have the serotonergic hallucinogen psilocybin. Toxicity of these mushrooms is substantial because of the popularity of hallucinogens. Psilocybin and its active metabolite psilocin are similar to lysergic acid diethylamide. These hallucinogens affect the central nervous system rapidly (within 0.5-1 hour after ingestion), producing ataxia, hyperkinesis, and hallucinations. In this review article there are discussed about history of use of hallucinogenic mushrooms and epidemiology; pharmacology, pharmacodynamics, somatic effects and pharmacokinetics of psilocybin, the clinical effects of psilocybin and psilocin, signs and symptoms of ingestion of hallucinogenic mushrooms, treatment and prognosis.
Jiang, Juan; Liu, Hongying; Li, Qiao; Gao, Ni; Yao, Yuan; Xu, Heng
2015-10-01
Remediation of soil co-contaminated with heavy metals and PAHs by mushroom and bacteria is a novel technique. In this study, the combined remediation effect of mushroom (Pleurotus cornucopiae) and bacteria (FQ1, Bacillus thuringiensis) on Cd and phenanthrene co-contaminated soil was investigated. The effect of bacteria (B. thuringiensis) on mushroom growth, Cd accumulation, phenanthrene degradation by P. cornucopiae and antioxidative responses of P. cornucopiae were studied. P. cornucopiae could adapt easily and grow well in Cd-phenanthrene co-contaminated soil. It was found that inoculation of FQ1 enhanced mushroom growth (biomass) and Cd accumulation with the increment of 26.68-43.58% and 14.29-97.67% respectively. Up to 100% and 95.07% of phenanthrene were removed in the bacteria-mushroom (B+M) treatment respectively spiked with 200mg/kg and 500mg/kg phenanthrene. In addition, bacterial inoculation alleviated oxidative stress caused by co-contamination with relative decreases in lipid peroxidation and enzyme activity, including malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). This study demonstrated that the integrated remediation strategy of bacteria and mushroom is an effective and promising method for Cd-phenanthrene co-contaminated soil bioremediation. Copyright © 2015 Elsevier Inc. All rights reserved.
Singh, Varinder; Bedi, Gurleen Kaur; Shri, Richa
2017-01-01
Management of type 2 diabetes by delaying or preventing glucose absorption using natural products is gaining significant attention. Edible mushrooms are well documented for their nutritional and medicinal properties. This investigation was designed to evaluate the antidiabetic activity of aqueous extracts of selected culinary-medicinal mushrooms, namely, Pleurotus ostreatus, Calocybe indica, and Volvariella volvacea, using in vitro models (α-amylase inhibition assay, glucose uptake by yeast cells, and glucose adsorption capacity). The most active extract was subsequently examined in vivo using the oral starch tolerance test in mice. All prepared extracts showed dose-dependent inhibition of α-amylase and an increase in glucose transport across yeast cells. C. indica extract was the most active α-amylase inhibitor (half-maximal inhibitory concentration, 18.07 ± 0.75 mg/mL) and exhibited maximum glucose uptake by yeast cells (77.53 ± 0.97% at 35 mg/mL). All extracts demonstrated weak glucose adsorption ability. The positive in vitro tests for C. indica paved the way for in vivo studies. C. indica extract (200 and 400 mg/kg) significantly (P < 0.05) reduced postprandial blood glucose peaks in mice challenged with starch. The extract (400 mg/kg) and acarbose normalized blood glucose levels at 180 minutes, when they were statistically similar to values in normal mice. Thus, it may be concluded that the antidiabetic effect of C. indica is mediated by inhibition of starch metabolism (α-amylase inhibition), increased glucose uptake by peripheral cells (promotion of glucose uptake by yeast cells), and mild entrapment (adsorption) of glucose. Hence, C. indica can be developed as antidiabetic drug after detailed pharmacological studies.
DEFF Research Database (Denmark)
Poojary, Mahesha Manjunatha; Orlien, Vibeke; Passamonti, Paolo
2017-01-01
In this study, enzyme-assisted extraction was performed to extract umami taste and total free amino acids (FAAs) from the six different mushrooms including shiitake (Lentinus edodes), oyster (Pleurotus ostreatus), tea tree (Agrocybe aegerita) and, white, brown and portobello champignons (Agaricus...
Oyster mushroom cultivation with rice and wheat straw.
Zhang, Ruihong; Li, Xiujin; Fadel, J G
2002-05-01
Cultivation of the oyster mushroom, Pleurotus sajor-caju, on rice and wheat straw without nutrient supplementation was investigated. The effects of straw size reduction method and particle size, spawn inoculation level, and type of substrate (rice straw versus wheat straw) on mushroom yield, biological efficiency, bioconversion efficiency, and substrate degradation were determined. Two size reduction methods, grinding and chopping, were compared. The ground straw yielded higher mushroom growth rate and yield than the chopped straw. The growth cycles of mushrooms with the ground substrate were five days shorter than with the chopped straw for a similar particle size. However, it was found that when the straw was ground into particles that were too small, the mushroom yield decreased. With the three spawn levels tested (12%, 16% and 18%), the 12% level resulted in significantly lower mushroom yield than the other two levels. Comparing rice straw with wheat straw, rice straw yielded about 10% more mushrooms than wheat straw under the same cultivation conditions. The dry matter loss of the substrate after mushroom growth varied from 30.1% to 44.3%. The straw fiber remaining after fungal utilization was not as degradable as the original straw fiber, indicating that the fungal fermentation did not improve the feed value of the straw.
Identification of Tanzanian saprophytic edible mushrooms
African Journals Online (AJOL)
ABUU SUMMAYYAH
After trimming of non-overlapping start/end positions of sequences as well as excluding ambiguously aligned regions, there were a total of 499 and 519 positions in the final datasets of LSU and ITS, respectively. Phylogenetic relationships. The phylogenetic tree using LSU datasets revealed two major clades. The first clade.
Proximate analysis on four edible mushrooms ADEDAYO ...
African Journals Online (AJOL)
Michael Horsfall
mycelium in the substrate upon which the fungus feeds; most often their mycelia are buried in the soil around the ... morning from farmlands in Egbe, Yagba West L.G.A. of Kogi State. .... that caution must be exercise in eating Chlorophyllum.
EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms
Energy Technology Data Exchange (ETDEWEB)
Bercu, V., E-mail: vbercu@gmail.co [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania); Negut, C.D., E-mail: dnegut@nipne.r [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania); Horia Hulubei National Institute for Physics and Nuclear Engineering, P.O. Box MG-6, 077125 Magurele (Ilfov) (Romania); Duliu, O.G., E-mail: duliu@b.astral.r [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania)
2010-12-15
The suitability of the EPR spectroscopy for detection of {gamma}-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel-Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom-Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle-Cantharellus cibarius Fr., as well as oyster mushroom-Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.
EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms
International Nuclear Information System (INIS)
Bercu, V.; Negut, C.D.; Duliu, O.G.
2010-01-01
The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel-Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom-Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle-Cantharellus cibarius Fr., as well as oyster mushroom-Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.
Mushroom cultivation, processing and value added products: a patent based review.
Singhal, Somya; Rasane, Prasad; Kaur, Sawinder; Garba, Umar; Singh, Jyoti; Raj, Nishant; Gupta, Neeru
2018-06-03
Edible mushrooms are an abundant source of carbohydrates, proteins, and multiple antioxidants and phytonutrients. This paper presents a general overview on the edible fungus describing the inventions made in the field of its cultivation, equipment and value added products. To understand and review the innovations and nutraceutical benefits of mushrooms as well as to develop interest regarding the edible mushrooms. Information provided in this review is based on the available research investigations and patents. Mushrooms are an edible source of a wide variety of antioxidants and phytonutrients with a number of nutraceutical properties including anti-tumor and anti-carcinogenic. Thus, several investigations are made for cultivation and improvement of the yield of mushrooms through improvisation of growth substrates and equipment used for mushroom processing. The mushroom has been processed into various products to increase its consumption, providing the health and nutritional benefit to mankind. This paper summarizes the cultivation practices of mushroom, its processing equipments, methods of preservation, value added based products, and its nutraceutical properties. The review also highlights the various scientific feats achieved in terms of patents and research publications promoting mushroom as a wholesome food. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Household methods to reduce {sup 137}Cs contents of mushrooms
Energy Technology Data Exchange (ETDEWEB)
Kostiainen, E. [Radiation and Nuclear Safety Authority - STUK, Helsinki (Finland)
2005-09-15
High radiocaesium contents in different species of mushrooms have been observed in areas contaminated by radiocaesium deposition after the Chernobyl accident in 1986. There has been no significant reduction in the {sup 137}Cs contents of mushrooms during the past ten years, besides via radioactive decay. The internal radiation dose received via mushrooms can be reduced by processing mushrooms before consumption. Various household methods were studied to find out their efficiency to reduce {sup 137}Cs contents of mushrooms. The methods tested were the same as normally used in cooking. The tests were made for the species of edible mushrooms widely consumed. The retention factors for the treatments tested were in most cases 0.2-0.3. The efficiency of treatments in reducing the {sup 137}Cs contents increased with larger water volumes and prolonged treatment times.
Household methods to reduce 137Cs contents of mushrooms
International Nuclear Information System (INIS)
Kostiainen, E.
2005-01-01
High radiocaesium contents in different species of mushrooms have been observed in areas contaminated by radiocaesium deposition after the Chernobyl accident in 1986. There has been no significant reduction in the 137 Cs contents of mushrooms during the past ten years, besides via radioactive decay. The internal radiation dose received via mushrooms can be reduced by processing mushrooms before consumption. Various household methods were studied to find out their efficiency to reduce 137 Cs contents of mushrooms. The methods tested were the same as normally used in cooking. The tests were made for the species of edible mushrooms widely consumed. The retention factors for the treatments tested were in most cases 0.2-0.3. The efficiency of treatments in reducing the 137 Cs contents increased with larger water volumes and prolonged treatment times
Oyster mushrooms (Pleurotus) are useful for utilizing lignocellulosic ...
African Journals Online (AJOL)
DR. ADEBAYO
2015-01-07
Jan 7, 2015 ... Agro-residues contain three major structural polymers, cellulose ... aggregated together in the form of micro-fibrils order that ... Rice straw. 29.2-34.7 ... Oat straw. 31-35 ...... production of banana shell and cassava starch. Dyna ...
Oyster mushrooms ( Pleurotus ) are useful for utilizing lignocellulosic ...
African Journals Online (AJOL)
The biodegradation and bioconversion of agro wastes (lignin, cellulose and hemicellulose) could have vital implication in cleaning our environment. The bioprocessing of lignin depends on the potent lignocellulolytic enzymes such as phenol oxidases (laccase) or heme peroxidases (lignin peroxidase (LiP), manganese ...
Alexander, Susan J; Pilz, David; Weber, Nancy S; Brown, Ed; Rockwell, Victoria A
2002-07-01
Wild edible mushrooms are harvested in the forests of the Pacific Northwest, where both trees and mushrooms grow in the same landscape. Although there has been some discussion about the value of trees and mushrooms individually, little information exists about the joint production of, and value for, these two forest products. Through four case studies, the information needed to determine production and value for three wild mushroom species in different forests of the Pacific Northwest is described, and present values for several different forest management scenarios are presented. The values for timber and for mushrooms are site- and species-specific. On the Olympic Peninsula in Washington, timber is highly valued and chanterelles are a low-value product by weight; timber has a soil expectation value (SEV) 12 to 200 times higher than chanterelles. In south-central Oregon, timber and American matsutake mushrooms have the potential to have about the same SEV. In eastern Oregon, timber is worth 20 to 110 times as much as the morels that grow in the forest. Production economics is concerned with choices about how much and what to produce with what resources. The choices are influenced by changes in technical and economic circumstances. Through our description and analysis of the necessary definitions and assumptions to assess value in joint production of timber and wild mushrooms, we found that values are sensitive to assumptions about changes in forest management, yields for mushrooms and trees, and costs.
Pardo-Giménez, Arturo; Catalán, Luis; Carrasco, Jaime; Álvarez-Ortí, Manuel; Zied, Diego; Pardo, José
2016-08-01
This work assesses the agronomic performance of defatted pistachio meal, after oil extraction, as a nutritional substrate supplement when growing the mushroom species Agaricus bisporus (Lange) Imbach and Pleurotus ostreatus (Jacq.) P. Kumm. Materials were applied at different doses at spawning. Along with non-supplemented substrates, commercial nutritional supplements were used as controls. Proximate analysis of mushrooms is also considered. For the cultivation of champignon, defatted pistachio meal has provided larger mushrooms (unitary weight and cap diameter) with firmer texture and greater content in dry weight and protein, without significant alterations in quantitative parameters. For Pleurotus ostreatus, the supplement led to significant yield increase, even providing up to 34.4% of increment compared to non-supplementation with meal, reaching a biological efficiency of 129.9 kg dt(-1) , when applied to the 15 g kg(-1) compost dose. Supplementation has also been conducted to increase dry weight, protein and fibre within carpophores and to decrease the energy value. Defatted pistachio meal has similar or better results compared to the commercial supplements used as reference. Compost supplementation with defatted pistachio meal in A. bisporus concerns mainly the quantitative parameters (size, texture, dry weight and protein). Based on the results obtained, this technique has greater potential of development for P. ostreatus commercial crops, basically due to expected increases in production, with a direct impact on benefits and crop profitability. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.
The use of the ITS region in marketable mushrooms authenticity
Nogueira, Liliana; Oliveira, Ivo; Baptista, Paula
2010-01-01
Edible mushrooms, due to their flavour and nutritional characteristics, are very popular in many dishes. Some species are high valuated and reaching high market values. There are frequent reports of adulteration of these kinds of products due to the presence of fungal species less expensive among others with high-value market. This adulteration occurs especially in products in which the flavour is not prominent and in which the mushrooms are difficult to examine. In this work we utilized the ...
African Journals Online (AJOL)
The pastoralists have been hopelessly trying to get rid of the bush through ... mushroom cultivation the mentioned problems can be solved yielding nutritious ..... Mean values within the same column with no common superscript letter differ at the 95% confidence level and the .... Encroachment in the Borana Low Land.
Structural Features and Healthy Properties of Polysaccharides Occurring in Mushrooms
Directory of Open Access Journals (Sweden)
Eva Guillamón
2012-12-01
Full Text Available Polysaccharides from mushrooms have attracted a great deal of attention due to the many healthy benefits they have demonstrated, such as immunomodulation, anticancer activity, prevention and treatment of cardiovascular diseases, antiviral and antimicrobial effects, among others. Isolation and purification of polysaccharides commonly involve several steps, and different techniques are actually available in order to increase extraction yield and purity. Studies have demonstrated that the molecular structure and arrangement significantly influence the biological activity; therefore, there is a wide range of analytical techniques for the elucidation of chemical structures. Different polysaccharides have been isolated from mushrooms, most of them consisting of β-linked glucans, such as lentinan from Lentinus edodes, pleuran from Pleurotus species, schizophyllan from Schizophyllum commune, calocyban from Calocybe indica, or ganoderan and ganopoly from Ganoderma lucidum. This article reviews the main methods of polysaccharide isolation and structural characterization, as well as some of the most important polysaccharides isolated from mushrooms and the healthy benefits they provide.
Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi
2013-01-01
Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.
Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.
Directory of Open Access Journals (Sweden)
José Maria Rodrigues da Luz
Full Text Available Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.
Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes
Directory of Open Access Journals (Sweden)
José Maria Rodrigues da Luz
2012-12-01
Full Text Available The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse. The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase and hydrolytic enzymes (cellulases, xylanases and tanases. Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6. These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes.
Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi
2013-01-01
Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057
Directory of Open Access Journals (Sweden)
Roberto Garibay-Orijel
2009-08-01
Full Text Available Los hongos comestibles son recursos forestales cuyo aprovechamiento sustentable depende del conocimiento de la distribución y productividad de sus esporomas. En el presente trabajo se evaluó la disponibilidad de 81 hongos comestibles por medio de la abundancia, distribución temporal y espacial de sus esporomas. Estas variables se integraron en un índice de importancia ecológica (VI que brinda una medida para estimar la disponibilidad de sus esporomas en los bosques. El estudio se realizó durante 2001 y 2002 en los bosques de Pinus-Quercus de Ixtlán de Juárez, Oaxaca. Las especies más abundantes fueron Laccaria laccata var. pallidifolia, Gymnopus confluens y Laccaria vinaceobrunnea. La especie con mayor producción de biomasa húmeda de esporomas (2.21 Kg/sitio de muestreo fue Laccaria laccata var. Pallidifolia. Sólo G. confluens y G. dryophilus produjeron esporomas desde principios de junio hasta finales de octubre. Las especies con mayor disponibilidad fueron L. laccata var. pallidifolia, G. confluens, L. vinaceobrunnea y H. purpurascens. La riqueza de hongos comestibles silvestres en Ixtlán es alta (96 especies, pero su disponibilidad es muy heterogénea (de L. laccata var. pallidifolia VI = 0.7905, a Helvella infula VI = 0.0055. Dentro del mismo bosque, en sitios relativamente cercanos la composición de especies es diferente y su producción de esporomas y biomasa son contrastantes.Wild edible mushrooms are non timber forest products whose sustainable use must have an ecological basis. In this work, we measured the availability of 81 edible mushrooms by means of their abundance, frequency, biomass production, temporal and spatial distribution of their fruiting bodies. These variables were integrated into an ecological importance index (IV which describes sporome availability in the forest. The research was carried out during 2001 and 2002 in the Pinus-Quercus forests of Ixtlán de Juárez, Oaxaca. The most abundant species were
[Knowledge of students of tourism and recreation Academy of Physical Education on wild mushrooms].
Chwaluk, Paweł; Parnicki, Florian
2011-01-01
Prophylaxis of acute poisoning with mushrooms is justified because of the relatively high risk of death associated with these intoxications. Mushrooming in Poland has a long tradition and knowledge about mushrooms is usually passed on in families. In recent years the mushrooming becomes an organized form of recreation. Graduates of tourism and recreation should have a minimum of reliable knowledge about mushrooms, to ensure the safety of persons entrusted to their care. The knowledge of wild mushrooms among students of tourism and recreation was tested by means of questionnaire. Mushrooms gathered 108 out of 125 respondents. The primary source of knowledge about mushrooms for 84% of the mushrooms pickers were the parents. Up to 70% of respondents considered at least one of irrational methods useful to distinguish edible mushrooms from the poisonous. Thirteen percent of those polled believed that by simple means mushrooms may be deprived of their toxic properties. Knowledge of the only one deadly poisonous mushrooms growing in Poland was 53%. The tourism and recreation students must pass basic knowledge about mushrooms and identify reliable sources of knowledge in this field.
Dose Response for Monokaryon mycelium of Pleurotus pulmonarius After Acute Gamma Radiation
International Nuclear Information System (INIS)
Wan Safina Wan Abdul Razak; Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus pulmonarius is locally known as Grey oyster. The species is popular and widely cultivated throughout the world mostly in Asia Europe as their simple and low cost production technology and higher biological efficiency. Mutation induction is an alternative ways for improving available commercial strain for better quality traits. Dose response is important in evaluating effects of mutagenesis via acute gamma radiation. Monokaryon mycelium of Pleurotus pulmonarius was exposed to acute gamma radiation ranged from 0 Gy, 0.1 kGy, 0.2 kGy, 0.3 kGy, 0.4 kGy, 0.5 kGy, 0.6 kGy, 0.7 kGy, 0.8 kGy, 0.9 kGy, 1.0 kGy, 1.5 Gy, 2.0 kGy, 3.0 kGy and 4.0 kGy at dose rate 0.013 kGy/ min. growth performance was measured at 2 days interval to get the LD_5_0. Increasing of the irradiation dose found to decrease the growth performance of the monokaryon mycelium. LD_5_0 was revealed at 1.56 kGy for mono karyon mycelium. Discoveries of the works are important for the improvement of Pleurotus species via acute gamma radiation and benefiting to growers and mushroom industries. (author)
Alternative substrates for higher mushrooms mycelia cultivation
Directory of Open Access Journals (Sweden)
TETIANA KRUPODOROVA
2015-12-01
Full Text Available Cultivation of 29 species of higher mushroom mycelia on alternative substrates – wastes of Ukrainian oil-fat industry, has been investigated. The amount of mushroom mycelia obtaining on 12 investigated substrates varied significantly, from 1.0 g/L to 22.9 g/L on the 14th day of cultivation. The superficial cultivation adopted in this study allows for easy to choose appropriate medium (substrate for mycelia production. Alternative substrates (compared to glucose-peptone-yeast medium were selected for all studied species, from soybean cake – most suitable for the mycelial growth of 24 species, to walnut cake − suitable only for 2 species. The utilization of substrates has been evaluated by biological efficiency. The best index of biological efficiency varied from 19.0% to 41.6% depending on the mushroom species. It was established high biological efficiency of mycelia cultivation on substrates: wheat seed cake – Pleurotus djamor, Lyophyllum shimeji, Crinipellis schevczenkovi, Phellinus igniarius, Spongipellis litschaueri; oat seed cake – Ganoderma applanatum and G. lucidum; soybean cake – Hohenbuehelia myxotricha, Trametes versicolor, Morchella esculenta, Cordyceps sinensis, C. militaris, and Agrocybe aegerita; rape seed cake – Auriporia aurea; camelina seed cake – Fomes fomentarius. The cultivation of these species are perspective as a biotechnological process of agricultural wastes converted into mycelia, which could be used in different forms of products with therapeutic action: powder or tablets nutraceuticals or ingredients for functional foods.
International Nuclear Information System (INIS)
Rosnani Abdul Rashid; Azhar Mohamad; Mat Rasol Awang; Hassan Hamdani Mutaat; Shaiful Azuar Mohamad; Affrida Abu Hasan; Mohd Meswan Maskom; Siti Khadijah Mohd Nahar
2013-01-01
Mushroom can be used as a biological indicator in assessing radiological impact on the environment. Radiological effect would be reflected through morphological changes as well as those changes at molecular level. For this purpose, a preliminary work was conducted, which included DNA isolation, optimization of PCR parameters for Inter-Simple Sequence Repeat (ISSR) and primers screening on Pleurotus sajor caju mushroom strains from Nuclear Malaysia's Sterifeed Mushrooms Collection Centre. In this work, DNA isolation technique from cap and stalk of fruit body were optimized and quantified. It was found that stalk produced highest amount of genomic DNA at 304.01 ng/ μl and cap at 149.00 ng/ μl. A total of 100 ISSR primers were tested and 51 primers were successfully amplified. These primers will be used further for dose response evaluation and molecular profiling in mushroom species. (author)
Directory of Open Access Journals (Sweden)
Regina Prado Zanes Furlani
2007-06-01
Full Text Available In this study, folates were evaluated in the main species of mushroom cultivated in Brazil. The species analysed were Agaricus bisporus (button mushroom, Lentinula edodes (shiitake and Pleorotus ostreatus (shimeji. The five main forms of folate found in foods were determined: tetrahydrofolic acid (THFA, 10-methyl folic acid (10MFA, 5-methyl tetrahydrofolic acid (5MTHFA, 10-formyl folic acid (10FFA and 5-formy tetrahydrofolic acid (5FTHFA. The methodology employed used extraction with phosphate buffer, clean up with trichloroacetic acid and separation of the vitamins by high-performance liquid chromatography, with simultaneous ultraviolet and fluorescence detection. The results obtained for total folate were 551 to 1404 µg.100 g -1 for the button mushroom, 606 to 727 µg.100 g -1 for shiitake and 460 to 1325 µg.100 g-1 for shimeji. The data showed that mushrooms could be considered as sources of folates and that their contribution of these vitamins to the diet was meaningful.O teor de folatos nas principais espécies de cogumelos cultivados no Brasil foi avaliado neste trabalho. As espécies analisadas foram Agaricus bisporus (champignon de Paris, Lentinula edodes (shiitake e Pleorotus ostreatus (shimeji. Foram determinadas as cinco principais formas de folatos presentes em alimentos: tetrahidro ácido fólico (THAF, 10-metil ácido fólico (10MAF, 5-metil tetrahidro ácido fólico (5MTHAF, 10-formil ácido fólico (10FAF e 5formil tetrahidro ácido fólico (5FTHAF. A metodologia empregada utilizou extração com tampão fosfato, limpeza com ácido tricloroacético e separação das vitaminas por cromatografia líquida de alta eficiência, com detecção em série por fluorescência e ultravioleta. Os resultados obtidos para o total de folatos foram 551 a 1404 µg.100 g -1 para o champignon de Paris, 606 a 727 µg.100 g -1 para o shiitake e 460 a 1325 µg.100 g -1 para o shimeji. Os dados mostram que os cogumelos podem ser considerados fontes
Chemical composition of Pleurotus pulmonarius (Fr. Quél., substrates and residue after cultivation
Directory of Open Access Journals (Sweden)
Silva Sueli Oliveira
2002-01-01
Full Text Available The cultivation of Pleurotus pulmonarius was carried out on different substrate: cotton waste (A leaves of Cymbopogon citratus (B and leaves of Panicum maximum Jacq. (C. The mushroom had a varied chemical composition; nevertheless they contained a good composition for to be used as a good source of protein for human kind. The results showed the higher protein content (29.19% and fibre (9.0% for the mushroom that were cultivated on cotton peel. The substrate composition and the residue composition after the mushroom harvest were: Protein for the substrate "A" (10.63% and 9.35%, "B" (7.87% and 4.24% and "C" (7.55% and 5.90 %; Lipids "A" (4.17% and 2.03%, "B"(2.77% and 3.20% and "C" (0.91% and 2.05%; Fibres "A" (49.02% and 37.02%, "B" (28.40% and 23.26% and "C" (37.50% and 26.66% respectively. The substrate "A" showed 0.048% of iron and "C" 0.14% of magnesium, 0.31% of potassium and 0.26% of calcium. In the substrate "B" the quantity of the minerals were very low in comparison to the other substrates. The residues after the harvest of mushroom could be used as fertiliser or as complement in the composition for animal feed.
Directory of Open Access Journals (Sweden)
I MADE SUDARMA
2015-09-01
Full Text Available The growth rate comparison of white oyster mushroom (Pleurotus ostreatus (Jacq. ex FrKummer mycelium in the composition of different seed (F3 and baglog media . Cultivation ofoyster mushroom (Pleurotus ostreatus (Jacq. ex Fr Kummer has grown rapidly along with the increasein income and health awareness. Oyster mushrooms growing need for media with a particular compositionin order to grow optimally. Oyster mushroom production is determined by the quality of the seeds (F3is used, which is sourced from the media with good quality and composition. The research aimed todetermine the rate of growth of white oyster mushroom mycelium in the different composition of seedmedium (F3 (sawdust: fine bran: corn flour: CaCO3 . The experiments was conducted at nurseriesand oyster mushroom development, Jl. Siulan Gang Zella No. 7 Denpasar, from June to August 2013.Each treatment contained 50 bottles, and 10 bottles only used as a sample, in environmental conditionswith temperature and humidity ranges, 20-29oC and 59-86% respectively . T-test was used todifferentiate the growth rate of white oyster mushroom mycelium with different compositions. Theresults showed that seeds (F3 derived from the growing media composition, sawdust (1 week old:fine bran: corn flour: CaCO3 (10:4:2:0,5 significantly different and better than the composition sawdust(age 1 month : fine bran: corn flour (20:2:1:0.5, with a growth rate of mycelium in a mean 6.14±0.56cm/week and 1,81±0,82 cm/week, respectively. Spawn running in baglog with media composition10:4:2:0.5 was 2.77±1.22cm/week, but with composition media 20:2:1:0.5 mycelium could not grow.Effect of temperature and humidity on the growth rate of white oyster mushroom mycelium in seedmedia (F3 is not significantly.
Effect of 60Co γ-irradiation on postharvest quality of pleurotus nebrodensis stored at 4 degree C
International Nuclear Information System (INIS)
Xiong Qiaoling; Huazhong Agriculture Univ., Wuhan; Xing Zengtao; Feng Zhiyong; Buswell, J.; Bian Yinbing
2007-01-01
The effect of γ-rays irradiation on the fresh-keeping of Pleurotus nebrodensis fruit bodies was reported in this paper. Fresh harvested fruit bodies of Pleurotus nebrodensis were irradiate at different doses levels (0.8-2.0 kGy) and stored for 22 days at 4 degree C. The fruit bodies treated with 1.2 kGy irradiation retained the highest soluble protein contents, and exhibited less postharvest softening throughout the storage period. Regression analysis plots of fruit body hardness versus soluble protein content were linear (t>0.05). Increases in mushroom cell permeability observed throughout the storage period were directly related to irradiation dose. Too higher dose(≥2.0 kGy) of irradiation will accelerate the nutrition degradation and rotting of the fruit bodies. (authors)
Enrichment of mushrooms: an interesting strategy for the acquisition of lithium.
de Assunção, Laélia Soares; da Luz, José Maria Rodrigues; da Silva, Marliane de Cássia Soares; Vieira, Patrícia Aparecida Fontes; Bazzolli, Denise Mara Soares; Vanetti, Maria Cristina Dantas; Kasuya, Maria Catarina Megumi
2012-09-15
The capability of Pleurotus ostreatus mushroom to accumulate lithium (Li) and the accessibility of this Li compared with lithium carbonate (Li(2)CO(3)), often used as psychiatric medicine, were investigated. Mushrooms were produced on a substrate-based on coffee husk, with different added concentrations of lithium chloride (LiCl). Biological efficiency (BE), the crude protein content, the concentration of Li and other elements present in mushrooms were determined. The sequential extraction and in vitro test were used to verify the accessibility and the degree of solubility of this element. Li concentration in mushrooms was directly influenced by increasing LiCl concentration in the substrate (Plithium can be an alternative source of Li, as well as being a food with high nutritional value. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Xiaolong Shi
Full Text Available BACKGROUND: A greater reduction in cancer risk associated with mushroom diet rich in fungus polysaccharides is generally accepted. Meanwhile, edible Pleurotus abalonus as a member of Abalone mushroom family is a popular nutritional supplement that purportedly prevents cancer occurrence. However, these anecdotal claims are supported by limited studies describing tumor-inhibitory responses to the promising polysaccharides, and the molecular mechanisms underlying these properties have not yet been elucidated. METHODOLOGY/PRINCIPAL FINDINGS: We here fractionated the crude polysaccharide preparation from the fruiting bodies of P. abalonus into three fractions, namely PAP-1, PAP-2 and PAP-3, and tested these fractions for antiproliferative activity in human breast cancer MCF-7 cells. The largest PAP-3, an acidic polysaccharide fraction with a molecular mass of 3.68×10(5 Da, was the most active in inhibiting MCF-7 cancer cells with an IC50 of 193 µg/mL. The changes in cell normal morphology were observed by DAPI staining and the PAP-3-induced apoptosis was confirmed by annexin V/propidium iodide staining. The apoptosis was involved in mitochondria-mediated pathway including the loss of mitochondrial membrane potential (Δψm, the increase of Bax/Bcl-2 ratio, caspase-9/3 activation, and poly(ADP-ribose polymerase (PARP degradation, as well as intracellular ROS production. PAP-3 also induced up-regulation of p53, and cell cycle arrest at the S phase. The incubation of MCF-7 cells with antioxidant superoxide dismutase (SOD and N-acetylcysteine (NAC significantly attenuated the ROS generation and apoptosis caused by PAP-3, indicating that intracellular ROS plays a pivotal role in cell death. CONCLUSIONS/SIGNIFICANCE: These findings suggest that the polysaccharides, especially acidic PAP-3, are very important nutritional ingredients responsible for, at least in part, the anticancer health benefits of P. abalonus via ROS-mediated mitochondrial apoptotic
A Low Cost 3D Acquiring System for Mushroom Robot Based on Webcam and Line Laser
Directory of Open Access Journals (Sweden)
Gang Sun
2014-03-01
Full Text Available This paper presents a low cost 3D acquiring system for mushroom robot based on webcam and line laser. The system comprises Webcam, semiconductor line laser, motion platform and data process unit. The system can get the 3D information of the Pleurotus eryngii in bottle based on structured light scanning theory. Field test shows the accuracy of the height is less than 2mm and it can be use to locate the buds in the bottle correctly. It has the potention to fulfill the requirement of the location of the mushroom for thinning bud robot.
Antiproliferative and Antioxidant Activities of Wild Boletales Mushrooms from France.
Morel, Sylvie; Arnould, Stéphanie; Vitou, Manon; Boudard, Frédéric; Guzman, Caroline; Poucheret, Patrick; Fons, Françoise; Rapior, Sylvie
2018-01-01
We selected edible and inedible mushrooms growing in the Mediterranean area of France to screen their biological activity: Caloboletus calopus, Rubroboletus lupinus, R. pulchrotinctus, R. satanas, Gyroporus castaneus, Suillus luteus, and Omphalotus olearius. Mushrooms were sequentially extracted using cyclohexane, chloroform, ethanol, and water. The antiproliferative activity against the HCT116 colon adenocarcinoma cell line and the antioxidant properties (DPPH radical scavenging assay, Folin-Ciocalteu assay, and oxygen radical absorbance capacity) of the Boletales extracts were evaluated and compared. Among the 28 mushroom extracts evaluated, 11 presented antiproliferative activity against HCT116 cells. These activities were not linked to antioxidant capacity. Among the antioxidant extracts, most were aqueous extracts in the oxygen radical absorbance capacity assay, whereas the highest values on the Folin-Ciocalteu and DPPH assays were noted for chloroform, ethanol, or aqueous extracts, depending on the mushroom species. Further studies are necessary to identify bioactive compounds and to valorize the mushrooms-for edible species, directly as health foods, or, for inedible mushrooms, as ingredients in the pharmaceutical and food industries.
Savoie, Jean-Michel
2013-01-01
Gourmet mushrooms may contribute to the development of a new agriculture by addressing the consumer demand and some of the non-nutritional uses of agricultural productions. The value of recycling with gourmet and medicinal mushrooms is clearly understood and wastes can be viewed as positive products, at least in term of providing new economic opportunities and positive environmental consequences. Important cultivated edible and medicinal mushrooms are members of the Agaricus genus. They are s...
Nutriceutical potential of Pleurotus tuber-regium sclerotium
Directory of Open Access Journals (Sweden)
R. C. Ohiri
2018-04-01
Full Text Available The aim of the study was to determine the composition of the sclerotium of Pleurotus tuber-regium and to analyze its nutritional potential. Major minerals and micronutrients content of the P. tuber-regium sclerotium were determined. The study has shown fairly high concentrations of potassium and magnesium as major minerals with values of 60.66 ± 4.13 and 41.79 ± 3.14 mg/kg, while manganese and zinc were micronutrients with the highest values of 1.20 ± 0.10 and 0.95 ± 0.07 mg/kg. Glutamic acid and aspartic acid were also observed in high concentrations with values of 11.51 ± 1.01 and 5.52 ± 0.86 mg/kg. The mushroom powder of P. tuber-regium was a source for production of oil, which was analyzed by GC-MS method. Benzenedicarboxylic acid mono-(2-ethylhexyl ester and benzenedicarboxylic acid butyl-cyclohexyl ester were volatile constituents predominating with percentage total of 78.7 and 5.2, respectively. It is concluded that the presence of mineral elements, amino acids and volatile components observed in this fungus indicated the presence of the nutritional potential in the sclerotia of P. tuber-regium.
Endotoxemia (sepsis, septic shock) is an inflammatory, virulent disease that results mainly from bacterial infection. The present study investigates the inhibitory effect of the bio-processed polysaccharide (BPP) isolated from the edible Lentinus edodes liquid mycelial mushroom culture supplemented...
Functional foods from mushroom
Mushrooms are defined as “a macro fungus with distinctive fruiting bodies that could be hypogeous or epigeous, large enough to be seen by naked eyes and to be picked by hands.” The Basidiomycetes and some species of Ascomycetes are categorized as mushrooms. Mushrooms constitute 22,000 known species ...
Energy Technology Data Exchange (ETDEWEB)
Vimala, R., E-mail: vimararagu@yahoo.co.in [School of Biotechnology, Chemical and Biomedical Engineering, VIT University, Vellore 632014, Tamil Nadu (India); Das, Nilanjana [School of Biotechnology, Chemical and Biomedical Engineering, VIT University, Vellore 632014, Tamil Nadu (India)
2009-08-30
Sorption capacity of oyster mushroom (Pleurotus platypus), button mushroom (Agaricus bisporus) and milky mushroom (Calocybe indica) were evaluated on biosorption of heavy metals, viz. cadmium (II) and lead (II) from aqueous solutions. The optimum sorption conditions were studied for each metal separately. The desired pH of the aqueous solution was found to be 6.0 for the removal of cadmium (II) and 5.0 for removal of lead (II) for all the mushrooms. The percent removal of both the metals was found to increase with the increase in biosorbent dosage and contact time. The fitness of the biosorption data for Langmuir and Freundlich adsorption models was investigated. It was found that biosorption of cadmium (II) and lead (II) ions onto the biomass of the three mushrooms were better suitable to Langmuir than Freundlich adsorption model. P. platypus showed the highest metal uptake potential for cadmium (q{sub max} 34.96 mg/g) whereas A. bisporus exhibited maximum potential for lead (q{sub max} 33.78 mg/g). Milky mushroom showed the lowest metal uptake capacity for both the metals. The present data confirms that mushrooms may be used as efficient biosorbent for the removal of cadmium (II) and lead (II) ions from aqueous solution.
Directory of Open Access Journals (Sweden)
Nutsuda Banlangsawan
2016-02-01
Full Text Available Oyster mushroom (Pleurotus ostreatus Fries. is rich in nutrition and has many medicinal properties such as antioxidant and anticancer activities. It also contains a high amount of ergosterol which can be converted to vitamin D2 when exposing to UV light. Oyster mushroom powder was irradiated with UV-B for 180 min and extracted with 95% ethanol. Mushroom extract was determined for vitamin D2 concentration, total phenolic compound, antioxidative activity, tyrosinase inhibitory property and cytotoxicity effect on human keratinocytes (HaCaT and murine melanoma cells (B16F10 by MTT assay. The results demonstrated that the concentration of vitamin D2 of irradiated oyster mushroom extract was 153.96 µg/g, which is 13 times higher than that of non-irradiated mushroom extract. Total phenolic content, antioxidative and tyrosinase inhibitory activities of the two mushroom extracts were not significantly different. Neither oyster mushroom extract had a cytotoxic effect on keratinocytes, but on the other hand both inhibited the growth of murine melanoma cells.
An Overview of Culinary and Medicinal Mushrooms in Neurodegeneration and Neurotrauma Research.
Wong, Kah-Hui; Ng, Chai-Chee; Kanagasabapathy, Gowri; Yow, Yoon-Yen; Sabaratnam, Vikineswary
2017-01-01
Culinary and medicinal mushrooms have been appreciated since prehistoric times as valuable resources for food and medicine. Edible mushrooms represent an untapped source of nutraceuticals and valuable palatable food. Long considered tonics, they are now treasured as functional foods that can improve human health and quality of life. Numerous studies have provided insights into the neuroprotective effects of edible mushrooms, which are attributed to their antioxidant, antineuroinflammatory, and cholinesterase inhibitory properties, and their ability to prevent neuronal death. Here we review the recent literature on the role of culinary and medicinal mushrooms in the management of neurodegenerative diseases and neurotrauma. We highlight some of the molecular mechanisms for how these alternative medicines provide health benefits that could help us to harness their neuroprotective effects.
Directory of Open Access Journals (Sweden)
Marli Camassola
2013-01-01
Full Text Available Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc and manganese peroxidase (MnP. New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm-1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm-1, respectively. The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes.
Pardede, Astrid; Budihardjo, Mochamad Arief; Purwono
2018-02-01
Oyster mushroom (Pleurotus ostreatus) can be utilized as biocoagulant since it has chitin cell wall. Chitin has characteristics of bioactivity, biodegradability, absorption and could bind the metal ions. In this study, Oyster Mushroom is micronized and mixed with wastewater to treat turbidity and Total Suspended Solid (TSS) using coagulation-flocculation process employed jartest method. Various doses of Oyster mushroom, 600 mg/l, 1000 mg/l, and 2000 mg/l were tested in several rapid mixing rates which were 100 rpm, 125 rpm, and 150 rpm for 3 minutes followed by 12 minutes of slow mixing at 45 rpm. The mixture then was settled for 60 minutes with pH level maintained at 6-8. The result showed that the Oyster mushroom biocoagulant was able to remove 84% of turbidity and 90% of TSS. These reductions were achieved with biocoagulant dose of 600 mg/ L at 150 rpm mixing rate.
Amanitin and phallotoxin concentration in Amanita phalloides var. alba mushroom.
Kaya, Ertugrul; Yilmaz, Ismail; Sinirlioglu, Zeynep Aydin; Karahan, Selim; Bayram, Recep; Yaykasli, Kursat Oguz; Colakoglu, Serdar; Saritas, Ayhan; Severoglu, Zeki
2013-12-15
Although rarely seen, Amanita phalloides var. alba, a variety of A. phalloides type mushrooms, causes mushroom poisoning resulting in death. Since it is frequently confused with some edible mushrooms due to its white colored cap and macroscopic appearance, it becomes important in toxicological terms. Knowledge of the toxin amount contained in this mushroom type is invaluable in the treatment of cases involving poisoning. In this study, we examined the toxin levels of various parts of the A. phalloides var. alba mushroom growing Duzce region of Turkey. Toxin analyses were carried out for A. phalloides var. alba, which were collected from the forests Duzce region of Turkey in 2011, as a whole and also separately in its spore, pileus, gills, stipe and volva parts. The alpha amanitin, beta amanitin, gamma amanitin, phalloidin and phallacidine analyses of the mushrooms were carried out using the RP-HPLC method. A genetic analysis of the mushroom showed that it had similar genetic characteristics as A. phalloides and was a variety of it. The lowest toxins quantity was detected in spores, volva and stipe among all parts of the mushroom. The maximum amount of amatoxins was measured in the gills. The pileus also contained a high amount of amatoxins. Generally, amatoxins and phallotoxin concentrations were lower as compared to A. phalloides, but interestingly all toxins other than gamma toxin were higher in the spores of A. phalloides var. alba. The amount of toxin in all of its parts had sufficient concentrations to cause death. With this study, the amatoxin and phallotoxin concentrations in A. phalloides var. alba mushroom and in its parts have been revealed in detail for the first time. Copyright © 2013 Elsevier Ltd. All rights reserved.
Phan, Chia-Wei; David, Pamela; Naidu, Murali; Wong, Kah-Hui; Sabaratnam, Vikineswary
2015-01-01
Mushrooms have long been used not only as food but also for the treatment of various ailments. Although at its infancy, accumulated evidence suggested that culinary-medicinal mushrooms may play an important role in the prevention of many age-associated neurological dysfunctions, including Alzheimer's and Parkinson's diseases. Therefore, efforts have been devoted to a search for more mushroom species that may improve memory and cognition functions. Such mushrooms include Hericium erinaceus, Ganoderma lucidum, Sarcodon spp., Antrodia camphorata, Pleurotus giganteus, Lignosus rhinocerotis, Grifola frondosa, and many more. Here, we review over 20 different brain-improving culinary-medicinal mushrooms and at least 80 different bioactive secondary metabolites isolated from them. The mushrooms (either extracts from basidiocarps/mycelia or isolated compounds) reduced beta amyloid-induced neurotoxicity and had anti-acetylcholinesterase, neurite outgrowth stimulation, nerve growth factor (NGF) synthesis, neuroprotective, antioxidant, and anti-(neuro)inflammatory effects. The in vitro and in vivo studies on the molecular mechanisms responsible for the bioactive effects of mushrooms are also discussed. Mushrooms can be considered as useful therapeutic agents in the management and/or treatment of neurodegeneration diseases. However, this review focuses on in vitro evidence and clinical trials with humans are needed.
Directory of Open Access Journals (Sweden)
Eduardo Bernardi
2009-01-01
Full Text Available O objetivo deste trabalho foi avaliar a produtividade, eficiência biológica, massa fresca, composição centesimal dos cogumelos Pleurotus ostreatus (BF24 e Pleurotus sajor-caju (PSC96/03 e PSC01/06 produzidos no substrato capim-elefante (Pennisetum purpureum pasteurizado e a relação Carbono/Nitrogênio inicial e final do substrato. O substrato seco e particulado a 2 cm foi umedecido por 24 horas e pasteurizado a 100 ºC durante 30 minutos. Adicionaram-se 3% de inóculo de cada linhagem, sendo acondicionado em embalagens de polipropileno com 1 kg cada uma. Os substratos foram incubados a 26 ºC e na fase de frutificação a 23±3 ºC e umidade relativa de 75% a 90%. Na linhagem BF24 observou-se maior massa fresca (281,19g, eficiência biológica (112,46% e produtividade (28,11%. O substrato com relação Carbono:Nitrogênio inicial de 162:1 foi o de menor relação (68:1 após o cultivo do P. sajor-caju (PSC01/06. A linhagem PSC96/03 proporcionou maior teor de proteína em relação às demais, tendo a BF24 maior teor de lipídios. Quanto ao teor de carboidratos e cinzas, nas diferentes espécies e linhagens não houve diferenças significativas; já para a quantidade de fibras, as linhagens BF24 e PSC01/06 foram similares, porém superiores a PSC96/03. As duas espécies de Pleurotus podem ser cultivadas em capim-elefante pasteurizado, suprimindo o processo de compostagem.The objective of this work was to evaluate the productivity, biological efficiency, fresh matter, and centesimal composition of mushroom Pleurotus ostreatus (BF24 and Pleurotus sajor-caju (PSC96/03 and PSC01/06 grown in pasteurized elephant grass substrate (Pennisetum purpureum. It was also assessed the initial and final Carbon/Nitrogen ratio. The dried 2-cm-particulate substrate was moist for 24 hours and pasteurized at 100ºC during 30 minutes. Then, it was added 3% of inoculum of each strain. The substrate was placed into 1-kg polypropylene bags. The bags were incubated
Effect of some heavy metals on the growth and development of Pleurotus tuber-regium.
Directory of Open Access Journals (Sweden)
Akpaja EO
2012-02-01
Full Text Available The effects of five heavy metals (cadmium, copper, mercury, lead and zinc on the growth and fruit body production in Pleurotus tuber-regium was investigated. Lead sulphate, zinc sulphate, copper sulphate, cadmium nitrate and mercury chloride were added to garden soil at concentrations of 0, 0.125, 0.25, 0.5, 1.0, and 2.0 mmol per 3 kg of soil. Sclerotia of the test mushroom were used to inoculate the artificially contaminated soil. Mercury prevented growth and fruit body production in P. tuber-regium. Fungal morphometry was greatly affected by lead. The heavy metal content in the fungal biomass complex increased with increase of heavy metal concentration in the soil. The highest concentration (183.06 mg/kg was found in zinc at 2 mmol/L.
Directory of Open Access Journals (Sweden)
Evânia Geralda Silva
2007-03-01
Full Text Available Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúcar, farelo de trigo e diferentes teores de nitrogênio. Apenas os substratos com teores de nitrogênio de 0,65 a 1,30% foram colonizados, enquanto que nos substratos com 1,75 e 2,20% de nitrogênio não houve colonização. Não houve diferença significativa na produção de cogumelos, porém o teor de proteína dos cogumelos produzidos no substrato com 1,30% de N foi significativamente superior em relação aos substratos com menor teor de N.Mushrooms of Pleurotus genus usually grow well in substrates containing low amounts of nitrogen, whereas Agaricus mushrooms require substrates with a high content of nitrogen. On the other hand, the nutritional values of mushrooms depend on the chemical composition of the substrate in use and the conditions of cultivation. The aim of this work is to measure the protein content of the fructification bodies of Pleurotus sajor-caju cultivated in coast-cross grass, sugar cane bagasse, whole wheat meal and various nitrogen concentrations. Only the substrates with nitrogen content ranging from 0.65 to 1.30% were colonized, while in the substrates with 1.75 and 2.20% of nitrogen, colonization did not occur. There was no significant difference in the production of mushrooms, however the protein content of the mushrooms produced on the substrate with 1.30% of N was considerably higher in relation to those mushrooms grown in substrates with a reduced nitrogen content.
Phytochemical characterization of wild edible Boletus sp. from Northeast Portugal
Heleno, Sandrina A.; Barros, Lillian; Martins, Anabela; Sousa, Maria João; Ferreira, Isabel C.F.R.
2010-01-01
Our research has been focused on the documentation of nutritional composition and nutraceutical potential of wild mushrooms, making the information available for a better management and conservation of these species and related habitats. In the present work, the chemical composition and bioactivity of three wild edible Boletus sp. (Boletus aereus, Boletus edulis, Boletus reticulatus) from Northeast Portugal were evaluated, in order to valorise these species as sources of important...
Cobweb, a serious pathology in mushroom crops: A review
International Nuclear Information System (INIS)
Carrasco, J.; Navarro, M.J.; Gea, F.
2017-01-01
Cobweb is a fungal disease of commercially cultivated mushrooms. Several members of the ascomycete genus Cladobotryum sp. have been reported as causal agents. White button mushroom is the most frequently cited host, but a wide range of cultivated edible mushrooms suffer cobweb. The pathology causes production losses and reduces the crop surface available. The parasite produces a great number of harmful conidia that can be released easily and distributed throughout the mushroom farm to generate secondary points of infection. To prevent initial outbreaks, hygiene is of primary importance within the facilities dedicated to mushroom cultivation, while additional measures must be implemented to control and reduce cobweb if there is an outbreak, including chemical and biological methods. This review summarizes and discusses the knowledge available on the historic occurrence of cobweb and its impact on commercial mushroom crops worldwide. Causal agents, disease ecology, including the primary source of infection and the dispersal of harmful conidia are also reviewed. Finally, control treatments to prevent the disease from breaking out are discussed.
Cobweb, a serious pathology in mushroom crops: A review
Energy Technology Data Exchange (ETDEWEB)
Carrasco, J.; Navarro, M.J.; Gea, F.
2017-07-01
Cobweb is a fungal disease of commercially cultivated mushrooms. Several members of the ascomycete genus Cladobotryum sp. have been reported as causal agents. White button mushroom is the most frequently cited host, but a wide range of cultivated edible mushrooms suffer cobweb. The pathology causes production losses and reduces the crop surface available. The parasite produces a great number of harmful conidia that can be released easily and distributed throughout the mushroom farm to generate secondary points of infection. To prevent initial outbreaks, hygiene is of primary importance within the facilities dedicated to mushroom cultivation, while additional measures must be implemented to control and reduce cobweb if there is an outbreak, including chemical and biological methods. This review summarizes and discusses the knowledge available on the historic occurrence of cobweb and its impact on commercial mushroom crops worldwide. Causal agents, disease ecology, including the primary source of infection and the dispersal of harmful conidia are also reviewed. Finally, control treatments to prevent the disease from breaking out are discussed.
Cobweb, a serious pathology in mushroom crops: A review
Directory of Open Access Journals (Sweden)
Jaime Carrasco
2017-07-01
Full Text Available Cobweb is a fungal disease of commercially cultivated mushrooms. Several members of the ascomycete genus Cladobotryum sp. have been reported as causal agents. White button mushroom is the most frequently cited host, but a wide range of cultivated edible mushrooms suffer cobweb. The pathology causes production losses and reduces the crop surface available. The parasite produces a great number of harmful conidia that can be released easily and distributed throughout the mushroom farm to generate secondary points of infection. To prevent initial outbreaks, hygiene is of primary importance within the facilities dedicated to mushroom cultivation, while additional measures must be implemented to control and reduce cobweb if there is an outbreak, including chemical and biological methods. This review summarizes and discusses the knowledge available on the historic occurrence of cobweb and its impact on commercial mushroom crops worldwide. Causal agents, disease ecology, including the primary source of infection and the dispersal of harmful conidia are also reviewed. Finally, control treatments to prevent the disease from breaking out are discussed.
Directory of Open Access Journals (Sweden)
Ayşenur Yılmaz
2017-01-01
Full Text Available In this study, the usage possibilities of some agro-industrial wastes such as; peanut wastes, potatoes farm wastes, walnut and orange tree sawdust in Pleurotus ostreatus cultivation were investigated and total phenolic, flavonoid, condensed tannin content and antioxidant properties of these methanolic mushroom extracts were examined. For the determination of the total phenolic contents, the Folin-Ciocalteau procedure was used. The content of total flavonoid present in the methanolic extracts was measured using a spectrophotometric assay. Condensed tannins were determined according to the method by Julkunen-Tıtto. The antioxidant capacity was determined using ferric reducing antioxidant power (FRAP and free radical scavenging activity of DPPH. The highest total phenolic content (2.672 ± 0.003 mg GAE/g was found in mushroom cultivated on walnut sawdust. The highest condensed tannin (1.011 ± 0.088 CE mg/g and ferric reducing antioxidant power (FRAP (12.332 ± 0.017 μmol FeSO4.7H2O/g were observed in the same mushroom extract. The highest total flavonoid and free radical scavenging activity of DPPH were found in extract of mushroom cultivated on potatoes handle. Bioactive properties of P. ostreatus cultivated on walnut tree sawdust were generally exhibited remarkable results.
Directory of Open Access Journals (Sweden)
Ira Djajanegara
2012-02-01
Full Text Available Irradiation aplied to living organisms may have positive or negative effects on physiological and morphological properties of the organisms. One way to gain genetic variation with better properties than the parental strain is by Gamma (Co 60 radiation application. During this experiment, Gama (Co 60 rays was applied to the grey oyster (Pleurotus sajur-caju mushroom mycellia during exponential phase. Radiation was applied at 0.75 KGray with dose velocity of 1.149 KGray. Analysis of mushroom productivity performances indicate that diameter of mycellia, fresh weight, dry weight, diameter of fruit body and the amount of fruit body of the mutant and control were not significantly different. However, the isozyme pattern showed a different pattern between the mutant and the control which indicates that mutation process has already occured. These data show that mutation did not affect the productivity of the mushroom. Therefore, mutation may affect the nutritional quality of the mushroom instead. Further experiment to verify this possibility is suggested.
EFEKTIVITAS PEMBERIAN AIR LERI TERHADAP PERTUMBUHAN DAN HASIL JAMUR TIRAM PUTIH (Pleurotus ostreatus
Directory of Open Access Journals (Sweden)
Ummu Kalsum
2011-09-01
Full Text Available White oyster mushroom is kind of consumed mushroom that has delicious taste and efficacious drug. Mushroom need nutrition addition to increase growth and development so that better production, like nutrition from rice washing water. The contain are carbon element, nitrogen, mineral and vitamin B. This experiment aim to determine addition of rice washing water effect, optimal volume and time interval on growth and yield of white oyster mushroom (Pleurotus ostreatus. This experiment is carried out at mushroom’s house Maduraya Agro Kamal. The research design used was factorial completely randomized design with two factors. First factor is addition rice washing water volume with 4 level, that is without addition rice washing water (A0, addition rice washing water as much as 20 ml/1000 g substrat (A1, 40 ml/1000 g substrat (A2 and 60 ml/1000 g substrat (A3. Second factor is addition time interval that consists of 2 level, that is 2 days (B1 and 4 days (B2. Experiment result shows that interaction between volume treatment and addition time interval give effect on fruit body total. Addition rice washing water volume treatment give real effect on maximal pileus fruit width. While addition time interval treatment does not give significant difference on all parameters but it can increase pileus fruit width, total weight and biological efficiency. Interaction of volume treatment and addition time interval is the best combination is volume treatment 40 ml/1000 g substrat with time interval 2 days (A2B1, this matter is showed in lot fruit body total as big as 8,871 fruit. Addition rice washing water volume 40 ml/1000 g substrat is the best volume that indicated from first bud appear, first harvest time, total weight and biological efficiency.
Interactions between Xylotrophic Mushrooms and Mycoparasitic Fungi in Dual-Culture Experiments
Directory of Open Access Journals (Sweden)
S.M. Badalyan
2004-04-01
Full Text Available Seventeen wood-decaying mushroom species (Coriolus versicolor, Flammulina velutipes, Ganoderma sp., Hypholoma fasciculare, H. sublateritium, Kühneromyces mutabilis, Lentinula edodes, Lentinus tigrinus, Pholiota alnicola, Ph. aurivella, Ph. destruens, Pleurotus cornucopiae, Pl. ostreatus, Polyporus subarcularius, Po. squamosus, Po. varius and Schizophyllum commune were paired with three Trichoderma species (T. harzianum, T. pseudokoningii, and T. viride and Clonostachys rosea in dual-culture experiments on an agar-based medium. Xylotrophic mushrooms and mycoparasitic fungi in general showed similar competitive ability; deadlock, or mutual inhibition after mycelial contact, was observed in 45.6% of pairings, while stable inhibition at a distance occurred in 4.4% of pairings. Replacement, or overgrowth of xylotrophic mushroom by a mycoparasitic fungus was observed in 29.4% of pairings; the opposite, overgrowth of the xylotrophic mushroom on the mycoparasitic fungus in 20.6%. of pairings. Of the xylotrophic mushrooms, Pl. ostreatus, Ganoderma sp., F. velutipes and H. fasciculare, showed the highest competitive ability against mycoparasitic fungi. Of the mycoparasitic fungi, T. harzianum showed the strongest competitive activity against xylotrophic mushrooms.
Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C
2007-03-01
Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.
Directory of Open Access Journals (Sweden)
Paula Fernanda Bomfim Oliveira Cogorni
2014-06-01
Full Text Available The aim of this study was to evaluate of Pleurotus sajor-caju production in peach palm leaves and the addition of different fractions of mushroom powder to wheat flour to increase its nutritional value without changing its characteristics. The best yield (48.4%, biologic efficiency (4.5%, and Pr (0.36 g/day values were obtained using 20% inoculum fraction and 10% rice bran fraction. The Pleurotus sajor-caju fruiting body cultivated under these conditions had the following composition in 100 g: 29.91 g (carbohydrates, 42.92 g (proteins, 1.24 g (lipids, 15.93 g (fibers, 7.42 g (ashes, 1.6 g (phosphorus, 2.7 g (potassium, 8.73 mg (iron, 23.75 mg (sodium, 0.34 mg (thiamine, and 0.57 mg (riboflavin. The wheat flour with mushroom powder had reduced sugar content, but it did not have increased fat content. The fiber, protein, phosphorus, potassium, iron, and riboflavin contents were increased mainly when 10% mushroom powder was added to the wheat flour. Furthermore, this flour does not undergo drastic alterations in its physicochemical characteristics such as in moisture, wet gluten, color, and falling number.
Directory of Open Access Journals (Sweden)
Ursula Peintner
Full Text Available Mycophiles forage for and pick vast quantities of a wide variety of wild mushroom species. As a result, mushroom intoxications are comparatively frequent in such countries with mycophiles. Thus, national governments are forced to release guidelines or enact legislation in order to ensure the safe commerce of wild mushrooms due to food safety concerns. It is in these guidelines and laws that one can observe whether a country is indeed mycophobic or mycophilic. Furthermore, these laws and guidelines provide valuable information on mushroom preferences and on the consumption habits of each country. As such we were interested in the questions as to whether mushroom consumption behaviour was different within Europe, and if it was possible to discover the typical or distinctive culinary preferences of Slavic or Romanic speaking people, people from special geographical regions or from different zones. This work is based on the analysis of edible mushroom lists available in specific guidelines or legislation related to the consumption and commerce of mushrooms in 27 European countries. The overall diversity of edible mushrooms authorised to be commercialised in Europe is very high. However, only 60 out of a total 268 fungal species can be cultivated. This highlights the importance of guidelines or legislation for the safe commerce of wild mushrooms. The species richness and composition of the mushrooms listed for commerce is very heterogeneous within Europe. The consumption behaviour is not only language-family-related, but is strongly influenced by geographical location and neighbouring countries. Indicator species were detected for different European regions; most of them are widespread fungi, and thus prove culture-specific preferences for these mushrooms. Our results highlight tradition and external input such as trade and cultural exchange as strong factors shaping mushroom consumption behaviour.
International Nuclear Information System (INIS)
Sattler, P.W.
1986-01-01
This document contains newspaper cuttings and correspondence with various ministries in Hessen on the subject of radiation damage to mushrooms from the Odenwald area. The reader is given, amongst other things, detailed information on radiation damage to different types of mushroom in 1986. (MG) [de
Czech Academy of Sciences Publication Activity Database
Braeuer, S.; Goessler, W.; Kameník, J.; Konvalinková, T.; Žigová, Anna; Borovička, Jan
2018-01-01
Roč. 242, 1 March (2018), s. 225-231 ISSN 0308-8146 Institutional support: RVO:67985831 Keywords : edible mushrooms * dimethylarsinic acid * soil * health risk * HPLC-ICPMS Subject RIV: DF - Soil Science OBOR OECD: Soil science Impact factor: 4.529, year: 2016
First Collection and Identification of Wild Mushrooms in Western Iraq
Directory of Open Access Journals (Sweden)
Mustafa Nadhim Owaid
2014-04-01
Full Text Available Fungi are found everywhere and affect our lives every day from mushroom to industrially important product, plant helpers, plant pathogens and to human diseases. Therefore, we concentrated our attention on fungi that can be grown in our environment, while maintaining an interest in their performance in nature. About fifteen different species were collected and identified from different villages of Heet district, Anbar province, Iraq. Out of the fifteen, two species, naming Armillaria mellea and Coprinus disseminates were identified as species level and others: Pleurotus spp., Agaricus spp., Calvatia sp., Telephora sp., Fomes sp., Lepiota sp. and Morchella sp. as genus level only. This study was aimed to collect and identify wild mushrooms that grow naturally in different orchards and gardens on 2009-2013 in Heet city. A total of 15 species in 9 genera, 9 families and 5 orders belong to woody and fleshy species were identified for the first time in Anbar province. The collected mushrooms were appearing from November to February of each year.
How (post-)genomic insights can provide new leads for improvements of mushroom cultivation
Patyshakuliyeva, A.; Post, H.; Zhou, Miaomiao; Jurak, E.; Heck, A.; Hildén, K.; Kabel, M.A.; Makela, M.R.; Altelaar, Maarten; Vries, De Ronald P.
2016-01-01
The economically important edible basidiomycete mushroom Agaricus bisporus thrives on
decaying plant material in forests and grasslands of North America and Europe. It degrades forest
litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in
How (post-)genomic insights can provide new leads for improvements of mushroom cultivation
Patyshakuliyeva, A.; Post, Harm; Zhou, Miaomiao; Jurak, Edita; Heck, Albert; Hildén, Kristiina S.; Kabel, Mirjam; Mäkelä, Miia R.; Altelaar, Maarten; de Vries, R.P.
2016-01-01
The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.
Hepatoprotective Effects of Mushrooms
Directory of Open Access Journals (Sweden)
Rosane Marina Peralta
2013-07-01
Full Text Available The particular characteristics of growth and development of mushrooms in nature result in the accumulation of a variety of secondary metabolites such as phenolic compounds, terpenes and steroids and essential cell wall components such as polysaccharides, b-glucans and proteins, several of them with biological activities. The present article outlines and discusses the available information about the protective effects of mushroom extracts against liver damage induced by exogenous compounds. Among mushrooms, Ganoderma lucidum is indubitably the most widely studied species. In this review, however, emphasis was given to studies using other mushrooms, especially those presenting efforts of attributing hepatoprotective activities to specific chemical components usually present in the mushroom extracts.
Directory of Open Access Journals (Sweden)
Ceci Sales-Campos
2008-11-01
Full Text Available O objetivo deste trabalho foi avaliar o crescimento micelial do cogumelo Pleurotus ostreatus, cultivado na serragem da espécie madeireira Simarouba amara. Avaliaram-se: o efeito das temperaturas de 22, 25, 27, 30 e 35ºC sobre o crescimento micelial de P. ostreatus, nos meios malte-ágar 3% e SDA-MA (infusão da serragem de S. amara, enriquecida com farelo de soja-dextrose-ágar; e o crescimento micelial em substrato de cultivo de serragem de S. amara, com e sem suplementação de farelo de soja, a 25 e 30ºC. O melhor desenvolvimento de P. ostreatus ocorreu em meio malte-ágar 3% a 25ºC. A suplementação de farelo de soja na serragem de S. amara favorece o crescimento micelial.The objective of this work was to assess the mycelial growth of oyster mushroom (Pleurotus ostreatus cultivated in sawdust of Simarouba amara. Evaluations were made for the effect of temperatures 22, 25, 27, 30 and 35ºC on the mycelial growth of P. ostreatus in 3% malt-agar and SDA-MA (infusion of S. amara sawdust, enriched with soybean meal-dextrose-agar media; and the mycelial growth in cultivation substrate of S. amara sawdust, with and without supplementation of soybean meal, at 25 and 30ºC. The best development of P. ostreatus was in 3% malt-agar medium at 25ºC. Soybean meal supplementation on S. amara sawdust promoted mycelial growth.
Production of exopolysaccharides in submerged cultures of gamma irradiation pleurotus ostreatus
International Nuclear Information System (INIS)
Khalaf, M.A.; Atia, A.I.
2009-01-01
Mushrooms have become attractive as a functional food and as a source for the development of drugs and nutraceuticals. Pleurotus ostreatus is considered as the best among them. The exopolysaccharides (EPS) of mushrooms demonstrated a strong antitumor and antioxidant action. However, there is little information available in the literature about the optimization of fermentation conditions for production of EPS by P. ostreatus. So, the effect of medium composition and fermentation parameters on mycelial growth and EPS production by gamma irradiated isolate of P. ostreatus were investigated in shake-flask cultures. The economical optimum fermentation parameters for the highest EPS production 5.73 g/l and mycelial growth rate 11.8 g/l were achieved at initial ph 6, cultivation temperature 28 C(degree), 20 g/l sucrose, 4 g/l yeast extract, 50 ml of medium working volume in a 250 ml flask, and 6% (v/v) of inoculum size after 10 and 12 days, respectively. EPS produced, in this study, showed strong antioxidant activity (96.3%) at concentration 10 mg/ml.
Directory of Open Access Journals (Sweden)
Purbowati Purbowati
2016-06-01
Full Text Available Background : Diabetes mellitus is a chronic disease caused by acquired deficiency in insulin production by the pancreas, or by the ineffectiveness of using the produced insulin. Oyster mushroom (Pleurotus ostreatus can help lower blood glucose levels, improve lipid profile and reduce levels of MDA. Objective : to analyze the effect of oyster mushroom on blood glucose levels, lipid profile and MDA levels in STZ induced rats as type 1 DM model. Methods : thirty Sprague Dawley rats were randomly divided into 3 groups: one positive group (1 and two treated group which received 100 mg/kgBB (2 and 200 mg/kgBB (3 oyster mushroom extract, respectively. The interventions were carried out for 30 days. The examination of blood glucose levels, lipid profile and MDA levels was before and after the intervention. The differences inthe datapre-post interventions were analyzed by paired t-test, whereas the differences between the groups were analyzed by one-way ANOVA and kruskal wallis followed by post hoc analysis. Results : the treatment group experienced a decrease in blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and an increase in HDL cholesterol levels post-intervention (p < 0,001. Oyster mushroom extract with the dose of 200 mg/kg was more effective in lowering blood glucose levels, MDA levels and improving lipid profiles (p < 0,001. Conclusion : Oyster mushrooms administration lowers blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and increases HDL cholesterol levels.
Tibuhwa, Donatha Damian
2012-09-21
Maasai and Kurya form two main communities around the Serengeti National Park in Tanzania which are mainly pastoralists. Changing climate to excessive drought, have recently forced them to start practicing subsistence farming which is severely affected by wild animals. This study explored status of the folk taxonomy and uses of mushrooms in the two communities as a pave way for possibilities of introducing mushroom cultivation, an alternative crop which is hardly affected by wild animals. Folk taxonomy and use mushrooms by the Kurya and Maasai communities were investigated. Information was collected by face to face interviews with 150 individuals in 6 selected villages. Using descriptive statistics by Statistic Package for the Social Science (SPSS) version 17.0, the demographic characteristics of informants were evaluated and cross relationships with the recorded data were analysed. Kurya are mycophilic with 94% of the informants recognizing utilization of the wild mushroom either as foodstuff or as tonics while the Maasai are mycophobic with 99% being unaware of the edibility of mushroom although 28% recognized mushrooms as tonic. For both communities, the knowledge of mushroom utilization and folk taxonomy increased with age of the informants, while it decreases with formal education level of the informants which imply that the basis of knowledge is mainly traditional. Comparing the two communities, the Maasai use mushrooms only for medicinal purposes and never sought them for food while the Kurya were well knowledgeable on the edibility and folk classification especially the Termitomyces species. Characters used in folkal taxonomy included color and size of the basidiomata, shape and size of the pseudorrhiza, habitats and edibility information. A new use of ascospores whereby they anaesthaesia bees during honey harvesting was discovered, and mushroom cultivation was widely welcomed (94.7%) as an alternative crop which is rarely affected by wild animals. In order
Directory of Open Access Journals (Sweden)
Tibuhwa Donatha
2012-09-01
Full Text Available Abstract Background Maasai and Kurya form two main communities around the Serengeti National Park in Tanzania which are mainly pastoralists. Changing climate to excessive drought, have recently forced them to start practicing subsistence farming which is severely affected by wild animals. This study explored status of the folk taxonomy and uses of mushrooms in the two communities as a pave way for possibilities of introducing mushroom cultivation, an alternative crop which is hardly affected by wild animals. Methods Folk taxonomy and use mushrooms by the Kurya and Maasai communities were investigated. Information was collected by face to face interviews with 150 individuals in 6 selected villages. Using descriptive statistics by Statistic Package for the Social Science (SPSS version 17.0, the demographic characteristics of informants were evaluated and cross relationships with the recorded data were analysed. Results Kurya are mycophilic with 94% of the informants recognizing utilization of the wild mushroom either as foodstuff or as tonics while the Maasai are mycophobic with 99% being unaware of the edibility of mushroom although 28% recognized mushrooms as tonic. For both communities, the knowledge of mushroom utilization and folk taxonomy increased with age of the informants, while it decreases with formal education level of the informants which imply that the basis of knowledge is mainly traditional. Comparing the two communities, the Maasai use mushrooms only for medicinal purposes and never sought them for food while the Kurya were well knowledgeable on the edibility and folk classification especially the Termitomyces species. Characters used in folkal taxonomy included color and size of the basidiomata, shape and size of the pseudorrhiza, habitats and edibility information. A new use of ascospores whereby they anaesthaesia bees during honey harvesting was discovered, and mushroom cultivation was widely welcomed (94.7% as an alternative
Abulude, F. Olawale; Ndamitso, M. Muhammed
2017-01-01
This paper reviews a fungus – mushrooms. In this paper, identification, cultivation, uses, side effects, nutritional and medicinal values, storage, marketing and other uses of mushrooms were discussed. From the review too it was observed that its usefulness surpasses the side effects. These side effects could be eliminated if proper ‘processing’ could be employed. Due to advances in both basic knowledge and practical technology relevant to mushroom farming, mushroom products and mushroom bior...
LENUS (Irish Health Repository)
Cassidy, Nicola
2012-02-01
BACKGROUND: Occasionally, mycologist assistance is requested to reliably identify mushroom species in symptomatic cases where there is a concern that a toxic species is involved. The aim of this study was to describe the epidemiology of mushroom poisoning in Ireland, to describe the working arrangement between the National Poisons Information Centre (NPIC) and professional mycologists and to present a case series detailing the circumstances when mycologists were consulted. METHODS: Computerised records from 1 January 2004 to 31 December 2009 were retrospectively reviewed and data on patient demographics, circumstances, and mushroom species collated. In 1999, the NPIC established a national registry of volunteer professional mycologists who are available 24 h\\/day for mushroom identification. The NPIC staff liaises directly with the mycologist and arranges transport of mushroom material. Digital photographic images are requested if there is likely to be a delay in arranging transportation of mushroom material, and the images are subsequently emailed to a mycologist. Five cases of suspected mushroom poisoning were chosen to demonstrate the inter-professional collaboration between the NPIC and mycologists. RESULTS: From 2004 to 2009, the NPIC was consulted about 70 cases of suspected mushroom exposures. Forty-five children ingested unknown mushrooms, 12 adults and 2 children ingested hallucinogenic mushrooms and 11 adults ingested wild toxic mushrooms that were incorrectly identified or confused with edible species. The mycologists were consulted 10 times since 1999. In this series, Amanita species were identified in two cases. In three cases, the species identified were Clitocybe nebularis, Coprinus comatus and Panaeolina foenisecii, respectively, and serious poisoning was excluded. Incorrect mushroom identification by a health care professional using the Internet occurred in two cases. The mycologists assisted Poisons Information Centres in Northern Ireland and the
LENUS (Irish Health Repository)
Cassidy, Nicola
2011-03-01
Background. Occasionally, mycologist assistance is requested to reliably identify mushroom species in symptomatic cases where there is a concern that a toxic species is involved. The aim of this study was to describe the epidemiology of mushroom poisoning in Ireland, to describe the working arrangement between the National Poisons Information Centre (NPIC) and professional mycologists and to present a case series detailing the circumstances when mycologists were consulted. Methods. Computerised records from 1 January 2004 to 31 December 2009 were retrospectively reviewed and data on patient demographics, circumstances, and mushroom species collated. In 1999, the NPIC established a national registry of volunteer professional mycologists who are available 24 h\\/day for mushroom identification. The NPIC staff liaises directly with the mycologist and arranges transport of mushroom material. Digital photographic images are requested if there is likely to be a delay in arranging transportation of mushroom material, and the images are subsequently emailed to a mycologist. Five cases of suspected mushroom poisoning were chosen to demonstrate the inter-professional collaboration between the NPIC and mycologists. Results. From 2004 to 2009, the NPIC was consulted about 70 cases of suspected mushroom exposures. Forty-five children ingested unknown mushrooms, 12 adults and 2 children ingested hallucinogenic mushrooms and 11 adults ingested wild toxic mushrooms that were incorrectly identified or confused with edible species. The mycologists were consulted 10 times since 1999. In this series, Amanita species were identified in two cases. In three cases, the species identified were Clitocybe nebularis, Coprinus comatus and Panaeolina foenisecii, respectively, and serious poisoning was excluded. Incorrect mushroom identification by a health care professional using the Internet occurred in two cases. The mycologists assisted Poisons Information Centres in Northern Ireland
Wong, Ka-Hing; Katsumata, Shin-Ichi; Masuyama, Ritsuko; Uehara, Mariko; Suzuki, Kazuharu; Cheung, Peter C K
2006-03-08
The effect of three novel dietary fibers (DFs) prepared from mushroom sclerotia, namely, Pleurotus tuber-regium, Polyporus rhinocerus, and Wolfiporia cocos, on calcium and magnesium absorption was evaluated in ovariectomized (OVX) rats fed with sclerotial DF based and low Ca (0.3%) diets for 14 days. The animals in the W. cocos DF diet group possessed significantly (p cocos DF group were also significantly (p cocos DF could improve the overall Ca and Mg absorptions of the OVX rats fed a low Ca diet. The potential use of sclerotial DFs as a functional food ingredient for enhancing mineral absorption is also discussed.
EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms
Bercu, V.; Negut, C. D.; Duliu, O. G.
2010-12-01
The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel— Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom— Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle— Cantharellus cibarius Fr., as well as oyster mushroom— Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.
Mleczek, Mirosław; Siwulski, Marek; Mikołajczak, Patrycja; Gąsecka, Monika; Rissmann, Iwona; Goliński, Piotr; Sobieralski, Krzysztof
2015-01-01
The aim of the study was to estimate copper (Cu) accumulation efficiency in whole-fruiting bodies of 18 edible and non-edible wild growing mushrooms collected from 27 places in the Wielkopolska Voivodeship. Mushrooms were collected each time from the same places to estimate the diversity in Cu accumulation between tested mushroom species within 3 consecutive years of study (2011-2013). The study results revealed various accumulation of Cu in the whole-tested mushroom fruiting bodies. The highest mean accumulation of Cu was observed in Macrolepiota procera (119.4 ± 20.0 mg kg(-1) dm), while the lowest was in Suillus luteus and Russula fellea fruiting bodies (16.1 ± 3.0 and 18.8 ± 4.6 mg kg(-1) dm, respectively). Significant differences in Cu accumulation between mushroom species collected in 2011 and in the two following years (2012 and 2013) were observed. The results indicated that sporadic consumption of these mushrooms was not related to excessive intake of Cu for the human body (no toxic influence on health).
Janjarasskul, Theeranun; Krochta, John M
2010-01-01
Research groups and the food and pharmaceutical industries recognize edible packaging as a useful alternative or addition to conventional packaging to reduce waste and to create novel applications for improving product stability, quality, safety, variety, and convenience for consumers. Recent studies have explored the ability of biopolymer-based food packaging materials to carry and control-release active compounds. As diverse edible packaging materials derived from various by-products or waste from food industry are being developed, the dry thermoplastic process is advancing rapidly as a feasible commercial edible packaging manufacturing process. The employment of nanocomposite concepts to edible packaging materials promises to improve barrier and mechanical properties and facilitate effective incorporation of bioactive ingredients and other designed functions. In addition to the need for a more fundamental understanding to enable design to desired specifications, edible packaging has to overcome challenges such as regulatory requirements, consumer acceptance, and scaling-up research concepts to commercial applications.
International Nuclear Information System (INIS)
Randa, Z.; Benada, J.; Singert, M.; Horyna, J.
1988-01-01
Tabulated is the content of 137 Cs in dry matter of higher mushrooms collected in the years 1986 to 1987. The radioactive level of mushrooms collected in Czechoslovakia such as Boletus badius and B. chrysenteron reached 20 to 50 kBq/kg of dry matter. The individual dose at mean consumption of these mushrooms was estimated at 0.2 to 0.3 mSv/year which amounted to 20 to 30% of the dose from the natural background. (J.B.). 1 tab
Sheng, Ji-Ping; Shen, Lin; Ru, Bing-Gen
2009-03-01
Metallothioneins (MTs) are a family of low molecular weight, cysteine-rich and metal-binding functional proteins. Transgenic MT mushroom can be used as functional food additives, but its zinc-enriching ability has not been studied systemically until now. The zinc contents in mycelia of transgenic MT mushroom (Pleurotus ostreatus) and wild type mushroom mycelia cultivated in different zinc concentration media were analyzed by ICP-OES. The growth status, zinc-enriching ability and degree of zinc in organic form (DZOF) were also analyzed. Results showed that MT mushroom mycelia grew rapidly, but the growth was inhibited when the zinc content in solid media was higher than 1.6 mmol x L(-1). MT mushroom mycelia could enrich more zinc than that of wild type, and the zinc content in MT mushroom mycelia could be 2.56-27.49 mg x kg(-1) when it was cultivated in a liquid media with 0.6-1.2 mmol x L(-1) zinc. DZOF of MT mushroom mycelia in a liquid media with 0.6 mmol x L(-1) zinc at 7 d was significantly higher (88.7%) than that in the wild type (82.1%, alpha = 0.05), but there was no significant difference in DZOF when the MT mushroom mycelia was cultivated in a liquid media with different zinc content at 7 d.
Anti-Growth Factors Associated with Pleurotus ostreatus in a Submerged Liquid Fermentation
Directory of Open Access Journals (Sweden)
Juliet B. Akinyele
2012-09-01
Full Text Available Aims: Previous studies had revealed that cultivation of Pleurotus ostreatus is often met with a lot of challenges ranging from environmental to biological factors which adversely affect the successful cultivation of the mushroom. Hence, a need to determine factors against mycelia colonization of substrate during mushroom’s cultivation.Methodology and Result: Conventional streak method was employed to establish the percentage inhibition as well as intercolony distance between the test organisms obtained from the infected substrate and mycelia of the mushroom during substrate colonization. The test organisms are: a fungus, Kutilakesopsis macalpineae and a bacterium,Pseudomonas tolaasii. The effect of pH and temperature on the mycelia growth of P. ostreatus was also investigated. There was a gradual increase in the percentage inhibition from 33.3 % at 24 h to 75.0 % at 168 h for K. macalpineae and 37.5 % at 24 h to 70.0 at 168 h for P. tolaasii. The inter-colony distance between the antagonists and the mushroom mycelium gradually decreased. Optical density of the mycelium growth was at its optimum at pH 4.5 and temperature of25 °C respectively. In vitro study also showed a significant increase in the optical density from 0.855±0.03 at 24 h to 1.316±0.02 at 168 h in the absence of test antagonist as against 0.812±0.06 and 0.79±0.02 at 24 h to 1.103±0.03 and 0.902±0.03 at 168 h when K. macalpineae and P.tolaasii were used as test antagonistic respectively.Conclusion, significance and impact of study: Sterilization of substrate is essential to avoid contamination during mycelia colonization. Also, slightly acidic medium and temperature control is necessary for high yield of fruit bodies.
International Nuclear Information System (INIS)
Keller, C.
1990-01-01
It has been found that the various mushroom species accumulate Cs-137 in very different quantities. Whereas specimens of the species Xeromus badius always contained high amounts of Cs-137, analyses of specimens of the related species Boletus edulis showed only weak accumulation of the radionuclide. It is assumed that this general difference in accumulation of Cs-137 is due to a difference in the organic constituents of the mushrooms. (orig.) [de
Cultivation of three types of indigenous wild edible mushrooms ...
African Journals Online (AJOL)
STORAGESEVER
2008-12-17
Dec 17, 2008 ... they generate adverse environmental and economic effects related to their .... (i) Sisal decortication residue was used instead of cereal straws. ... diameter of 6 mm and there were 50 holes on the entire plastic sheet. The holes ...
Cultivation of three types of indigenous wild edible mushrooms ...
African Journals Online (AJOL)
STORAGESEVER
2008-12-17
Dec 17, 2008 ... the medium to inhibit the growth of bacteria. Prior to addition to ... was used before any degradation had occurred. The dried biomass ... Each hole had a diameter of 6 mm and there were 50 holes on the entire plastic sheet.
Effect of gamma radiations on some organoleptic qualities of mushroom (Agraricus Bisporus)
International Nuclear Information System (INIS)
Wahid, M.
1985-01-01
Edible mushrooms were picked at a stretched-veil stage and irradiated at 0, 0.5, 1.0 and 2.5 kGy. The samples were studied for the organileptic characteristics in function of storage time and irradiation doses. No significant difference of irradiation was observed immediately on the colour, odour, flavour or texture of mushrooms. During storage the colour and texture of irradiated lots were superior as compared to unirradiated samples. Higher doses of irradiation brought about significantly favourable results in these qualities during storage. Odour and flavour did not differ significantly in all the treatments. Irradiated mushrooms were found to be better (hard) in texture when the measurements were made with a texturometer. Ionizing radiation exerted a favourable influence upon the organoleptic properties of picked mushrooms. (author)
Self-Heating Pasteurization of Substrates for Culinary-Medicinal Mushrooms Cultivation in Mexico.
Morales, Viviana; Sánchez, Jose E
2017-01-01
The aim of this study was to evaluate a self-heating pasteurization technique in preparing substrates for mushroom production. Seven species were used: Agrocybe aegerita, Auricularia fuscosuccinea, Pleurotus djamor, P. eryngii, P. ostreatus, Lentinula edodes, and Ganoderma lucidum. They were cultivated on grass, corncob, wood shavings, and a mixture thereof. The self-heating technique allowed for pasteurization of 3 of the substrates (grass, corncob, and the mixture). The preheating chamber comprised a drawer placed under the pasteurization crate. With this chamber, it was possible to increase inlet air temperatures by 4--5°C. The evaluated mushroom species responded in different ways to the pasteurization process. P. ostreatus (control) and P. djamor produced basidiomes when cultivated in all pasteurization substrates. A. aegerita and P. eryngii fruited only on corncob and the mixture, whereas A. fuscosuccinea fruited only on the pasteurized corncob. G. lucidum and L. edodes did not fructify on the pasteurized substrates.
A CTAB Procedure Of Total Genomic DNA Extraction For Medicinal Mushrooms
International Nuclear Information System (INIS)
Azhar Mohamad; Muhammad Hussaini Mohd Mustafa; Muhammad Hanif Azhari Noor; Rosnani Abdul Rashid; Hasan Hamdani Hasan Mutaat; Meswan Meskom; Mat Rasol Awang
2014-01-01
Medicinal mushroom is defined as mushrooms used in medicine or medical research. Isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including Polymerase Chain Reaction (PCR), endonuclease restriction digestion, Southern blot analysis, and genomic library construction. The most important and prerequisite towards reliable molecular biology work is the total genomic DNA of a sample must be in good quality. Five freshly samples of medicinal mushroom were used in this work known as Auriculariapolytricha, Lentinus edode, Pleurotus sayorcaju, Sczhizopyllum commune and Ganodermalucidum. 5 mg of each sample were used to extraction the DNA, prepared in 3 replications and repeated twice. PCR based technique by using ISSR markers were used in checking the amplification ability of the total genomic extraction. A standard Doyle and Doyle protocol for genomic DNA extraction was modified in optimizing the total genomic DNA from the medicinal mushroom.The modification parameters were percentage of CTAB, incubation period and temperature. The results reveal that each sample required a certain combinations of time and period of incubation. Besides, percentage of CTAB in the buffer was found significant in giving a high yielding of extracted total genomic DNA. The extracted total genomic DNA from the medicinal mushroom yielded from 39.7 ng/ μl to 919.1 ng/ μl. The different yield among the samples found to be corresponded to polysaccharide content in the medicinal mushrooms. The objective of this works is to optimize total genomic DNA extraction of medicinal mushrooms towards a high quality intact genomic DNA for molecular activities. (author)
EFFECT OF USING VARIOUS SUBSTRATES ON CULTIVATION OF PLEUROTUS SAJOR-CAJU
Directory of Open Access Journals (Sweden)
S. N. FASEHAH
2017-04-01
Full Text Available The unmanageable agricultural waste comprises of structural polymers, cellulose, hemicellulose and lignin can be led to pollutions, thus it can be used as a mushroom substrate. Lignocellulosic materials are most favorable feedstock as renewable and natural resource. Forestry and agricultural practices generated a large amount of ligncelluosic waste and promoted to serious problematic environmental pollution. It can be easily broken down by lignocellulotic enzymes. In this study, an attempt was made to evaluate the effect of various substrates on cultivation of Pleurotus sajor-caju. The substrates used in this study were tissue paper, rice husk ash and rubber sawdust. All of the substrates were added with rice bran and calcium carbonate (CaCO3. Then, the mixtures were transferred into plastic sized 8 cm × 4.5 cm and were pasteurized in the steamer for 1 hour at60 °C - 100 °C. After that they were cooled overnight at 25 °C - 30 °C. The spawn were inoculated into the bag and incubated in incubation room. The media bags were incubated until mycelium fully colonized and watering was done twice a day. The parameters studies were included spawn running, number of fruit body, total of stipe length, weight of fruit body and biological efficiency. Results showed that the fastest spawn running and highest number of fruits body, total of stipe length, weight of fruit body and biological efficiency are found using tissue paper substrates. In contrast the rubber sawdust showed the lowest values of spawn running, total of stipe length, weight of fruit body and biological efficiency. It can be concluded that the tissue paper is one of promising substrate which can be used in growing of Pleurotus sajor-caju due to lower cost and easy to purchase as compared to other substrates.
[Use of ITS and ISSR markers in the molecular characterisation of Pleurotus djamor hybrid strains].
Aguilar Doroteo, Leticia; Zárate Segura, Paola Berenice; Villanueva Arce, Ramón; Yáñez Fernández, Jorge; Garín Aguilar, María Eugenia; Guadarrama Mendoza, Paula Cecilia; Valencia Del Toro, Gustavo
Molecular characterisation of wild type Pleurotus species is important for germplasm conservation and its further use for genetic improvement. No molecular studies have been performed with monokaryons used for producing hybrid strains, either with the reconstituted strains obtained by pairing those monokaryons. The molecular characterisation of parental dikaryons, hybrid, and reconstituted strains as well as monokaryotic strains, is therefore of utmost importance. To carry out the molecular identification of Pleurotus djamor strains, i.e. dikaryotic wild type strains, hybrid strains, and the monokaryotic strains used for the hybrid formation. Five wild type strains of P. djamor from different states in Mexico were collected and molecularly identified by sequencing the ITS1-5.8-ITS2 region using ITS1 and ITS4 universal oligonucleotides. Four hybrid strains were obtained by pairing neohaplonts of two wild type strains selected. Six ISSR markers were used for the molecular characterisation of monokaryotic and dikaryotic strains. Using the ITS markers, an amplified product of 700bp was obtained in five wild type strains, with a 99-100% similarity with P. djamor. A total of 95 fragments were obtained using the ISSR markers, with 99% of polymorphism. Wild type strains were identified as P. djamor, and were clearly grouped with Mexican strains from other states of Mexico. ISSR markers allowed the generation of polymorphic bands in monokaryotic and dikaryotic strains, splitting both types of strains. The high degree of polymorphism indicates the genetic diversity of P. djamor, an advantage in mushroom production and in the improving of the species. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.
Directory of Open Access Journals (Sweden)
L Razeghi yadak
2011-01-01
Full Text Available Abstarct Shiitake mushroom [Lentinula edodes(Berk Singer/Pegler] has the second production class among the most important edible mushrooms. For a long time this mushroom has draw attention due to its unique flavor and taste and also therapeutic properties. ِDue to the importance of this mushroom in the world and also the effect of substrate on the production of this medicinal mushroom, a research were conducted in randomized complete block design with 6 replications on 4 different substrate formulations including: 1 sawdust, wheat bran, millet; 2 sawdust, wheat bran, molasses, chalk, calcium super phosphate; 3sawdust, wheat bran, tea waste; 4sawdust, saccharose, citric acid, chalk and calcium carbonate on L.edodes production for determining the suitable substarte on early fruiting, yield, biological effeciency, average mushroom numbers and weights per block. Results showed that substrate formulation 1 caused earlier fruiting than others (58 days from incubation time, this formulation also had the highest yield (112/3 g/log and biological effeciency (35/09% between the others formula. mashroom number was the most in substrate formulation 1 (16/67 n/log and the highest mushroom wieght was obtained from formulation 4 (14/33 g/per mushroom. there wasn’t any significant differences at (p≤0.05 between substrate formulation 1 and 2. Keywords: Shiitake, Substrate formulation, Yield, Biological effeciency, Mushroom number and weight
Directory of Open Access Journals (Sweden)
E. N. Vlasenko
2017-08-01
Full Text Available The aim of the study was to determine the intensity of synthesis of volatile aroma compounds by Pleurotus ostreatus (oyster mushroom on sunflower husks and barley straw using sensory profile analysis and UV spectroscopy. The main cultural and morphological characteristics of the mycelial growth and development of fruiting bodies are determined: the period of mycelial development on the substrate, the time of primordial formation, the number of mushroom bunches per unit volume of substrate, the morphology of carpophores. Characteristic attributes of the aroma of dried fruiting bodies (mushroom, woody, sweet, herbaceous, fish, meat, floral, earthy, acidic, putrescent are established and their aroma profiles are built. Sensory profile analysis of flavor of dried samples showed that the mushroom flavor of fungi cultivated on the sunflower husk is more pronounced than of those grown on barley straw. The light absorption maxima are recorded in the ranges 204–210 and 250–290 nm according to UV absorption spectra. Optimal conditions for extracting aromatics from dried fungi samples are the extraction time of 20–35 min at the boiling point of the solvent. Analysis of the UV spectra of fungal alcohol and hexane extracts showed that the intensity of the synthesis of volatile compounds is higher for strains cultivated on sunflower husks than for samples obtained on barley straw.
Directory of Open Access Journals (Sweden)
Li Fen
2014-01-01
Full Text Available In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase. The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P<0.01 higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330 cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92 U/L on the 9th day and 22.58 U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67 U/L and 489.17 U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels.
Cultivation of Schizophyllum commune mushroom on different wood substrates
Directory of Open Access Journals (Sweden)
P.N. Dasanayaka
2017-07-01
Full Text Available Schizophyllum commune is an edible mushroom grown on wood under natural conditions. Present study focused on cultivation of S.commune on different wood substrates since it is not commercially cultivated. A pure culture of S. commune was obtained by growing a tissue of the mushroom on Potato Dextrose Agar (PDA medium. Spawns were produced by growing the mycelium on paddy grains. Mushroom was cultivated on sawdust of seven different wood substrates. The maximum yield was observed in sawdust of jackfruit (Artocarpusheterophyllus followed by sawdust of rambutan (Nepheliumlappaceum and country almond (Terminaliacatappa. A significant difference was not observed when mango (Mangiferaindica elephant apple (Dilleniaindica, tulip wood tree (Harpulliaarborea and thungfaa (Alstoniamacrophylla sawdust used as substrate. The lowest yield was observed in thungfaa (Alstoniamacrophylla sawdust. Effect of some additives on the yield was studied and significant difference in yield was observed when rice bran and used-tea leaves used as additives. Effect of rice bran on yield was studied using different ratios of sawdust to rice bran and the highest was observed in 2:1 ratio of sawdust to rice bran. The best incubating temperature for mycelial growth on the substrate was 350C. The composition of the mushroom on a dry weight basis was; 71.4% moisture, 23.35% crude protein and 6% ash. Tested wood species are promising substrates for cultivation of S.communeas cottage industry.
Radiocesium activity reduction in mushrooms by heat pressure treatment
International Nuclear Information System (INIS)
Dvorak, P.; Dolezalova, J.; Benova, K.; Ohera, M.
2008-01-01
The total activity of radiocesium is decreasing in forest ecosystems more slowly than it was expected. Hence it is topical to find technology that reduces the radiocesium content in foodstuffs. Some kinds of mushrooms including consumable ones cumulate significant amount of radiocesium (Cs-137) from the environment. The samples of edible boletus (Xerosomus badius) always originate from the same location, i.e. the Bohemian-Moravian Uplands, where the contamination of Cs-137 has been monitored for a long time using a laboratory semiconductor gamma-spectrometry. To reduce the radiocesium content in the wet samples a pressure cooker was applied with the boiling time of 15 minutes. After cooling juice was separated from the samples. This technology offers 65 percent activity reduction on average in boiled mushrooms. (authors)
Radioactivity in mushrooms in northeast Italy following the Chernobyl accident
International Nuclear Information System (INIS)
Battiston, G.A.; Degetto, S.; Gerbasi, R.; Sbrignadello, G.
1989-01-01
Radionuclide activities in common edible mushrooms, collected in northeast Italy following the Chernobyl accident, are reported. The highest levels were found in Clitocybe infundibuliformis, Cantharellus lutescens and Boletus cavipes. In addition, a large number of soil samples was collected in the same area. From the 137 Cs/ 134 Cs ratios, its was possible to differentiate the radiocesium contribution from pre-Chernobyl fallout in both fungi and soil. The contour maps for 137 Cs and 134 Cs distributions are reported. The radioactivity detected in the mushrooms is not related in a simple manner to the contamination level of the corresponding soil. Some species tend to concentrate cesium and silver nuclides, whilst others show little affinity for these and other nuclides. Explanations for the different behavioral characteristics of the species are suggested. (author)
Free amino acids and 5'-nucleotides in Finnish forest mushrooms.
Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo
2018-05-01
Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.
Collecting and learning to identify edible fungi in southeastern Poland: age and gender differences.
Luczaj, Lukasz; Nieroda, Zofia
2011-01-01
The gathering of 17 folk taxa of edible fungi (most commonly Boletus edulis, Leccinum spp., Xerocomus spp., Suillus spp., Cantharellus cibarius, Armillaria spp., Russula spp., Lactarius salmonicolor, Macrolepiota procera, Boletus erythropus) was recorded in three villages in southeast Poland, but only 13 of them are gathered by children. Gender and age differences were small (apart from the fact that more adults than children collect non-Boletaceae species), and relatives of both sexes took part in teaching children about mushrooms, although fathers were most frequently mentioned as first teachers. Collecting mushrooms, mainly for own use, sometimes for sale, is still a culturally significant activity.
Kimura, Takashi
2013-01-01
Sparassis crispa, also known as cauliflower mushroom, is an edible mushroom with medicinal properties. Its cultivation became popular in Japan about 10 years ago, a phenomenon that has been attributed not only to the quality of its taste, but also to its potential for therapeutic applications. Herein, I present a comprehensive summary of the pharmacological activities and mechanisms of action of its bioactive components, such as beta-glucan, and other physiologically active substances. In particular, the immunomodulatory mechanisms of the beta-glucan components are presented herein in detail.
Energy Technology Data Exchange (ETDEWEB)
Van der Wel, A.J.; Bakker, R.
2000-07-01
As a result of a new Dutch Electricity Law and the liberalization of the natural gas market the mushroom cultivation business requires insight in the consequences of those developments for the energy costs. Also attention is paid to the consequences of the abolition of the limited exemption of the Regular Energy Levy (REB, abbreviated in Dutch). Finally, insight is given into the consequences of changes in the government policy on the so-called long-range agreements on energy efficiency (sector edible mushrooms)18 refs.
Directory of Open Access Journals (Sweden)
Takashi Kimura
2013-01-01
Full Text Available Sparassis crispa, also known as cauliflower mushroom, is an edible mushroom with medicinal properties. Its cultivation became popular in Japan about 10 years ago, a phenomenon that has been attributed not only to the quality of its taste, but also to its potential for therapeutic applications. Herein, I present a comprehensive summary of the pharmacological activities and mechanisms of action of its bioactive components, such as beta-glucan, and other physiologically active substances. In particular, the immunomodulatory mechanisms of the beta-glucan components are presented herein in detail.
Phan, Chia-Wei; Wong, Wei-Lun; David, Pamela; Naidu, Murali; Sabaratnam, Vikineswary
2012-07-19
Drugs dedicated to alleviate neurodegenerative diseases like Parkinson's and Alzheimer's have always been associated with debilitating side effects. Medicinal mushrooms which harness neuropharmacological compounds offer a potential possibility for protection against such diseases. Pleurotus giganteus (formerly known as Panus giganteus) has been consumed by the indigenous people in Peninsular Malaysia for many years. Domestication of this wild mushroom is gaining popularity but to our knowledge, medicinal properties reported for this culinary mushroom are minimal. The fruiting bodies P. giganteus were analysed for its nutritional values. Cytotoxicity of the mushroom's aqueous and ethanolic extracts towards PC12, a rat pheochromocytoma cell line was assessed by using 3-[4,5-dimethythiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay. Neurite outgrowth stimulation assay was carried out with nerve growth factor (NGF) as control. To elucidate signaling mechanisms involved by mushroom extract-induced neurite outgrowth, treatment of specific inhibitor for MEK/ERK and PI3K signalling pathway was carried out. The fruiting bodies of P. giganteus were found to have high carbohydrate, dietary fibre, potassium, phenolic compounds and triterpenoids. Both aqueous and ethanolic extracts induced neurite outgrowth of PC12 cells in a dose- and time-dependant manner with no detectable cytotoxic effect. At day 3, 25 μg/ml of aqueous extract and 15 μg/ml of ethanolic extract showed the highest percentage of neurite-bearing cells, i.e. 31.7 ± 1.1% and 33.3 ± 0.9%; respectively. Inhibition treatment results suggested that MEK/ERK and PI3K/Akt are responsible for neurite outgrowth of PC12 cells stimulated by P. giganteus extract. The high potassium content (1345.7 mg/100 g) may be responsible for promoting neurite extension, too. P. giganteus contains bioactive compounds that mimic NGF and are responsible for neurite stimulation. Hence, this mushroom may be
Fernandes, Ângela; Antonio, Amilcar L; Oliveira, M Beatriz P P; Martins, Anabela; Ferreira, Isabel C F R
2012-11-15
The short shelf-life of mushrooms is an obstacle to the distribution and marketing of the fresh product. Thus, prolonging postharvest storage, while preserving their quality, would benefit the mushroom industry as well as consumers. There has been extensive research on finding the most appropriate technology for mushrooms preservation. Gamma, electron-beam and UV irradiation have been shown to be potential tools in extending the postharvest shelf-life of fresh mushrooms. Studies evaluating the effects of ionizing radiation are available mainly in cultivated species such as Agaricus bisporus, Lentinus edodes and Pleurotus ostreatus. This review comprises a comprehensive study of the effects of irradiation on physico-chemical parameters (weight, colour, texture and pH), chemical compounds including nutrients (proteins, sugars and vitamins) and non-nutrients (phenolics, flavonoids and flavour compounds), and on biochemical parameters such as enzymatic activity of mushrooms for different species and from different regions of the world. Copyright © 2012 Elsevier Ltd. All rights reserved.
Slawinska, Aneta; Fornal, Emilia; Radzki, Wojciech; Jablonska-Rys, Ewa; Parfieniuk, Ewa
2017-01-01
The effects of ultraviolet B (UVB) irradiation on the synthesis of vitamin D2 and its stability during refrigerated storage was determined in fresh cultivated culinary-medicinal mushrooms (Agaricus bisporus, Pleurotus ostreatus, and Lentinus edodes) after harvest. The irradiated mushrooms were stored at 4°C for up to 10 days. The concentrations of vitamin D2 and ergosterol were determined using ultrahigh-performance liquid chromatography/tandem mass spectrometry. The cultivated mushrooms not treated with UVB were devoid of vitamin D2. After UVB irradiation, we obtained mushrooms with a large amount of ergocalciferol. A. bisporus showed the lowest vitamin D2 content (3.55 ± 0.11 μg D2/g dry weight); P. ostreatus contained 58.96 ± 1.15 μg D2/g dry weight, and L. edodes contained 29.46 ± 2.21 μg/g dry weight. During storage at 4°C, the amount of vitamin D2 was gradually decreased in P. ostreatus and L. edodes, whereas in A. bisporus vitamin D2 gradually increased until the sixth day, then decreased. Mushrooms exposed to UVB radiation contain a significant amount of vitamin D2 and are therefore an excellent food source of vitamin D.
Directory of Open Access Journals (Sweden)
Mojgan Parvandi
2017-12-01
Full Text Available Introduction: The white button mushroom does not produce remarkable yield in the third flash. Nutritional deficiency and the inability of this mushroom to efficient use of compost are mentioned as its reasons. Basically, compost includes two major food components, lignocellulose and microbial biomass. But this microbial biomass provides just 10% of button mushroom food needs. According to research studies, differentenzymes in both white button mushroom and oyster mushroom are responsible for decomposition of lignin compounds in compost media, from begin of mycelium grows to the end of fruiting. Lacasse, manganese peroxidase, lignin peroxidase, glyoxal oxidase enzymes contribute to degradation of lignin compounds in degradation mushroom has proven by researchers however itis dependent on mushroom types. Manganese peroxidase enzyme (EC. 1.11.1.13 is an extracellular parser lignin enzyme that has a central peroxidase core. Manganese peroxidase enzyme oxidizesMn2+ to Mn3+ and then Mn3+ oxidizes phenolic structure to fonoxile radical. Produced Mn3+ is very active and makes complex by chelating organic acids that is produced by mushrooms such as oxalate or malate. Mn3+ ions become stable by helping of these chelates and it can penetrate through materials such as wood. On the other hand, in recent years, plant biotechnology provides new solutions for old problems such as use of microorganisms, particularly using bacteria for gene transfer and improvement of superlatives. For a sample of this method, Agrobacterium-mediated transformation system can be noted. In addition, the use of suitable promoters for heterologous genes expression in suitable hosts is an important strategy in functional biotechnology that has been raised in edible mushroom genetic engineering. The lack of efficient and sufficient use of compost, low power of white button mushroom in competition with other rivals, lack of yield per area unit due to production costs, pests and diseases
Tang, Xia; Dong, Shunwen; Shi, Wenjin; Gao, Ni; Zuo, Lei; Xu, Heng
2016-11-01
This study focused on the bioremediation role of Pleurotus eryngii in different characteristics soils contaminated with nickel (Ni) and fluoranthene. The results of bioremediation experiments showed that fluoranthene had a positive effect on the growth of P. eryngii, whereas Ni exerted a negative influence. The concentration of fluoranthene significantly decreased in inoculated soil accounting for 86.39-91.95% of initial concentration in soils and 71.46-81.76% in non-inoculated soils, which showed that the dissipation of fluoranthene was enhanced by mushroom inoculating. The highest removal rates of fluoranthene in sandy loam, loamy clay, and sandy soils reached to 87.81, 86.39, and 91.95%, respectively, which demonstrated that P. eryngii was more suitable for the bioremediation of sandy soil contaminated with fluoranthene. In addition, the presence of Ni tended to decrease the dissipation of fluoranthene in inoculated soil. Higher ligninolytic enzymes activities were detected in inoculated soils, resulting in the enhanced dissipation of fluoranthene in inoculated soils. Furthermore, P. eryngii had the ability to uptake Ni (4.88-39.53 mg kg -1 ) in co-contamination soil. In conclusion, the inoculating of P. eryngii was effective in remediating of Ni-fluoranthene co-contaminated soils. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Mohammad Ebrahim RANJBAR
2017-12-01
Full Text Available Shiitake is an edible mushroom native to East Asia. In the present research, the soaking water was targeted as the vehicle to enrich the substrate. The amount of nutrients in the substrate is severely reduced by mycelium growth and development during spawn running and browning period. Some part of this reduction can be compensated by soaking the substrate in the enriched soaking water. In this study, soaking water was enriched by some complement materials and enrichment effects on some important properties of shiitake mushroom were evaluated. The highest biological efficiency (69.88 % was gained with soaking the blocks in wheat bran extraction suspension. The highest dry matter of mushroom was obtained by rice bran extraction suspension as the enriched soaking water. The results of this research showed that some important properties of shiitake mushroom can be improved by soaking the blocks with enriched soaking water. According to the results, wheat bran extraction suspension was the best enriched solution to increase productivity of shiitake mushrooms and rice bran extraction suspension was suitable to improve quality of mushrooms.
Arsenic hyperaccumulation and speciation in the edible ink stain bolete (Cyanoboletus pulverulentus)
Czech Academy of Sciences Publication Activity Database
Braeuer, S.; Gössler, W.; Kameník, Jan; Konvalinková, Tereza; Žigová, A.; Borovička, Jan
2018-01-01
Roč. 242, č. 3 (2018), s. 225-231 ISSN 0308-8146 R&D Projects: GA ČR GF16-34839L; GA MŠk LM2015056 Institutional support: RVO:61388971 ; RVO:61389005 Keywords : Edible mushrooms * Dimethylarsinic acid * Soil * Health risk * HPLC-ICPMS Subject RIV: CB - Analytical Chemistry, Separation; EE - Microbiology, Virology (MBU-M) OBOR OECD: Analytical chemistry; Microbiology (MBU-M) Impact factor: 4.529, year: 2016
Directory of Open Access Journals (Sweden)
Kouki Fujioka
2013-11-01
Full Text Available Electronic noses have the benefit of obtaining smell information in a simple and objective manner, therefore, many applications have been developed for broad analysis areas such as food, drinks, cosmetics, medicine, and agriculture. However, measurement values from electronic noses have a tendency to vary under humidity or alcohol exposure conditions, since several types of sensors in the devices are affected by such variables. Consequently, we show three techniques for reducing the variation of sensor values: (1 using a trapping system to reduce the infering components; (2 performing statistical standardization (calculation of z-score; and (3 selecting suitable sensors. With these techniques, we discriminated the volatiles of four types of fresh mushrooms: golden needle (Flammulina velutipes, white mushroom (Agaricus bisporus, shiitake (Lentinus edodes, and eryngii (Pleurotus eryngii among six fresh mushrooms (hen of the woods (Grifola frondosa, shimeji (Hypsizygus marmoreus plus the above mushrooms. Additionally, we succeeded in discrimination of white mushroom, only comparing with artificial mushroom flavors, such as champignon flavor and truffle flavor. In conclusion, our techniques will expand the options to reduce variations in sensor values.
Directory of Open Access Journals (Sweden)
Julita Reguła
2016-06-01
Product may be a valuable source of iron in the nutrition of individuals with a deficiency of this element, first of all patients with absorption and metabolism disorders, but also may add variety to the traditional daily diet.
Yang, Wenjie; Guo, Fengling; Wan, Zhengjie
2013-10-01
Oyster mushroom (Pleurotus ostreatus) was cultivated on rice straw basal substrate, wheat straw basal substrate, cotton seed hull basal substrate, and wheat straw or rice straw supplemented with different proportions (15%, 30%, and 45% in rice straw substrate, 20%, 30%, and 40% in wheat straw substrate) of cotton seed hull to find a cost effective substrate. The effect of autoclaved sterilized and non-sterilized substrate on growth and yield of oyster mushroom was also examined. Results indicated that for both sterilized substrate and non-sterilized substrate, oyster mushroom on rice straw and wheat basal substrate have faster mycelial growth rate, comparatively poor surface mycelial density, shorter total colonization period and days from bag opening to primordia formation, lower yield and biological efficiency, lower mushroom weight, longer stipe length and smaller cap diameter than that on cotton seed hull basal substrate. The addition of cotton seed hull to rice straw and wheat straw substrate slowed spawn running, primordial development and fruit body formation. However, increasing the amount of cotton seed hull can increase the uniformity and white of mycelium, yield and biological efficiency, and increase mushroom weight, enlarge cap diameter and shorten stipe length. Compared to the sterilized substrate, the non-sterilized substrate had comparatively higher mycelial growth rate, shorter total colonization period and days from bag opening to primordia formation. However, the non-sterilized substrate did not gave significantly higher mushroom yield and biological efficiency than the sterilized substrate, but some undesirable characteristics, i.e. smaller mushroom cap diameter and relatively long stipe length.
Mycorrhizal and Saprophytic edible fungi as biological indicators for environmental radioactivity
International Nuclear Information System (INIS)
Gaso, M.I.; Segovia, N.; Cervantes, M.L.
2002-01-01
40 K and 137 Cs specific activities were determined in soil and in 137 mushroom samples belonging to 32 edible mushroom species from a forest ecosystem located in Mexico. Among all the species investigated, 15 were mycorrhizal fungi and 15 were saprophytes. 40 K specific activities lay within a range from 332 to 2070 (Bq kg -1 , dry weight), with the lower value corresponding to the saprophytic fungi Clitocybe gibba and the higher value to the ectomycorrhizal Amanita cesarea. The 137 Cs concentration determined in mycorrhizal fungi was also higher than in saprophytes. The contribution from mushrooms to the dietary intake of 40 K was estimated to be several times higher than the corresponding component of annual intake calculated for 137 Cs. (orig.)
Mycorrhizal and Saprophytic edible fungi as biological indicators for environmental radioactivity
Energy Technology Data Exchange (ETDEWEB)
Gaso, M.I.; Segovia, N.; Cervantes, M.L. [ININ, Mexico D.F. (Mexico)
2002-03-01
{sup 40}K and {sup 137}Cs specific activities were determined in soil and in 137 mushroom samples belonging to 32 edible mushroom species from a forest ecosystem located in Mexico. Among all the species investigated, 15 were mycorrhizal fungi and 15 were saprophytes. {sup 40}K specific activities lay within a range from 332 to 2070 (Bq kg{sup -1}, dry weight), with the lower value corresponding to the saprophytic fungi Clitocybe gibba and the higher value to the ectomycorrhizal Amanita cesarea. The {sup 137}Cs concentration determined in mycorrhizal fungi was also higher than in saprophytes. The contribution from mushrooms to the dietary intake of {sup 40}K was estimated to be several times higher than the corresponding component of annual intake calculated for {sup 137}Cs. (orig.)
Lee, Tzu-Tai; Ciou, Jhih-Ying; Chiang, Ching-Jen; Chao, Yun-Peng; Yu, Bi
2012-11-07
Pleurotus eryngii stalk residue (PESR) is a byproduct of the edible portion of the fruiting body. The present study was conducted to evaluate the effects of PESR on the oxidative status and meat quality of broilers. Two hundred fifty 1-d-old male broilers (Arbor Acre) were evenly divided by gender and randomly allocated into control (corn-soybean meal diet) or 1.0, 5.0, 10.0, or 20.0 g/kg dried PESR groups. The results revealed that at 35 d, the dried PESR groups displayed a significantly increased water-holding capacity and decreased storage loss of breast and thigh fillets when compared to the control group. Regarding fillets color, the L* (lightness) values were lower and the a* (redness) and b* (yellowness) values were higher following dried PESR supplementation. In 5.0-20.0 g/kg PESR supplementation groups, the activities of antioxidative enzymes were significantly elevated in serum, liver, spleen, and fillet tissues when compared to control group. Additionally, malondialdehyde production was slightly decreased in the PESR supplementation groups. Lower crude fat contents were observed in fillet tissues of 5.0-20.0 g/kg PESR groups when compared with the control group. In conclusion, PESR may potentially be used as an antioxidant to decrease lipid peroxidation and improve meat quality in broilers.
Functional expression of a valencene dioxygenase from Pleurotus sapidus in E. coli.
Zelena, Kateryna; Krings, Ulrich; Berger, Ralf G
2012-03-01
Valencene dioxygenase (ValOx) from the edible basidiomycete Pleurotus sapidus converted the sesquiterpene (+)-valencene to the valuable grapefruit flavour (+)-nootkatone and to nootkatols through intermediate hydroperoxides. Expression of the enzyme was carried out in the cytosol and periplasm of Escherichia coli. The heterologous production led to high yields of inclusion bodies. The poor yield of soluble recombinant protein was improved by various strategies including cold shock expression, chaperone co-expression, and employment of mutant E. coli strains. Up to 60 mg of the biologically active, soluble ValOx was produced by cold shock under control of the cspA promoter at 8 °C in the BL21(DE3)Star strain and co-expression of the E. coli trigger factor. The recombinant enzyme, purified using the N-terminal His tag, showed the catalytic properties of the wild-type enzyme, as was confirmed by the LC-MS analysis of hydroperoxide intermediates and GC-MS analysis of the volatile products. Copyright © 2011 Elsevier Ltd. All rights reserved.
Nakagawa, Kouichi; Hara, Hideyuki
2016-01-01
We investigated the antioxidant activities and locations of stable paramagnetic species in dry (or drying) shiitake mushroom (Lentinus edodes) using continuous wave (CW) electron paramagnetic resonance (EPR) and 9 GHz EPR imaging. CW 9 GHz EPR detected paramagnetic species (peak-to-peak linewidth (ΔHpp) = 0.57 mT) in the mushroom. Two-dimensional imaging of the sharp line using a 9 GHz EPR imager showed that the species were located in the cap and shortened stem portions of the mushroom. No other location of the species was found in the mushroom. However, radical locations and concentrations varied along the cap of the mushroom. The 9 GHz EPR imaging determined the exact location of stable paramagnetic species in the shiitake mushroom. Distilled water extracts of the pigmented cap surface and the inner cap of the mushroom showed similar antioxidant activities that reduced an aqueous solution of 0.1 mM 4-hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl. The present results suggest that the antioxidant activities of the edible mushroom extracts are much weaker than those of ascorbic acid. Thus, CW EPR and EPR imaging revealed the location and distribution of stable paramagnetic species and the antioxidant activities in the shiitake mushroom for the first time.
Degradation of Green Polyethylene by Pleurotus ostreatus.
Directory of Open Access Journals (Sweden)
José Maria Rodrigues da Luz
Full Text Available We studied the biodegradation of green polyethylene (GP by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.
Degradation of Green Polyethylene by Pleurotus ostreatus.
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Ribeiro, Karla Veloso Gonçalves; Mendes, Igor Rodrigues; Kasuya, Maria Catarina Megumi
2015-01-01
We studied the biodegradation of green polyethylene (GP) by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.
A Data Mining Approach to Improve Inorganic Characterization of Amanita ponderosa Mushrooms
Directory of Open Access Journals (Sweden)
Cátia Salvador
2018-01-01
Full Text Available Amanita ponderosa are wild edible mushrooms that grow in some microclimates of Iberian Peninsula. Gastronomically this species is very relevant, due to not only the traditional consumption by the rural populations but also its commercial value in gourmet markets. Mineral characterisation of edible mushrooms is extremely important for certification and commercialization processes. In this study, we evaluate the inorganic composition of Amanita ponderosa fruiting bodies (Ca, K, Mg, Na, P, Ag, Al, Ba, Cd, Cr, Cu, Fe, Mn, Pb, and Zn and their respective soil substrates from 24 different sampling sites of the southwest Iberian Peninsula (e.g., Alentejo, Andalusia, and Extremadura. Mineral composition revealed high content in macroelements, namely, potassium, phosphorus, and magnesium. Mushrooms showed presence of important trace elements and low contents of heavy metals within the limits of RDI. Bioconcentration was observed for some macro- and microelements, such as K, Cu, Zn, Mg, P, Ag, and Cd. A. ponderosa fruiting bodies showed different inorganic profiles according to their location and results pointed out that it is possible to generate an explanatory model of segmentation, performed with data based on the inorganic composition of mushrooms and soil mineral content, showing the possibility of relating these two types of data.
A Data Mining Approach to Improve Inorganic Characterization of Amanita ponderosa Mushrooms.
Salvador, Cátia; Martins, M Rosário; Vicente, Henrique; Caldeira, A Teresa
2018-01-01
Amanita ponderosa are wild edible mushrooms that grow in some microclimates of Iberian Peninsula. Gastronomically this species is very relevant, due to not only the traditional consumption by the rural populations but also its commercial value in gourmet markets. Mineral characterisation of edible mushrooms is extremely important for certification and commercialization processes. In this study, we evaluate the inorganic composition of Amanita ponderosa fruiting bodies (Ca, K, Mg, Na, P, Ag, Al, Ba, Cd, Cr, Cu, Fe, Mn, Pb, and Zn) and their respective soil substrates from 24 different sampling sites of the southwest Iberian Peninsula (e.g., Alentejo, Andalusia, and Extremadura). Mineral composition revealed high content in macroelements, namely, potassium, phosphorus, and magnesium. Mushrooms showed presence of important trace elements and low contents of heavy metals within the limits of RDI. Bioconcentration was observed for some macro- and microelements, such as K, Cu, Zn, Mg, P, Ag, and Cd. A. ponderosa fruiting bodies showed different inorganic profiles according to their location and results pointed out that it is possible to generate an explanatory model of segmentation, performed with data based on the inorganic composition of mushrooms and soil mineral content, showing the possibility of relating these two types of data.
Marik, Tamás; Urbán, Péter; Tyagi, Chetna; Szekeres, András; Leitgeb, Balázs; Vágvölgyi, Máté; Manczinger, László; Druzhinina, Irina S; Vágvölgyi, Csaba; Kredics, László
2017-06-01
Certain Trichoderma species are causing serious losses in mushroom production worldwide. Trichoderma aggressivum and Trichoderma pleuroti are among the major causal agents of the green mould diseases affecting Agaricus bisporus and Pleurotus ostreatus, respectively. The genus Trichoderma is well-known for the production of bioactive secondary metabolites, including peptaibols, which are short, linear peptides containing unusual amino acid residues and being synthesised via non-ribosomal peptide synthetases (NRPSs). The aim of this study was to get more insight into the peptaibol production of T. aggressivum and T. pleuroti. HPLC/MS-based methods revealed the production of peptaibols closely related to hypomurocins B by T. aggressivum, while tripleurins representing a new group of 18-residue peptaibols were identified in T. pleuroti. Putative NRPS genes enabling the biosynthesis of the detected peptaibols could be found in the genomes of both Trichoderma species. In vitro experiments revealed that peptaibols are potential growth inhibitors of mushroom mycelia, and that the host mushrooms may have an influence on the peptaibol profiles of green mould agents. © 2017 Wiley-VHCA AG, Zurich, Switzerland.
Radioactive contamination of wild mushrooms: mycological approach and risk perception
International Nuclear Information System (INIS)
Droujinina, I.
2001-11-01
Recent investigations of the wide range of polluted environments have proven that different toxic elements, especially long-lived radionuclides of caesium and strontium, can be accumulated in fruit bodies of fungi. Therefore, consumption of wild mushrooms can be regarded as a risky activity. Radiocaesium, which was released into the environment by atomic weapons testing and accidents in the nuclear industry, is now accumulated particularly in the upper, mainly organic horizons of forest soils and it is assumed that fungal mycelium play a substantial role for the retention of this pollutant in top layers of soil. Nowadays macromycete fungi become a key point of the forest radioecology because of the extremely high level of the inter- and intraspecific variability of the radionuclide accumulation (from two to four orders of magnitude). The latter significantly complicates all efforts to predict the future migration of radionuclides in the ecosystem and creates a high uncertainty in the radioecological models. At the same time, mechanisms of radiocaesium uptake by fungal mycelium remain poorly understood. In this work, physiological mechanisms of radiocaesium accumulation by fungal mycelium (complex in vitro mycological approach) were investigated along with the pilot sociological study of the perception of the contamination of wild edible mushrooms by citizens of different countries. Such bilateral approach allows the comparison of an expert's perception of the problem with the mental model of those people who consume wild mushrooms. The revealed difference should be useful in future risk communication efforts when interested population should be informed. (author)
Global collection of mushroom pathogens
Baars, J.J.P.; Hendrickx, P.M.; Sonnenberg, A.S.M.; Korsten, L.
2013-01-01
In many places in the world, increasingly less chemical crop protection agents are available for use in mushroom cultivation. As a consequence, mushroom cultivation will loose the ability to use crop protection agents. As a consequence, good hygiene management, early detection and monitoring of
Yao, Sen; Li, Tao; Li, JieQing; Liu, HongGao; Wang, YuanZhong
2018-06-01
Boletus griseus and Boletus edulis are two well-known wild-grown edible mushrooms which have high nutrition, delicious flavor and high economic value distributing in Yunnan Province. In this study, a rapid method using Fourier transform infrared (FT-IR) and ultraviolet (UV) spectroscopies coupled with data fusion was established for the discrimination of Boletus mushrooms from seven different geographical origins with pattern recognition method. Initially, the spectra of 332 mushroom samples obtained from the two spectroscopic techniques were analyzed individually and then the classification performance based on data fusion strategy was investigated. Meanwhile, the latent variables (LVs) of FT-IR and UV spectra were extracted by partial least square discriminant analysis (PLS-DA) and two datasets were concatenated into a new matrix for data fusion. Then, the fusion matrix was further analyzed by support vector machine (SVM). Compared with single spectroscopic technique, data fusion strategy can improve the classification performance effectively. In particular, the accuracy of correct classification of SVM model in training and test sets were 99.10% and 100.00%, respectively. The results demonstrated that data fusion of FT-IR and UV spectra can provide higher synergic effect for the discrimination of different geographical origins of Boletus mushrooms, which may be benefit for further authentication and quality assessment of edible mushrooms.
Amylolytic studies of pleurotus tuber-regium | Monago | Global ...
African Journals Online (AJOL)
The alpha amylase of the sclerotium of Pleurotus tuber-regium was studied. The enzyme was purified from the fresh sclerotium through dialysis, ammonium sulphate fractionation and column chromatography of CM sephadex. The enzyme showed 70% of it's optimal activity between p.H 4.0 to 8.0. Acid and thermal stability ...
nutrient composition of pleurotus tuberregium (fr) sing's sclerotia
African Journals Online (AJOL)
DJFLEX
The amino acid and mineral profile of Pleurotus tuberregium sclerotia, was investigated. Every 100g ... sample was dried to a constant weight, defatted (by placing a ... (67%), millet, soy bean (74%), peanuts (65%), African ... sodium content to cashew nut (5-13.02mg/100g) [Nandi, .... sclerotia Flour and Protein Concentrate.
Improving the feeding value of straws with Pleurotus ostreatus
Khan, N.A.; Hussain, S.; Ahmad, N.; Alam, S.; Bezabhi, M.; Hendriks, W.H.; Yu, P.; Cone, J.W.
2015-01-01
The high content of lignin in cell walls is the major limiting factor in the digestion and utilisation of cereal crop residues by ruminants. The aim of this study was to evaluate the effectiveness of the white rot fungus, Pleurotus ostreatus (P. ostreatus), to degrade lignin and to enhance the rumen
Effect of Pleurotus ostreatus fermentation on cocoa pod husk ...
African Journals Online (AJOL)
Cocoa pod husk (CPH) is a major agro-industrial residue in Ghana with a potential value as a low-cost unconventional feedstuff for livestock. However, its effective use is limited by poor nutrient composition, mainly due to its high lignocellulose or fibre and also low protein levels. White–rot fungi such as Pleurotus species ...
Preliminary investigation into the use of Pleurotus tuber-regium ...
African Journals Online (AJOL)
The swelling capacity was three times that of maize starch BP Tablets prepared with P. tuber-regium powder disintegrated faster than those prepared with maize starch BP at concentrations below 10% w/w. At the disintegrant concentration of 10% w/w paracetamol tablets made from both Pleurotus powder and maize starch ...
(Pleurotus pulmonarius) grown on cotton waste and cassava peel
African Journals Online (AJOL)
This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...
Directory of Open Access Journals (Sweden)
MARÍA DEL PILAR RÍOS
2010-12-01
3 inteiramente casualizado. Na terceira seção avaliada, se avaliou a colonização e frutificação do fungo em bagaço de cana utilizando parâmetros biológicos, tais como desempenho, eficiência e taxa de produção de sementes, com o inteiramente casualizado 3x3. 0 meio alternativo em pH 5,0 foi o mais adequado para o crescimento de Pleurotus ostreatus, demonstrando sua adaptabilidade a meios com alto conteúdo de carboidrato, cujos níveis de renda foram adequados para a produção competitiva e fruticultura diminuindo o tempo de incubação e colheita.Alternative media were evaluated for the propagation of Pleurotus ostreatus and its behavior was compared with that of a commercial media. The response to these media was measured through the adaptation of the fungus in barley for obtaining the commercial seed and this one in its turn in the response to a substratum based on cane bagasse for obtaining oyster mushrooms. In the first phase the fungus was obtained and planted in a solid media of potato extract at two concentrations and three pH values using a factorial design 2x3 (pH vs. concentration of potato extract. In the second phase was measured the growth of Pleurotus ostreatus inoculated in sterilized hydrated barley through a completely random design 3x3. In the third phase was evaluated the colonization and fructification of the fungus in cane bagasse using parameters as biológical efficiency performance and seed production rate, with a completely random design 3x3. The alternative media with pH 5,0 was the most adequate for the growth of Pleurotus ostreatus, displaying its adaptability to media with high carbohydrates content which performances were appropiate to obtain competitive production levels in growth and fructification, diminishing thus the incubation and harvesting time.
Directory of Open Access Journals (Sweden)
Ceci Sales-Campos
2009-12-01
Full Text Available Os cogumelos do gênero Pleurotus são cultivados em diversos substratos lignocelulósicos, dada a atividade decompositora desses organismos proveniente de seu metabolismo enzimático. O presente estudo teve como objetivo analisar a composição mineral de Pleurotus ostreatus e dos substratos de cultivo preparados à base de resíduos madeireiros e agroindustriais da região amazônica. Foram analisados macro (P, K, Ca e Mg e micronutrientes (Fe, Zn, Cu, Mn e Na dos cogumelos e dos substratos. Os substratos foram formulados a partir da serragem de Simarouba amara Aubl. (marupá, Ochroma piramidale Cav. ex. Lam. (pau de balsa e de bagaços de Bactris gasipaes Kunth (pupunheira e de Saccharum officinarum (cana-de-açúcar. As amostras foram solubilizadas mediante digestão ácida (nítrico-peridrol. Os elementos Ca, Mg, Fe, Cu, Zn e Mn foram determinados por espectrometria de absorção atômica; o Na e K, por emissão atômica e o P, por colorimetria. A composição mineral do cogumelo variou com o substrato de cultivo. Os diferentes substratos possibilitaram a produção de um cogumelo rico em K, P, Mg e Fe, essenciais à nutrição e à saúde humana. O potássio foi o mineral de maior teor no cogumelo em todos os substratos testados (36,83-42,18 g.kg-1, seguido de fósforo (6,95-10,60 g.kg-1 e do magnésio (1,57-2,50 g.kg-1.Mushrooms belonging to the Pleurotus gender are grown in several lignocellulosic substrates due to the decomposing activity of these organisms that result from their enzymatic metabolism. The objective of the present study was to analyze the mineral composition of Pleurotus ostreatus and the cultivation substrates prepared with wood and agroindustrial residues from the Amazon region. Macro (P, K, Ca and Mg and micronutrients (Fe, Zn, Cu, Mn and Na of mushroom and substrates were analyzed. Substrates were formulated from Simarouba amara Aubl. and Ochroma piramidale Cav. ex. Lam. sawdust and crushed Bactris gasipaes Kunth
Yuan, Biao; Zhao, Liyan; Yang, Wenjian; McClements, David Julian; Hu, Qiuhui
2017-09-01
Edible mushrooms contain a variety of bioactive molecules that may enhance human health and wellbeing. Consequently, there is increasing interest in fortifying functional foods with these nutraceutical-rich substances. However, incorporation of mushroom-based ingredients into foods should not adversely affect the quality attributes of the final product. In this study, the impact of incorporating powdered Auricularia auricula, a widely consumed edible mushroom, into bread products was examined. The rheological and structural properties of wheat dough and bread supplemented with 0% to 10% (w/w) A. auricula flour were measured. Supplementation of wheat doughs with A. auricula flour increased the peak viscosity and enhanced their water holding capacity. Rapid viscosity analysis showed that peak and final viscosities of the blended flour (wheat flour with A. auricula flour) were higher than wheat flour alone. However, dough stability and elastic modulus were reduced by blending wheat flour with A. auricula flour. SEM observation showed that doughs with up to 5% (w/w) A. auricula flour had acceptable gluten network microstructure. Characterization of the quality attributes of bread indicated that incorporation of A. auricula flour at levels >5% negatively impacted bread volume, height, texture, and appearance. © 2017 Institute of Food Technologists®.
Lead and cadmium in mushrooms from the vicinity of two large emission sources in Slovenia
International Nuclear Information System (INIS)
Petkovšek, Samar Al Sayegh; Pokorny, Boštjan
2013-01-01
Cd and Pb contents were determined in 699 samples of fruiting bodies of 55 mushrooms species, collected in the period 2000–2007 in the vicinity of the largest Slovenian thermal power plant (the Šalek Valley) and near an abandoned lead smelter (the Upper Meža Valley). The present study is the first regarding lead and cadmium in mushrooms from those exposed areas. Therefore, there was a significant lack of prior data. Among 55 studied mushroom species 36 species are edible and important from an ecotoxicological perspective. However, the remaining non-edible species are important for bioindication and allowed us to compare our results with other studies carried out in other polluted areas in Europe. The highest contents of Cd were found in Agaricus arvensis Schff.: Fr. (117 mg/kg dw) and Agaricus silvicola L.: Fr. (67.9 mg/kg dw), while the highest contents of Pb were found in Macrolepiota procera (Scop.) Singer (53.8 mg/kg dw) and Lycoperdon perlatum Pers. (50 mg/kg dw), respectively. Considering the high contents of both metals in fruiting bodies of edible fungi, together with FAO/WHO directives on tolerable levels of weekly intake of Pb/Cd by humans, it is evident that consumption of some mushroom species originating from both study areas may pose a significant human health risk. A. arvensis Schff.: Fr., A. silvicola L.: Fr. and Cortinarius caperatus (Pers.) Fr. originating from the Šalek Valley, and Armillaria mellea Vahl. P. Kumm., Boletus edulis Bull., L. perlatum Pers., Leccinum versipelle (Fr. and Hök) Snell, and M. procera (Scop.) Singer originating from the Upper Meža Valley should not be consumed at all. Our findings are consistent with some other studies, which emphasized that mushrooms from heavily polluted areas, such as in the vicinity of smelters, accumulate extremely high amounts of metals, and should therefore be omitted from human consumption. - Highlights: ► The Pb contents were higher in saprophytic fungi in comparison with mycorrhizal
Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul
2014-03-01
The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.
Zarenejad, F; Yakhchali, B; Rasooli, I
2012-01-01
Mushrooms such as Agaricus bisporus, are cultivated for food worldwide. Fruit body initiation in Agaricus bisporus is a phase change from the vegetative to the reproductive stage which depends on the presence of a casing layer with particular physical, chemical and microbiological properties. The phase change is achieved practically by environmental manipulation and the presence of naturally occurring bacteria such as Pseuodomonas putida. In this study, 274 individual bacterial isolates were collected by screening the casing layer of 14 edible mushroom farms. The isolates were analysed with respect to biochemical properties, organic and inorganic phosphate solubilization, production of siderophore and growth in the presence of volatile compound of 1-octen-3-ol. It was found that approximately 97% of the strains were able to grow in the presence of 1-octen-3-ol and 36% were able to solubilize phosphorus. Among the isolates, 23 strains were selected as potent mushroom growth promoting bacteria (MGPB) for inoculation of the casing layer. Field experiments using these strains showed various promoting effects on production of mushroom. Finally, 2 strains (strains Bt4 and Ps7) showing the highest increase in A. bisporus production, were characterized as Pseuodomonas putida by molecular methods and identified as the best suited growth promoting inoculants for application in production farms for increasing the mushroom yield.
Jaworska, Grażyna; Pogoń, Krystyna; Skrzypczak, Aleksandra; Bernaś, Emilia
2015-12-01
Wild edible mushrooms Boletus edulis and Xerocomus badius were prepared for consumption by braising with 10 % canola oil (half of the batch was blanched prior to braising). Fresh X.badius had comparable to B.edulis amounts of proximate components and higher levels of most B-group vitamins and antioxidants. Analyzed mushrooms prepared for consumption fulfilled 7-14 % RDA of vitamin B1 for healthy adults and 15-35, 18-37 and 1 % RDA of B2, B3 and B3 respectively. Prepared for consumption mushrooms were rich in antioxidants containing in 100 g dry weight 164,601 mg total polyphenols, 19-87 mg total flavonoids, 22.1-27.4 mg L-ascorbic acid, 0.531-1.031 mg β-carotene, 0.325-0.456 mg lycopene and 38.64-44.49 mg total tocopherols and presented high antioxidant activity against ABTS (4.9-36.5 mmol TE), against DPPH (7.8-21.3 mmol TE) and in FRAP assay (15.0-28.1 mmol Fe(2+)). Mushrooms prepared for consumption with blanching prior to culinary treatment showed lower antioxidant properties and vitamin content in comparison to mushrooms braised raw.
Anticancer potential evoked by Pleurotus florida and Calocybe ...
African Journals Online (AJOL)
Jane
2011-07-20
Jul 20, 2011 ... Actually, world trade in mushrooms is as big as the trade in coffee. Mushroom polysaccharides support some or all of the major systems of the body, including nervous, hormonal and immune systems as well as regulatory functions. ..... mechanistic description of dead and dying eukaryotic cells. Infection.
Performance of different strains of Pleurotus species under ...
African Journals Online (AJOL)
P. citrinopileatus strain PCB did not produce any fruiting bodies during the period of study. Significant differences (P<0.05) in yield of the different species of mushrooms were recorded. Keywords: Mushrooms, flushes, biological efficiency. J Food Tech in Africa (2002) 7, 98-100. http://dx.doi.org/10.4314/jfta.v7i3.19240.
Contamination of mushrooms with radionuclides
International Nuclear Information System (INIS)
Benova, K.
2013-01-01
There is 27 years after the Chernobyl nuclear accident and the half-life of 137 Cs is 30 years. The radioactive cloud hit both former Czechoslovakia, but also very distant cities throughout Europe. In this work, author focused on recovery of radiocesium content in mushrooms from various sites in Slovakia, Poland and England. Author evaluated 28 samples of dried mushrooms. 137 Cs was measured by gamma spectrometry (Canberra). Elevated levels have been reported occasionally in mushroom not only in Slovakia but also in distant England. The values obtained are lower than recommended standard (author)
Chang, Bea-Ven; Chang, Yi-Ming
2016-04-01
The toxic chemicals bisphenol A (BPA), bisphenol F (BPF), nonylphenol (NP), and tetrabromobisphenol A (TBBPA) are endocrine-disrupting chemicals that have consequently drawn much concern regarding their effect on the environment. The objectives of this study were to investigate the degradation of BPA, BPF, NP, and TBBPA by enzymes from Pleurotus eryngii in submerged fermentation (SmF) and solid-state fermentation (SSF), and also to assess the removal of toxic chemicals in spent mushroom compost (SMC). BPA and BPF were analyzed by high-performance liquid chromatography; NP and TBBPA were analyzed by gas chromatography. NP degradation was enhanced by adding CuSO4 (1 mM), MnSO4 (0.5 mM), gallic acid (1 mM), tartaric acid (20 mM), citric acid (20 mM), guaiacol (1 mM), or 2,2'-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid; 1 mM), with the last yielding a higher NP degradation rate than the other additives from SmF. The optimal conditions for enzyme activity from SSF were a sawdust/wheat bran ratio of 1:4 and a moisture content of 5 mL/g. The enzyme activities were higher with sawdust/wheat bran than with sawdust/rice bran. The optimal conditions for the extraction of enzyme from SMC required using sodium acetate buffer (pH 5.0, solid/solution ratio 1:5), and extraction over 3 hours. The removal rates of toxic chemicals by P. eryngii, in descending order of magnitude, were SSF > SmF > SMC. The removal rates were BPF > BPA > NP > TBBPA. Copyright © 2014. Published by Elsevier B.V.
Preliminary studies on productivity of white Pleurotus eryngii isolates in protected cultivation
Directory of Open Access Journals (Sweden)
Gian Luigi Rana
2013-03-01
Full Text Available Four isolates of Pleurotus eryngii species-complex, originating from different basidiomata growing in a mountainous area of the Basilicata region (southern Italy and characterized by white pileus cuticle (Wh A, Wh B, Wh C, and Wh D were compared, in artificial cultivation conditions, to other isolates of the same mushroom with beige (Be 3, Be 5 or brown cap (Br 1, Br 2 originating from the same area of the former or selected among the commercial ones (Com 142 and Com 164 in order to evaluate their productivity and morphological features. The experiments were carried out in a greenhouse belonging to the Faculty of Agriculture, University of Bari Aldo Moro, in autumn winter 2010-2011, using substrate bags well colonized by P. eryngii mycelium and kept at 4-6°C for 5 months. Wh A and Wh D and, less significantly, Wh C, Be 5 and Com 142, produced a fresh basidioma yield significantly higher than the five other tested isolates (Wh B, Be 3, Br 1, Br 2 and Com 164. Only Com 142 produced the basidiomata of medium and maximum size significantly heavier and with larger pileus diameter than other tested isolates. Com 142 also resulted significantly different, for the basidiomata number/substrate bag, from the white pileus cuticle isolates except for Wh B. All tested isolates concentrated almost all (90-95% of the sporophore yield in the first basidioma flush. No significant differences were found among all tested P. eryngii isolates in terms of yield earliness.
Antimelanogenesis and Anti-Inflammatory Activity of Selected Culinary-Medicinal Mushrooms.
Saad, Hazwani Mat; Sim, Kae Shin; Tan, Yee Shin
2018-01-01
Five culinary-medicinal mushrooms are commonly available in the Malaysian market: Agaricus bisporus (white and brown), Ganoderma lucidum, Hypsizygus marmoreus, Pleurotus floridanus, and P. pulmonarius. These species were selected for use in the current study, the aim of which was to investigate the antimelanogenesis and anti-inflammatory activity of these mushrooms in an attempt to evaluate their potential use in cosmeceuticals. Mushroom fruiting bodies were extracted with hot water, and the extracts were freeze-dried before testing. The antimelanogenesis activity of the extracts was determined by cell viability assay, measurement of intracellular melanin content, and cellular tyrosinase assay with B16F10 melanoma cells. The anti-inflammatory activity of the mushroom extracts was tested by measuring the levels of nitric oxide (NO), tumor necrosis factor (TNF)-α, and interleukin-10 excreted by RAW264.7 macrophages. Brown A. bisporus reduced intracellular melanin content to the largest extent-up to 57.05 ± 3.90%-without a cytotoxic effect on B16F10 melanoma cells. This extract also reduced cellular tyrosinase activity to 17.93 ± 2.65%, performing better than kojic acid, the positive control. In parallel, the extract from brown A. bisporus, at the highest concentration tested, has appreciable anti-inflammatory activity through reductions of NO and TNF-α levels. The other 5 extracts showed moderate antimelanogenesis and anti-inflammatory activities. In summary, our findings show that A. bisporus (brown) extract has the potential to be used as an ingredient in whitening skincare products and to sooth the inflammatory response on the skin.
Colavolpe, María Belén; Mejía, Santiago Jaramillo; Albertó, Edgardo
2014-01-01
Trichoderma spp is the cause of the green mold disease in mushroom cultivation production. Many disinfection treatments are commonly applied to lignocellulose substrates to prevent contamination. Mushroom growers are usually worried about the contaminations that may occur after these treatments during handling or spawning. The aim of this paper is to estimate the growth of the green mold Trichoderma sp on lignocellulose substrates after different disinfection treatments to know which of them is more effective to avoid contamination during spawning phase. Three different treatments were assayed: sterilization (121 °C), immersion in hot water (60 and 80 °C), and immersion in alkalinized water. Wheat straw, wheat seeds and Eucalyptus or Populus sawdust were used separately as substrates. After the disinfection treatments, bagged substrates were sprayed with 3 mL of suspension of conidia of Trichoderma sp (10(5) conidia/mL) and then separately spawned with Pleurotus ostreatus or Gymnopilus pampeanus. The growth of Trichoderma sp was evaluated based on a qualitative scale. Trichoderma sp could not grow on non-sterilized substrates. Immersions in hot water treatments and immersion in alkalinized water were also unfavorable treatments for its growth. Co- cultivation with mushrooms favored Trichoderma sp growth. Mushroom cultivation disinfection treatments of lignocellulose substrates influence on the growth of Trichoderma sp when contaminations occur during spawning phase. The immersion in hot water at 60 °C for 30 min or in alkalinized water for 36 h, are treatments which better reduced the contaminations with Trichoderma sp during spawning phase for the cultivation of lignicolous species.
Savoie, Jean-Michel; Vedier, R.; Blanc, Frederic; Minvielle, Nathalie; Rousseaut, T.; Delgenès, Jean-Philippe
2011-01-01
Mushroom cultivation is a direct utilization of their ecological role of organic matter degradation in the bioconversion of solid wastes generated from industry and agriculture into edible biomass, which could also be regarded as a functional food or as a source of drugs and pharmaceuticals. Significant changes are expected in the integrated management of wastes streams in the future due to the use of plant biomass for biofuel and energy production and other non-food crops. On the one ...
Rupcic, Zeljka; Rascher, Monique; Kanaki, Sae; Köster, Reinhard W.; Stadler, Marc; Wittstein, Kathrin
2018-01-01
Basidiomycetes of the genus Hericium are among the most praised medicinal and edible mushrooms, which are known to produce secondary metabolites with the potential to treat neurodegenerative diseases. This activity has been attributed to the discovery of various terpenoids that can stimulate the production of nerve growth factor (NGF) or (as established more recently) brain-derived neurotrophic factor (BDNF) in cell-based bioassays. The present study reports on the metabolite profiles of a Li...
Suseem, S R; Saral, Mary
2015-07-01
To evaluate the ethyl acetate, methanol and aqueous extracts of dried fruiting bodies of Pleurotus eous for its anti-platelet activity on human volunteer's blood. And also to analyze the free radical scavenging property of the extracts of P.eous by using various in vitro models. Anti-platelet activity of dried fruiting bodies of P.eous was evaluated by in vitro model using blood platelets. Inhibition of platelet aggregation was monitored after pre-incubation of platelets with the crude extracts of mushroom P.eous. Antioxidant activities of extracts of P.eous were evaluated by different in vitro experiments, namely, 1, 1-diphenyl-2-picryl hydrazyl (DPPH), superoxide, hydroxyl radical and lipid peroxide radical models. Crude extracts of mushroom P.eous inhibited platelet aggregation dose-dependently which was induced by adenosine diphosphate (ADP). At a maximum concentration of 10 mg/mL, methanol extract effected 64.02% inhibition of lipid per-oxidation and 50.12% scavenging effect on superoxide anion radical. Aqueous extract of P.eous have shown 69.43% chelating ability on ferrous ions, 24.27% scavenging effect on hydroxyl radical and 49.57% scavenging effect on DPPH radical at 10 mg/mL. Increasing concentrations of the extract were found to cause progressively decreasing of the intensity of absorbance. Anti-platelet effects could be related in part to the polyphenolic compounds present in the extracts. Antioxidant activity results indicated the free radical scavenging property of the extracts of P.eous which might be due to the high content of phenolic compounds and flavonoids.
Directory of Open Access Journals (Sweden)
Kátia Maria Gomes Machado
2006-12-01
Full Text Available Pleurotus ostreatus ("shimeji" is produced in Brazil on a commercial scale using various lignocellulosic residues. Efforts have been made to reuse the culture residue to obtain products of greater aggregate value such as enzymes or in processes of bioremediation. We evaluated the Remazol brilliant blue R (RBBR degradation potential of extracts from solid substrate colonized by P. ostreatus and extracts from residue of the "shimeji" mushroom yield. Colonized substrates and residue were provided by Toyobo do Brasil Ltda. Extraction was performed with sodium acetate buffer (50 mM, pH 4.6. RBBR decolorization was monitored at 592 nm and peroxidase and laccase activities were measured by monitoring the oxidation of ABTS. Horseradish peroxidase was used as reference. The time of growth of P. ostreatus influenced RBBR degradation and peroxidase and laccase activities. Concentration of 1 mM H2O2 and pH 4.0 were the best for RBBR decolorization. Complete RBBR decolorization was obtained with the addition of only one aliquot of 50 µL of 1 mM H2O2. The stability of the extracts was higher when they were kept under refrigeration than when stored frozen. The potential application of the ligninolytic complex derived from P. ostreatus and mushroom residue for xenobiotic degradation was demonstrated.Pleurotus ostreatus ("shimeji" é produzido no Brasil em escala comercial empregando-se vários resíduos lignocelulósicos. Esforços têm sido feitos para reaproveitamento do resíduo do cultivo em produtos de maior valor agregado, como enzimas ou sua aplicação em processos de biorremediação. Foi feita avaliação do potencial de degradação do azul brilhante de remazol (RBBR por extratos obtidos de substratos sólidos colonizados por P. ostreatus e por extratos do resíduo da produção do cogumelo "shimeji". Substratos colonizados e o resíduo foram fornecidos pela Toyobo do Brasil Ltda. Extração foi feita com tampão acetato de sódio (50 mM, pH 4
Directory of Open Access Journals (Sweden)
Jon-Magnus Tangen
2017-01-01
Full Text Available Agaricus blazei Murill is an edible mushroom of the Basidiomycetes family, which has been found to contain a number of compounds with antitumor properties, such as proteoglycans and ergosterol. In the present investigation, we show that the commercial mushroom product Andosan, which contains 82.4% Agaricus blazei Murill, together with medicinal mushrooms Hericium erinaceus (14.7% and Grifola frondosa (2.9%, has a cytotoxic effect on primary myeloma cells, other myeloma cell lines, and leukemia cell lines in vitro. Although the exact content and hence the mechanisms of action of the Andosan extract are unknown, we have found in this investigation indications of cell cycle arrest when myeloma cell lines are cultivated with Andosan. This may be one of the possible explanations for the cytotoxic effects of Andosan.
International Nuclear Information System (INIS)
Sarwar, S.; Khalid, N.; Dentinger, B.M.
2016-01-01
Fleshy pored mushrooms is the name given to boletes due to their porous hymenium and fleshy nature. These are ectomycorrhizal basidiomycetes found in all continents except Antarctica. These mushrooms are important economically due to their edibility and medicinal value. This research work highlights the diversity of boletes in Pakistan and their correct identification by using molecular phylogenetic techniques. Western Himalayan range (WHR) of Pakistan is considered as diversity rich area. During present investigation regarding diversity of boletes in these areas, two bolete taxa viz. Hortiboletus rubellus and Neoboletus luridiformis were found under conifers. These mushrooms were collected and analyzed morphologically as well as phylogenetically by using Internal Transcribed Spacer (ITS) region of nrDNA sequences, and compared with their allies. All description and comparison with related taxa is provided in detail. These boletes are first time analyzed using molecular method from Pakistan. (author)
Omarini, Alejandra B; Plagemann, Ina; Schimanski, Silke; Krings, Ulrich; Berger, Ralf G
2014-11-01
Several hundred monokaryotic and new dikaryotic strains derived thereof were established from (+)-valencene tolerant Pleurotus species. When grouped according to their growth rate on agar plates and compared to the parental of Pleurotus sapidus 69, the slowly growing monokaryons converted (+)-valencene more efficiently to the grapefruit flavour compound (+)-nootkatone. The fast growing monokaryons and the slow×slow and the fast×fast dikaryotic crosses showed similar or inferior yields. Some slow×fast dikaryons, however, exceeded the biotransformation capability of the parental dikaryon significantly. The activity of the responsible enzyme, lipoxygenase, showed a weak correlation with the yields of (+)-nootkatone indicating that the determination of enzyme activity using the primary substrate linoleic acid may be misleading in predicting the biotransformation efficiency. This exploratory study indicated that a classical genetics approach resulted in altered and partly improved terpene transformation capability (plus 60%) and lipoxygenase activity of the strains. Copyright © 2014 Elsevier Ltd. All rights reserved.
Ming, Jian; Chen, Long; Hong, Hui; Li, Jinlong
2015-09-01
Lentinus edodes is an edible mushroom commonly known as shiitake, which is the second most produced and consumed edible mushroom in the world and is an important nutrient source in the human diet. To fully use L. edodes, the mushrooms are occasionally ground into powder as a flavourful and functional food additive. This study produces powders from the cap and stipe of Lentinus edodes mushrooms through superfine grinding. These powders are composed of sub-micron range particles with various size distributions. The superfine grinding process is then compared with shear pulverisation to determine the different effects on both the cap and stipe powders in terms of particle size and physico-chemical, morphological and thermogravimetric properties. When average particle size was reduced to 0.54 and 0.46 µm, respectively, the moisture and protein content, angles of repose and slide, and water holding capacity of the powders decreased to varied extents. However, soluble dietary fibre, water solubility index, and swelling capacity increased. Scanning electron microscope images suggested that the superfine grinding process effectively changed the original surface structure of the L. edodes powders. The curves of thermogravimetric analysis and those of the derivatives of thermogravimetry indicated that superfine grinding can improve the thermostability of L. edodes powders. Furthermore, superfinely ground L. edodes powders may be used as pharmaceutical or food additives in various fields. The present study suggests that superfinely ground L. edodes powders may be applied in various fields as pharmaceutical or food additives. © 2014 Society of Chemical Industry.
Radioprotective effect of edible herbs
International Nuclear Information System (INIS)
Jiang Ying; Huang Meiying; Zhu Genbo; Fang Jixi; Fan Xiudi
1992-08-01
The radioprotective effect of the edible herbs was studied in animals. The results showed: (1) The acute death rate of animals was decreased. (2) The peripheral leukocytes were increased. (3) The valine, hydroxyproline, glycine, aspartic acid and glutamic acid in the plasma also were increased. (4) The activity of SOD (superoxide dimutase) was risen. (5) the edible herbs have the function to protect the structure of organs of thymus and testes
Edible insects of Northern Angola
Lautenschläger,Thea; Neinhuis,Christoph; Monizi,Mawunu; Mandombe,José Lau; Förster,Anke; Henle,Thomas; Nuss,Matthias
2017-01-01
From 2013–2017, we accompanied and interviewed local people harvesting edible insects in the Northern Angolan province of Uíge. Insect and host plant samples were collected for species identification and nutritive analyses. Additionally, live caterpillars were taken to feed and keep until pupation and eclosion of the imago, necessary for morphological species identification. Altogether, 18 insect species eaten by humans were recorded. Twenty four edible insect species were formerly known from...
Directory of Open Access Journals (Sweden)
Cilene Ferreira de Queiroz Neves
2008-10-01
control and to the inappropriate growing system. In 2004, there were 45,000 Shiitake-inoculated logs in this region, and the yield stood around 200 g of fresh mushroom/log. The mushrooms arepacked in boxes of 200 g, and are sold mainly to Ceasa in open markets.
Directory of Open Access Journals (Sweden)
Tariqul Islam
2017-03-01
Full Text Available Pleurotus pulmonarius was cultivated in three different environmental conditions, in ambient indoor environment (System 1, in humidifying without ventilation (System 2 and in humidifying with ventilation (System 3 to analyse the major nutritional contents. Sawdust was the main substrate for all the cultivation systems. The lowest temperature and the highest optimal humidity were found in System 3. The temperature and humidity had shown statistically significant among the three cultivation Systems. The highest numbers of flushes was found both in System 2 and System 3 but System 1 was produced mushrooms till 3rd flush. About 29.5%, 28.3%, 28.5% protein; 59.0%, 55.8%, 54.3% carbohydrate and 3.8%, 3.5%, 3.3% lipid were found in System 1, System 2 and System 3 respectively. The protein, carbohydrate, and lipid contents were shown statistically insignificant among the cultivation systems. The highest value of protein, carbohydrate and lipid were found for the sample of 1st flush in all the cultivation systems but the values were started to decrease with the increased numbers of flushes significantly. So, this study shown that, although the environmental conditions of the three cultivation systems were varied significantly but the protein, carbohydrate and lipid contents were existed their normal values in all cases but the values were decreased by the increased numbers of flushes.
Effectiveness of Training Programme on Mushroom Cultivation
Rahman, Md. Sazzadur; Hossain, Kh. Zulfikar; Ali, Md. Sekender; Afroz, Fauzia
2017-01-01
Effectiveness is one of the key parameters to assess success of any programs. However, the effectiveness of training programme on mushroom cultivation was not well addressed. The purposes of this study were to investigate the effectiveness of training programme on mushroom cultivation and to explore the relationships of each of the selected characteristics of the trained mushroom farmers with their effectiveness of training programme. Data were collected from the trained mushroom farmers of s...
Wild and domesticated mushroom consumption in Nigeria ...
African Journals Online (AJOL)
African Crop Science Journal ... On the other hand, if nutrition analysis reveals different nutrition parameters for both types of mushrooms, 43.3% opted for cultivated mushroom, 42.2%, wild; 12.2% both; while 2.2% would eat ... Keywords: Consumption pattern, Lentinus squarrosulus, nutrition, perception, wild mushroom ...
Beaulieu, M.; D'Aprano, G.; Lacroix, M.
2002-03-01
In order to enhance the shelf-life of edible mature mushrooms Agaricus bisporus, 2 kGy ionising treatments were applied at two different dose rates: 4.5 kGy/h ( I-) and 32 kGy/h ( I+). Both I+ and I- showed 2 and 4 days shelf-life enhancement compared to the control ( C). Before day 9, no significant difference ( p>0.05) in L* value was detected in irradiated mushrooms. However, after day 9, the highest observed L* value (whiteness) was obtained for the mushrooms irradiated in I-. Analyses of phenolic compounds revealed that mushrooms in I- contained more phenols than I+ and C, the latter containing the lower level of phenols. The polyphenol oxidase (PPO) activities of irradiated mushrooms, analysed via catechol oxidase and dopa oxidase substrates, resulted in being significantly lowered ( p⩽0.05) compared to C, with a further decrease in I+. Analyses of the enzymes indicated that PPO activity was lower in I+, contrasting with its lower phenol concentration. Ionising treatments also increased significantly ( p⩽0.05) the phenylalanine ammonia-lyase (PAL) activity. The observation of mushrooms cellular membranes, by electronic microscopy, revealed a better preserved integrity in I- than in I+. It is thus assumed that the browning effect observed in I+ was caused by both the decompartimentation of vacuolar phenol and by the entry of molecular oxygen into the cell cytoplasm. The synergetic effect of the residual active PPO and the molecular oxygen, in contact with the phenols, allowed an increased oxidation rate and, therefore, a more pronounced browning in I+ than in I-.
The heavy metals content in wild growing mushrooms from burdened Spiš area
Directory of Open Access Journals (Sweden)
Marek Slávik
2016-05-01
Full Text Available In this work, we evaluated the rate of entry of heavy metals into the edible parts of wild mushrooms, from central Spiš area. The area is characterized by extremely high content of heavy metals particularly mercury in abiotic and biotic components of ecosystems. The toxicity of heavy metals is well known and described. Known is also the ability of fungi to accumulate contaminants from substrates in which mushrooms grow. We have collected commonly consumed species of mushrooms (Russula vesca., Macrolepiota procera, Lycoperdon pyriforme, Lecinum piceinum, Boletus reticulatus. Sampling was conducted for two years 2012 and 2013. The samples taken mushrooms and substrates on which to grow, we determined heavy metal content (Cd, Pb, Cu, including total mercury content modified by atomic absorption spectrometry (AMA - 254. In the substrate, we determined the humus content and pH value. The heavy metal content in soils were evaluated according to Law no. 220/2004 Z.z The exceedance limit values of Cd, Pb, Cu and Hg was recorded. Most significantly the respective limit was recorded in soil samples in the case of mercury. The determined concentration Hg was 39.01 mg.kg-1. From the results, we evaluated the degree of ability to bioaccumulate heavy metals different kinds of fungi. We also evaluated the health safety of the consumption of these fungi on the comparison with the limit values provided in the food code of SR. We recorded a high rate of accumulation of mercury in the species Boletus reticulatus and Macrolepiota procera. For these types we recorded the most significant than allowed concentrations of mercury in mushrooms. The highest recorded concentration reached 17.64 mg.kg-1 Hg in fresh matter. The limit value was exceeded also in the case of copper. We do not recommend to increased consumption of wild mushrooms in the reference area.
International Nuclear Information System (INIS)
Beaulieu, M.; D'Aprano, G.; Lacroix, M.
2002-01-01
In order to enhance the shelf-life of edible mature mushrooms Agaricus bisporus, 2 kGy ionising treatments were applied at two different dose rates: 4.5 kGy/h (I - ) and 32 kGy/h (I + ). Both I + and I - showed 2 and 4 days shelf-life enhancement compared to the control (C). Before day 9, no significant difference (p>0.05) in L * value was detected in irradiated mushrooms. However, after day 9, the highest observed L * value (whiteness) was obtained for the mushrooms irradiated in I - . Analyses of phenolic compounds revealed that mushrooms in I - contained more phenols than I + and C, the latter containing the lower level of phenols. The polyphenol oxidase (PPO) activities of irradiated mushrooms, analysed via catechol oxidase and dopa oxidase substrates, resulted in being significantly lowered (p≤0.05) compared to C, with a further decrease in I + . Analyses of the enzymes indicated that PPO activity was lower in I + , contrasting with its lower phenol concentration. Ionising treatments also increased significantly (p≤0.05) the phenylalanine ammonia-lyase (PAL) activity. The observation of mushrooms cellular membranes, by electronic microscopy, revealed a better preserved integrity in I - than in I + . It is thus assumed that the browning effect observed in I + was caused by both the decompartimentation of vacuolar phenol and by the entry of molecular oxygen into the cell cytoplasm. The synergetic effect of the residual active PPO and the molecular oxygen, in contact with the phenols, allowed an increased oxidation rate and, therefore, a more pronounced browning in I + than in I -
Nutritional value of huitlacoche, maize mushroom caused by Ustilago maydis
Directory of Open Access Journals (Sweden)
Mehmet AYDOĞDU
2017-09-01
Full Text Available Abstract Smutty maize cobs, caused by Ustilago maydis ((DC Corda., a fungus belonging to Basidiomycetes, can be seen wherever maize is grown. It is considered as a fungal disease limiting maize yield worldwide. However, in Mesoamerica, it is called as “huitlacoche” and evaluated as an edible mushroom. The present study was conducted to examine nutritional characteristics of this mushroom. In the study, smutty cobs naturally infected by U. maydis were randomly gleaned from plants in maize producing areas in the Mediterranean region of Turkey, in 2015. Huitlacoche was analyzed in terms of proximate composition, fatty acids, mineral elements, total phenolic and flavonoid matters and antioxidant activity. Average protein content was 12%, while fatty acids ranged from 0.44 to 42.49% (dry basis. Of the 11 fatty acids, oleic and linoleic acids had the highest percentages. Phosphorus (342.07 mg/kg and magnesium (262.69 mg/kg were found in high quantities. As for total phenolic and flavonoid matters were 113.11 mg GAE/kg and 28.51 mg CE/kg, respectively. The study suggests that huitlacoche has numerous good nutritional features for human diet, thus, it can be evaluated as a valuable food source in international cuisines.
Map of radioactive contamination in mushrooms of Poland in 1991
International Nuclear Information System (INIS)
Mietelski, J.W.; Jasinska, M.; Kubica, B.; Kozak, K.; Macharski, P.
1992-01-01
Results from part of the Polish Government programme for forests radioactive contamination studies are presented. 278 samples of edible mushroom (Xerocomus badius) were analysed for radiocesium 137 Cs and 134 Cs) and 40 K using low-background gamma spectrometer with a germanium detector. Samples were collected from all districts of Poland in October 1991 by forest inspectors. In consequence maps of 137 Cs, 134 Cs and for 40 K concentration in ''Xerocomus badius'' are presented. The method of measurements is also presented. Large differences in radiocesium contamination levels are observed for various parts of the country. The higher radiocesium contamination level is observed in Czestochowa-Opole region. Maximum value for 137 Cs is equal to 157 kBq/kg d.m. and that for 134 Cs is equal to 16.3 kBq/kg d.m. The 40 K content level is nearly constant and equal to c.a. 1.3 kBq/kg d.m. Minimum values for caesium contamination were observed in the Bieszczady Mountains. The effective dose equivalent estimation due to the consumption of mushrooms is performed. The limits of ingestion amounts are calculated. (author). 15 refs, 15 figs, 6 tabs
Radiotracer experiments on the uptake of radionuclides by mushrooms and vegetables
International Nuclear Information System (INIS)
Ban-Nai, Tadaaki; Muramatsu, Yasuyuki; Yoshida, Satoshi; Yanagisawa, Kei
1996-01-01
Radiotracer experiments were performed to study radionuclide uptake by mushrooms and plants. Four mushroom species, Hebeloma vinosophyllum, Flammulina velutipes, Agrocybe cylindracea and Coprinus phlyctidosporus were cultivated in a flask containing medium with the radiotracers 137 Cs, 85 Sr, 54 Mn, 60 Co and 65 Zn. Mushrooms tended to accumulate Cs, Mn and Zn. The concentration ratio of Cs between mushroom and medium ranged from 2.6 to 21. The highest was observed in H. vinospohyllum. The concentration ratio of Mn was about 10, while the ratio of Zn ranged from 15 to 30. No noticeable accumulations were found for Sr or Co. Transfer factors (TFs) of radionuclides from soil to leaf vegetables (cabbage, Chinese cabbage, komatsuna, spinach and lettuce) were also studied using Andosol (a representative Japanese soil). The TFs of 137 Cs, 85 Sr, 54 Mn, 60 Co and 65 Zn for edible parts of these vegetables were (mean value) 0.11, 0.24, 0.61, 0.05 and 0.52, respectively. The TFs of Mn, Co and Zn for spinach were higher than those for the other vegetables. The distributions of Cs in different organs of the leaf vegetables were rather uniform. The TFs of Sr and Mn were higher for older (outer) leaves than younger (inner) ones. In contrast to Sr and Mn, TFs of Zn for younger leaves were higher than those for older ones
GC-MS studies of the chemical composition of two inedible mushrooms of the genus Agaricus
Directory of Open Access Journals (Sweden)
Gjosheva Melania
2007-12-01
Full Text Available Abstract Background Mushrooms in the genus Agaricus have worldwide distribution and include the economically important species A. bisporus. Some Agaricus species are inedible, including A. placomyces and A. pseudopratensis, which are similar in appearance to certain edible species, yet are known to possess unpleasant odours and induce gastrointestinal problems if consumed. We have studied the chemical composition of these mushrooms using GC-MS. Results Our GC-MS studies on the volatile fractions and butanol extracts resulted in the identification of 44 and 34 compounds for A. placomyces and A. pseudopratensis, respectively, including fatty acids and their esters, amino acids, and sugar alcohols. The most abundant constituent in the volatiles and butanol were phenol and urea respectively. We also identified the presence of ergosterol and two Δ7-sterols. In addition, 5α,8α-Epidioxi-24(ξ-methylcholesta-6,22-diene-3β-ol was isolated for the first time from both mushrooms. Our study is therefore the first report on the chemical composition of these two species. Conclusion The results obtained contribute to the knowledge of the chemical composition of mushrooms belonging to the Agaricus genus, and provide some explanation for the reported mild toxicity of A. placomyces and A. pseudopratensis, a phenonomenon that can be explained by a high phenol content, similar to that found in other Xanthodermatei species.
Wong, Ka-Hing; Cheung, Peter C K
2005-11-30
Preparation of three novel dietary fibers (DFs) from mushroom sclerotia, namely, Pleurotus tuberregium, Polyporous rhinocerus, and Wolfiporia cocos, by a scale-up modified AOAC procedure using industrial enzymes was investigated. A remarkably high level of total dietary fiber (TDF) ranging from 81.7 to 96.3% sample dry matter (DM), in which a content of nonstarch polysaccharide (NSP) ranging from 86.6 to 94.3% sclerotial TDF DM, was obtained from the three sclerotia. All sclerotial DFs were rich in beta-glucan (the glucose residue ranged from 89.7 to 94.5% NSP DM) with a very low level of resistant glycogen (ranged from 3.77 to 3.94% sclerotial TDF DM). All three novel sclerotial DFs also exhibited similar, if not better, physicochemical and functional properties (pH, color, water binding capacity, oil holding capacity, and emulsifying properties) as those of barely DF control and commercial DF-rich ingredients. The potential use of the three mushroom sclerotial DFs as a new beta-glucan type DF-rich ingredient in the food industry was discussed.
Distribution of radionuclides in different parts of a mushroom: Influence of the degree of maturity
Energy Technology Data Exchange (ETDEWEB)
Baeza, Antonio [Department of Physics, Veterinary Faculty, University of Extremadura, Avda de la Universidad s/n, 10071 Caceres (Spain)]. E-mail: ymiralle@unex.es; Guillen, Fco. Javier [Department of Physics, Veterinary Faculty, University of Extremadura, Avda de la Universidad s/n, 10071 Caceres (Spain); Salas, Alejandro [Department of Physics, Veterinary Faculty, University of Extremadura, Avda de la Universidad s/n, 10071 Caceres (Spain); Manjon, Jose Luis [Department of Plant Biology, Faculty of Sciences, University of Alcala, 28871 Alcala de Henares, Madrid (Spain)
2006-04-15
Mushrooms are known to be bioaccumulators of radionuclides, but little is known about their distribution within the fruiting bodies or the influence of the degree of maturity on uptake. We carried out a series of cultures of the species Pleurotus eryngii under controlled laboratory conditions to analyze these variables. The maximal uptake of {sup 134}Cs and {sup 85}Sr was found to occur in mature fruiting bodies, and with the growth of the mushroom the distribution of radionuclides within the fruiting bodies became inhomogeneous. In particular, there was an exponential increase in the percentage of the total activity of {sup 134}Cs, {sup 85}Sr, and {sup 6}Co in the cap + gills as the fruiting bodies matured, accompanied by a complementary decrease in the stem. Radiocaesium, potassium, calcium, {sup 239+24}Pu, {sup 234,238}U, {sup 228,230,232}Th, and {sup 226}Ra were assayed in the cap, gills, and stem of fruiting bodies of Tricholoma equestre collected in a natural ecosystem and cultured P. eryngii. Potassium and radiocaesium were mainly located in the cap + gills, and {sup 226}Ra in the gills. There was a disequilibrium between {sup 230,232}Th and {sup 228}Th in the different parts of the fungi, probably due to uptake of {sup 228}Ra and subsequent decay to {sup 228}Th. Finally, the distribution pattern of{sup 239+24}Pu, {sup 234,238}U, and {sup 230,232}Th seemed to be species dependent.
Rubio, C; Napoleone, G; Luis-González, G; Gutiérrez, A J; González-Weller, D; Hardisson, A; Revert, C
2017-04-01
The concentration levels of 20 metals were analyzed by ICP-OES in edible seaweed (Chondrus, Eisenia, Gelidium, Himanthalia, Laminaria, Palmaria, Porphyra, Undaria), from two origins (Asia vs EU) according to their cultivation practices (conventional vs organic). Red seaweed showed higher concentrations of trace and toxic elements. Porphyra may be used as a potential bioindicator for metals. Significant differences were found between the Asian vs European mean contents. The mean Cd level from the conventional cultivation (0.28 mg/kg) was two points higher than the organic cultivation (0.13 mg/kg). A daily consumption of seaweed (4 g/day) contributes to the dietary intake of metals, mainly Mg and Cr. The average intakes of Al, Cd and Pb were 0.064, 0.001 and 0.0003 mg/day, respectively. Based on obtained results, this study suggests that exposure to the toxic metals analyzed (Al, Cd and Pb) through seaweed consumption does not raise serious health concerns, but other toxic metals should be monitored. Copyright © 2017. Published by Elsevier Ltd.
Phan, Chia-Wei; David, Pamela; Naidu, Murali; Wong, Kah-Hui; Sabaratnam, Vikineswary
2013-10-11
Mushrooms are not only regarded as gourmet cuisine but also as therapeutic agent to promote cognition health. However, little toxicological information is available regarding their safety. Therefore, the aim of this study was to screen selected ethno-pharmacologically important mushrooms for stimulatory effects on neurite outgrowth and to test for any cytotoxicity. The stimulatory effect of mushrooms on neurite outgrowth was assessed in differentiating mouse neuroblastoma (N2a) cells. Neurite length was measured using Image-Pro Insight processor system. Neuritogenesis activity was further validated by fluorescence immunocytochemical staining of neurofilaments. In vitro cytotoxicity was investigated by using mouse embryonic fibroblast (BALB/3T3) and N2a cells for any embryo- and neuro-toxic effects; respectively. Aqueous extracts of Ganoderma lucidum, Lignosus rhinocerotis, Pleurotus giganteus and Grifola frondosa; as well as an ethanol extract of Cordyceps militaris significantly (p effects following 24 h exposure of N2a and 3T3 cells to mushroom extracts. Our results indicate that G. lucidum, L. rhinocerotis, P. giganteus, G. frondosa and C. militaris may be developed as safe and healthy dietary supplements for brain and cognitive health.
International Nuclear Information System (INIS)
Roy, M.K.; Chatterjee, S.R.; Bahukhandi, D.; Sharma, R.; Philips, A.S.
2000-01-01
Gamma radiation of spawn of Agaricus bisporus and pleurotus sajor-caju at doses of 0.1 to 0.3 kGy and 0.1 to 0.25 kGy respectively, reduced the mycelial spawn run time and exerted a stimulatory effect on the growth of these two mushrooms. Irradiation also increased yield of these mushrooms. In all cases of the former, the highest yield of 2.57g was recorded from spawn irradiated at 0.3 kGy, while with the latter, best yield of 1119 g was recorded from spawn treated with 0.25 kGy. The control (non-irradiated) spawns of A. bisporus and P. sajor-caju gave yields of 2.03 g and 565 g respectively. Thus, a major boost in yields could be achieved using this technology. The shelf life of P. sajor-caju could be extended up to 9 days by 0.5 kGy of radiation, when the treated fruit bodies were held at 15 deg C as against the un-irradiated ones which had a shelf-life of 6 days. This dose neither adversely affected the browning of the fruit bodies at 45 deg C, nor lowered their protein (protein + free amino acids) and carbohydrate contents. Irradiation, however, at all the doses from 0.1 to 0.75 kGy enhanced the rehydration ratio and total free amino acid contents. The rehydration ratio of 0.62 was the maximum, reached with a dose of 0.25 kGy as against the control, which showed a value of 5.0. Dehydration along with gamma radiation treatment could play an important role for long term storage of mushrooms. Weight loss of un-dehydrated fruit bodies also decreased as a result of irradiation. (author)
Wild Edible Plants Used by the Polish Community in Misiones, Argentina.
Kujawska, Monika; Łuczaj, Łukasz
We studied the cultural significance of wild edible plants for Eastern European migrants who settled in rural subtropical areas of South America. In 50 interviews with Polish migrants and their descendants in northern Misiones, Argentina, we recorded the use of 41 botanical species and two mushroom taxa. Different cultural significance indices were applied and sociodemographic factors such as gender, age and origin were addressed. Out of the ten most salient species, nine were fruits ( Eugenia uniflora , Eugenia involucrata , Rollinia salicifolia , Campomanesia xanthocarpa , Syagrus romanzoffiana , Allophylus edulis , Plinia peruviana , Plinia rivularis , Eugenia pyriformis ) and only one was a green vegetable ( Hypochaeris chillensis ). None of our informants reported famine foods, recreational teas or condiments. Men mentioned more wild edible species than women due to their more extensive knowledge of the forest plants growing further from settlements.
Edible insects are the future?
van Huis, Arnold
2016-08-01
The global increase in demand for meat and the limited land area available prompt the search for alternative protein sources. Also the sustainability of meat production has been questioned. Edible insects as an alternative protein source for human food and animal feed are interesting in terms of low greenhouse gas emissions, high feed conversion efficiency, low land use, and their ability to transform low value organic side streams into high value protein products. More than 2000 insect species are eaten mainly in tropical regions. The role of edible insects in the livelihoods and nutrition of people in tropical countries is discussed, but this food source is threatened. In the Western world, there is an increasing interest in edible insects, and examples are given. Insects as feed, in particular as aquafeed, have a large potential. Edible insects have about the same protein content as conventional meat and more PUFA. They may also have some beneficial health effects. Edible insects need to be processed and turned into palatable dishes. Food safety may be affected by toxicity of insects, contamination with pathogens, spoilage during conservation and allergies. Consumer attitude is a major issue in the Western world and a number of strategies are proposed to encourage insect consumption. We discuss research pathways to make insects a viable sector in food and agriculture: an appropriate disciplinary focus, quantifying its importance, comparing its nutritional value to conventional protein sources, environmental benefits, safeguarding food safety, optimising farming, consumer acceptance and gastronomy.
VALOR NUTRICIONAL DE PLEUROTUS DJAMOR CULTIVADO EM PALHA DE BANANEIRA
Directory of Open Access Journals (Sweden)
Jamile Rosa RAMPINELLI
2010-11-01
Full Text Available
Cogumelos do gênero Pleurotus representam um alimento de custo baixo, com teor elevado de proteínas, aminoácidos essenciais, proporção elevada de ácidos graxos insaturados, diversas vitaminas e minerais, além de teores baixos de gorduras, ácidos nucléicos, açúcares e calorias. Assim, o objetivo deste trabalho foi avaliar o valor nutricional de basidiomas de Pleurotus djamor de 1o e 2o fluxo produtivo, cultivados em palha de bananeira, em termos de teores de carboidratos, proteínas, fi bras, gorduras, cinzas, vitaminas, fósforo e potássio. Os teores de carboidratos totais, proteína bruta, fi bra bruta e cinzas diminuíram do 1o para o 2o fl uxo produtivo de 32,7 para 27,4g/100g, de 20,5 para 19,8g/100g, de 22,4 para 12,7g/100g e de 7,4 para 6,3g/100g, respectivamente. Os valores de gordura bruta e umidade não variaram, permanecendo em torno de 1,1 e 90g/100g, respectivamente. Os teores de vitamina B1 foram superiores aos de vitamina B2, independentemente do fluxo produtivo, e foi encontrada maior quantidade de potássio do que de fósforo. Pleurotus djamor, de 1o fl uxo produtivo, pode ser considerado fonte de fósforo e potássio, além de apresentar baixo teor de açúcar e não conter gordura.
Encarnacion, Angel B; Fagutao, Fernand; Hirono, Ikuo; Ushio, Hideki; Ohshima, Toshiaki
2010-02-24
The antimelanosic and antioxidative properties of a hot water extract prepared from the fruiting body of the edible mushroom (Flammulina velutipes) were evaluated by dietary supplementation in Kuruma shrimp (Marsupenaeus japonicus) for possible aquaculture application. The extract contained ergothioneine (ERT) at a level of 2.05 mg/mL. A commercial standard of l-ergothioneine (l-ERT) and the mushroom extract showed inhibitory activity against mushroom polyphenoloxidase (PPO). Feeding of the extract had no adverse effects on the immune systems of the shrimp under the present experimental conditions. Supplementation of the extract in the diet significantly suppressed PPO activities in the hemolymphs of the shrimp. Expression of the prophenoloxidase (proPO) gene decreased in the hemocyte of the Kuruma shrimp fed with the mushroom extract. Consequently, development of melanosis was significantly suppressed in the supplement fed shrimp during ice storage. Lipid oxidation was also effectively controlled in the supplement fed group throughout the storage period. In vitro experiments showed that l-ERT effectively inhibited the activation of proPO in the hemocyte lysate supernatant (HLS). The transcript of the proPO gene in the hemocyte showed lower expression in the l-ERT-treated HLS. It was concluded that dietary supplementation of the mushroom extract in shrimp could be a promising approach to control post mortem development of melanosis and lipid oxidation in shrimp muscles.
International Nuclear Information System (INIS)
Bachman, S.; Gebicka, L.
1992-01-01
Mushrooms are a valuable food raw materials because of their nutritional and taste values. Post-harvest ripening, chemical composition (94% water) and possible microbial contamination decrease not only organoleptic and nutritional value, but also the shelf-life. As an objective method of evaluation of irradiated mushrooms we adopted activity determination of o-diphenyl oxidase (o-DPO) which is responsible for discoloration of the edible mushrooms and altered qualitative and quantitative content of amino acids. It was observed that doses up to 2 kGy did not cause any increase in the activity of o-DPO; irradiation also did not affect the taste. Mushrooms irradiated with doses up to 4 kGy were of good quality after 5 days of storage at 4 C, while the control samples (unirradiated) after the same time were considerably changed, probably due too post-harvest ripening. Immediately after exposure the activity of o-DPO increased in proportion to the dose used. During subsequent storage, however, no increase in o-DPO activity was observed. Irradiation used in the range from 0.2 to 0.4 kGy did not affect the nutritional value of the raw material. The results are an additional confirmation that radiation can be used for efficient preservation of mushrooms. (author). 14 refs, 6 tabs
Muthoosamy, Kasturi; Bai, Renu Geetha; Abubakar, Ibrahim Babangida; Sudheer, Surya Mudavasseril; Lim, Hong Ngee; Loh, Hwei-San; Huang, Nay Ming; Chia, Chin Hua; Manickam, Sivakumar
2015-01-01
Purpose A simple, one-pot strategy was used to synthesize reduced graphene oxide (RGO) nanosheets by utilizing an easily available over-the-counter medicinal and edible mushroom, Ganoderma lucidum. Methods The mushroom was boiled in hot water to liberate the polysaccharides, the extract of which was then used directly for the reduction of graphene oxide. The abundance of polysaccharides present in the mushroom serves as a good reducing agent. The proposed strategy evades the use of harmful and expensive chemicals and avoids the typical tedious reaction methods. Results More importantly, the mushroom extract can be easily separated from the product without generating any residual byproducts and can be reused at least three times with good conversion efficiency (75%). It was readily dispersible in water without the need of ultrasonication or any surfactants; whereas 5 minutes of ultrasonication with various solvents produced RGO which was stable for the tested period of 1 year. Based on electrochemical measurements, the followed method did not jeopardize RGO’s electrical conductivity. Moreover, the obtained RGO was highly biocompatible to not only colon (HT-29) and brain (U87MG) cancer cells, but was also viable towards normal cells (MRC-5). Conclusion Besides being eco-friendly, this mushroom based approach is easily scalable and demonstrates remarkable RGO stability and biocompatibility, even without any form of functionalization. PMID:25759577
Yao, Sen; Li, Tao; Liu, HongGao; Li, JieQing; Wang, YuanZhong
2018-04-01
Boletaceae mushrooms are wild-grown edible mushrooms that have high nutrition, delicious flavor and large economic value distributing in Yunnan Province, China. Traceability is important for the authentication and quality assessment of Boletaceae mushrooms. In this study, UV-visible and Fourier transform infrared (FTIR) spectroscopies were applied for traceability of 247 Boletaceae mushroom samples in combination with chemometrics. Compared with a single spectroscopy technique, data fusion strategy can obviously improve the classification performance in partial least square discriminant analysis (PLS-DA) and grid-search support vector machine (GS-SVM) models, for both species and geographical origin traceability. In addition, PLS-DA and GS-SVM models can provide 100.00% accuracy for species traceability and have reliable evaluation parameters. For geographical origin traceability, the accuracy of prediction in the PLS-DA model by data fusion was just 64.63%, but the GS-SVM model based on data fusion was 100.00%. The results demonstrated that the data fusion strategy of UV-visible and FTIR combined with GS-SVM could provide a higher synergic effect for traceability of Boletaceae mushrooms and have a good generalization ability for the comprehensive quality control and evaluation of similar foods. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Nowak, Renata; Nowacka-Jechalke, Natalia; Juda, Marek; Malm, Anna
2018-06-01
According to the vast body of evidence demonstrating that the intestinal microbiota is undoubtedly linked with overall health, including cancer risk, searching for functional foods and novel prebiotic influencing on beneficial bacteria is necessary. The present study aimed to investigate the potential of polysaccharides from 53 wild-growing mushrooms to stimulate the growth of Lactobacillus acidophilus and Lactobacillus rhamnosus and to determine the digestibility of polysaccharide fractions. Mushroom polysaccharides were precipitated with ethanol from aqueous extracts. Determination of growth promoting activity of polysaccharides was performed in U-shaped 96-plates in an ELISA reader in relation to the reference strain of L. acidophilus and two clinical strains of L. rhamnosus. The digestibility of mushroom polysaccharides was investigated in vitro by exposing them to artificial human gastric juice. Obtained results revealed that fungal polysaccharides stimulate the growth of Lactobacillus strains stronger than commercially available prebiotics like inulin or fructooligosaccharides. Moreover, selected polysaccharides were subjected to artificial human gastric juice and remain undigested in more than 90%. Obtained results indicate that mushroom polysaccharides are able to pass through the stomach unchanged, reaching the colon and stimulating the growth of beneficial bacteria. Majority of 53 polysaccharide fractions were analysed for the first time in our study. Overall, our findings suggest that polysaccharide fractions from edible mushrooms might be useful in producing functional foods and nutraceuticals.
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Edible kernel. 981.7 Section 981.7 Agriculture... Regulating Handling Definitions § 981.7 Edible kernel. Edible kernel means a kernel, piece, or particle of almond kernel that is not inedible. [41 FR 26852, June 30, 1976] ...
Albuquerque, Margeli Pereira de
2010-01-01
As espécies de Pleurotus, popularmente conhecidas por cogumelos ostra, são decompositoras primárias de madeira e outros resíduos vegetais biodegradáveis. Estes fungos apresentam propriedades nutricionais com elevados teores de proteínas aminoácidos essenciais, ácidos graxos insaturados, vitaminas e minerais, por isso estão tornando-se cada vez mais importantes como um recurso alimentar. A identificação de substratos que permitam o rápido desenvolvimento do micélio fúngico é uma...
Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique
International Nuclear Information System (INIS)
Migliore, Luciana; Fiori, Maurizio; Spadoni, Anna; Galli, Emanuela
2012-01-01
Highlights: ► Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. ► The role of extracellular laccase in degradation was evaluated. ► The almost complete OTC removal was obtained. ► A possible degradation product was identified in mycelia (ADOTC). ► The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.
Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique
Energy Technology Data Exchange (ETDEWEB)
Migliore, Luciana [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Fiori, Maurizio [Dept. Veterinary Public Health and Food Safety, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy); Spadoni, Anna [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy); Galli, Emanuela [Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy)
2012-05-15
Highlights: Black-Right-Pointing-Pointer Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. Black-Right-Pointing-Pointer The role of extracellular laccase in degradation was evaluated. Black-Right-Pointing-Pointer The almost complete OTC removal was obtained. Black-Right-Pointing-Pointer A possible degradation product was identified in mycelia (ADOTC). Black-Right-Pointing-Pointer The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.
Czech Academy of Sciences Publication Activity Database
Svobodová, Kateřina; Petráčková, Denisa; Szabad, Hana; Novotný, Čeněk
2016-01-01
Roč. 3, č. 3 (2016), s. 395-407 ISSN 2372-0344 Institutional support: RVO:61388971 Keywords : Pleurotus ostreatus * activated sludge * fungal/bacterial co-cultur Subject RIV: EE - Microbiology, Virology
Green revolution vaccines, edible vaccines
African Journals Online (AJOL)
Admin
of development. Food vaccines may also help to suppress autoimmunity disorders such as Type-1. Diabetes. Key words: Edible vaccines, oral vaccines, antigen expression, food vaccines. INTRODUCTION. Vaccination involves the stimulation of the immune system to prepare it for the event of an invasion from a particular ...
Edible insects are the future?
Huis, van Arnold
2016-01-01
The global increase in demand for meat and the limited land area available prompt the search for alternative protein sources. Also the sustainability of meat production has been questioned. Edible insects as an alternative protein source for human food and animal feed are interesting in terms of
Edible insects and research needs
Huis, van A.
2017-01-01
The recent research interest is illustrated by the many refereed articles that appeared during the last years. Only in 2016, there were 47 articles listed in Web of Science (consulted 15 February 2017) when using ‘edible insects’ compared to only 25 during the entire five-year period 2006-2010. At
International Nuclear Information System (INIS)
Thakur, Rajendra Singh; Singh; Alpana; Gautam, Satendra; Shukla, Shashita; Deshmukh, Reena
2015-01-01
An extensive survey for collection and identification of wild edible fungi was undertaken in three districts namely Mandla, Dindori and Shahdol of Northern Hill Region of Chhattisgarh (An Agro-climatic Zone) belonging to Madhya Pradesh. A total of 9 species were documented as wild edible fungi used for food purpose by ethnic tribes of selected region. These wild edible fungi make a substantial contribution to the food security of tribal people of Madhya Pradesh. Identification was done on the basis of morphological characteristics. Termitomyces spp. recorded highest no. of spp. (7) followed by Scleroderma spp (1spp.) and Russula spp. (1spp). For shelf life enhancement, wild edible fungi were irradiated with 0,1.0, 1.5 or 2.0 kGy gamma radiation doses, packed in LDPE bags and stored at 50℃. T. heimii Natrajan showed 15 days, T. radicatus Natarajan 9 days, Scleroderma spp. Showed 24 days of shelf life treated with 1.5 kGy dose whereas Russula Spp., T. eurhizus (Berk) R.heim treated with 1.0 kGy radiation dose showed 9 days of shelf life in terms of all sensory attributes. All the irradiated mushrooms had lower PLW (Physiological Loss in Weight) and better microbial quality as compared to control. Nutritional quality of wild edible fungi was not affected adversely by gamma radiation. This type of study could contribute significantly to improve food security in tribal areas, whose potential as source of nutrition is currently undervalued. (author)
Commercial Scale Production of Mushroom Liquid Seeds
International Nuclear Information System (INIS)
Rosnani Abdul Rashid; Hassan Hamdani Hassan Mutaat; Mohd Meswan Maskom; Khairuddin Abdul Rahim
2015-01-01
Mushroom liquid seed production technology was developed by Malaysian Nuclear Agency (Nuclear Malaysia) in the late 1990s. Initially, the liquid seeds were used mainly in the solid state fermentation process for converting oil palm empty fruit bunch fibres into ruminant feed. Considering widespread problems encountered by mushroom growers from use of solid seeds, especially in cases of contaminant agents infecting cultivated bags and inconsistencies in yield, we diverted our focus to utilising liquid seeds as alternative inocula for mushroom cultivation. These problems provide us opportunities to look into the issues and address the problems faced by mushroom growers. However, the technology of producing liquid seed at laboratory scale needs to be primed for commercial production. This paper discusses developmental aspects of mushroom liquid seed at commercial scale for the advancement of the country's mushroom industry. (author)
Economic assessment of mushroom project commercialisation
International Nuclear Information System (INIS)
Mat Rasol Awang; Rosnani Abdul Rashid; Hassan Hamdani Hassan Mutaat; Meswan Maskom
2010-01-01
The market value of mushroom is worth US $45 billion comprising: US $28-30 billion from food, US $9-10 billion from medicinal products and US $3.5-4 billion from wild mushroom. Malaysian import deficit of mushroom over the year 2001-2007 was 40,933 metric ton that worth of RM 187.7 million. The existing local market is lucrative and the potential world market is very large. Having cultivation technology in placed, understanding key value chains of cultivation technology processes, this paper assesses the case study of project economic of mushroom commercialization. (author)
Bacteria associated with compost used for cultivation of Nigerian ...
African Journals Online (AJOL)
The bacteria involved in an outdoor single phase composting using sawdust and wheat bran as substrates for cultivation of Pleurotus tuber-regium (Fr.) Singer, and Lentinus squarrosulus (Berk.), two Nigerian edible mushrooms were identified. Composting was carried out for 2 weeks. The highest core and peripheral ...
Economic benefit analysis of cultivating Pleurotus ostreatus with rape straw
Guan, Qinlan; Gong, Mingfu; Tang, Mei
2018-04-01
The cultivation of Pleurotus ostreatus with rape straw not only can save the cultivation cost of P. ostreatus, but also can reuse the resources and protect the environment. By adding different proportion of rape straw to the cultivation material of P. ostreatus, the reasonable amount of rape straw was selected and the economic benefit of P. ostreatus cultivated with the optimum amount of rape straw was analyzed. The results showed that adding 10% to 40% rape straw to the cultivation material of P. ostreatus did not affect the yield and biological conversion rate of P. ostreatus, and the ratio of production and investment of the amount of rape straw in the range of 10% to 50% was higher than of cottonseed husk alone as the main material of the formula.
Molecular phylogenetics of porcini mushrooms (Boletus section Boletus).
Dentinger, Bryn T M; Ammirati, Joseph F; Both, Ernst E; Desjardin, Dennis E; Halling, Roy E; Henkel, Terry W; Moreau, Pierre-Arthur; Nagasawa, Eiji; Soytong, Kasem; Taylor, Andy F; Watling, Roy; Moncalvo, Jean-Marc; McLaughlin, David J
2010-12-01
Porcini (Boletus section Boletus: Boletaceae: Boletineae: Boletales) are a conspicuous group of wild, edible mushrooms characterized by fleshy fruiting bodies with a poroid hymenophore that is "stuffed" with white hyphae when young. Their reported distribution is with ectomycorrhizal plants throughout the Northern Hemisphere. Little progress has been made on the systematics of this group using modern molecular phylogenetic tools because sampling has been limited primarily to European species and the genes employed were insufficient to resolve the phylogeny. We examined the evolutionary history of porcini by using a global geographic sampling of most known species, new discoveries from little explored areas, and multiple genes. We used 78 sequences from the fast-evolving nuclear internal transcribed spacers and are able to recognize 18 reciprocally monophyletic species. To address whether or not porcini form a monophyletic group, we compiled a broadly sampled dataset of 41 taxa, including other members of the Boletineae, and used separate and combined phylogenetic analysis of sequences from the nuclear large subunit ribosomal DNA, the largest subunit of RNA polymerase II, and the mitochondrial ATPase subunit six gene. Contrary to previous studies, our separate and combined phylogenetic analyses support the monophyly of porcini. We also report the discovery of two taxa that expand the known distribution of porcini to Australia and Thailand and have ancient phylogenetic connections to the rest of the group. A relaxed molecular clock analysis with these new taxa dates the origin of porcini to between 42 and 54 million years ago, coinciding with the initial diversification of angiosperms, during the Eocene epoch when the climate was warm and humid. These results reveal an unexpected diversity, distribution, and ancient origin of a group of commercially valuable mushrooms that may provide an economic incentive for conservation and support the hypothesis of a tropical
Reis, Filipa S; Heleno, Sandrina A; Barros, Lillian; Sousa, Maria João; Martins, Anabela; Santos-Buelga, Celestino; Ferreira, Isabel C F R
2011-08-01
Mushrooms are widely appreciated all over the world for their nutritional properties and pharmacological value as sources of important bioactive compounds. Mycorrhizal macrofungi associate with plant roots constituting a symbiotic relationship. This symbiosis could influence the production of secondary metabolites, including bioactive compounds. We focused on the evaluation of antioxidant potential and chemical composition of mycorrhizal mushrooms species from Northeast Portugal: Amanita caesarea, Amanita muscaria, Amanita pantherina, Chroogomphus fulmineus, Cortinarius anomalus, Cortinarius collinitus, Cortinarius violaceus, Lactarius quietus, Lactarius volemus, Russula sardonia, Suillus luteus, and Tricholoma ustale. A similar profile of metabolites was observed in the studied species with the order sugars > fat > ascorbic acid > phenolic compounds > tocopherols. Nevertheless, the samples revealed different compositions: prevalence of sugars in L. volemus, fat and ascorbic acid in A. muscaria, phenolic compounds in C. anomalus and tocopherols, and antioxidant activity in S. luteus. Chemical characterization of 12 mycorrhizal mushrooms was achieved. They are sources of nutraceuticals, such as sugars and fatty acids, and contain bioactive compounds, such as vitamins and phenolic acids. Edible species can be incorporated in diets as sources of antioxidants, while nonedible species can be explored as sources of bioactive metabolites. © 2011 Institute of Food Technologists®
2010-04-01
... diglycerides of edible fats or oils, or edible fat-forming fatty acids. 582.4521 Section 582.4521 Food and... Monosodium phosphate derivatives of mono- and diglycerides of edible fats or oils, or edible fat-forming... oils, or edible fat-forming fatty acids. (b) Conditions of use. This substance is generally recognized...
21 CFR 582.4505 - Mono- and diglycerides of edible fats or oils, or edible fat-forming acids.
2010-04-01
... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Mono- and diglycerides of edible fats or oils, or... GENERALLY RECOGNIZED AS SAFE Emulsifying Agents § 582.4505 Mono- and diglycerides of edible fats or oils, or edible fat-forming acids. (a) Product. Mono- and diglycerides of edible fats or oils, or edible fat...
Edible insects are the future?
Huis, van, Arnold
2016-01-01
The global increase in demand for meat and the limited land area available prompt the search for alternative protein sources. Also the sustainability of meat production has been questioned. Edible insects as an alternative protein source for human food and animal feed are interesting in terms of low greenhouse gas emissions, high feed conversion efficiency, low land use, and their ability to transform low value organic side streams into high value protein products. More than 2000 insect speci...
Pleurotus pulmonarius cultivation on amended palm press fibre waste
African Journals Online (AJOL)
In the last few decades, rapid global demand for edible oils has resulted in a significant increase in the land area of oil crop cultivation. In the process of extraction of palm oil from oil palm fruit, biomass materials such as palm pressed fibre (PPF) are generated as waste products. This research was undertaken to evaluate ...
Fresh-keeping of mushroom by irradiation
International Nuclear Information System (INIS)
Liu Chao; Xu Hongqing; Wang Hong; Cai Jian
2003-01-01
The effect of 60 Co γ irradiation on the preservation of Agaricus bisporus were studied. The results showed that after irradiation the mushroom had lower rates of membrane split, opening of pilei, browning, decomposition and lose of fresh weight. The fresh keeping period of mushroom irradiated with 1.2 kGy and stored at 4 degree C was prolonged to 30 days