International Nuclear Information System (INIS)
Martinez M, V.
1992-01-01
Dysprosium bis (tetraphenylporphyrinate) and bis (dysprosium) Tris (tetraphenylporphyrinate) were synthesized from dysprosium tetraphenylporphyrinate prepared in situ, and characterized by IR, UV-vis, TGA, DTA, EPR and magnetic susceptibility measurements. The double decker compound was obtained by direct oxidation of the HDy(TPP) 2 intermediate. The existence of the radical anion, (TPP) - , in the double decker product was conformed by EPR spectrometry. Dysprosium monoporphyrinate was isolated and characterized by the same techniques. (Author)
Can a dysprosium shortage threaten green energy technologies?
International Nuclear Information System (INIS)
Hoenderdaal, Sander; Tercero Espinoza, Luis; Marscheider-Weidemann, Frank; Graus, Wina
2013-01-01
Dysprosium, one of the various rare earth elements, is currently for more than 99% mined in China. As China is reducing its exports, new mining projects outside of China are needed to sustain supply and meet future demands. Dysprosium is mainly used in permanent magnets to retain the magnet's strength at elevated temperatures. Therefore, the use of dysprosium doped permanent magnets is preferred in electric vehicles and direct-drive wind turbines. Based on four scenarios it could be shown that dysprosium demand will probably outstrip supply in the short term (up to 2020). Although new mines are being developed, it takes several years for them to become productive. For the long term it is expected that enough dysprosium oxide is available in the earth crust (which is economically feasible to mine with current dysprosium prices) to fulfil the projected demand of dysprosium up to 2050. Recycling of dysprosium can further secure dysprosium supply in the long term by reducing primary dysprosium use by 35% in 2050. Electric vehicles are likely to play a dominant role in future increases in dysprosium demand. Even with the limited market share in 2011, electric vehicles already contribute to 20% of dysprosium use. -- Highlights: ► Dysprosium may hamper the implementation of electric cars and wind mills. ► In the short term (up to 2020) a deficit of dysprosium supply can be expected. ► In the long term (up to 2050) sufficient dysprosium is available. ► Electric vehicles are expected to dominate future dysprosium demand. ► China's dominance in dysprosium supply is likely to decrease by 2020.
International Nuclear Information System (INIS)
Demidov, V.G.; Levitin, R.Z.; Chistyakov, O.D.
1976-01-01
The paramagnetic susceptibility of single crystals of dysprosium-yttirum alloys is measured in the basal plane and along the hexagonal axis. It is shown that the susceptibility of the alloys obeys the Curie-Weiss law, the effective magnetic moments allong the different directions being the same and the paramagnetic Curie temperatures being different. The difference between the paramagnetic Curie temperatures in the basal plane and along the hexagonal axis is independent of the dysprosium concentration in the alloy. As a comparison with the theoretical models of magnetic anisotropy shows, this is an indication that the magnetic anisotropy of dysprosium - yttrium alloys is of a single-ion nature
Energy Technology Data Exchange (ETDEWEB)
Martinez M, V
1993-12-31
Dysprosium bis (tetraphenylporphyrinate) and bis (dysprosium) Tris (tetraphenylporphyrinate) were synthesized from dysprosium tetraphenylporphyrinate prepared in situ, and characterized by IR, UV-vis, TGA, DTA, EPR and magnetic susceptibility measurements. The double decker compound was obtained by direct oxidation of the HDy(TPP){sub 2} intermediate. The existence of the radical anion, (TPP){sup -} , in the double decker product was conformed by EPR spectrometry. Dysprosium monoporphyrinate was isolated and characterized by the same techniques. (Author).
Can a dysprosium shortage threaten green energy technologies?
Hoenderdaal, S.; Tercero Espinoza, L.; Marschneider-Weidemann, F.; Crijns - Graus, Wina|info:eu-repo/dai/nl/308005015
2013-01-01
Dysprosium, one of the various rare earth elements, is currently for more than 99% mined in China. As China is reducing its exports, new mining projects outside of China are needed to sustain supply and meet future demands. Dysprosium is mainly used in permanent magnets to retain the magnet's
Method for producing dysprosium-iron-boron alloy powder
International Nuclear Information System (INIS)
Camp, F.E.; Wooden, S.A.
1989-01-01
A method for producing a dysprosium-iron alloy adapted for use in the manufacture of rare-earth element containing, iron-boron permanent magnets, the method including providing a particle mixture comprising dysprosium oxide, iron and calcium, compacting the particle mixture to produce a consolidated article, heating the article for a time at temperature to form a metallic compound comprising dysprosium and iron and to form calcium oxide, producing a particle mass of -35 mesh from the compact, washing the particle mass with water at a temperature no greater than 10 0 C to react to the calcium and to the calcium oxide therewith to form a calcium hydroxide, while preventing oxidation of the particle mass, and removing the calcium hydroxide from the particle mass
Dysprosium complexes with the tetraphenylporphyrin macrocyclic ligand
International Nuclear Information System (INIS)
Martinez M, V.; Padilla, J.; Ramirez, F.M.
1992-04-01
In this report, the results obtained on the synthesis, characterization and study of the chemical behavior of dysprosium complex with the acetylacetone chelating agent (Hacac) and the tetraphenylporphyrin macrocyclic ligand (H 2 TFP) are given. Based on the literature but according to our necessities and interest, the appropriate methodology settled down from the synthesis of prime matters until the obtaining and characterization of the products. The acetyl acetonate complex was obtained of mono hydrated dysprosium [Dy(acac) 3 . H 2 0] and trihydrated [Dy(acac) 3 .3 H 2 0], the mono tetra phenyl porphyrinate [Dy(TFP)(acac). 2 ac] the double sandwich of the dysprosium porphyrinate [Dy(TFP) 2 ] and the triple sandwich of the dysprosium porphyrinate [Dy(TFP) 3 . 2 TCB] (TCB = trichlorobenzene). Its were characterized by their melting points, solubility, IR, UV, TGA and DTA both first and besides the techniques already mentioned for NMR'H, RPE and Magnetic susceptibility the three last complexes. From the spectroscopic point of view, IR and RPE its suggested the existence of a complex of inverse mixed valence [Dy(TFP) 2- (TFP) 1- ] for the Dy(TFP) 2 as a result of the existence of the free radical (TFP' 1- and that it was not in none of the other porphyrin compounds. In the NMR'H spectra of the compounds were not observed signals in the region from 0 to 10 ppm that which shows that the dysprosium complexes in special those of the porphyrin type are highly paramagnetic and its could be used as displacement reagents, creators of images and contrast agents of great utility in these days in studies of NMR, technique today by today used in medical diagnoses. (Author)
Magnon contribution to electrical resistance of gadolinium-dysprosium alloy single crystals
International Nuclear Information System (INIS)
Nikitin, S.A.; Slobodchikov, S.S.; Solomkin, I.K.
1978-01-01
The magnon, phonon and interelectron collision contributions to the electric resistance of single crystals of gadolinium-dysprosium alloys were quantified. A relationship was found to exist between the electric resistance and the variation of the topology of the Fermi surface on melting of gadolinium with dysprosium. It was found that gadolinium-dysprosium alloys, which have no helicoidal magnetic structure in magnetically ordered state, feature a spin-spin helicoidal-type correlations in the paramagnetic field
Dosimetric properties of dysprosium doped lithium borate glass irradiated by 6 MV photons
International Nuclear Information System (INIS)
Ab Rasid, A.; Wagiran, H.; Hashim, S.; Ibrahim, Z.; Ali, H.
2015-01-01
Undoped and dysprosium doped lithium borate glass system with empirical formula (70–x) B 2 O 3 –30 Li 2 O–(x) Dy 2 O 3 (x=0.1, 0.3, 0.5, 0.7, 1.0 mol%) were prepared using the melt-quenching technique. The dosimetric measurements were performed by irradiating the samples to 6 MV photon beam using linear accelerator (LINAC) over a dose range of 0.5–5.0 Gy. The glass series of dysprosium doped lithium borate glass produced the best thermoluminescence (TL) glow curve with the highest intensity peak from sample with 1.0 mol% Dy 2 O 3 concentration. Minimum detectable dose was detected at 2.24 mGy, good linearity of regression coefficient, high reproducibility and high sensitivity compared to the undoped glass are from 1.0 mol% dysprosium doped lithium borate glass. The results indicated that the series of dysprosium doped lithium glasses have a great potential to be considered as a thermoluminescence dosimetry (TLD). - Highlights: • TL response of undoped and dysprosium doped lithium borate glass subjected to 6 MV photons irradiation at low dose range. • TL linear response of dysprosium doped lithium borate glass. • The sensitivity of dysprosium doped lithium borate glass is approximately 93 times higher than undoped glass
Heat capacity measurements on dysprosium titanate
International Nuclear Information System (INIS)
Kandan, R.; Prabhakara Reddy, B.; Panneerselvam, G.; Nagarajan, K.
2014-01-01
Dysprosium titanate is considered as a candidate material for use in the control rods of future nuclear reactors. The Dy 2 TiO 5 compound was prepared by solid-state synthesis and characterized by XRD technique. The high temperature enthalpy increments of dysprosium titanates have been measured for the first time by employing the method of inverse drop calorimetry in the temperature range 748-1645 K by using high temperature drop calorimeter. The calorimeter, the method of measurement and the procedure adopted for enthalpy increment measurements and analysis of the measured data to compute thermodynamic functions have been described elsewhere. The measured enthalpy increments were fitted to polynomial in temperature by using the least squares method. The fit equation in the temperature range from 298 to 1800 K is given
High temperature oxidation kinetics of dysprosium particles
Energy Technology Data Exchange (ETDEWEB)
Jaques, Brian J.; Butt, Darryl P., E-mail: DarrylButt@BoiseState.edu
2015-09-25
Highlights: • The oxidation behavior of dysprosium particles was studied from 500 to 1000 °C. • Activation energy in initial region found as 8–25 kJ/mol, depending on atmosphere. • Activation energy in intermediate region found as 80–95 kJ/mol. • The oxide grows at the metal–oxide interface. • Generally, the formed oxide behaved as a p-type semiconductor. - Abstract: Rare earth elements have been recognized as critical materials for the advancement of many strategic and green technologies. Recently, the United States Department of Energy has invested many millions of dollars to enhance, protect, and forecast their production and management. The work presented here attempts to clarify the limited and contradictory literature on the oxidation behavior of the rare earth metal, dysprosium. Dysprosium particles were isothermally oxidized from 500 to 1000 °C in N{sub 2}–(2%, 20%, and 50%) O{sub 2} and Ar–20% O{sub 2} using simultaneous thermal analysis techniques. Two distinct oxidation regions were identified at each isothermal temperature in each oxidizing atmosphere. Initially, the oxidation kinetics are very fast until the reaction enters a slower, intermediate region of oxidation. The two regions are defined and the kinetics of each are assessed to show an apparent activation energy of 8–25 kJ/mol in the initial region and 80–95 kJ/mol in the intermediate oxidation reaction region. The effects of varying the oxygen partial pressure on the reaction rate constant are used to show that dysprosium oxide (Dy{sub 2}O{sub 3}) generally acts as a p-type semiconductor in both regions of oxidation (with an exception above 750 °C in the intermediate region)
Neutron capture measurements and resonance parameters of dysprosium
Energy Technology Data Exchange (ETDEWEB)
Shin, S.G.; Kye, Y.U.; Namkung, W.; Cho, M.H. [Pohang University of Science and Technology, Division of Advanced Nuclear Engineering, Pohang, Gyeongbuk (Korea, Republic of); Kang, Y.R.; Lee, M.W. [Dongnam Inst. of Radiological and Medical Sciences, Research Center, Busan (Korea, Republic of); Kim, G.N. [Kyungpook National University, Department of Physics, Daegu (Korea, Republic of); Ro, T.I. [Dong-A University, Department of Physics, Busan (Korea, Republic of); Danon, Y.; Williams, D. [Rensselaer Polytechnic Institute, Department of Mechanical, Aerospace, and Nuclear Engineering, Troy, NY (United States); Leinweber, G.; Block, R.C.; Barry, D.P.; Rapp, M.J. [Naval Nuclear Laboratory, Knolls Atomic Power Laboratory, Schenectady, NY (United States)
2017-10-15
Neutron capture yields of dysprosium isotopes ({sup 161}Dy, {sup 162}Dy, {sup 163}Dy, and {sup 164}Dy) were measured using the time-of-flight method with a 16 segment sodium iodide multiplicity detector. The measurements were made at the 25m flight station at the Gaerttner LINAC Center at Rensselaer Polytechnic Institute. Resonance parameters were obtained using the multilevel R-matrix Bayesian code SAMMY. The neutron capture data for four enriched dysprosium isotopes and one natural dysprosium sample were sequentially fitted. New resonances not listed in ENDF/B-VII.1 were observed. There were 29 and 17 new resonances from {sup 161}Dy and {sup 163}Dy isotopes, respectively. Six resonances from {sup 161}Dy isotope, two resonances from {sup 163}Dy, and four resonances from {sup 164}Dy were not observed. The capture resonance integrals of each isotope were calculated with the resulting resonance parameters and those of ENDF/B-VII.1 in the energy region from 0.5 eV to 20 MeV and were compared to the capture resonance integrals with the resonance parameters from ENDF/B-VII.1. A resonance integral value of the natural dysprosium calculated with present resonance parameters was 1405 ± 3.5 barn. The value is ∝ 0.3% higher than that obtained with the ENDF/B-VII.1 parameters. The distributions of the present and ENDF/B-VII.1 neutron widths were compared to a Porter-Thomas distribution. Neutron strength functions for {sup 161}Dy and {sup 163}Dy were calculated with the present resonance parameters and both values were in between the values of ''Atlas of Neutron Resonances'' and ENDF/B-VII.1. The present radiation width distributions of {sup 161}Dy and {sup 163}Dy were fitted with the χ{sup 2} distribution by varying the degrees of freedom. (orig.)
Dosimetric properties of dysprosium doped lithium borate glass irradiated by 6 MV photons
Ab Rasid, A.; Wagiran, H.; Hashim, S.; Ibrahim, Z.; Ali, H.
2015-07-01
Undoped and dysprosium doped lithium borate glass system with empirical formula (70-x) B2O3-30 Li2O-(x) Dy2O3 (x=0.1, 0.3, 0.5, 0.7, 1.0 mol%) were prepared using the melt-quenching technique. The dosimetric measurements were performed by irradiating the samples to 6 MV photon beam using linear accelerator (LINAC) over a dose range of 0.5-5.0 Gy. The glass series of dysprosium doped lithium borate glass produced the best thermoluminescence (TL) glow curve with the highest intensity peak from sample with 1.0 mol% Dy2O3 concentration. Minimum detectable dose was detected at 2.24 mGy, good linearity of regression coefficient, high reproducibility and high sensitivity compared to the undoped glass are from 1.0 mol% dysprosium doped lithium borate glass. The results indicated that the series of dysprosium doped lithium glasses have a great potential to be considered as a thermoluminescence dosimetry (TLD).
Elevated temperature study of Nd-Fe-B--based magnets with cobalt and dysprosium additions
International Nuclear Information System (INIS)
Gauder, D.R.; Froning, M.H.; White, R.J.; Ray, A.E.
1988-01-01
This paper discusses the elevated temperature performance of Nd-Fe-B magnets containing 0--15 wt. % cobalt substitutions for iron and 0--10 wt. % dysprosium substitutions for neodymium. Test samples were prepared using conventional powder metallurgy techniques. Elevated temperature hysteresis loop and open-circuit measurements were performed on the samples to investigate irreversible losses and long term aging losses at 150 0 C. Magnets with high amounts of both cobalt and dysprosium exhibited lower losses of coercivity and magnetization. Dysprosium had more influence on the elevated temperature performance of the material than did cobalt
In situ characterization of the nitridation of dysprosium during mechanochemical processing
Energy Technology Data Exchange (ETDEWEB)
Jaques, Brian J.; Osterberg, Daniel D.; Alanko, Gordon A.; Tamrakar, Sumit; Smith, Cole R.; Hurley, Michael F.; Butt, Darryl P., E-mail: DarrylButt@BoiseState.edu
2015-01-15
Highlights: • A nitridation reaction in a high energy planetary ball mill was monitored in situ. • Dysprosium mononitride was synthesized from Dy at low temperatures in short times. • Ideal gas law and in situ temperature and pressure used to assess reaction extent. • It is proposed that reaction rate is proportional to the creation of new surface. - Abstract: Processing of advanced nitride ceramics traditionally requires long durations at high temperatures and, in some cases, in hazardous atmospheres. In this study, dysprosium mononitride (DyN) was rapidly formed from elemental dysprosium in a closed system at ambient temperatures. An experimental procedure was developed to quantify the progress of the nitridation reaction during mechanochemical processing in a high energy planetary ball mill (HEBM) as a function of milling time and intensity using in situ temperature and pressure measurements, SEM, XRD, and particle size analysis. No intermediate phases were formed. It was found that the creation of fresh dysprosium surfaces dictates the rate of the nitridation reaction, which is a function of milling intensity and the number of milling media. These results show clearly that high purity nitrides can be synthesized with short processing times at low temperatures in a closed system requiring a relatively small processing footprint.
A terminal fluoride ligand generates axial magnetic anisotropy in dysprosium complexes
Energy Technology Data Exchange (ETDEWEB)
Norel, Lucie [Department of Chemistry, University of California, Berkeley, CA (United States); Univ Rennes, CNRS, ISCR (Institut des Sciences Chimiques de Rennes) - UMR 6226, Rennes (France); Darago, Lucy E.; Chakarawet, Khetpakorn; Gonzalez, Miguel I.; Olshansky, Jacob H.; Long, Jeffrey R. [Department of Chemistry, University of California, Berkeley, CA (United States); Le Guennic, Boris; Rigaut, Stephane [Univ Rennes, CNRS, ISCR (Institut des Sciences Chimiques de Rennes) - UMR 6226, Rennes (France)
2018-02-12
The first dysprosium complexes with a terminal fluoride ligand are obtained as air-stable compounds. The strong, highly electrostatic dysprosium-fluoride bond generates a large axial crystal-field splitting of the J=15/2 ground state, as evidenced by high-resolution luminescence spectroscopy and correlated with the single-molecule magnet behavior through experimental magnetic susceptibility data and ab initio calculations. (copyright 2018 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)
The development of dysprosium-165 hydroxide macroaggregates for radiation synovectomy
International Nuclear Information System (INIS)
McLaren, A.B.; Hetherington, E.L.R.; Maddalena, D.J.; Snowden, G.M.
1988-06-01
The development of a dysprosium-165 product, Dy-HMA, which is suitable for the radiation synovectomy of arthritic joints is described. Dysprosium-165 is a short-lived (t 1/2 = 139 min) beta-emitter produced by the neutron irradiation of natural dysprosium. Dy-HMA is a suspension of macroaggregated hydroxide particles in saline with the majority of particles in the 3-5 μm range. Studies in rabbits have demonstrated minimal leakage following the intra-articular injection of a knee joint. At 24 hours, the accumulation in the liver is about 0.003% of the injected dose and there is considerably less in other organs and tissue. The use of Dy-HMA has considerable advantages over the presently used yttrium-90 products. The undesired leakage to and subsequent irradiation of other organs is considerably reduced. The period of hospitalisation is reduced from four days to one and the production of 165 Dy in Australia will overcome the difficulties of supply 90 Y from overseas. 21 refs., 1 fig., 18 tabs
Properties of Polydisperse Tin-doped Dysprosium and Indium Oxides
Directory of Open Access Journals (Sweden)
Malinovskaya Tatyana
2017-01-01
Full Text Available The results of investigations of the complex permittivity, diffuse-reflectance, and characteristics of crystal lattices of tin-doped indium and dysprosium oxides are presented. Using the methods of spectroscopy and X-ray diffraction analysis, it is shown that doping of indium oxide with tin results in a significant increase of the components of the indium oxide complex permittivity and an appearance of the plasma resonance in its diffuse-reflectance spectra. This indicates the appearance of charge carriers with the concentration of more than 1021 cm−3 in the materials. On the other hand, doping of the dysprosium oxide with the same amount of tin has no effect on its optical and electromagnetic properties.
International Nuclear Information System (INIS)
Gajfutdinova, R.K.; Sharafutdinova, A.A.; Murinov, Yu.I.
1988-01-01
The isothermal cross section method at 25 and 50 deg C is applied to study pyridine hydrochloride-terbium chloride-water (1) piperidine hydrochloride-dysprosium chloride-water (2), piperazine dihydrochloride-dysprosium chloride-water (3) and morpholine hydrochloride-terbium chloride (4) systems. Solubility isotherma prove the formation of incongruently soluble compound of the TbCl 3 x6C 5 H 5 NxHCl composition systems (1). The individuality of the new solid phase is proved by the chemical and DTA methods. Systems (2-4) are of a simple eutonic type
Synthesis and thermal decomposition study of dysprosium trifluoroacetate
DEFF Research Database (Denmark)
Opata, Y. A.; Grivel, J.-C.
2018-01-01
A study of the thermal decomposition process of dysprosium trifluoroacetate hydrate under flowing argon is presented. Thermogravimetry, differential thermal analysis, evolved gas analysis and ex-situ x-ray diffraction techniques have been employed in the investigation. Three main stages were...
Charge transfer cross sections for dysprosium and cerium
Energy Technology Data Exchange (ETDEWEB)
Adachi, Hajime; Tamura, Koji; Okazaki, Tetsuji; Shibata, Takemasa [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment
1998-06-01
Symmetric resonant charge transfer cross sections between singly ionized ions and the parent atoms were measured for dysprosium and cerium in the impact energy of 200-2000eV. The cross sections were determined from the ratio between the number of ions produced by charge transfer and those in primary ion beam. The primary ion beam was produced by a laser ion source in which their atoms were ionized by laser resonant photo-ionization. The slow ions produced by charge transfer and fast primary ions were detected with Faraday cups. The obtained cross sections were (1.82{+-}0.14) x 10{sup -14} cm{sup 2} for dysprosium and (0.88{+-}0.12) x 10{sup -14} cm{sup 2} for cerium in the above energy range. The difference of these values can mostly be explained by considering the electron configurations of these atoms and ions. (author)
Charge transfer cross sections for dysprosium and cerium
International Nuclear Information System (INIS)
Adachi, Hajime; Tamura, Koji; Okazaki, Tetsuji; Shibata, Takemasa
1998-06-01
Symmetric resonant charge transfer cross sections between singly ionized ions and the parent atoms were measured for dysprosium and cerium in the impact energy of 200-2000eV. The cross sections were determined from the ratio between the number of ions produced by charge transfer and those in primary ion beam. The primary ion beam was produced by a laser ion source in which their atoms were ionized by laser resonant photo-ionization. The slow ions produced by charge transfer and fast primary ions were detected with Faraday cups. The obtained cross sections were (1.82±0.14) x 10 -14 cm 2 for dysprosium and (0.88±0.12) x 10 -14 cm 2 for cerium in the above energy range. The difference of these values can mostly be explained by considering the electron configurations of these atoms and ions. (author)
International Nuclear Information System (INIS)
Chiriac, L.B.; Trandafir, D.L.; Turcu, R.V.F.; Todea, M.; Simon, S.
2016-01-01
Highlights: • Dysprosium containing silica microparticles obtained by freeze and spray drying. • Higher structural units interconnection achieved in freeze vs. spray dried samples. • Dy occurance on the outermost layer of the microparticles evidenced by XPS. • Enhanced MRI contrast observed for freeze dried samples with 5% mol Dy_2O_3. - Abstract: The work is focused on synthesis and structural characterization of novel dysprosium-doped silica particles which could be considered as MRI contrast agents. Sol-gel derived silica rich particles obtained via freeze-drying and spray-drying processing methods were structurally characterized by XRD, "2"9Si MAS-NMR and XPS methods. The occurrence of dysprosium on the outermost layer of dysprosium containing silica particles was investigated by XPS analysis. The MRI contrast agent characteristics have been tested using RARE-T_1 and RARE-T_2 protocols. The contrast of MRI images delivered by the investigated samples was correlated with their local structure. Dysprosium disposal on microparticles with surface structure characterised by decreased connectivity of the silicate network units favours dark T_2-weighted MRI contrast properties.
Energy Technology Data Exchange (ETDEWEB)
Arratia-Quijada, Jenny [Departamento de Ciencias de la Salud, Centro Universitario Tonalá, Universidad de Guadalajara, Av. Nuevo Periférico No. 555, C.P. 48525, Tonalá, Jalisco (Mexico); Sánchez Jiménez, Cecilia [Departamento de Química, Universidad de Guadalajara, Boulevard Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico); Gurinov, Andrey [Research Resources Center for Magnetic Resonance, St. Petersburg State University, Universitetskiy pr. 26, 198504 St. Petersburg (Russian Federation); NMR Core Lab, King Abdullah University of Science and Technology, Thuwal 23955-6900 (Saudi Arabia); Pérez Centeno, Armando; Ceja Andrade, Israel [Departamento de Física, Universidad de Guadalajara, Boulevard Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico); Carbajal Arízaga, Gregorio Guadalupe, E-mail: gregoriocarbajal@yahoo.com.mx [Departamento de Química, Universidad de Guadalajara, Boulevard Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico)
2016-01-15
Graphical abstract: - Highlights: • LDH structure including dysprosium was prepared by co-precipitation. • LDH was capable to produce contrast in the T1 mode of MRI. • LDH were intercalated with folate, ibuprofen and gallate ions. - Abstract: A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.
International Nuclear Information System (INIS)
Arratia-Quijada, Jenny; Sánchez Jiménez, Cecilia; Gurinov, Andrey; Pérez Centeno, Armando; Ceja Andrade, Israel; Carbajal Arízaga, Gregorio Guadalupe
2016-01-01
Graphical abstract: - Highlights: • LDH structure including dysprosium was prepared by co-precipitation. • LDH was capable to produce contrast in the T1 mode of MRI. • LDH were intercalated with folate, ibuprofen and gallate ions. - Abstract: A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.
Semiconductor composition containing iron, dysprosium, and terbium
Pooser, Raphael C.; Lawrie, Benjamin J.; Baddorf, Arthur P.; Malasi, Abhinav; Taz, Humaira; Farah, Annettee E.; Kalyanaraman, Ramakrishnan; Duscher, Gerd Josef Mansfred; Patel, Maulik K.
2017-09-26
An amorphous semiconductor composition includes 1 to 70 atomic percent iron, 15 to 65 atomic percent dysprosium, 15 to 35 atomic percent terbium, balance X, wherein X is at least one of an oxidizing element and a reducing element. The composition has an essentially amorphous microstructure, an optical transmittance of at least 50% in at least the visible spectrum and semiconductor electrical properties.
Energy Technology Data Exchange (ETDEWEB)
Chiriac, L.B.; Trandafir, D.L. [Faculty of Physics & National Magnetic Resonance Center, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Interdisciplinary Research Institute on Bio-Nano-Sciences & Faculty of Physics, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Turcu, R.V.F. [Faculty of Physics & National Magnetic Resonance Center, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Todea, M. [Interdisciplinary Research Institute on Bio-Nano-Sciences & Faculty of Physics, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Simon, S., E-mail: simons@phys.ubbcluj.ro [Faculty of Physics & National Magnetic Resonance Center, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Interdisciplinary Research Institute on Bio-Nano-Sciences & Faculty of Physics, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania)
2016-11-01
Highlights: • Dysprosium containing silica microparticles obtained by freeze and spray drying. • Higher structural units interconnection achieved in freeze vs. spray dried samples. • Dy occurance on the outermost layer of the microparticles evidenced by XPS. • Enhanced MRI contrast observed for freeze dried samples with 5% mol Dy{sub 2}O{sub 3}. - Abstract: The work is focused on synthesis and structural characterization of novel dysprosium-doped silica particles which could be considered as MRI contrast agents. Sol-gel derived silica rich particles obtained via freeze-drying and spray-drying processing methods were structurally characterized by XRD, {sup 29}Si MAS-NMR and XPS methods. The occurrence of dysprosium on the outermost layer of dysprosium containing silica particles was investigated by XPS analysis. The MRI contrast agent characteristics have been tested using RARE-T{sub 1} and RARE-T{sub 2} protocols. The contrast of MRI images delivered by the investigated samples was correlated with their local structure. Dysprosium disposal on microparticles with surface structure characterised by decreased connectivity of the silicate network units favours dark T{sub 2}-weighted MRI contrast properties.
Ethanolamine derivatives of dysprosium and holmium
International Nuclear Information System (INIS)
Gharia, K.S.; Singh, M.; Mathur, S.; Sankhla, B.S.
1981-01-01
The preparation and properties of dysprosium and holmium derivatives of mono-, di- and tri-ethanolamine derivatives are described. Compounds of general formulae: Ln(OPrsup(i)) 2 (mea), Ln(OPrsup(i))(mea) 2 , Ln(mea) 3 , Ln(OPrsup(i))(dea), Ln 2 (dea) 3 , Ln(dea)(deaH) and Ln(tea) (where Ln = Dy or Ho and mea, dea and tea are the anions of respective ethanolamine) were obtained and characterized by elemental analysis and IR spectra. (author)
Energy Technology Data Exchange (ETDEWEB)
Sessler, J.L.; Mody, T.D. (Texas Univ., Austin, TX (United States). Dept. of Chemistry); Ramasamy, R.; Sherry, A.D. (Texas Univ., Dallas, TX (United States))
1992-05-01
The synthesis and characterization of a novel dysprosium(III) crown-ether texaphyrin (Dy(BCTxp)){sup 2+} is reported. This complex was designed to serve as a ditopic chelate for both dysprosium(III) and sodium cations. {sup 23}Sodium NMR spectroscopic studies indicates that titration of Na{sup +} with increasing concentrations of (Dy(BCTxp)){sup 2+} results in a shift toward higher frequency and gives a net hyperfine shift of 0.86 ppm. Sodium complexation is taking place into the crown subunit in (Dy(BCTxp)){sup 2+} and the degree of complexation is not reduced substantially by the positive charge on the dysprosium(III) portion of this binucleating system.
Arratia-Quijada, Jenny
2015-10-23
A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.
Arratia-Quijada, Jenny; Sá nchez Jimé nez, Cecilia; Gurinov, Andrei; Pé rez Centeno, Armando; Ceja Andrade, Israel; Carbajal Arí zaga, Gregorio Guadalupe
2015-01-01
A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.
International Nuclear Information System (INIS)
Zakharov, A.V.; Risovany, V.D.; Muraleva, E.M.; Sokolov, V.F.
2011-01-01
The main advantages of dysprosium hafnate as an absorbing material for LWR control rods are the following: -) unlimited radiation resistance; - two absorbing components, Dy and Hf, increasing physical efficiency of the material compared to Dy 2 O 3 -TiO 2 and alloy 80% Ag - 15% In - 5% Cd; -) variability of physical efficiency by changing a composition, but maintaining other performance characteristics of the material; -) high process-ability due to the absence of phase transients and single-phase structure (solid solution); -) production of high density pellets. Lab-scale mastering of dysprosium hafnate pellets production showed a possibility of material synthesis using a solid-phase method, as well as of dysprosium hafnate pellets production by cold pressing and subsequent sintering. Within a whole range of examined compositions (23 mol% - 75 mol% Dy 2 O 3 ), a single-phase material with a highly radiation resistant fluorite-like structure was produced. Experiments on cold pressing and sintering of pellets confirmed a possibility of producing high quality dysprosium hafnate pellets from synthesized powder. A pilot batch of dysprosium hafnate pellets with standard sizes was produced. The standard sizes corresponded to the absorbing elements of the WWER-1000 control rods and met the main requirements to the absorbing element columns. The pilot batch size was approximately 6 kg. Acceptance testing of the pilot batch of dysprosium hafnate pellets was conducted, fulfillment of the requirements of technical conditions was checked and preirradiation properties of the pellets were examined. High quality of the produced pellets was confirmed, thus, demonstrating a real possibility of producing large batches of the dysprosium hafnate pellets. The next step is the production of test absorbing elements and cluster assemblies for the WWER-1000 control rods with their further installation for pilot operation at one of the Russian nuclear power plants
Energy Technology Data Exchange (ETDEWEB)
Sánchez Lafarga, Ana Karen; Pacheco Moisés, Fermín P. [Departamento de Química, Universidad de Guadalajara, Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico); Gurinov, Andrey [Research Resources Center for Magnetic Resonance, Saint Petersburg State University, Universitetskij pr. 26, 198504 St. Petersburg (Russian Federation); Ortiz, Genaro Gabriel [Laboratorio Desarrollo-Envejecimiento, Enfermedades Neurodegenerativas, Centro de Investigación Biomédica de Occidente (CIBO), Instituto Mexicano de Seguro Social (IMSS), Guadalajara, Jalisco (Mexico); Carbajal Arízaga, Gregorio Guadalupe, E-mail: gregoriocarbajal@yahoo.com.mx [Departamento de Química, Universidad de Guadalajara, Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico)
2015-03-01
The development of probes for biomedical applications demands materials with low toxicity levels besides fluorescence or magnetic properties to be detected by confocal microscopes or MRI resonators. Several drug delivery systems or other biomedical materials prepared with hydroxyapatite have been proposed, however, toxicity effects might arise when the size of particles is nanometric. In this study, hydroxyapatite functionalized with glucuronic or folic acids presented lower oxidative stress, measured from lipoperoxides and nitric oxide indicators in rats than pure hydroxyapatite. In separated experiments, hydroxyapatite was doped with dysprosium cations by coprecipitation producing a single crystal phase with fluorescent properties easily visualized by confocal microscopy when excited at 488 nm. These particles also presented the ability to modify the proton relaxation time in T1 maps collected by magnetic resonance imaging. These modified hydroxyapatite nanoparticles could be candidates to design bimodal probes with low toxicity. - Highlights: • Hydroxyapatite functionalized with glucuronic acid reduced oxidative stress in rats. • Functionalization with folic acid reduced oxidative stress in rats. • Dysprosium doping does not affect the crystalline structure of hydroxyapatite. • Dysprosium doped particles are visible in fluorescent microscope. • Dysprosium doped particles act as MRI contrast agents.
International Nuclear Information System (INIS)
Sánchez Lafarga, Ana Karen; Pacheco Moisés, Fermín P.; Gurinov, Andrey; Ortiz, Genaro Gabriel; Carbajal Arízaga, Gregorio Guadalupe
2015-01-01
The development of probes for biomedical applications demands materials with low toxicity levels besides fluorescence or magnetic properties to be detected by confocal microscopes or MRI resonators. Several drug delivery systems or other biomedical materials prepared with hydroxyapatite have been proposed, however, toxicity effects might arise when the size of particles is nanometric. In this study, hydroxyapatite functionalized with glucuronic or folic acids presented lower oxidative stress, measured from lipoperoxides and nitric oxide indicators in rats than pure hydroxyapatite. In separated experiments, hydroxyapatite was doped with dysprosium cations by coprecipitation producing a single crystal phase with fluorescent properties easily visualized by confocal microscopy when excited at 488 nm. These particles also presented the ability to modify the proton relaxation time in T1 maps collected by magnetic resonance imaging. These modified hydroxyapatite nanoparticles could be candidates to design bimodal probes with low toxicity. - Highlights: • Hydroxyapatite functionalized with glucuronic acid reduced oxidative stress in rats. • Functionalization with folic acid reduced oxidative stress in rats. • Dysprosium doping does not affect the crystalline structure of hydroxyapatite. • Dysprosium doped particles are visible in fluorescent microscope. • Dysprosium doped particles act as MRI contrast agents
Dysprosium-Catalyzed Growth of Single-Walled Carbon Nanotube Arrays on Substrates
Directory of Open Access Journals (Sweden)
Qian Yong
2009-01-01
Full Text Available Abstract In this letter, we report that dysprosium is an effective catalyst for single-walled carbon nanotubes (SWNTs growth via a chemical vapor deposition (CVD process for the first time. Horizontally superlong well-oriented SWNT arrays on SiO2/Si wafer can be fabricated by EtOH-CVD under suitable conditions. The structure and properties are characterized by scanning electron microscopy, transition electron microscopy, Raman spectroscopy and atomic force microscopy. The results show that the SWNTs from dysprosium have better structural uniformity and better conductivity with fewer defects. This rare earth metal provides not only an alternative catalyst for SWNTs growth, but also a possible method to generate high percentage of superlong semiconducting SWNT arrays for various applications of nanoelectronic device.
Energy Technology Data Exchange (ETDEWEB)
Martinez M, V.; Padilla, J.; Ramirez, F.M
1992-04-15
In this report, the results obtained on the synthesis, characterization and study of the chemical behavior of dysprosium complex with the acetylacetone chelating agent (Hacac) and the tetraphenylporphyrin macrocyclic ligand (H{sub 2}TFP) are given. Based on the literature but according to our necessities and interest, the appropriate methodology settled down from the synthesis of prime matters until the obtaining and characterization of the products. The acetyl acetonate complex was obtained of mono hydrated dysprosium [Dy(acac){sub 3}. H{sub 2}0] and trihydrated [Dy(acac){sub 3} .3 H{sub 2}0], the mono tetra phenyl porphyrinate [Dy(TFP)(acac). 2 ac] the double sandwich of the dysprosium porphyrinate [Dy(TFP){sub 2}] and the triple sandwich of the dysprosium porphyrinate [Dy(TFP){sub 3}. 2 TCB] (TCB = trichlorobenzene). Its were characterized by their melting points, solubility, IR, UV, TGA and DTA both first and besides the techniques already mentioned for NMR'H, RPE and Magnetic susceptibility the three last complexes. From the spectroscopic point of view, IR and RPE its suggested the existence of a complex of inverse mixed valence [Dy(TFP){sup 2-} (TFP) {sup 1-}] for the Dy(TFP){sub 2} as a result of the existence of the free radical (TFP' {sup 1-} and that it was not in none of the other porphyrin compounds. In the NMR'H spectra of the compounds were not observed signals in the region from 0 to 10 ppm that which shows that the dysprosium complexes in special those of the porphyrin type are highly paramagnetic and its could be used as displacement reagents, creators of images and contrast agents of great utility in these days in studies of NMR, technique today by today used in medical diagnoses. (Author)
Energy Technology Data Exchange (ETDEWEB)
Martinez M, V; Padilla, J; Ramirez, F M
1992-04-15
In this report, the results obtained on the synthesis, characterization and study of the chemical behavior of dysprosium complex with the acetylacetone chelating agent (Hacac) and the tetraphenylporphyrin macrocyclic ligand (H{sub 2}TFP) are given. Based on the literature but according to our necessities and interest, the appropriate methodology settled down from the synthesis of prime matters until the obtaining and characterization of the products. The acetyl acetonate complex was obtained of mono hydrated dysprosium [Dy(acac){sub 3}. H{sub 2}0] and trihydrated [Dy(acac){sub 3} .3 H{sub 2}0], the mono tetra phenyl porphyrinate [Dy(TFP)(acac). 2 ac] the double sandwich of the dysprosium porphyrinate [Dy(TFP){sub 2}] and the triple sandwich of the dysprosium porphyrinate [Dy(TFP){sub 3}. 2 TCB] (TCB = trichlorobenzene). Its were characterized by their melting points, solubility, IR, UV, TGA and DTA both first and besides the techniques already mentioned for NMR'H, RPE and Magnetic susceptibility the three last complexes. From the spectroscopic point of view, IR and RPE its suggested the existence of a complex of inverse mixed valence [Dy(TFP){sup 2-} (TFP) {sup 1-}] for the Dy(TFP){sub 2} as a result of the existence of the free radical (TFP' {sup 1-} and that it was not in none of the other porphyrin compounds. In the NMR'H spectra of the compounds were not observed signals in the region from 0 to 10 ppm that which shows that the dysprosium complexes in special those of the porphyrin type are highly paramagnetic and its could be used as displacement reagents, creators of images and contrast agents of great utility in these days in studies of NMR, technique today by today used in medical diagnoses. (Author)
International Nuclear Information System (INIS)
Berger, Claudia A.
2017-01-01
The thesis was aimed to the characterization of electrochemically deposited film of lithium, titanium and dysprosium on Au(111) from different ionic liquids, finally dysprosium on neodymium-iron-boron magnate for industrial applications. The investigation of the deposits were performed using cyclic voltametry, in-situ scanning tunneling microscopy, electrochemical quartz microbalance, XPS and Auger electron spectroscopy. The sample preparation is described in detail. The deposition rate showed a significant temperature dependence.
Synthesis and X-ray structure of the dysprosium(III) complex derived ...
African Journals Online (AJOL)
Synthesis and X-ray structure of the dysprosium(III) complex derived from the ligand 5-chloro-1 ... Bulletin of the Chemical Society of Ethiopia ... synthesized and its crystal structure determined by single X-ray diffraction at room temperature.
Directory of Open Access Journals (Sweden)
David Ricardo Martínez Vargas
2013-01-01
Full Text Available The layers of a Zn/Al layered double hydroxide (LDH were doped with Dy3+ cations. Among some compositions, the Zn2+ : Al3+ : Dy3+ molar ratio equal to 30 : 9 : 1 presented a single crystalline phase. Organic anions with carboxylic, amino, sulfate, or phosphate functional groups were intercalated as single layers between LDH layers as confirmed by X-ray diffraction and infrared spectroscopy. Photoluminescence spectra of the nitrate intercalated LDH showed a wide emission band with strong intensity in the yellow region (around 574 nm, originated due to symmetry distortion of the octahedral coordination in dysprosium centers. Moreover, a broad red band emission was also detected apparently due to the presence of zinc oxide. The distorted symmetry of the dysprosium coordination environment, also confirmed by X-ray photoelectron spectroscopy analysis, was modified after the intercalation with phenyl phosphonate (PP, aspartate (Asp, adipate (Adip, and serinate (Ser anions; the emission as measured from PL spectra of these LDH was more intense in the blue region (ca. 486 nm, thus indicating an increase in symmetry of dysprosium octahedrons. The red emission band from zinc oxide kept the same intensity after intercalation of dodecyl sulfate (DDS. An additional emission of unknown origin at λ = 767 nm was present in all LDHs.
Neutronography of an intermediate phase in dysprosium near the Neel point
Energy Technology Data Exchange (ETDEWEB)
Bessergenev, V G; Gogava, V V; Kovalevskaya, Yu A; Mandzhavidze, A G; Fedorov, V M; Shilo, S I
1985-11-25
Neutronographical study of dysprosium magnetic structure near the point of magnetic disordering depending on thermal prehistory of the sample is carried out. Intermediate vortex phase transformed then into the helical one is shown to occur from the paramagnetic phase under cooling.
Sandwich-type tetrakis(phthalocyaninato) dysprosium-cadmium quadruple-decker SMM.
Wang, Hailong; Qian, Kang; Wang, Kang; Bian, Yongzhong; Jiang, Jianzhuang; Gao, Song
2011-09-14
Homoleptic tetrakis[2,3,9,10,16,17,23,24-octa(butyloxy)phthalocyaninato] dysprosium-cadmium quadruple-decker complex 1 was isolated in relatively good yield of 43% from a simple one-pot reaction. This compound represents the first sandwich-type tetrakis(phthalocyaninato) rare earth-cadmium quadruple-decker SMM that has been structurally characterized. This journal is © The Royal Society of Chemistry 2011
International Nuclear Information System (INIS)
Sledge, C.B.; Zuckerman, J.D.; Shortkroff, S.; Zalutsky, M.R.; Venkatesan, P.; Snyder, M.A.; Barrett, W.P.
1987-01-01
One hundred and eleven patients who had seropositive rheumatoid arthritis and persistent synovitis of the knee were treated with intra-articular injection of 270 millicuries of dysprosium-165 bound to ferric hydroxide macroaggregates. A two-year follow-up was available for fifty-nine of the treated knees. Thirty-nine had a good result; nine, a fair result; and eleven, a poor result. Of the twenty-five knees that had Stage-I radiographic changes, nineteen had a good result. Of the thirty-four knees that had Stage-II radiographic changes, twenty showed a good result. Systemic spread of the radioactivity from the injected joint was minimum. The mean whole-body dose was calculated to be 0.3 rad and that to the liver twenty-four hours after injection, 3.2 rads. The results indicated that dysprosium-165-ferric hydroxide macroaggregate is an effective agent for performing radiation synovectomy, particularly in knees that have Stage-I radiographic changes. Because of the minimum rate of systemic spread of the dysprosium-165, it offers a definite advantage over agents that previously have been used
On polymorphism of dysprosium trichloride
International Nuclear Information System (INIS)
Zakiryanova, Irina D.; Khokhlov, Vladimir A.; Salyulev, Alexander B.; Korzun, Iraida V.
2015-01-01
For the first time, the structure of crystalline DyCl 3 over a wide temperature range from room temperature to melting point was studied by Raman spectroscopy. The phonon modes (cm -1 ) of dysprosium trichloride (monoclinic crystal lattice of AlCl 3 type, Z = 4, CN = 6) at room temperature are 257 (A 1g ), 201 (E g ), 112 (E g ), 88 (A 1g ), and 63 (E g ). The monoclinic structure of the crystalline DyCl 3 C 2h 3 symmetry was found to remain constant over the studied temperature range. No polymorphic transformation in the solid state was detected. Gravimetry, calorimetry, and mass spectrometry have been used in addition to support the conclusions made on the basis of Raman spectroscopic data.
Wang, Hailong; Liu, Chenxi; Liu, Tao; Zeng, Suyuan; Cao, Wei; Ma, Qi; Duan, Chunying; Dou, Jianmin; Jiang, Jianzhuang
2013-11-21
Reaction between Schiff-base ligand and half-sandwich complex M(Pc)(acac) led to the isolation of new sandwich-type mixed (phthalocyaninato)(Schiff-base) di-lanthanide compounds M2(Pc)2(L)H2O (M = Dy, Gd) (1, 2) [H2Pc = metal free phthalocyanine, Hacac = acetylacetone, H2L = N,N'-bis(3-methyloxysalicylidene)benzene-1,2-diamine] with the triple-decker molecular structure clearly revealed by single crystal X-ray diffraction analysis. For the comparative studies, sandwich triple-decker analogues with pure Schiff-base ligand M2(L)3H2O (M = Dy, Gd) (3, 4) were also prepared. Dynamic magnetic measurement result reveals the single-molecule magnet (SMM) nature of the di-dysprosium derivative 1, while the static magnetic investigation over both pure and the diamagnetic diluted samples of this compound discloses the interionic ferromagnetic coupling between the two dysprosium ions, which in turn effectively suppresses the QTM and enhances the energy barrier of this SMM. Nevertheless, comparative studies over the static magnetic properties of the di-dysprosium triple-decker complexes 1 and 3 indicate the stronger magnetic coupling between the two lanthanide ions in mixed (phthalocyaninato)(Schiff-base) species than in the pure Schiff-base triple-decker analogue, suggesting the special coordination sphere around the dysprosium ions in the former compound over the latter one on the more intense inter-ionic ferromagnetic coupling. As a very small step towards understanding the structure-property relationship, the present result will be surely helpful for the design and synthesis of the multinuclear lanthanide-based SMMs with good properties.
On polymorphism of dysprosium trichloride
Energy Technology Data Exchange (ETDEWEB)
Zakiryanova, Irina D.; Khokhlov, Vladimir A.; Salyulev, Alexander B.; Korzun, Iraida V. [RAS Ural Branch, Ekaterinburg (Russian Federation). Institute of High-Temperature Electrochemistry
2015-07-01
For the first time, the structure of crystalline DyCl{sub 3} over a wide temperature range from room temperature to melting point was studied by Raman spectroscopy. The phonon modes (cm{sup -1}) of dysprosium trichloride (monoclinic crystal lattice of AlCl{sub 3} type, Z = 4, CN = 6) at room temperature are 257 (A{sub 1g}), 201 (E{sub g}), 112 (E{sub g}), 88 (A{sub 1g}), and 63 (E{sub g}). The monoclinic structure of the crystalline DyCl{sub 3} C{sub 2h}{sup 3} symmetry was found to remain constant over the studied temperature range. No polymorphic transformation in the solid state was detected. Gravimetry, calorimetry, and mass spectrometry have been used in addition to support the conclusions made on the basis of Raman spectroscopic data.
Energy Technology Data Exchange (ETDEWEB)
Rekha, G. [Department of Physics, College of Engineering Guindy, Anna University, Sardar Patel Road, Chennai 600025 (India); Tholkappiyan, R. [Department of Physics, College of Engineering Guindy, Anna University, Sardar Patel Road, Chennai 600025 (India); Department of Physics, College of Science, UAE University, Al-Ain 15551 (United Arab Emirates); Vishista, K., E-mail: raovishista@gmail.com [Department of Physics, College of Engineering Guindy, Anna University, Sardar Patel Road, Chennai 600025 (India); Hamed, Fathalla [Department of Physics, College of Science, UAE University, Al-Ain 15551 (United Arab Emirates)
2016-11-01
Highlights: • Garnet type Dy{sub 3}Fe{sub 5-x}Mn{sub x}O{sub 12} (x = 0–0.06) nanoparticles of 88.4–86.8 nm were synthesized by hydrothermal method. • The Dy, Mn, Fe and O elements in the ferrites were confirmed from XPS. • The multiple oxidation states of Fe and Mn ions, bonding energy and cationic distributions of the samples were examined by XPS. • The magnetic property shows ferromagnetic behavior from VSM technique. • The results from these studies are correlated with respect to Mn dopant. - Abstract: Dysprosium iron garnets are of scientific importance because of the wide range of magnetic properties that can be obtained in substituting dysprosium by a rare earth metal. In the present work, the effect of Mn substitution on magnetostructural changes in dysprosium ferrite nanoparticles is studied. Highly crystalline pure and Mn doped dysprosium ferrite nanoparticles were synthesized by hydrothermal method. The samples were calcined at 1100 °C for 2 h in air atmosphere which is followed by characterization using XRD, FT-IR analysis, SEM, XPS and VSM. The average crystallite size of synthesized samples were calculated by X-ray diffraction falls in the range of 88.4–86.8 nm and was found to be in cubic garnet structure. For further investigation of the structure and corresponding changes in the tetrahedral and octahedral stretching vibrational bonds, FT-IR was used. The synthesized samples consist of multiple oxidation (Fe{sup 3+} and Fe{sup 2+}) states for Fe ions and (Mn{sup 3+} and Mn{sup 2+}) Mn ions analyzed in three ways of Fe 2p and Mn 2p spectra from the XPS analysis. With respect to Mn dopant in Dy{sub 3}Fe{sub 5}O{sub 12}, the cationic distributions of elements were discussed from high resolution XPS spectra by peak position and shift, area, width. To find out the porous/void surface morphology of the sample, scanning electron microscopy was used. From XPS analysis, the presence of elements (Dy, Mn, Fe and O) and their composition in the
International Nuclear Information System (INIS)
Tolubara, A.I.; Kochubej, A.I.; Usatenko, Yu.I.
1978-01-01
Effect of salicylic acid upon complex formation in the systems REE - boronsulfoalizarinate, REE - oxine and REE - boronsulfoalizarinate - oxine is investigated. Comparison of optical characteristics of the above systems in the absence and in the presence of salicylic acid is carried out. It is established that in all the cases the effect of salicylic acid depends both on the nature of REE and the ratio of all the components of the system. Under certain conditions the given dependence is observed only for erbium complexes. Extraction-photometric methods of dysprosium and holmium determination in the presence of equal erbium amounts, as well as holmium and erbium determination in the presence of cerium equal amounts is developed
Energy Technology Data Exchange (ETDEWEB)
Tolubara, A I; Kochubei, A I; Usatenko, Yu I
1978-01-01
Effect of salicylic acid upon complex formation in the systems REE - boronsulfoalizarinate, REE - oxine and REE - boronsulfoalizarinate - oxine is investigated. Comparison of optical characteristics of the above systems in the absence and in the presence of salicylic acid is carried out. It is established that in all the cases the effect of salicylic acid depends both on the nature of REE and the ratio of all the components of the system. Under certain conditions the given dependence is observed only for erbium complexes. Extraction-photometric methods of dysprosium and holmium determination in the presence of equal erbium amounts, as well as holmium and erbium determination in the presence of cerium equal amounts is developed.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Lactose. 168.122 Section 168.122 Food and Drugs... § 168.122 Lactose. (a) Lactose is the carbohydrate normally obtained from whey. It may be anhydrous or... the following specifications: (1) The lactose content is not less than 98.0 percent, mass over mass (m...
{Delta}I = 2 energy staggering in normal deformed dysprosium nuclei
Energy Technology Data Exchange (ETDEWEB)
Riley, M.A.; Brown, T.B.; Archer, D.E. [Florida State Univ., Tallahassee, FL (United States)] [and others
1996-12-31
Very high spin states (I{ge}50{Dirac_h}) have been observed in {sup 155,156,157}Dy. The long regular band sequences, free from sharp backbending effects, observed in these dysprosium nuclei offer the possibility of investigating the occurence of any {Delta}I = 2 staggering in normal deformed nuclei. Employing the same analysis techniques as used in superdeformed nuclei, certain bands do indeed demonstrate an apparent staggering and this is discussed.
Resonance ionization spectroscopy in dysprosium
Energy Technology Data Exchange (ETDEWEB)
Studer, D., E-mail: dstuder@uni-mainz.de; Dyrauf, P.; Naubereit, P.; Heinke, R.; Wendt, K. [Johannes Gutenberg-Universität Mainz, Institut für Physik (Germany)
2017-11-15
We report on resonance ionization spectroscopy (RIS) of high-lying energy levels in dysprosium. We developed efficient excitation schemes and re-determined the first ionization potential (IP) via analysis of Rydberg convergences. For this purpose both two- and three-step excitation ladders were investigated. An overall ionization efficiency of 25(4) % could be demonstrated in the RISIKO mass separator of Mainz University, using a three-step resonance ionization scheme. Moreover, an extensive analysis of the even-parity 6sns- and 6snd-Rydberg-series convergences, measured via two-step excitation was performed. To account for strong perturbations in the observed s-series, the approach of multichannel quantum defect theory (MQDT) was applied. Considering all individual series limits we extracted an IP-value of 47901.76(5) cm{sup −1}, which agrees with the current literature value of 47901.7(6) cm{sup −1}, but is one order of magnitude more precise.
46 CFR 168.15-10 - Construction.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Construction. 168.15-10 Section 168.15-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL VESSELS Accommodations § 168.15-10 Construction. (a) The accommodations provided must be securely constructed, properly...
2010-07-01
... 32 National Defense 1 2010-07-01 2010-07-01 false Definition. 168a.3 Section 168a.3 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE DEFENSE CONTRACTING NATIONAL DEFENSE SCIENCE AND ENGINEERING GRADUATE FELLOWSHIPS § 168a.3 Definition. Sponsoring Agency. A DoD Component or an...
25 CFR 168.14 - Livestock trespass.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Livestock trespass. 168.14 Section 168.14 Indians BUREAU... PARTITIONED LANDS AREA § 168.14 Livestock trespass. The owner of any livestock grazing in trespass on the Hopi... Hopi Partitioned Lands of any livestock without an approved grazing or crossing permit; (b) Allowing...
28 CFR 16.8 - Business information.
2010-07-01
... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Business information. 16.8 Section 16.8... Procedures for Disclosure of Records Under the Freedom of Information Act § 16.8 Business information. (a) In general. Business information obtained by the Department from a submitter will be disclosed under the FOIA...
21 CFR 168.111 - Dextrose monohydrate.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dextrose monohydrate. 168.111 Section 168.111 Food... Table Sirups § 168.111 Dextrose monohydrate. (a) Dextrose monohydrate is purified and crystallized D.../mass (m/m), and the reducing sugar content (dextrose equivalent), expressed as D-glucose, is not less...
International Nuclear Information System (INIS)
Anbu, M.; Prasada Rao, T.; Iyer, C. S. P.; Damodaran, A. D.
1996-01-01
High purity individual rare earth oxides are increasingly used as major components in lasers (Y 2 O 3 ), phosphors (YVO 3 , Eu 2 O 3 ), magnetic bubble memory films (Gd 2 O 3 ) and refractive-index lenses and fibre optics (La 2 O 3 ). The determination of individual lanthanides in high purity rare earth oxides is a more important and difficult task. This paper reports the utilization of higher order derivative spectrophotometry for the simultaneous determination of dysprosium, holmium and erbium in high purity rare earth oxides. The developed procedure is simple, reliable and allows the determination of 0.001 to 0.2% of dysprosium, holmium and erbium in several rare earth. (author). 9 refs, 2 figs, 2 tabs
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Maple sirup. 168.140 Section 168.140 Food and... § 168.140 Maple sirup. (a) Maple sirup is the liquid food derived by concentration and heat treatment of the sap of the maple tree (Acer) or by solution in water of maple sugar (mapel concrete) made from...
21 CFR 168.110 - Dextrose anhydrous.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dextrose anhydrous. 168.110 Section 168.110 Food... Table Sirups § 168.110 Dextrose anhydrous. (a) Dextrose anhydrous is purified and crystallized D-glucose... solids content is not less than 98.0 percent m/m. (b) The name of the food is “Dextrose anhydrous” or...
Terbium and dysprosium complexes luminescence at low temperatures
Energy Technology Data Exchange (ETDEWEB)
Meshkova, S B; Kravchenko, T B; Kononenko, L.I.; Poluehktov, N S [AN Ukrainskoj SSR, Odessa. Fiziko-Khimicheskij Inst.
1979-01-01
The variation is studied of the luminescence intensity of terbium and dysprosium complexes used in the analysis as solutions are cooled down to the liquid nitrogen temperature. Three groups of methods have been studied: observation of fluorescence of aqueous solutions, precipitate and extract suspensions in organic solvents. The brightest luminescence and greatest increase in luminescence intensity are observed at freezing of complex solvents with 1,2-dioxybenzene-3,5-disulfonic acid (DBSA) and iminodiacetic acid (IDA) and DBSA+EDTA, as well as in the case of benzene extracting of complexes with phenanthroline and salicylic acid. Otherwise the intensity increases 2-14-fold and for the complex of terbium with acetoacetic ester 36-fold.
A model for additive transport in metal halide lamps containing mercury and dysprosium tri-iodide
Beks, M.L.; Haverlag, M.; Mullen, van der J.J.A.M.
2008-01-01
The distribution of additives in a metal halide lamp is examined through numerical modelling. A model for a lamp containing sodium iodide additives has been modified to study a discharge containing dysprosium tri-iodide salts. To study the complex chemistry the method of Gibbs minimization is used
International Nuclear Information System (INIS)
Pillay, A.E.; Mboweni, R.C.M.
1990-01-01
A novel aspect of activation analysis is described for the determination of dysprosium and holmium at low concentrations. The method involves the measurement of K x-rays from radionuclides produced by thermal neutron activation using a 1 mg 252 Cf source. The basis for elemental selection depends largely on the demand for analysis and on the existence of favourable nuclear properties for the production of a practicable x-ray yield. A full appraisal of the analytical potential of the method is presented with particular emphasis on its application to geological matrices. The sensitivity was optimised by employing a detector that was particularly effective at photon energies below 150 keV. Analytical conditions are demonstrated for the elements of interest over a wide range of concentrations in small powdered samples. The investigation formed the basis of a feasibility study to establish if the application could be developed for the routine off-line determination of dysprosium and holmium using an isotopic-neutron source. (author)
7 CFR 3015.168 - Disposal of equipment.
2010-01-01
..., DEPARTMENT OF AGRICULTURE UNIFORM FEDERAL ASSISTANCE REGULATIONS Property § 3015.168 Disposal of equipment. When original or replacement equipment is no longer to be used in projects or programs currently or... 7 Agriculture 15 2010-01-01 2010-01-01 false Disposal of equipment. 3015.168 Section 3015.168...
32 CFR 644.168 - Exercise of options.
2010-07-01
... 32 National Defense 4 2010-07-01 2010-07-01 true Exercise of options. 644.168 Section 644.168... ESTATE HANDBOOK Acquisition Procurement of Options Prior to Real Estate Directives (military) § 644.168 Exercise of options. Upon issuance of a real estate directive for acquisition of the optioned real property...
Prognostic impact of CD168 expression in gastric cancer
International Nuclear Information System (INIS)
Ishigami, Sumiya; Yoshiaki, Kita; Kijima, Yuko; Kitazono, Masaki; Natsugoe, Shoji; Ueno, Shinichi; Nishizono, Yuka; Matsumoto, Masataka; Kurahara, Hiroshi; Arigami, Takaaki; Uchikado, Yasuto; Setoyama, Tetsuro; Arima, Hideo
2011-01-01
Interactions of stromal hyaluronic acid (HA) with its binding protein RHAMM (receptor for HA-mediated motility) (CD168) have been reported to affect tumor extension and the migration of crucial molecules to promote tumor progression and metastases. Cancerous CD168 expression is correlated with aggressive biological features in several cancers. However, the clinical implications of CD168 positivity in gastric cancer have remained unclear. We examined the CD168 expression of 196 consecutive gastric cancer patients by immunohistochemistry. According to CD168 positivity, the 196 gastric cancer patients were divided into two groups (57 CD168-positive and 139 CD168-negative patients). The correlation between CD168 expression and clinicopathological factors (age, sex, histology, tumor depth, lymph node status, and vessel invasion) was evaluated according to the Japanese Classification of Gastric Carcinoma. Cancerous CD168 expression was detectable in 57 of the 196 tumors (29%). CD168 positivity was significantly correlated with the depth of invasion, nodal involvement, and vessel invasion (p < 0.01). Survival analysis of the 196 gastric cancer patients showed that the CD168-positive group had a significantly higher mortality than the CD168-negative group (p < 0.01). In terms of a correlation with CD168 positivity at separate clinical stages, a significance difference was only found in stages II and III. Multivariate analysis revealed that CD168 expression was a significant independent prognostic marker (p = 0.013) after depth of invasion (p < 0.005) and nodal involvement (p < 0.01). Our results suggest that cancerous CD168 positivity is strongly related to the invasion and metastasis of gastric cancer tumors. These results suggest that cancerous CD168 expression can be used as a prognostic marker of gastric cancer owing to its interactions with stromal hyaluronic acid
10 CFR 26.168 - Blind performance testing.
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Blind performance testing. 26.168 Section 26.168 Energy... and Human Services § 26.168 Blind performance testing. (a) Each licensee and other entity shall submit blind performance test samples to the HHS-certified laboratory. (1) During the initial 90-day period of...
International Nuclear Information System (INIS)
Ortega, Claudia; Cerutti, Soledad; Silva, Maria F.; Olsina, Roberto A.; Martinez, Luis D.
2003-01-01
An on-line dysprosium preconcentration and determination system based on the hyphenation of cloud point extraction (CPE) to flow injection analysis (FIA) associated with ICP-OES was studied. For the preconcentration of dysprosium, a Dy(III)-2-(5-bromo-2-pyridylazo)-5-diethylaminophenol complex was formed on-line at pH 9.22 in the presence of nonionic micelles of PONPE-7.5. The micellar system containing the complex was thermostated at 30 C in order to promote phase separation, and the surfactant-rich phase was retained in a microcolumn packed with cotton at pH 9.2. The surfactant-rich phase was eluted with 4 mol L -1 nitric acid at a flow rate of 1.5 mL min -1 , directly in the nebulizer of the plasma. An enhancement factor of 50 was obtained for the preconcentration of 50 mL of sample solution. The detection limit value for the preconcentration of 50 mL of aqueous solution of Dy was 0.03 μg L -1 . The precision for 10 replicate determinations at the 2.0 μg L -1 Dy level was 2.2% relative standard deviation (RSD), calculated from the peak heights obtained. The calibration graph using the preconcentration system for dysprosium was linear with a correlation coefficient of 0.9994 at levels near the detection limits up to at least 100 μg L -1 . The method was successfully applied to the determination of dysprosium in urine. (orig.)
25 CFR 168.7 - Kind of livestock.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Kind of livestock. 168.7 Section 168.7 Indians BUREAU OF... LANDS AREA § 168.7 Kind of livestock. Unless determined otherwise by the Area Director for conservation purposes, the Hopi Tribe may determine, subject to the authorized carrying capacity, the kind of livestock...
46 CFR 168.15-35 - Hospital space.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Hospital space. 168.15-35 Section 168.15-35 Shipping... VESSELS Accommodations § 168.15-35 Hospital space. (a) Each vessel must be provided with a hospital space. This space must be situated with due regard for the comfort of the sick so that they may receive proper...
On-line experience with the 168/E
International Nuclear Information System (INIS)
Carroll, J.T.; Brau, J.E.; Maruyama, T.; Parker, D.B.; Chima, J.S.; Price, D.R.; Rankin, P.; Hatley, R.W.
1981-04-01
Current 20 GeV/c photoproduction experiments at the SLAC Hybrid Facility require a decision to take a picture within 150 to 300 μs after the beam pulse. A charged track trigger is provided by a 168/E processor which finds tracks in a downstream PWC system. To meet trigger time requirements the 168/E SNOOP module CAMAC interface is augmented by a CAMAD Auxiliary Controller and dedicated I/0 cards in the 168/E chassis. Between beam pulses a floating point Fortran program executing on a 168/E monitors data acquisition. Experiences with software development and application are reviewed
Incinerator carryover tests with dysprosium as a stand-in for plutonium
International Nuclear Information System (INIS)
Hooker, R.L.
1981-11-01
A full-scale (5 kg/h) incinerator is being tested with nonradioactive feed materials which simulate SRP-generator combustible transuranic wastes. The incinerator is two-stage and is designed to provide relatively quiescent conditions in the primary chamber where the ash is formed. This feature should minimize entrainment of Pu-bearing particles into the off-gas system. A series of runs have been completed in which incinerator feed was spiked with dysprosium to simulate Pu. Carryover of Dy into the off-gas system was found to be low (about 1/4%). 4 figures, 3 tables
42 CFR 423.168 - Accreditation organizations.
2010-10-01
... 42 Public Health 3 2010-10-01 2010-10-01 false Accreditation organizations. 423.168 Section 423.168 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICARE PROGRAM VOLUNTARY MEDICARE PRESCRIPTION DRUG BENEFIT Cost Control and Quality...
40 CFR 68.168 - Five-year accident history.
2010-07-01
... 40 Protection of Environment 15 2010-07-01 2010-07-01 false Five-year accident history. 68.168 Section 68.168 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CHEMICAL ACCIDENT PREVENTION PROVISIONS Risk Management Plan § 68.168 Five-year accident history...
7 CFR 987.168 - Handler records.
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Handler records. 987.168 Section 987.168 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... weight and destination or name and address of the person to whom each shipment was sent; (c) If different...
International Nuclear Information System (INIS)
Daidoji, Hidehiro; Tamura, Shohei
1982-01-01
The determination of yttrium, samarium, and dysprodium by means of graphite-furnace atomic absorption spectrometry (AAS) was studied by a tantalum boat inserted into a graphite tube atomizer. These elements could not be determined by the use of a commercial graphite tube, In the atomization from a tantalum boat, better analytical sensitivities and negligible memory effects for these rare earths are obtained. The analytical sensitivities of yttrium, samarium, and dysprodium with the tantalum boat were 0.60 ng, 0.86 ng, and 0.17 ng respectively. This method was applied for the determination of yttrium, samarium, and dysprosium in a mish metal. The measurements were performed with slightly acidified solutions (0.01 mol dm 3 HCI or HNO 3 ). The sensitivities and the precisions for these elements decreased with increasing acid concentration. An enhancement in the sensitivities of yttrium and dysprosium upon the addition of a large excess of lanthanum, neodymium, and praseodymium salts were observed. The yttrium, samarium, and dysprosium in a mish metal were determined with both analytical curves of standard solutions containing an excess of lanthanum, cerium, and neodymium ions and of the standard addition. The precisions for this work were in the 3 - 9.3% range. (author)
Analysis of the x-ray spectrum emitted by laser-produced plasma of dysprosium
International Nuclear Information System (INIS)
Marcus, Gilad; Louzon, Einat; Henis, Zohar; Maman, Shlomo; Mandelbaum, Pinchas
2007-01-01
A detailed analysis of the x-ray spectrum (5-10.2 A ring ) emitted by laser-produced plasma of dysprosium (Dy) is given using ab initio calculations with the HULLAC relativistic code and isoelectronic trends. Resonance 3d-4p, 3d-nf (n=4 to 7), 3p-4s, and 3p-4d transitions of Ni I-like Dy XXXIX and neighboring ion satellite transitions (from Dy XXXIV to Dy XL) are identified
46 CFR 168.15-45 - Heating and cooling.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Heating and cooling. 168.15-45 Section 168.15-45 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL VESSELS Accommodations § 168.15-45 Heating and cooling. All quarters must be adequately heated and cooled...
46 CFR 168.10-5 - Civilian nautical school.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Civilian nautical school. 168.10-5 Section 168.10-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL VESSELS Definitions of Terms Used in This Part § 168.10-5 Civilian nautical school. The term civilian...
2010-01-01
... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Small issues. 16.8 Section 16.8 Banks and....8 Small issues. (a) The OCC will deem offers and sales of bank issued securities that satisfy the requirements of Commission Regulation A (17 CFR part 230, Regulation A—Conditional Small Issues Exemption) to...
Using the MMPI 168 with Medical Inpatients
Erickson, Richard C.; Freeman, Charles
1976-01-01
Explores the potential utility of the MMPI 168 with two inpatient medical populations. Correlations and clinically relevant comparisons suggest that the MMPI 168 predicted the standard MMPI with a high degree accuracy. (Editor/RK)
Energy Technology Data Exchange (ETDEWEB)
Omar, R. S., E-mail: ratnasuffhiyanni@gmail.com; Wagiran, H., E-mail: husin@utm.my; Saeed, M. A. [Department of Physics, Faculty of Science, Universiti Teknologi Malaysia, 81310 Johor Bahru (Malaysia)
2016-01-22
Thermoluminescence (TL) dosimetric properties of dysprosium doped calcium magnesium borate (CMB:Dy) glass are presented. This study is deemed to understand the application of calcium as the modifier in magnesium borate glass with the presence of dysprosium as the activator to be performed as TL dosimeter (TLD). The study provides fundamental knowledge of a glass system that may lead to perform new TL glass dosimetry application in future research. Calcium magnesium borate glass systems of (70-y) B{sub 2}O{sub 3} − 20 CaO – 10 MgO-(y) Dy{sub 2}O{sub 3} with 0.05 mol % ≤ y ≤ 0.7 mol % of dyprosium were prepared by melt-quenching technique. The amorphous structure and TL properties of the prepared samples were determined using powder X-ray diffraction (XRD) and TL reader; model Harshaw 4500 respectively. The samples were irradiated to Co-60 gamma source at a dose of 50 Gy. Dosimetric properties such as annealing procedure, time temperature profile (TTP) setting, optimization of Dy{sub 2}O{sub 3} concentration of 0.5 mol % were determined for thermoluminescence dosimeter (TLD) reader used.
International Nuclear Information System (INIS)
Khelevina, O.G.; Vojnov, A.A.
1999-01-01
Water-soluble dysprosium tetraazaporphine with acetylacetonate-ion as extraligand is synthesized for the first time. Its kinetic stability in acetic acid solutions is investigated. It is shown that the complex is dissociated with formation of free tetraazaporphine. Kinetic parameters of dissociation reaction are determined [ru
Incorporation of dysprosium ions into PbTiO3 ferroelectric ceramic system
Directory of Open Access Journals (Sweden)
A. Peláiz-Barranco
2015-03-01
Full Text Available A structural analysis concerning the incorporation of dysprosium into A- and/or B-sites of the lead titanate is shown. The two "boundary" refinements are presented, i.e., Dy2+ substitutes for Pb2+ (Dy3+ substitutes for Ti4+ and Dy3+ substitutes for Pb2+ (Dy3+ substitutes for Ti4+. The results offer quantitative information about the incorporation into both crystallographic sites. The increase of Dy3+ fraction into B-site provides the increase of the Ti4+ atomic displacement along the [001] direction and the tetragonal distortion.
Proton NMR relaxivity of blood samples in the presence of some gadolinium and dysprosium compounds
International Nuclear Information System (INIS)
Coroiu, I.; Darabont, Al.; Bogdan, M.
1999-01-01
The use of some new compounds in MRI tissue and blood characterisation based on nuclear spin relaxation time measurements cannot be sustained until the molecular sources of these variations are understood. Tissues and blood are complex molecular systems with complex NMR properties. A better comprehension of the molecular basis of relaxation offers the possibility to predict the changes expected for a given pathology. The purpose of this contribution is to evidence the different relaxation characteristics of some gadolinium and dysprosium compounds in the presence and absence of the blood and to give a possible explanation about the molecular processes that cause occurrence of changes. Some gadolinium and dysprosium compounds such as: Gd-CIT (gadolinium citrate), Dy-DTPA (DTPA-diethylenetriamine pentaacetic acid), iron oxide - gadolinium oxide (or dysprosium oxide)- dextran complexes were prepared. The longitudinal T 1 -1 and transverse T 2 -1 'relaxation rates' measurements have been carried out as a function of molar concentrations. All measurements have been made at room temperature (about 25 deg.C) and the proton Larmor frequency ν o = 90 MHz. The pulsed NMR spectrometer utilised was a commercial Bruker SXP4/100 spectrometer. Transverse relaxation rate measurements have been made using the Carr-Purcell method, while longitudinal relaxation rate measurements using the inversion recovery pulse sequence, 180 angle-τ-90 angle. The accuracy was about 2-3% for the longitudinal relaxation rates and about 5-7% for the transverse relaxation rates. R 1 and R 2 relaxivities, in mM -1 s -1 were determined from the least square determination of the slopes of plots 1/T 1,2 versus compound molar concentration, using at least five independent measurements at several concentrations between 0 and 2 mM. Increased R 2 relaxivity observed for dysprosium compounds in the blood presence can be explained by PRE effect. The largest gain in R 2 relaxivity seems to imply a noncovalent
Does the MMPI-168 exaggerate psychotic pathology?
Dingemans, P. M.; Wekking, E. M.
1996-01-01
Three scoring versions of the MMPI, scored on the same protocol, were compared in a multivariate design with 198 psychiatric patients. The MMPI-168 schizophrenia scale had a statistically higher elevation than the Dutch and American scoring versions. This makes MMPI-168 profiles more often
Energy Technology Data Exchange (ETDEWEB)
Joseph, Aswathy; Praveen, G.L; Abha, K.; Lekha, G.M [Department of Chemistry, University of Kerala, Kariavattom, Kerala 695581 (India); George, Sony, E-mail: emailtosony@gmail.com [Department of Chemistry, University of Kerala, Kariavattom, Kerala 695581 (India)
2012-08-15
An organic dispersion of 9-15 nm size stable dysprosium oxide incorporated zinc oxide nanocomposites exhibiting luminescence in the visible region has been synthesised by a wet chemical precipitation technique at room temperature. Tetraethoxysilane TEOS [(C{sub 2}H{sub 5}O){sub 4}Si], (3-aminopropyl) trimethoxysilane (APTS) and a 1:1 mixture of TEOS-APTS have been used as capping agents to control the particle size as well as to achieve uniform dispersion of composite nanoparticles in methanol medium. X-ray diffractometer (XRD) analysis reveals the formation phase of amino-functionalised colloidal dysprosium oxide incorporated ZnO composite nanoparticles to be of zincite structure. The Transmission Electron Microscopy (TEM) images show that the particles are spheroids in shape, having average crystalline sizes ranging from 9 to 15 nm. The photoluminescence (PL) observed in these composites has been attributed to the presence of near band edge excitonic emission and existence of defect centres. The time correlated single photon counting studies of the composite nanoparticles exhibited three decay pathways. The enhanced PL emission intensity of solid state fluorescence spectra of samples is attributed to the absence of vibrational relaxation process. - Highlights: Black-Right-Pointing-Pointer Nano-composites are synthesised using a one step wet chemical precipitation method. Black-Right-Pointing-Pointer A significant fluorescence life time of 8.25 ns is obtained for the nano-composite. Black-Right-Pointing-Pointer Nano-composite particles exhibited pale yellow fluorescence rather than blue. Black-Right-Pointing-Pointer Vibrational cascade free enhanced fluorescence is obtained for the dry sample.
Bousrez, G; Déchamps, I; Vasse, J-L; Jaroschik, F
2015-05-28
The reduction of titanocene dichloride with dysprosium yields a new titanocene(ii) equivalent without the need for further stabilising ligands. This reagent can be employed in combination with dithioacetals for the olefination of different carbonyl groups and allows for a simplified all-in-one procedure.
Major conformations of the ligand skeleton of a tetranuclear dysprosium (3) tartrate complex
International Nuclear Information System (INIS)
Chevela, V.V.; Semenov, V.Eh.; Bezryadin, S.G.; Savitskaya, T.V.; Kolesar, I.R.; Matveev, S.N.; Shamov, G.A.
1999-01-01
By the molecular mechanics method (MIND program, stoichiometry was studied and basic conformations of ligand frame of dysprosium (3) tetranuclear complex bis-(d-tartrato) bis-(l-tartrato)tetradysprosiate (3) - anion Dy 4 (d-L) 2 (l-L) 2 4- (1) (d-H 4 L = d-tartaric acid, l-H 4 L = l - tartaric acid) were revealed. It is shown that theoretically calculated mP τ constants for so-called compact conformations of 1, where tartratoligands are in gosh conformation, agree with experimentally obtained constant of paramagnetic birefringence (mP e ) of complex 1 [ru
The Use of the MMPI-168 with Delinquent Adolescents.
Lueger, Robert J.
1983-01-01
Compared the standard MMPI and MMPI-168 scores of 90 male delinquent adolescents. Raw score and T-score correlations were high and within acceptable limits, which indicates that MMPI-168 scores are useful with delinquent adolescents. However, two-point codetypes derived from standard MMPIs and MMPI-168s were in agreement less than half the time.…
International Nuclear Information System (INIS)
Nur Ubaidah Saidin; Muhamad Daud; Siti Radiah Mohd Kamarudin
2011-01-01
This report explained the test conducted in salt fog chamber to evaluate the effectiveness of mild steel, coated with rust converter, for 168 hours in artificial seawater exposure. The samples were compared with mild steel coated with commercial primer. The tests were conducted followed ASTM B117. Individual pictures were taken of each sample before the tests began, at 24, 48, 72, 96, 120, 144 and 168 hours to see the progression of the corrosion. Results showed that the samples coated with rust converter provide a good significant protection against corrosion phenomenon than the samples coated with commercial primer that available in the market. (author)
Automated spectrofluorimetric determinations of terbium and dysprosium in rare earth mixtures
Energy Technology Data Exchange (ETDEWEB)
Lyle, S.J.; Za' tar, N. (Kent Univ., Canterbury (UK))
1983-12-01
Several methods involving the use of water-soluble binary and ternary complexes have been proposed for the spectrofluorimetric determination based on terbium(III) emission at 545 nm. These are terbium(III) with (A) ethylenediamine-N,N'-bis(o-hydroxyphenylacetic acid), (B) o-hydroxyphenyliminodiacetic acid, (C) EDTA + 5-sulphosalicylic acid, (D) EDTA + 1,2-dihydroxybenzene-3,5-disulphonic acid disodium salt (Tiron), and (E) iminodiacetic acid (IDA) + Tiron. Two of the reagent mixtures (D and E) can also be used for the fluorimetric determination of dysprosium(III) at 582 nm. A comparison has been made of these methods in order to select the most satisfactory procedure with respect to selectivity, sensitivity and suitability for adaption to automatic operation. Results are given and discussed.
Livebearing or egg-laying mammals: 27 decisive nucleotides of FAM168.
Pramanik, Subrata; Kutzner, Arne; Heese, Klaus
2017-05-23
In the present study, we determine comprehensive molecular phylogenetic relationships of the novel myelin-associated neurite-outgrowth inhibitor (MANI) gene across the entire eukaryotic lineage. Combined computational genomic and proteomic sequence analyses revealed MANI as one of the two members of the novel family with sequence similarity 168 member (FAM168) genes, consisting of FAM168A and FAM168B, having distinct genetic differences that illustrate diversification in its biological function and genetic taxonomy across the phylogenetic tree. Phylogenetic analyses based on coding sequences of these FAM168 genes revealed that they are paralogs and that the earliest emergence of these genes occurred in jawed vertebrates such as Callorhinchus milii. Surprisingly, these two genes are absent in other chordates that have a notochord at some stage in their lives, such as branchiostoma and tunicates. In the context of phylogenetic relationships among eukaryotic species, our results demonstrate the presence of FAM168 orthologs in vertebrates ranging from Callorhinchus milii to Homo sapiens, displaying distinct taxonomic clusters, comprised of fish, amphibians, reptiles, birds, and mammals. Analyses of individual FAM168 exons in our sample provide new insights into the molecular relationships between FAM168A and FAM168B (MANI) on the one hand and livebearing and egg-laying mammals on the other hand, demonstrating that a distinctive intermediate exon 4, comprised of 27 nucleotides, appears suddenly only in FAM168A and there in the livebearing mammals only but is absent from all other species including the egg-laying mammals.
Data acquisition using the 168/E
International Nuclear Information System (INIS)
Carroll, J.T.; Cittolin, S.; Demoulin, M.; Fucci, A.; Martin, B.; Norton, A.; Porte, J.P.; Rossi, P.; Storr, K.M.
1983-03-01
Event sizes and data rates at the CERN anti p p collider compose a formidable environment for a high level trigger. A system using three 168/E processors for experiment UA1 real-time event selection is described. With 168/E data memory expanded to 512K bytes, each processor holds a complete event allowing a FORTRAN trigger algorithm access to data from the entire detector. A smart CAMAC interface reads five Remus branches in parallel transferring one word to the target processor every 0.5 μs. The NORD host computer can simultaneously read an accepted event from another processor
International Nuclear Information System (INIS)
Ye Gangfeng; Nogami, Jun; Crimp, Martin A.
2006-01-01
The microstructure of self-assembled dysprosium silicide nanostructures on silicon(001) has been studied by scanning tunneling microscopy and transmission electron microscopy. The studies focused on nanostructures that involve multiple atomic layers of the silicide. Cross-sectional high resolution transmission electron microscopy images and fast Fourier transform analysis showed that both hexagonal and orthorhombic/tetragonal silicide phases were present. Both the magnitude and the anisotropy of lattice mismatch between the silicide and the substrate play roles in the morphology and epitaxial growth of the nanostructures formed
International Nuclear Information System (INIS)
Sledge, C.B.; Zuckerman, J.D.; Zalutsky, M.R.
1986-01-01
One hundred eight knees of 93 patients with seropositive rheumatoid arthritis and persistent synovitis of the knee were treated with an intraarticular injection of 270 mCi of dysprosium 165 bound to ferric hydroxide macroaggregate. Leakage of radioactivity from the injected joint was minimal. Mean leakage to the venous blood 3 hours after injection was 0.11% of the injected dose; this corresponds to a mean whole body dose of 0.2 rads. Mean leakage to the liver 24 hours after injection was 0.64% of the injected dose; this corresponds to a mean liver dose of 3.2 rads. In 7 additional patients examined, there was negligible or near negligible activity found in the draining inguinal lymph nodes. One-year followup was possible for 74 knees (63 patients). Sixty-one percent of the knees had good results, 23% had fair results, and 16% had poor results. There was a direct correlation between the radiographic stage and response to treatment. In knees with stage I radiographic changes, 72% showed good results; 93% showed improvement. In knees with stage II changes, 59% showed good results; 81% showed improvement. These preliminary results indicate that dysprosium 165-ferric hydroxide macroaggregate is an effective agent for radiation synovectomy. The low leakage rates observed offer a definite advantage over agents previously used
A 168E emulator for off-line production
CERN PhotoLab
1982-01-01
By the end of 1982 seven such processors each with 184 kbyte memory were made available to a few experiments for about 3500 hours of equivalent IBM 370/168 equivalent time, at a cost of about 300 hours of equivalent IBM 370/168 time on the Computer Centre IBM. See Annual Report 1982 p. 81. In front of the computer, Christiane Ball
International Nuclear Information System (INIS)
Santos, D.M.F.; Šljukić, B.; Sequeira, C.A.C.; Macciò, D.; Saccone, A.; Figueiredo, J.L.
2013-01-01
Development of electrocatalytic materials for the hydrogen evolution reaction (HER) is attempted with the aim of reducing the water electrolysis overpotential and increasing its efficiency. Using linear scan voltammetry measurements of the hydrogen discharge enables evaluation of the electrocatalytic activity for the HER of platinum–dysprosium (Pt–Dy) intermetallic alloy electrodes of different compositions. Understanding of materials electrocatalytic performance is based on determination of several crucial kinetic parameters, including the Tafel coefficients, b, charge transfer coefficients, α, exchange current densities, j 0 , and activation energies, E a . Influence of temperature on HER is investigated by performing studies at temperatures ranging from 25 °C to 85 °C. The effect of the Dy amount in the efficiency of the HER on the Pt–Dy alloys is analysed. Results demonstrate that Dy can substantially increase the electrocatalytic activity of the Pt alloys, in comparison to the single Pt electrode. Efforts are made to correlate the microstructure of the alloys with their performance towards the HER. - Highlights: ► Development of electrocatalysts to increase efficiency of electrolytic hydrogen production. ► Synthesis and evaluation of composition and morphology of platinum–dysprosium (Pt–Dy) alloys. ► Hydrogen evolution reaction on Pt–Dy alloys electrodes studied using linear scan voltammetry in alkaline medium. ► Pt–Dy alloy with equiatomic composition enhances kinetics of hydrogen discharge compared to single Pt
Electrochemical behaviour of dysprosium in the eutectic LiCl-KCl at W and Al electrodes
International Nuclear Information System (INIS)
Castrillejo, Y.; Bermejo, M.R.; Barrado, A.I.; Pardo, R.; Barrado, E.; Martinez, A.M.
2005-01-01
The electrochemical behaviour of DyCl 3 was studied in the eutectic LiCl-KCl at different temperatures. The cathodic reaction can be written:Dy(III)+3e-bar Dy(0)which can be divided in two very close cathodic steps:Dy(III)+1e-bar Dy(II)andDy(II)+2e-bar Dy(0)Transient electrochemical techniques, such as cyclic voltammetry, chronopotentiometry, and chronoamperometry were used in order to study the reaction mechanism and the transport parameters of electroactive species at a tungsten electrode. The results showed that in the eutectic LiCl-KCl, electrocrystallization of dysprosium seems to be the controlling electrochemical step. Chronoamperometric studies indicated instantaneous nucleation of dysprosium with three dimensional growth of the nuclei whatever the applied overpotential.Mass transport towards the electrode is a simple diffusion process, and the diffusion coefficient of the electroactive species, i.e. Dy(III), has been calculated. The validity of the Arrhenius law was also verified by plotting the variation of the logarithm of the diffusion coefficient versus 1/T.In addition, the electrode reactions of the LiCl-KCl-DyCl 3 solutions at an Al wire were also investigated by cyclic voltammetry and open circuit chronopotentiometry. The redox potential of the Dy(III)/Dy couple at the Al electrode was observed at more positive potentials values than those at the inert electrode. This potential shift was thermodynamically analyzed by a lowering of activity of Dy in the metal phase due to the formation of intermetallic compounds
β-γ and isomeric decay spectroscopy of 168Dy
Directory of Open Access Journals (Sweden)
Zhang G.X.
2018-01-01
Full Text Available This contribution will report on the experimental work on the level structure of 168Dy. The experimental data have been taken as part of the EURICA decay spectroscopy campaign at RIBF, RIKEN in November 2014. In the experiment, a 238U primary beam is accelerated up to 345 MeV/u with an average intensity of 12 pnA. The nuclei of interest are produced by in-flight fission of 238U impinging on Be target with a thickness of 5 mm. The excited states of 168Dy have been populated through the decay from a newly identified isomeric state and via the β decay from 168Tb. In this contribution, scientific motivations, experimental procedure and some preliminary results for this study are presented.
β-γ and isomeric decay spectroscopy of 168Dy
Zhang, G. X.; Watanabe, H.; Kondev, F. G.; Lane, G. J.; Regan, P. H.; Söderström, P.-A.; Walker, P. M.; Kanaoka, H.; Korkulu, Z.; Lee, P. S.; Liu, J. J.; Nishimura, S.; Wu, J.; Yagi, A.; Ahn, D. S.; Alharbi, T.; Baba, H.; Browne, F.; Bruce, A. M.; Carroll, R. J.; Chae, K. Y.; Dombradi, Zs.; Doornenbal, P.; Estrade, A.; Fukuda, N.; Griffin, C.; Ideguchi, E.; Inabe, N.; Isobe, T.; Kanaya, S.; Kojouharov, I.; Kubo, T.; Kubono, S.; Kurz, N.; Kuti, I.; Lalkovski, S.; Lee, C. S.; Lee, E. J.; Lorusso, G.; Lotay, G.; Moon, C.-B.; Nishizuka, I.; Nita, C. R.; Odahara, A.; Patel, Z.; Phong, V. H.; Podolyák, Zs.; Roberts, O. J.; Sakurai, H.; Schaffner, H.; Shand, C. M.; Shimizu, Y.; Sumikama, T.; Suzuki, H.; Takeda, H.; Terashima, S.; Vajta, Zs.; Valiente-Dóbon, J. J.; Xu, Z. Y.
2018-05-01
This contribution will report on the experimental work on the level structure of 168Dy. The experimental data have been taken as part of the EURICA decay spectroscopy campaign at RIBF, RIKEN in November 2014. In the experiment, a 238U primary beam is accelerated up to 345 MeV/u with an average intensity of 12 pnA. The nuclei of interest are produced by in-flight fission of 238U impinging on Be target with a thickness of 5 mm. The excited states of 168Dy have been populated through the decay from a newly identified isomeric state and via the β decay from 168Tb. In this contribution, scientific motivations, experimental procedure and some preliminary results for this study are presented.
A model for additive transport in metal halide lamps containing mercury and dysprosium tri-iodide
International Nuclear Information System (INIS)
Beks, M L; Haverlag, M; Mullen, J J A M van der
2008-01-01
The distribution of additives in a metal halide lamp is examined through numerical modelling. A model for a lamp containing sodium iodide additives has been modified to study a discharge containing dysprosium tri-iodide salts. To study the complex chemistry the method of Gibbs minimization is used to decide which species have to be taken into account and to fill lookup tables with the chemical composition at different combinations of elemental abundance, lamp pressure and temperature. The results from the model with dysprosium additives were compared with earlier results from the lamp containing sodium additives and a simulation of a pure mercury lamp. It was found that radial segregation creates the conditions required for axial segregation. Radial segregation occurs due to the unequal diffusion of atoms and molecules. Under the right conditions convection currents in the lamp can cause axial demixing. These conditions depend on the ratio of axial convection and radial diffusion as expressed by the Peclet number. At a Peclet number of unity axial segregation is most pronounced. At low Peclet numbers radial segregation is at its worst, while axial segregation is not present. At large Peclet numbers the discharge becomes homogeneously mixed. The degree of axial segregation at a Peclet number of unity depends on the temperature at which the additive under consideration fully dissociates. If the molecules dissociate very close to the walls no molecules are transported by the convective currents in the lamp, and hence axial segregation is limited. If they dissociate further away from the walls in the area where the downward convective currents are strongest, more axial segregation is observed
26 CFR 5c.168(f)(8)-4 - Minimum investment of lessor.
2010-04-01
... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Minimum investment of lessor. 5c.168(f)(8)-4....168(f)(8)-4 Minimum investment of lessor. (a) Minimum investment. Under section 168(f)(8)(B)(ii), an... has a minimum at risk investment which, at the time the property is placed in service under the lease...
Energy Technology Data Exchange (ETDEWEB)
Zhao Di; Yu Jing [Institute of Bioengineering and Information Technology Materials, Center for Advanced Materials and Nano-Biomedicine, Tongji University, Shanghai, 200092 (China); Huang Wenhai, E-mail: whhuang@tongji.edu.cn [Institute of Bioengineering and Information Technology Materials, Center for Advanced Materials and Nano-Biomedicine, Tongji University, Shanghai, 200092 (China); Zhou Nai; Wang Deping [Institute of Bioengineering and Information Technology Materials, Center for Advanced Materials and Nano-Biomedicine, Tongji University, Shanghai, 200092 (China); Yin Wei [Institute of Isotope Research, Sinitic Academy of Atomic Energy, Beijing 102413 (China); Chen Yaqing [The Sixth People' s Hospital, Shanghai 200233 (China)
2010-08-30
The radioactive dysprosium lithium borate glass (DyLB) microspheres with different glass compositions were prepared for radiation synovectomy. The biodegradability and biocompatibility of these DyLB microspheres were evaluated in vitro and in vivo. The DyLB microspheres studied in this work were partially biodegradable in a simulated body fluid (SBF), with the final weight loss of the microspheres in the range of 24.6% and 55.0% (wt.%) after 8 days of immersion. The ICP results revealed that the dissolution of lithium significantly decreased from 100% to 53.7% with increasing content of Dy{sub 2}O{sub 3} in the microspheres from 18% to 22% (wt.%, from S-1 to S-3). However, for all of the three samples, nearly all of the dysprosium (> 99.997%, wt.%) remained in the microspheres, in the form of insoluble phosphates and carbonates, which was proved by the SEM and EDX analyses. The degradation of DyLB microspheres in SBF gradually decreased with immersion time and eventually reached equilibrium after 7 days of immersion. Compared to the other two samples, the S-3 sample with the lowest Dy{sup 3+} dissolution (about 0.002%) was considered more secure for clinical application. Furthermore, the S-3 DyLB microspheres exhibited good biocompatibility, since neither tissue damage nor inflammation was observed, after they were implanted in the liver of rat for two weeks. After neutron activation, the radionuclide purity of radioactive S-3 DyLB microspheres was 99.999%, which were suitable for radiation synovectomy.
Lim, Kwang Soo; Baldoví, José J; Jiang, ShangDa; Koo, Bong Ho; Kang, Dong Won; Lee, Woo Ram; Koh, Eui Kwan; Gaita-Ariño, Alejandro; Coronado, Eugenio; Slota, Michael; Bogani, Lapo; Hong, Chang Seop
2017-05-01
Controlling the coordination sphere of lanthanoid complexes is a challenging critical step toward controlling their relaxation properties. Here we present the synthesis of hexacoordinated dysprosium single-molecule magnets, where tripodal ligands achieve a near-perfect octahedral coordination. We perform a complete experimental and theoretical investigation of their magnetic properties, including a full single-crystal magnetic anisotropy analysis. The combination of electrostatic and crystal-field computational tools (SIMPRE and CONDON codes) allows us to explain the static behavior of these systems in detail.
Kinetics of the nitridation of dysprosium during mechanochemical processing
Energy Technology Data Exchange (ETDEWEB)
Alanko, Gordon A.; Osterberg, Daniel D.; Jaques, Brian J. [Department of Materials Science and Engineering, College of Engineering, Boise State University, 1910 University Drive, Boise, ID 83725 (United States); Hurley, Michael F. [Department of Materials Science and Engineering, College of Engineering, Boise State University, 1910 University Drive, Boise, ID 83725 (United States); Center for Advanced Energy Studies, 995 University Boulevard, Idaho Falls, ID 83401 (United States); Butt, Darryl P., E-mail: darrylbutt@boisestate.edu [Department of Materials Science and Engineering, College of Engineering, Boise State University, 1910 University Drive, Boise, ID 83725 (United States); Center for Advanced Energy Studies, 995 University Boulevard, Idaho Falls, ID 83401 (United States)
2015-01-25
Highlights: • DyN was mechanochemically synthesized by milling pure metal under nitrogen. • Temperature and pressure were monitored to investigate reaction progress. • The effects of metal adhered to media on the impact energetics was measured. • The reactive milling kinetics are described in terms of reactive surface formation. - Abstract: Dysprosium nitride was synthesized by the reactive milling of the rare earth metal under 400 kPa nitrogen gas in a planetary ball mill. The nitrogen consumption rate was calculated from in situ temperature and pressure measurements to find the reaction extent as a function of milling time at milling speeds from 350 to 650 rpm. The results are analyzed in terms of a fundamental milling dynamics model in which the input milling energy is the primary driving force for reaction and the rate limiting step of the nitridation kinetics is the formation of chemically active surfaces. The model differs from traditional gas–solid reactions which are often limited by diffusion of a species through a surface layer or by dissociation of the gas molecule. These results give fresh insight into reactive gas–solid milling kinetics.
25 CFR 168.16 - Impoundment and disposal of unauthorized livestock.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Impoundment and disposal of unauthorized livestock. 168... REGULATIONS FOR THE HOPI PARTITIONED LANDS AREA § 168.16 Impoundment and disposal of unauthorized livestock. Unauthorized livestock within any range unit of the Hopi Partitioned Lands which are not removed therefrom...
25 CFR 168.15 - Control of livestock diseases and parasites.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Control of livestock diseases and parasites. 168.15... REGULATIONS FOR THE HOPI PARTITIONED LANDS AREA § 168.15 Control of livestock diseases and parasites. Whenever... parasites or have been exposed thereto, such livestock must be treated and the movement thereof restricted...
Self-organized dysprosium-directed alginate hydrogels and its chemical features
Energy Technology Data Exchange (ETDEWEB)
Ma, Qianmin [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Gao, Jinwei [Institute for Advanced Materials, Academy of Advanced Optoelectronics, South China Normal University, Guangzhou 510006 (China); Peng, Huojun [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Qianming, E-mail: qmwang@scnu.edu.cn [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Guangzhou Key Laboratory of Materials for Energy Conversion and Storage, Guangzhou 510006 (China)
2016-09-15
Rational use of self-organized materials may contribute in developing new structures and devices in practical technology. Synthetic metallo-supramolecular gels are generally designed with transitional metal-directed process. However, the assembly of both lanthanide and sodium alginate in macromolecular systems would find a new way of utilizing its physical properties. The stimuli-responsive molecule (alginate) could firmly form stable hydrogels upon the encapsulation of dysprosium ions. In addition, the immobilization of YVO{sub 4}: Eu{sup 3+} nanoparticle in the soft matrix has been achieved and it has never been explored in the fabrication of phosphor-incorporated luminescent alginate gels. The key feature of the present soft matter is that its red emission could be switched off in the presence of sodium ascorbate and the results may have a tremendous impact on the extension of photophysical application based on soft nanoscale devices. - Highlights: • Dy{sup 3+} can be used for the gelation of the dissolved alginate. • Lanthanide hydrogels could exhibit red emissions under excitations. • Luminescence could be switched “off” in the presence of sodium ascorbate.
SNOOP module CAMAC interface to the 168/E microprocessor
International Nuclear Information System (INIS)
Bernstein, D.; Carroll, J.T.; Mitnick, V.H.; Paffrath, L.; Parker, D.B.
1979-10-01
A pair of 168/E microprocessors will be used to meet the realtime computing requirements of the SLAC Hybrid Facility. A SNOOP module and 168/E Interface provide the link between the host computer and the microprocessors. By eavesdropping on normal CAMAC read operations, the SNOOP provides a direct data transfer from CAMAC to microprocessor memory. The host computer controls the processors using standard CAMAC programmed I/O to the SNOOP
Lifescience Database Archive (English)
Full Text Available TAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAAXXXXXXXXXXAATGTCCANATTTCCATANATGTGT...>SFG168Z.Seq ----------AATGTCCANATTTCCATANATGTGTTNAAANACGTGGTGGTATNTTAAGN TGTGAATTTNANCCNCCAAGACAACCAAGATCCC...GTAAAATCAATTTGTAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAA----------AATGTCCANATTTCCATANATGTGTTNAA ANACGTGG
26 CFR 1.168(h)-1 - Like-kind exchanges involving tax-exempt use property.
2010-04-01
... property. 1.168(h)-1 Section 1.168(h)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... and Corporations § 1.168(h)-1 Like-kind exchanges involving tax-exempt use property. (a) Scope. (1... property (as defined in section 168(h)) at the time of the transfer; and (ii) Property that does not become...
29 CFR 4.168 - Wage payments-deductions from wages paid.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Wage payments-deductions from wages paid. 4.168 Section 4... Standards Compliance with Compensation Standards § 4.168 Wage payments—deductions from wages paid. (a) The wage requirements of the Act will not be met where unauthorized deductions, rebates, or refunds reduce...
Hart, Matthew
This paper develops scenarios of future rare-earth-magnet metal (neodymium, dysprosium, terbium, and praseodymium) consumption in the permanent magnets used in wind turbines and hybrid electric vehicles. The scenarios start with naive base-case scenarios for growth in wind-turbine and hybrid-electric-vehicle sales over the period 2011 to 2020, using historical data for each good. These naive scenarios assume that future growth follows time trends in historical data and does not depend on any exogenous variable. Specifically, growth of each technological market follows historical time trends, and the amount of rare earths used per unit of technology remains fixed. The chosen reference year is 2010. Implied consumptions of the rare earth magnet metals are calculated from these scenarios. Assumptions are made for the material composition of permanent magnets, the market share of permanent-magnet wind turbines and vehicles, and magnet weight per unit of technology. Different scenarios estimate how changes in factors like the material composition of magnets, growth of the economy, and the price of a substitute could affect future consumption. Each scenario presents a different method for reducing rare earth consumption and could be interpreted as potential policy choices. In 2010, the consumption (metric tons, rare-earth-oxide equivalent) of each rare-earth-magnet metal was as follows. Total neodymium consumption in the world for both technologies was 995 tons; dysprosium consumption was 133 tons; terbium consumption was 50 tons; praseodymium consumption was zero tons. The base scenario for wind turbines shows there could be strong, exponential growth in the global wind turbine market. New U.S. sales of hybrid vehicles would decline (in line with the current economic recession) while non-U.S. sales increase through 2020. There would be an overall increase in the total amount of magnetic rare earths consumed in the world. Total consumption of each rare earth in the short
Watt-level dysprosium fiber laser at 315 μm with 73% slope efficiency
Woodward, R. I.; Majewski, M. R.; Bharathan, G.; Hudson, D. D.; Fuerbach, A.; Jackson, S. D.
2018-04-01
Rare-earth-doped fiber lasers are emerging as promising high-power mid-infrared sources for the 2.6-3.0 {\\mu}m and 3.3-3.8 {\\mu}m regions based on erbium and holmium ions. The intermediate wavelength range, however, remains vastly underserved, despite prospects for important manufacturing and defense applications. Here, we demonstrate the potential of dysprosium-doped fiber to solve this problem, with a simple in-band pumped grating-stabilized linear cavity generating up to 1.06 W at 3.15 {\\mu}m. A slope efficiency of 73% with respect to launched power (77% relative to absorbed power) is achieved: the highest value for any mid-infrared fiber laser to date, to the best of our knowledge. Opportunities for further power and efficiency scaling are also discussed.
Energy Technology Data Exchange (ETDEWEB)
Elwert, Tobias; Schwarz, Sabrina; Goldmann, Daniel [TU Clausthal, Clausthal-Zellerfeld (Germany). Lehrstuhl fuer Rohstoffaufbereitung und Recycling
2016-01-15
The aim of this study was to investigate the applicability of three organophosphorus acid derivates (D2EHPA, EHEHPA and Cyanex 572) for the separation of terbium and dysprosium from praseodymium and neodymium from NdFeB magnets in chloride solution. A special focus was put on the effect of phase modifiers. The investigations revealed that all extractants show in general a similar extraction behavior but the extraction is shifted to higher pH values in the order D2EHPA < EHEHPA < Cyanex 572. Therefore, and due to higher realizable loadings, EHEHPA and Cyanex 572 are more suitable for the investigated separation problem than D2EHPA. Whereas EHEHPA requires 1-decanol as phase modifier, Cyanex 572 can be employed without modifier addition.
International Nuclear Information System (INIS)
Grigoletto, T.; Lordello, A.R.
1984-01-01
A spectrographic method is described for the quantitative determination of dysprosium in doped crystals of calcium sulphate. The consequences of the changes in some parameters of the excitation conditions, such as arc current, electrode type and total or partial burning of sample, in the analytical results are discussed. Matrix effects are investigated. Variations in the intensity of the spectral lines are verified by recording the spectrum in distinct photographic plates. The role of internal standard in analytical reproducibility and in counterbalance of the variations in the arc current and in the weight of sample is studied. Accuracy is estimated by comparative analysis of two calcium sulphate samples by X-Ray Fluorescence, Neutron Activation and Inductive Coupled Plasma Emission Spectroscopy. (M.A.C.) [pt
Centrifugal stretching along the ground state band of 168Hf
International Nuclear Information System (INIS)
Costin, A.; Pietralla, N.; Reese, M.; Moeller, O.; Ai, H.; Casten, R. F.; Heinz, A.; McCutchan, E. A.; Meyer, D. A.; Qian, J.; Werner, V.; Dusling, K.; Fitzpatrick, C. R.; Guerdal, G.; Petkov, P.; Rainovski, G.
2009-01-01
The lifetimes of the J π =4 + , 6 + , 8 + , and 10 + levels along the ground state band in 168 Hf were measured by means of the recoil distance Doppler shift (RDDS) method using the New Yale Plunger Device (NYPD) and the SPEEDY detection array at Wright Nuclear Structure Laboratory of Yale University. Excited states in 168 Hf were populated using the 124 Sn( 48 Ti,4n) fusion evaporation reaction. The new lifetime values are sufficiently precise to clearly prove the increase of quadrupole deformation as a function of angular momentum in the deformed nucleus 168 Hf. The data agree with the predictions from the geometrical confined β-soft (CBS) rotor model that involves centrifugal stretching in a soft potential
40 CFR 35.168 - Award limitations.
2010-07-01
... STATE AND LOCAL ASSISTANCE Environmental Program Grants Water Pollution Control (section 106) § 35.168...) The State monitors and compiles, analyzes, and reports water quality data as described in section 106... October 18, 1972, a summary report of the current status of the State pollution control program, including...
Akiyama, Y.; Heyde, K.; Arima, A.; Yoshinaga, N.
1986-05-01
Extending the interacting boson model by incorporating besides s and d, also the g-boson, we can describe the population of positive parity states of 168Er in the 166Er(t,P) 168Er reaction rather well. In particular, the excitation of I,Kπi = 4,3 +1; 2,2 +2; 0,0 +3 and 0,0 +4 states is much improved over the sd-IBM approach.
42 CFR 460.168 - Reinstatement in other Medicare and Medicaid programs.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Reinstatement in other Medicare and Medicaid programs. 460.168 Section 460.168 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF... Reinstatement in other Medicare and Medicaid programs. To facilitate a participant's reinstatement in other...
Low Field Magnetic and Thermal Hysteresis in Antiferromagnetic Dysprosium
Directory of Open Access Journals (Sweden)
Iuliia Liubimova
2017-06-01
Full Text Available Magnetic and thermal hysteresis (difference in magnetic properties on cooling and heating have been studied in polycrystalline Dy (dysprosium between 80 and 250 K using measurements of the reversible Villari effect and alternating current (AC susceptibility. We argue that measurement of the reversible Villari effect in the antiferromagnetic phase is a more sensitive method to detect magnetic hysteresis than the registration of conventional B(H loops. We found that the Villari point, recently reported in the antiferromagnetic phase of Dy at 166 K, controls the essential features of magnetic hysteresis and AC susceptibility on heating from the ferromagnetic state: (i thermal hysteresis in AC susceptibility and in the reversible Villari effect disappears abruptly at the temperature of the Villari point; (ii the imaginary part of AC susceptibility is strongly frequency dependent, but only up to the temperature of the Villari point; (iii the imaginary part of the susceptibility drops sharply also at the Villari point. We attribute these effects observed at the Villari point to the disappearance of the residual ferromagnetic phase. The strong influence of the Villari point on several magnetic properties allows this temperature to be ranked almost as important as the Curie and Néel temperatures in Dy and likely also for other rare earth elements and their alloys.
The liquid membrane for extraction of Yttrium and Dysprosium from Acid Nitric
International Nuclear Information System (INIS)
Johny, W.S.; Raldi-Artono-Koestoer; Kris-Tri-Basuki; Sudibyo
1996-01-01
The determination of surfactant in liquid membrane has been done. The surfactant is span-80 (sorbitol-monooleate), the liquid membrane phase was the organic phase (O), the internal liquid phase (W) with ratio O/W = 1, and surfactant. The organic phase using D 2 EHPA in the kerosene and the internal liquid phase using aqua des or acid nitric. The determination of surfactant with variation of span-80 (0,25 - 2%) in the liquid membrane volume. The speed of stirrer was 3500 rpm in 20 minute. The ratio of liquid membrane phase form and external phase (aqua des or acid nitric) was 1, the speed of stirrer was 350 rpm in 10 minute (permeation process). The liquid phase and the liquid membrane phase was separated and then determinated the volume of liquid membrane, the result of percentage of span-80 was 0,25 % volume. The extraction of yttrium and dysprosium in 2 M HNO 3 was Kd y = 2.945 and Kd D y = 0.019
Clinical and Biological Manifestation of RNF168 Deficiency in Two Polish Siblings
Directory of Open Access Journals (Sweden)
Barbara Pietrucha
2017-12-01
Full Text Available Germline mutations in the RING finger protein gene RNF168 have been identified in a combined immunodeficiency disorder called RIDDLE syndrome. Since only two patients have been described with somewhat different phenotypes, there is need to identify further patients. Here, we report on two Polish siblings with RNF168 deficiency due to homozygosity for a novel frameshift mutation, c.295delG, that was identified through exome sequencing. Both patients presented with immunoglobulin deficiency, telangiectasia, cellular radiosensitivity, and increased alpha-fetoprotein (AFP levels. The younger sibling had a more pronounced neurological and morphological phenotype, and she also carried an ATM gene mutation in the heterozygous state. Immunoblot analyses showed absence of RNF168 protein, whereas ATM levels and function were proficient in lymphoblastoid cells from both patients. Consistent with the absence of RNF168 protein, 53BP1 recruitment to DNA double-strand breaks (DSBs after irradiation was undetectable in lymphoblasts or primary fibroblasts from either of the two patients. γH2AX foci accumulated normally but they disappeared with significant delay, indicating a severe defect in DSB repair. A comparison with the two previously identified patients indicates immunoglobulin deficiency, cellular radiosensitivity, and increased AFP levels as hallmarks of RNF168 deficiency. The variability in its clinical expression despite similar cellular phenotypes suggests that some manifestations of RNF168 deficiency may be modified by additional genetic or epidemiological factors.
International Nuclear Information System (INIS)
Gómez-Ros, J.M.; Bedogni, R.; Palermo, I.; Esposito, A.; Delgado, A.; Angelone, M.; Pillon, M.
2011-01-01
This communication describes a photon insensitive passive neutron spectrometer consisting of Dysprosium (Dy) activation foils located along three perpendicular axes within a single moderating polyethylene sphere. The Monte Carlo code MCNPX 2.6 was used to optimize the spatial arrangement of the detectors and to derive the spectrometer response matrix. Nearly isotropic response in terms of neutron fluence for energies up to 20 MeV was obtained by combining the readings of the detectors located at the same radius value. The spectrometer was calibrated using a previously characterized 14 MeV neutron beam produced in the ENEA Frascati Neutron Generator (FNG). The overall uncertainty of the spectrometer response matrix at 14 MeV, assessed on the basis of this experiment, was ±3%.
9 CFR 381.168 - Maximum percent of skin in certain poultry products.
2010-01-01
... poultry products. 381.168 Section 381.168 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and...
Energy Technology Data Exchange (ETDEWEB)
Page, R.H.; Schaffers, K.I.; Payne, S.A.; Krupke, W.F.; Beach, R.J.
1997-12-02
Dysprosium-doped metal chloride materials offer laser properties advantageous for use as optical amplifiers in the 1.3 {micro}m telecommunications fiber optic network. The upper laser level is characterized by a millisecond lifetime, the host material possesses a moderately low refractive index, and the gain peak occurs near 1.31 {micro}m. Related halide materials, including bromides and iodides, are also useful. The Dy{sup 3+}-doped metal chlorides can be pumped with laser diodes and yield 1.3 {micro}m signal gain levels significantly beyond those currently available. 9 figs.
Energy Technology Data Exchange (ETDEWEB)
Page, Ralph H. (San Ramon, CA); Schaffers, Kathleen I. (Pleasanton, CA); Payne, Stephen A. (Castro Valley, CA); Krupke, William F. (Pleasanton, CA); Beach, Raymond J. (Livermore, CA)
1997-01-01
Dysprosium-doped metal chloride materials offer laser properties advantageous for use as optical amplifiers in the 1.3 .mu.m telecommunications fiber optic network. The upper laser level is characterized by a millisecond lifetime, the host material possesses a moderately low refractive index, and the gain peak occurs near 1.31 .mu.m. Related halide materials, including bromides and iodides, are also useful. The Dy.sup.3+ -doped metal chlorides can be pumped with laser diodes and yield 1.3 .mu.m signal gain levels significantly beyond those currently available.
International Nuclear Information System (INIS)
Yadav, Kartikey K.; Singh, D.K.; Kain, V.
2017-01-01
Rare earth elements (REEs) are a basic requirement of the electronics and new industries including green technology. In the present work an organophosphoric extractant encapsulating polyethersulfone (PES) beads has been developed and employed for dysprosium (Dy) separation from aqueous stream. Polyethersulfonic beads encapsulating PC88A were prepared by phase inversion method. During the synthesis of the beads, preparatory parameters were also optimized to obtain best suited beads which were subsequently characterized for their encapsulation capacity and micro structural investigation. The results obtained in the present investigation suggested that PES/PVAJPC88A composite beads could be used for separation of rare earths from aqueous medium obtained from the solubilisation of magnetic scrap materials
Energy Technology Data Exchange (ETDEWEB)
Gloeser-Chahoud, Simon; Kuehn, Andre; Tercero Espinoza, Luis
2016-06-15
Neodymium-iron-boron magnets (NdFeB) have experienced a significant demand as the most powerful permanent magnet in recent years, especially for the manufacture of compact electric servomotors with high efficiency and high power density, especially for mobile applications in hybrid traction motors and electric vehicles or for electric bikes. However, NdFeB magnets are also increasingly being used in general mechanical engineering (conveying and pumping systems, tools, air conditioning systems, lift motors, etc.), in the small electric motors of conventional passenger cars or in the generators of large wind power plants with permanent magnetic direct drive. Nevertheless, there is still high uncertainty in the use structures of NdFeB magnets and the contained rare earth elements neodymium and dysprosium. An effective instrument for increasing the market transparency and the understanding of complex anthropogenic material cycles is the dynamic material flow modeling. In the present work paper, this instrument is used for an in-depth analysis of the use structures of NdFeB magnets and the contained rare earths on a global scale. The dynamic modeling of product usage cycles reveals today's usage structures and quantifies future magnetic quantities in obsolete product flows. It could be shown that the magnets in today's scrap volume are mainly contained in obsolete electronics applications such as hard disks (HDD), CD and DVD drives, which makes the recycling hardly seem to be economical due to the small magnets and the high material spread, but in the foreseeable future with larger magnetic quantities from synchronous servomotors and generators can be expected, which significantly increases the recycling potential. In a further step, the effect of the diffusion of alternative drives in the automotive market on the dysprosium requirement is analyzed using a system dynamics model and possible adaptation mechanisms in the form of different substitution effects in
Image collection: 168 [Togo Picture Gallery[Archive
Lifescience Database Archive (English)
Full Text Available 168 Choloepus_didactylus_NL.png フタユビナマケモノ Toed sloth Choloepus didactylus 27675 生物アイコン,脊索動物門,脊椎動物亜門,哺乳綱,獣亜綱,真獣下綱
Optical properties of zinc borotellurite glass doped with trivalent dysprosium ion
Ami Hazlin, M. N.; Halimah, M. K.; Muhammad, F. D.; Faznny, M. F.
2017-04-01
The zinc borotellurite doped with dysprosium oxide glass samples with chemical formula {[(TeO2) 0 . 7(B2O3) 0 . 3 ] 0 . 7(ZnO) 0 . 3 } 1 - x(Dy2O3)x (where x=0.01, 0.02, 0.03, 0.04 and 0.05 M fraction) were prepared by using conventional melt quenching technique. The structural and optical properties of the proposed glass systems were characterized by using X-ray diffraction (XRD) spectroscopy, Fourier Transform Infrared (FTIR) spectroscopy, and UV-VIS spectroscopy. The amorphous nature of the glass systems is confirmed by using XRD technique. The infrared spectra of the glass systems indicate three obvious absorption bands which are assigned to BO3 and TeO4 vibrational groups. Based on the absorption spectra obtained, the direct and indirect optical band gaps, as well as the Urbach energy were calculated. It is observed that both the direct and indirect optical band gaps increase with the concentration of Dy3+ ions. On the other hand, the Urbach energy is observed to decrease as the concentration of Dy3+ ions increases.
Spectrographic determination of dysprosium dopant in calcium sulphate used as dosimetric material
International Nuclear Information System (INIS)
Grigoletto, T.
1982-01-01
A spectrographic method is described for the quantitative determination of dysprosium in doped crystals of calcium sulphate. The consequences of the changes in some parameters of the excitation conditions, such as arc current, electrode type and total or partial burning of sample, in the analytical results are discussed. Matrix effects are investigated by comparison among analytical curves obtained from three different methods of standard preparations. Variations in the intensity of the spectral lines are verificated by recording the spectrum in distinct photographic plates (SA-1). The role of internal standard in analytical reproducibility and in counterbalance of the variations in the arc current and in the weight of sample are studied. The great similarity in excitation behavior of many of the rare earths is used to provide a high degree of internal standardization. Precision studies show a standard deviation of about + - 2,4 percent by use of lanthanum as an internal standard. Accuracy is estimate by comparative analysis of two calcium sulphate samples by X-Rays Fluorescence, Neutron Activation and Inductive Coupled Plasma (ICP) Emission Spectroscopy. (Author) [pt
27 CFR 24.168 - Identification of tanks.
2010-04-01
..., DEPARTMENT OF THE TREASURY LIQUORS WINE Construction and Equipment § 24.168 Identification of tanks. (a) General. Each tank, barrel, puncheon, or similar bulk container, used to ferment wine or used to process or store wine, spirits, or wine making materials will have the contents marked and will be marked as...
International Nuclear Information System (INIS)
Chadderton, L.T.; Johnson, E.
1977-01-01
Despite continuing improvements in applications of the analytical method of Rutherford backscattering (RBS) to solid state physics it is recognized that more complete information can be obtained if other techniques - for example transmission electron microscopy (TEM) - are employed simultaneously. Experiments are described in which a combined RBS and TEM study of the annealing of nickel, rendered amorphous by implantation of 20 keV dysprosium ions is supplemented with a completely new technique - total current spectroscopy (TCS). In TCS low energy electrons (0-15 eV) are used to probe the damaged nickel. Observations have been made during annealing of both the reappearance of the bulk band structure of the metal and of a 'surface peak' which is highly sensitive to the recovery process. Changes in the height of the surface peak reveal three sharp annealing stages, the first two being preceded by reverse annealing which correlates well with RBS and TEM results. The first annealing stage - following the amorphous to crystalline transition - may be associated with electronic effects in the vicinity of the Curie point. Changes in the position of the surface peak allow one to trace the diffusion of dysprosium to the surface. Quantum mechanical resonances at the damage/crystal interface have also been followed throughout annealing. The initially amorphous layer (approximately 2.2nm) increases in thickness slightly during recovery. (Auth.)
Energy Technology Data Exchange (ETDEWEB)
Akiyama, Y.; Heyde, K.; Arima, A.; Yoshinaga, N.
1986-05-29
Extending the interacting boson model by incorporating besides s and d, also the g-boson, we can describe the population of positive parity states of /sup 168/Er in the /sup 166/Er(t,P)/sup 168/Er reaction rather well. In particular, the excitation of I,Ksub(i)sup(..pi..) = 4,3/sub 1//sup +/; 2,2/sub 2//sup +/; 0,0/sub 3//sup +/ and 0,0/sub 4//sup +/ states is much improved over the sd-IBM appraoch.
1983-01-01
Five 168/E processors and associated specialized interface hardware made an importartant contribution to the UA1 experiment. The processors provided an online event display facility, and also flagged candidate events. See Annual Report 1983 p. 75, and photo 8305815X, 8395813X. This photo shows the team including DD personnel and UA1 members. On the foreground left, is Michel Demoulin. On the background, 3rd from left, is Adolfo Fucci, last Sergio Cittolin.
Directory of Open Access Journals (Sweden)
Kequan Fu
Full Text Available Transmembrane protein 168 (TMEM168 comprises 697 amino acid residues, including some putative transmembrane domains. It is reported that TMEM168 controls methamphetamine (METH dependence in the nucleus accumbens (NAc of mice. Moreover, a strong link between METH dependence-induced adaptive changes in the brain and mood disorders has been evaluated. In the present study, we investigated the effects of accumbal TMEM168 in a battery of behavioral paradigms. The adeno-associated virus (AAV Tmem168 vector was injected into the NAc of C57BL/6J mice (NAc-TMEM mice. Subsequently, the accumbal TMEM168 mRNA was increased approximately by seven-fold when compared with the NAc-Mock mice (controls. The NAc-TMEM mice reported no change in the locomotor activity, cognitive ability, social interaction, and depression-like behaviors; however, TMEM168 overexpression enhanced anxiety in the elevated-plus maze and light/dark box test. The increased anxiety was reversed by pretreatment with the antianxiety drug diazepam (0.3 mg/kg i.p.. Moreover, the NAc-TMEM mice exhibited decreased prepulse inhibition (PPI in the startle response test, and the induced schizophrenia-like behavior was reversed by pretreatment with the antipsychotic drug risperidone (0.01 mg/kg i.p.. Furthermore, accumbal TMEM168 overexpression decreased the basal levels of extracellular GABA in the NAc and the high K+ (100 mM-stimulated GABA elevation; however, the total contents of GABA in the NAc remained unaffected. These results suggest that the TMEM168-regulated GABAergic neuronal system in the NAc might become a novel target while studying the etiology of anxiety and sensorimotor gating deficits.
2013-01-01
Background Mycoplasma hyopneumoniae is the causative agent of porcine enzootic pneumonia (EP), a mild, chronic pneumonia of swine. Despite presenting with low direct mortality, EP is responsible for major economic losses in the pig industry. To identify the virulence-associated determinants of M. hyopneumoniae, we determined the whole genome sequence of M. hyopneumoniae strain 168 and its attenuated high-passage strain 168-L and carried out comparative genomic analyses. Results We performed the first comprehensive analysis of M. hyopneumoniae strain 168 and its attenuated strain and made a preliminary survey of coding sequences (CDSs) that may be related to virulence. The 168-L genome has a highly similar gene content and order to that of 168, but is 4,483 bp smaller because there are 60 insertions and 43 deletions in 168-L. Besides these indels, 227 single nucleotide variations (SNVs) were identified. We further investigated the variants that affected CDSs, and compared them to reported virulence determinants. Notably, almost all of the reported virulence determinants are included in these variants affected CDSs. In addition to variations previously described in mycoplasma adhesins (P97, P102, P146, P159, P216, and LppT), cell envelope proteins (P95), cell surface antigens (P36), secreted proteins and chaperone protein (DnaK), mutations in genes related to metabolism and growth may also contribute to the attenuated virulence in 168-L. Furthermore, many mutations were located in the previously described repeat motif, which may be of primary importance for virulence. Conclusions We studied the virulence attenuation mechanism of M. hyopneumoniae by comparative genomic analysis of virulent strain 168 and its attenuated high-passage strain 168-L. Our findings provide a preliminary survey of CDSs that may be related to virulence. While these include reported virulence-related genes, other novel virulence determinants were also detected. This new information will form
33 CFR 110.168 - Hampton Roads, Virginia and adjacent waters (Datum: NAD 83).
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Hampton Roads, Virginia and adjacent waters (Datum: NAD 83). 110.168 Section 110.168 Navigation and Navigable Waters COAST GUARD..., Virginia and adjacent waters (Datum: NAD 83). (a) Anchorage Grounds—(1) Anchorage A [Naval Anchorage]. The...
Watt-level dysprosium fiber laser at 3.15 μm with 73% slope efficiency.
Woodward, R I; Majewski, M R; Bharathan, G; Hudson, D D; Fuerbach, A; Jackson, S D
2018-04-01
Rare-earth-doped fiber lasers are emerging as promising high-power mid-infrared sources for the 2.6-3.0 μm and 3.3-3.8 μm regions based on erbium and holmium ions. The intermediate wavelength range, however, remains vastly underserved, despite prospects for important manufacturing and defense applications. Here, we demonstrate the potential of dysprosium-doped fiber to solve this problem, with a simple in-band pumped grating-stabilized linear cavity generating up to 1.06 W at 3.15 μm. A slope efficiency of 73% with respect to launched power (77% relative to absorbed power) is achieved-the highest value for any mid-infrared fiber laser to date, to the best of our knowledge. Opportunities for further power and efficiency scaling are also discussed.
32 CFR 168a.4 - Policy and procedures.
2010-07-01
... to pursue graduate degrees in science, engineering, or other fields of study that are designated, in... DEFENSE SCIENCE AND ENGINEERING GRADUATE FELLOWSHIPS § 168a.4 Policy and procedures. (a) Sponsoring... nationwide competition in which all appropriate actions have been taken to encourage applications from...
33 CFR 165.168 - Safety Zones; Coast Guard Captain of the Port New York Fireworks Displays.
2010-07-01
... of the Port New York Fireworks Displays. 165.168 Section 165.168 Navigation and Navigable Waters... Guard District § 165.168 Safety Zones; Coast Guard Captain of the Port New York Fireworks Displays. (a... Upper New York Bay within a 360-yard radius of the fireworks barge in approximate position 40°41′16.5″ N...
Li, Wei; Cui, Xiao; Meng, Zhaolu; Huang, Xiahe; Xie, Qi; Wu, Heng; Jin, Hailing; Zhang, Dabing; Liang, Wanqi
2012-03-01
The accumulation of a number of small RNAs in plants is affected by abscisic acid (ABA) and abiotic stresses, but the underlying mechanisms are poorly understood. The miR168-mediated feedback regulatory loop regulates ARGONAUTE1 (AGO1) homeostasis, which is crucial for gene expression modulation and plant development. Here, we reveal a transcriptional regulatory mechanism by which MIR168 controls AGO1 homeostasis during ABA treatment and abiotic stress responses in Arabidopsis (Arabidopsis thaliana). Plants overexpressing MIR168a and the AGO1 loss-of-function mutant ago1-27 display ABA hypersensitivity and drought tolerance, while the mir168a-2 mutant shows ABA hyposensitivity and drought hypersensitivity. Both the precursor and mature miR168 were induced under ABA and several abiotic stress treatments, but no obvious decrease for the target of miR168, AGO1, was shown under the same conditions. However, promoter activity analysis indicated that AGO1 transcription activity was increased under ABA and drought treatments, suggesting that transcriptional elevation of MIR168a is required for maintaining a stable AGO1 transcript level during the stress response. Furthermore, we showed both in vitro and in vivo that the transcription of MIR168a is directly regulated by four abscisic acid-responsive element (ABRE) binding factors, which bind to the ABRE cis-element within the MIR168a promoter. This ABRE motif is also found in the promoter of MIR168a homologs in diverse plant species. Our findings suggest that transcriptional regulation of miR168 and posttranscriptional control of AGO1 homeostasis may play an important and conserved role in stress response and signal transduction in plants.
Bernot, Kevin; Luzon, Javier; Bogani, Lapo; Etienne, Mael; Sangregorio, Claudio; Shanmugam, Muralidharan; Caneschi, Andrea; Sessoli, Roberta; Gatteschi, Dante
2009-04-22
A mixed theoretical and experimental approach was used to determine the local magnetic anisotropy of the dysprosium(III) ion in a low-symmetry environment. The susceptibility tensor of the monomeric species having the formula [Dy(hfac)(3)(NIT-C(6)H(4)-OEt)(2)], which contains nitronyl nitroxide (NIT-R) radicals, was determined at various temperatures through angle-resolved magnetometry. These results are in agreement with ab initio calculations performed using the complete active space self-consistent field (CASSCF) method, validating the predictive power of this theoretical approach for complex systems containing rare-earth ions, even in low-symmetry environments. Susceptibility measurements performed with the applied field along the easy axis eventually permitted a detailed analysis of the temperature and field dependence of the magnetization, providing evidence that the Dy ion transmits an antiferromagnetic interaction between radicals but that the Dy-radical interaction is ferromagnetic.
Coulomb-nuclear interference measurements of hexadecapole deformations in 168Yb and 178,180Hf
International Nuclear Information System (INIS)
Nettles, W.G.; Mississippi Coll., Clinton; Ramayya, A.V.; Hamilton, J.H.
1988-01-01
Coulomb-nuclear interference studies of 168 Yb and 178,180 Hf have been carried out with alpha particles from the Pittsburgh tandem. From coupled channel fits to the data at 18 MeV for 168 Yb and 19.5 MeV for 178,180 Hf, β 4 c values of -0.030(20), -0.166(18), and -0.180(6) were obtained, respectively. These data agree with the positive M 04 value from sub-Coulomb studies of 168 Yb but with the large negative M 04 values from sub-Coulomb studies of 178,180 Hf. (author)
Lifetimes Measurements in 160Yb,162Yb,164Yb,166Yb,168Yb
International Nuclear Information System (INIS)
Araddad, S. Y.; El-barouni, A. M.; Rateb, G. M.; Mosbah, D. S.; Elahrash, M. S.; Sergiwa, S. M.
2004-01-01
From our measurements of the lifetimes of high spin states in 168 Yb along with the published lifetime data for the nearby even even ytterbium isotopes, 160-168 Yb using the Recoil Distance Method (RDM) and the Doppler Shift Attenuation Method (DSAM) present a great opportunity to probe systematically the relationship between the nuclear shape changes and the reduction in collectivity. (authors)
Isotopic shifts and configuration mixing in the dysprosium II spectrum
International Nuclear Information System (INIS)
Aufmuth, P.
1977-01-01
Using a photoelectric Fabry-Perot spectrometer with digital data acquisition, the isotopic shifts of all stable dysprosium isotopes (Z = 66, A = 156, 158, 160, 161, 162, 163, 164) have been measured in transitions from the groundstate configuration 4f 10 6s to the excited configurations 4f 9 5d6s, 4f 9 5d 2 , and 4f 10 6p of the spark spectrum. Mass and volume effects have been seperated; the results are compared with arc spectrum measurements. From the volume effect of a pure s-p transition the change of the mean electric quadratic nuclear radius delta 2 > has been calculated. In order to test fine structure calculations of the Dy II spectrum, the isotopic shifts of 29 lines of the isotopes 162 Dy and 164 Dy have been measured. Based on the sharing rule, the reported configuration mixing could be confirmed in principle; for one energy level (E = 22908 K) the asignement has been proved to be false, in the case of three other levels (E = 22467, 22672, and 28885 K) the asignement is doubtfull. For the ground state levels 4f 10 6s 6 I the influence of relativistic effects could be proved; these effects can be interpreted in the framework of a parametric representation of the isotopic shift. The order of magnitude of the crossed second order effects has been estimated. (orig.) [de
International Nuclear Information System (INIS)
Mallah, M.H.; Atomic Energy Organization of Iran, Tehran; Shemirani, F.; Ghannadi Maragheh, M.
2008-01-01
A new preconcentration method of dispersive liquid-liquid microextraction (DLLME) was developed for simultaneous preconcentration of samarium, europium, gadolinium and dysprosium. DLLME technique was successfully used as a sample preparation method. In this preconcentration method, an appropriate mixture of extraction solvent, disperser solvent was injected rapidly into an aqueous solution containing Sm, Eu, Gd and Dy after complex formation using chelating reagent of the 1-(2-pyridylazo)-2-naphthol (PAN). After phase separation, 0.5 mL of the settled phase containing enriched analytes was determined by inductively coupled plasma optical emission spectrometry (ICP-OES). The main factors affected the preconcentration of Sm, Eu, Gd and Dy were extraction and dispersive solvent type and their volume, extraction time, volume of chelating agent (PAN), centrifuge speed and drying temperature of the samples. Under the best operating condition simultaneous preconcentration factors of 80, 100, 103 and 78 were obtained for Sm, Eu, Gd and Dy, respectively. (author)
Energy Technology Data Exchange (ETDEWEB)
Brauer, G; Kristen, H [Freiburg Univ. (Germany, F.R.)
1980-03-01
In analogy to our investigations concerning tetravalent Nd in oxide perovskites, we also tried to stabilize dysprosium(IV) by incorporation in host-lattices with the perovskite structure. As host-lattices we used BaCeO/sub 3/, BaTbO/sub 3/, and SrTbO/sub 3/. Only in Ba(Ce, Dy)O/sub 3/ we could trace Dy(IV) with certainty. Among the prepared mixed oxides, also the phase Ba/sub 3/Dy/sub 4/O/sub 9/ occured. The lattice parameters of several phases of this latter type were redetermined.
28 CFR 0.168 - Redelegation by Assistant Attorneys General.
2010-07-01
..., Penalties, and Forfeitures § 0.168 Redelegation by Assistant Attorneys General. (a) Assistant Attorneys... the Assistant Attorney General level must be presented to the Assistant Attorney General for... the Deputy Attorney General or the Associate Attorney General, as appropriate, before taking effect...
The 168/E at CERN and the MARK 2. An improved processor design
International Nuclear Information System (INIS)
Kunz, P.; Botterill, D.R.; Lord, D.; Edwards, A.; Fucci, A.; Lee, G.; Martin, B.; Mornacchi, G.; Scharff-Hansen, P.; Storr, M.
1981-01-01
In the first part of this paper the history of the 168/E work at CERN is reviewed, this is followed by a short description of the hardware and software in use and finally some examples of future applications are given. In the second part of the paper the limitations of the present 168/E design are discussed and the ways that a new design, Mark 2, could overcome them are presented. (orig.)
Li, Wei; Cui, Xiao; Meng, Zhaolu; Huang, Xiahe; Xie, Qi; Wu, Heng; Jin, Hailing; Zhang, Dabing; Liang, Wanqi
2012-01-01
The accumulation of a number of small RNAs in plants is affected by abscisic acid (ABA) and abiotic stresses, but the underlying mechanisms are poorly understood. The miR168-mediated feedback regulatory loop regulates ARGONAUTE1 (AGO1) homeostasis, which is crucial for gene expression modulation and plant development. Here, we reveal a transcriptional regulatory mechanism by which MIR168 controls AGO1 homeostasis during ABA treatment and abiotic stress responses in Arabidopsis (Arabidopsis thaliana). Plants overexpressing MIR168a and the AGO1 loss-of-function mutant ago1-27 display ABA hypersensitivity and drought tolerance, while the mir168a-2 mutant shows ABA hyposensitivity and drought hypersensitivity. Both the precursor and mature miR168 were induced under ABA and several abiotic stress treatments, but no obvious decrease for the target of miR168, AGO1, was shown under the same conditions. However, promoter activity analysis indicated that AGO1 transcription activity was increased under ABA and drought treatments, suggesting that transcriptional elevation of MIR168a is required for maintaining a stable AGO1 transcript level during the stress response. Furthermore, we showed both in vitro and in vivo that the transcription of MIR168a is directly regulated by four abscisic acid-responsive element (ABRE) binding factors, which bind to the ABRE cis-element within the MIR168a promoter. This ABRE motif is also found in the promoter of MIR168a homologs in diverse plant species. Our findings suggest that transcriptional regulation of miR168 and posttranscriptional control of AGO1 homeostasis may play an important and conserved role in stress response and signal transduction in plants. PMID:22247272
Sánchez Lafarga, Ana Karen; Pacheco Moisés, Fermín P; Gurinov, Andrey; Ortiz, Genaro Gabriel; Carbajal Arízaga, Gregorio Guadalupe
2015-03-01
The development of probes for biomedical applications demands materials with low toxicity levels besides fluorescence or magnetic properties to be detected by confocal microscopes or MRI resonators. Several drug delivery systems or other biomedical materials prepared with hydroxyapatite have been proposed, however, toxicity effects might arise when the size of particles is nanometric. In this study, hydroxyapatite functionalized with glucuronic or folic acids presented lower oxidative stress, measured from lipoperoxides and nitric oxide indicators in rats than pure hydroxyapatite. In separated experiments, hydroxyapatite was doped with dysprosium cations by coprecipitation producing a single crystal phase with fluorescent properties easily visualized by confocal microscopy when excited at 488nm. These particles also presented the ability to modify the proton relaxation time in T1 maps collected by magnetic resonance imaging. These modified hydroxyapatite nanoparticles could be candidates to design bimodal probes with low toxicity. Copyright © 2014 Elsevier B.V. All rights reserved.
Exploration of dysprosium: the most critical element for Japan
Watanabe, Y.
2012-04-01
Dysprosium (Dy), one of the heavy rare earth elements, is used mainly as an additive for NdFeB permanent magnets which are installed in various modern industrial products such as voice coil motors in computers, factory automation machinery, hybrid and electric vehicles, home electronics, and wind turbine, to improve heat resistance of the magnets. Dy has been produced about 2,000t per year from the ores from ion adsorption type deposits in southern China. However, the produced amount of Dy was significantly reduced in 2011 in China due to reservation of heavy rare earth resources and protection of natural environment, resulting in soaring of Dy price in the world. In order to respond the increasing demand of Dy, unconventional supply sources are inevitably developed, in addition to heavy rare earth enriched ion adsorption type deposits outside China. Heavy rare earth elements including Dy are dominantly hosted in xenotime, fergusonite, zircon, eudialyte, keiviite, kainosite, iimoriite, etc. Concentration of xenotime is found in placer deposits in Malaysia and India, hydrothermal deposits associated with unconformity-type uranium mineralization (Athabasca basin in Canada, Western Australia), iron-oxide fluorite mineralization (South Africa) and Sn-bearing alkaline granite (Brazil). Zircon and fergusontie concentration is found as igneous and hydrothermal products in peralkaline syenite, alkaline granite and pegmatite (e.g., Nechalacho in Canada). Eudialyte concentration is found in some peralkaline syenite bodies in Greenland, Canada, Sweden and Russia. Among these sources, large Dy resources are estimated in the deposits hosted in peralkaline rocks (Nechalacho: 79,000t, Kvanefjeld: 49,000t, Norra Karr: 15,700t, etc.) compared to the present demand of Dy. Thus, Dy will be supplied from the deposits associated with peralkaline and alkaline deposits in future instead of ion adsorption type deposits in southern China.
Isolation of {sup 163}Ho from dysprosium target material by HPLC for neutrino mass measurements
Energy Technology Data Exchange (ETDEWEB)
Mocko, Veronika; Taylor, Wayne A.; Nortier, Francois M.; Engle, Jonathan W.; Pollington, Anthony D.; Kunde, Gerd J.; Rabin, Michael W.; Birnbaum, Eva R. [Los Alamos National Laboratory, Los Alamos, NM (United States). Chemistry Div.; Barnhart, Todd E.; Nickles, Robert J. [Univ. Wisconsinn, Madison, WI (United States). Dept. of Medical Physics
2015-07-01
The rare earth isotope {sup 163}Ho is of interest for neutrino mass measurements. This report describes the isolation of {sup 163}Ho from a proton-irradiated dysprosium target and its purification. A Dy metal target was irradiated with 16 MeV protons for 10 h. After target dissolution, {sup 163}Ho was separated from the bulk Dy via cation-exchange high performance liquid chromatography using 70 mmol dm{sup -3} α-hydroxyisobutyric acid as the mobile phase. Subsequent purification of the collected Ho fraction was performed to remove the α-hydroxyisobutyrate chelating agent and to concentrate the Ho in a low ionic strength aqueous matrix. The final solution was characterized by MC-ICP-MS to determine the {sup 163}Ho/{sup 165}Ho ratio, {sup 163}Ho and the residual Dy content. The HPLC purification process resulted in a decontamination factor 1.4 x 10{sup 5} for Dy. The isolated Ho fraction contained 24.8 ± 1.3 ng of {sup 163}Ho corresponding to holmium recovery of 72 ± 3%.
Bermuda Triangle: a subsystem of the 168/E interfacing scheme used by Group B at SLAC
International Nuclear Information System (INIS)
Oxoby, G.J.; Levinson, L.J.; Trang, Q.H.
1979-12-01
The Bermuda Triangle system is a method of interfacing several 168/E microprocessors to a central system for control of the processors and overlaying their memories. The system is a three-way interface with I/O ports to a large buffer memory, a PDP11 Unibus and a bus to the 168/E processors. Data may be transferred bidirectionally between any two ports. Two Bermuda Triangles are used, one for the program memory and one for the data memory. The program buffer memory stores the overlay programs for the 168/E, and the data buffer memory, the incoming raw data, the data portion of the overlays, and the outgoing processed events. This buffering is necessary since the memories of 168/E microprocessors are small compared to the main program and the amount of data being processed. The link to the computer facility is via a Unibus to IBM channel interface. A PDP11/04 controls the data flow. 7 figures, 4 tables
International Nuclear Information System (INIS)
Gloeser-Chahoud, Simon; Kuehn, Andre; Tercero Espinoza, Luis
2016-01-01
Neodymium-iron-boron magnets (NdFeB) have experienced a significant demand as the most powerful permanent magnet in recent years, especially for the manufacture of compact electric servomotors with high efficiency and high power density, especially for mobile applications in hybrid traction motors and electric vehicles or for electric bikes. However, NdFeB magnets are also increasingly being used in general mechanical engineering (conveying and pumping systems, tools, air conditioning systems, lift motors, etc.), in the small electric motors of conventional passenger cars or in the generators of large wind power plants with permanent magnetic direct drive. Nevertheless, there is still high uncertainty in the use structures of NdFeB magnets and the contained rare earth elements neodymium and dysprosium. An effective instrument for increasing the market transparency and the understanding of complex anthropogenic material cycles is the dynamic material flow modeling. In the present work paper, this instrument is used for an in-depth analysis of the use structures of NdFeB magnets and the contained rare earths on a global scale. The dynamic modeling of product usage cycles reveals today's usage structures and quantifies future magnetic quantities in obsolete product flows. It could be shown that the magnets in today's scrap volume are mainly contained in obsolete electronics applications such as hard disks (HDD), CD and DVD drives, which makes the recycling hardly seem to be economical due to the small magnets and the high material spread, but in the foreseeable future with larger magnetic quantities from synchronous servomotors and generators can be expected, which significantly increases the recycling potential. In a further step, the effect of the diffusion of alternative drives in the automotive market on the dysprosium requirement is analyzed using a system dynamics model and possible adaptation mechanisms in the form of different substitution effects in the
26 CFR 1.168(i)-4 - Changes in use.
2010-04-01
... property because the equipment was used by Z in its steam production plant for 8 months in 2004. If the... classification of the equipment under section 168(e) changes from 7-year property to 5-year property and the... equipment in its combustion turbine production plant for 4 months and then uses the equipment in its steam...
Microscopic study of neutron-rich dysprosium isotopes
International Nuclear Information System (INIS)
Vargas, Carlos E.; Velazquez, Victor; Lerma, Sergio
2013-01-01
Microscopic studies in heavy nuclei are very scarce due to large valence spaces involved. This computational problem can be avoided by means of the use of symmetry-based models. Ground-state, γ and β bands, and their B(E2) transition strengths in 160-168 Dy isotopes, are studied in the framework of the pseudo-SU(3) model which includes the preserving symmetry Q . Q term and the symmetry-breaking Nilsson and pairing terms, systematically parametrized. Additionally, three rotor-like terms are considered, whose free parameters, fixed for all members of the chain, are used to fine tune the moment of inertia of rotational bands and the band head of γ and β bands. The model succesfully describes in a systematic way rotational features in these nuclei and allows to extrapolate toward the midshell nucleus 170 Dy. The results presented show that it is possible to study a full chain of isotopes or isotones in the region with the present model. (orig.)
Microscopic study of neutron-rich dysprosium isotopes
Energy Technology Data Exchange (ETDEWEB)
Vargas, Carlos E. [Universidad Veracruzana, Facultad de Fisica e Inteligencia Artificial, Xalapa (Mexico); Universidad Nacional Autonoma de Mexico, Facultad de Ciencias, Apartado Postal 70-542, Mexico D.F. (Mexico); Velazquez, Victor [Universidad Nacional Autonoma de Mexico, Facultad de Ciencias, Apartado Postal 70-542, Mexico D.F. (Mexico); Lerma, Sergio [Universidad Veracruzana, Facultad de Fisica e Inteligencia Artificial, Xalapa (Mexico)
2013-01-15
Microscopic studies in heavy nuclei are very scarce due to large valence spaces involved. This computational problem can be avoided by means of the use of symmetry-based models. Ground-state, {gamma} and {beta} bands, and their B(E2) transition strengths in {sup 160-168}Dy isotopes, are studied in the framework of the pseudo-SU(3) model which includes the preserving symmetry Q . Q term and the symmetry-breaking Nilsson and pairing terms, systematically parametrized. Additionally, three rotor-like terms are considered, whose free parameters, fixed for all members of the chain, are used to fine tune the moment of inertia of rotational bands and the band head of {gamma} and {beta} bands. The model succesfully describes in a systematic way rotational features in these nuclei and allows to extrapolate toward the midshell nucleus {sup 170}Dy. The results presented show that it is possible to study a full chain of isotopes or isotones in the region with the present model. (orig.)
Synthesis and X-ray diffraction studies of dysprosium-calcium ferrites Dy1-xCaxFeO3-y (0≤x≤2/3)
International Nuclear Information System (INIS)
Li, J.; Song, D.; Su, Z.; Wang, T.M.
1997-01-01
Samples of dysprosium-calcium ferrites Dy 1-x Ca x FeO 3-y with x ranging from 0 to 2/3 were novelly prepared in air by solid state reaction and characterized by X-ray powder diffraction. These samples are single-phased orthorhombic perovskite-type compounds belonging to the space group D 2h 16 -Pbnm. The lattice constants of the Dy 1-x Ca x FeO 3-y samples have been refined by Cohen's least-squares method. The initial substitution of Ca for Dy leads to a decrease of the lattice constants. Further substitution of Ca for Dy has hardly any influence on the lattice dimensions. (orig.)
Investigation of the 168Hf electron capture decay using fast radiochemical separation
International Nuclear Information System (INIS)
Trubert, D.; Hussonnois, M.; Brillard, L.; Barci, V.; Ardisson, G.; Szeglowski, Z.; Constantinescu, O.
1995-01-01
The (EC + β + ) decay of 168 Hf, produced by the 156 Gd ( 16 O,4n) reaction, has been studied, with high efficiency HPGe coaxial detectors, using on-line measurements carried out with the RACHEL setup, built to investigate the chemical properties of transactinide elements. Off-line measurements were also carried out using catcher collection technique. Energies and intensities of 119 γ-lines are reported among which only two were known in the earlier study of Chu and Reednick. The 168 Lu level scheme built on the basis of single and γ-γ coincidence measurements, allows the interpretation of more than 79 γ-transitions, between 38 excited states reported for the first time. (orig.)
Zhang, Li; Zhang, Peng; Zhao, Lang; Wu, Jianfeng; Guo, Mei; Tang, Jinkui
2016-06-28
An unprecedented octanuclear dysprosium(iii) cluster with the formula [Dy8L6(μ3-OH)4(μ2-CH3O)2(CH3OH)6(H2O)2]·6H2O·10CH3OH·2CH3CN () based on a nonlinearly tritopic aroylhydrazone ligand H3L has been isolated, realizing the successful linking of pairwise interesting triangular Dy3 SMMs. It is noteworthy that two enantiomers (Λ and Δ configurations) individually behaving as a coordination-induced chirality presented in the Dy3 helicate are connected in the meso Dy8 cluster. Remarkably, alternating-current magnetic susceptibility measurements revealed that the Dy8 cluster shows typical SMM behavior inherited from its Dy3 helical precursor. It is one of the rare polynuclear Lnn SMMs (n > 7) under zero dc field.
International Nuclear Information System (INIS)
Kononenko, L.I.; Bel'tyukova, S.V.; Meshkova, S.B.; Kravchenko, T.B.; Poluehktov, N.S.
1978-01-01
An investigation is made of the effect of different solvents on the ratio of the intensity of luminescence spectrum bands of terbium and dysprosium ions, corresponding and not corresponding to ''supersensitive'' transitions in complex compounds with acetoacetic ether. A dependence is established between these values and the dielectric constant of the solvent, and also parallels in their changes, which indicate the similar manifestation of the effect of solvents in both elements. A correlation is observed between ratios of the intensity of luminescence spectrum bands and values of forces of neodymium complex absorption band oscillators in different solvents
Ocular Toxicity Profile of ST-162 and ST-168 as Novel Bifunctional MEK/PI3K Inhibitors.
Smith, Andrew; Pawar, Mercy; Van Dort, Marcian E; Galbán, Stefanie; Welton, Amanda R; Thurber, Greg M; Ross, Brian D; Besirli, Cagri G
2018-04-30
ST-162 and ST-168 are small-molecule bifunctional inhibitors of MEK and PI3K signaling pathways that are being developed as novel antitumor agents. Previous small-molecule and biologic MEK inhibitors demonstrated ocular toxicity events that were dose limiting in clinical studies. We evaluated in vitro and in vivo ocular toxicity profiles of ST-162 and ST-168. Photoreceptor cell line 661W and adult retinal pigment epithelium cell line ARPE-19 were treated with increasing concentrations of bifunctional inhibitors. Western blots, cell viability, and caspase activity assays were performed to evaluate MEK and PI3K inhibition and dose-dependent in vitro toxicity, and compared with monotherapy. In vivo toxicity profile was assessed by intravitreal injection of ST-162 and ST-168 in Dutch-Belted rabbits, followed by ocular examination and histological analysis of enucleated eyes. Retinal cell lines treated with ST-162 or ST-168 exhibited dose-dependent inhibition of MEK and PI3K signaling. Compared with inhibition by monotherapies and their combinations, bifunctional inhibitors demonstrated reduced cell death and caspase activity. In vivo, both bifunctional inhibitors exhibited a more favorable toxicity profile when compared with MEK inhibitor PD0325901. Novel MEK and PI3K bifunctional inhibitors ST-162 and ST-168 demonstrate favorable in vitro and in vivo ocular toxicity profiles, supporting their further development as potential therapeutic agents targeting multiple aggressive tumors.
The sdg interacting-boson model applied to 168Er
Yoshinaga, N.; Akiyama, Y.; Arima, A.
1986-03-01
The sdg interacting-boson model is applied to 168Er. Energy levels and E2 transitions are calculated. This model is shown to solve the problem of anharmonicity regarding the excitation energy of the first Kπ=4+ band relative to that of the first Kπ=2+ one. The level scheme including the Kπ=3+ band is well reproduced and the calculated B(E2)'s are consistent with the experimental data.
Combustion of gadolinium and dysprosium chelates as a cellular integrity marker in MR imaging
International Nuclear Information System (INIS)
Ericsson, A.; Bach-Gansmo, T.; Niklasson, F.; Hemmingsson, A.
1995-01-01
A combination of gadolinium (Gd) and dysprosium (Dy) chelates was investigated as a potential marker of cell-membrane integrity by means of a double-contrast effect in MR imaging. Blood samples with varying hematocrit (Hct) levels containing intact or lysed cells were used as model systems. With intact cells, the agents were assumed to be distributed solely extracellularly and the highest Hct studied (69%) was assumed to mimic the ratio of extracellular to intracellular water in tissue. The combined effect on image intensity of Gd (in a concentration corresponding to 0.2 mmol/kg b.w. in humans) and Dy (0.6 mmol/kg b.w.) applied simultaneously was a marked difference in signal intensity between samples with intact and lysed cells in both the T1- and T2-weighted spin-echo images with a corresponding increase in the contrast-to-noise ratio. This was the result of a T1 reduction caused by Gd with a negligible Dy susceptibility effect in areas with lysed cells. On the other hand, the Dy susceptibility effect (i.e. reduced apparent T2) dominated in areas with intact cells. Thus, the combination of Gd and Dy may serve as a marker of cell-membrane integrity in MR examinations. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Jain, Richa [School of Sciences, Indira Gandhi National Open University, Maidan Garhi, New Delhi 110068 (India); Department of Physics, ARSD college, University of Delhi, New Delhi 110021 (India); Luthra, Vandna [Department of Physics, Gargi College, Siri Fort Road, New Delhi 110049 (India); Gokhale, Shubha, E-mail: sgokhale@ignou.ac.in [School of Sciences, Indira Gandhi National Open University, Maidan Garhi, New Delhi 110068 (India)
2016-09-15
The effect of dysprosium doping on evolution of structural and magnetic properties of magnetite (Fe{sub 3}O{sub 4}) nanoparticles is reported. A standard route of co-precipitation was used for the synthesis of undoped and doped magnetite nanoparticles Fe{sub 3−x}Dy{sub x}O{sub 4} (x=0.0–0.1). Transmission electron microscopy (TEM) shows formation of round shaped particles with diameter in the range of 8–14 nm for undoped sample. On doping beyond x=0.01, the formation of rod like structures is initiated along with the round shaped particles. The number of rods is found to increase with increasing doping concentration. Magnetic characterization using Vibrating Sample Magnetometer (VSM) revealed doping dependent magnetic properties which can be correlated with the crystallite size as determined from X-ray diffraction (XRD). Enhancement in the saturation magnetization in the initial stages of doping can be explained on the basis of incorporation of Dy{sup 3+} ions in the inverse spinel structure at the octahedral site in place of Fe{sup 3+} ions. Subsequent decrease in saturation magnetization observed beyond x=0.03 could be attributed to precipitation of excess Dy in form of dysprosium ferrite phase. - Highlights: • Report on formation of nanorods in magnetite prompted by Dy doping. • Observation of anisotropic magnetic behaviour emanating from the shape anisotropy. • Evidence of Dy{sup 3+} ions occupying octahedral site in place of Fe{sup 3+} ions. • Nanorods envisaged to be useful as catalysts and in biomedical applications.
Identification of excited states in 167Os and 168Os: shape coexistence at extreme neutron deficiency
International Nuclear Information System (INIS)
Joss, D.T.; King, S.L.; Page, R.D.; Simpson, J.; Keenan, A.; Amzal, N.; Baeck, T.; Bentley, M.A.; Cederwall, B.; Cocks, J.F.C.; Cullen, D.M.; Greenlees, P.T.; Helariutta, K.; Jones, P.M.; Julin, R.; Juutinen, S.; Kankaanpaeae, H.; Kettunen, H.; Kuusiniemi, P.; Leino, M.; Muikku, M.; Savelius, A.; Uusitalo, J.; Williams, S.J.
2001-01-01
Excited states in the very neutron-deficient isotopes 167 Os and 168 Os have been observed using the reaction 112 Sn( 58 Ni, 2pxn). The JUROSPHERE γ-ray spectrometer array was used in conjunction with the RITU gas-filled recoil separator to collect prompt γ radiation in coincidence with recoils implanted in a silicon strip detector located at the focal plane of RITU. Using a selective recoil decay tagging technique it has been possible to unambiguously assign γ-ray transitions to 167 Os and 168 Os through the characteristic α radioactivity of these nuclides. The high-spin structure of the bands is discussed in terms of quasiparticle configurations within the framework of the cranked shell model. The role of shape coexistence in 168 Os is examined with phenomenological three-band mixing calculations
Isomer spectroscopy of neutron-rich 168 Tb 103
Energy Technology Data Exchange (ETDEWEB)
Gurgi, L. A.; Regan, P. H.; Söderström, P. -A.; Watanabe, H.; Walker, P. M.; Podolyák, Zs.; Nishimura, S.; Berry, T. A.; Doornenbal, P.; Lorusso, G.; Isobe, T.; Baba, H.; Xu, Z. Y.; Sakurai, H.; Sumikama, T.; Catford, W. N.; Bruce, A. M.; Browne, F.; Lane, G. J.; Kondev, F. G.; Odahara, A.; Wu, J.; Liu, H. L.; Xu, F. R.; Korkulu, Z.; Lee, P.; Liu, J. J.; Phong, V. H.; Yag, A.; Zhang, G. X.; Alharbi, T.; Carroll, R. J.; Chae, K. Y.; Dombradi, Zs.; Estrade, A.; Fukuda, N.; Griffin, C.; Ideguchi, E.; Inabe, N.; Kanaoka, H.; Kojouharov, I.; Kubo, T.; Kubono, S.; Kurz, N.; Kuti, I.; Lalkovski, S.; Lee, E. J.; Lee, C. S.; Lotay, G.; Moon, C. -B.; Nishizuka, I.; Nita, C. R.; Patel, Z.; Roberts, O. J.; Schaffner, H.; Shand, C. M.; Suzuki, H.; Takeda, H.; Terashima, S.; Vajta, Zs.; Yoshida, S.; Valiente-Dòbon, J. J.
2017-11-01
In-flight fission of a 345 MeV per nucleon 238U primary beam on a 2 mm thick 9Be target has been used to produce and study the decays of a range of neutron-rich nuclei centred around the doubly mid-shell nucleus 170Dy at the RIBF Facility, RIKEN, Japan. The produced secondary fragments of interest were identified event-by-event using the BigRIPS separator. The fragments were implanted into the WAS3ABI position sensitive silicon active stopper which allowed pixelated correlations between implants and their subsequent β-decay. Discrete γ-ray transitions emitted following decays from either metastable states or excited states populated following beta decay were identified using the 84 coaxial high-purity germanium (HPGe) detectors of the EURICA spectrometer, which was complemented by 18 additional cerium-doped lanthanum bromide (LaBr3) fast-timing scintillation detectors from the FATIMA collaboration. This paper presents the internal decay of a metastable isomeric excited state in the odd-odd nucleus 168Tb, which corresponds to a single proton-neutron hole configuration in the valence maximum nucleus 170Dy. These data represent the first information on excited states in this nucleus, which is the most neutron-rich odd-odd isotope of terbium (Z=65) studied to date. Nilsson configurations associated with an axially symmetric, prolate-deformed nucleus are proposed for the 168Tb ground state the observed isomeric state by comparison with Blocked BCS-Nilsson calculations.
BEPS redesign of 168 commercial buildings: summary report
Energy Technology Data Exchange (ETDEWEB)
Stoops, J.L.; Deringer, J.J.; Moreno, S.; Misuriello, H.P.
1984-05-01
The objective of this report is to present, in usable form, summary data from the Building Energy Performance Standards (BEPS) Phase II commercial buildings energy research conducted in 1978-1979. Summary data presented were obtained from two major research efforts: the BEPS Phase II Redesign experiment; and the related research on ASHRAE Standard 90-75R. The bulk of this report consists of data tabulations of key energy parameters for the 168 sample buildings, which were tabulated from computer-stored files of the 1978-1979 data. Two kinds of tabulations are included: numerical tabulations that extracted information from the computer-stored data base for the 168 sample buildings; and graphic presentations of the computer-generated data, plus data extracted from other sources. The intent is to provide a single data compendium of key energy-related factors from the 1978 redesign experiment and the associated 1978-1979 ASHRAE Standard 90-75R research. This report also supplements the information for which there was not space in the magazine articles. Thus, for some building types, additional analysis, comments, and data tabulations are included that could not be included in the articles because space was limited. These additional analysis items are not consistent across building types because both the energy conservation opportunities and the design strategies applied by the building designers varied considerably by building type. The chapters have been entered individually into EDB and ERA.
New levels in 168Er: Use of a Compton-suppressed Ge array with the (n,γ) reaction
International Nuclear Information System (INIS)
Gill, R.L.; Casten, R.F.; Phillips, W.R.; Varley, B.J.; Lister, C.J.; Durell, J.L.; Shannon, J.A.; Warner, D.D.
1996-01-01
For the first time an (n,γ) reaction has been extensively studied using a large array of Compton-suppressed Ge detectors (the TESSA array). The nucleus 168 Er was studied and the data show substantial improvement, in both quantity and quality, over previous coincidence data. Even though 168 Er is perhaps the best studied deformed nucleus, over 250 new coincidence relations and a number of new levels in 168 Er were disclosed, demonstrating the usefulness of this approach. Nuclear physics applications relate to the extension of nearly complete spectroscopy to higher excitation energies and to the study of statistical and chaotic features of the decay of low spin compound nuclear levels. copyright 1996 The American Physical Society
26 CFR 1.168(k)-1 - Additional first year depreciation deduction.
2010-04-01
... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Additional first year depreciation deduction. 1... Corporations § 1.168(k)-1 Additional first year depreciation deduction. (a) Scope and definitions—(1) Scope. This section provides the rules for determining the 30-percent additional first year depreciation...
Textured dysprosium and gadolinium poles for high-field, short-period hybrid undulators
International Nuclear Information System (INIS)
Murokh, Alex; Solovyov, Vyacheslav; Agustsson, Ron; O'Shea, Finn H.; Chubar, Oleg; Chen, Yung; Grandsaert, Thomas
2014-01-01
We discuss the feasibility of enhancement of the gap field in a short-period hybrid undulator by using pole inserts with the saturation inductance B s , over that of iron, 2 T. Dysprosium metal, with the saturation inductance of 3.4 T below 90 K, and Gadolinium with B s =2.7 T, appear as good candidates as the optimized pole material. However, due to the high magnetic anisotropy of Dy, such a high level of magnetization can only be realized when the external field lies in the basal plane. This implies that the pole has to be single-crystalline or highly textured. Considering that growing large, >10mm, Dy single crystals is difficult, we propose secondary recrystallization as a method to induce the required texture in thin Dy and Gd foils. The textured foils can be stacked to produce pole inserts of the desired geometry and orientation. Results of small-scale processing and magnetic measurements of thin (20–60 μ) foils provide evidence that the required texture quality can be achieved by a relatively simple sequence of heat-treatments and cold rolling. The advantage of textured Dy and Gd poles is demonstrated in a several period test undulator. -- Highlights: • Textured rare-earth materials for use as undulator pole materials. • We measure the development of texture in Dy and Gd. • We compare the rare-earth materials with high saturation steel in undulators. • Thin sheets of Dy and Gd materials perform similar to single crystals
2010-04-01
... 25 Indians 2 2010-04-01 2010-04-01 false Is it mandatory to go through the information phase before initiating the negotiation phase? 1000.168 Section 1000.168 Indians OFFICE OF THE ASSISTANT SECRETARY, INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ANNUAL FUNDING AGREEMENTS UNDER THE TRIBAL SELF-GOVERNMENT ACT AMENDMENTS TO THE INDIAN...
2013-08-16
... DEPARTMENT OF LABOR Employee Benefits Security Administration 168th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of Teleconference Meeting Pursuant to the.... 1142, the 168th open meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans...
International Nuclear Information System (INIS)
Nakada, Shinichiro
2016-01-01
The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway
Jeong, Seon-Ju; Park, Ji Yeong; Lee, Jae Yong; Lee, Kang Wook; Cho, Kye Man; Kim, Gyoung Min; Shin, Jung-Hye; Kim, Jong-Sang; Kim, Jeong Hwan
2015-11-01
Fibrinolytic enzyme genes (aprE2, aprE176, and aprE179) were introduced into the Bacillus subtilis 168 chromosome without any antibiotic resistance gene. An integration vector, pDG1662, was used to deliver the genes into the amyE site of B. subtilis 168. Integrants, SJ3-5nc, SJ176nc, and SJ179nc, were obtained after two successive homologous recombinations. The integration of each fibrinolytic gene into the middle of the amyE site was confirmed by phenotypes (Amy(-), Spec(S)) and colony PCR results for these strains. The fibrinolytic activities of the integrants were higher than that of B. subtilis 168 by at least 3.2-fold when grown in LB broth. Cheonggukjang was prepared by inoculating each of B. subtilis 168, SJ3-5nc, SJ176nc, and SJ179nc, and the fibrinolytic activity of cheonggukjang was 4.6 ± 0.7, 10.8 ± 0.9, 7.0 ± 0.6, and 8.0 ± 0.2 (U/g of cheonggukjang), respectively at 72 h. These results showed that construction of B. subtilis strains with enhanced fibrinolytic activities is possible by integration of a strong fibrinolytic gene via a marker-free manner.
High-spin spectroscopy of {sup 168}Yb and the reduction of pairing correlations
Energy Technology Data Exchange (ETDEWEB)
Oliveira, J R.B. [Sao Paulo Univ., SP (Brazil); Stephens, F S; Deleplanque, M A; Diamond, R M [Lawrence Berkeley Lab., CA (United States); Draper, J E; Rubel, E; Duyar, C [California Univ., Davis, CA (United States); Beacker, J A; Henry, E A; Roy, N [Lawrence Livermore National Lab., CA (United States); Beausang, C W [Liverpool Univ. (United Kingdom); Frauendorf, S [Institut fur Kern und Hadronen Physik, F2-Rossendorf, Dresden (Germany)
1992-08-01
The high spin states of {sup 168}Yb were investigated by means of in-beam gamma spectroscopy with the High Energy Resolution Array at the 88 in. cyclotron of the Lawrence Berkeley Laboratory. The {sup 168}Yb nucleus was produced in the reaction {sup 48}Ca({sup 124}Sn,4n) at 210 MeV. Five bands previously reported were confirmed; additionally, four other bands, two extending to spins as high as 36 {Dirac_h} were observed. Cranked shell models suggest that one of the new bands can be interpreted as the continuation of the ground state band (above the AB crossing frequency) crossing into the four-quasiparticle band ABCD at about 0.38 MeV. Both relative alignment and Routhians are in good agreement with the experimental values. However, these calculations were done at constant pairing strength, which is not expected to be good at high rotational frequencies where one or more crossings have occurred in each band. Particle-hole calculations (with no pairing) were done for {sup 168}Yb as well as for other N {approx_equal} 98 nuclei for which good experimental data are available. In most cases, it is possible to associate a particle-hole configuration for each band observed at very high rotational frequencies, and the overall description is good. At frequencies below the first crossing, a full pairing calculation is necessary to describe the bands properly. At intermediate frequencies, the pairing strength is believed to be intermediate. 3 figs.
Impact of UK NICE clinical guidelines 168 on referrals to a specialist academic leg ulcer service.
Davies, Huw Ob; Popplewell, Matthew; Bate, Gareth; Kelly, Lisa; Darvall, Katy; Bradbury, Andrew W
2018-03-01
Background Leg ulcers are a common cause of morbidity and disability and result in significant health and social care expenditure. The UK National Institute for Health and Care Excellence (NICE) Clinical Guideline (CG)168, published in July 2013, sought to improve care of patients with leg ulcers, recommending that patients with a break in the skin below the knee that had not healed within two weeks be referred to a specialist vascular service for diagnosis and management. Aim Determine the impact of CG168 on referrals to a leg ulcer service. Methods Patients referred with leg ulceration during an 18-month period prior to CG168 (January 2012-June 2013) and an 18-month period commencing six months after (January 2014-June 2015) publication of CG168 were compared. Results There was a two-fold increase in referrals (181 patients, 220 legs vs. 385 patients, 453 legs) but no change in mean age, gender or median-duration of ulcer at referral (16.6 vs. 16.2 weeks). Mean-time from referral to specialist appointment increased (4.8 vs. 6 weeks, p = 0.0001), as did legs with superficial venous insufficiency (SVI) (36% vs. 44%, p = 0.05). There was a trend towards more SVI endovenous interventions (32% vs. 39%, p = 0.271) with an increase in endothermal (2 vs. 32 legs, p = 0.001) but no change in sclerotherapy (24 vs. 51 legs) treatments. In both groups, 62% legs had compression. There was a reduction in legs treated conservatively with simple dressings (26% vs. 15%, p = 0.0006). Conclusions Since CG168, there has been a considerable increase in leg ulcer referrals. However, patients are still not referred until ulceration has been present for many months. Although many ulcers are multi-factorial and the mainstay of treatment remains compression, there has been an increase in SVI endovenous intervention. Further efforts are required to persuade community practitioners to refer patients earlier, to educate patients and encourage further investment in
26 CFR 5c.168(f)(8)-7 - Reporting of income, deductions and investment tax credit; at risk rules.
2010-04-01
... tax credit; at risk rules. 5c.168(f)(8)-7 Section 5c.168(f)(8)-7 Internal Revenue INTERNAL REVENUE... investment tax credit; at risk rules. (a) In general. The fact that the lessor's payments of interest and... property shall be limited to the extent the at risk rules under the investment tax credit provisions and...
International Nuclear Information System (INIS)
Bedogni, R.; Gómez-Ros, J.M.; Esposito, A.; Gentile, A.; Chiti, M.; Palacios-Pérez, L.; Angelone, M.; Tana, L.
2012-01-01
A photon insensitive passive neutron spectrometer consisting of a single moderating polyethylene sphere with Dysprosium activation foils arranged along three perpendicular axes was designed by CIEMAT and INFN. The device is called Dy-SSS (Dy foil-based Single Sphere Spectrometer). It shows nearly isotropic response in terms of neutron fluence up to 20 MeV. The first prototype, previously calibrated with 14 MeV neutrons, has been recently tested in workplaces having different energy and directional distributions. These are a 2.5 MeV nearly mono-chromatic and mono-directional beam available at the ENEA Frascati Neutron Generator (FNG) and the photo-neutron field produced in a 15 MV Varian CLINAC DHX medical accelerator, located in the Ospedale S. Chiara (Pisa). Both neutron spectra are known through measurements with a Bonner Sphere Spectrometer. In both cases the experimental response of the Dy-SSS agrees with the reference data. Moreover, it is demonstrated that the spectrometric capability of the new device are independent from the directional distribution of the neutron field. This opens the way to a new generation of moderation-based neutron instruments, presenting all advantages of the Bonner sphere spectrometer without the disadvantage of the repeated exposures. This concept is being developed within the NESCOFI@BTF project of INFN (Commissione Scientifica Nazionale 5).
Bedogni, R.; Gómez-Ros, J. M.; Esposito, A.; Gentile, A.; Chiti, M.; Palacios-Pérez, L.; Angelone, M.; Tana, L.
2012-08-01
A photon insensitive passive neutron spectrometer consisting of a single moderating polyethylene sphere with Dysprosium activation foils arranged along three perpendicular axes was designed by CIEMAT and INFN. The device is called Dy-SSS (Dy foil-based Single Sphere Spectrometer). It shows nearly isotropic response in terms of neutron fluence up to 20 MeV. The first prototype, previously calibrated with 14 MeV neutrons, has been recently tested in workplaces having different energy and directional distributions. These are a 2.5 MeV nearly mono-chromatic and mono-directional beam available at the ENEA Frascati Neutron Generator (FNG) and the photo-neutron field produced in a 15 MV Varian CLINAC DHX medical accelerator, located in the Ospedale S. Chiara (Pisa). Both neutron spectra are known through measurements with a Bonner Sphere Spectrometer. In both cases the experimental response of the Dy-SSS agrees with the reference data. Moreover, it is demonstrated that the spectrometric capability of the new device are independent from the directional distribution of the neutron field. This opens the way to a new generation of moderation-based neutron instruments, presenting all advantages of the Bonner sphere spectrometer without the disadvantage of the repeated exposures. This concept is being developed within the NESCOFI@BTF project of INFN (Commissione Scientifica Nazionale 5).
Energy Technology Data Exchange (ETDEWEB)
Bedogni, R., E-mail: roberto.bedogni@lnf.infn.it [INFN-LNF (Frascati National Laboratories), Via E. Fermi n. 40-00044 Frascati (Italy); Gomez-Ros, J.M. [INFN-LNF (Frascati National Laboratories), Via E. Fermi n. 40-00044 Frascati (Italy); CIEMAT, Av. Complutense 40, 28040 Madrid (Spain); Esposito, A.; Gentile, A.; Chiti, M.; Palacios-Perez, L. [INFN-LNF (Frascati National Laboratories), Via E. Fermi n. 40-00044 Frascati (Italy); Angelone, M. [ENEA C.R. Frascati, C.P. 65, 00044 Frascati (Italy); Tana, L. [A.O. Universitaria Pisana-Ospedale S. Chiara, Via Bonanno Pisano, Pisa (Italy)
2012-08-21
A photon insensitive passive neutron spectrometer consisting of a single moderating polyethylene sphere with Dysprosium activation foils arranged along three perpendicular axes was designed by CIEMAT and INFN. The device is called Dy-SSS (Dy foil-based Single Sphere Spectrometer). It shows nearly isotropic response in terms of neutron fluence up to 20 MeV. The first prototype, previously calibrated with 14 MeV neutrons, has been recently tested in workplaces having different energy and directional distributions. These are a 2.5 MeV nearly mono-chromatic and mono-directional beam available at the ENEA Frascati Neutron Generator (FNG) and the photo-neutron field produced in a 15 MV Varian CLINAC DHX medical accelerator, located in the Ospedale S. Chiara (Pisa). Both neutron spectra are known through measurements with a Bonner Sphere Spectrometer. In both cases the experimental response of the Dy-SSS agrees with the reference data. Moreover, it is demonstrated that the spectrometric capability of the new device are independent from the directional distribution of the neutron field. This opens the way to a new generation of moderation-based neutron instruments, presenting all advantages of the Bonner sphere spectrometer without the disadvantage of the repeated exposures. This concept is being developed within the NESCOFI@BTF project of INFN (Commissione Scientifica Nazionale 5).
Nuclear statistics of dysprosium resonance parameters in the energy range 10 - 1000 eV
International Nuclear Information System (INIS)
Shin, S. G.; Kye, Y. U.; Cho, M. H.; Kim, G. N.; Namkung, W.; Lee, M. W.; Kang, Y. R.; Roe, T. I.
2016-01-01
A resonance parameter analysis is often performed in the Resolved Resonance Region (RRR) in order to estimate the average level spacing, distribution of the reduced widths and so on. Neutron Capture experiments on dysprosium isotopes were performed at the electron linear accelerator (LINAC) facility of the Rensselear Polytechnic Institute (RPI) in the neutron energy region from 10 eV to 1 keV. The following nuclear statistics of the resonance parameters will be discussed in this paper. The D 0 for 161 Dy and 163 Dy were judged to be constant up to 120.6 and 163.9 eV, respectively. It was assumed that the D 0 of 162 Dy and 164 Dy is constant up to 1000 eV because they have few resonances. The results were compared with the values from Reference 11 as shown in Figure 1. Statistical distributions of reduced neutron were investigated for the three isotopes in the region from 0 to 1000 eV; 161 Dy, 162 Dy, and 163 Dy, but not for 164 Dy because of a few number of resonances. The reduced neutron widths Γ n 0 were divided by the unweighted average reduced neutron width < Γ n 0 > for each isotope. A cumulative distribution of these unitless ratios is compared with the integral of the Porter-Thomas distribution (χ 2 distribution with one degree of freedom). The results agree reasonably with the Porter Thomas distributions.
Chen, Fuchao; Fang, Baoxia; Li, Peng; Zhu, Xuesong; Zhou, Benhong
2014-08-01
This study was to investigate the physical and chemical compatibility of butorphanol with tramadol or fentanyl in 0.9% sodium chloride injections for patient controlled analgesia administration. The solutions were prepared in polyvinyl chloride (PVC) infusion bags and stored without protected from light exposure at room temperature (25 degrees C) or refrigerated (4 degrees C). Over a period of 168 hours, stabilities were determined by visual inspection, pH measurement, and high-pressure liquid chromatography (HPLC) assay of drug concentrations. At both temperatures, admixtures of butorphanol-tramadol and butorphanol-fentanyl were clear in appearance, and no color change or precipitation was observed during the study period. The maximum losses obtained were lower than 5% for the three drugs after 168 hours of storage. The results indicate that, at ambient or refrigerated storage conditions, the drug mixtures of butorphanol-tramadol and butorphanol-fentanyl in 0.9% sodium chloride injections were physically and chemically stable for at least 168 hours when stored in PVC syringes.
International Nuclear Information System (INIS)
Caires, A.C.F.
1985-01-01
A study for determination of samarium, europium, terbium, dysprosium and yttrium in a gadolinium oxide matrix by atomic absorption spectrophotometry using a graphite furnace is presented. The best charrring and atomization conditions were estabilished for each element, the most convenient ressonance lines being selected as well. The study was carried out for the mentioned lanthanides both when pure and when in binary mixtures with gadolinium, besides those where all for them were together with gadolinium. The determination limits for pure lanthanides were found to be between 1.3 and 9.6 ng assuming a 20% relative standard deviation as acceptable. The detection limits were in the range 0.51 and 7.5 ng, assuming as positive any answer higher than twofold the standard deviation. (author) [pt
Moulin, Jean-Claude; Silvano, Jérémy; Barban, Véronique; Riou, Patrice; Allain, Caroline
2013-07-01
The neurovirulence of two new candidate 17D-204 Stamaril™ working seed lots and that of two reference preparations were compared. The Stamaril™ working seed lots have been used for more than twenty years for the manufacturing of vaccines of acceptable safety and efficacy. The preparation designated RK 168-73 and provided by the Robert Koch Institute was used as a reference. It was confirmed that RK 168-73 strain was not a good virus control in our study because it has a very low neurovirulence regarding both the clinical and histopathological scores in comparison with Stamaril™ strain and is not representative of a vaccine known to be satisfactory in use. The results were reinforced by the phenotypic characterization by plaque assay demonstrating that RK 168-73 was very different from the Stamaril™ vaccine, and by sequencing results showing 4 mutations between Stamaril™ and RK 168-73 viruses leading to amino acid differences in the NS4B and envelop proteins. Copyright © 2013 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Halimah, M. K.; Ami Hazlin, M. N.; Muhammad, F. D.
2018-04-01
A series of glass samples with chemical formula {[(TeO2)0.7(B2O3)0.3]0.7(ZnO)0.3}1 - x(Dy2O3)x where x = 0.01, 0.02, 0.03, 0.04 and 0.05 M fraction were synthesized through conventional melt-quenching method. The most common way to fabricate a glass material is by fusion of two or more component oxides followed by their quenching. This technique is known as melt-quenching technique. Kaur et al. (2016) [1] highlighted that the melt-quenching method able to enhance the mechanical properties like hardness and flexural strength of the material. The nature of the glass systems is proven to be amorphous based on the XRD pattern. The FTIR spectra of the glass systems confirm the existence of five bands which are assigned for the BO4, BO3, TeO4 and TeO3 vibrational groups. The density of the glass systems is increased with the addition of Dy2O3 while the molar volume is found to be inversely proportional to the density of the proposed glass. The optical properties of the glasses are determined through the absorption spectra obtained from the UV-VIS spectrophotometer. From the absorption spectra, the indirect and direct optical band gaps and the Urbach energy are found to be inversely proportional to each other. As the molar fraction of the Dy2O3 increased, the optical band gaps are observed to increase as opposed to the Urbach energy. For this glass system, the values of refractive index, electronic polarizability, oxide ion polarizability and the optical basicity are found to decrease as the addition of the dysprosium oxide is increased. From the emission spectra, two intense blue and yellow emission bands are observed, which correspond to the 4F9/2 → 6H15/2 and 4F9/2 → 6H13/2 transitions of Dy3 + ions respectively. The CIE chromaticity coordinates of the zinc borotellurite glass systems are found to be located in the white light region. Generation of white light The generation of the white light can be achieved by using two emission bands which comprise of the yellow
On-line use of the 168/E emulator at the CERN ISR SFM detector
International Nuclear Information System (INIS)
Bertuzzi, C.; Drijard, D.; Frehse, H.; Gavillet, P.; Gokieli, R.; Innocenti, P.G.; Messerli, R.; Mornacchi, G.; Norton, A.; Porte, J.P.
1981-01-01
The Split Field Magnet Detector at the CERN ISR has been used in recent years to study events with a high transverse momentum charged particle. As a first level computer based trigger a linear estimate of the track momentum by fixed point arithmethic was calculated on-line by a minicomputer. In addition appreciable further rejection was obtained by off-line filtering on the IBM-370/168, using pattern recognition and a fit of the triggering particle in the magnetic field. The availability of the 168/E emulator makes it possible to transfer the proven methods used off-line to real time data reduction. Preliminary results on filter efficiency and speed for an experiment triggering on a high Psub(T) hadron at 10 to 20 0 with respect to the outgoing beam (Exp. R 419) are given. Possible improvements and extensions are discussed. (orig.)
International Nuclear Information System (INIS)
Hu, Yumei; Jia, Shiru; Ren, Feifei; Huang, Chun-Hsiang; Ko, Tzu-Ping; Mitchell, Douglas A.; Guo, Rey-Ting; Zheng, Yingying
2012-01-01
A bacteria biofilm formation involved enzyme, BsYisP, from Bacillus subtilis subsp. subtilis strain 168, was crystallized and diffracted to 1.92 Å. YisP is an enzyme involved in the pathway of biofilm formation in bacteria and is predicted to possess squalene synthase activity. A BlastP search using the YisP protein sequence from Bacillus subtilis subsp. subtilis strain 168 shows that it shares 23% identity with the dehydrosqualene synthase from Staphylococcus aureus. The YisP from B. subtilis 168 was expressed in Escherichia coli and the recombinant protein was purified and crystallized. The crystals, which belong to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 43.966, b = 77.576, c = 91.378 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.92 Å resolution. Structure determination using MAD and MIR methods is in progress
Dysprosium, the balance problem, and wind power technology
International Nuclear Information System (INIS)
Elshkaki, Ayman; Graedel, T.E.
2014-01-01
Highlights: • We investigate the impacts of the increasing market share of wind power on the demand and supply of REE. • The analysis is carried out using a dynamic material flow and stock model and three scenarios for Dy supply. • The supply of Dy from all deposits will likely lead to an oversupply of the total REEs, Nd, La, Ce and Y. • The supply of Dy from critical REE or Dy rich deposits will likely lead to an oversupply of Ce and Y only. • Large quantities of thorium will be co-produced as a result of Dy demand that needs to be managed carefully. - Abstract: Wind power technology is one of the cleanest electricity generation technologies that are expected to have a substantial share in the future electricity mix. Nonetheless, the expected increase in the market share of wind technology has led to an increasing concern of the availability, production capacity and geographical concentration of the metals required for the technology, especially the rear earth elements (REE) neodymium (Nd) and the far less abundant dysprosium (Dy), and the impacts associated with their production. Moreover, Nd and Dy are coproduced with other rare earth metals mainly from iron, titanium, zirconium, and thorium deposits. Consequently, an increase in the demand for Nd and Dy in wind power technology and in their traditional applications may lead to an increase in the production of the host metals and other companion REE, with possible implications on their supply and demand. In this regard, we have used a dynamic material flow and stock model to study the impacts of the increasing demand for Nd and Dy on the supply and demand of the host metals and other companion REE. In one scenario, when the supply of Dy is covered by all current and expected producing deposits, the increase in the demand for Dy leads to an oversupply of 255 Gg of total REE and an oversupply of the coproduced REE Nd, La, Ce and Y. In the second and third scenarios, however, when the supply of Dy is
DEFF Research Database (Denmark)
Mosbech, Anna; Lukas, Claudia; Bekker-Jensen, Simon
2013-01-01
Protein recruitment to DNA double-strand breaks (DSBs) relies on ubiquitylation of the surrounding chromatin by the RING finger ubiquitin ligases RNF8 and RNF168. Flux through this pathway is opposed by several deubiquitylating enzymes (DUBs), including OTUB1 and USP3. By analyzing the effect...... of individually overexpressing the majority of human DUBs on RNF8/RNF168-mediated 53BP1 retention at DSB sites, we found that USP44 and USP29 powerfully inhibited this response at the level of RNF168 accrual. Both USP44 and USP29 promoted efficient deubiquitylation of histone H2A, but unlike USP44, USP29...... displayed non-specific reactivity towards ubiquitylated substrates. Moreover, USP44 but not other H2A DUBs was recruited to RNF168-generated ubiquitylation products at DSB sites. Individual depletion of these DUBs only mildly enhanced accumulation of ubiquitin conjugates and 53BP1 at DSBs, suggesting...
Fukuda, Takamitsu; Matsumura, Kazuya; Ishikawa, Naoto
2013-10-10
Nuclear spin driven quantum tunneling of magnetization (QTM) phenomena, which arise from admixture of more than two orthogonal electronic spin wave functions through the couplings with those of the nuclear spins, are one of the important magnetic relaxation processes in lanthanide single molecule magnets (SMMs) in the low temperature range. Although recent experimental studies have indicated that the presence of the intramolecular f-f interactions affects their magnetic relaxation processes, little attention has been given to their mechanisms and, to the best of our knowledge, no rational theoretical models have been proposed for the interpretations of how the nuclear spin driven QTMs are influenced by the f-f interactions. Since quadruple-decker phthalocyanine complexes with two terbium or dysprosium ions as the magnetic centers show moderate f-f interactions, these are appropriate to investigate the influence of the f-f interactions on the dynamic magnetic relaxation processes. In the present paper, a theoretical model including ligand field (LF) potentials, hyperfine, nuclear quadrupole, magnetic dipolar, and the Zeeman interactions has been constructed to understand the roles of the nuclear spins for the QTM processes, and the resultant Zeeman plots are obtained. The ac susceptibility measurements of the magnetically diluted quadruple-decker monoterbium and diterbium phthalocyanine complexes, [Tb-Y] and [Tb-Tb], have indicated that the presence of the f-f interactions suppresses the QTMs in the absence of the external magnetic field (H(dc)) being consistent with previous reports. On the contrary, the faster magnetic relaxation processes are observed for [Tb-Tb] than [Tb-Y] at H(dc) = 1000 Oe, clearly demonstrating that the QTMs are rather enhanced in the presence of the external magnetic field. Based on the calculated Zeeman diagrams, these observations can be attributed to the enhanced nuclear spin driven QTMs for [Tb-Tb]. At the H(dc) higher than 2000 Oe, the
DEFF Research Database (Denmark)
Smeenk, G.; Wiegant, W.W.; Luijsterburg, M.S.
2013-01-01
Ionizing radiation (IR)-induced DNA double-strand breaks (DSBs) arising in native chromatin elicit an RNF8/RNF168-dependent ubiquitylation response, which triggers the recruitment of various repair factors. Precisely how this response is regulated in the context of chromatin remains largely...... unexplored. Here, we show that SMARCA5/SNF2H, the catalytic subunit of ISWI chromatin remodeling complexes, is recruited to DSBs in a poly(ADP-ribose) polymerase 1 (PARP1)-dependent manner. Remarkably, PARP activity, although dispensable for the efficient spreading of νH2AX into damaged chromatin......, selectively promotes spreading of SMARCA5, the E3 ubiquitin ligase RNF168, ubiquitin conjugates and the ubiquitin-binding factors RAD18 and the RAP80-BRCA1 complex throughout DSB-flanking chromatin. This suggests that PARP regulates the spatial organization of the RNF168-driven ubiquitin response to DNA...
Measurement on K-electron capture probabilities in the decay of [sup 183]Re and [sup 168]Tm
Energy Technology Data Exchange (ETDEWEB)
Prasad, N.V.S.V.; Rao, M.V.S.C.; Reddy, S.B.; Satyanarayana, G.; Sastry, D.L. (Andhra Univ., Visakhapatnam (India). Swami Jnanananda Labs. for Nuclear Research); Murty, G.S.K. (UNDNJ, Newark, NJ (United States). Dept. of Radiology); Chintalapudi, S.N. (Inter University Consortium for DAE Facilities, Calcutta (India))
1994-03-01
The K-electron capture probabilities for the 5/2[sup +] to 3/2[sup -]transition in the electron capture decay of [sup 183]Re to the 208.805 keV level in the daughter [sup 183]W and for the 3[sup (+)] to 3[sup -]and 3[sup (+)] to 4[sup -] transitions in the electron capture decay of [sup 168]Tm to the 1541.4 keV and 1093.0 keV levels, respectively, in the daughter [sup 168]Er were measured for the first time using an x-[gamma] summing method. The experimental P[sub K] values are reported in this paper, together with those due to theory, and discussed. (Author).
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Advertising of unregistered pesticides... ENFORCEMENT POLICIES AND INTERPRETATIONS Advertising § 168.22 Advertising of unregistered pesticides.... EPA interprets these provisions as extending to advertisements in any advertising medium to which...
Compounds of divalent thulium, neodymium, and dysprosium
International Nuclear Information System (INIS)
Bochkarev, M.N.; Fedushkin, I.L.; Trifonov, A.A.; Fagin, A.A.; Kirillov, E.N.
1998-01-01
Full text: Judging on the Ln(II)/Ln(III) potentials Tm, Nd, and Dy are the first candidates after Sm, Eu, and Yb for the preparation of Ln(II) compounds. The first molecular Tm(II) derivatives, TmI 2 (DME) 3 (I), has been obtained recently by the reduction of TmI 3 with thulium metal in DME (1,2-dimethoxyethane). The tetrahydrofuran (THF) analogue, TmI 2 (THF) 5 , was synthesized similarly. In the case of TmBI 3 and TmCl 3 the same reaction does not occur. The compound I is inert toward naphthalene, anthracene, phenylacetylene, CpH, (Me 3 Si) 2 NH, 2,4,6-t-Bu 3 C 6 H 2 OH, Cp 2 V, Cp 2 Fe, or Cp 3 Er. The reactions of I with PhOH, Ph 3 COH, 3,6-t-Bu 2 C 6 H 2 (OH) 2 -1,2 (Cat), and calixarene (Cal) produce, Ph 3 COTmI 2 (DME) 2 , (Cat)TmI(DME) 2 , and (Cal)TmI, correspondingly. The attempts to use I for preparation of the other Tm(II) complexes failed. In all cases (reactions with C 10 H 8 Li, CpK, [1,3-(Me 3 Si) 2 C 5 H 3 ]MgCl, and [Cp'-SiMe 2 -Ind']K 2 ) the Tm(III) derivatives (respectively, (C 10 H 8 Tm) 2 C 10 H 8 , Cp 3 Tm, [1,3-(Me 3 Si) 2 C 5 H 3 ] 2 TmCl, and Cp'-SiMe 2 -Ind')TmI) were obtained. The new stable Tm(II) complex, PhOTmI(DME) 2 (II), has been synthesized by the reduction of I with potassium metal in DME. The product was isolated as the green crystals with μ eff 4.6 BM. Unlike TmI 3 , NdI 3 and DyI 3 can not be reduced by metallic neodymium, dysprosium or sodium in DME or THF. Re-investigation of the product formed in the reaction of NdCl 3 with a lack of Li and naphthalene which was claimed before as NdCl 2 (THF) 2 has shown that this is a mixture of Nd(III) naphthalene complexes of the type [(NdCl 2 (THF) 2 ]nC 10 H 8 (n = 4- 7) (III). Nevertheless the product may be used instead of NdCl 2 for the preparation of RNdCl 2 type complexes. The reactions of III with t-BuNCH=CHNBu-t (DAD), PhCH=CHCH=CHPh (DBD), and PhCH=CHPh afford (DAD)NdCl 2 (THF) 2 , (DBD)[NdCl 2 (THF) 2 ] 2 , and (PhCHCHPh)[NdCl 2 ] 2 (THF) 3 , respectively. The iodides of Nd
Czech Academy of Sciences Publication Activity Database
Mrázek, Jan; Potel, M.; Buršík, Jiří; Mráček, A.; Kallistová, Anna; Jonášová, Šárka; Boháček, Jan; Kašík, Ivan
2015-01-01
Roč. 168, November (2015), s. 159-167 ISSN 0254-0584 Institutional support: RVO:67985882 ; RVO:68081723 ; RVO:67985831 Keywords : Ceramics * Inorganic compounds * Optical materials Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering; JG - Metallurgy (UFM-A); CB - Analytical Chemistry, Separation (GLU-S) Impact factor: 2.101, year: 2015
Lifetime measurement in {sup 168}Yb using the recoil distance Doppler shift (RDDS) method
Energy Technology Data Exchange (ETDEWEB)
Reese, Michael; Moeller, Oliver; Pietralla, Norbert [TU Darmstadt (Germany); Dewald, Alfred; Pissulla, Thomas [Universitaet Koeln (Germany); Petkov, Pavel [Universitaet Koeln (Germany); INRNE, Bulgarian Academy of Sciences, Sofia (Bulgaria)
2009-07-01
In the analysis of coincidence RDDS experiments one uses the Differential Decay Curve (DDC) Method to determine lifetimes of excited states. Experiments with small recoil velocities, thus small Doppler shifts, enforce the use of narrow coincidence gates to determine peak intensities. This results in a loss of statistics. As an alternative to the application of gates, we present the fit of 2-dimensional functions to the {gamma}{gamma} coincidence data. This approach has been studied on data taken in a RDDS measurement for the ground state band of {sup 168}Yb. The {sup 18}O({sup 154}Sm,4n){sup 168}Yb{sup *} fusion evaporation reaction was induced by an 80 MeV ion beam of the tandem accelerator facility in Cologne. The target was mounted in the Cologne coincidence plunger device. Lifetimes from the 4{sub 1}{sup +} to the 10{sub 1}{sup +} states have been extracted. The method is discussed and the results are compared to the CBS rotor model in the context of centrifugal stretching.
Melo, Fernando Menegatti de; Almeida, Sabrina da Nobrega; Uezu, Noemi Saori; Ramirez, Carlos Alberto Ospina; Santos, Antonio Domingues Dos; Toma, Henrique Eisi
2018-06-01
The extraction of dysprosium (Dy3+) ions from aqueous solution was carried out successfully, using magnetite (Fe3O4) nanoparticles functionalized with diethylenetriaminepentaacetic acid (MagNP@DTPA). The process was monitored by energy dispersive X-ray fluorescence spectroscopy, as a function of concentration, proceeding according to a Langmuir isotherm with an equilibrium constant of 2.57 × 10-3 g(MagNP) L-1 and a saturation limit of 63.2 mgDy/gMagNP. The presence of paramagnetic Dy3+ ions attached to the superparamagnetic nanoparticles led to an overall decrease of magnetization. By imaging the nanoparticles surface using scanning transmission electron microscopy equipped with high resolution elemental analysis, it was possible to probe the binding of the Dy3+ ions to DTPA, and to show their distribution in a region of negative magnetic field gradients. This finding is coherent with the observed decrease of magnetization, associated with the antiferromagnetic coupling between the lanthanide ions and the Fe3O4 core.
Rotational bands in the nuclear sup(168)Er and some remarks on their interpretation
International Nuclear Information System (INIS)
Davidson, W.F.; Dixon, W.R.; Storey, R.S.
1984-01-01
Further analysis of previously published data on sup(168)Er, together with results of new measurements of selected portions of the neutron capture γ-ray spectrum, has resulted in the construction of an improved level spectrum for this nucleus. Altogether 127 excited levels have now been established and grouped into 36 rotational bands. Some remarks on their interpretation are advanced
About octupole states in the 158Dy and the 168Er nuclei
International Nuclear Information System (INIS)
Kvasil, Ya.; Chariev, M.M.; Choriev, B.
1984-01-01
The properties of negative parity low-lying states in 158 Dy and 168 Er in the random phase approximation based on the cranking model are investigated. Octupole-octupole forces have been used as a residual interaction. Calculated energy levels are compared with the experimental ones, and also with the energy values obtained with making allowance for dipole-dipole, octupole-octupole and dipole-octupole type forces. The resuits of calculation by the used model permit to understand the nature of negative parity low-lying states
26 CFR 1.168(i)-0 - Table of contents for the general asset account rules.
2010-04-01
... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Table of contents for the general asset account... and Corporations § 1.168(i)-0 Table of contents for the general asset account rules. This section...) Irrevocable election. (2) Time for making election. (3) Manner of making election. (l) Effective date. (1) In...
Tárkányi, F; Ditrói, F; Takács, S; Hermanne, A; Ignatyuk, A V
2015-04-01
Activation cross-sections data of longer-lived products of proton induced nuclear reactions on dysprosium were extended up to 65MeV by using stacked foil irradiation and gamma spectrometry experimental methods. Experimental cross-sections data for the formation of the radionuclides (159)Dy, (157)Dy, (155)Dy, (161)Tb, (160)Tb, (156)Tb, (155)Tb, (154m2)Tb, (154m1)Tb, (154g)Tb, (153)Tb, (152)Tb and (151)Tb are reported in the 36-65MeV energy range, and compared with an old dataset from 1964. The experimental data were also compared with the results of cross section calculations of the ALICE and EMPIRE nuclear model codes and of the TALYS nuclear reaction model code as listed in the latest on-line libraries TENDL 2013. Copyright © 2015. Published by Elsevier Ltd.
Bekker, Pirow; Dairaghi, Daniel; Seitz, Lisa; Leleti, Manmohan; Wang, Yu; Ertl, Linda; Baumgart, Trageen; Shugarts, Sarah; Lohr, Lisa; Dang, Ton; Miao, Shichang; Zeng, Yibin; Fan, Pingchen; Zhang, Penglie; Johnson, Daniel; Powers, Jay; Jaen, Juan; Charo, Israel; Schall, Thomas J
2016-01-01
The complement 5a receptor has been an attractive therapeutic target for many autoimmune and inflammatory disorders. However, development of a selective and potent C5aR antagonist has been challenging. Here we describe the characterization of CCX168 (avacopan), an orally administered selective and potent C5aR inhibitor. CCX168 blocked the C5a binding, C5a-mediated migration, calcium mobilization, and CD11b upregulation in U937 cells as well as in freshly isolated human neutrophils. CCX168 retains high potency when present in human blood. A transgenic human C5aR knock-in mouse model allowed comparison of the in vitro and in vivo efficacy of the molecule. CCX168 effectively blocked migration in in vitro and ex vivo chemotaxis assays, and it blocked the C5a-mediated neutrophil vascular endothelial margination. CCX168 was effective in migration and neutrophil margination assays in cynomolgus monkeys. This thorough in vitro and preclinical characterization enabled progression of CCX168 into the clinic and testing of its safety, tolerability, pharmacokinetic, and pharmacodynamic profiles in a Phase 1 clinical trial in 48 healthy volunteers. CCX168 was shown to be well tolerated across a broad dose range (1 to 100 mg) and it showed dose-dependent pharmacokinetics. An oral dose of 30 mg CCX168 given twice daily blocked the C5a-induced upregulation of CD11b in circulating neutrophils by 94% or greater throughout the entire day, demonstrating essentially complete target coverage. This dose regimen is being tested in clinical trials in patients with anti-neutrophil cytoplasmic antibody-associated vasculitis. Trial Registration ISRCTN registry with trial ID ISRCTN13564773.
2010-04-01
... investment tax credit to a party other than the ultimate user of the property. [Reserved] 5c.168(f)(8)-9...) INCOME TAX (CONTINUED) TEMPORARY INCOME TAX REGULATIONS UNDER THE ECONOMIC RECOVERY TAX ACT OF 1981 § 5c.168(f)(8)-9 Pass-through leases—transfer of only the investment tax credit to a party other than the...
Omony, Jimmy; de Jong, Anne; Krawczyk, Antonina O; Eijlander, Robyn T; Kuipers, Oscar P
2018-02-09
Sporulation is a survival strategy, adapted by bacterial cells in response to harsh environmental adversities. The adaptation potential differs between strains and the variations may arise from differences in gene regulation. Gene networks are a valuable way of studying such regulation processes and establishing associations between genes. We reconstructed and compared sporulation gene co-expression networks (GCNs) of the model laboratory strain Bacillus subtilis 168 and the food-borne industrial isolate Bacillus amyloliquefaciens. Transcriptome data obtained from samples of six stages during the sporulation process were used for network inference. Subsequently, a gene set enrichment analysis was performed to compare the reconstructed GCNs of B. subtilis 168 and B. amyloliquefaciens with respect to biological functions, which showed the enriched modules with coherent functional groups associated with sporulation. On basis of the GCNs and time-evolution of differentially expressed genes, we could identify novel candidate genes strongly associated with sporulation in B. subtilis 168 and B. amyloliquefaciens. The GCNs offer a framework for exploring transcription factors, their targets, and co-expressed genes during sporulation. Furthermore, the methodology described here can conveniently be applied to other species or biological processes.
26 CFR 1.168A-6 - Depreciation of portion of emergency facility not subject to amortization.
2010-04-01
... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Depreciation of portion of emergency facility... for Individuals and Corporations § 1.168A-6 Depreciation of portion of emergency facility not subject... in lieu of any deduction for depreciation which would otherwise be allowable under section 167 is...
Directory of Open Access Journals (Sweden)
Pirow Bekker
Full Text Available The complement 5a receptor has been an attractive therapeutic target for many autoimmune and inflammatory disorders. However, development of a selective and potent C5aR antagonist has been challenging. Here we describe the characterization of CCX168 (avacopan, an orally administered selective and potent C5aR inhibitor. CCX168 blocked the C5a binding, C5a-mediated migration, calcium mobilization, and CD11b upregulation in U937 cells as well as in freshly isolated human neutrophils. CCX168 retains high potency when present in human blood. A transgenic human C5aR knock-in mouse model allowed comparison of the in vitro and in vivo efficacy of the molecule. CCX168 effectively blocked migration in in vitro and ex vivo chemotaxis assays, and it blocked the C5a-mediated neutrophil vascular endothelial margination. CCX168 was effective in migration and neutrophil margination assays in cynomolgus monkeys. This thorough in vitro and preclinical characterization enabled progression of CCX168 into the clinic and testing of its safety, tolerability, pharmacokinetic, and pharmacodynamic profiles in a Phase 1 clinical trial in 48 healthy volunteers. CCX168 was shown to be well tolerated across a broad dose range (1 to 100 mg and it showed dose-dependent pharmacokinetics. An oral dose of 30 mg CCX168 given twice daily blocked the C5a-induced upregulation of CD11b in circulating neutrophils by 94% or greater throughout the entire day, demonstrating essentially complete target coverage. This dose regimen is being tested in clinical trials in patients with anti-neutrophil cytoplasmic antibody-associated vasculitis. Trial Registration ISRCTN registry with trial ID ISRCTN13564773.
Energy Technology Data Exchange (ETDEWEB)
Sahu, Ishwar Prasad, E-mail: ishwarprasad1986@gmail.com [School of Studies in Physics & Astrophysics, Pt. Ravishankar Shukla University, Raipur, C.G. 492010 (India); Chandrakar, Priya; Baghel, R.N.; Bisen, D.P.; Brahme, Nameeta [School of Studies in Physics & Astrophysics, Pt. Ravishankar Shukla University, Raipur, C.G. 492010 (India); Tamrakar, Raunak Kumar [Department of Applied Physics, Bhilai Institute of Technology, Durg, C.G. 491001 (India)
2015-11-15
Dysprosium doped calcium magnesium silicate (CaMgSi{sub 2}O{sub 6}:Dy{sup 3+}) white light emitting phosphor was synthesized by solid state reaction process. The crystal structure of sintered phosphor was monoclinic structure with space group C2/c. Chemical composition of the sintered CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor was confirmed by EDX. The prepared CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor was excited from 352 nm and their corresponding emission spectra were recorded at blue (470 nm), yellow (570 nm) and red (675 nm) line due to the {sup 4}F{sub 9/2} → {sup 6}H{sub 15/2}, {sup 4}F{sub 9/2} → {sup 6}H{sub 13/2}, {sup 4}F{sub 9/2} → {sup 6}H{sub 11/2} transitions of Dy{sup 3+} ions. The combination of these three emissions constituted as white light confirmed by the Commission Internationale de L'Eclairage (CIE) chromatic coordinate diagram. The possible mechanism of the white light emitting long lasting CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor was also investigated. Investigation on afterglow property show that phosphor held fast and slow decay process. The peak of mechanoluminescence (ML) intensity increases linearly with increasing impact velocity of the moving piston. Thus the present investigation indicates that the local piezoelectricity-induced electron bombardment model is responsible to produce ML in prepared CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor. - Highlights: • The crystal structure of CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor is consistent with standard monoclinic structure. • CIE coordinates of CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor is suitable as white light emitting phosphor. • The local piezoelectricity-induced electron bombardment model is responsible to produce ML in CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor.
International Nuclear Information System (INIS)
NSTec Environmental Restoration
2007-01-01
Corrective Action Unit (CAU) 168 is identified in the Federal Facility Agreement and Consent Order of 1996 as Area 25 and 26 Contaminated Materials and Waste Dumps. CAU 168 consists of twelve Corrective Action Sites (CASs) in Areas 25 and 26 of the Nevada Test Site, which is approximately 105 kilometers (65 miles) northwest of Las Vegas, Nevada. The CASs contain surface and subsurface debris, impacted soil, and contaminated materials. Site characterization activities were conducted in 2002, and the results are presented in the Corrective Action Decision Document (CADD) for CAU 168 (U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office [NNSA/NSO], 2006). Site characterization results indicated that soil at several sites exceeded the clean-up criteria for total petroleum hydrocarbons (TPH), polychlorinated biphenyls (PCBs), and radionuclides. The Nevada Division of Environmental Protection approved the proposed corrective actions specified in the CADD (NNSA/NSO, 2006). The approved corrective actions include no further action, clean closure, and closure in place with administrative controls
Magnetic anisotropy and neutron scattering studies of some rare earth metals
International Nuclear Information System (INIS)
Day, R.
1978-08-01
The thesis is concerned with magnetic anisotropy of dysprosium and alloys of gadolinium: yttrium, and also neutron scattering studies of dysprosium. The experiments are discussed under the topic headings: magnetic anisotropy, rare earths, torque measurements, elastic neutron scattering, inelastic neutron scattering, dysprosium measurements, and results for the gadolinium: yttrium alloys. (U.K.)
Directory of Open Access Journals (Sweden)
Justin W Leung
2014-03-01
Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.
G. Smeenk (Godelieve); W.W. Wiegant (Wouter); J.A. Marteijn (Jurgen); M.S. Luijsterburg (Martijn); N. Sroczynski (Nicholas); T. Costelloe (Thomas); R. Romeijn (Ron); A. Pastink (Albert); N. Mailand (Niels); W. Vermeulen (Wim); H. van Attikum (Haico)
2013-01-01
textabstractIonizing radiation (IR)-induced DNA double-strand breaks (DSBs) arising in native chromatin elicit an RNF8/RNF168-dependent ubiquitylation response, which triggers the recruitment of various repair factors. Precisely how this response is regulated in the context of chromatin remains
RPA method based on the self-consistent cranking model for 168Er and 158Dy
International Nuclear Information System (INIS)
Kvasil, J.; Cwiok, S.; Chariev, M.M.; Choriev, B.
1983-01-01
The low-lying nuclear states in 168 Er and 158 Dy are analysed within the random phase approximation (RPA) method based on the self-consistent cranking model (SCCM). The moment of inertia, the value of chemical potential, and the strength constant k 1 have been obtained from the symmetry condition. The pairing strength constants Gsub(tau) have been determined from the experimental values of neutron and proton pairing energies for nonrotating nuclei. A quite good agreement with experimental energies of states with positive parity was obtained without introducing the two-phonon vibrational states
Early complications after pneumonectomy: retrospective study of 168 patients.
Alloubi, Ihsan; Jougon, Jacques; Delcambre, Frédéric; Baste, Jean Marc; Velly, Jean François
2010-08-01
The purpose of this study was to assess the mortality and risk factors of complications after pneumonectomy for lung cancer. Between 1996 and 2001, we reviewed and analysed the demographic, clinical, functional, and surgical variables of 168 patients to identify risk factors of postoperative complications by univariate and multivariate analyses with Medlog software system. The mean age was 60+/-10 years, overall mortality and morbidity rates were 4.17% and 41.6%, respectively. All frequencies of respiratory complications were 1.2% for acute respiratory failure, 10.1% for pneumonia, 2.4% for acute pulmonary oedema, 4.17% for bronchopleural fistula, 2.4% for thoracic empyema and 18.5% for left recurrent nerve injuries. Postoperative arrhythmias developed in 46% of our patients. The risk factors for cardiopulmonary morbidity and mortality with univariate analysis were advanced age (P<0.01), preoperative poor performance status (P<0.015), and chronic artery disease (P<0.008). Factors adversely affecting morbidity with multivariate analysis included age (P=0.0001), associated cardiovascular disease (P=0.001), and altered forced expiratory volume in 1 s (P=0.0005). Complications after pneumonectomy are associated with high mortality. Careful attention must be paid to patients with advanced age and heart disease. Chest physiotherapy is paramount to have uneventful outcomes.
2010-04-01
... 26 Internal Revenue 3 2010-04-01 2010-04-01 false Limitations on investment tax credit and... Limitations on investment tax credit and recovery deductions under section 168 for passenger automobiles and... the amount of investment tax credit determined under section 46(a) and recovery deductions under...
2010-10-01
... SERVICES TRIBAL SELF-GOVERNANCE Operational Provisions Audits and Cost Principles § 137.168 May the Secretary require audit or accounting standards other than those specified in § 137.167? No, no other audit... 42 Public Health 1 2010-10-01 2010-10-01 false May the Secretary require audit or accounting...
sdg interacting-boson model in the SU(3) scheme and its application to 168Er
Yoshinaga, N.; Akiyama, Y.; Arima, A.
1988-07-01
The sdg interacting-boson model is presented in the SU(3) tensor formalism. The interactions are decomposed according to their SU(3) tensor character. The existence of the SU(3)-seniority preserving operator is found to be important. The model is applied to 168Er. Energy levels and electromagnetic transitions are calculated. This model is shown to solve the problem of anharmonicity regarding the excitation energy of the first Kπ=4+ band relative to that of the first Kπ=2+ one. E4 transitions are calculated to give different predictions from those by the quasiparticle-phonon nuclear model.
Distribución de los elementos Cu-Pb-Zn en suelos de la plancha 168 (Argelia).
Sánchez-Arredondo, Luis Hernán
2014-01-01
El objetivo de este estudio fue el análisis espacial de los elementos cobre, plomo y cinc en horizontes A de suelos de la plancha geológica 168 (Argelia), región sureste del departamento de Antioquia Colombia. Las muestras utilizadas hacen parte del programa "Levantamiento y Compilación de Información Geoquímica-Mapas Regionales-Ingeominas (Colombia)" y fueron facilitadas por INGEOMINAS (hoy Servicio Geológico Colombiano) para el proyecto "Mapa Geoquímico de Antioquia". Para la elaboración de...
Wang, Meizhou; Xu, Meijuan; Rao, Zhiming; Yang, Taowei; Zhang, Xian
2015-11-01
L-Ornithine, a non-protein amino acid, is usually extracted from hydrolyzed protein as well as produced by microbial fermentation. Here, we focus on a highly efficient whole-cell biocatalyst for the production of L-ornithine. The gene argI, encoding arginase, which catalyzes the hydrolysis of L-arginine to L-ornithine and urea, was cloned from Bacillus amyloliquefaciens B10-127 and expressed in GRAS strain Bacillus subtilis 168. The recombinant strain exhibited an arginase activity of 21.9 U/mg, which is 26.7 times that of wild B. subtilis 168. The optimal pH and temperature of the purified recombinant arginase were 10.0 and 40 °C, respectively. In addition, the recombinant arginase exhibited a strong Mn(2+) preference. When using whole-cell biocatalyst-based bioconversion, a hyper L-ornithine production of 356.9 g/L was achieved with a fed-batch strategy in a 5-L reactor within 12 h. This whole-cell bioconversion study demonstrates an environmentally friendly strategy for L-ornithine production in industry.
Study on Magnetic Responsibility of Rare Earth Ferrite/Polyacrylamide Magnetic Microsphere
Institute of Scientific and Technical Information of China (English)
Zhang Ming; Wang Zhifeng; Zhang Hong; Dai Shaojun; Qiu Guanming; Okamoto Hiroshi
2005-01-01
In inverse microemulsion, rare earth ferrite/polyacrylamide magnetic microsphere were prepared and their magnetic responsibility were studied by magnetic balance. Results indicate that the magnetic responsibility of microsphere relates to magnetic moment of rare earth ion, and it can be improved by the addition of dysprosium ion of high magnetic moment. Dysprosium content has an effect on magnetic responsibility of dysprosium ferrite/polyacrylamide magnetic microsphere. The microsphere displays strong magnetic responsibility when the molar ratio of Dy3+/iron is 0.20.
Directory of Open Access Journals (Sweden)
Ali Akbar Moosavi-Movahedi
2009-09-01
Full Text Available A new detection technique called Fast Fourier Transform Square-Wave Voltammetry (FFT SWV is based on measurements of electrode admittance as a function of potential. The response of the detector (microelectrode, which is generated by a redox processes, is fast, which makes the method suitable for most applications involving flowing electrolytes. The carbon paste electrode was modified by nanostructures to improve sensitivity. Synthesized dysprosium nanowires provide a more effective nanotube-like surface [1-4] so they are good candidates for use as a modifier for electrochemical reactions. The redox properties of diclofenac were used for its determination in human serum and urine samples. The support electrolyte that provided a more defined and intense peak current for diclofenac determination was a 0.05 mol L−1 acetate buffer pH = 4.0. The drug presented an irreversible oxidation peak at 850 mV vs. Ag/AgCl on a modified nanowire carbon paste electrode which produced high current and reduced the oxidation potential by about 100 mV. Furthermore, the signal-to-noise ratio was significantly increased by application of a discrete Fast Fourier Transform (FFT method, background subtraction and two-dimensional integration of the electrode response over a selected potential range and time window. To obtain the much sensivity the effective parameters such as frequency, amplitude and pH was optimized. As a result, CDL of 2.0 × 10−9 M and an LOQ of 5.0 × 10−9 M were found for the determination for diclofenac. A good recovery was obtained for assay spiked urine samples and a good quantification of diclofenac was achieved in a commercial formulation.
Kitevski-Leblanc, Julianne; Fradet-Turcotte, Amélie; Kukic, Predrag; Wilson, Marcus D.; Portella, Guillem; Yuwen, Tairan; Panier, Stephanie; Duan, Shili; Canny, Marella D.; Van Ingen, Hugo; Arrowsmith, Cheryl H.; Rubinstein, John L.; Vendruscolo, Michele; Durocher, Daniel; Kay, Lewis E
2017-01-01
Site-specific histone ubiquitylation plays a central role in orchestrating the response to DNA double-strand breaks (DSBs). DSBs elicit a cascade of events controlled by the ubiquitin ligase RNF168, which promotes the accumulation of repair factors such as 53BP1 and BRCA1 on the chromatin flanking
Sdg interacting-boson model in the SU(3) scheme and its application to /sup 168/Er
International Nuclear Information System (INIS)
Yoshinaga, N.; Akiyama, Y.; Arima, A.
1988-01-01
The sdg interacting-boson model is presented in the SU(3) tensor formalism. The interactions are decomposed according to their SU(3) tensor character. The existence of the SU(3)-seniority preserving operator is found to be important. The model is applied to /sup 168/Er. Energy levels and electromagnetic transitions are calculated. This model is shown to solve the problem of anharmonicity regarding the excitation energy of the first K/sup π/ = 4 + band relative to that of the first K/sup π/ = 2 + one. E4 transitions are calculated to give different predictions from those by the quasiparticle-phonon nuclear model
Energy Technology Data Exchange (ETDEWEB)
Narjis, A., E-mail: narjis78@gmail.com [Research Group ESNPS, Physics Department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); El Kaaouachi, A.; Limouny, L.; Dlimi, S.; Errai, M.; Sybous, A. [Research Group ESNPS, Physics Department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); Kumaresavanji, M. [Centro Brasileiro de Pesquisas Fisicas (CBPF), Rua Dr. Xavier Sigaud, 150 Urca, Rio de Janeiro (Brazil)
2013-04-15
The transport properties in the La{sub 1.32}Sr{sub 1.68}Mn{sub 2}O{sub 7} layered manganite system have been studied in the presence of magnetic field up to 5 T. An analysis of the low temperature (T<45 K) dependence of the resistivity under hydrostatic pressure up to 25 kbars shows the spin-dependent Coulomb Blockade phenomenon. The surface phase and the link condition in grain boundaries are suggested to be responsible for the magnetoresistance data while influencing the charge transfer probability between grains. - Highlights: ►Magnetotransport in a colossal magnetoresistive material La{sub 1.32}Sr{sub 1.68}Mn{sub 2}O{sub 7}. ► The effect of the forming pressure on the magnetoresistance (MR). ► The grain size effect and charge transfer probability between grains. ► A simple model to explain the negative MR.
International Nuclear Information System (INIS)
Oka, Yasuyoshi; Suzuki, Keiji; Yamauchi, Motohiro; Mitsutake, Norisato; Yamashita, Shunichi
2011-01-01
Highlights: → NIPBL is recruited to DSBs. → Localization of NIPBL to DSBs is regulated by MDC1 and RNF168. → HP1γ is required for NIPBL accumulation at DSBs. -- Abstract: The cohesin loading factor NIPBL is required for cohesin to associate with chromosomes and plays a role in DNA double-strand break (DSB) repair. Although the NIPBL homolog Scc2 is recruited to an enzymatically generated DSB and promotes cohesin-dependent DSB repair in yeast, the mechanism of the recruitment remains poorly understood. Here we show that the human NIPBL is recruited to the sites of DNA damage generated by micro-irradiation as well as to the sites of DSBs induced by homing endonuclease, I-PpoI. The recruitment of NIPBL was impaired by RNAi-mediated knockdown of MDC1 or RNF168, both of which also accumulate at DSBs. We also show that the recruitment of NIPBL to the sites of DNA damage is mediated by its C-terminal region containing HEAT repeats and Heterochromatin protein 1 (HP1) interacting motif. Furthermore, NIPBL accumulation at damaged sites was also compromised by HP1γ depletion. Taken together, our study reveals that human NIPBL is a novel protein recruited to DSB sites, and the recruitment is controlled by MDC1, RNF168 and HP1γ.
Energy Technology Data Exchange (ETDEWEB)
Sahota, H S; Hasiza, M L; Mittal, R [Punjabi Univ., Patiala (India). Dept. of Physics
1976-06-01
The 2sub(..gamma..)..-->..2sub(g) transition in /sup 168/Er has been examined for the presence of electric monopole contribution. The experimental E0/E2 reduced transition probabilities and monopole matrix element have been found to be somewhat larger than the theoretical predictions of the Bohr-Mottelson model but the ratio rhosup(2)/X has been found to agree well with the theoretical value. The band mixing parameters have also been evaluated and found to be sizeable.
Clinical laboratorial analysis of 168 patients with galactorrhea from different etiologic conditions
International Nuclear Information System (INIS)
Pacheco, I.H.F.
1984-01-01
This paper evaluated the data of 168 patients with galactorrhea throught factorial analysis. This method consists, initially, of an intercorrelation analysis, which serves as a base for the determination of a number of factors, one of them, which could be described as the patient's risk of having a pituitary tumour. This factor was formed, basically, by four elements: the existence of radiological changes, head pain, menstrual irregularities and the prolactin level. After the global study, the patients were analysed within the etiological subgroups, in several clinical and laboratorial aspects, as menstrual abnormalities, duration of the galactorrhea, prolactin level, dynamic tests to evaluate the prolactin secretion an the pituitary reserve, and by the therapeutic aspect. The results of the tests that measures the prolactin secretion were analysed, also, in terms of it's basal hormonal level, and have shown to be more dependent on them, than on the etiological group. We have compared the surgical, radioactive and bromocriptine treatment of pituitary tumours. There wasn't a satisfactory cure rate in any of them, which reinforces the need of an earlier recognition of these tumours. (author)
International Nuclear Information System (INIS)
Tegafaw, Tirusew; Xu, Wenlong; Ahmad, Md Wasi; Lee, Gang Ho; Baeck, Jong Su; Chang, Yongmin; Bae, Ji Eun; Chae, Kwon Seok; Kim, Tae Jeong
2015-01-01
A new type of dual-mode T_1 and T_2 magnetic resonance imaging (MRI) contrast agent based on mixed lanthanide oxide nanoparticles was synthesized. Gd"3"+ ("8S_7_/_2) plays an important role in T_1 MRI contrast agents because of its large electron spin magnetic moment resulting from its seven unpaired 4f-electrons, and Dy"3"+ ("6H_1_5_/_2) has the potential to be used in T_2 MRI contrast agents because of its very large total electron magnetic moment: among lanthanide oxide nanoparticles, Dy_2O_3 nanoparticles have the largest magnetic moments at room temperature. Using these properties of Gd"3"+ and Dy"3"+ and their oxide nanoparticles, ultrasmall mixed gadolinium-dysprosium oxide (GDO) nanoparticles were synthesized and their potential to act as a dual-mode T_1 and T_2 MRI contrast agent was investigated in vitro and in vivo. The D-glucuronic acid coated GDO nanoparticles (d_a_v_g = 1.0 nm) showed large r_1 and r_2 values (r_2/r_1 ≈ 6.6) and as a result clear dose-dependent contrast enhancements in R_1 and R_2 map images. Finally, the dual-mode imaging capability of the nanoparticles was confirmed by obtaining in vivo T_1 and T_2 MR images. (paper)
Energy Technology Data Exchange (ETDEWEB)
Vukov, Oliver, E-mail: vuko3930@mylaurier.ca [Biology Department, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada); Smith, D. Scott [Chemistry Department, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada); McGeer, James C. [Biology Department, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada)
2016-01-15
The toxicological understanding of rare earth elements (REEs) in the aquatic environment is very limited but of increasing concern. The objective of this research is to compare the toxicological effect of the REE dysprosium to the freshwater invertebrates Daphnia pulex and Hyalella azteca and in the more sensitive organism, understand the toxicity modifying influence of Ca, Na, Mg, pH and dissolved organic matter (DOM). Standard methods (Environment Canada) were followed for testing and culture in media of intermediate hardness (60 mg CaCO{sub 3} mg/L) at pH 7.8 with Ca at 0.5, Na 0.5, Mg 0.125 (mM) and 23 °C. Acute toxicity tests were done with <24 h old neonates for 48 h in the case of D. pulex and with 2–9 days old offspring for 96 h tests with Hyalella. The potential protective effect of cationic competition was tested with Ca (0.5–2.0 mM), Na (0.5–2.0 mM) and Mg (0.125–0.5 mM). The effect of pH (6.5–8.0) and Suwannee River DOM complexation (at dissolved organic carbon (DOC) concentrations of 9 and 13 mg C/L) were evaluated. Dissolved Dy concentrations were lower than total (unfiltered) indicating precipitation, particularly at higher concentrations. Acute toxicity of Dy to H. azteca and D. pulex revealed Hyalella to be 1.4 times more sensitive than Daphnia. Additions of Ca and Na but not Mg provided significant protection against Dy toxicity to Hyalella. Similarly, low pH was associated with reduction in toxicity. Exposures which were pH buffered with and without MOPS were significantly different and indicated that MOPS enhanced Dy toxicity. DOM also mitigated Dy toxicity. Biotic ligand based parameters (Log K values) were calculated based on free ion relationships as determined by geochemical equilibrium modeling software (WHAM ver. 7.02). The log K value for Dy{sup 3+} toxicity to Hyalella was 7.75 while the protective influence of Ca and Na were 3.95 and 4.10, respectively. This study contributes data towards the development of site specific
International Nuclear Information System (INIS)
Misso, Agatha Matos
2016-01-01
Ca and Mg silicates based phosphors were prepared by sol-gel method combined with the molten salts process. The gel of silica was obtained from Na 2 SiO 3 solution by using europium, dysprosium, calcium and magnesium chloride solutions. Therefore, those chlorides were homogeneously dispersed into the gel. The obtained gel was dried and heat treated to 900° C for 1h to allow the fusion of the present salts. Then it was water washed until negative test for Cl - , and dried. The reduction of the europium to Eu 2+ was performed under atmosphere of 5% of H 2 and 95% of Ar to 900° C for 3h, to reach CaMgSi 2 O 6 :Eu 2+ and CaMgSi 2 O 6 :Eu 2+ :Dy 3+ phosphors. Diopside was identified as main crystalline phase and quartz, as secondary phase from XRD (X-ray diffraction) patterns. SEM (scanning electron microscopy) micrographs, of the samples showed needles, spheres, leaves and rods of particles and agglomerates. Thermal analysis (TGA-DTGA) curves revealed that the crystallization temperature of CaMgSi 2 O 6 :Eu 2+ lies around 765° C. Photoluminescence spectroscopy of the phosphors was studied based on interconfigurational 4f N → 4f N-1 5d transition of Eu 2+ ion. The spectra of excitation showed 4f N → 4f N-1 5d transition of Eu 2+ ion broad band, related to the ligand to metal charge transfer transition (LMCT) O 2- (2p) → Eu 3+ in the 250 nm region, when the emission is monitored at 583,5 nm. It also presents the 4f ↔ 4f transitions of Eu 3+ ion bands, showing the 7 F 0 → 5 L 6 transition at 393 nm. From emission spectra with excitation monitored at 393 nm, it can be observed fine peaks between 570 and 750 nm which are characteristics of 5 D 0 → 7 F J (J = 0 - 5) transition of Eu 3+ ion, indicating that the Eu 3+ ion occupies a site with center of inversion. Finally, the obtained results indicate that the developed method is suitable to synthesize CaMgSi 2 O 6 :Eu 2+ and CaMgSi 2 O 6 :Eu 2+ :Dy 3+ phosphors, as it has been proposed. (author)
International Nuclear Information System (INIS)
Vukov, Oliver; Smith, D. Scott; McGeer, James C.
2016-01-01
The toxicological understanding of rare earth elements (REEs) in the aquatic environment is very limited but of increasing concern. The objective of this research is to compare the toxicological effect of the REE dysprosium to the freshwater invertebrates Daphnia pulex and Hyalella azteca and in the more sensitive organism, understand the toxicity modifying influence of Ca, Na, Mg, pH and dissolved organic matter (DOM). Standard methods (Environment Canada) were followed for testing and culture in media of intermediate hardness (60 mg CaCO 3 mg/L) at pH 7.8 with Ca at 0.5, Na 0.5, Mg 0.125 (mM) and 23 °C. Acute toxicity tests were done with <24 h old neonates for 48 h in the case of D. pulex and with 2–9 days old offspring for 96 h tests with Hyalella. The potential protective effect of cationic competition was tested with Ca (0.5–2.0 mM), Na (0.5–2.0 mM) and Mg (0.125–0.5 mM). The effect of pH (6.5–8.0) and Suwannee River DOM complexation (at dissolved organic carbon (DOC) concentrations of 9 and 13 mg C/L) were evaluated. Dissolved Dy concentrations were lower than total (unfiltered) indicating precipitation, particularly at higher concentrations. Acute toxicity of Dy to H. azteca and D. pulex revealed Hyalella to be 1.4 times more sensitive than Daphnia. Additions of Ca and Na but not Mg provided significant protection against Dy toxicity to Hyalella. Similarly, low pH was associated with reduction in toxicity. Exposures which were pH buffered with and without MOPS were significantly different and indicated that MOPS enhanced Dy toxicity. DOM also mitigated Dy toxicity. Biotic ligand based parameters (Log K values) were calculated based on free ion relationships as determined by geochemical equilibrium modeling software (WHAM ver. 7.02). The log K value for Dy 3+ toxicity to Hyalella was 7.75 while the protective influence of Ca and Na were 3.95 and 4.10, respectively. This study contributes data towards the development of site specific water quality
Energy Technology Data Exchange (ETDEWEB)
Kim, Jinseong; Kim, Dowan; Noh, Taimin [School of Materials Science and Engineering, Pusan National University, Busan 609-735 (Korea, Republic of); Ahn, Byungmin [Department of Chemical Engineering and Materials Science, University of Southern California, Los Angeles, CA 90089-0241 (United States); Lee, Heesoo, E-mail: heesoo@pusan.ac.kr [School of Materials Science and Engineering, Pusan National University, Busan 609-735 (Korea, Republic of)
2011-09-15
Highlights: > Dy/Tm co-doping method in BaTiO{sub 3} was suggested to improve electrical properties and temperature stability simultaneously. > We examined these properties in terms of microstructural analysis and substitution rate. > Increase of Dy{sub 2}O{sub 3} addition enhanced dielectric constant. > Increase of Tm{sub 2}O{sub 3} addition enhanced temperature stability. > Improved electrical properties and temperature stability through Dy/Tm co-doping were deduced from formation of electrons and core-shell structure. - Abstract: The co-doping characteristics on microstructure and thermal properties of barium titanate (BaTiO{sub 3}) were investigated to elucidate formation of core-shell structure by dysprosium (Dy) and thulium (Tm) addition in the BaTiO{sub 3}-Dy{sub 2}O{sub 3}-Tm{sub 2}O{sub 3} system. The dielectrics co-doped with 0.7 mol% Dy{sub 2}O{sub 3} and 0.3 mol% Tm{sub 2}O{sub 3} had the dielectric constant up to 2200 as a function of temperature, which was 30% higher than that of specimen containing only Tm{sub 2}O{sub 3} at the room temperature. It could be explained by the fact that the increase of Dy{sub 2}O{sub 3} addition contributed to the improvement of dielectric constant. On the other hand, the rapid diffusion rate of Dy{sup 3+} ions in BaTiO{sub 3} showed an adverse effect on temperature stability caused by destruction of core-shell. As the compensation for shell expansion in BaTiO{sub 3}, the reinforcement of the core-shell structure through the addition of Tm{sub 2}O{sub 3} was confirmed by TEM-EDS analysis and attributed the temperature coefficient of capacitance (TCC) in a reliability condition (-55 deg. C to 125 deg. C, {Delta}C = {+-}15% or less). The enhanced electrical properties and temperature stability could be deduced from the generation of electrons and the formation core-shell structure in co-doped BaTiO{sub 3} system respectively.
An ICP AES method for determination of dysprosium and terbium in high purity yttrium oxide
International Nuclear Information System (INIS)
Rupawate, V.H.; Hareendran, K.N.; Roy, S.B.
2011-01-01
High purity yttrium finds interesting application in astronavigation, luminescence, nuclear energy and metallurgical industries. Most of these applications require yttrium oxide of highest purity. Consequently there is a need for production of high purity yttrium oxide. Separation and purification of yttrium from other rare earths is a challenging task due to their close chemical properties. Liquid-liquid extraction and ion exchange have been widely used in the production of yttrium oxide of highest purity. Determination of impurities, especially other rare earths, in ppm level is required for process development and chemical characterization of the high purity Y 2 O 3 . Many methods have been described in literature. However since the advent of ICP AES much work in this area has been carried out by this technique. This paper describes the work done for determination of dysprosium (Dy) and terbium (Tb) in yttrium oxide using a high resolution sequential ICP AES. Emission spectra of rare earth elements are very complex and due to this complexity it is important to select spectral interference free analyte lines for determination of rare earths in rare earth matrix. For the determination of Dy and Tb in Y 2 O 3 , sensitive lines of Dy and Tb are selected from the instrument wavelength table and spectral interference free emission lines for the determination is selected by scanning around the selected wavelengths using 5 g/L Y solution and 5 mg/L standard solutions of Dy and Tb prepared in 4% nitric acid. It is found 353.170 nm line of Dy and 350.917 nm line Tb is suitable for quantitative determination. The signal to background ratio increases with increase in matrix concentration, i.e. from 1 to 5 mg/L. The optimum forward power is determined and it is found to be 1100W for Dy and 1000W for Tb. The instrument is calibrated using matrix matched standards containing 5g/L of Y matrix. Samples are dissolved in nitric acid and Y concentration is maintained at 5g/L. Two
Prostate alpha/beta revisited - an analysis of clinical results from 14 168 patients
Energy Technology Data Exchange (ETDEWEB)
Dasu, Alexandru [Dept. of Radiation Physics UHL, County Council of Oestergoetland, Linkoeping (Sweden); Radiation Physics, Dept. of Medical and Health Sciences, Faculty of Health Sciences, Linkoeping Univ., Linkoeping (Sweden); Toma-Dasu, Iuliana [Medical Radiation Physics, Stockholm Univ. and Karolinska Institutet, Stockholm (Sweden)
2012-11-15
Purpose. To determine the dose response parameters and the fractionation sensitivity of prostate tumours from clinical results of patients treated with external beam radiotherapy. Material and methods. The study was based on five-year biochemical results from 14 168 patients treated with external beam radiotherapy. Treatment data from 11 330 patients treated with conventional fractionation have been corrected for overall treatment time and fitted with a logit equation. The results have been used to determine the optimum {alpha}/{beta} values that minimise differences in predictions from 2838 patients treated with hypofractionated schedules. Results. Conventional fractionation data yielded logit dose response parameters for all risk groups and for all definitions of biochemical failures. The analysis of hypofractionation data led to very low {alpha}/{beta} values (1-1.7 Gy) in all mentioned cases. Neglecting the correction for overall treatment time has little impact on the derivation of {alpha}/{beta} values for prostate cancers. Conclusions. These results indicate that the high fractionation sensitivity is an intrinsic property of prostate carcinomas and they support the use of hypofractionation to increase the therapeutic gain for these tumours.
International Nuclear Information System (INIS)
Moeller, R.; Berger, T.; Reitz, G.; Okayasu, Ryuichi
2006-01-01
This research project is aimed at correlating radiation effects induced DNA damage in Bacillus subtilis endospores with the linear energy transfer (LET) of the used radiation by investigating survival and gene activation after irradiation with high-LET particles. During the stationary growth phase Bacillus subtilis change their metabolic active state from the vegetative cells to the metabolic inactive but even more resistant endospores. If spores find optimal conditions, they could germinate and switch to the vegetative growth. With these outgrowth spores can and/or must repair the induced formed DNA damage. During germination spores lose their most resistance. In more detail, DNA repair and mutation induction events investigated will include the survivability, behaviour against specific antibiotics and their germination. DNA repair pattern will be detected during germination by using DNA microarrays, which contain the whole genome of Bacillus subtilis 168. (author)
Urinary phthalates from 168 girls and boys measured twice a year during a 5-year period
DEFF Research Database (Denmark)
Mouritsen, A; Frederiksen, H; Sørensen, K
2013-01-01
Background: Little is known about the possible deleterious effects of phthalate exposure on endogenous sex steroid levels in children. Objective: Our objective was to investigate whether urinary phthalate metabolite levels are associated with circulating adrenal androgen levels and age at puberty....... Methods: This was a longitudinal study of 168 healthy children (84 girls) examined every 6 months for 5 years. Serum levels of dehydroepiandrostenedione sulfate (DHEAS), Δ4-androstenedione, testosterone, and urinary morning excretion of 14 phthalate metabolites, corresponding to 7 different phthalate...... diesters were determined. A variation in urinary excretion of phthalates was evident in each child, which made a mean of repetitive samples more representative for long-term excretion than a single determination. Results: We found that girls with excretion of monobutyl phthalate isomers (MBP) and di(2...
Kuang, Xiaojun; Evans, Ivana R
2010-07-05
Four new Dy and Nd hydrated octamolybdate materials have been prepared: [Dy(2)(H(2)O)(12)](Mo(8)O(27)) x 8 H(2)O, [Dy(2)(H(2)O)(6)](Mo(8)O(27)), [Nd(2)(H(2)O)(12)](Mo(8)O(27)) x 6 H(2)O, and [Nd(2)(H(2)O)(6)]Mo(8)O(27) x 3 H(2)O. They adopt one known and three new structure types, which we have determined ab initio from powder X-ray diffraction data. The four compounds contain the same basic structural building block, in the form of RE(2)Mo(8)O(27) (RE = Dy, Nd) chains, which are arranged differently for the two rare earths in the fully hydrated precursor materials. [Dy(2)(H(2)O)(12)](Mo(8)O(27)) x 8 H(2)O comprises isolated Dy(2)Mo(8)O(27) chains assembled in a zigzag manner along the a axis with interspersed crystallized water molecules, which differs from the parallel arrangements of isolated Nd(2)Mo(8)O(27) chains in [Nd(2)(H(2)O)(12)](Mo(8)O(27)) x 6 H(2)O. Partial dehydration of the two precursors leads to new phases [Dy(2)(H(2)O)(6)](Mo(8)O(27)) and [Nd(2)(H(2)O)(6)]Mo(8)O(27) x 3 H(2)O, respectively, prior to complete dehydration, which leads to initially amorphous and eventually crystalline rare-earth molybdenum mixed metal oxides. Both initial transformations occur topotactically. Partial dehydration of the Dy phase condenses the assembly of the Dy(2)Mo(8)O(27) chains principally along the a axis, leading to a 3-dimensional (3D) framework, with each Dy bridging two (Mo(8)O(27))(6-) sheets in the product. The partial dehydration of the Nd precursor condenses the assembly of Nd(2)Mo(8)O(27) chains along the [110] axis, leading to a 3D framework where each Nd bridges three (Mo(8)O(27))(6-) units. Both new dysprosium octamolybdates adopt noncentrosymmetric polar structures in space group P2(1) and are second harmonic generation (SHG) active.
Evaluación sobre la seguridad de la acupuntura en 297.168 punturas.
Directory of Open Access Journals (Sweden)
Liliana Hernández Leal
2014-07-01
Full Text Available Con el propósito de obtener una casuística propia y de determinar la seguridad de la práctica de la acupuntura en nuestro medio, se realizó el seguimiento de la incidencia de efectos adversos en la consulta particular de un médico acupunturista con amplia experiencia clínica durante un periodo de 72 meses en el que se realizaron 24.707 consultas, encontrándose 260 eventos adversos de 297.168 punturas, con una incidencia de 0.87 por 1.000 y 7 de 2.390 puntos moxados para una incidencia de 2.92 por 1.000. El efecto adverso más frecuente para la acupuntura fue la presentación de equimosis – hematomas con una incidencia de 0.65 por 1.000. Para la moxibustión el único efecto adverso que se presentó fue la quemadura con una incidencia de 2.92 por 1.000. No hubo ningún efecto adverso mayor que requiriera intervención médica. En conclusión se puede considerar que la acupuntura en manos expertas es una práctica médica segura.
Chemical composition and microstructure of magnetically melt-textured Bi2Sr2Ca0.8Dy0.2Cu2O8-y
International Nuclear Information System (INIS)
Stassen, S.; Rulmont, A.; Krekels, T.; Ausloos, M.; Cloots, R.
1996-01-01
Dysprosium-doped Bi-based 2212 materials have been synthesized in the presence of a magnetic field, applied perpendicularly to the lateral face of a cylinder, by a melt-textured growth process. Thick (well oriented) layers of different chemical composition have been observed. A dysprosium-doped 2212 phase (the expected D phase) and a dysprosium-free bismuth-rich and strontium-deficient 2212 phase have been found. It is argued that the latter is a so-called M phase. Other impurity phases have been observed, connected with both 2212-type layers. A novel aspect of this work is the calcium solubility at the strontium site in the 2201 structure, and inversely the strontium solubility at the calcium site in the 8250 structure. (orig.)
Secondhand smoke exposure among never-smoking youth in 168 countries.
Veeranki, Sreenivas P; Mamudu, Hadii M; Zheng, Shimin; John, Rijo M; Cao, Yan; Kioko, David; Anderson, James; Ouma, Ahmed E O
2015-02-01
To estimate the prevalence of secondhand smoke (SHS) exposure among never-smoking adolescents and identify key factors associated with such exposure. Data were obtained from nationally representative Global Youth Tobacco Surveys conducted in 168 countries during 1999-2008. SHS exposure was ascertained in relation to the location-exposure inside home, outside home, and both inside and outside home, respectively. Independent variables included parental and/or peer smoking, knowledge about smoke harm, attitudes toward smoking ban, age, sex, and World Health Organization region. Simple and multiple logistic regression analyses were conducted. Of 356,414 never-smoking adolescents included in the study, 30.4%, 44.2%, and 23.2% were exposed to SHS inside home, outside home, and both, respectively. Parental smoking, peer smoking, knowledge about smoke harm, and positive attitudes toward smoke ban were significantly associated with increased odds of SHS exposure. Approximately 14% of adolescents had both smoking parents and peers. Compared with never-smoking adolescents who did not have both smoking parents and peers, those who had both smoking parents and peers had 19 (adjusted odds ratio [aOR], 19.0; 95% confidence interval [CI], 16.86-21.41), eight (aOR, 7.71; 95% CI, 7.05-8.43), and 23 times (aOR, 23.16; 95% CI, 20.74-25.87) higher odds of exposure to SHS inside, outside, and both inside and outcome home, respectively. Approximately one third and two fifths of never-smoking adolescents were exposed to SHS inside or outside home, and smoking parents and/or peers are the key factors. Study findings highlight the need to develop and implement comprehensive smoke-free policies consistent with the World Health Organization Framework Convention on Tobacco Control. Copyright © 2015 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Herskind, B; Dossing, T; Ninel, N; Atac, A; Jensen, H J; Hagemann, G B; Lieder, R M; Maj, A; Nyberg, J; Piiparinen, M; Sugawara, M; Virtanen, A [Niels Bohr Inst., Copenhagen (Denmark); Leoni, S; Vigezzi, E; Bosetti, P; Bracco, A; Broglia, R A; Million, B [Milan Univ. (Italy); Matsuo, M [Kyoto Univ., Uji (Japan). Uji Research Center of Yukawa Inst. for Theoretical Physics; Bergstrom, M; Brockstedt, A; Carlsson, H; Ekstrom, P; Nordlund, A; Ryde, H [Lund Univ. (Sweden). Dept. of Physics; Jongman, J [Rijksuniversiteit Groningen (Netherlands). Kernfysisch Versneller Inst.; Ingebretsen, F; Tjom, P O [Oslo Univ. (Norway); Lonnroth, T [Aabo Akademi, Turku (Finland). Dept. of Physics
1992-08-01
A new method has been developed for analyzing fluctuations of count in two-dimensional gamma ray energy coincidence spectra of deformed nuclei formed in heavy ion fusion reactions. Most of the gamma decay cascades flow through regions of high level density, and the method is based upon assumptions about average properties of the excited states. Transition energies along discrete rotational bands are viewed as randomly selected from a continuous distribution of rotational frequencies and moments of inertia. For damped rotational motion, implying a mixing of the rotational bands, a random matrix model is assumed, leading to smooth energy spectra, and strong fluctuations of the transition strengths. The method is illustrated for {sup 168}Yb and {sup 163}Tm. 4 refs., 4 figs.
Application of the RPA method based on the cranked Hartree-Fock-Bogolyubov model in 168Er and 158Dy
International Nuclear Information System (INIS)
Kvasil, J.; Khariev, M.M.; Cwiok, S.; Mikhajlov, I.N.; Khoriev, B.
1984-01-01
The Random Phase Approximation (RPA) based on the Cranked Hartree-Fock-Bogolyubov (CHFB) model is used for the study of low-lying nuclear states near the yrast line in 158 Dy and 168 Er. The relation of the spurious unphysical states connected with the nucleus centre of mass rotational motion to the solutions of RPA equations of motion is cleared up. The calculated level energies and reduced probabilities B(E2) are compared with experimental ones. The dependence of the residual interaction strength constants and the nucleus moment of inertia on the angular momentum is discussed. The experimental characteristics of low-lying states up to approx. 2 MeV are reproduced by the CHFB+RPA model. (author)
Heterologous expression and characterization of a new heme-catalase in Bacillus subtilis 168.
Philibert, Tuyishime; Rao, Zhiming; Yang, Taowei; Zhou, Junping; Huang, Genshu; Irene, Komera; Samuel, Niyomukiza
2016-06-01
Reactive oxygen species (ROS) is an inherent consequence to all aerobically living organisms that might lead to the cells being lethal and susceptible to oxidative stress. Bacillus pumilus is characterized by high-resistance oxidative stress that stimulated our interest to investigate the heterologous expression and characterization of heme-catalase as potential biocatalyst. Results indicated that recombinant enzyme significantly exhibited the high catalytic activity of 55,784 U/mg expressed in Bacillus subtilis 168 and 98.097 µmol/min/mg peroxidatic activity, the apparent K m of catalytic activity was 59.6 ± 13 mM with higher turnover rate (K cat = 322.651 × 10(3) s(-1)). The pH dependence of catalatic and peroxidatic activity was pH 7.0 and pH 4.5 respectively with temperature dependence of 40 °C and the recombinant heme-catalase exhibited a strong Fe(2+) preference. It was further revealed that catalase KatX2 improved the resistance oxidative stress of B. subtilis. These findings suggest that this B. pumilus heme-catalase can be considered among the industrially relevant biocatalysts due to its exceptional catalytic rate and high stability and it can be a potential candidate for the improvement of oxidative resistance of industrially produced strains.
International Nuclear Information System (INIS)
Rahimi, Hamed; Ghasemi, Ali; Mozaffarinia, Reza; Tavoosi, Majid
2017-01-01
In current work, Nd2Fe14B nanoparticles was synthesized by sol-gel method. Dysprosium powders were added into Nd2Fe14B nanoparticles by mechanical alloying process in order to enhancement of coercivity. The phase analysis, structure, and magnetic properties of annealed (Nd_1_−_xDy_x)_2Fe_1_4B nanoparticles with different Dy-content (x=0.1, 0.2, 0.3, 0.4, 0.5, 0.6) were investigated by employing X-ray diffraction, X-ray photoelectron spectroscopy, energy dispersive spectroscopy, field emission scanning electron microscope, transmission electron microscope and vibrating sample magnetometer techniques. The results showed that with an increase in Dy amounts, the coercivity of particles increased from 2.9 kOe to 13.4 kOe and then decreased to 5.6 kOe. By adding an optimum amount of Dy (x=0.4), the coercivity was significantly increased from 2.9 kOe to 13.4 kOe. The average particle size of annealed (Nd_1_−_xDy_x)_2Fe_1_4B nanoparticles was below 10 nm. Magnetization reversal studies indicate that the coercivity of milled and annealed (Nd_1_−_xDy_x)_2Fe_1_4B nanoparticles is controlled by the nucleation of reversed magnetic domains. The experimental results in the angular dependence of coercivity for (Nd_1_−_xDy_x)_2Fe_1_4B permanent magnets showed that the normalized coercivity of the permanent magnets H_c(θ)/H_c(0) increases from 1 to about 1.2–1.5 with increasing θ from 0 to about π/3, for x=0.4–0.6. - Highlights: • Dy was added to Nd_2Fe_1_4B nanoparticles to improve the coercivity. • A maximum squareness ratio of 0.99 was obtained. • The average particle size decreased with an increase in Dy-content.
International Nuclear Information System (INIS)
Janke, W.; Hueppe, M.
1987-01-01
A collective of 168 persons aged 18 to 59 were studied to assess the impact of the Chernobyl reactor accident on how they experience, and react to, incidents. Four groups were made up of 42 persons each (male/female; 18-39-year-olds/40-59-year-olds). As variables, the instantaneous psychic condition as a reaction to the accident, and strategies to cope with stress were studied by psychometric methods. Furthermore a questionnaire on attitudes and behaviour, specially drawn up for the study, was used, whose reliability was confirmed by analyses of the individual items. The Chernobyl nuclear accident, it is found, was felt to be a grave incident and led to a number of reactions in the attitudes and views of people. The very different response of the age and sex groups is considered to be the result of the highest significance. (orig./MG) [de
Habib, Komal; Schibye, Peter Klausen; Vestbø, Andreas Peter; Dall, Ole; Wenzel, Henrik
2014-10-21
Neodymium-iron-boron (NdFeB) magnets have become highly desirable for modern hi-tech applications. These magnets, in general, contain two key rare earth elements (REEs), i.e., neodymium (Nd) and dysprosium (Dy), which are responsible for the very high strength of these magnets, allowing for considerable size and weight reduction in modern applications. This study aims to explore the current and future potential of a secondary supply of neodymium and dysprosium from recycling of NdFeB magnets. For this purpose, material flow analysis (MFA) has been carried out to perform the detailed mapping of stocks and flows of NdFeB magnets in Denmark. A novel element of this study is the value added to the traditionally practiced MFAs at national and/or global levels by complementing them with a comprehensive sampling and elemental analysis of NdFeB magnets, taken out from a sample of 157 different products representing 18 various product types. The results show that the current amount of neodymium and dysprosium in NdFeB magnets present in the Danish waste stream is only 3 and 0.2 Mg, respectively. However, this number is estimated to increase to 175 Mg of neodymium and 11.4 Mg of dysprosium by 2035. Nevertheless, efficient recovery of these elements from a very diverse electronic waste stream remains a logistic and economic challenge.
Scanning Electron Microscope-Cathodoluminescence Analysis of Rare-Earth Elements in Magnets.
Imashuku, Susumu; Wagatsuma, Kazuaki; Kawai, Jun
2016-02-01
Scanning electron microscope-cathodoluminescence (SEM-CL) analysis was performed for neodymium-iron-boron (NdFeB) and samarium-cobalt (Sm-Co) magnets to analyze the rare-earth elements present in the magnets. We examined the advantages of SEM-CL analysis over conventional analytical methods such as SEM-energy-dispersive X-ray (EDX) spectroscopy and SEM-wavelength-dispersive X-ray (WDX) spectroscopy for elemental analysis of rare-earth elements in NdFeB magnets. Luminescence spectra of chloride compounds of elements in the magnets were measured by the SEM-CL method. Chloride compounds were obtained by the dropwise addition of hydrochloric acid on the magnets followed by drying in vacuum. Neodymium, praseodymium, terbium, and dysprosium were separately detected in the NdFeB magnets, and samarium was detected in the Sm-Co magnet by the SEM-CL method. In contrast, it was difficult to distinguish terbium and dysprosium in the NdFeB magnet with a dysprosium concentration of 1.05 wt% by conventional SEM-EDX analysis. Terbium with a concentration of 0.02 wt% in an NdFeB magnet was detected by SEM-CL analysis, but not by conventional SEM-WDX analysis. SEM-CL analysis is advantageous over conventional SEM-EDX and SEM-WDX analyses for detecting trace rare-earth elements in NdFeB magnets, particularly dysprosium and terbium.
Buxton, R S; Ward, J B
1980-10-01
Three heat-sensitive mutants of Bacillus subtilis 168, which lysed at the non-permissive temperature, have been shown under these conditions to be defective in the synthesis of peptidoglycan. This was caused by lesions in three different stages of peptidoglycan synthesis.In one mutant (ddl), D-alanine: D-alanine ligase was defective, leading to the accumulation of UDP-MurAc-L-Ala-D-Glu-meso-A,pm ; the ddl mutation was closely linked(87 yo cotransducible) with dal, specifying alanine racemase. In a second mutant (dapE),the lesion was in N-acetyl-L-diaminopimelate deacylase, resulting in UDP-MurAc-L-Ala-D-Glu being accumulated, whilst in a third mutant (ptg-1435), UDP-MurAc-L-Ala-D-Glumeso-A,pm-D-Ala-D-Ala was the peptidoglycan precursor accumulated although the enzyme defect has not been ascertained. Both dapE and ptg-1435 were located between metC and pyr(AD), dapE being 25% cotransducible and ptg-1435 were located between metC and pyr(AD), dapE being 25% cotransducible with pyr(AD).
Cortesogno, L.; Gaggero, L.; Marescotti, P.
2003-04-01
Basalts, from around 0.8 to 3.5 Ma in age, were recovered during Leg 168 from nine sites (Sites 1023-1029 and 1031-1032), drilled across the eastern flank of the Juan de Fuca Ridge (JdFR). The sites are located from about 20 km to roughly 100 km east of the ridge axis and were subdivided into the Hydrothermal Transition (HT, Sites 1023-1025), Buried Basement (BB, Sites 1028-1031), and Rough Basement (RB, Sites 1026 and 1027) transects, described in the Leg 168 Initial Reports (Davis, Fisher, Firth, et al., 1997). The igneous rocks mainly consists of aphyric to moderately phyric pillow basalt (Sites 1023-1029 and 1031-1032), subordinate aphyric massive basalt (Site 1025), basalt-hyaloclastite breccia (Site 1026), and fine- to medium-grained diabase (Site 1027). On the whole, samples are weakly altered: the alteration style and intensity vary systematically from Site to Site being related to several factors, including the ageing of the igneous crust, the increase of temperatures from younger to older Sites (from 15.5 ^oC at the youngest 1023 Site to 62.8^oC at the oldest 1027 Site), the local and regional variations in lithology and primary porosity, and the degree of fracturing. Over 90 samples of basalts representative of the nine Sites were studied for mineralogy and petrography; 30 selected samples, representative of the igneous chemistry were analyzed for major, minor, trace and rare earth elements by XRF, ICP, ICP-MS, and INAA. An overall MORB high-Ti tholeiitic affinity arises from the Ti - LaN/SmN, Ti/Cr-Ni, Cr - Y diagrams. The sequence ranges from very primitive (Sites 1023, 1027: Mg# ≈ 70, Zr ≈ 60 ppm) to highly evolved Fe-basaltic compositions (Mg# up to 46). The FMM-normalized patterns of the most primitive compositions compared with the melting models for major oceans (Pearce & Parkinson, 1993) evidence a good analogy with magmas from 10-15% partial melting of a Fertile MORB Mantle source. The progressive decrease of compatible elements and the
Twin radio relics in the nearby low-mass galaxy cluster Abell 168
Dwarakanath, K. S.; Parekh, V.; Kale, R.; George, L. T.
2018-06-01
We report the discovery of twin radio relics in the outskirts of the low-mass merging galaxy cluster Abell 168 (redshift=0.045). One of the relics is elongated with a linear extent ˜800 kpc and projected width of ˜80 kpc and is located ˜900 kpc towards the north of the cluster centre, oriented roughly perpendicular to the major axis of the X-ray emission. The second relic is ring-shaped with a size ˜220 kpc and is located near the inner edge of the elongated relic at a distance of ˜600 kpc from the cluster centre. These radio sources were imaged at 323 and 608 MHz with the Giant Meterwave Radio Telescope and at 1520 MHz with the Karl G. Jansky Very Large Array (VLA). The elongated relic was detected at all frequencies, with a radio power of 1.38 ± 0.14 × 1023 W Hz-1 at 1.4 GHz and a power law in the frequency range 70-1500 MHz (S ∝ να, α = -1.1 ± 0.04). This radio power is in good agreement with that expected from the known empirical relation between the radio powers of relics and host cluster masses. This is the lowest mass (M500 = 1.24 × 1014 M⊙) cluster in which relics due to merger shocks are detected. The ring-shaped relic has a steeper spectral index (α) of -1.74 ± 0.29 in the frequency range 100-600 MHz. We propose this relic to be an old plasma, revived due to adiabatic compression by the outgoing shock that produced the elongated relic.
The estimation of the control rods absorber burn-up during the VVER-1000 operation
Energy Technology Data Exchange (ETDEWEB)
Bolshagin, Sergey N.; Gorodkov, Sergey S.; Sukhino-Khomenko, Evgeniya A. [National Research Centre ' Kurchatov Institute' , Moscow (Russian Federation)
2013-09-15
The isotopic composition of the control rods absorber changes under the neutron flux influence, so the control rods efficiency can decrease. In the VVER-1000 control rods boron carbide and dysprosium titanate are used as absorbing materials. In boric part the efficiency decreases due to the {sup 10}B isotope burn-up. Dysprosium isotopes turn into other absorbing isotopes, so the absorbing properties of dysprosium part decrease to a lesser degree. Also the control rod's shells may be deformed as a consequence of boron carbide radiation swelling. This fact should be considered in substantiation of control rods durability. For the estimation of the control rods absorber burn-up two models are developed: VVER-1000 3-D fuel assembly with control rods partially immersed (imitation of the control rods operation in the working group) and VVER-1000 3-D fuel assembly with control rods, located at the upper limit switch (imitation of the control rods operation in groups of the emergency shutdown system). (orig.)
Maskalick, Nicholas J.
1988-08-30
Disclosed is a cermet electrode consisting of metal particles of nickel, cobalt, iron, or alloys or mixtures thereof immobilized by zirconia stabilized in cubic form which contains discrete deposits of about 0.1 to about 5% by weight of praseodymium, dysprosium, terbium, or a mixture thereof. The solid oxide electrode can be made by covering a substrate with particles of nickel, cobalt, iron, or mixtures thereof, growing a stabilized zirconia solid oxide skeleton around the particles thereby immobilizing them, contacting the skeleton with a compound of praseodymium, dysprosium, terbium, or a mixture thereof, and heating the skeleton to a temperature of at least 500.degree. C. The electrode can also be made by preparing a slurry of nickel, cobalt, iron, or mixture and a compound of praseodymium, dysprosium, terbium, or a mixture thereof, depositing the slurry on a substrate, heating the slurry to dryness, and growing a stabilized zirconia skeleton around the metal particles.
Boyle, Timothy J; Bunge, Scott D; Clem, Paul G; Richardson, Jacob; Dawley, Jeffrey T; Ottley, Leigh Anna M; Rodriguez, Mark A; Tuttle, Bruce A; Avilucea, Gabriel R; Tissot, Ralph G
2005-03-07
Using either an ammoniacal route, the reaction between DyCl3, Na0, and HOR in liquid ammonia, or preferentially reacting Dy(N(SiMe3)2)3 with HOR in a solvent, we isolated a family of dysprosium alkoxides as [Dy(mu-ONep)2(ONep)]4 (1), (ONep)2Dy[(mu3-ONep)(mu-ONep)Dy(ONep)(THF)]2(mu-ONep) (2), (ONep)2Dy[(mu3-ONep)(mu-ONep)Dy(ONep)(py)]2(mu-ONep) (3), [Dy3(mu3-OBut)2(mu-OBut3(OBut)4(HOBut)2] (4), [Dy3(mu3-OBut)2(mu-OBut)3(OBut)4(THF)2] (5), [Dy3(mu3-OBut)2(mu-OBut)3(OBut)4(py)2] (6), (DMP)Dy(mu-DMP)4[Dy(DMP)2(NH3)]2 (7), [Dy(eta6-DMP)(DMP)2]2 (8), Dy(DMP)3(THF)3 (9), Dy(DMP)3(py)3 (10), Dy(DIP)3(NH3)2 (11), [Dy(eta6-DIP)(DIP)2]2 (12), Dy(DIP)3(THF)2 (13), Dy(DIP)3(py)3 (14), Dy(DBP)3(NH3) (15), Dy(DBP)3 (16), Dy(DBP)3(THF) (17), Dy(DBP)3(py)2 (18), [Dy(mu-TPS)(TPS2]2 (19), Dy(TPS)3(THF)3 (20), and Dy(TPS)3(py)3 (21), where ONep = OCH2CMe3, OBut) = OCMe3, DMP = OC6H3(Me)(2)-2,6, DIP = OC6H3(CHMe2)(2)-2,6, DBP = OC6H3(CMe3)(2)-2,6, TPS = OSi(C6H5)3, tol = toluene, THF = tetrahydrofuran, and py = pyridine. We were not able to obtain X-ray quality crystals of compounds 2, 8, and 9. The structures observed and data collected for the Dy compounds are consistent with those reported for its other congeners. A number of these precursors were used as Dy dopants in Pb(Zr0.3Ti0.7)O3 (PZT 30/70) thin films, with compound 12 yielding the highest-quality films. The resulting Pb0.94Dy0.04(Zr0.3Ti0.7)O3 [PDyZT (4/30/70)] had similar properties to PZT (30/70), but showed substantial resistance to polarization reversal fatigue.
International Nuclear Information System (INIS)
Kondrashina, Yu.G.; Mustafina, A.R.; Vul'fson, S.G.
1994-01-01
Stability and structure of dysprosium(3) aminobenzoate complexes with molar ratios Dy:L 1:1 and 1:2 (HL-aminobenzoic acid) in aqueous solutions are determined on the basis of pH-metric and paramagnetic birefringence data. The increase of conjugation effect in the series of benzoic, meta- ortho-, and para-aminobenzoic acid results in the increase of stability of 1:1 and 1:2 complexes. Features of the structure and coordination of ligands in dysprosium complexes with meta-, ortho-, and para-aminobenzoic acid are considered. 11 refs.; 4 figs.; 2 tabs
Energy Technology Data Exchange (ETDEWEB)
Gorodyskij, A.V.; Fialkov, Yu.Ya.; Chernyj, D.B. (AN Ukrainskoj SSR, Kiev. Inst. Obshchej i Neorganicheskoj Khimii; Kievskij Politekhnicheskij Inst. (Ukrainian SSR))
1982-03-01
Influence of the double mixed solvent on thermodynamic characteristics of ionic migration of lanthanum, neodymium, europium and dysprosium chlorides as well as their phenanthroline complexes is considered. Decrease of lambdasub(c) of simple and complex rare earth salts in the lanthanum, neodymium-europium-dysprosium series as explained by increase of solvation degree, associated with lanthanum compression. It is shown that increase of methanol or propanol content results in exothermicity decrease of the ionic migration process. The temperature constituents of enthalpy and entropy of dissociation of the simple and complex rare earth salts are presented.
DEFF Research Database (Denmark)
Jensen, Sanne B.; Serre, Stephanie B. N.; Humes, Daryl G.
2015-01-01
to nine PIs (telaprevir, boceprevir, simeprevir, asunaprevir, vaniprevir, faldaprevir, paritaprevir, deldeprevir, and grazoprevir) in Huh7.5 cells. We found that most variants showed decreased fitness compared to original viruses. Overall, R155K-, A156G/S-, and D/Q168A/E/H/N/V-variants showed highest...... resistant. For the remaining PIs, most genotype 2-, 4-, 5-, and 6-, but not genotype 3-variants, showed varying resistance levels. Overall, grazoprevir (MK-5172) had the highest efficacy against original viruses and variants.This is the first comprehensive study revealing the impact of described key PI...
Measurements of the 169Tm(n,2n)168Tm cross section between 9.0 and 17.5 MeV
Soter, J.; Bhike, Megha; Krishichayan, Fnu; Finch, S. W.; Tornow, W.
2016-09-01
Measurements of the 169Tm(n,2n)168Tm cross section have been performed in 0.5 MeV intervals for neutron energies ranging from 9.0 MeV to 17.5 MeV in order to resolve discrepancies in the current literature data. The neutron activation technique was used with 90Zr and 197Au as monitor foils. After irradiation, de-excitation gamma rays were recorded off-line with High-Purity Germanium (HPGE) detectors in TUNL's Low-Background Counting Facility. In addition, data for the 169Tm(n,3n)167Tm reaction have also been obtained from 15.5 MeV to 17.5 MeV. The results of these measurements provide the basis for investigating properties of the interial confinement fusion plasma in deuterium-tritium (DT) capsules at the National Ignition Facility located at Lawrence Livermore National Laboratory.
Energy Technology Data Exchange (ETDEWEB)
Wickline, Alfred
2006-12-01
This Corrective Action Decision Document has been prepared for Corrective Action Unit (CAU) 168: Area 25 and 26, Contaminated Materials and Waste Dumps, Nevada Test Site, Nevada. The purpose of this Corrective Action Decision Document is to identify and provide a rationale for the selection of a recommended corrective action alternative for each corrective action site (CAS) within CAU 168. The corrective action investigation (CAI) was conducted in accordance with the ''Corrective Action Investigation Plan for Corrective Action Unit 168: Area 25 and 26, Contaminated Materials and Waste Dumps, Nevada Test Site, Nevada'', as developed under the ''Federal Facility Agreement and Consent Order'' (1996). Corrective Action Unit 168 is located in Areas 25 and 26 of the Nevada Test Site, Nevada and is comprised of the following 12 CASs: CAS 25-16-01, Construction Waste Pile; CAS 25-16-03, MX Construction Landfill; CAS 25-19-02, Waste Disposal Site; CAS 25-23-02, Radioactive Storage RR Cars; CAS 25-23-13, ETL - Lab Radioactive Contamination; CAS 25-23-18, Radioactive Material Storage; CAS 25-34-01, NRDS Contaminated Bunker; CAS 25-34-02, NRDS Contaminated Bunker; CAS 25-99-16, USW G3; CAS 26-08-01, Waste Dump/Burn Pit; CAS 26-17-01, Pluto Waste Holding Area; and CAS 26-19-02, Contaminated Waste Dump No.2. Analytes detected during the CAI were evaluated against preliminary action levels (PALs) to determine contaminants of concern (COCs) for CASs within CAU 168. Radiological measurements of railroad cars and test equipment were compared to unrestricted (free) release criteria. Assessment of the data generated from the CAI activities revealed the following: (1) Corrective Action Site 25-16-01 contains hydrocarbon-contaminated soil at concentrations exceeding the PAL. The contamination is at discrete locations associated with asphalt debris. (2) No COCs were identified at CAS 25-16-03. Buried construction waste is present in at least two
Energy Technology Data Exchange (ETDEWEB)
Rahimi, Hamed; Ghasemi, Ali, E-mail: ali13912001@yahoo.com; Mozaffarinia, Reza; Tavoosi, Majid
2017-02-15
In current work, Nd2Fe14B nanoparticles was synthesized by sol-gel method. Dysprosium powders were added into Nd2Fe14B nanoparticles by mechanical alloying process in order to enhancement of coercivity. The phase analysis, structure, and magnetic properties of annealed (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B nanoparticles with different Dy-content (x=0.1, 0.2, 0.3, 0.4, 0.5, 0.6) were investigated by employing X-ray diffraction, X-ray photoelectron spectroscopy, energy dispersive spectroscopy, field emission scanning electron microscope, transmission electron microscope and vibrating sample magnetometer techniques. The results showed that with an increase in Dy amounts, the coercivity of particles increased from 2.9 kOe to 13.4 kOe and then decreased to 5.6 kOe. By adding an optimum amount of Dy (x=0.4), the coercivity was significantly increased from 2.9 kOe to 13.4 kOe. The average particle size of annealed (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B nanoparticles was below 10 nm. Magnetization reversal studies indicate that the coercivity of milled and annealed (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B nanoparticles is controlled by the nucleation of reversed magnetic domains. The experimental results in the angular dependence of coercivity for (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B permanent magnets showed that the normalized coercivity of the permanent magnets H{sub c}(θ)/H{sub c}(0) increases from 1 to about 1.2–1.5 with increasing θ from 0 to about π/3, for x=0.4–0.6. - Highlights: • Dy was added to Nd{sub 2}Fe{sub 14}B nanoparticles to improve the coercivity. • A maximum squareness ratio of 0.99 was obtained. • The average particle size decreased with an increase in Dy-content.
International Nuclear Information System (INIS)
Shijo, Yoshio
1976-01-01
A spectrophotometric method of determination of the rare earth was studied by the solvent extraction of rare earth-Xylenol Orange chelate into xylene solution of trioctylethylammonium bromide(TOEA). The rare earth-XO-TOEA complexes are extracted into aromatic hydrocarbons such as benzene, toluene, and xylene, but not into polar solvents such as n-butanol ethylacetate, methylisobutylketone, and nitrobenzene. The optimum pH range for the extraction were 6.3 -- 6.7, 6.3 -- 6.5, 5.8 -- 6.9, 5.7 -- 6.9, and 5.5 -- 6.8 for lanthanum, praseodymium, cerium, gadolinium, and dysprosium, respectively. The absorption maximum of the complexes extracted into xylene were found at 605 nm for lanthanum, praseodymium, and cerium, 596 nm for gadolinium, and 590 nm for dysprosium. Beer's law held for about 0 -- 4.5 μg of rare earth per 5 ml of xylene. The molar absorptivity of the extracted species were 1.53x10 5 , 1.42x10 5 , 1.35x10 5 , 8.5x10 4 , 8.2x10 4 cm -1 mol -1 l for lanthanum, praseodymium, cerium, gadolinium, and dysprosium, respectively. The composition of the ternary complexes were estimated to be M:XO:TOEA=1:1:2 for gadolinium and dysprosium, whereas 1:2:n for lanthanum, praseodymium and cerium. Combination ratio n of TOEA to metal-XO chelates in the latters could not be estimated by the commonly available methods. Thorium, vanadium, uranium, bismuth, aluminum, zirconium, chromium, nitrate, perchlorate and iodide interfered when triethylenetetramine and 1,10-phenanthroline were added as masking agent. (auth.)
Directory of Open Access Journals (Sweden)
Sonia G. Andrade
1981-09-01
Full Text Available Fifteen albino (Sprague Dawley rats with subcutaneous transplanted fibromas was used in the present study. The tumour was formed by typical fibroblasts in a dense collagen matrix and was provenient from a fibroma that appeared spontaneously in an albino rat of the same strain. Ultrastructurally collagen disclosed normal periodicity and the fibroblasts showed irregular notched nuclei with irregular distribution of chromatin, that suggests transitional aspects to fibrosarcoma. The 15 animals, from different passage groups, were divided into: 8 animals submitted to treatment with the drug acexamic acid (CY-168F - N acetyl-amino-6-hexanoic acid (plastenan and 7 untreated control animals. Three of the treated animals showed a malignant transformation to fibrosarcoma. transitional histological features from typical fibroma to highly indifferentiated fibrosarcoma could be detected in come animal subjected to repeated biopsies. Ultrastructural study disclosed nuclear alterations and hyperactive ergastoplasm and collagen containing inclusions into the cytoplasm of fibroblasts. In the group of 7 untreated naimals, no malignant transformation could be detected histologically. Two aspects deserve attention: the malignant potential of a typical fibroma and the apparent effect of an antifibrosing drug in inducing malignization of this tumour.Foram utilizados no presente estudo, quinze ratos albinos (Sprague Dawley portadores de fibronas transplantados no tecido subcutâneo da parede abdominal. O tumor era constituído por fibroblastos típicos, em uma densa matriz colagênica e eram provenientes de um fibroma que apareceu espontaneamente em um rato albino da mesma linhagem. Ultraestruturalmente o colágeno mostrava periodicidade normal e os fibroblastos mostravam núcleo irregularmente denteado, com cromatina irregularmente distribuída, sugerindo aspectos transicionais para um fibrossarcoma. Os quinze animais, de diferentes grupos de passagem do tumor, foram
Glass microspheres for medical applications
Conzone, Samuel David
Radioactive dysprosium lithium borate glass microspheres have been developed as biodegradable radiation delivery vehicles for the radiation synovectomy treatment of rheumatoid arthritis. Once injected into a diseased joint, the microspheres deliver a potent dose of radiation to the diseased tissue, while a non-uniform chemical reaction converts the glass into an amorphous, porous, hydrated dysprosium phosphate reaction product. The non-radioactive, lithium-borate component is dissolved from the glass (up to 94% weight loss), while the radioactive 165Dy reacts with phosphate anions in the body fluids, and becomes "chemically" trapped in a solid, dysprosium phosphate reaction product that has the same size as the un-reacted glass microsphere. Ethylene diamine tetraacetate (EDTA) chelation therapy can be used to dissolve the dysprosium phosphate reaction product after the radiation delivery has subsided. The dysprosium phosphate reaction product, which formed in vivo in the joint of a Sprague-Dawley rat, was dissolved by EDTA chelation therapy in 100 Gy) of localized beta radiation to a treatment site within the body, followed by complete biodegradability. The non-uniform reaction process is a desirable characteristic for a biodegradable radiation delivery vehicle, but it is also a novel material synthesis technique that can convert a glass to a highly porous materials with widely varying chemical composition by simple, low-temperature, glass/solution reaction. The reaction product formed by nonuniform reaction occupies the same volume as the un-reacted glass, and after drying for 1 h at 300°C, has a specific surface area of ≈200 m2/g, a pore size of ≈30 nm, and a nominal crushing strength of ≈10 MPa. Finally, rhenium glass microspheres, composed of micron-sized, metallic rhenium particles dispersed within a magnesium alumino borate glass matrix were produced by sintering ReO2 powder and glass frit at 1050°C. A 50 mg injection of radioactive rhenium glass
RETRACTED: Granular and intergranular conduction in La1.32Sr1.68Mn2O7 layered manganite system
International Nuclear Information System (INIS)
Narjis, A.; El kaaouachi, A.; Dlimi, S.; Biskupski, G.; Daoudi, E.; Errai, M.; Sybous, A.; Limouny, L.
2013-01-01
This article has been retracted: please see Elsevier Policy on Article Withdrawal ( (http://www.elsevier.com/locate/withdrawalpolicy)). This article has been retracted at the request of the Editors. The authors have plagiarized part of a paper that had already appeared in J. Appl. Phys. 106, 093709 (2009); (10.1063/1.3256182) (6 pages): Title: Effects of pressure on charge transport and magnetic properties of La1.32Sr1.68Mn2O7 layered manganite by M. Kumaresavanji, M. S. Reis, Y. T. Xing, and M. B. Fontes. One of the conditions of submission of a paper for publication is that authors declare explicitly that their work is original and has not appeared in a publication elsewhere. Re-use of any data should be appropriately cited. As such this article represents a severe abuse of the scientific publishing system. The scientific community takes a very strong view on this matter and apologies are offered to readers of the journal that this was not detected during the submission process
Faraday effect in γ-Dy2S3 and c-Dy2O3 paramagnetic crystals
International Nuclear Information System (INIS)
Shelykh, A.I.
1987-01-01
Studies of spectral and temperature dependences of Faraday effect in γ-Dy 2 S 3 and C-Dy 2 O 3 paramagnetic crystals are conducted. Paramagnetism of these crystals is brought about by Dy 3+ ions. Estimation of the effect of such factors as the value of paramagnetic ion concentration, width of the forbidden band, crystallochemical composition on magnetooptical effect in the considered compounds of dysprosium is carried out on the basis of the obtained experimental data and theoretical analysis. It is shown, that the Faraday effect in the considered compounds of dysprosium as well as the value of paramagnetic moment may be regarded rather accurately in free ion approximation
Role of hydrogen in Nd–Fe–B sintered magnets with DyH{sub x} addition
Energy Technology Data Exchange (ETDEWEB)
Liu, Pan [State Key Laboratory of Silicon Materials, Department of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Ma, Tianyu, E-mail: maty@zju.edu.cn [Key Laboratory of Novel Materials for Information Technology of Zhejiang Province, Zhejiang University, Hangzhou 310027 (China); Wang, Xinhua, E-mail: xinhwang@zju.edu.cn [State Key Laboratory of Silicon Materials, Department of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Zhang, Yujing [State Key Laboratory of Silicon Materials, Department of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Yan, Mi [State Key Laboratory of Silicon Materials, Department of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Key Laboratory of Novel Materials for Information Technology of Zhejiang Province, Zhejiang University, Hangzhou 310027 (China)
2015-04-15
Highlights: • DyH{sub 2} and DyH{sub 3} fine powder were prepared. • Effect of DyH{sub x} on the magnetic properties of Nd–Fe–B sintered magnets was studied. • The effect mechanism of Dy hydrides was discussed. • The magnetic properties are greatly improved by DyH{sub 2} and DyH{sub 3} addition. - Abstract: In order to improve the coercivity of Nd–Fe–B sintered magnets, DyH{sub 2} and DyH{sub 3} fine powders were prepared and used as additive for preparing Nd–Fe–B sintered magnets. The effects of DyH{sub x} powders addition on the microstructures and the magnetic properties of the magnets have been investigated. It was found that hydrogen will react with oxygen of NdO{sub x} rich intergranular phases to form Nd rich phases by dysprosium hydride addition. The Nd-rich grain boundary phases are more homogenous and continuous because the volume fraction of Nd-rich grain boundary phases increases with respect to the Nd oxide phases. After desorption, fine dysprosium powders become more active and wrap matrix phases well so that the diffusion of dysprosium to the surface layer of matrix phases is convenient, so dysprosium decreases in grain boundary phases and aggregates in surface layer of matrix phases. Then, intrinsic coercivity of NdFeB sintered magnets is improved from 14.96 kOe to 20.5 kOe and 20.31 kOe by 2.0 wt.% DyH{sub 3} and 2.0 wt.% DyH{sub 2} addition, respectively. This study has shown that DyH{sub x} addition can reduce the content of oxygen in grain boundary phases. This can be an effective method for massive production.
Anisotropic bonded Sm2.3Fe16.8Zr0.2Ny magnets prepared by milling of as cast material
International Nuclear Information System (INIS)
Gebel, B.; Kubis, M.; Roessler, U.K.; Mueller, K.H.
2001-01-01
As cast Sm 2.3 Fe 16.8 Zr 0.2 material was milled for 100 min ≤ t ≤ 900 min. After annealing at 800 C for 1 h and subsequent nitrogenation, the samples were cold compacted in a magnetic field and resin bonded. The coercivity μ 0J H C of the samples increased from 0.59 T (t = 100 min) to 2.18 T (t = 900 min). On the other hand, the remanence along the texture axis decreased monotonically with increasing milling time due to the decrease of the degree of texture of the aligned powders. Prolonged milling leads finally to the formation of a soft magnetic phase as indicated by a shoulder in the demagnetization curve for t > 600 min. The highest energy product (BH) max of 50 kJm -3 (136 kJm -3 for the theoretical density of 7.7 gcm -3 ) was obtained for an intermediate milling time of 400 min. Zn bonding of the powders resulted in magnets with lower energy products but improved coercivities. (orig.)
International Nuclear Information System (INIS)
Belykh, S.F.; Evtukhov, R.N.; Redina, I.V.; Ferleger, V.Kh.
1989-01-01
Results of experiment, where Dy + beams, its spraying products emitting intensively optical radiation with continuous spectrum (CSR), are used for tantalum surface bombardment, are presented. The given experiment allowed one to separate the scattered particle CSR contribution and was conducted under controlled beam n atom concentration on the target surface. E 0 energy and j 0 dysprosium ion flux density made up respectively 3.5 keV and 3x10 5 Axcm -2 . The obtained result analysis has shown that a notable dependence of spectrum type on n value is detected. Dy scattered atoms to not emit CSR. The main contribution to CSR is made by sprayed particles, containing dysprosium atoms
Low temperature magnetoresistance in La1.32Sr1.68Mn2O7 layered manganite under hydrostatic pressure
International Nuclear Information System (INIS)
Kumaresavanji, M.; Fontes, M.B.
2010-01-01
The La 1.32 Sr 1.68 Mn 2 O 7 layered manganite system has been studied by the low temperature electrical resistance and magnetoresistance under hydrostatic pressure up to 25 kbar. We have observe both, a Curie temperature (T C ) and a metal-insulator transition (T MI ) at 118 K in the ambient pressure. The applied pressure shifts the T MI to higher temperature values and induces a second metal-insulator transition (T 2 MI ) at 90 K, in the temperature dependence of resistivity measurements. Also, the pressure suppresses the peak resistance abruptly at T C . When an external field of 5 T is applied, we have observed a large negative magnetoresistance of 300% at the transition temperature and a 128% at 4.5 K. However, the increased pressure decreases the magnetoresistance ratio gradually. When the pressure reaches its maximum available value of 25 kbar, the magnetoresistance ratio decreases at a rate of 1.3%/kbar. From our experimental results, the decrease of magnetoresistance ratio with pressure is explained by the pressure induced canted spin state which is not favor for the spin polarized intergrain tunneling in layered manganites.
International Nuclear Information System (INIS)
Dantas, E.S.K.
1990-01-01
A graphite furnace atomic-absorption spectrometry method for the determination of neodymium, europium, terbium, dysprosium and yttrium at trace level in samarium oxide; of samarium, europium, dysprosium, holmium, erbium and yttrium in terbium oxide and of europium, terbium, holmium, erbium and yttrium in dysprosium oxide was established. The best pyrolysis and atomization temperatures were determined for each lanthanide considered. Calibration curves were obtained for the pure elements, for binary mixtures formed by the matrix and each of the lanthanides studied and, finally, for the complex mixtures constituted by the matrix and all the other lanthanide of the group under scrutiny. This study has been carried out to examine the interference of the presence of one lanthanide on the behaviour of the other, since a lack of linearity on the calibration curves has been observed in some cases. Detection and determination limits have been determined as well. The detection limits encountered were within the range 0.002 to 0.3% for different elements. The precision of the method expressed as the relative standard deviation was calculated for each element present in each of the matrices studied. The conclusion arrived at is that the method can be applied for determining the above mentioned lanthanides present in the matrices studied with purity up to 99.50%. (author)
Performance assessment of imaging plates for the JHR transfer Neutron Imaging System
Simon, E.; Guimbal, P. AB(; )
2018-01-01
The underwater Neutron Imaging System to be installed in the Jules Horowitz Reactor (JHR-NIS) is based on a transfer method using a neutron activated beta-emitter like Dysprosium. The information stored in the converter is to be offline transferred on a specific imaging system, still to be defined. Solutions are currently under investigation for the JHR-NIS in order to anticipate the disappearance of radiographic films commonly used in these applications. We report here the performance assessment of Computed Radiography imagers (Imaging Plates) performed at LLB/Orphée (CEA Saclay). Several imaging plate types are studied, in one hand in the configuration involving an intimate contact with an activated dysprosium foil converter: Fuji BAS-TR, Fuji UR-1 and Carestream Flex XL Blue imaging plates, and in the other hand by using a prototypal imaging plate doped with dysprosium and thus not needing any contact with a separate converter foil. The results for these imaging plates are compared with those obtained with gadolinium doped imaging plate used in direct neutron imaging (Fuji BAS-ND). The detection performances of the different imagers are compared regarding resolution and noise. The many advantages of using imaging plates over radiographic films (high sensitivity, linear response, high dynamic range) could palliate its lower intrinsic resolution.
Directory of Open Access Journals (Sweden)
Marzieh tavanaei
2017-02-01
Full Text Available Introduction: Heavy metals contamination due to natural and anthropogenic sources is a global environmental concern. Lead (Pb is one of the very toxic heavy metals. Industrial production processes and their emissions, mining operation, smelting, combustion sources and solid waste incinerators are the primary sources of lead. This heavy metal has aberrant effects on the environment and living organisms. Hence, proper treatment of lead from soil and industrial wastewaters is very important. In order to remove toxic heavy metals from contaminated water systems, conventional methods such as chemical precipitation, coagulation, ion exchange, solvent extraction and filtration, evaporation and membrane methods are being used. These conventional methods generally have high costs and technical problems. Therefore, biosorption processes, in which microorganisms are used as sorbents, have been considered as economical and environmentally friendly options for removal of heavy metals from aqueous solution. Clay minerals are another group of sorbents used in removal of heavy metals from polluted environments. Furthermore, bacterial cells can be attached on clay mineral surfaces and form bacteria-mineral composites. These composites adsorb heavy metals and convert them into forms with low mobility and bioavailability. Pseudomonas putida is a unique microorganism with a high tendency to sorb and/or degrade certain environmental pollutants. Palygorskite and sepiolite are the fibrous clay minerals of arid and semiarid regions; their structures consist of ribbons and channels. These fibrous minerals have various applications in industry and the environment because of its large surface area and high adsorption capacity. The present study was conducted in order to determine the ability of Pseudomonas putida (P168, and its composites with palygorskite and sepiolite in lead sorption. Materials and Methods: The bacterial strain used in the present study was Pseudomonas
Dysprosium selective potentiometric membrane sensor
Energy Technology Data Exchange (ETDEWEB)
Zamani, Hassan Ali, E-mail: haszamani@yahoo.com [Department of Applied Chemistry, Mashhad Branch, Islamic Azad University, Mashhad (Iran, Islamic Republic of); Faridbod, Farnoush; Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)
2013-03-01
A novel Dy(III) ion-selective PVC membrane sensor was made using a new synthesized organic compound, 3,4-diamino-N Prime -((pyridin-2-yl)methylene)benzohydrazide (L) as an excellent sensing element. The electrode showed a Nernstian slope of 19.8 {+-} 0.6 mV per decade in a wide concentration range of 1.0 Multiplication-Sign 10{sup -6}-1.0 Multiplication-Sign 10{sup -2} mol L{sup -1}, a detection limit of 5.5 Multiplication-Sign 10{sup -7} mol L{sup -1}, a short conditioning time, a fast response time (< 10 s), and high selectivity towards Dy(III) ion in contrast to other cations. The proposed sensor was successfully used as an indicator electrode in the potentiometric titration of Dy(III) ions with EDTA. The membrane sensor was also applied to the F{sup -} ion indirect determination of some mouth washing solutions and to the Dy{sup 3+} determination in binary mixtures. Highlights: Black-Right-Pointing-Pointer The novelty of this work is based on the high affinity of the ionophore toward the Dy{sup 3+} ions. Black-Right-Pointing-Pointer This technique is very simple, fast and inexpensive and it is not necessary to use sophisticated equipment. Black-Right-Pointing-Pointer The newly developed sensor is superior to the formerly reported Dy{sup 3+} sensors in terms of selectivity.
Chilton, Nicholas F; Deacon, Glen B; Gazukin, Olga; Junk, Peter C; Kersting, Berthold; Langley, Stuart K; Moubaraki, Boujemaa; Murray, Keith S; Schleife, Frederik; Shome, Mahasish; Turner, David R; Walker, Julia A
2014-03-03
Three complexes of the form [Ln(III)3(OQ)9] (Ln = Gd, Tb, Dy; OQ = 8-quinolinolate) have been synthesized and their magnetic properties studied. The trinuclear complexes adopt V-shaped geometries with three bridging 8-quinolinolate oxygen atoms between the central and peripheral eight-coordinate metal atoms. The magnetic properties of these three complexes differ greatly. Variable-temperature direct-current (dc) magnetic susceptibility measurements reveal that the gadolinium and terbium complexes display weak antiferromagnetic nearest-neighbor magnetic exchange interactions. This was quantified in the isotropic gadolinium case with an exchangecoupling parameter of J = -0.068(2) cm(-1). The dysprosium compound displays weak ferromagnetic exchange. Variable-frequency and -temperature alternating-current magnetic susceptibility measurements on the anisotropic cases reveal that the dysprosium complex displays single-molecule-magnet behavior, in zero dc field, with two distinct relaxation modes of differing time scales within the same molecule. Analysis of the data revealed anisotropy barriers of Ueff = 92 and 48 K for the two processes. The terbium complex, on the other hand, displays no such behavior in zero dc field, but upon application of a static dc field, slow magnetic relaxation can be observed. Ab initio and electrostatic calculations were used in an attempt to explain the origin of the experimentally observed slow relaxation of the magnetization for the dysprosium complex.
Directory of Open Access Journals (Sweden)
A. Rouillard
2004-12-01
Full Text Available An understanding of how the heliosphere modulates galactic cosmic ray (GCR fluxes and spectra is important, not only for studies of their origin, acceleration and propagation in our galaxy, but also for predicting their effects (on technology and on the Earth's environment and organisms and for interpreting abundances of cosmogenic isotopes in meteorites and terrestrial reservoirs. In contrast to the early interplanetary measurements, there is growing evidence for a dominant role in GCR shielding of the total open magnetic flux, which emerges from the solar atmosphere and enters the heliosphere. In this paper, we relate a strong 1.68-year oscillation in GCR fluxes to a corresponding oscillation in the open solar magnetic flux and infer cosmic-ray propagation paths confirming the predictions of theories in which drift is important in modulating the cosmic ray flux. Key words. Interplanetary physics (Cosmic rays, Interplanetary magnetic fields
García-Caballero, Tomás; Grabau, Dorthe; Green, Andrew R; Gregory, John; Schad, Arno; Kohlwes, Elke; Ellis, Ian O; Watts, Sarah; Mollerup, Jens
2010-01-01
García-Caballero T, Grabau D, Green A R, Gregory J, Schad A, Kohlwes E, Ellis I O, Watts S & Mollerup J (2010) Histopathology56, 472–480 Determination of HER2 amplification in primary breast cancer using dual-colour chromogenic in situ hybridization is comparable to fluorescence in situ hybridization: a European multicentre study involving 168 specimens Aims: Fluorescence in situ hybridization (FISH) can be used to reveal several genomic imbalances relevant to proper cancer diagnosis and to the correct treatment regime. However, FISH requires expensive and advanced fluorescence microscopes in addition to expertise in fluorescence microscopy. To determine whether a newly developed dual-colour chromogenic in situ hybridization (CISH) method is a suitable alternative to FISH, we analysed the human epidermal growth factor receptor 2 gene (HER2) amplification level of 168 breast cancer specimens using dual-colour CISH and FISH and compared the results. Methods and results: We found 100% agreement between HER2 status determined by FISH and dual-colour CISH. Furthermore, we observed that the time used to score slides was significantly reduced by 28% in dual-colour CISH compared with the FISH protocol. Concordance between HER2 protein status and dual-colour CISH or FISH was equally good with an overall agreement of 96.8%. Correlation between the HER2/centromere 17 gene ratios obtained with dual-colour CISH and FISH was highly significant with an overall correlation coefficient (ρ) of 0.96. Conclusions: We conclude that dual-colour CISH and bright field microscopy are excellent alternatives to FISH when analysing the HER2 status of primary breast cancer. PMID:20459554
African Journals Online (AJOL)
USER
2014-12-02
Dec 2, 2014 ... 2Applied Plant Anatomy and Wood Technology Laboratory, Department Of Plant Biology, University Of Ilorin, ... Fresh flowers of five species of Amaranthus were studied and documented in detail using light ... problems related to the origin and evolution of many taxa (Nair, 1980) and provide classification of.
Energy Technology Data Exchange (ETDEWEB)
Narjis, A., E-mail: NARJIS78@gmail.com [Research Group ESNPS, Physics department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); El kaaouachi, A.; Dlimi, S. [Research Group ESNPS, Physics department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); Biskupski, G. [Laboratoire de Spectroscopie Hertzienne LSH, Bâtiment P5, Université des Sciences et Technologies, de Lille I 59 655 Villeneuve d’Ascq Cedex (France); Daoudi, E.; Errai, M.; Sybous, A.; Limouny, L. [Research Group ESNPS, Physics department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco)
2013-06-15
This article has been retracted: please see Elsevier Policy on Article Withdrawal ( (http://www.elsevier.com/locate/withdrawalpolicy)). This article has been retracted at the request of the Editors. The authors have plagiarized part of a paper that had already appeared in J. Appl. Phys. 106, 093709 (2009); (10.1063/1.3256182) (6 pages): Title: Effects of pressure on charge transport and magnetic properties of La1.32Sr1.68Mn2O7 layered manganite by M. Kumaresavanji, M. S. Reis, Y. T. Xing, and M. B. Fontes. One of the conditions of submission of a paper for publication is that authors declare explicitly that their work is original and has not appeared in a publication elsewhere. Re-use of any data should be appropriately cited. As such this article represents a severe abuse of the scientific publishing system. The scientific community takes a very strong view on this matter and apologies are offered to readers of the journal that this was not detected during the submission process.
Cressault, Yann; Teulet, Philippe; Zissis, Georges
2016-07-01
The lighting represents a consumption of about 19% of the world electricity production. We are thus searching new effective and environment-friendlier light sources. The ceramic metal-halide high intensity lamps (C-MHL) are one of the options for illuminating very high area. The new C-MHL lamps contain additives species that reduce mercury inside and lead to a richer spectrum in specific spectral intervals, a better colour temperature or colour rendering index. This work is particularly focused on the power radiated by these lamps, estimated using the net emission coefficient, and depending on several additives (calcium, sodium, tungsten, dysprosium, and thallium or strontium iodides). The results show the strong influence of the additives on the power radiated despite of their small quantity in the mixtures and the increase of visible radiation portion in presence of dysprosium.
Axial segregation in high intensity discharge lamps measured by laser absorption spectroscopy
Stoffels, W.W.; Flikweert, A.J.; Nimalasuriya, T.; Groothuis, C.H.J.M.; Haverlag, M.; Kroesen, G.M.W.
2005-01-01
HID lamps containing rare earth additives (in our case dysprosium) show color separation because of axial segregation, caused by diffusion and convection. Two-dimensional atomic Dy density profiles are measured by means of laser absorption spectroscopy. The radially resolved atomic density
Paramagnetic metal complexes as potential relaxation agents for NMR imaging
International Nuclear Information System (INIS)
Coroiu, Ilioara; Demco, D. E.; Darabont, Al.; Bogdan, M.
1997-01-01
The development of nuclear magnetic resonance (NMR) imaging technique as a clinical diagnostic modality has prompted the need for a new class of pharmaceuticals. These drugs must be administered to a patient in order to enhance the image contrast between the normal and diseased tissue and/or indicate the status of organ function or blood flow. Paramagnetic compounds are presently undergoing extensive evaluation as contrast agents in magnetic resonance imaging (MRI). These agents increase contrast in MRI by differentially localizing in tissue where they increase the relaxation rates of nearby water protons. The longitudinal R 1 and transverse R 2 relaxivities were measured as a function of molar concentrations for some new paramagnetic complexes like the following: dysprosium, erbium and gadolinium citrates, gadolinium methylene diphosphonate, dysprosium and gadolinium iminodiacetate, manganese para-aminobenzoate and copper nicotinate. The available theoretical approaches for quantitative understanding are presented. (authors)
Dysprosium-free melt-spun permanent magnets
International Nuclear Information System (INIS)
Brown, D N; Wu, Z; He, F; Miller, D J; Herchenroeder, J W
2014-01-01
Melt-spun NdFeB powders can be formed into a number of different types of permanent magnet for a variety of applications in electronics, automotive and clean technology industries. The melt-spinning process produces flake powder with a fine uniform array of nanoscale Nd 2 Fe 14 B grains. These powders can be net-shape formed into isotropic polymer-bonded magnets or hot formed into fully dense magnets. This paper discusses the influence of heavy rare earth elements and microstructure on the magnetic performance, thermal stability and material cost of NdFeB magnets. Evidence indicates that melt-spun nanocrystalline NdFeB magnets are less dependent on heavy rare earth elements for high-temperature performance than the alternative coarser-grained sintered NdFeB magnets. In particular, hot-pressed melt-spun magnets are an attractive low-cost solution for applications that require thermal stability up to 175–200 °C. (paper)
Dysprosium-free melt-spun permanent magnets.
Brown, D N; Wu, Z; He, F; Miller, D J; Herchenroeder, J W
2014-02-12
Melt-spun NdFeB powders can be formed into a number of different types of permanent magnet for a variety of applications in electronics, automotive and clean technology industries. The melt-spinning process produces flake powder with a fine uniform array of nanoscale Nd2Fe14B grains. These powders can be net-shape formed into isotropic polymer-bonded magnets or hot formed into fully dense magnets. This paper discusses the influence of heavy rare earth elements and microstructure on the magnetic performance, thermal stability and material cost of NdFeB magnets. Evidence indicates that melt-spun nanocrystalline NdFeB magnets are less dependent on heavy rare earth elements for high-temperature performance than the alternative coarser-grained sintered NdFeB magnets. In particular, hot-pressed melt-spun magnets are an attractive low-cost solution for applications that require thermal stability up to 175-200 °C.
The decay of hot dysprosium nuclei
International Nuclear Information System (INIS)
Atac, A.; Rekstad, J.; Guttormsen, M.; Messelt, S.; Ramsoey, T.; Thorsteinsen, T.F.; Loevhoeiden, G.; Roedland, T.
1987-03-01
The γ-decay following the 162,163 Dy( 3 He,αxn) reactions with E 3 He =45 MeV has been studied. Non-statistical γ-radiation with energies of E γ ≅1 MeV and ≅2 MeV is found for various residual nuclei. The properties of these γ-ray bumps depend on the number of emitted neutrons and reveal an odd-even mass dependence. New techniques to extract average neutron energies as a function of excitation energy and of the number of emitted neutrons are employed. The deduced neutron energies are consistent with Fermi-gas model predictions
Accumulation of weak optical signals and spectral memory in InSe single crystals
International Nuclear Information System (INIS)
Abdinov, A.Shj.; Babaeva, R.F.
1995-01-01
Dysprosium alloying effect on the electron and physico-chemical properties of InSe monocrystals is studied. Accumulation of low light signals and spectral or color memory is shown to be observed under certain conditions (temperature, content of admitted impurity, wave length and light intensity)
Energy Technology Data Exchange (ETDEWEB)
Gebel, B.; Kubis, M.; Roessler, U.K.; Mueller, K.H. [Institut fuer Festkoerper- und Werkstofforschung Dresden e.V. (Germany). Inst. fuer Metallische Werkstoffe
2001-07-01
As cast Sm{sub 2.3}Fe{sub 16.8}Zr{sub 0.2} material was milled for 100 min {<=} t {<=} 900 min. After annealing at 800 C for 1 h and subsequent nitrogenation, the samples were cold compacted in a magnetic field and resin bonded. The coercivity {mu}{sub 0J}H{sub C} of the samples increased from 0.59 T (t = 100 min) to 2.18 T (t = 900 min). On the other hand, the remanence along the texture axis decreased monotonically with increasing milling time due to the decrease of the degree of texture of the aligned powders. Prolonged milling leads finally to the formation of a soft magnetic phase as indicated by a shoulder in the demagnetization curve for t > 600 min. The highest energy product (BH){sub max} of 50 kJm{sup -3} (136 kJm{sup -3} for the theoretical density of 7.7 gcm{sup -3}) was obtained for an intermediate milling time of 400 min. Zn bonding of the powders resulted in magnets with lower energy products but improved coercivities. (orig.)
Czech Academy of Sciences Publication Activity Database
Kalbáč, Martin; Kavan, Ladislav; Zukalová, Markéta; Yang, S.; Čech, J.; Roth, S.; Dunsch, L.
2007-01-01
Roč. 13, - (2007), s. 8811-8817 ISSN 0947-6539 R&D Projects: GA AV ČR KJB400400601; GA MŠk LC510 Institutional research plan: CEZ:AV0Z40400503 Keywords : dysprosium * electrochemistry * fullerenes * nanotubes Subject RIV: CG - Electrochemistry Impact factor: 5.330, year: 2007
Thermal characterization of (U, Dy)O2 pellets
International Nuclear Information System (INIS)
Pelloni, M; Bianchi, L; Pablovich, M.E; Kaufmann, F; Kempf, R
2012-01-01
The thermal diffusivity of (U,Dy)O 2 pellets were determined in the temperature range 250 K to 1600 K measured by the laser flash method. The dependence of thermal with temperature and dysprosium content was studied and found in good agreement with physical models available (author)
Axial segregation in high intensity discharge lamps measured by laser absorption spectroscopy
Flikweert, A.J.; Nimalasuriya, T.; Groothuis, C.H.J.M.; Kroesen, G.M.W.; Stoffels, W.W.
2005-01-01
High intensity discharge lamps have a high efficiency. These lamps contain rare-earth additives (in our case dysprosium iodide) which radiate very efficiently. A problem is color separation in the lamp because of axial segregation of the rare-earth additives, caused by diffusion and convection. Here
American Society for Testing and Materials. Philadelphia
2008-01-01
1.1 The purpose of this test method is to define a general procedure for determining an unknown thermal-neutron fluence rate by neutron activation techniques. It is not practicable to describe completely a technique applicable to the large number of experimental situations that require the measurement of a thermal-neutron fluence rate. Therefore, this method is presented so that the user may adapt to his particular situation the fundamental procedures of the following techniques. 1.1.1 Radiometric counting technique using pure cobalt, pure gold, pure indium, cobalt-aluminum, alloy, gold-aluminum alloy, or indium-aluminum alloy. 1.1.2 Standard comparison technique using pure gold, or gold-aluminum alloy, and 1.1.3 Secondary standard comparison techniques using pure indium, indium-aluminum alloy, pure dysprosium, or dysprosium-aluminum alloy. 1.2 The techniques presented are limited to measurements at room temperatures. However, special problems when making thermal-neutron fluence rate measurements in high-...
Double Solvent for Extracting Rare Earth Concentrate
International Nuclear Information System (INIS)
Bintarti, AN; Bambang EHB
2007-01-01
An extraction process to rare earth concentrate which contain elements were yttrium (Y), lanthanum (La), cerium (Ce), neodymium (Nd), samarium (Sm), gadolinium (Gd) and dysprosium (Dy) which were dissolved in to nitric acid has been done. The experiment of the extraction by double solvent in batch to mix 10 ml of the feed with 10 ml solvent contained the pair of solvent was TBP and TOA, D2EHPA and TOA, TBP and D2EHPA in cyclohexane as tinner. It was selected a right pairs of solvent for doing variation such as the acidity of the feed from 2 - 6 M and the time of stirring from 5 - 25 minutes gave the good relatively extraction condition to Dy element such as using 10 % volume of TOA in D2EHPA and cyclohexane, the acidity of the feed 3 M and the time stirring 15 minutes produced coefficient distribution to dysprosium = 0.586 and separation factor Dy-Ce = ∼ (unlimited); Dy-Nd = 4.651. (author)
Investigations on structural, optical and magnetic properties of Dy-doped zinc ferrite nanoparticles
Vinosha, P. Annie; Deepapriya, S.; Rodney, John. D.; Das, S. Jerome
2018-04-01
A persuasive and thriftily feasible homogeneous co-precipitation route was adopted to fabricate dysprosium (Dy) doped zinc ferrite (Zn1-xDyxFe2O4)nanoparticles in order to examine their structural, optical and magnetic properties. Theas-synthesized Zn1-xDyxFe2O4 was studied for its momentous applications in photo-degradation of organic Methylene Blue (MB) dye. The paper marksthe connotation of zinc ferrite nanocatalyst in Photo-Fenton degradation. The chemical composition of dysprosium has a decisive feature of this research work. From X-ray diffraction analysis (XRD), spinel phase formation of theas-synthesized Zn1-xDyxFe2O4 nanoparticles was observedand the crystallite size was foundto increase as the doping concentration increased. Theabsorption bands peaked between 600-400 cm-l waspragmatic by Fourier Transform Infrared spectral analysis (FTIR). Transmission Electron Microscopy (TEM) micrograph elucidated the morphology and the speck size of as-synthesized nanoparticles. Surface area and pore size were determined by Brunauer-Emmett-Teller (BET) technique.
Comparative examination of the fresh and spent nuclear TRIGA fuel by neutron radiography
International Nuclear Information System (INIS)
Dinca, M.
2016-01-01
At the Institute for Nuclear Research (INR) there is in operation an underwater (wet) neutron radiography facility (INUM) designed especially for nuclear fuel investigation. INUM was involved in CANDU experimental type and TRIGA type nuclear fuel investigations. In this paper are presented the results after investigation of the nuclear fuel TRIGA-HEU and TRIGA-LEU, fresh and spent, using transfer method with metallic foils of dysprosium and indium and radiographic films (38 cm x 10 cm). This method is the most suitable for spent fuel and offers a high geometrical resolution of the images that subsequently are digitalized with a professional scanner for films. From the images obtained for TRIGA-HEU and TRIGA-LEU with different degree of burn-up there are established the opportunities to use dysprosium or indium converter foils based on their response to thermal or epithermal neutrons to evaluate the degree of burn-up, dimensional measurements, defects etc. (authors)
International Nuclear Information System (INIS)
Nettles, W.G.
1979-01-01
Alpha scattering measurements were performed at center-of-mass energies near the Coulomb barrier. These energies allow for nuclear as well as pure Coulomb forces to play a significant role in the excitation process. The interference of these two forces is very sensitive to the sign of the E4 ground-state moment, whereas pure Coulomb excitation is not. Systematics of the E4 moments of the rare earth mass region indicate a transition in the magnitude and sign of the reduced matrix element of the M(E4) operator between 0 + and 4 + states from small and positive to large and negative between Yb and W. Previous Coulomb-nuclear interference measurements show that this reduced matrix element for 180 Hf is large and negative. The present results agree with that conclusion. It is also shown that the above reduced matrix element for 178 Hf, like that of 180 Hf, is large and negative. The small and positive moment (matrix element) for 168 Yb is seen to be consistent with the experimental data. No conclusions are drawn for the E4 moment in 176 Hf. The measurement of nuclear lifetimes shorter than 500 ps requires the use of plastic scintilltor detectors. These detectors, however have very poor energy resolution. A system is described that uses plastic scintillators with a magnetic lens spectrometer for energy selection. The system was used to measure the lifetime of the 522-keV 0 + sate in 186 Hf. A data analysis method using higher-order distribution moments is also presented
DEFF Research Database (Denmark)
Habib, Komal; Schibye, Peter Klausen; Vestbø, Andreas Peter
2014-01-01
for considerable size and weight reduction in modern applications. This study aims to explore the current and future potential of secondary supply of neodymium and dysprosium from recycling of NdFeB magnets. For this purpose, Material Flow Analysis (MFA) has been carried out to perform the detailed mapping...
Tuning the activity of Pt alloy electrocatalysts by means of the lanthanide contraction
DEFF Research Database (Denmark)
Escribano, Maria Escudero; Malacrida, Paolo; Hansen, Martin Hangaard
2016-01-01
is lanthanum, cerium, samarium, gadolinium, terbium, dysprosium, thulium, or calcium. The materials are among the most active polycrystalline Pt-based catalysts reported, presenting activity enhancement by a factor of 3 to 6 over Pt. The active phase consists of a Pt overlayer formed by acid leaching. The ORR...
Energy Technology Data Exchange (ETDEWEB)
U.S. Department of Energy, National Nuclear Security Administration Nevada
2001-11-21
This Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Operations Office's approach to collect data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit 168 under the Federal Facility Agreement and Consent Order. Corrective Action Unit 168 consists of a group of twelve relatively diverse Corrective Action Sites (CASs 25-16-01, Construction Waste Pile; 25-16-03, MX Construction Landfill; 25-19-02, Waste Disposal Site; 25-23-02, Radioactive Storage RR Cars; 25-23-18, Radioactive Material Storage; 25-34-01, NRDS Contaminated Bunker; 25-34-02, NRDS Contaminated Bunker; CAS 25-23-13, ETL - Lab Radioactive Contamination; 25-99-16, USW G3; 26-08-01, Waste Dump/Burn Pit; 26-17-01, Pluto Waste Holding Area; 26-19-02, Contaminated Waste Dump No.2). These CASs vary in terms of the sources and nature of potential contamination. The CASs are located and/or associated wit h the following Nevada Test Site (NTS) facilities within three areas. The first eight CASs were in operation between 1958 to 1984 in Area 25 include the Engine Maintenance, Assembly, and Disassembly Facility; the Missile Experiment Salvage Yard; the Reactor Maintenance, Assembly, and Disassembly Facility; the Radioactive Materials Storage Facility; and the Treatment Test Facility Building at Test Cell A. Secondly, the three CASs located in Area 26 include the Project Pluto testing area that operated from 1961 to 1964. Lastly, the Underground Southern Nevada Well (USW) G3 (CAS 25-99-16), a groundwater monitoring well located west of the NTS on the ridgeline of Yucca Mountain, was in operation during the 1980s. Based on site history and existing characterization data obtained to support the data quality objectives process, contaminants of potential concern (COPCs) for CAU 168 are primarily radionuclide; however, the COPCs for several CASs were not defined. To address COPC
Critical resources in clean energy technologies and waste flows
DEFF Research Database (Denmark)
Habib, Komal
is fraught with the risk of shifting the supply security problem from one type of non‐renewable resources (fossil fuels) to another type (metals), in particular the specialty metals such as rare earth elements e.g. neodymium and dysprosium. This PhD work presented an in‐depth analysis of potential resource...
Regulation of the growth and photosynthesis of cherry tomato ...
African Journals Online (AJOL)
The growth and photosynthetic characteristics of cherry tomato seedlings were investigated under seven light irradiations such as dysprosium lamps (white light; control, C), red light emitting diodes (LEDs) (R), blue LEDs (B), orange LEDs (O), green LEDs (G), red and blue LEDs (RB) and red, blue and green LEDs (RBG) ...
A Thermally Actuated Flux Pump for Energizing YBCO Pucks
2016-05-01
a Hall sensor with an advertised active area of approximately 1.016 mm diameter supplied by Lakeshore was positioned in the centre of the YBCO as...top and the coldhead (green) along the bottom. The brown colour is the light green of the coldhead and the orange of the dysprosium centre
Perovskite catalysts for oxidative coupling
Campbell, Kenneth D.
1991-01-01
Perovskites of the structure A.sub.2 B.sub.2 C.sub.3 O.sub.10 are useful as catalysts for the oxidative coupling of lower alkane to heavier hydrocarbons. A is alkali metal; B is lanthanide or lanthanum, cerium, neodymium, samarium, praseodymium, gadolinium or dysprosium; and C is titanium.
International Nuclear Information System (INIS)
2010-01-01
AREVA generated consolidated revenue of 6.168 billion euros over the first nine months of 2010 for growth of 6.3% (+5.2% like-for-like) compared with the same period in 2009. The main revenue growth engines were the Reactors and Services Business Group and the Back End Business Group, with growth of 11.5% and 7.1% respectively. Foreign exchange had a positive impact of 82 million euros over the period, while changes in consolidation scope had negligible impact. Third quarter 2010 revenue amounted to 2.011 billion euros for growth of 6.1% (+4.4% LFL) compared with the third quarter of 2009. The Reactors and Services Business Group and the Back End Business Group, posting increases of 11.2% and 9.0% respectively, continued to lead this growth. Foreign exchange had a positive impact of 39 million euros, while changes in consolidation scope had negligible impact. The group's backlog came to 42.7 billion euros at September 30, 2010, an increase of 2.2% compared with September 30, 2009 (41.8 billion euros). For the full year of 2010, the group confirms its outlook for significant revenue and backlog growth, increased operating performance excluding particular items, negative operating income, and strong growth in net income attributable to owners of the group with the contribution of the gain on the sale of the Transmission and Distribution business
Preparation, Structure Characterization and Thermal Decomposition ...
African Journals Online (AJOL)
NJD
Decomposition Process of the Dysprosium(III) m-Methylbenzoate 1 ... A dinuclear complex [Dy(m-MBA)3phen]2·H2O was prepared by the reaction of DyCl3·6H2O, m-methylbenzoic acid and .... ing rate of 10 °C min–1 are illustrated in Fig. 4.
International Nuclear Information System (INIS)
Kondrashina, Yu.G.; Mustafina, A.R.; Devyatov, F.V.; Vul'fson, S.G.; Kazanskij Gosudarstvennyj Univ., Kazan
1995-01-01
Data of pH-metric and magnetooptical analyses were used to evaluate stability and structure of benzoate and aminobenzoate dysprosium (3) complexes in water and water - 80 vol.% DMSO (DMFA) mixtures. Factors, dictating change of complex structure and stability when passing from water to organic water solvents, are discussed. 19 refs.; 2 figs.; 1 tab
Field dosimetry on sterilization area of medical-hospitable materials
International Nuclear Information System (INIS)
Mariano, C.S.T.P.; Campos, L.L.
1992-01-01
The calcium sulfate doped with dysprosium, used in high dose dosimetry by electron paramagnetic resonance (EPR), is studied on field dosimetry for medical-hospitable materials sterilization. The calibration curves of EPR signal in function of absorbed dose in air and the thermal decay of EPR signal at room temperature are also presented. (C.G.C)
Excited bands in even-even rare-earth nuclei
International Nuclear Information System (INIS)
Vargas, Carlos E.; Hirsch, Jorge G.
2004-01-01
The energetics of states belonging to normal parity bands in even-even dysprosium isotopes, and their B(E2) transition strengths, are studied using an extended pseudo-SU(3) shell model. States with pseudospin 1 are added to the standard pseudospin 0 space, allowing for a proper description of known excited normal parity bands
Possibility for precise Weinberg-angle measurement in centrosymmetric crystals with axis
Mukhamedjanov, T. N.; Sushkov, O. P.
2006-03-01
We demonstrate that parity-nonconserving interaction due to the nuclear weak charge QW leads to a nonlinear magnetoelectric effect in centrosymmetric paramagnetic crystals. It is shown that the effect exists only in crystals with special symmetry axis k . Kinematically, the correlation (correction to energy) has the form HPNC∝QWE•[B×k](B•k) , where B and E are external magnetic and electric fields. This gives rise to the magnetic induction MPNC∝QW{k(B•[k×E])+[k×E](B•k)} . To be specific, we consider rare-earth-metal trifluorides and, in particular, dysprosium trifluoride which looks the most suitable for experiment. We estimate the optimal temperature for the experiment to be of a few kelvin. For the magnetic field B=1T and the electric field E=10kV/cm , the expected magnetic induction is 4πMPNC˜0.5×10-11G , six orders of magnitude larger than the best sensitivity currently under discussion. Dysprosium has several stable isotopes, and so comparison of the effects for different isotopes provides the possibility for precise measurement of the Weinberg angle.
International Nuclear Information System (INIS)
Ruffenach, J.C.
1977-01-01
Isotopic and chemical analysis of uranium and five rare earths: neodymium, samarium, europium, gadolinium and dysprosium were effected on fourteen samples taken in the same core drilled through a reaction zone of the Oklo uranium deposit. This study points out the general stability of uranium and fission rare earths; spatial distributions of these elements are quite analogous. Migrations have affected about 5% only of fission neodymium in the core of the reaction zone; corresponding values for samarium and gadolinium are slightly higher. These migration phenomena have carried rare earths to no more than 80 cm out of the core. By study of the europium it is shown that nuclear reactions have stayed in the ground since the time of reactions. On the other hand it is shown by analysis of the dysprosium that rare earths have not undergone an important movement. This study allow also the datation of nuclear reactions from the measurement of the quantity of fission neodymium produced. A value of 1.98x10 9 years is obtained slightly higher than the value obtained by geochronology [fr
Isothermal sections at 500 deg C of the Dy-V-Al and Dy-Cr-Al systems in the aluminium rich regions
International Nuclear Information System (INIS)
Rykhal', R.M.; Zarechnyuk, O.S.; Mats'kiv, O.P.
1979-01-01
X-ray diffraction and microscopic analyses have been used to investigate the ternary system dysprosium-vanadium-aluminium in the aluminium rich region. In the system Dy-V-Al two ternary compounds have been found: DyV 2 Al 20 (cubic structure, CeCr 2 Al 20 type, a=14.54 A and approximately DyVAl 8 (hexagonal crystal system, structure unknown, a=10.86, c=17.71 A, c/a=1.631). In the system dysprosium-chromium-aluminium three ternary compounds have been found: DyCr 2 Al 20 (cubic structure, CeCr 2 Al 20 type, a=14.39), approximately equal to DyCrAl 8 ) hexagonal crystal system, structure type unkown a=10.75, c=17.60 A, c/a=1.637) and DyCr 4 Al 8 (tetragonal structure, CeMn 4 Al 8 type, a=8.87, c=5.04 A, c/a=0.568). Isothermal sections of the systems Dy-V-Al and Dy-Cr-Al have been plotted at 500 deg C
Wong, Martin Chi-Sang; Chan, Chun-Hei; Cheung, Wilson; Fung, Din-Hei; Liang, Miaoyin; Huang, Jason Li-Wen; Wang, Yan-Hong; Jiang, Johnny Yu; Yu, Chun-Pong; Wang, Harry Haoxiang; Wu, Justin Che-Yuen; Chan, Francis Ka-Leung; Sung, Joseph Jao-Yiu
2018-01-01
The objective of this meta-analysis is to evaluate the odds of colorectal adenoma (CRA) in colorectal cancer screening participants with different body mass index (BMI) levels, and examine if this association was different according to gender and ethnicity. The EMBASE and MEDLINE were searched to enroll high quality observational studies that examined the association between investigator-measured BMI and colonoscopy-diagnosed CRA. Data were independently extracted by two reviewers. A random-effects meta-analysis was conducted to estimate the summary odds ratio (SOR) for the association between BMI and CRA. The Cochran's Q statistic and I 2 analyses were used to assess the heterogeneity. A total of 17 studies (168,201 subjects) were included. When compared with subjects having BMI CRA (SOR 1.44, 95% CI 1.30-1.61; I 2 = 43.0%). Subjects with BMI ≥ 30 had similarly higher risk of CRA (SOR 1.42, 95% CI 1.24-1.63; I 2 = 18.5%). The heterogeneity was mild to moderate among studies. The associations were significantly higher than estimates by previous meta-analyses. There was no publication bias detected (Egger's regression test, p = 0.584). Subgroup analysis showed that the magnitude of association was significantly higher in female than male subjects (SOR 1.43, 95% CI 1.30-1.58 vs. SOR 1.16, 95% CI 1.07-1.24; different among different ethnic groups (SOR 1.72, 1.44 and 0.88 in White, Asians and Africans, respectively) being insignificant in Africans; and no difference exists among different study designs. In summary, the risk conferred by BMI for CRA was significantly higher than that reported previously. These findings bear implications in CRA risk estimation.
International Nuclear Information System (INIS)
Bohle, D.
1985-01-01
By inelastic electron scattering with high energy resolution a new magnetic dipole mode in heavy, deformed nuclei could be detected. For this the nuclei 154 Sm, 156 Gd, 158 Gd, 164 Dy, 168 Er, and 174 Yb were studied at the Darmstadt electron linear accelerator (DALINAC) at small momentum transfer q ≤ 0.6 fm -1 and low excitation energies. A collective magnetic dipole excitation could be discovered in all nuclei at an excitation energy of E x ≅ 66 δA -1/3 MeV whereby δ means the mass deformation. The transition strength extends in the mean to B(M1)↑ ≅ 1.3 μ N 2 . A systematic study of the nucleus 156 Gd yielded hints to a strong fragmentation of the magnetic dipole strength. A comparison of electron scattering, proton scattering, and nuclear resonance fluorescence experiments shows that the new mode is a pure orbital mode. (orig./HSI) [de
Feng, Yue; Liu, Song; Jiao, Yun; Gao, Hui; Wang, Miao; Du, Guocheng; Chen, Jian
2017-02-01
L-asparaginase (EC 3.5.1.1, ASN) exhibits great commercial value due to its uses in the food and medicine industry. In this study, we reported the enhanced expression of type II ASN from Bacillus subtilis 168 in B. subtilis WB600 through a combined strategy. First, eight signal peptides (the signal peptide of the ASN, ywbN, yvgO, amyE, oppA, vpr, lipA, and wapA) were used for ASN secretion in B. subtilis by using Hpa II promoter, respectively. The signal peptide wapA achieved the highest extracellular ASN activity (28.91 U/mL). Second, Hpa II promoter was replaced by a strong promoter, P43 promoter, resulting in 38.1 % enhanced ASN activity. By two rounds of error-prone PCR mutation, the P43 promoter variants with remarkably enhanced strength (D7, E2, H6, B2, and F3) were identified. B2 (-28: A → G, -13: A → G) achieved ASN activity up to 51.13 U/mL. Third, after deletion of the N-terminal 25-residues, ASN activity reached 102.41 U/mL, which was 100 % higher than that of the intact ASN. At last, the extracellular ASN of the B. subtilis arrived at 407.6 U/mL (2.5 g/L of ASN protein) in a 3-L bioreactor by using a fed-batch strategy. The purified ASN showed maximal activity at 65 °C and its half-life at 65 °C was 61 min. The K m and k cat of the ASN were 5.29 mM and 54.4 s -1 , respectively. To the best of our knowledge, we obtained the highest yield of ASN in a food-grade host ever reported, which may benefit the industrial production and application of ASN.
Test plan for air monitoring during the Cryogenic Retrieval Demonstration
International Nuclear Information System (INIS)
Yokuda, E.
1992-06-01
This report presents a test plan for air monitoring during the Cryogenic Retrieval Demonstration (CRD). Air monitors will be used to sample for the tracer elements neodymium, terbium, and ytterbium, and dysprosium. The results from this air monitoring will be used to determine if the CRD is successful in controlling dust and minimizing contamination. Procedures and equipment specifications for the test are included
Thermodynamics of ionic migration of simple and complex rare earth salts in mixed alcohol solvents
International Nuclear Information System (INIS)
Gorodyskij, A.V.; Fialkov, Yu.Ya.; Chernyj, D.B.
1982-01-01
The influence of the composition of double mixed solvents (water-methanol and methanol-propanol) on thermodynamic characteristics of electrolytic dissociation process-enthalpy and entropy, dissociation constants of chlorides and diphenanthroline chlorides of lanthanum, neodymium, europium and dysprosium, is analyzed. It is shown that when passing from water to methanol, that is, with decrease of dielectric permeability, the endothermicity of electrolytic dissociation process increases
Thermodynamics of ionic migration of simple and complex rare earth salts in mixed alcohol solvents
Energy Technology Data Exchange (ETDEWEB)
Gorodyskij, A.V.; Fialkov, Yu.Ya.; Chernyj, D.B. (AN Ukrainskoj SSR, Kiev. Inst. Obshchej i Neorganicheskoj Khimii; Kievskij Politekhnicheskij Inst. (Ukrainian SSR))
1982-04-01
The influence of the composition of double mixed solvents (water-methanol and methanol-propanol) on thermodynamic characteristics of electrolytic dissociation process-enthalpy and entropy, dissociation constants of chlorides and diphenanthroline chlorides of lanthanum, neodymium, europium and dysprosium, is analyzed. It is shown that when passing from water to methanol, that is, with decrease of dielectric permeability, the endothermicity of electrolytic dissociation process increases.
African Journals Online (AJOL)
Fr. Ikenga
situations, civilians have suffered loss of property, life and limb and it would seem that the civilian population is not ... conflict thus ensuring that in the midst of hostilities, the dignity of the human person is and shall be respected. ..... Funding and human resource development efforts should be improved for the military trainers.
2010-07-01
... birth through 26). (Approved by the Office of Management and Budget under control number 1820-0030... with disabilities (ages birth through 26); (2) Individuals with disabilities; (3) Teachers; (4... of private schools and public charter schools; (9) Not less than one representative of a vocational...
The age of fathers in the USA is rising: an analysis of 168 867 480 births from 1972 to 2015.
Khandwala, Yash S; Zhang, Chiyuan A; Lu, Ying; Eisenberg, Michael L
2017-10-01
How has the mean paternal age in the USA changed over the past 4 decades? The age at which men are fathering children in the USA has been increasing over time, although it varies by race, geographic region and paternal education level. While the rise in mean maternal age and its implications for fertility, birth outcomes and public health have been well documented, little is known about paternal characteristics of births within the USA. A retrospective data analysis of paternal age and reporting patterns for 168 867 480 live births within the USA since 1972 was conducted. All live births within the USA collected through the National Vital Statistics System (NVSS) of the Centers for Disease Control and Prevention (CDC) were evaluated. Inverse probability weighting (IPW) was used to reduce bias due to missing paternal records. Mean paternal age has increased over the past 44 years from 27.4 to 30.9 years. College education and Northeastern birth states were associated with higher paternal age. Racial/ethnic differences were also identified, whereby Asian fathers were the oldest and Black fathers were the youngest. The parental age difference (paternal age minus maternal age) has decreased over the past 44 years. Births to Black and Native American mothers were most often lacking paternal data, implying low paternal reporting. Paternal reporting was higher for older and more educated women. Although we utilized IPW to reduce the impact of paternal reporting bias, our estimates may still be influenced by the missing data in the NVSS. Paternal age is rising within the USA among all regions, races and education levels. Given the implications for offspring health and demographic patterns, further research on this trend is warranted. No funding was received for this study and there are no competing interests. N/A. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For
Directory of Open Access Journals (Sweden)
Sabyasachi Mishra
2018-06-01
Full Text Available Reseña de Lo divino y lo humano: poetas místicos de India y de España en la modernidad temprana, ed. Meenakshi Sundriyal y Juan Manuel Escudero Baztán, New Delhi/Pamplona, CSPILAS-Jawaharlal Nehru University/GRISO-Universidad de Navarra (Friends Digital Color Solutions, 2017, 168 pp., ISBN 181-901849-9-7.
Characterization and Luminescence Properties of Color-Tunable Dy3+-Doped BaY2ZnO5 Nanophosphors
Sonika; Khatkar, S. P.; Khatkar, Avni; Kumar, Rajesh; Taxak, V. B.
2015-01-01
Dy3+-doped BaY2ZnO5 nanophosphors were successfully synthesized by use of a solution combustion process. The effects of sintering temperature and dysprosium concentration on the structural and luminescence characteristics of the phosphors were investigated. X-ray diffraction (XRD) analysis confirmed the formation of pure orthorhombic BaY2ZnO5 with the space group Pbnm at 1100°C. Morphological investigation revealed spherical nanoparticles with smooth surfaces. The luminescence features of the nanophosphor were studied by use of photoluminescence excitation (PLE) and photoluminescence emission (PL), with luminescence decay curves and color ( x, y) coordinates. On excitation at 355 nm, BaY2ZnO5 nanophosphor doped with trivalent dysprosium ion emits white light as a mixture of blue (4F9/2 → 6H15/2) and yellow (4F9/2 → 6H13/2) emission. Concentration quenching is explained on the basis of cross-relaxation between intermediate Dy3+ states. Thus, BaY2ZnO5:Dy3+ nanophosphor may be suitable for producing efficient white light for ultraviolet-light-emitting diodes (UV-LEDs), fluorescent lamps, and a variety of optical display panels.
Magnesium borate radiothermoluminescent detectors
International Nuclear Information System (INIS)
Kazanskaya, V.A.; Kuzmin, V.V.; Minaeva, E.E.; Sokolov, A.D.
1974-01-01
In the report the technology of obtaining polycrystalline magnesium borate activated by dysprosium is described briefly and the method of preparing the tabletted detectors from it is presented. The dependence of the light sum of the samples on the proportion of the components and on the sintering regime has shown that the most sensitive material is obtained at the proportion of boric anhydride and magnesium oxide 2.2-2.4 and at the dysprosium concentration about 1 milligram-atom per gram molecule of the base. The glow curve of such a material has a simple form with one peak the maximum of which is located at 190-200 0 C. The measurement of the main dosimetric characteristics of the magnesium borate tabletted detectors and the comparison with similar parmaeters of the lithium fluoride tabletted detectors have shown that at practically identical effective number the former detectors have the following substantial advantages: the sensitivity is ten-twenty times as large, they are substantially more technological on synthesis of the radiothermoluminophor and during the production of the tabletted detectors, they have a simple glow curve, they do not require the utilization of the thermocycling during the use. (author)
Effect of NaFeEDTA-fortified soy sauce on zinc absorption in children.
Li, Min; Wu, Jinghuan; Ren, Tongxiang; Wang, Rui; Li, Weidong; Piao, Jianhua; Wang, Jun; Yang, Xiaoguang
2015-03-01
NaFeEDTA has been applied in many foods as an iron fortificant and is used to prevent iron deficiency in Fe-depleted populations. In China, soy sauce is fortified with NaFeEDTA to control iron deficiency. However, it is unclear whether Fe-fortified soy sauce affects zinc absorption. To investigate whether NaFeEDTA-fortified soy sauce affects zinc absorption in children, sixty children were enrolled in this study and randomly assigned to three groups (10 male children and 10 female children in each group). All children received daily 3 mg of (67)Zn and 1.2 mg of dysprosium orally, while the children in the three groups were supplemented with NaFeEDTA-fortified soy sauce (6 mg Fe, NaFeEDTA group), FeSO₄-fortified soy sauce (6 mg Fe, FeSO₄ group), and no iron-fortified soy sauce (control group), respectively. Fecal samples were collected during the experimental period and analyzed for the Zn content, (67)Zn isotope ratio and dysprosium content. The Fe intake from NaFeEDTA-fortified and FeSO₄-fortified groups was significantly higher than that in the control group (P sauce does not affect Zn bioavailability in children.
The study of heat conductivity properties of GdS1.48 and DyS1.48
International Nuclear Information System (INIS)
Ahmadov, O.R.
2009-01-01
The heat conductivity properties of sulfides of gadolinium and dysprosium up to 900 K with use of the average speed of ultrasound distribution, a specific thermal capacity and Viderman-Frans law have been investigated. The value of Debay temperature, thermal extension coefficient and the temperature dependence are established. It is shown that the scattering on crystal lattice phonons plays the main role in lattice heat conductivity
An application of neutron radiography to archaeology
International Nuclear Information System (INIS)
Tugrul, B.
1990-01-01
Neutron radiography is more useful for certain materials than are the other radiographic techniques. Some neutrons are attenuated by light materials such as water, hydrocarbons and boron, but penetrate through heavy materials such as steel, lead and uranium. The object must be irradiated by neutrons for neutron radiography. The neutron irradiation can take place in a reactor or with a neutron source. The transfer technique relies on the build-up of radioactivity in a foil due to neutron absorption. In this way an activation image is formed in the foil. For this technique, dysprosium ( 164 Dy) and indium ( 115 In) foils can be used. After this irradiation, foils are transferred to a film in the dark-room, the latent image being formed in the film by decay radiation from the foil. The neutron radiography technique has been applied to a sword together with its sheath (inventory number 83/173) (Tugrul and Erdal 1987); a piece of cloth was visible on the handle of the sword. Sword and sheath had become corroded together. The artefact is from the Ikiztepe excavation near the city of Samsun in north Anatolia and belongs to the Early Bronze Age. First, X-ray radiography showed that the sword had been destroyed in large part and was not suitable for conservation and restoration procedures. Second, neutron radiography was carried out. Dysprosium-164 was used for the transfer method as a foil screen and irradiated in the reactor at 100 kW for half an hour. The dysprosium foil remained against the radiographic (Structurix, D-7) film for approximately three half-lives after the irradiation. The neutron radiograph shows the cloth layer continuing towards the bottom of the sheath. Through the cloth, water would have been introduced to the inside of the sheath and this was the main cause of corrosion to the artefact and so of the sword's destruction. (author)
Calorimetric investigation of an yttrium-dysprosium spin glass
International Nuclear Information System (INIS)
Wenger, L.E.
1978-01-01
In an effort to compare the spin glass characteristics of yttrium--rare earth alloys with those of the noble-metal spin glasses, the susceptibility and heat capacity of Y/sub 0.98/Dy/sub 0.02/ have been measured in the temperature range 2.5--40 K. The low-field ac susceptibility measurement shows the characteristic cusp-like peak at 7.64 K. The magnetic specific heat of the same sample shows a peak at 7.0 K and may be qualitatively described as a semi-cusp. The magnetic entropy change from absolute zero to 7 K is approximately 0.52 of cR ln(2J+1). These results are qualitatively different than previous calorimetric results on the archetypal spin glasses, AuFe and CuMn, where rounded maxima are observed at temperatures above the spin glass transition temperatures
Photodissociation spectroscopy of the dysprosium monochloride molecular ion
Energy Technology Data Exchange (ETDEWEB)
Dunning, Alexander, E-mail: alexander.dunning@gmail.com; Schowalter, Steven J.; Puri, Prateek; Hudson, Eric R. [Department of Physics and Astronomy, University of California, Los Angeles, California 90095 (United States); Petrov, Alexander; Kotochigova, Svetlana [Department of Physics, Temple University, Philadelphia, Pennsylvania 19122 (United States)
2015-09-28
We have performed a combined experimental and theoretical study of the photodissociation cross section of the molecular ion DyCl{sup +}. The photodissociation cross section for the photon energy range 35 500 cm{sup −1} to 47 500 cm{sup −1} is measured using an integrated ion trap and time-of-flight mass spectrometer; we observe a broad, asymmetric profile that is peaked near 43 000 cm{sup −1}. The theoretical cross section is determined from electronic potentials and transition dipole moments calculated using the relativistic configuration-interaction valence-bond and coupled-cluster methods. The electronic structure of DyCl{sup +} is extremely complex due to the presence of multiple open electronic shells, including the 4f{sup 10} configuration. The molecule has nine attractive potentials with ionically bonded electrons and 99 repulsive potentials dissociating to a ground state Dy{sup +} ion and Cl atom. We explain the lack of symmetry in the cross section as due to multiple contributions from one-electron-dominated transitions between the vibrational ground state and several resolved repulsive excited states.
Influence of dysprosium addition on the structural, morphological ...
Indian Academy of Sciences (India)
Microwave absorption properties of hexaferrite (70 wt%)–acrylic resin. (30 wt%) composites ... the RE ions were substituted for Sr (Ba) or Fe, taking into accounts the .... general the RE substitutions weaken the super exchange interactions ...
2016-04-01
thereby performing disease staging entirely non-invasively. Also, in contrast to PET/CT or SPECT/CT, disease diagnostics and therapy monitoring would...2011;6.e27370. 11. Zhang SR, Sherry AD. Physical characteristics of lanthanide com- plexes that act as magnetization transfer (MT) contrast agents. J...reper- fused and nonreperfused myocardial infarctions - MR imaging with dysprosium-DTPA-BMA in the pig. Acta Radiol 1996;37:18–26. 28. Nilsson S
Pushing the pseudo-SU(3) model towards its limits: Excited bands in even-even Dy isotopes
International Nuclear Information System (INIS)
Vargas, Carlos E.; Hirsch, Jorge G.
2004-01-01
The energetics of states belonging to normal parity bands in even-even dysprosium isotopes, and their B(E2) transition strengths, are studied using an extended pseudo-SU(3) shell model. States with pseudospin 1 are added to the standard pseudospin 0 space, allowing for a proper description of known excited normal parity bands. A realistic Hamiltonian is employed. Both the success of model and its limitations are discussed
Rademaker, Jelle H; Kleijn, René; Yang, Yongxiang
2013-09-17
End-of-life recycling is promoted by OECD countries as a promising strategy in the current global supply crisis surrounding rare earth elements (REEs) so that dependence on China, the dominant supplier, can be decreased. So far the feasibility and potential yield of REE recycling has not been systematically evaluated. This paper estimates the annual waste flows of neodymium and dysprosium from permanent magnets, the main deployment of these critical REEs, during the 2011-2030 period. The estimates focus on three key permanent magnet waste flows: wind turbines, hybrid and electric vehicles, and hard disk drives (HDDs) in personal computers (PCs). This is a good indication of the end-of-life recycling of neodymium and dysprosium maximum potential yield. Results show that for some time to come, waste flows from permanent magnets will remain small relative to the rapidly growing global REE demand. Policymakers therefore need to be aware that during the next decade recycling is unlikely to substantially contribute to global REE supply security. In the long term, waste flows will increase sharply and will meet a substantial part of the total demand for these metals. Future REE recycling efforts should, therefore, focus on the development of recycling technology and infrastructure.
Charge transport properties in microcrystalline KDyFe(China)6
International Nuclear Information System (INIS)
Aubert, P.H.; Goubard, F.; Chevrot, C.; Tabuteau, A.
2007-01-01
Microcrystalline solid dysprosium(III) hexacyanoferrate(II) was synthesized by co-precipitation in aqueous solution. The resulting solid has been studied by Fourier transform infrared spectroscopy, X-ray analysis and solid state electrochemistry. The use of a cavity microelectrode was necessary to explore a wide range of time scale and minimize the (undesired) capacitive currents. Cyclic voltametric experiments were very helpful to understand the kinetic of charge transfer in such microstructure. A structure-properties relationship has been established from the crystallographic and the electrochemical properties. A square-scheme is presented to explain the unique electrochemical behavior of hexacyanoferrate containing dysprosium since this compound exhibits a second redox system. The solid presents an open channel-like morphology in which the motion of charged species occurs during the redox processes. Precisely, the electronic transfer is accompanied by a cation diffusion inside the microcrystalline structure. The size of these channels strongly suggests that the kinetic of charge transfer is limited by the cation transport into these structures. - Graphical abstract: Dy and Fe polyhedra packing in the cell of KDyFe(China) 6 .3.5H 2 O shows occluded water molecules and potassium ions forming a pseudohexagonal 2D sub-lattice connected to each other by diffusion channels
Application of Atomic Fluorescence to Measurement of Combustion Temperature in Solid Propellants.
1986-12-04
into a cytal (yttrium- aluminum -garnet) is shown to be an ideal seed, the fluoresce. f which is stimulated by the ultra-violet output of a Nd:YAG...been successfully employed in atmospheric flames for making thermometric measurements. However, because of the amorphous nature of energetic materials...be determined. R. 6 A .6 An example of this type of behavior is found in trivalent dysprosium, doped at 3% in yttrium- aluminum -garnet (Dy+3 :YAG
Neutron flux distribution measurement in the elementary cell of the RB reactor
Energy Technology Data Exchange (ETDEWEB)
Takac, S [Boris Kidric Institute of Nuclear Sciences Vinca, Beograd (Yugoslavia)
1963-04-15
The distribution of thermal neutrons was measured in the elementary cell with dysprosium foils for different lattice pitches and the results obtained were given. From the distributions measured average fluxes were determined for every single zone. By using the published data concerning effective absorption cross sections thermal utilization factors were calculated and their changes given as functions of lattice pitches: l = 8.0 cm; 11.3 cm and 17.9 cm. (author)
2010-04-01
...), the Director of Personnel and Manpower (AID), and the Chief, Employee-Management Relations Division... correspondence under § 16.7(a), any documentary evidence readily available to the grievant on which the grievance... documentary evidence, and, in that official's discretion, interview persons having knowledge of the facts. The...
Publications | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Filipino women migrant domestic workers' access to sexual and reproductive health services in Hong Kong, Singapore and Qatar (open access) ... to disadvantaged populations, national health policies such as universal health coverage risk ...
2010-04-01
... percent soluble sweetener solids by weight and is prepared with or without added water. It may contain one.... (5) Natural and artificial flavorings, either fruit or nonfruit, alone or in carriers. (6) Color...
Energy Technology Data Exchange (ETDEWEB)
Bravim, Amanda; Campos, Leticia Lucente, E-mail: abravin@ipen.b, E-mail: rsakuraba@einstein.b, E-mail: lcrodri@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Sakuraba, Roberto K.; Cruz, Jose Carlos da, E-mail: rsakuraba@einstein.b, E-mail: josecarlosc@einstein.b [Hospital Israelita Albert Einstein (HIAE), Sao Paulo, SP (Brazil)
2011-10-26
Yet not so widely applied in radiotherapy, the calcium sulfate doped with dysprosium (CaSO{sub 4}:Dy) is used in radioprotection and studies has been demonstrated its great potential for the dosimetry in radiotherapy. This work evaluates the energy dependence of the thermoluminescent answer of the CaSO{sub 4}:D, LiF:Mg,Ti (TLD-100) and micro LiF:Mg,Ti in clinical beams of electrons by using water simulators, PMMA and solid water
Phosphor for thermoluminescent type radiation dosimeter
International Nuclear Information System (INIS)
Nada, N.; Yamashita, T.
1975-01-01
This has the accumulation effect of radiation energy and is mainly used as the element for thermoluminescent type radiation dosimeters. It has as the principal constituent a phosphor consisting of calcium sulfate as the principal constituent and other impurity elements such as dysprosium, thulium and the like. It is more sensitive by the order of 1 to 2 or more figures than the conventional ones and is excellent in the retention of absorbed radiation energy. (U.S.)
Surface Thermometry of Energetic Materials by Laser-Induced Fluorescence
1989-09-01
at 34 yttrium- aluminum -garnet (Dy:YAG). The simplified energy diagram of Dy:YAG is shown in Fig. 1. Absorbed laser light (at 355 nrm) can 5 excite the...the thermometric technique on a surface similar to that of an energetic material, a thermal-setting plastic supplied by Buehler, Ltd., was employed...temperature over the temperature range of interest. The rare-earth ion dysprosium (Dy) doped into a yttrium- aluminum -garnet (YAG) crystal was I determined
From NdFeB magnets towards the rare-earth oxides: a recycling process consuming only oxalic acid
Vander Hoogerstraete, Tom; Blanpain, Bart; Van Gerven, Tom; Binnemans, Koen
2014-01-01
A chemical process which consumes a minimum amount of chemicals to recover rare-earth metals from NdFeB magnets was developed. The recovery of rare-earth elements from end-of-life consumer products has gained increasing interest during the last few years. Examples of valuable rare earths are neodymium and dysprosium because they are important constituents of strong permanent magnets used in several large or growing application fields (e.g. hard disk drives, wind turbines, electric vehicles, m...
A high resolution x-ray fluorescence spectrometer for near edge absorption studies
International Nuclear Information System (INIS)
Stojanoff, V.; Hamalainen, K.; Siddons, D.P.; Hastings, J.B.; Berman, L.E.; Cramer, S.; Smith, G.
1991-01-01
A high resolution fluorescence spectrometer using a Johann geometry in a back scattering arrangement was developed. The spectrometer, with a resolution of 0.3 eV at 6.5 keV, combined with an incident beam, with a resolution of 0.7 eV, form the basis of a high resolution instrument for measuring x-ray absorption spectra. The advantages of the instrument are illustrated with the near edge absorption spectrum of dysprosium nitrate. 10 refs., 4 figs
Concepts for using trapped-flux bulk high-temperature superconductor in motors and generators
International Nuclear Information System (INIS)
Hull, John R; Strasik, Michael
2010-01-01
We review previous concepts for using bulk high-temperature superconductors (HTSs) in motors and generators and discuss methods for using trapped-flux (TF) HTSs in motors and generators that have been recently investigated in our laboratory. We examine the expected performance of a brushless motor/generator that uses TF bulk HTSs to provide magnetomotive force, where the stator windings are used to create the TF. A key feature is the use of dysprosium for the stator and rotor cores.
Scissors Mode of Dipolar Quantum Droplets of Dysprosium Atoms
Ferrier-Barbut, Igor; Wenzel, Matthias; Böttcher, Fabian; Langen, Tim; Isoard, Mathieu; Stringari, Sandro; Pfau, Tilman
2018-04-01
We report on the observation of the scissors mode of a single dipolar quantum droplet. The existence of this mode is due to the breaking of the rotational symmetry by the dipole-dipole interaction, which is fixed along an external homogeneous magnetic field. By modulating the orientation of this magnetic field, we introduce a new spectroscopic technique for studying dipolar quantum droplets. This provides a precise probe for interactions in the system, allowing us to extract a background scattering length for 164Dy of 69 (4 )a0 . Our results establish an analogy between quantum droplets and atomic nuclei, where the existence of the scissors mode is also only due to internal interactions. They further open the possibility to explore physics beyond the available theoretical models for strongly dipolar quantum gases.
Single molecule magnet behaviour in robust dysprosium-biradical complexes.
Bernot, Kevin; Pointillart, Fabrice; Rosa, Patrick; Etienne, Mael; Sessoli, Roberta; Gatteschi, Dante
2010-09-21
A Dy-biradical complex was synthesized and characterized down to very low temperature. ac magnetic measurements reveal single molecule magnet behaviour visible without any application of dc field. The transition to the quantum tunneling regime is evidenced. Photophysical and EPR measurements provide evidence of the excellent stability of these complexes in solution.
Crystal and molecular structure of dysprosium (3) n-aminobenzoate
International Nuclear Information System (INIS)
Khiyalov, M.S.; Amiraslanov, I.R.; Mamedov, Kh.S.; Movsumov, Eh.M.
1981-01-01
The X ray diffraction investigation of the Dy(NH 2 C 6 H 4 COO) 3 x3H 2 O complex is carried out. Triclinic crystals have lattice parameters α=11.095(15), b=9.099(17), c=12.780 (15)A, α=108.051(12), β=89.072(10); γ=104.954(12) 0 , space group P anti 1, Z=2. The structure consists of dimer molecules. The third water molecule in the formula is an outer spherical one. The average lengths of Dy-O and Dy-OH 2 are 2.39 and 2.40 A respectively, the average value of Dy-O in bridge carboxylates (2.26A) is remarkably shorter. Hydrogen bonds between amine ligand ends, carboxylic groups oxygen and water molecules bind complex molecules into the three-dimensional frame [ru
Dysprosium Acetylacetonato Single-Molecule Magnet Encapsulated in Carbon Nanotubes
Directory of Open Access Journals (Sweden)
Ryo Nakanishi
2016-12-01
Full Text Available Dy single-molecule magnets (SMMs, which have several potential uses in a variety of applications, such as quantum computing, were encapsulated in multi-walled carbon nanotubes (MWCNTs by using a capillary method. Encapsulation was confirmed by using transmission electron microscopy (TEM. In alternating current magnetic measurements, the magnetic susceptibilities of the Dy acetylacetonato complexes showed clear frequency dependence even inside the MWCNTs, meaning that this hybrid can be used as magnetic materials in devices.
Cundiff, David K; Agutter, Paul S
2016-08-24
Nutrition researchers recently recognized that deficiency of vitamin K2 (menaquinone: MK-4-MK-13) is widespread and contributes to cardiovascular disease (CVD). The deficiency of vitamin K2 or vitamin K inhibition with warfarin leads to calcium deposition in the arterial blood vessels. Using publicly available sources, we collected food commodity availability data and derived nutrient profiles including vitamin K2 for people from 168 countries. We also collected female and male cohort data on early death from CVD (ages 15-64 years), insufficient physical activity, tobacco, biometric CVD risk markers, socioeconomic risk factors for CVD, and gender. The outcome measures included (1) univariate correlations of early death from CVD with each risk factor, (2) a multiple regression-derived formula relating early death from CVD (dependent variable) to macronutrient profile, vitamin K1 and K2 and other risk factors (independent variables), (3) for each risk factor appearing in the multiple regression formula, the portion of CVD risk attributable to that factor, and (4) similar univariate and multivariate analyses of body mass index (BMI), fasting blood sugar (FBS) (simulated from diabetes prevalence), systolic blood pressure (SBP), and cholesterol/ HDL-C ratio (simulated from serum cholesterol) (dependent variables) and dietary and other risk factors (independent variables). Female and male cohorts in countries that have vitamin K2 24 µg/day of vitamin K2 per 2000 kcal/day (n = 72). A multiple regression-derived formula relating early death from CVD to dietary nutrients and other risk factors accounted for about 50% of the variance between cohorts in early CVD death. The attributable risks of the variables in the CVD early death formula were: too much alcohol (0.38%), too little vitamin K2 (6.95%), tobacco (6.87%), high blood pressure (9.01%), air pollution (9.15%), early childhood death (3.64%), poverty (7.66%), and male gender (6.13%). Worldwide dietary vitamin K2
Thermal, optical and structural properties of Dy3+ doped sodium aluminophosphate glasses
Kaur, Manpreet; Singh, Anupinder; Thakur, Vanita; Singh, Lakhwant
2016-03-01
Trivalent Dysprosium doped sodium aluminophosphate glasses with composition 50P2O5-10Al2O3-(20-x)Na2O-20CaO-xDy2O3 (x varying from 0 to 5 mol%) were prepared by melt quench technique. The density of the prepared samples was measured using Archimedes principle and various physical properties like molar volume, rare earth ion concentration, polaron radius, inter nuclear distance and field strength were calculated using different formulae. The differential scanning calorimetry (DSC) was carried out to study the thermal stability of prepared glasses. The UV Visible absorption spectra of the dysprosium doped glasses were found to be comprised of ten absorption bands which correspond to transitions from ground state 6H15/2 to various excited states. The indirect optical band gap energy of the samples was calculated by Tauc's plot and the optical energy was found to be attenuated with Dy3+ ions. The photoluminescence spectrum revealed that Dy3+ doped aluminophosphate glasses have strong emission bands in the visible region. A blue emission band centred at 486 nm, a bright yellow band centred at 575 nm and a weak red band centred at 668 nm were observed in the emission spectrum due to excitation at 352 nm wavelength. Both FTIR and Raman spectra assert slight structural changes induced in the host glass network with Dy3+ ions.
Levitation in paramagnetic liquids
Energy Technology Data Exchange (ETDEWEB)
Dunne, P.A. [School of Physics and CRANN, Trinity Collge, Dublin 2 (Ireland)]. E-mail: pdunne2@tcd.ie; Hilton, J. [School of Physics and CRANN, Trinity Collge, Dublin 2 (Ireland); Coey, J.M.D. [School of Physics and CRANN, Trinity Collge, Dublin 2 (Ireland)
2007-09-15
Magnetic levitation of diamagnetic and paramagnetic substances in a paramagnetic liquid is explored. Materials ranging from graphite to tin and copper can be made to float at ambient temperature in concentrated solutions of dysprosium nitrate, when an electromagnet or four-block permanent magnet array is used to produce a gradient field. Simulations illustrate the stable regions for levitation above the permanent magnets; and a novel eight-block configuration is proposed, which allows denser materials such as gold or lead to be levitated.
On the specific electrophysical properties of n-InSe single crystals
Energy Technology Data Exchange (ETDEWEB)
Abdinov, A. Sh., E-mail: abdinov-axmed@yahoo.com [Baku State University (Azerbaijan); Babaeva, R. F., E-mail: babaeva-rena@yandex.ru; Rzaev, R. M., E-mail: abdinov-axmed@yandex.ru [Azerbaijan State Economic University (Azerbaijan); Ragimova, N. A.; Amirova, S. I. [Baku State University (Azerbaijan)
2016-01-15
The temperature dependences of physical parameters (the conductivity and the Hall constant) are experimentally investigated for pure indium-selenide (n-InSe) crystals and those lightly doped with rareearth elements (gadolinium, holmium, and dysprosium). It is established that the obtained results depend on the origin of the samples under investigation and prove to be contradictory for different samples. The obtained experimental results are treated taking into account the presence of chaotic large-scale defects and drift barriers caused by them in these samples.
International Nuclear Information System (INIS)
Vicy, Masok.
1978-01-01
This work represents a comparative study of the radiothermoluminescence (R.T.L.) induced by 60 Co gamma rays and 238 Pu alpha-particles in three R.T.L. materials: lithium fluoride, alumina and dysprosium activated calcium sulphate. The T.L. glow curves induced by the two radiations are very similar. However, for the same absorbed dose, different sensitivity is seen to each form of irradiation. Measurements of the relative R.T.L. efficiency, epsilon, were made in the linear zone (dose [fr
Surface analysis of model systems: From a metal-graphite interface to an intermetallic catalyst
Energy Technology Data Exchange (ETDEWEB)
Kwolek, Emma J. [Iowa State Univ., Ames, IA (United States)
2016-10-25
This thesis summarizes research completed on two different model systems. In the first system, we investigate the deposition of the elemental metal dysprosium on highly-oriented pyrolytic graphite (HOPG) and its resulting nucleation and growth. The goal of this research is to better understand the metal-carbon interactions that occur on HOPG and to apply those to an array of other carbon surfaces. This insight may prove beneficial to developing and using new materials for electronic applications, magnetic applications and catalysis.
Levitation in paramagnetic liquids
International Nuclear Information System (INIS)
Dunne, P.A.; Hilton, J.; Coey, J.M.D.
2007-01-01
Magnetic levitation of diamagnetic and paramagnetic substances in a paramagnetic liquid is explored. Materials ranging from graphite to tin and copper can be made to float at ambient temperature in concentrated solutions of dysprosium nitrate, when an electromagnet or four-block permanent magnet array is used to produce a gradient field. Simulations illustrate the stable regions for levitation above the permanent magnets; and a novel eight-block configuration is proposed, which allows denser materials such as gold or lead to be levitated
International Nuclear Information System (INIS)
Potiens Junior, A.J.; Campos, L.L.; Todo, A.S.
1992-01-01
The magnesium tetraborate doped with dysprosium (Mg B 4 O 7 :O y ) thermoluminescent phosphor is developed, containing boron, which boron 10 isotope has high cross section for thermal neutrons by 10 B (n,α) 7 Li reaction. The nitric acid concentration, the number of washing for removing the excess of boric acid, the powder granulation of Mg B 4 O 7 :O y , the percentage of teflon used as binder and the reproducibility of thermoluminescent answer are also presented. (C.G.C.)
Labeling of fruitflies and their identification by tracer activation
International Nuclear Information System (INIS)
Haisch, A.; Forster, S.; Staerk, H.
1975-01-01
A technique was worked out to label and identify cherry fruit flies (Rhagoletic cerasi L.) in large numbers. For that purpose, the tracers dysprosium and samarium were mingled with a carrier substance (silica gel) which, mixed with silica sand, formed the substrate for emergence. The flies, the pupae of which were in this substrate, took up with their ptilinum-labeled silica gel during their crawling through the sand up to the surface. The tracer was detected after its activation by neutron irradiation
Orefice, Martina; Binnemans, Koen; Vander Hoogerstraete, Tom
2018-01-01
Ionic liquids are largely used to leach metals from primary (ores) and secondary sources (end-of-life products). However, dry ionic liquids with a carboxylic function on the cation have not yet been used to leach metals at temperature above 100 °C and under atmospheric pressure. The ionic liquid betainium bis(trifluoromethylsulfonyl)imide, [Hbet][Tf2N], was used in the dry state to recover neodymium, dysprosium and cobalt from NdFeB magnets and NdFeB production scrap. The magnets and the scra...
Surface-ionization ion source designed for in-beam operation with the BEMS-2 isotope separator
International Nuclear Information System (INIS)
Bogdanov, D.D.; Voboril, J.; Demyanov, A.V.; Karnaukhov, V.A.; Petrov, L.A.
1976-01-01
A surface-ionization ion source designed to operate in combination with the BEMS-2 isotope separator in a heavy ion beam is described. The ion source is adjusted for the separation of rare-earth elements. The separation efficiency for 150 Dy is determined to be equal to about 20% at the ionizer temperature of 2600 deg K. The hold-up times for praseodymium, promethium and dysprosium in the ion source range from 5 to 10 sec at the ionizer temperature of 2500-2700 deg K
Costa, José M.; Loper, Joyce E.
1994-01-01
Erwinia carotovora subsp. betavasculorum Ecb168 produces an antibiotic(s) that suppresses growth of the related bacterium Erwinia carotovora subsp. carotovora in culture and in wounds of potato tubers. Strain Ecb168 also produces and secretes pectolytic enzymes and causes a vascular necrosis and root rot of sugar beet. Genes (out) involved in secretion of pectolytic enzymes by Ecb168 were localized to two HindIII fragments (8.5 and 10.5 kb) of Ecb168 genomic DNA by hybridization to the cloned out region of E. carotovora subsp. carotovora and by complementation of Out- mutants of E. carotovora subsp. carotovora. Out- mutants of Ecb168, which did not secrete pectate lyase into the culture medium, were obtained when deletions internal to either HindIII fragment were introduced into the genome of Ecb168 through marker exchange mutagenesis. Out- mutants of Ecb168 were complemented to the Out+ phenotype by introduction of the corresponding cloned HindIII fragment. Out- mutants of Ecb168 were less virulent than the Out+ parental strain on potato tubers. Strain Ecb168 and Out- derivatives inhibited the growth of E. carotovora subsp. carotovora in culture, indicating that the uncharacterized antibiotic(s) responsible for antagonism was exported through an out-independent mechanism. Strain Ecb168 and Out- derivatives reduced the establishment of large populations of E. carotovora subsp. carotovora in wounds of potato tubers and suppressed tuber soft rot caused by E. carotovora subsp. carotovora. PMID:16349316
Coolant void reactivity adjustments in advanced CANDU lattices using adjoint sensitivity technique
International Nuclear Information System (INIS)
Assawaroongruengchot, M.; Marleau, G.
2008-01-01
Coolant void reactivity (CVR) is an important factor in reactor accident analysis. Here we study the adjustments of CVR at beginning of burnup cycle (BOC) and k eff at end of burnup cycle (EOC) for a 2D Advanced CANDU Reactor (ACR) lattice using the optimization and adjoint sensitivity techniques. The sensitivity coefficients are evaluated using the perturbation theory based on the integral neutron transport equations. The neutron and flux importance transport solutions are obtained by the method of cyclic characteristics (MOCC). Three sets of parameters for CVR-BOC and k eff -EOC adjustments are studied: (1) Dysprosium density in the central pin with Uranium enrichment in the outer fuel rings, (2) Dysprosium density and Uranium enrichment both in the central pin, and (3) the same parameters as in the first case but the objective is to obtain a negative checkerboard CVR-BOC (CBCVR-BOC). To approximate the EOC sensitivity coefficient, we perform constant-power burnup/depletion calculations using a slightly perturbed nuclear library and the unperturbed neutron fluxes to estimate the variation of nuclide densities at EOC. Our aim is to achieve a desired negative CVR-BOC of -2 mk and k eff -EOC of 0.900 for the first two cases, and a CBCVR-BOC of -2 mk and k eff -EOC of 0.900 for the last case. Sensitivity analyses of CVR and eigenvalue are also included in our study
Coolant void reactivity adjustments in advanced CANDU lattices using adjoint sensitivity technique
Energy Technology Data Exchange (ETDEWEB)
Assawaroongruengchot, M. [Institut de Genie Nucleaire, Ecole Polytechnique de Montreal, P.O. Box 6079, stn. Centre-ville, Montreal, H3C3A7 (Canada)], E-mail: monchaia@gmail.com; Marleau, G. [Institut de Genie Nucleaire, Ecole Polytechnique de Montreal, P.O. Box 6079, stn. Centre-ville, Montreal, H3C3A7 (Canada)], E-mail: guy.marleau@polymtl.ca
2008-03-15
Coolant void reactivity (CVR) is an important factor in reactor accident analysis. Here we study the adjustments of CVR at beginning of burnup cycle (BOC) and k{sub eff} at end of burnup cycle (EOC) for a 2D Advanced CANDU Reactor (ACR) lattice using the optimization and adjoint sensitivity techniques. The sensitivity coefficients are evaluated using the perturbation theory based on the integral neutron transport equations. The neutron and flux importance transport solutions are obtained by the method of cyclic characteristics (MOCC). Three sets of parameters for CVR-BOC and k{sub eff}-EOC adjustments are studied: (1) Dysprosium density in the central pin with Uranium enrichment in the outer fuel rings, (2) Dysprosium density and Uranium enrichment both in the central pin, and (3) the same parameters as in the first case but the objective is to obtain a negative checkerboard CVR-BOC (CBCVR-BOC). To approximate the EOC sensitivity coefficient, we perform constant-power burnup/depletion calculations using a slightly perturbed nuclear library and the unperturbed neutron fluxes to estimate the variation of nuclide densities at EOC. Our aim is to achieve a desired negative CVR-BOC of -2 mk and k{sub eff}-EOC of 0.900 for the first two cases, and a CBCVR-BOC of -2 mk and k{sub eff}-EOC of 0.900 for the last case. Sensitivity analyses of CVR and eigenvalue are also included in our study.
Li, Ya Jie; Li, Min; Liu, Xiao Bing; Ren, Tong Xiang; Li, Wei Dong; Yang, Chun; Wu, Meng; Yang, Lin Li; Ma, Yu Xia; Wang, Jun; Piao, Jian Hua; Yang, Li Chen; Yang, Xiao Guang
2017-06-01
To determine the dietary zinc absorption in a Chinese elderly population and provide the basic data for the setting of zinc (Zn) recommended nutrient intakes (RNI) for Chinese elderly people. A total of 24 elderly people were recruited for this study and were administered oral doses of 3 mg 67Zn and 1.2 mg dysprosium on the fourth day. The primary macronutrients, energy, and phytic acid in the representative diet were examined based on the Chinese National Standard Methods. Fecal samples were collected during the experimental period and analyzed for zinc content, 67Zn isotope ratio, and dysprosium content. The mean (± SD) zinc intake from the representative Chinese diet was 10.6 ± 1.5 mg/d. The phytic acid-to-zinc molar ratio in the diet was 6.4. The absorption rate of 67Zn was 27.9% ± 9.2%. The RNI of zinc, which were calculated by the absorption rate in elderly men and women, were 10.4 and 9.2 mg/d, respectively. This study got the dietary Zn absorption in a Chinese elderly population. We found that Zn absorption was higher in elderly men than in elderly women. The current RNI in elderly female is lower than our finding, which indicates that more attention is needed regarding elderly females' zinc status and health. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Search Results | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
... (sub-Saharan Africa), consisted of a study of the risk of diarrheal diseases or their resurgence in the ... Microfinance and reducing poverty in Central Africa ... The business process outsourcing (BPO) sector, worth over $130 billion worldwide, ...
26 CFR 1.168-5 - Special rules.
2010-04-01
...) Retirement-replacement-betterment (RRB) property—(1) RRB replacement property placed in service before... for the taxable year for retirement-replacement-betterment (RRB) replacement property (as defined in...
47 CFR 90.168 - Equal employment opportunities.
2010-10-01
... encourage referral of qualified minority or female applicants. (F) Encouraging present employees to refer... who make decisions on placement and promotion that minority employees and females are to be considered... groups and female employees equal opportunity for positions which lead to higher positions. Inquiring as...
Search Results | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Tax policies in developing countries, and indeed around the world, are under continued reform. ... ICTs, Economic Growth and Poverty ... a research network on the theme of equal access to health services in West Africa under project 101160.
Glacial Features (Point) - Quad 168 (EPPING, NH)
University of New Hampshire — The Glacial Features (Point) layer describes point features associated with surficial geology. These glacial features include, but are not limited to, delta forsets,...
Fisheries Restoration Grant Program Projects [ds168
California Natural Resource Agency — This shapefile (FRGP_All_020209.shp) represents the locations of all ongoing and completed salmonid restoration projects in California with existing records in the...
15 CFR 16.8 - Termination of participation.
2010-01-01
... written decision to the participant in the event such participant does not appeal the proposed termination... responsibilities under this program with regard to a specific type of product by giving written notice to the... products of the type involved. ...
7 CFR 1.168 - Procedure for hearing.
2010-01-01
... surprise. (2) The parties shall not be required to exchange testimony in accordance with this paragraph if... with the Hearing Clerk a notice of the change, which notice shall be served on the parties, unless it... notice is given to the parties. (2)(i) Any party may move that the hearing be conducted by telephone or...
Directory of Open Access Journals (Sweden)
A. Hussain Syed Rehan
2012-06-01
Full Text Available Título en ingles: Characterization of a Mutant Bacillus thuringiensis d-endotoxin With Enhanced Stability and Toxicity SummaryThe centrally located a-helix 5 of Bacillus thuringiensis d-endotoxins is critical for insect toxicity through ion-channel formation. We analyzed the role of the highly conserved residue Histidine 168 (H168 using molecular biology, electrophysiology and biophysical techniques. Toxin H168R was ~3-fold more toxic than the wild type (wt protein whereas H168Q was 3 times less toxic against Manduca sexta. Spectroscopic analysis revealed that the H168Q and H168R mutations did not produce gross structural alterations, and that H168R (Tm= 59 °C was more stable than H168Q (Tm= 57.5 °C or than the wt (Tm= 56 °C toxins. These three toxins had similar binding affinities for larval midgut vesicles (Kcom suggesting that the differences in toxicity did not result from changes in initial receptor binding. Dissociation binding assays and voltage clamping analysis suggest that the reduced toxicity of the H168Q toxin may result from reduced insertion and/or ion channel formation. In contrast, the H168R toxin had a greater inhibition of the short circuit current than the wt toxin and an increased rate of irreversible binding (kobs, consistent with its lower LC50 value. Molecular modeling analysis suggested that both the H168Q and H168R toxins could form additional hydrogen bonds that could account for their greater thermal stability. In addition to this, it is likely that H168R has an extra positive charge exposed to the surface which could increase its rate of insertion into susceptible membranes. Key words: a-helix 5; Circular dichroism; molecular modeling; site-directed mutagenesis; thermal stability; Bacillus thuringiensis ResumenLa a-Hélice 5 del domino I de las d-endotoxinas de Bacillus thuringiensis, es crítica para la toxicidad de las toxinas contra insectos al participar en la formación de canales iónicos. La
Jayakumar, Samydurai; Louven, Kathrin; Strohmann, Carsten; Kumar, Kamal
2017-12-11
The active complexes of chiral N,N'-dioxide ligands with dysprosium and magnesium salts catalyze the hetero-Diels-Alder reaction between 2-aza-3-silyloxy-butadienes and alkylidene oxindoles to selectively form 3,3'- and 3,4'-piperidinoyl spirooxindoles, respectively, in very high yields and with excellent enantioselectivities. The exo-selective asymmetric cycloaddition successfully regaled the construction of sp 3 -rich and highly substituted natural-product-based spirooxindoles supporting many chiral centers, including contiguous all-carbon quaternary centers. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mechanical and corrosion properties of binary Mg–Dy alloys for medical applications
International Nuclear Information System (INIS)
Yang Lei; Huang Yuanding; Peng Qiuming; Feyerabend, Frank; Kainer, Karl Ulrich; Willumeit, Regine; Hort, Norbert
2011-01-01
Microstructure, mechanical and corrosion properties of binary magnesium–dysprosium (Mg-5, 10, 15, 20 wt.% Dy) alloys were investigated for medical applications. In the as-cast condition, the distribution of Dy is quite inhomogeneous. Mg–10Dy alloy exhibits a moderate tensile and compression yield strength, and the best elongation and corrosion resistance. After T4 (solutionizing) treatment, the distribution of Dy becomes homogeneous. The tensile and compression yield strength of all Mg–Dy alloys decreases. The elongation remains unchanged, while the corrosion resistance is largely improved after T4 treatment.
Mechanical and corrosion properties of binary Mg-Dy alloys for medical applications
Energy Technology Data Exchange (ETDEWEB)
Yang Lei, E-mail: lei.yang@hzg.de [Helmholtz-Zentrum Geesthacht, Institute of Materials Research, Max-Planck-Str. 1, D-21502 Geesthacht (Germany); Yuanding, Huang; Qiuming, Peng; Feyerabend, Frank; Kainer, Karl Ulrich; Willumeit, Regine; Hort, Norbert [Helmholtz-Zentrum Geesthacht, Institute of Materials Research, Max-Planck-Str. 1, D-21502 Geesthacht (Germany)
2011-12-15
Microstructure, mechanical and corrosion properties of binary magnesium-dysprosium (Mg-5, 10, 15, 20 wt.% Dy) alloys were investigated for medical applications. In the as-cast condition, the distribution of Dy is quite inhomogeneous. Mg-10Dy alloy exhibits a moderate tensile and compression yield strength, and the best elongation and corrosion resistance. After T4 (solutionizing) treatment, the distribution of Dy becomes homogeneous. The tensile and compression yield strength of all Mg-Dy alloys decreases. The elongation remains unchanged, while the corrosion resistance is largely improved after T4 treatment.
Mesoporous tertiary oxides via a novel amphiphilic approach
Energy Technology Data Exchange (ETDEWEB)
Bennett, Natasha; Hall, Simon R., E-mail: simon.hall@bristol.ac.uk, E-mail: Annela.Seddon@bristol.ac.uk [Bristol Centre for Functional Nanomaterials, Centre for Nanoscience and Quantum Information, Tyndall Avenue, Bristol BS8 1FD, United Kingdom and Complex Functional Materials Group, School of Chemistry, University of Bristol, Bristol BS8 1TS (United Kingdom); Seddon, Annela M., E-mail: simon.hall@bristol.ac.uk, E-mail: Annela.Seddon@bristol.ac.uk; Hallett, James E. [H.H. Wills Physics Laboratory, University of Bristol, Tyndall Avenue, Bristol BS8 1TL (United Kingdom); Kockelmann, Winfried [STFC Rutherford Appleton Laboratory, Chilton OX11 0QX (United Kingdom); Ting, Valeska P. [Department of Chemical Engineering, University of Bath, Bath BA2 7AY (United Kingdom); Sadasivan, Sajanikumari; Tooze, Robert P. [Sasol Technology (UK) Ltd, Purdie Building, North Haugh, St Andrews, Fife KY16 9ST (United Kingdom)
2016-01-01
We report a facile biomimetic sol-gel synthesis using the sponge phase formed by the lipid monoolein as a structure-directing template, resulting in high phase purity, mesoporous dysprosium- and gadolinium titanates. The stability of monoolein in a 1,4-butanediol and water mixture complements the use of a simple sol-gel metal oxide synthesis route. By judicious control of the lipid/solvent concentration, the sponge phase of monoolein can be directly realised in the pyrochlore material, leading to a porous metal oxide network with an average pore diameter of 10 nm.
Emission spectra of yttrium vanadate doped with bismuth and dysprosium
International Nuclear Information System (INIS)
Pawar, B.V.; Patil, R.N.
1975-01-01
The fluorescence spectra of YVO 4 :Bi and YVO 4 :Bi:Dy phosphors under X-rays and ultra-violet radiation have been studied. The observations on the phosphors with constant Bi 3+ and varying Dy 3+ concentration can be attributed to radiationless transfer of energy from Bi 3+ to Dy 3+ coupled with non-radiative losses due to self-quenching at higher level of Dy 3+ concentration. While the observations on the phosphors with constant Dy 3+ and varying Bi 3+ concentration indicate that there is radiationless transfer from Bi 3+ to Dy 3+ under X-ray or UV irradiation. (author)
Structural and magnetic study of dysprosium substituted cobalt ferrite nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Kumar, Hemaunt, E-mail: hvatsal@gmail.com [Department of Physics, Govind Ballabh Pant University of Agr. & Technology, Pantnagar, Uttarakhand 263145 (India); Srivastava, R.C. [Department of Physics, Govind Ballabh Pant University of Agr. & Technology, Pantnagar, Uttarakhand 263145 (India); Pal Singh, Jitendra [Advanced Analysis Centre, Korea Institute of Science and Technology, Seoul 02792 (Korea, Republic of); Negi, P. [Department of Physics, Govind Ballabh Pant University of Agr. & Technology, Pantnagar, Uttarakhand 263145 (India); Agrawal, H.M. [Advanced Analysis Centre, Korea Institute of Science and Technology, Seoul 02792 (Korea, Republic of); Das, D. [UGC-DAE CSR Kolkata Centre, Kolkata 700098 (India); Hwa Chae, Keun [Advanced Analysis Centre, Korea Institute of Science and Technology, Seoul 02792 (Korea, Republic of)
2016-03-01
The present work investigates the magnetic behavior of Dy{sup 3+} substituted cobalt ferrite nanoparticles. X-ray diffraction studies reveal presence of cubic spinel phases in these nanoparticles. Raman spectra of these nanoparticles show change in intensity of Raman bands, which reflects cation redistribution in cubic spinel lattice. Saturation magnetization and coercivity decrease with increase of Dy{sup 3+}concentration in these nanoparticles. Room temperature Mössbauer measurements show the cation redistribution in these nanoparticles and corroborates the results obtained from Raman Spectroscopic measurements. Decrease in magnetization of Dy{sup 3+} substituted cobalt ferrite is attributed to the reduction in the magnetic interaction and cation redistribution. - Highlights: • Slight decrease in crystallite size after Dy{sup 3+} doping. • Saturation magnetization and coercivity decrease after Dy{sup 3+} doping. • Mössbauer measurements show the cation redistribution in the samples.
Heterosis in some crosses of bread wheat under irrigation and drought conditions.
Abdel-Moneam, M A
2009-03-15
Five bread wheat varieties with different characteristics were crossed in a half-diallel model in 2005/2006 season. The five parents and their 10 F1 hybrids were evaluated under normal and water stress conditions during 2006/2007 season, to estimate heterosis of some wheat crosses for drought tolerance and selecting the crosses which could be useful in breeding programs for drought tolerance. The results indicated that, the best crosses over their mid parents at water stress condition for days to heading was Sakha-61 x Sakha-93; for flag leaf area were Giza-168 x Gemmeiza-9 and Sakha-61 x Gemmeiza-9 and for plant height was Sakha-61 x Sakha-93. The best crosses over their mid parents at both normal and stress conditions for days to maturity was Sakha-61 x Gemmeiza-9; for flag leaf area were Giza-168 x Sakha-61, Sakha-8 x Gemmeiza-9 and Sakha-93 x Gemmeiza-9; for spikes/plant were Sakha-8 x Sakha-61, Sakha-8 x Gemmeiza-9 and Sakha-61 x Sakha-93; for kernels/spike were Giza-168 x Sakha-8, Giza-168 x Sakha-61, Giza-168 x Sakha-93 and Sakha-8 x Gemmeiza-9; for 100-kernel weight were Giza-168 x Gemmeiza-9, Sakha-61 x Sakha-93 and Sakha-93 x Gemmeiza-9 and for grain yield/plant were Giza-168 x Sakha-93, Sakha-8 x Gemmeiza-9 and Sakha-93 x Gemmeiza-9. The best crosses over their better parents at water stress condition for flag leaf area were Giza-168 x Sakha-8, Giza-168 x Gemmeiza-9 and Sakha-8 x Gemmeiza-9; for plant height were Giza-168 x Gemmeiza-9 and Sakha-8 x Sakha-61. The best crosses over better parents at both normal and stress conditions for plant height were Giza-168 x Sakha-8, Sakha-8 x Gemmeiza-9 and Sakha-93 x Gemmeiza-9; for spikes/plant were Sakha-8xSakha-61, Sakha-61 x Sakha-93 and Sakha-8 x Gemmeiza-9; forkernels/spike were Giza-168 x Sakha-61 and Giza-168 x Sakha-93 and for grain yield/plant were Sakha-61 x Sakha-93 and Sakha-93 x Gemmeiza-9. Estimation of useful heterosis over better parent for grain yield/plant proved that it never exceeds 10.16% at
Kan, Jinglan; Wang, Hailong; Sun, Wei; Cao, Wei; Tao, Jun; Jiang, Jianzhuang
2013-08-05
Employment of the raise-by-one step method starting from M(TClPP)(acac) (acac = monoanion of acetylacetone) and [Pc(OPh)8]M'[Pc(OPh)8] led to the isolation and free modulation of the two rare-earth ions in the series of four mixed tetrapyrrole dysprosium sandwich complexes {(TClPP)M[Pc(OPh)8]M'[Pc(OPh)8]} [1-4; TClPP = dianion of meso-tetrakis(4-chlorophenyl)porphyrin; Pc(OPh)8 = dianion of 2,3,9,10,16,17,23,24-octa(phenoxyl)phthalocyanine; M-M' = Dy-Dy, Y-Dy, Dy-Y, and Y-Y]. Single-crystal X-ray diffraction analysis reveals different octacoordination geometries for the two metal ions in terms of the twist angle (defined as the rotation angle of one coordination square away from the eclipsed conformation with the other) between the two neighboring tetrapyrrole rings for the three dysprosium-containing isostructural triple-decker compounds, with the metal ion locating between an inner phthalocyanine ligand and an outer porphyrin ligand with a twist angle of 9.64-9.90° and the one between two phthalocyanine ligands of 25.12-25.30°. Systematic and comparative studies over the magnetic properties reveal magnetic-field-induced single-molecule magnet (SMM), SMM, and non-SMM nature for 1-3, respectively, indicating the dominant effect of the coordination geometry of the spin carrier, instead of the f-f interaction, on the magnetic properties. The present result will be helpful for the future design and synthesis of tetrapyrrole lanthanide SMMs with sandwich molecular structures.
Luminescent properties in films of ZrO2: Dy
International Nuclear Information System (INIS)
Martinez, R. C.; Guzman, J.; Rivera, T.; Ceron, P.; Montes, E.; Guzman, D.; Garcia H, M.; Falcony, C.; Azorin, J.
2014-08-01
In this work the luminescent characterization of zirconium oxide (ZrO 2 ) films impure with dysprosium (Dy +3 ) is reported, obtained by means of the ultrasonics spray pyrolysis technique. The films were deposited on glass substrates (Corning), in a temperatures interval of 400 to 550 grades C, using as precursor elements Zirconium oxide chloride octahydrate (ZrOCl 2 ·8H 2 O) and Dysprosium tri-chloride (DyCl 3 ), dissolved in deionized water, varying the concentration of the contaminated from the 1 to 20 atomic % with relationship to the zirconium in solution. The luminescent characterization was analyzed by means of photoluminescence and thermoluminescence. The photoluminescence results showed a spectrum with three maxima which correspond to the electronic transitions 4 F 9/2 - 6 H 15/2 , 4 F 9/2 - 6 H 13/2 and 4 F 9/2 - 6 H 11/2 characteristics of the Dy 3+ ion. The thermoluminescence (Tl) response when being exposed to a monochrome UV beam in 240 nm showed a wide curve that exhibits a maxim centered in 200 grades C. The Tl response of ZrO 2 :Dy in function of the dose was shown lineal in the interval of 24 mJ/cm 2 to 432 mJ/cm 2 . A study of the repeatability and dissipation of the ZrO 2 :Dy Tl response is included. Considering the shown previous results we can conclude that the ZrO 2 in film form obtained by spray pyrolysis has luminescent properties in 240 nm. (Author)
Virtualisasi Server Sederhana Menggunakan Proxmox
Directory of Open Access Journals (Sweden)
Teguh Prasandy
2015-05-01
Penggunaan proxmox sebagai virtual server bahwa proxmox menyediakan sebuah desktop local dan beberapa node. Di dalam node tersebut sistem operasi akan diinstal sesuai dengan kebutuhan dari user. Routing IP supaya sistem operasi yang berada di dalam proxmox dapat terkoneksi ke internet dengan IP Desktop Virtual box 192.168.56.102 IP ini digunakan sebagai gateway proxmox dan sistem operasi di dalamnya, IP Proxmox 192.168.56.105, IP Linux Ubuntu 192.168.56.109, IP Linux Debian 192.168.56.108.
International Nuclear Information System (INIS)
Zhang Yangmei; Ni Bangfa; Tian Weizhi; Wang Pingsheng; Cao Lei
2002-01-01
The bioavailability of diet iron of 10 healthy young women in Beijing area is studied by using two enriched isotopes 54 Fe and 58 Fe, and neutron activation analysis techniques. The abundance of 54 Fe and 58 Fe is 61.4% and 23.4%, respectively. In additional, the atomic absorption spectrometry is employed to measure total iron in fecal samples. Dysprosium, rarely absorbed by human body, is used to monitor the residence time of tracer isotopes in order to collect the fecal samples completely. The results show that the bioavailability of dietary iron in young women is (14.9 +- 3.9)%
Calculation of the void reactivity of CANDU lattices using the SCALE code system
Energy Technology Data Exchange (ETDEWEB)
Valko, J. [Technische Univ. Delft (Netherlands). Interfacultair Reactor Inst.; Feher, S. [Technische Univ. Delft (Netherlands). Interfacultair Reactor Inst.; Hoogenboom, J.E. [Technische Univ. Delft (Netherlands). Interfacultair Reactor Inst.; Slobben, J. [Netherlands Energy Research Foundation (ECN), Petten (Netherlands)
1995-11-01
The reactivity effect of coolant voiding in CANDU-type fuel lattices has been calculated with different methods using the SCALE code system. The known positive void reactivity coefficient of the original lattice was correctly obtained. A modified fuel bundle containing dysprosium and slightly enriched uranium to eliminate the positive reactivity effect was also calculated. Owing to the increased heterogeneity of this modified fuel the one-dimensional cylindrical calculation with XSDRN proved to be inadequate. Code options allowing bundle geometry were successfully used for the calculation of the strongly space dependent flux and spectrum changes which determine the void reactivity. (orig.).
Unexpected structure in the E2 quasicontinuum spectrum of 154Dy
International Nuclear Information System (INIS)
Holzmann, R.; Khoo, T.L.; Ma, W.C.
1988-01-01
The evolution of the γ quasicontinuum spectrum with neutron number has been investigated in the sequence of dysprosium isotopes /sup 152,154,156/Dy. The three nuclei display a pronounced collective E2 component. In 154 Dy this component shows an unexpected splitting into two distinct parts, signifying a structural change along the γ cascade. The E2 and statistical components can be reproduced in simple γ cascade calculations; in 152 Dy and 156 Dy only rotational bands were included, whereas in 154 Dy additional vibration-like transitions were required to reproduce the two E2 peaks. 11 refs., 2 figs
Quadrupolar frustration in shastry-sutherland lattice of DyB4 studied by resonant x-ray scattering
International Nuclear Information System (INIS)
Okuyama, Daisuke; Matsumura, Takeshi; Nakao, Hironori; Murakami, Youichi
2005-01-01
We have observed geometrical frustration of quadrupolar and magnetic moments in dysprosium tetraboride, DyB 4 , where the rare-earth sites form a Shastry-Sutherland lattice. Resonant X-ray scattering at the L III absorption edge of Dy was utilized. Analysis of the energy, polarization, temperature, and azimuthal-angle dependences of the E1 resonance of the (100) forbidden reflection show that the magnetic and quadrupolar components within the frustrated c plane have a short-range correlation, suggesting that the moments are fluctuating. In contrast, the basic antiferromagnetic component along the c-axis has a long-range order. (author)
Quality of information accompanying on-line marketing of home diagnostic tests.
Datta, Adrija K; Selman, Tara J; Kwok, Tony; Tang, Teresa; Khan, Khalid S
2008-01-01
To assess the quality of information provided to consumers by websites marketing medical home diagnostic tests. A cross-sectional analysis of a database developed from searching targeted websites. Data sources were websites written in English which marketed medical home diagnostic tests. A meta-search engine was used to identify the first 20 citations for each type of home diagnostic medical test. Relevant websites limited to those written in English were reviewed independently and in triplicate, with disputes resolved by two further reviewers. Information on the quality of these sites was extracted using a pre-piloted performer. 168 websites were suitable for inclusion in the review. The quality of these sites showed marked variation. Only 24 of 168 (14.2%) complied with at least three-quarters of the quality items and just over half (95 of 168, 56.5%) reported official approval or certification of the test. Information on accuracy of the test marketed was reported by 87 of 168 (51.7%) websites, with 15 of 168 (8.9%) providing a scientific reference. Instructions for use of the product were found in 97 of 168 (57.9%). However, the course of action to be taken after obtaining the test result was stated in only 63 of 168 (37.5%) for a positive result and 43 of 168 (25.5%) for a negative result. The quality of information posted on commercial websites marketing home tests online is unsatisfactory and potentially misleading for consumers.
Quinolone Amides as Antitrypanosomal Lead Compounds with In Vivo Activity.
Hiltensperger, Georg; Hecht, Nina; Kaiser, Marcel; Rybak, Jens-Christoph; Hoerst, Alexander; Dannenbauer, Nicole; Müller-Buschbaum, Klaus; Bruhn, Heike; Esch, Harald; Lehmann, Leane; Meinel, Lorenz; Holzgrabe, Ulrike
2016-08-01
Human African trypanosomiasis (HAT) is a major tropical disease for which few drugs for treatment are available, driving the need for novel active compounds. Recently, morpholino-substituted benzyl amides of the fluoroquinolone-type antibiotics were identified to be compounds highly active against Trypanosoma brucei brucei Since the lead compound GHQ168 was challenged by poor water solubility in previous trials, the aim of this study was to introduce structural variations to GHQ168 as well as to formulate GHQ168 with the ultimate goal to increase its aqueous solubility while maintaining its in vitro antitrypanosomal activity. The pharmacokinetic parameters of spray-dried GHQ168 and the newly synthesized compounds GHQ242 and GHQ243 in mice were characterized by elimination half-lives ranging from 1.5 to 3.5 h after intraperitoneal administration (4 mice/compound), moderate to strong human serum albumin binding for GHQ168 (80%) and GHQ243 (45%), and very high human serum albumin binding (>99%) for GHQ242. For the lead compound, GHQ168, the apparent clearance was 112 ml/h and the apparent volume of distribution was 14 liters/kg of body weight (BW). Mice infected with T. b. rhodesiense (STIB900) were treated in a stringent study scheme (2 daily applications between days 3 and 6 postinfection). Exposure to spray-dried GHQ168 in contrast to the control treatment resulted in mean survival durations of 17 versus 9 days, respectively, a difference that was statistically significant. Results that were statistically insignificantly different were obtained between the control and the GHQ242 and GHQ243 treatments. Therefore, GHQ168 was further profiled in an early-treatment scheme (2 daily applications at days 1 to 4 postinfection), and the results were compared with those obtained with a control treatment. The result was statistically significant mean survival times exceeding 32 days (end of the observation period) versus 7 days for the GHQ168 and control treatments
Lifescience Database Archive (English)
Full Text Available IVFXNXMXXKKXXFKNXXKSSXKXXIXIXXGNSXLNNXSNNX*xxnpfgxxxff nxkxxxxxixxxixiixiiiiiiiitxixivxxi* Translated Amino ...Acid sequence (All Frames) Frame A: kkkysihtyiyiyiyi*nnik*afiilifillkkk--- ---lxkx*fxkixcxxkxqxlkxxqnqvxkxx*...xfxkxivf*ixkvixfkxxtllexxxf lixkxxxxx*xxxlx**x********xx*x*lxxyn Frame B: kkniqyihiytyiyiykii*nkhl*f*ylfy*kk--- ---xxx...nsfxkxnvxxkxnx*kxxkikxxxvnnxxxrx*xfk*xk**xlxxkpfwkxxif *xknxxxxxnxxxyxn...nxnnnnnnnnxxnxsyxxi Frame C: kkifntyiyihiyiyik*YKISIYNFNIYFIKKK--- ---XKXIVFXNXMXXKKXXFKNXXKSSXKXXIXIXXGNSXLNNXSNNX*xxnpfgxxx
What we do | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
This knowledge can be used as a tool for addressing pressing global challenges. ... for face-to-face dialogue on development issues of mutual concern through a variety of ... A communication system that can provide health managers with timely ... marketing - to boost agricultural productivity and enhance rural livelihoods.
South of Sahara | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Language French. Read more about Action multisectorielle en matière de prévention des maladies non transmissibles en Afrique subsaharienne. Language French. Read more about Chaire en écosanté sur la pollution urbaine de l'air et les maladies respiratoires non transmissibles (Afrique de l'Ouest). Language French.
46 CFR 168.01-1 - Purpose of regulations.
2010-10-01
... Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL... this part is to set forth uniform minimum requirements for vessels, whether being navigated or not, which are used by or in connection with any civilian nautical school, except vessels of the Navy or...
What we do | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
... sharing our knowledge with policymakers, researchers, and communities around the world;; fostering new talent by offering fellowships and awards; and; putting new knowledge into the hands of those who can use it best to address global challenges. Part of Canada's foreign affairs and development efforts, IDRC invests ...
7 CFR 457.168 - Mustard crop insurance provisions.
2010-01-01
... amount of production delivered, and the processor contract provides for delivery of the mustard under... that are identified by the Food and Drug Administration or other public health organizations of the... FCIC including, but not limited to, protein and oil will not be considered. (e) Any production...
168 Indigenous Language Implementation and Nation Building: The ...
African Journals Online (AJOL)
of Nigerian indigenous language implementation and use in the ... Nigeria, it will become obvious that language is central to ... major indigenous languages. .... personality and thought pattern would be given as credit to the ... (13) The purpose of pre-primary education shall be to: .... Ado-Ekiti and sampled the five of them.
A Linear Tetranuclear Dysprosium(III) Compound Showing Single-Molecule Magnet Behavior
Energy Technology Data Exchange (ETDEWEB)
Ke, Hongshan; Xu, Gong Feng; Guo, Yun-Nan; Gamez, Patrick; Beavers, Christine M; Teat, Simon J; Tang, Jinkui
2010-04-20
Although magnetic measurements reveal a single-relaxation time for a linear tetranuclear Dy(III) compound, the wide distribution of the relaxation time observed clearly suggests the presence of two slightly different anisotropic centres, therefore opening new avenues for investigating the relaxation dynamics of lanthanide aggregates.
Synthesis, photoluminescence and intramolecular energy transfer model of a dysprosium complex
Energy Technology Data Exchange (ETDEWEB)
Zhang Aiqin; Zhang Jiuli; Pan Qiliang; Wang Shuhua [College of Materials Science and Engineering, Taiyuan University of Technology, No. 79 West Yingze Street, Taiyuan, Shanxi 030024 (China); Key Laboratory of Interface Science and Engineering in Advanced Materials of Taiyuan University of Technology, Ministry of Education, Taiyuan, Shanxi 030024 (China); Jia Husheng, E-mail: Jia_Husheng@126.com [College of Materials Science and Engineering, Taiyuan University of Technology, No. 79 West Yingze Street, Taiyuan, Shanxi 030024 (China) and Key Laboratory of Interface Science and Engineering in Advanced Materials of Taiyuan University of Technology, Ministry of Education, Taiyuan, Shanxi 030024 (China); Xu Bingshe [College of Materials Science and Engineering, Taiyuan University of Technology, No. 79 West Yingze Street, Taiyuan, Shanxi 030024 (China); Key Laboratory of Interface Science and Engineering in Advanced Materials of Taiyuan University of Technology, Ministry of Education, Taiyuan, Shanxi 030024 (China)
2012-04-15
The energy of the highest occupied molecular orbital and the lowest unoccupied molecular orbital as well as their energy gaps, and the singlet and triplet state energy levels of 4-benzoylbenzoic acid (HL=4-BBA) and triphenylphosphine oxide (TPPO) were calculated with the Gaussian03 program package. The singlet state and triplet state energy levels were also estimated from the UV-vis absorption spectra and phosphorescence spectra. The results suggest that the calculated values approximately coincided with the experimental values. A Dy(III) complex was synthesized with 4-BBA as primary ligand and TPPO as neutral ligand. The structure of the complex was characterized by elemental analysis, {sup 1}H NMR spectrometry, and FTIR spectrometry. TG-DTG analysis indicates that the complex kept stable up to 305 Degree-Sign C. The photoluminescence properties were studied by fluorescence spectrometry. The results show that Dy(III) ion sensitized by 4-BBA and TPPO emitted characteristic peaks at 572 nm ({sup 4}F{sub 9/2}-{sup 6}H{sub 13/2}) and 480 nm ({sup 4}F{sub 9/2}-{sup 6}H{sub 15/2}), and its Commission Internationale de L'Eclairge coordinates were calculated as x=0.33 and y=0.38, being located in the white range. Intermolecular energy transfer process was discussed and energy transfer model was also proposed. - Highlights: Black-Right-Pointing-Pointer Quantum calculation provides theoretical method of ligand choice for rare earth. Black-Right-Pointing-Pointer The complex Dy(L){sub 3}(TPPO){sub 2} emitted white light. Black-Right-Pointing-Pointer The CIE coordinates were calculated as x=0.33 and y=0.38. Black-Right-Pointing-Pointer Energy transfer in Dy(L){sub 3}(TPPO){sub 2} followed Dexter electron exchange theory.
Influence of dysprosium and terbium additions on aluminium structure and properties
International Nuclear Information System (INIS)
Fridlyander, I.N.; Sokolovskaya, E.M.; Zimina, E.N.; Tkachenko, E.A.; Artemova, M.S.
1992-01-01
The influence of 0.3%Dy and 0.3%Tb additions were investigated on grain size in aluminium ingots and on recrystallization and mechanical properties in 1.5 mm thick sheets. Grain refinement in ingots was revealed along with an increase of sheet recrystallization temperature and grain growth retardation in the process of secondary recrystallization. Ultimate strength was found to rise at some decrease of specific elongation
Quality of information accompanying on-line marketing of home diagnostic tests
Datta, Adrija K; Selman, Tara J; Kwok, Tony; Tang, Teresa; Khan, Khalid S
2008-01-01
Objective To assess the quality of information provided to consumers by websites marketing medical home diagnostic tests. Design A cross-sectional analysis of a database developed from searching targeted websites. Setting Data sources were websites written in English which marketed medical home diagnostic tests. Main outcome measures A meta-search engine was used to identify the first 20 citations for each type of home diagnostic medical test. Relevant websites limited to those written in English were reviewed independently and in triplicate, with disputes resolved by two further reviewers. Information on the quality of these sites was extracted using a pre-piloted performer. Results 168 websites were suitable for inclusion in the review. The quality of these sites showed marked variation. Only 24 of 168 (14.2%) complied with at least three-quarters of the quality items and just over half (95 of 168, 56.5%) reported official approval or certification of the test. Information on accuracy of the test marketed was reported by 87 of 168 (51.7%) websites, with 15 of 168 (8.9%) providing a scientific reference. Instructions for use of the product were found in 97 of 168 (57.9%). However, the course of action to be taken after obtaining the test result was stated in only 63 of 168 (37.5%) for a positive result and 43 of 168 (25.5%) for a negative result. Conclusions The quality of information posted on commercial websites marketing home tests online is unsatisfactory and potentially misleading for consumers. PMID:18263912
Energy Technology Data Exchange (ETDEWEB)
Misso, Agatha Matos
2016-07-01
Ca and Mg silicates based phosphors were prepared by sol-gel method combined with the molten salts process. The gel of silica was obtained from Na{sub 2}SiO{sub 3} solution by using europium, dysprosium, calcium and magnesium chloride solutions. Therefore, those chlorides were homogeneously dispersed into the gel. The obtained gel was dried and heat treated to 900° C for 1h to allow the fusion of the present salts. Then it was water washed until negative test for Cl{sup -}, and dried. The reduction of the europium to Eu{sup 2+} was performed under atmosphere of 5% of H{sub 2} and 95% of Ar to 900° C for 3h, to reach CaMgSi{sub 2}O{sub 6}:Eu{sup 2+} and CaMgSi{sub 2}O{sub 6}:Eu{sup 2+}:Dy{sup 3+} phosphors. Diopside was identified as main crystalline phase and quartz, as secondary phase from XRD (X-ray diffraction) patterns. SEM (scanning electron microscopy) micrographs, of the samples showed needles, spheres, leaves and rods of particles and agglomerates. Thermal analysis (TGA-DTGA) curves revealed that the crystallization temperature of CaMgSi{sub 2}O{sub 6}:Eu{sup 2+} lies around 765° C. Photoluminescence spectroscopy of the phosphors was studied based on interconfigurational 4f{sup N} → 4f{sup N-1} 5d transition of Eu{sup 2+} ion. The spectra of excitation showed 4f{sup N} → 4f{sup N-1} 5d transition of Eu{sup 2+} ion broad band, related to the ligand to metal charge transfer transition (LMCT) O{sup 2-} (2p) → Eu{sup 3+} in the 250 nm region, when the emission is monitored at 583,5 nm. It also presents the 4f ↔ 4f transitions of Eu{sup 3+} ion bands, showing the {sup 7}F{sub 0} → {sup 5}L{sub 6} transition at 393 nm. From emission spectra with excitation monitored at 393 nm, it can be observed fine peaks between 570 and 750 nm which are characteristics of {sup 5}D{sub 0} → {sup 7}F{sub J} (J = 0 - 5) transition of Eu{sup 3+} ion, indicating that the Eu{sup 3+} ion occupies a site with center of inversion. Finally, the obtained results indicate
Energy Technology Data Exchange (ETDEWEB)
Mhareb, M.H.A., E-mail: mmhareb@hotmail.com [Radiation Protection Directorate, Energy and Minerals Regulatory Commission, Amman 11821 (Jordan); Hashim, S. [Department of Physics, Faculty of Science, Universiti Teknologi Malaysia, 81310 UTM Skudai, Johor (Malaysia); Ghoshal, S.K., E-mail: lordshib@gmail.com [Department of Physics, Faculty of Science, Universiti Teknologi Malaysia, 81310 UTM Skudai, Johor (Malaysia); Alajerami, Y.S.M. [Department of Medical Radiography, Al-Azhar University, Gaza Strip, Palestine (Country Unknown); Bqoor, M.J.; Hamdan, A.I. [Radiation Protection Directorate, Energy and Minerals Regulatory Commission, Amman 11821 (Jordan); Saleh, M.A. [Nuclear Engineering Programme, Faculty of Petroleum and Renewable Energy Engineering, Universiti Teknologi Malaysia, 81310 Skudai, Johor (Malaysia); Karim, M.K.B. Abdul [Department of Physics, Faculty of Science, Universiti Teknologi Malaysia, 81310 UTM Skudai, Johor (Malaysia)
2016-09-15
Dysprosium (Dy) doped lithium borate glass (LBG) is prepared using conventional melting-quenching technique with varying Dy concentration in the range of 0 to 1.0 mol%. Prepared glass samples are characterized via X-Ray Diffraction (XRD), Fourier Transform Infrared (FTIR), UV–vis–IR, Photoluminescence (PL), Thermoluminescence (TL) spectroscopy and Differential Thermal Analysis (DTA). The physical parameters such as the density, optical energy band gap, oscillator strength, refractive index, ion concentration, Polaron radius, molar volume and inter-nuclear distance are determined. UV–vis–IR spectra revealed seven prominent bands centered at 448, 749, 796, 899, 1085, 1265 and 1679 nm corresponding to the transition from the Dy{sup 3+} ion's ground state ({sup 6}H{sub 15/2}) to the excited states ({sup 4}I{sub 15/2},{sup 6}F{sub 3/2}, {sup 6}F{sub 5/2}, {sup 6}H{sub 5/2}, {sup 6}F{sub 9/2}, {sup 6}H{sub 9/2} and {sup 6}H{sub 11/2}). The room temperature photoluminescence (PL) spectra of the glass series at 350 nm excitation displayed two peaks centered at 481 nm and 573 nm, which are assigned to the transitions of ({sup 4}F{sub 9/2}→{sup 6}H{sub 15/2}) and ({sup 4}F{sub 9/2}→{sup 6}H{sub 13/2}), respectively. The TL spectra of gamma-irradiated samples are measured, which showed Dy{sup 3+} content dependent simple glow peak at 190 °C. Dysprosium ion is found to play an important role in the TL and PL intensity enhancement of LB phosphor.
Energy Technology Data Exchange (ETDEWEB)
Martinez, R. C.; Guzman, J.; Rivera, T.; Ceron, P.; Montes, E.; Guzman, D. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Unidad Legaria, Av. Legaria No. 694, Col. Irrigacion, 11500 Mexico D. F. (Mexico); Garcia H, M. [UNAM, Instituto de Investigaciones en Materiales, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Falcony, C. [IPN, Centro de Investigacion y de Estudios Avanzados, Apdo. Postal 14-740, 07000 Mexico D. F. (Mexico); Azorin, J., E-mail: rodmarolm@yahoo.com [Universidad Autonoma Metropolitana, Unidad Iztapala, Av. San Rafael Atlixco 186, 09340 Mexico D. F. (Mexico)
2014-08-15
In this work the luminescent characterization of zirconium oxide (ZrO{sub 2}) films impure with dysprosium (Dy{sup +3}) is reported, obtained by means of the ultrasonics spray pyrolysis technique. The films were deposited on glass substrates (Corning), in a temperatures interval of 400 to 550 grades C, using as precursor elements Zirconium oxide chloride octahydrate (ZrOCl{sub 2}·8H{sub 2}O) and Dysprosium tri-chloride (DyCl{sub 3}), dissolved in deionized water, varying the concentration of the contaminated from the 1 to 20 atomic % with relationship to the zirconium in solution. The luminescent characterization was analyzed by means of photoluminescence and thermoluminescence. The photoluminescence results showed a spectrum with three maxima which correspond to the electronic transitions {sup 4}F{sub 9/2} - {sup 6}H{sub 15/2}, {sup 4}F{sub 9/2} - {sup 6}H{sub 13/2} and {sup 4}F{sub 9/2} - {sup 6}H{sub 11/2} characteristics of the Dy{sup 3+} ion. The thermoluminescence (Tl) response when being exposed to a monochrome UV beam in 240 nm showed a wide curve that exhibits a maxim centered in 200 grades C. The Tl response of ZrO{sub 2}:Dy in function of the dose was shown lineal in the interval of 24 mJ/cm{sup 2} to 432 mJ/cm{sup 2}. A study of the repeatability and dissipation of the ZrO{sub 2}:Dy Tl response is included. Considering the shown previous results we can conclude that the ZrO{sub 2} in film form obtained by spray pyrolysis has luminescent properties in 240 nm. (Author)
Synthesis and Optimization of the Sintering Kinetics of Actinide Nitrides
International Nuclear Information System (INIS)
Butt, Drryl P.; Jaques, Brian
2009-01-01
Research conducted for this NERI project has advanced the understanding and feasibility of nitride nuclear fuel processing. In order to perform this research, necessary laboratory infrastructure was developed; including basic facilities and experimental equipment. Notable accomplishments from this project include: the synthesis of uranium, dysprosium, and cerium nitrides using a novel, low-cost mechanical method at room temperature; the synthesis of phase pure UN, DyN, and CeN using thermal methods; and the sintering of UN and (U x , Dy 1-x )N (0.7 (le) X (le) 1) pellets from phase pure powder that was synthesized in the Advanced Materials Laboratory at Boise State University.
Directory of Open Access Journals (Sweden)
Camilo Méndez
2014-12-01
Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.
Determination of micro amounts of praseodymium by analogue derivative spectrophotometry
International Nuclear Information System (INIS)
Ishii, Hajime; Satoh, Katsuhiko.
1986-01-01
Derivative spectrophotometry using the analogue differentiation circuit was applied to the determination of praseodymium at the ppm level. By the proposed method, in which the second or fourth derivative spectrum of the characteristic absorption band of praseodymium(III) at 444 nm is measured, as little as 3 ppm of praseodymium can be determined directly and easily even in the presence of large amounts of other rare earths without any prior separation. Interferences from neodymium, samarium, dysprosium, holmium and erbium ions which have characteristic absorption bands around 444 nm can easily be removed by utilizing the isosbestic point in the derivative spectra of praseodymium(III) and the interfering rare earth(III). (author)
Epitaxial growth and new phase of single crystal Dy by molecular beam epitaxy
International Nuclear Information System (INIS)
Yang, Kai-Yueh; Homma, Hitoshi; Schuller, I.K.
1987-09-01
We have grown two novel epitaxial phases of dysprosium (Dy) on vanadium (V) by molecular beam epitaxy technique. Surface and bulk structures are studied by in-situ reflection high energy electron diffraction (RHEED) and x-ray diffraction techniques. The new hcp phases are ∼4% expanded uniformly in-plane (0001), and ∼9% and ∼4% expanded out of plane along the c-axes for non-interrupted and interrupted deposition case, respectively. We also observed (2 x 2), (3 x 3), and (4 x 4) Dy surface reconstruction patterns and a series of transitions as the Dy film thickness increases. 12 refs., 3 figs
Alaska's rare earth deposits and resource potential
Barker, James C.; Van Gosen, Bradley S.
2012-01-01
Alaska’s known mineral endowment includes some of the largest and highest grade deposits of various metals, including gold, copper and zinc. Recently, Alaska has also been active in the worldwide search for sources of rare earth elements (REE) to replace exports now being limitedby China. Driven by limited supply of the rare earths, combined with their increasing use in new ‘green’ energy, lighting, transportation, and many other technological applications, the rare earth metals neodymium, europium and, in particular, the heavy rare earth elements terbium, dysprosium and yttrium are forecast to soon be in critical short supply (U.S. Department of Energy, 2010).
Reversed-phase thin-layer chromatography of the rare earth elements
International Nuclear Information System (INIS)
Kuroda, R.; Adachi, M.; Oguma, K.
1988-01-01
Partition chromatographic behaviour of the rare earth elements on C 18 bonded silica reversed-phase material has been investigated by thin-layer chromatography in methanol - lactate media. The rare earth lactato complexes are distributed and fractionated on bonded silica layers without ion-interaction reagents. The concentration and pH of lactate solution, methanol concentration and temperature have effects on the migration and resolution of the rare earth elements. The partition system is particularly suited to separate adjacent rare earths of middle atomic weight groups, allowing the separation of gadolinium, terbium, dysprosium, holmium, erbium and thulium to be achieved by development to 18 cm distance. (orig.)
TL process in europium doped alkaline earth sulphate phosphors- a review
International Nuclear Information System (INIS)
Bhatt, B.C.
2003-01-01
CaSO 4 doped with the rare earth (RE) ion dysprosium or thulium is used routinely as a thermoluminescent dosimeter (TLD) to monitor personal exposure to x- and γ-radiation. The CaSO 4 :Eu phosphor is potentially important for radio photoluminescence (RPL) and ultraviolet (UV) dosimetry. Eu 3+ → Eu 2+ conversion is suggested to play a pivotal role in UV and γ-ray induced thermoluminescence. However, there is disagreement among different workers on the mechanism of gamma and UV induced TL in this phosphor system. This paper will review the work reported on CaSO 4 :Eu and make effects to project overall picture on this phosphor system. (author)
Determination of rare earth impurities in thorium by spectrographic methods
Energy Technology Data Exchange (ETDEWEB)
Wray, L W
1957-08-15
A method for determining rare earth impurities in thorium in the fractional ppm range is described. Before spectrographic examination is possible, the impurities must be freed from the thorium matrix. This is accomplished by removing the bulk of the thorium by extraction with TBP-CCl{sub 4} and the remainder by extraction with TTA-C{sub 6}H{sub 6}. This results in a consistent recovery of rare earths of about 85% with an average sensitivity of 0.2 ppm. The experimental error is within 10%. Details of the procedure are given together with working curves for the major neutron absorbing rare earths; i.e. dysprosium, europium, gadolinium and samarium. (author)
International Nuclear Information System (INIS)
Takezawa, Masaaki; Ikeda, Soichiro; Morimoto, Yuji; Kabashima, Hisayuki
2016-01-01
We used magnetic domain observation to statistically observe the thermal demagnetization behavior of Nd–Fe–B sintered magnets at elevated temperatures up to 150 °C. Simultaneous magnetization reversal in a hundred adjacent grains occurred at 90 °C because of the magnetic interaction among the grains beyond grain boundaries in the Dysprosium (Dy)-free low-coercivity magnet. Conversely, simultaneous magnetization reversal in a hundred grains did not occur in the Dy-added high-coercivity magnets, and the demagnetizing ratio steadily increased with temperature. Furthermore, the addition of Dy induced high thermal stability by eliminating the simultaneous thermal demagnetization, which was caused by the magnetic interaction among the grains.
Energy Technology Data Exchange (ETDEWEB)
Takezawa, Masaaki, E-mail: take@ele.kyutech.ac.jp; Ikeda, Soichiro; Morimoto, Yuji [Department of Applied Science for Integrated System Engineering, Faculty of Engineering, Kyushu Institute of Technology, 1-1 Sensui-cho, Tobata-ku, Kitakyushu, Fukuoka 804-8550 (Japan); Kabashima, Hisayuki [Mazda Motor Corporation,3-1, Shinchi, Fuchu-cho, Aki-gun Hiroshima 730-8670 (Japan)
2016-05-15
We used magnetic domain observation to statistically observe the thermal demagnetization behavior of Nd–Fe–B sintered magnets at elevated temperatures up to 150 °C. Simultaneous magnetization reversal in a hundred adjacent grains occurred at 90 °C because of the magnetic interaction among the grains beyond grain boundaries in the Dysprosium (Dy)-free low-coercivity magnet. Conversely, simultaneous magnetization reversal in a hundred grains did not occur in the Dy-added high-coercivity magnets, and the demagnetizing ratio steadily increased with temperature. Furthermore, the addition of Dy induced high thermal stability by eliminating the simultaneous thermal demagnetization, which was caused by the magnetic interaction among the grains.
Synthesis and Optimization of the Sintering Kinetics of Actinide Nitrides
Energy Technology Data Exchange (ETDEWEB)
Drryl P. Butt; Brian Jaques
2009-03-31
Research conducted for this NERI project has advanced the understanding and feasibility of nitride nuclear fuel processing. In order to perform this research, necessary laboratory infrastructure was developed; including basic facilities and experimental equipment. Notable accomplishments from this project include: the synthesis of uranium, dysprosium, and cerium nitrides using a novel, low-cost mechanical method at room temperature; the synthesis of phase pure UN, DyN, and CeN using thermal methods; and the sintering of UN and (Ux, Dy1-x)N (0.7 ≤ X ≤ 1) pellets from phase pure powder that was synthesized in the Advanced Materials Laboratory at Boise State University.
Environmental impacts of rare earth mining and separation based on Eudialyte. A new European way
Energy Technology Data Exchange (ETDEWEB)
Schreiber, Andrea; Marx, Josefine; Zapp, Petra; Hake, Juergen Friedrich [Forschungszentrum Juelich (Germany). Inst. of Energy and Climate Research - Systems Analysis and Technology Evaluation (IKE-STE); Vossenkaul, Daniel; Friedrich, Bernd [RWTH Aachen (Germany). Inst. of Process Metallurgy and Metal Recycling
2016-07-01
Neodymium and dysprosium are two rare earth elements (REEs), out of a group of 17 elements with similar chemical properties. Due to their unique properties, REEs gained increasing importance in many new technologies like wind turbines, batteries, lighting, and medical technique. However, the production of REEs requires high material and energy consumption and is associated with considerably environmental burdens e.g. radioactive loaded dust and tailings. Due to the Chinese hegemony regarding REE production and the strong dependency of European industry on Chinese REE exports this paper presents a possible European production chain of REEs based on the mineral Eudialyte found in Norra Karr (Sweden). Because almost 90% of the total mines production of 109,000 t REO equivalents in 2013 [USGS, 2013] occurred in China, the European production is compared to the Chinese route. Bayan Obo is the largest REE deposit in China located near Baotou in Inner Mongolia. Using the Life Cycle Assessment method (LCA), the environmental impacts of both production lines are assessed. Although LCA is a well-known methodology to determine environmental aspects from cradle-to-grave, there are only a few LCA studies available considering REE production, almost all based on process information gathered in the 1990s. This study presents newly estimated data of a possible European Eudialyte based production route collected in a corporate 4-year project together with Siemens AG, RWTH Aachen University and Forschungszentrum Julich. The results for the new European process route show reduced environmental burdens although the total REE content in Eudialyte is much smaller than in the Chinese deposit. Especially, the results for dysprosium from Eudialyte outreach those for Bayan Obo, due to the higher content of heavy rare earth elements (HREEs).
Neutron radiography applications in I.T.U. TRIGA Mark-II reactor
International Nuclear Information System (INIS)
Tugrul, A. B.
2002-01-01
Neutron radiography is an important radiographic technique which is supplied different and advanced information according to the X or gamma ray radiography. However, it has a trouble for supplying the convenient neutron sources. Tangential beam tube of Istanbul Technical University (ITU) TRIGA Mark-II Training and Research Reactor has been arranged for using neutron radiography. The neutron radiography set defined as detailed for the application of the technique. Two different techniques for neutron radiography are defined as namely, transfer method and direct method. For the transfer method dysprosium and indium screens are used in the study. But, dysprosium generally was preferred in many studies in the point of view nuclear safety. Gadolinium was used for direct method. Two techniques are compared and explained the preferring of the transfer technique. Firstly, reference composition is prepared for seeing the differences between neutron and X-ray or gamma radiography. In addition of it, some radiograph samples are given neutron and X-ray radiography which shows the different image characters. Lastly, some examples are given from archaeometric studies. One of them the brass plates of Great Mosque door in Cizre. After the neutron radiography application, organic dye traces are noticed. Other study is on a sword that belong to Urartu period at the first millennium B.C. It is seen that some wooden part on it. Some different artefacts are examined with neutron radiography from the Ikiztepe excavation site, then some animal post parts are recognized on them. One of them is sword and sheath which are corroded together. After the neutron radiography application, it can be noticed that there are a cloth between the sword and its sheath. By using neutron radiography, many interesting and detailed results are observed in ITU TRIGA Mark-II Training and Research Reactor. Some of them shouldn't be recognised by using any other technique
The effect of surface grain reversal on the AC losses of sintered Nd–Fe–B permanent magnets
International Nuclear Information System (INIS)
Moore, Martina; Roth, Stefan; Gebert, Annett; Schultz, Ludwig; Gutfleisch, Oliver
2015-01-01
Sintered Nd–Fe–B magnets are exposed to AC magnetic fields in many applications, e.g. in permanent magnet electric motors. We have measured the AC losses of sintered Nd–Fe–B magnets in a closed circuit arrangement using AC fields with root mean square-values up to 80 mT (peak amplitude 113 mT) over the frequency range 50 to 1000 Hz. Two magnet grades with different dysprosium content were investigated. Around the remanence point the low grade material (1.7 wt% Dy) showed significant hysteresis losses; whereas the losses in the high grade material (8.9 wt% Dy) were dominated by classical eddy currents. Kerr microscopy images revealed that the hysteresis losses measured for the low grade magnet can be mainly ascribed to grains at the sample surface with multiple domains. This was further confirmed when the high grade material was subsequently exposed to DC and AC magnetic fields. Here a larger number of surface grains with multiple domains are also present once the step in the demagnetization curve attributed to the surface grain reversal is reached and a rise in the measured hysteresis losses is evident. If in the low grade material the operating point is slightly offset from the remanence point, such that zero field is not bypassed, its AC losses can also be fairly well described with classical eddy current theory. - Highlights: • The eddy current losses of sintered Nd–Fe–B magnets were measured. • Field amplitudes up to 113 mT over the frequency range 50 to 1000 Hz were applied. • The Nd–Fe–B magnets showed significant hysteresis losses at low amplitudes (∼100 mT). • The source of such hysteresis losses in sintered Nd–Fe–B magnets was identified. • Two magnet grades with different dysprosium content were investigated
Environmental impacts of rare earth mining and separation based on Eudialyte. A new European way
International Nuclear Information System (INIS)
Schreiber, Andrea; Marx, Josefine; Zapp, Petra; Hake, Juergen Friedrich; Vossenkaul, Daniel; Friedrich, Bernd
2016-01-01
Neodymium and dysprosium are two rare earth elements (REEs), out of a group of 17 elements with similar chemical properties. Due to their unique properties, REEs gained increasing importance in many new technologies like wind turbines, batteries, lighting, and medical technique. However, the production of REEs requires high material and energy consumption and is associated with considerably environmental burdens e.g. radioactive loaded dust and tailings. Due to the Chinese hegemony regarding REE production and the strong dependency of European industry on Chinese REE exports this paper presents a possible European production chain of REEs based on the mineral Eudialyte found in Norra Karr (Sweden). Because almost 90% of the total mines production of 109,000 t REO equivalents in 2013 [USGS, 2013] occurred in China, the European production is compared to the Chinese route. Bayan Obo is the largest REE deposit in China located near Baotou in Inner Mongolia. Using the Life Cycle Assessment method (LCA), the environmental impacts of both production lines are assessed. Although LCA is a well-known methodology to determine environmental aspects from cradle-to-grave, there are only a few LCA studies available considering REE production, almost all based on process information gathered in the 1990s. This study presents newly estimated data of a possible European Eudialyte based production route collected in a corporate 4-year project together with Siemens AG, RWTH Aachen University and Forschungszentrum Julich. The results for the new European process route show reduced environmental burdens although the total REE content in Eudialyte is much smaller than in the Chinese deposit. Especially, the results for dysprosium from Eudialyte outreach those for Bayan Obo, due to the higher content of heavy rare earth elements (HREEs).
The effect of surface grain reversal on the AC losses of sintered Nd–Fe–B permanent magnets
Energy Technology Data Exchange (ETDEWEB)
Moore, Martina, E-mail: m.moore@ifw-dresden.de [Leibniz Institute for Solid State and Materials Research (IFW) Dresden, 01171 Dresden (Germany); Roth, Stefan; Gebert, Annett [Leibniz Institute for Solid State and Materials Research (IFW) Dresden, 01171 Dresden (Germany); Schultz, Ludwig [Leibniz Institute for Solid State and Materials Research (IFW) Dresden, 01171 Dresden (Germany); TU Dresden, Institute for Materials Science, 01062 Dresden (Germany); Gutfleisch, Oliver [TU Darmstadt, Department of Materials Science, Alarich-Weiß-Str. 16, 64287 Darmstadt (Germany); Fraunhofer Project Group for Materials Recycling and Resource Strategies IWKS, 63457 Hanau (Germany)
2015-02-01
Sintered Nd–Fe–B magnets are exposed to AC magnetic fields in many applications, e.g. in permanent magnet electric motors. We have measured the AC losses of sintered Nd–Fe–B magnets in a closed circuit arrangement using AC fields with root mean square-values up to 80 mT (peak amplitude 113 mT) over the frequency range 50 to 1000 Hz. Two magnet grades with different dysprosium content were investigated. Around the remanence point the low grade material (1.7 wt% Dy) showed significant hysteresis losses; whereas the losses in the high grade material (8.9 wt% Dy) were dominated by classical eddy currents. Kerr microscopy images revealed that the hysteresis losses measured for the low grade magnet can be mainly ascribed to grains at the sample surface with multiple domains. This was further confirmed when the high grade material was subsequently exposed to DC and AC magnetic fields. Here a larger number of surface grains with multiple domains are also present once the step in the demagnetization curve attributed to the surface grain reversal is reached and a rise in the measured hysteresis losses is evident. If in the low grade material the operating point is slightly offset from the remanence point, such that zero field is not bypassed, its AC losses can also be fairly well described with classical eddy current theory. - Highlights: • The eddy current losses of sintered Nd–Fe–B magnets were measured. • Field amplitudes up to 113 mT over the frequency range 50 to 1000 Hz were applied. • The Nd–Fe–B magnets showed significant hysteresis losses at low amplitudes (∼100 mT). • The source of such hysteresis losses in sintered Nd–Fe–B magnets was identified. • Two magnet grades with different dysprosium content were investigated.
The potential risks from metals bottlenecks to the deployment of Strategic Energy Technologies
International Nuclear Information System (INIS)
Moss, R.L.; Tzimas, E.; Kara, H.; Willis, P.; Kooroshy, J.
2013-01-01
This paper examines the use of materials, in particular metals, in six low-carbon energy technologies of the European Union's Strategic Energy Technology Plan (SET-Plan), namely nuclear, solar, wind, bioenergy, carbon capture and storage and electricity grids. The projected average annual demand for metals in the SET-Plan technologies for the decades up to 2020 and 2030 is compared to the known global production volume in 2010. From an initial inventory of over 50 metals, 14 metals were identified that will require 1% or more of the 2010 world supply per annum between 2020 and 2030. These 14 metals are cadmium, dysprosium, gallium, hafnium, indium, molybdenum, neodymium, nickel, niobium, selenium, silver, tellurium, tin and vanadium. These metals were examined further by analysing the effect of market and geo-political factors of supply and demand, which highlighted five metals to represent a high risk to large-scale technology deployment, namely: neodymium, dysprosium, indium, tellurium and gallium. The five metals were further analysed with respect to the wind and solar sectors, showing that the demand of these metals could increase significantly depending on future sub-technology choices. Mitigation strategies to alleviate potential shortages are also discussed, e.g. extending primary output; re-use, re-cycling and waste reduction; and substitution. - Highlights: ► Over 50 metals and their usage in six low-carbon energy technologies are analysed. ► 14 metals are identified that will require 1% or more of the 2010 world supply per annum. ► The 14 metals are further examined with respect to market and geo-political factors. ► 5 metals Nd, Dy, In, Te and Ga are a high risk to large-scale technology deployment. ► Demand for the 5 metals increases for sub-technology choices in PV and wind energy
Tse, Pui-Kwan
2011-01-01
Introduction China's dominant position as the producer of over 95 percent of the world output of rare-earth minerals and rapid increases in the consumption of rare earths owing to the emergence of new clean-energy and defense-related technologies, combined with China's decisions to restrict exports of rare earths, have resulted in heightened concerns about the future availability of rare earths. As a result, industrial countries such as Japan, the United States, and countries of the European Union face tighter supplies and higher prices for rare earths. This paper briefly reviews China's rare-earth production, consumption, and reserves and the important policies and regulations regarding the production and trade of rare earths, including recently announced export quotas. The 15 lanthanide elements-lanthanum, cerium, praseodymium, neodymium, promethium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, and lutetium (atomic numbers 57-71)-were originally known as the rare earths from their occurrence in oxides mixtures. Recently, some researchers have included two other elements-scandium and yttrium-in their discussion of rare earths. Yttrium (atomic number 39), which lies above lanthanum in transition group III of the periodic table and has a similar 3+ ion with a noble gas core, has both atomic and ionic radii similar in size to those of terbium and dysprosium and is generally found in nature with lanthanides. Scandium (atomic number 21) has a smaller ionic radius than yttrium and the lanthanides, and its chemical behavior is intermediate between that of aluminum and the lanthanides. It is found in nature with the lanthanides and yttrium. Rare earths are used widely in high-technology and clean-energy products because they impart special properties of magnetism, luminescence, and strength. Rare earths are also used in weapon systems to obtain the same properties.
New developments in the use of stable activable tracers in environmental science
International Nuclear Information System (INIS)
Loveland, W.; Keasler, K.; Ghannam, L.; Borovik, A.
1980-01-01
Recent developments in the use of stable activable tracers (SATs) in environmental science are reported. (A stable activable tracer is a stable material injected into a system under study and whose concentration is measured by post-sampling activation analysis.) The activable nuclear parts of the tracers studied have been rare earth nuclides with short-lived activation products or Cu. To trace the fate of fluid-bound pollutants (and/or water masses) in marine waters, we have used anionic DTPA complexes of the rare earths. These tracers were shown to be stable (80 to 90% nondissociated) in extensive laboratory tests involving solutions of the tracer in estuarine water including large amounts of marine sediments. Results of a field study in which the flushing time and other hydrological characteristics of an estuarine marina were measured by simultaneously using a fluorescent dye and a SAT are presented. To trace the path of potentially toxic organic molecules, three stable activable tracers, dysprosium(III)-trisacetylacetonate DY(acac) 3 3H 2 O), dysprosium(III)-trisdibenzoylmethane (DY(dbm) 3 H 2 O and copper oxinate Cu (C 9 H 6 ON) 2 were synthesized. Their octanol/water partition coefficients and their solubility in water were measured and used to correlate the tracer species and its biological activity with that of known toxic materials. In a project to demonstrate the simple use of SATs to trace the origin of common insecticides and herbicides, seven common insecticides and herbicides were marked with anionic rare earth DTPA complexes and shown to be detectable at dilutions of 1 part in 10 12 . Two arsenical herbicides were chosen for further study and the tracer/herbicide ratio was shown to remain constant in samples of herbicide material collected on plant surfaces and runoff waters in the environment for long periods
40 CFR 152.168 - Advertising of restricted use products.
2010-07-01
... advertising. (5) Billboards and posters. (c) The requirement may be satisfied for printed material by... in the broadcast of the spoken words “Restricted use pesticide,” or a statement of the terms of...
Engineering of Bacillus subtilis 168 for increased nisin resistance
DEFF Research Database (Denmark)
Hansen, Mette; Wangari, Romilda; Hansen, Egon Bech
2009-01-01
. Bacillus subtilis had been suggested as a potential host for the biosynthesis of nisin but was discarded due to its sensitivity to the lethal action of nisin. In this study, we have reevaluated the potential of B. subtilis as a host organism for the heterologous production of nisin. We applied...... transcriptome and proteome analyses of B. subtilis and identified eight genes upregulated in the presence of nisin. We demonstrated that the overexpression of some of these genes boosts the natural defenses of B. subtilis, which allows it to sustain higher levels of nisin in the medium. We also attempted...... to overcome the nisin sensitivity of B. subtilis by introducing the nisin resistance genes nisFEG and nisI from L. lactis under the control of a synthetic promoter library....
40 CFR 205.168-11 - Order to cease distribution.
2010-07-01
... order will not be issued if the manufacturer has made a good faith attempt to properly production verify the category and can establish such good faith. (b) Any such order shall be issued after notice and...
76 FR 168 - Heavy Forged Hand Tools From China
2011-01-03
.... (12) Identify significant changes, if any, in the supply and demand conditions or business cycle for..., Deputy Agency Ethics Official, at 202-205-3088. Limited disclosure of business proprietary information... Subject Merchandise, a U.S. or foreign trade or business association, or another interested party...
32 CFR 552.168 - Fort Lewis Area Access Office.
2010-07-01
... must be sponsored and accompanied by a parent or legal guardian. Individual registration requires: (1... event. It is the responsibility of each permit holder to inform a friend or relative of the area being...
All projects related to | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Topic: ACCESS TO EDUCATION, EDUCATIONAL COSTS, EDUCATIONAL DEVELOPMENT, DEVELOPING COUNTRIES, POLICY MAKING, LABOUR SHORTAGE, RESEARCH CAPACITY, RESEARCH NETWORKS, EDUCATIONAL EQUIPMENT. Region: Central Asia, Far East Asia, South Asia, North and Central America ...
26 CFR 1.168(i)-1 - General asset accounts.
2010-04-01
... residual) is a multiple category asset (as defined in § 1.861-9T(g)(3)(ii)), and the income yield from the... for Salt Lake City, Utah facility”) that identify the assets included in each general asset account...
A naproxen complex of dysprosium intercalates into calf thymus DNA base pairs
International Nuclear Information System (INIS)
Yang, Mengsi; Jin, Jianhua; Xu, Guiqing; Cui, Fengling; Luo, Hongxia
2014-01-01
Highlights: • Binding mode to ctDNA was studied by various methods. • Intercalation is the most possible binding mode. • Dynamic and static quenching occurred simultaneously. • Hydrophobic force played a major role. • Binding characteristic of rare earth complexes to DNA are dependent on the element. - Abstract: The binding mode and mechanism of dysprosium–naproxen complex (Dy–NAP) with calf thymus deoxyribonucleic acid (ctDNA) were studied using UV–vis and fluorescence spectra in physiological buffer (pH 7.4). The results showed that more than one type of quenching process occurred and the binding mode between Dy–NAP with ctDNA might be intercalation. In addition, ionic strength, iodide quenching and fluorescence polarization experiments corroborated the intercalation binding mode between Dy–NAP and ctDNA. The calculated thermodynamic parameters ΔG, ΔH and ΔS at different temperature demonstrated that hydrophobic interaction force played a major role in the binding process
White light emission and color tunability of dysprosium doped barium silicate glasses
Energy Technology Data Exchange (ETDEWEB)
Mishra, Lokesh; Sharma, Anchal; Vishwakarma, Amit K.; Jha, Kaushal [Department of Applied Physics, Delhi Technological University, Delhi 110042 (India); Jayasimhadri, M., E-mail: jayaphysics@yahoo.com [Department of Applied Physics, Delhi Technological University, Delhi 110042 (India); Ratnam, B.V.; Jang, Kiwan [Department of Physics, Changwon National University, Changwon 641-77 (Korea, Republic of); Rao, A.S.; Sinha, R.K. [Department of Applied Physics, Delhi Technological University, Delhi 110042 (India)
2016-01-15
The present work elucidates the synthesis of Dy{sup 3+} doped barium silicate glasses, along with the subsequent studies performed to evaluate its viability in solid state lighting applications. The synthesized photonic glasses were investigated via X-Ray Diffraction, Scanning Electron Microscopy and Fourier Transform Infrared Spectroscopy. The photoluminescence properties were examined under ultraviolet (UV)/near UV (NUV) excitation. Photoluminescence spectrum exhibited characteristic emission bands at λ{sub em}=483 nm (blue) and λ{sub em}=576 nm (yellow) which are ascribed to the {sup 4}F{sub 9/2}→{sup 6}H{sub 15/2} and {sup 4}F{sub 9/2}→{sup 6}H{sub 13/2} transitions of Dy{sup 3+} ion, respectively. The chromaticity coordinates under excitation of λ{sub ex}=348 nm are (0.31, 0.34), which lies in the white region of CIE 1931 chromaticity diagram and are in excellent proximity with the standard equal energy white illuminant (0.333, 0.333). The calculated correlated color temperature and the yellow to blue (Y/B) ratio are found to be 6602 K and 1.12, respectively for the optimized sample. The synthesized photonic glass also offered the possibility of tuning the color as exemplified through the variation in CIE coordinates, correlated color temperature and the Y/B ratio. The results confirm the possibility of color tunability from the proposed glass and may be useful for various photonic device applications. - Highlights: • Successfully synthesized Dy{sup 3+} doped barium silicate glasses. • Structural properties thoroughly discussed by using XRD and FT-IR. • Photoluminescence and colorimetry properties have been investigated. • Y/B ratio and the reason for color tunability have been successfully explained. • CIE coordinates of Dy{sup 3+}:BBS glass confirm its suitability for w-LEDs.
New ultrasonic attenuation maxima for single crystal dysprosium in a magnetic field
International Nuclear Information System (INIS)
Treder, R.A.; Maekawa, S.; Levy, M.
1976-01-01
The temperatures and corresponding applied basal plane magnetic fields are reported for longitudinal ultrasonic attenuation maxima in a cylindrical Dy sample. Besides maxima at Tsub(N) and Tsub(C), two new maxima are observed and possible explanations for their existence are given. (Auth.)
Experimental study of induced staggered magnetic fields in dysprosium gallium garnet (DGG)
International Nuclear Information System (INIS)
Steiner, M.; Corliss, L.M.; Hastings, J.M.; Blume, M.; Giordano, N.; Wolf, W.P.
1979-01-01
Neutron diffraction techniques have been used to study induced staggered magnetic field effects in DGG. The application of a uniform magnetic field at temperatures much greater than the Neel temperature induces a significant amount of antiferromagnetic order. The temperature and field dependences of this effect are in good agreement with recent theoretical predicions
Improvement of high-frequency characteristics of Z-type hexaferrite by dysprosium doping
International Nuclear Information System (INIS)
Mu Chunhong; Liu Yingli; Song Yuanqiang; Wang Liguo; Zhang Huaiwu
2011-01-01
Z-type hexaferrite has great potential applications as anti-EMI material for magnetic devices in the GHz region. In this work, Dy-doped Z-type hexaferrites with nominal stoichiometry of Ba 3 Co 2 Dy x Fe 24-x O 41 (x 0.0, 0.05, 0.5, 1.0) were prepared by an improved solid-state reaction method. The effects of rare earth oxide (Dy 2 O 3 ) addition on the phase composition, microstructure and electromagnetic properties of the ceramics were investigated. Structure and micromorphology characterizations indicate that certain content of Dy doping will cause the emergence of the second phase Dy 3 Fe 5 O 12 at the grain boundaries of the majority phase Z-type hexaferrite, due to which the straightforward result is the grain refinement during the successive sintering process. Permeability spectra measurements show that the initial permeability reaches its maximum of 17 at 300 MHz with x = 0.5, while the cutoff frequency keeps above 800 MHz. The apparent specific anisotropy field H K of Dy-doped Z-type hexaferrites decreases with x increasing. The relationships among phase composition, grain size, permeability spectra, and anisotropy are theoretically investigated, and according to the analysis, Dy doping effects on its magnetic properties can be well explained and understood.
Extraction and stripping of neodymium (III) and dysprosium (III) by TRUEX solvent
International Nuclear Information System (INIS)
Rout, Alok; Venkatesan, K.A.; Antony, M.P.; Srinivasan, T.G.; Vasudeva Rao, P.R.
2009-01-01
McCabe-Thiele diagram for the extraction and stripping of Nd (III) and Dy (III) by TRUEX solvent has been constructed to determine the number of stages required for complete extraction and stripping. (author)
Symmetries and modelling functions for diffusion processes
International Nuclear Information System (INIS)
Nikitin, A G; Spichak, S V; Vedula, Yu S; Naumovets, A G
2009-01-01
A constructive approach to the theory of diffusion processes is proposed, which is based on application of both symmetry analysis and the method of modelling functions. An algorithm for construction of the modelling functions is suggested. This algorithm is based on the error function expansion (ERFEX) of experimental concentration profiles. The high-accuracy analytical description of the profiles provided by ERFEX approximation allows a convenient extraction of the concentration dependence of diffusivity from experimental data and prediction of the diffusion process. Our analysis is exemplified by its employment in experimental results obtained for surface diffusion of lithium on the molybdenum (1 1 2) surface precovered with dysprosium. The ERFEX approximation can be directly extended to many other diffusion systems.
Isovector pairing effect on the particle-number projection two-proton separation energy
Energy Technology Data Exchange (ETDEWEB)
Mokhtari, Djamila; Kerrouchi, Slimane [Laboratoire de Physique Theorique, Faculte de Physique, Algiers (Algeria); Fellah, Mohamed; Allal, Nassima-Hosni [Laboratoire de Physique Theorique, Faculte de Physique, Algiers (Algeria); Centre de Recherche Nucleaire d' Alger, Comena, Algiers (Algeria)
2009-07-01
The two-proton separation energy is studied by performing a particle-number projection with and without inclusion of the isovector neutron-proton (np) pairing correlations. It is numerically evaluated for even-even rare-earth nuclei such that the np pairing parameter is non-zero. It is shown that the two-proton separation energy values calculated using the two approaches join, for almost all the considered elements, for the highest values of (N-Z). However, the results including the np pairing correlations are closest to the experimental data when available. Moreover, the two methods lead to the same prediction of the two-proton drip-line position, except for the Dysprosium and the Tungsten.
International Nuclear Information System (INIS)
Buster, D.C.
1988-01-01
A technique has been developed to investigate the antibiotic facilitated transmembrane transport of monovalent cations using 23 Na and 7 Li Nuclear Magnetic Resonance spectroscopy. The initial portion of this thesis outlines the production and characterization of a model lipid system amenable to the NMR detection of cation transport. Large unilamellar vesicles (LUV) have been prepared from a 4:1 mixture of phosphatidylcholine and phosphatidylglycerol. The presence of the anionic chemical shift reagent dysprosium (III) tripolyphosphate, either inside or outside of the vesicles, allows for the spectroscopic separation of the NMR resonances arising from the inter- and extravesicular cation pools. The cation transporting properties of the channel-forming pentadecapeptide, gramicidin D, have been studied using the NMR technique
Polarized Epithermal Neutron Studies of Magnetic Domains
International Nuclear Information System (INIS)
Alfimenkov, V.P.; Chernikov, A.N.; Lason, L.; Mareev, Yu. D.; Novitsky, V.V.; Pikelner, L.B.; Skoy, V.R.; Tsulaya, M.I.; Gould, C.R.; Haase, D.G.; Roberson, N.R.
1997-01-01
The average size and shape of magnetic domains in a material can be determined from the precession of polarized neutrons traversing the material. Epithermal neutrons (0.5eV< En<100eV), which process more slowly than thermals, effectively probe the internal structure of samples that are thick or have large domains or large internal fields. Such epithermal neutron measurements require a neutron polarizer and analyzer based on cryogenically polarized spin filters. We discuss the measurements at JINR, Dubna, of magnetic domains in a 2.0 cm. diam. crystal of holmium using 1.7 to 59eV neutrons polarized by a dynamically polarized proton target and analyzed with a statically polarized dysprosium target
Trace determination of yttrium and some heavy rare-earths by adsorptive stripping voltammetry
International Nuclear Information System (INIS)
Wang, J.; Zadeii, J.M.
1986-01-01
The interfacial and redox behaviour of rare-earth chelates the Solochrome Violet RS are exploited for developing a sensitive adsorptive stripping procedure. Yttrium and heavy rare earths such as dysprosium, holmium and ytterbium can thus be measured at ng/ml levels and below, by controlled adsorptive accumulation of the metal chelate at the hanging mercury drop electrode, followed by voltammetric measurement of the surface species. With a 3-min preconcentration time, the detection limit ranges from 5 x 10 -10 to 1.4 x 10 -9 M. The relative standard deviation at the 7 ng/ml level ranges from 4 to 7%. A separation method is required to differentiate between the individual rare-earth metals. (author)
Directory of Open Access Journals (Sweden)
Salvador Escorcia García
2014-01-01
Full Text Available Si un expediente clínico no se encuentra completo un prestador de servicios médicos no contará con la información necesaria para ofrecer una mejor atención al paciente. Actualmente existen esfuerzos para contar con un expediente clínico completo y de acceso rápido, pero en situaciones de emergencia la principal fuente de información para brindar una mejor atención es el paciente, pero este no siempre se encuentra disponible para proporcionar información. En el presente artículo se propone una metodología para el manejo de información clínica por medio de la tecnología inalámbrica NFC y los dispositivos móviles. Como producto final de dicha metodología se obtuvo una aplicación móvil Android. La información clínica que fue manejada en dicha metodología, se obtuvo a partir de la NOM-168 que establece los datos mínimos por los que se debe componer un expediente clínico. Dicha información clínica fue comparada con el estándar HL7 CDA Versión 2 para obtener un documento XML, el cual fue utilizado como una plantilla para crear documentos clínicos electrónicos. La incorporación de la tecnología NFC en dicha metodología fue necesaria para almacenar y recuperar la información clínica en la memoria de tags NFC. La ventaja de lo anterior es que un tag NFC tiene distintas presentaciones como puede ser un calcomanía o una tarjeta de identificación, por lo que los pacientes pueden fácilmente transportar información clínica. Y además dicha información puede ser accedida por medio de un dispositivo móvil con NFC incluso si los pacientes se encuentran en un estado que no puedan facilitar información.
Dicty_cDB: Contig-U15645-1 [Dicty_cDB
Lifescience Database Archive (English)
Full Text Available D021940 ) Packaging cell systems for use in promotion of th... 168 6e-78 2 ( AX35... BD021943 ) Packaging cell systems for use in promotion of th... 168 8e-78 2 ( AX356044 ) Sequence 15 from P
76 FR 33814 - Proposed Collection; Comment Request for Regulation Project
2011-06-09
... collection requirements related to Additional First Year Depreciation Deduction. DATES: Written comments... . SUPPLEMENTARY INFORMATION: Title: Additional First Year Depreciation Deduction. OMB Number: 1545-2207... year depreciation deduction. Section 401(b) of the TRUIRJCA amends Sec. 168(k) by adding Sec. 168(k)(5...
Rare earth elements: end use and recyclability
Goonan, Thomas G.
2011-01-01
Rare earth elements are used in mature markets (such as catalysts, glassmaking, lighting, and metallurgy), which account for 59 percent of the total worldwide consumption of rare earth elements, and in newer, high-growth markets (such as battery alloys, ceramics, and permanent magnets), which account for 41 percent of the total worldwide consumption of rare earth elements. In mature market segments, lanthanum and cerium constitute about 80 percent of rare earth elements used, and in new market segments, dysprosium, neodymium, and praseodymium account for about 85 percent of rare earth elements used. Regardless of the end use, rare earth elements are not recycled in large quantities, but could be if recycling became mandated or very high prices of rare earth elements made recycling feasible.
Yan, Yi-Ling; Guo, Jiun-Rung; Liang, Chien-Fu
2017-09-19
Dysprosium(III) trifluoromethanesulfonate-catalyzed per-O-acetylation and regioselective anomeric de-O-acetylation of carbohydrates can be tuned by adjusting the reaction medium. In this study, the per-O-acetylation of unprotected sugars by using a near-stoichiometric amount of acetic anhydride under solvent-free conditions resulted in the exclusive formation of acetylated saccharides as anomeric mixtures, whereas anomeric de-O-acetylation in methanol resulted in a moderate-to-excellent yield. Reactions with various unprotected monosaccharides or disaccharides followed by a semi-one-pot sequential conversion into the corresponding acetylated glycosyl hemiacetal also resulted in high yields. Furthermore, the obtained hemiacetals could be successfully transformed into trichloroimidates after Dy(OTf) 3 -catalyzed glycosylation. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
3D Reconstruction of the Glycocalyx Structure in Mammalian Capillaries using Electron Tomography
DEFF Research Database (Denmark)
Arkill, Kp; Neal, Cr; Mantell, Jm
2012-01-01
of the proteoglycan components of the glycocalyx layer (fundamental spacing about 20 nm), but require a large sample number. Attempts to visualise the glycocalyx face-on (i.e. in a direction perpendicular to the endothelial cell layer in the lumen and directly applicable for permeability modelling) has had limited...... success (e.g. freeze fracture). A new approach is therefore needed. Here we demonstrate the effectiveness of using the relatively novel electron microscopy technique of 3D electron tomography ontwo differently stained preparations to reveal details of the architecture of the glycocalyx just above...... the endothelial cell layer. One preparation uses the novel staining technique using Lanthanum Dysprosium Glycosamino Glycan adhesion (the LaDy GAGa method). © 2012 John Wiley & Sons Ltd....
Energy Technology Data Exchange (ETDEWEB)
Matsushima, Luciana C.; Veneziani, Glauco R.; Campos, Leticia L., E-mail: lmatsushima@usp.b, E-mail: veneziani@ipen.b, E-mail: lcrodri@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (GMR/IPEN/CNEN-SP), Sao Paulo, SP (Brazil). Gerencia de Metrologia das Radiacoes; Sakuraba, Roberto K.; Cruz, Jose C. da, E-mail: rsakuraba@einstein.b, E-mail: jccruz@einstein.b [Sociedade Beneficente Israelita Brasileira, Sao Paulo, SP (Brazil). Hospital Albert Einstein (HAE)
2011-10-26
This paper perform the comparative study of thermoluminescent answer of calcium sulfate dosemeter doped with dysprosium (DaSO{sub 4}:Dy) produced by the IPEN, Sao Paulo, with answer of lithium fluoride dosemeters doped with magnesium and titanium (LiF:Mg, Ti) in the dosimetry of clinical beams of photons (6 and 15 MV) by using water simulator object. Dose-answer curves were obtained for gamma radiation of cobalt-60 in the air and in conditions of electronic equilibrium (plate of PMMA), and clinical photons of CLINAC model 2100C accelerators of the two evaluated hospitals: Hospital das Clinicas of the Faculty of Medicine of Sao Paulo university and Hospital Albert Einstein. It was also evaluated the sensitivity and reproduction of the three dosemeters
Growth of fcc(111) Dy multi-height islands on 6H-SiC(0001) graphene
International Nuclear Information System (INIS)
Hershberger, M T; Hupalo, M; Thiel, P A; Tringides, M C
2013-01-01
Graphene based spintronic devices require an understanding of the growth of magnetic metals. Rare earth metals have large bulk magnetic moments so they are good candidates for such applications, and it is important to identify their growth mode. Dysprosium was deposited on epitaxial graphene, prepared by thermally annealing 6H-SiC(0001). The majority of the grown islands have triangular instead of hexagonal shapes. This is observed both for single layer islands nucleating at the top of incomplete islands and for fully completed multi-height islands. We analyze the island shape distribution and stacking sequence of successively grown islands to deduce that the Dy islands have fcc(111) structure, and that the triangular shapes result from asymmetric barriers to corner crossing. (paper)
The AMBRE Project: r-process element abundances in the Milky Way thin and thick discs
Guiglion, Guillaume; de Laverny, Patrick; Recio-Blanco, Alejandra; Worley, C. Clare
2018-04-01
Chemical evolution of r-process elements in the Milky Way disc is still a matter of debate. We took advantage of high resolution HARPS spectra from the ESO archive in order to derive precise chemical abundances of 3 r-process elements Eu, Dy & Gd for a sample of 4 355 FGK Milky Way stars. The chemical analysis has been performed thanks to the automatic optimization pipeline GAUGUIN. Based on the [α/Fe] ratio, we chemically characterized the thin and the thick discs, and present here results of these 3 r-process element abundances in both discs. We found an unexpected Gadolinium and Dysprosium enrichment in the thick disc stars compared to Europium, while these three elements track well each other in the thin disc.
Polarized epithermal neutron studies of magnetic domains
International Nuclear Information System (INIS)
Alfimenkov, V.P.; Chernikov, A.N.; Lason, L.; Mareev, Y.D.; Novitsky, V.V.; Pikelner, L.B.; Skoy, V.R.; Tsulaya, M.I.; Gould, C.R.; Haase, D.G.; the Triangle Universities Nuclear Laboratory, Durham, North Carolina; Roberson, N.R.; the Triangle Universities Nuclear Laboratory, Durham, North Carolina
1997-01-01
The average size and shape of magnetic domains in a material can be determined from the precession of polarized neutrons traversing the material. Epithermal neutrons (0.5eV n <100eV), which precess more slowly than thermals, effectively probe the internal structure of samples that are thick or have large domains or large internal fields. Such epithermal neutron measurements require a neutron polarizer and analyzer based on cryogenically polarized spin filters. We discuss the measurement at JINR, Dubna, of magnetic domains in a 2.0 cm. diam. crystal of holmium using 1.7 to 59 eV neutrons polarized by a dynamically polarized proton target and analyzed with a statically polarized dysprosium target. copyright 1997 American Institute of Physics
International Nuclear Information System (INIS)
Matsushima, Luciana C.; Veneziani, Glauco R.; Campos, Leticia L.
2011-01-01
This paper perform the comparative study of thermoluminescent answer of calcium sulfate dosemeter doped with dysprosium (DaSO 4 :Dy) produced by the IPEN, Sao Paulo, with answer of lithium fluoride dosemeters doped with magnesium and titanium (LiF:Mg, Ti) in the dosimetry of clinical beams of photons (6 and 15 MV) by using water simulator object. Dose-answer curves were obtained for gamma radiation of cobalt-60 in the air and in conditions of electronic equilibrium (plate of PMMA), and clinical photons of CLINAC model 2100C accelerators of the two evaluated hospitals: Hospital das Clinicas of the Faculty of Medicine of Sao Paulo university and Hospital Albert Einstein. It was also evaluated the sensitivity and reproduction of the three dosemeters
International Nuclear Information System (INIS)
Nor Azillah Fatimah Othman; Selambakkannu, S.; Norliza Ishak; Nor Azwin Shukri; Zulkafli Ghazali
2016-01-01
Full text: In this work kenaf bast fibers were used as trunk polymer for grafting with bis[2-(methacryloyloxy)ethyl]phosphate monomer through radiation induced grafting technique. Kenaf fibers were treated with different concentration of sodium chlorite (NaClO_2) solution at 70 degree Celsius for 6 hours. Kenaf fibers were irradiated with electron beam and reacted with bis[2-(methacryloyloxy)ethyl]phosphate/ water emulsion. Formation of grafting was observed from the increase in degree of grafting and confirmed by FTIR and SEM results. Effects of irradiation dose, reaction time, reaction temperature and monomer concentration on the degree of grafting were studied. Performance of the grafted kenaf fibers were then tested for adsorption of rare earth elements, namely Dysprosium, Neodymium and Holmium. (author)
International Nuclear Information System (INIS)
Sahu, M.; Nagara, B.K.; Saxena, M.K.; Dash, S.
2010-01-01
There is a need to improve the reactor performance through longer cycle length, which is being carried out by initial fuel enrichment. This additional fuel enrichment is being compensated by introduction of additional neutron absorber material called as burnable poison. Burnable poisons are materials having one or more isotopes which have high neutron absorption cross section and gets converted into other isotopes of relatively low absorption cross section. The use of burnable poison provides the necessary negative moderator reactivity coefficient at the beginning of core life and helps shape core power distribution. Usually rare-earth elements such as gadolinium, dysprosium and samarium have been applied for this purpose. Presently gadolinia doped urania is being used as burnable poison in boiling water reactor (BWR)
An operationally simple method for separating the rare-earth elements neodymium and dysprosium
Energy Technology Data Exchange (ETDEWEB)
Bogart, Justin A.; Lippincott, Connor A.; Carroll, Patrick J.; Schelter, Eric J. [Department of Chemistry, University of Pennsylvania, Philadelphia, PA (United States)
2015-07-06
Rare-earth metals are critical components of electronic materials and permanent magnets. Recycling of consumer materials is a promising new source of rare earths. To incentivize recycling there is a clear need for simple methods for targeted separations of mixtures of rare-earth metal salts. Metal complexes of a tripodal nitroxide ligand [{(2-"tBuNO)C_6H_4CH_2}{sub 3}N]{sup 3-} (TriNOx{sup 3-}), feature a size-sensitive aperture formed of its three η{sup 2}-(N,O) ligand arms. Exposure of metal cations in the aperture induces a self-associative equilibrium comprising [M(TriNOx)thf]/[M(TriNOx)]{sub 2} (M=rare-earth metal). Differences in the equilibrium constants (K{sub eq}) for early and late metals enables simple Nd/Dy separations through leaching with a separation ratio S{sub Nd/Dy}=359. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
An Operationally Simple Method for Separating the Rare-Earth Elements Neodymium and Dysprosium.
Bogart, Justin A; Lippincott, Connor A; Carroll, Patrick J; Schelter, Eric J
2015-07-06
Rare-earth metals are critical components of electronic materials and permanent magnets. Recycling of consumer materials is a promising new source of rare earths. To incentivize recycling there is a clear need for simple methods for targeted separations of mixtures of rare-earth metal salts. Metal complexes of a tripodal nitroxide ligand [{(2-(t) BuNO)C6 H4 CH2 }3 N](3-) (TriNOx(3-) ), feature a size-sensitive aperture formed of its three η(2) -(N,O) ligand arms. Exposure of metal cations in the aperture induces a self-associative equilibrium comprising [M(TriNOx)thf]/ [M(TriNOx)]2 (M=rare-earth metal). Differences in the equilibrium constants (Keq ) for early and late metals enables simple Nd/Dy separations through leaching with a separation ratio SNd/Dy =359. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Crystal-field magnetic anisotropy of dilute dysprosium or erbium in yttrium single crystals
DEFF Research Database (Denmark)
Høg, J.; Touborg, P.
1974-01-01
Magnetization measurements have been performed between 1.3 and 300 K in fields up to 50 × 105 A/m in the a, b, and c directions of hcp crystals of pure Y and Y doped with 0.14-at.% Dy or 0.14-at.% Er, using the Faraday method and a vibrating-sample method. The characteristic behavior of both...
Algeria: the illusions of oil wealth - CERI Studies No. 168
International Nuclear Information System (INIS)
Martinez, Luis
2010-09-01
Thirty years after the nationalisation of hydrocarbons Algeria's oil wealth seems to have disappeared judging by its absence in the country's indicators of well-being. In Algeria oil led to happiness for a few and sadness for many. The absence of controls over oil revenue led to the industries downfall. Since 2002 Algeria is again seeing oil wealth. The increase in the price per barrel from 30 to 147 dollars between 2002 and 2008 provided the country with unexpected revenue permitting it to accumulate funds estimated, in 2009, at 150 billion dollars. Abdelaziz Bouteflika, returned to a devastated Algeria to restore civil order, unexpectedly benefited from this price increase. Thus, in addition to national reconciliation he was able to offer Algeria renewed economic growth. However, given that the wounds of the 1990's are not entirely healed and the illusions of oil wealth have evaporated this unexpected return of financial abundance raises concerns. To what ends will this manna be put? Who will control it? Will it provoke new violence and conflict? (author)
Modulation of Rhamm (CD168) for selective adipose tissue development
Turley, Eva A; Bissell, Mina J
2014-05-06
Herein is described the methods and compositions for modulation of Rhamm, also known as CD 186, and its effects on wound repair, muscle differentiation, bone density and adipogeneisis through its ability to regulate mesenchymal stem cell differentiation. Compositions and methods are provided for blocking Rhamm function for selectively increasing subcutaneous, but not, visceral fat. Compositions and methods for modulating Rhamm in wound repair are also described.
FCJ-168 Do objects dream of an internet of things?
Directory of Open Access Journals (Sweden)
Teodor Mitew
2014-12-01
Full Text Available This paper develops the notion of heteroclite sociable objects in the context of the emerging internet of things, and examines their transformative effect for understandings of sociability and agency. The notion of sociable objects attempts to capture the heterogeneous identity-shift occurring when heretofore obscure and mute objects ranging from toasters to thermostats acquire the agencies to leave semantically distinct traces online, and detour their human interlocutors into an object-mediated entanglement. Using a toolkit drawn from actor network theory and object oriented ontology, the paper discusses several examples illustrating the case for new parameters of sociability, better suited to a materiality acquiring conversational and anticipatory agencies.
40 CFR 168.65 - Pesticide export label and labeling requirements.
2010-07-01
... graphic matter on or attached to the immediate container of the pesticide, device, or active ingredient...). Every exported pesticide, device, and active ingredient used in producing a pesticide (see § 152.3 of this chapter for the definition of “active ingredient” and “pesticide”) must bear a label or labeling...
Intrinsic Levanase Activity of Bacillus subtilis 168 Levansucrase (SacB.
Directory of Open Access Journals (Sweden)
Luz Méndez-Lorenzo
Full Text Available Levansucrase catalyzes the synthesis of fructose polymers through the transfer of fructosyl units from sucrose to a growing fructan chain. Levanase activity of Bacillus subtilis levansucrase has been described since the very first publications dealing with the mechanism of levan synthesis. However, there is a lack of qualitative and quantitative evidence regarding the importance of the intrinsic levan hydrolysis of B. subtilis levansucrase and its role in the levan synthesis process. Particularly, little attention has been paid to the long-term hydrolysis products, including its participation in the final levan molecules distribution. Here, we explored the hydrolytic and transferase activity of the B. subtilis levansucrase (SacB when levans produced by the same enzyme are used as substrate. We found that levan is hydrolyzed through a first order exo-type mechanism, which is limited to a conversion extent of around 30% when all polymer molecules reach a structure no longer suitable to SacB hydrolysis. To characterize the reaction, Isothermal Titration Calorimetry (ITC was employed and the evolution of the hydrolysis products profile followed by HPLC, GPC and HPAEC-PAD. The ITC measurements revealed a second step, taking place at the end of the reaction, most probably resulting from disproportionation of accumulated fructo-oligosaccharides. As levanase, levansucrase may use levan as substrate and, through a fructosyl-enzyme complex, behave as a hydrolytic enzyme or as a transferase, as demonstrated when glucose and fructose are added as acceptors. These reactions result in a wide variety of oligosaccharides that are also suitable acceptors for fructo-oligosaccharide synthesis. Moreover, we demonstrate that SacB in the presence of levan and glucose, through blastose and sucrose synthesis, results in the same fructooligosaccharides profile as that observed in sucrose reactions. We conclude that SacB has an intrinsic levanase activity that contributes to the final levan profile in reactions with sucrose as substrate.
Nicholson, Wayne L.; McCoy, Lashelle E.; Kerney, Krystal R.; Ming, Douglas W.; Golden, D. C.; Schuerger, Andrew C.
2012-08-01
Because Mars is a primary target for life detection and habitability assessment missions, its exploration is also by necessity a Planetary Protection issue. The recent finding of significant levels of perchlorate (ClO4-) in regolith sampled from the Phoenix landing site raises the question of its potential biotoxicity to putative indigenous martian life, microbial forward contaminants from Earth, or future human visitors. To address this issue, an analogue regolith was constructed based on regolith chemistry data from the Phoenix landing site. A Mars Aqueous Regolith Extract (MARE) was prepared from the Phoenix analogue regolith and analyzed by ion chromatography. The MARE contained (mg/L) the cations Na+ (1411 ± 181), Mg2+ (1051 ± 160), Ca2+ (832 ± 125), and K+ (261 ± 29), and the anions SO42-(5911±993), ClO4-(5316±1767), Cl(171±25) and F- (2.0 ± 0.4). Nitrogen-containing species NO3-(773±113) and NO2-(6.9±2.3) were also present as a result of regolith preparation procedures, but their relevance to Mars is at present unknown. The MARE was tested for potential toxic effects on two model spacecraft contaminants, the spore-forming bacteria Bacillus subtilis strain 168 and Bacillus pumilus strain SAFR-032. In B. subtilis, spore germination and initial vegetative growth (up to ˜5 h) was not inhibited in a rich complex medium prepared with the MARE, but growth after 5 h was significantly suppressed in medium prepared using the MARE. Both B. subtilis and B. pumilus exhibited significantly higher rates of spore germination and growth in the MARE vs. DW with no additions (likely due to endogenous spore nutrients), but germination and growth was further stimulated by addition of glucose and a combination of buffered inorganic salts (K2HPO4, KH2PO4, (NH4)2SO4, and MgSO4). The data indicate that the aqueous environment in the regolith from the Phoenix landing site containing high levels of perchlorate does not pose a significant barrier to growth of putative
Increased chemical weathering during the deglacial to mid-Holocene summer monsoon intensification
Digital Repository Service at National Institute of Oceanography (India)
Miriyala, P.; Sukumaran, N.P.; Nath, B.N.; Ramamurty, P.B.; Sijinkumar, A.V.; Vijayagopal, B.; Ramaswamy, V.; Sebastian, T.
by Myanmar Rivers. Figure 2. Downcore variations of (a) ε Nd of SK168 of Alcock seamount (this study - with 2sd error bars) and MD169 of Sewell seamount12 in the Central Andaman Trough (CAT); (b) 87Sr/86Sr of SK168 (this study); the 2sd errors of Sr... in the Central Andaman basin. The isotopic data of core SK168 (this work - northern half of the Central Andaman Trough - CAT) exhibits a narrow range of Nd isotopes (ε Nd − 11.24 to − 9.24; average − 10.15 ± 0.46) (Fig. 3) which fall very close to other...
Berger, K L; Scherer, J; Ranga, M; Sha, N; Stern, J O; Quinson, A-M; Kukolj, G
2015-10-01
Analysis of data pooled from multiple phase 2 (SILEN-C1 to 3) and phase 3 studies (STARTVerso1 to 4) of the hepatitis C virus (HCV) nonstructural protein 3/4A (NS3/4A) protease inhibitor faldaprevir plus pegylated interferon alpha/ribavirin (PR) provides a comprehensive evaluation of baseline and treatment-emergent NS3/4A amino acid variants among HCV genotype-1 (GT-1)-infected patients. Pooled analyses of GT-1a and GT-1b NS3 population-based pretreatment sequences (n = 3,124) showed that faldaprevir resistance-associated variants (RAVs) at NS3 R155 and D168 were rare (<1%). No single, noncanonical NS3 protease or NS4A cofactor baseline polymorphism was associated with a reduced sustained virologic response (SVR) to faldaprevir plus PR, including Q80K. The GT-1b NS3 helicase polymorphism T344I was associated with reduced SVR to faldaprevir plus PR (P < 0.0001) but was not faldaprevir specific, as reduced SVR was also observed with placebo plus PR. Among patients who did not achieve SVR and had available NS3 population sequences (n = 507 GT-1a; n = 349 GT-1b), 94% of GT-1a and 83% of GT-1b encoded faldaprevir treatment-emergent RAVs. The predominant GT-1a RAV was R155K (88%), whereas GT-1b encoded D168 substitutions (78%) in which D168V was predominant (67%). The novel GT-1b NS3 S61L substitution emerged in 7% of virologic failures as a covariant with D168V, most often among the faldaprevir breakthroughs; S61L in combination with D168V had a minimal impact on faldaprevir susceptibility compared with that for D168V alone (1.5-fold difference in vitro). The median time to loss of D168 RAVs among GT-1b-infected patients who did not have a sustained virologic response at 12 weeks posttreatment (non-SVR12) after virologic failure was 5 months, which was shorter than the 14 months for R155 RAVs among GT-1a-infected non-SVR12 patients, suggesting that D168V is less fit than R155K in the absence of faldaprevir selective pressure. Copyright © 2015, American Society for
Zhang, Junjiao; Zhao, Xiangying; Zhang, Jiaxiang; Zhao, Chen; Liu, Jianjun; Tian, Yanjun; Yang, Liping
2017-09-14
The present work aims to block 2,3-butanediol synthesis in acetoin fermentation of Bacillus subtilis. First, we constructed a recombinant strain BS168D by deleting the 2,3-butanediol dehydrogenase gene bdhA of the B. subtilis168, and there was almost no 2,3-butanediol production in 20 g/L of glucose media. The acetoin yield of BS168D reached 6.61 g/L, which was about 1.5 times higher than that of the control B. subtilis168 (4.47 g/L). Then, when the glucose concentration was increased to 100 g/L, the acetoin yield reached 24.6 g/L, but 2.4 g/L of 2,3-butanediol was detected at the end of fermentation. The analysis of 2,3-butanediol chiral structure indicated that the main 2,3-butanediol production of BS168D was meso-2,3-butanediol, and the bdhA gene was only responsible for (2R,3R)-2,3-butanediol synthesis. Therefore, we speculated that there may exit another pathway relating to the meso-2,3-butanediol synthesis in the B. subtilis. In addition, the results of low oxygen condition fermentation showed that deletion of bdhA gene successfully blocked the reversible transformation between acetoin and 2,3-butanediol and eliminated the effect of dissolved oxygen on the transformation.
Lee, Sang-Hee; Park, Choon-Keun
2015-03-01
The objective of this study was to evaluate the effect of a magnetized extender on sperm membrane damage and development of oocytes in vitro fertilized with liquid storage boar semen. Before semen dilution, extender was flowed through a neodymium magnet (0, 2000, 4000 and 6000G) for 5min and collected semen was preserved for 168h at 18°C. In results, plasma membrane integrity with live sperm was significantly higher in semen treated with extenders magnetized at 4000G than sperm treated with extenders magnetized at 0G during semen preservation for 120-168h (psemen treated with extenders magnetized at 4000 and 6000G compared to 0 and 2000G during semen preservation for 168h (psemen treated with extenders magnetized at 2000G than other groups during semen preservation for 168h. The ability of semen to achieve successful in vitro fertilization was also not significantly different among the groups during preservation. However, when the semen was preserved for 168h, the blastocyst formation rates were significantly higher at 6000G compared to 0 and 2000G (psemen extender could protect the sperm membrane from damage, and improve the ability of rates of in vitro blastocyst development and magnetized semen diluter is beneficial for long liquid preservation of boar semen. Copyright © 2014 Elsevier B.V. All rights reserved.
26 CFR 1.861-9 - Allocation and apportionment of interest expense.
2010-04-01
... characterized on the basis of the fair market value of the taxpayer's pro rata share of assets held by the... remained in effect. (iv) The tax book value of section 168 property shall be determined without regard to... of determining the tax book value of its section 168 property, the taxpayer's depreciation deduction...
Calabi, Luisella; Paleari, Lino; Biondi, Luca; Linati, Laura; De Miranda, Mario; Ghelli, Stefano
2003-09-01
The up-take of Gd(III) complexes of BOPTA, DTPA, DOTA, EDTP, HPDO3A, and DOTP in HRBC has been evaluated by measuring the lanthanide induced shift (LIS) produced by the corresponding dysprosium complexes (DC) on the MAS-NMR resonances of water protons and free sodium ions. These complexes are important in their use as MRI contrast agents (MRI-CA) in diagnostics. 1H and 23Na MAS-NMR spectra of HRBC suspension, collected at 9.395 T, show only one signal due to extra- and intra-cellular water (or sodium). In MAS spectra, the presence of DC in a cellular compartment produces the LIS of only the nuclei (water proton or sodium) in that cellular compartment and this LIS can be related to the DC concentrations (by the experimental curves of LIS vs. DC concentrations) collected in the physiological solution. To obtain correct results about LIS, the use of MAS technique is mandatory, because it guarantees the only the nuclei staying in the same cellular compartment where the LC is present show the LIS. In all the cases considered, the addition of the DC to HRBC (100% hematocrit) produced a shift of only the extra-cellular water (or sodium) signal and the gradient of concentration ( GC) between extra- and intra-cellular compartments resulted greater than 100:1, when calculated by means of sodium signals. These high values of GC are direct proofs that none of the tested dysprosium complexes crosses the HRBC membrane. Since the DC are iso-structural to the gadolinium complexes the corresponding gadolinium ones (MRI-CA) do not cross the HRBC membrane and, consequently, they are not up-taken in HRBC. The GC values calculated by means of water proton signals resulted much lower than those obtained by sodium signals. This proves that the choice of the isotope is a crucial step in order to use this method in the best way. In fact, GC value depends on the lowest detectable LIS which, in turn, depends on the nature of the LC (lanthanide complex) and the observed isotopes.
Directory of Open Access Journals (Sweden)
David Wifling
Full Text Available In contrast to the corresponding mouse and rat orthologs, the human histamine H4 receptor (hH4R shows extraordinarily high constitutive activity. In the extracellular loop (ECL, replacement of F169 by V as in the mouse H4R significantly reduced constitutive activity. Stabilization of the inactive state was even more pronounced for a double mutant, in which, in addition to F169V, S179 in the ligand binding site was replaced by M. To study the role of the FF motif in ECL2, we generated the hH4R-F168A mutant. The receptor was co-expressed in Sf9 insect cells with the G-protein subunits Gαi2 and Gβ1γ2, and the membranes were studied in [3H]histamine binding and functional [35S]GTPγS assays. The potency of various ligands at the hH4R-F168A mutant decreased compared to the wild-type hH4R, for example by 30- and more than 100-fold in case of the H4R agonist UR-PI376 and histamine, respectively. The high constitutive activity of the hH4R was completely lost in the hH4R-F168A mutant, as reflected by neutral antagonism of thioperamide, a full inverse agonist at the wild-type hH4R. By analogy, JNJ7777120 was a partial inverse agonist at the hH4R, but a partial agonist at the hH4R-F168A mutant, again demonstrating the decrease in constitutive activity due to F168A mutation. Thus, F168 was proven to play a key role not only in ligand binding and potency, but also in the high constitutive activity of the hH4R.
Review of monolete-producing Carboniferous-Permian sphenophylls
Czech Academy of Sciences Publication Activity Database
Libertín, M.; Bek, Jiří
2008-01-01
Roč. 2008, č. 2 (2008), s. 168-168 ISSN 0946-8978. [International Palynological Congress /12./ ; International Organisation of Palaeobotany Conference /8./. 30.08.2008-05.09.2008, Bonn] R&D Projects: GA AV ČR IAA300130503 Institutional research plan: CEZ:AV0Z30130516 Keywords : Carboniferous * Permian * sphenophylls Subject RIV: DB - Geology ; Mineralogy
Lifescience Database Archive (English)
Full Text Available tolB OS=Rhizobium leguminosarum bv.... 38 0.042 sp|A8F168|TOLB_RICM5 Protein tolB OS=Rickettsia massiliae (s...PDGARVSFES 309 >sp|A8F168|TOLB_RICM5 Protein tolB OS=Rickettsia massiliae (strain Mtu5) GN=tolB PE=3 SV=1 Le
Radioisotopic synovectomy using ferric hydroxide macroaggregated for chronic arthritis treatment
International Nuclear Information System (INIS)
Lima, Carla Flavia; Campos, Tarcisio P.R.
2002-01-01
Synovectomy radioisotopic is an arthritis treatment used in specific clinical conditions whose main goal is to sterilized the synovia. This treatment has specific and precise indications and it is considered to have an adequate response. The present work presents a modeling of an articulation (joint) based on its real geometric anatomy and chemical constitution. The internal dosimetry is evaluated by the Monte Carlo Code. The majority of the radionuclides were considered in the simulations. The syntheses of the ferric hydroxide macroaggregates with dysprosium and samarium have been prepared (Dy 165 -MHF and Sm 153 -MHF). Obtaining the cintilographic images of rabbits in which Dy 165 -MHF is injected is in progress. Biodistribution studies in addition with the internal dosimetry will certify the dose in the membrane of the synovia. (author)
Detecting Magnetic Monopoles in Spin Ice with NV-magnetometry
Flicker, Felix; Kirschner, Franziska; Yao, Norman; Blundell, Stephen
2017-04-01
Magnetic monopoles, isolated north and south poles, appear not to exist as fundamental particles in our universe. Nevertheless, it has been proposed that they may emerge as quasiparticles in certain materials: the geometrically-frustrated `spin ice' pyrochlores dysprosium and holmium titanate. Despite a great deal of experimental and theoretical work, the smoking gun signature of magnetic monopoles in spin ice remains to be discovered. A promising candidate for the detection of individual magnetic monopoles comes in the form of Nitrogen-Vacancy (NV) defects in diamond, which act as very sensitive probes of vector magnetic fields on the nanometre scale. We present the result of Monte Carlo modeling for the precise signals one would expect to see with nanometre-scale probes such as NV-magnetometers or muon spin rotation.
Radiological Hazard of Spallation Products in Accelerator-Driven System
International Nuclear Information System (INIS)
Saito, M.; Stankovskii, A.; Artisyuk, V.; Korovin, Yu.; Shmelev, A.; Titarenko, Yu.
2002-01-01
The central issue underlying this paper is related to elucidating the hazard of radioactive spallation products that might be an important factor affecting the design option of accelerator-driven systems (ADSs). Hazard analysis based on the concept of Annual Limit on Intake identifies alpha-emitting isotopes of rare earths (REs) (dysprosium, gadolinium, and samarium) as the dominant contributors to the overall toxicity of traditional (W, Pb, Pb-Bi) targets. The matter is addressed from several points of view: code validation to simulate their yields, choice of material for the neutron producing targets, and challenging the beam type. The paper quantitatively determines the domain in which the toxicity of REs exceeds that of polonium activation products broadly discussed now in connection with advertising lead-bismuth technology for the needs of ADSs
Xing, P; Chen, G F R; Zhao, X; Ng, D K T; Tan, M C; Tan, D T H
2017-08-22
Ring resonators on silicon rich nitride for potential use as rare-earth doped amplifiers pumped at 1310 nm with amplification at telecommunications-band are designed and characterized. The ring resonators are fabricated on 300 nm and 400 nm silicon rich nitride films and characterized at both 1310 nm and 1550 nm. We demonstrate ring resonators exhibiting similar quality factors exceeding 10,000 simultaneously at 1310 nm and 1550 nm. A Dysprosium-Erbium material system exhibiting photoluminescence at 1510 nm when pumped at 1310 nm is experimentally demonstrated. When used together with Dy-Er co-doped particles, these resonators with similar quality factors at 1310 nm and 1550 nm may be used for O-band pumped amplifiers for the telecommunications-band.
Dielectric behaviour of (Ba0.77Ca0.23(Ti0.98Dy0.02O3 ceramics
Directory of Open Access Journals (Sweden)
Abdul Moquim
2015-06-01
Full Text Available In this study, BaTiO3 is modified with Ca2+ and in addition doped with Dy3+ at the B site lattice. The main idea is to search for new lead-free ferroelectric material and improve their properties. For this purpose, the barium calcium titanate (BCT as a host and the rare earth element Dy3+ as an activator were used to fabricate a multifunctional material. The obtained ceramics was found to be homogeneous, dense and a single phase material with no evidence of secondary phases. The dielectric study showed that TC increases with the addition of dopants and the obtained ceramics behaves like a relaxor ferroelectric. Some important structural parameters and dielectric properties of dysprosium modified barium (calcium titanate ceramics are presented.
Shell model Monte Carlo investigation of rare earth nuclei
International Nuclear Information System (INIS)
White, J. A.; Koonin, S. E.; Dean, D. J.
2000-01-01
We utilize the shell model Monte Carlo method to study the structure of rare earth nuclei. This work demonstrates the first systematic full oscillator shell with intruder calculations in such heavy nuclei. Exact solutions of a pairing plus quadrupole Hamiltonian are compared with the static path approximation in several dysprosium isotopes from A=152 to 162, including the odd mass A=153. Some comparisons are also made with Hartree-Fock-Bogoliubov results from Baranger and Kumar. Basic properties of these nuclei at various temperatures and spin are explored. These include energy, deformation, moments of inertia, pairing channel strengths, band crossing, and evolution of shell model occupation numbers. Exact level densities are also calculated and, in the case of 162 Dy, compared with experimental data. (c) 2000 The American Physical Society
Directory of Open Access Journals (Sweden)
Hideo Honma
2012-10-01
Full Text Available (1 The photo-induced solubility and positive-tone direct photo-patterning of iron, copper and lanthanides chelated with 4-(2-nitrobenzyloxycarbonylcatechol (NBOC or 4-(6-nitroveratryloxycarbonylcatechol (NVOC was investigated. Photo-patterning of iron, copper, cerium, samarium, europium, terbium, dysprosium, holmium, erbium and lutetium complexes was accomplished. Continuous films were formed by the pyrolysis of metal complex films at 500 °C. (2 Based on the difference in the photo-reaction excitation wavelength profile of NBOC and NVOC complexes, a short and simple method for simultaneous micro-patterning of two independent films on each side of a transparent glass substrate was developed. Using the developed procedure, indium tin oxide and/or titanium oxide films were formed on each side of a quartz substrate without use of resist or etching.
Biological fabrication of cellulose fibers with tailored properties
Natalio, Filipe; Fuchs, Regina; Cohen, Sidney R.; Leitus, Gregory; Fritz-Popovski, Gerhard; Paris, Oskar; Kappl, Michael; Butt, Hans-Jürgen
2017-09-01
Cotton is a promising basis for wearable smart textiles. Current approaches that rely on fiber coatings suffer from function loss during wear. We present an approach that allows biological incorporation of exogenous molecules into cotton fibers to tailor the material’s functionality. In vitro model cultures of upland cotton (Gossypium hirsutum) are incubated with 6-carboxyfluorescein-glucose and dysprosium-1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid-glucose, where the glucose moiety acts as a carrier capable of traveling from the vascular connection to the outermost cell layer of the ovule epidermis, becoming incorporated into the cellulose fibers. This yields fibers with unnatural properties such as fluorescence or magnetism. Combining biological systems with the appropriate molecular design offers numerous possibilities to grow functional composite materials and implements a material-farming concept.
Czech Academy of Sciences Publication Activity Database
Šlancarová, Jana; Vrba, Pavel; Plátek, Michal; Zapletal, Michal; Spitzer, Lukáš; Konvička, Martin
2015-01-01
Roč. 49, 29-30 (2015), s. 1825-1848 ISSN 0022-2933 R&D Projects: GA ČR GAP505/10/2167 Grant - others:GA JU(CZ) 04-168/2013/P; MŠMT(CZ) 168/2013/P Institutional support: RVO:60077344 Keywords : butterfly demography * dispersal * oviposition Subject RIV: EH - Ecology, Behaviour Impact factor: 1.010, year: 2015
Kunstneren mellem kald og afkald
DEFF Research Database (Denmark)
Sapiro, Gisèle
2008-01-01
Oversættelse af artiklen "La Vocation artistique entre don et don de soi" fra Actes de la recherche en sciences sociales, nr. 168, juni 2007, s. 4-11......Oversættelse af artiklen "La Vocation artistique entre don et don de soi" fra Actes de la recherche en sciences sociales, nr. 168, juni 2007, s. 4-11...
Czech Academy of Sciences Publication Activity Database
Tomková, V.; Ovčačík, F.; Vlček, J.; Ovčačíková, H.; Topinková, M.; Vavro, M.; Martinec, Petr
2012-01-01
Roč. 56, č. 2 (2012), s. 168-176 ISSN 0862-5468 R&D Projects: GA ČR GA106/09/0588 Institutional support: RVO:68145535 Keywords : alkali-activated materials * blast furnace slag * mechanical activation * fly ash Subject RIV: DD - Geochemistry Impact factor: 0.418, year: 2012 http://www.ceramics-silikaty.cz/2012/pdf/2012_02_168.pdf
Nishito, Yukari; Osana, Yasunori; Hachiya, Tsuyoshi; Popendorf, Kris; Toyoda, Atsushi; Fujiyama, Asao; Itaya, Mitsuhiro; Sakakibara, Yasubumi
2010-04-16
Bacillus subtilis natto is closely related to the laboratory standard strain B. subtilis Marburg 168, and functions as a starter for the production of the traditional Japanese food "natto" made from soybeans. Although re-sequencing whole genomes of several laboratory domesticated B. subtilis 168 derivatives has already been attempted using short read sequencing data, the assembly of the whole genome sequence of a closely related strain, B. subtilis natto, from very short read data is more challenging, particularly with our aim to assemble one fully connected scaffold from short reads around 35 bp in length. We applied a comparative genome assembly method, which combines de novo assembly and reference guided assembly, to one of the B. subtilis natto strains. We successfully assembled 28 scaffolds and managed to avoid substantial fragmentation. Completion of the assembly through long PCR experiments resulted in one connected scaffold for B. subtilis natto. Based on the assembled genome sequence, our orthologous gene analysis between natto BEST195 and Marburg 168 revealed that 82.4% of 4375 predicted genes in BEST195 are one-to-one orthologous to genes in 168, with two genes in-paralog, 3.2% are deleted in 168, 14.3% are inserted in BEST195, and 5.9% of genes present in 168 are deleted in BEST195. The natto genome contains the same alleles in the promoter region of degQ and the coding region of swrAA as the wild strain, RO-FF-1. These are specific for gamma-PGA production ability, which is related to natto production. Further, the B. subtilis natto strain completely lacked a polyketide synthesis operon, disrupted the plipastatin production operon, and possesses previously unidentified transposases. The determination of the whole genome sequence of Bacillus subtilis natto provided detailed analyses of a set of genes related to natto production, demonstrating the number and locations of insertion sequences that B. subtilis natto harbors but B. subtilis 168 lacks
Whole genome assembly of a natto production strain Bacillus subtilis natto from very short read data
Directory of Open Access Journals (Sweden)
Fujiyama Asao
2010-04-01
Full Text Available Abstract Background Bacillus subtilis natto is closely related to the laboratory standard strain B. subtilis Marburg 168, and functions as a starter for the production of the traditional Japanese food "natto" made from soybeans. Although re-sequencing whole genomes of several laboratory domesticated B. subtilis 168 derivatives has already been attempted using short read sequencing data, the assembly of the whole genome sequence of a closely related strain, B. subtilis natto, from very short read data is more challenging, particularly with our aim to assemble one fully connected scaffold from short reads around 35 bp in length. Results We applied a comparative genome assembly method, which combines de novo assembly and reference guided assembly, to one of the B. subtilis natto strains. We successfully assembled 28 scaffolds and managed to avoid substantial fragmentation. Completion of the assembly through long PCR experiments resulted in one connected scaffold for B. subtilis natto. Based on the assembled genome sequence, our orthologous gene analysis between natto BEST195 and Marburg 168 revealed that 82.4% of 4375 predicted genes in BEST195 are one-to-one orthologous to genes in 168, with two genes in-paralog, 3.2% are deleted in 168, 14.3% are inserted in BEST195, and 5.9% of genes present in 168 are deleted in BEST195. The natto genome contains the same alleles in the promoter region of degQ and the coding region of swrAA as the wild strain, RO-FF-1. These are specific for γ-PGA production ability, which is related to natto production. Further, the B. subtilis natto strain completely lacked a polyketide synthesis operon, disrupted the plipastatin production operon, and possesses previously unidentified transposases. Conclusions The determination of the whole genome sequence of Bacillus subtilis natto provided detailed analyses of a set of genes related to natto production, demonstrating the number and locations of insertion sequences that B
ORF Alignment: NC_000964 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available NC_000964 gi|16079742 >1chkA 2 232 35 273 9e-71 ... ref|NP_390566.1| chitosanase [Bac...illus subtilis subsp. subtilis str. 168] ... emb|CAB14630.1| chitosanase [Bacillus subtilis subsp. ... ... ... subtilis str. 168] emb|CAA63455.1| chitosanase precursor ... [Bacillus subtilis] sp|O07921|C...HIS_BACSU Chitosanase ... precursor gb|AAB80882.1| chitosanase precursor [
International Nuclear Information System (INIS)
Kunz, P.F.
1976-01-01
The problems of data analysis with hardware processors are reviewed and a description is given of a programmable processor. This processor, the 168/E, has been designed for use in the LASS multi-processor system; it has an execution speed comparable to the IBM 370/168 and uses the subset of IBM 370 instructions appropriate to the LASS analysis task. (Auth.)
Virulence of viral haemorrhagic septicaemia virus (VHSV) genotype III in rainbow trout
DEFF Research Database (Denmark)
Ito, Takafumi; Kurita, Jun; Mori, Koh-Ichiro
2016-01-01
with the genotype III VHSV isolate 4p168 for 1 and 6 h. The viral titre in organs from fish challenged with NO-2007-50-385 for 6 h increased more rapidly than those exposed for 1 h. By in vitro studies it was demonstrated that the final titres of VHSV DK-3592B (GI), NO-2007-50-385 and 4p168 inoculated on EPC cells...... were very similar, whereas when inoculated on the rainbow trout cell line RTG-2 the titre of the non-virulent 4p168 isolate was 3-4 logs below the two other VHSV isolates. Based on a comparative analysis of the entire genome of the genotype III isolates, we suggest that substitutions of amino acids...
International Nuclear Information System (INIS)
Zolotarev, K.I.
2010-11-01
Evaluations of cross sections and their associated covariance matrices have been carried out for five dosimetry reactions: excitation functions were re-evaluated for the 89 Y(n,2n) 88 Y, 93 Nb(n,2n) 92 mNb and 169 Tm(n,2n) 168 Tm reactions over the neutron energy range from threshold up to 40 MeV; excitation functions were re-evaluated for the 59 Co(n,3n) 57 Co and 209 Bi(n,3n) 207 Bi reactions over the neutron energy range from threshold to 85 and 45 MeV, respectively. Uncertainties in the cross sections for all of those reactions were also derived in the form of relative covariance matrices. Benchmark calculations performed for 235 U thermal fission and 252 Cf spontaneous fission neutron spectra show that the integral cross sections calculated from the newly evaluated excitation functions exhibit improved agreement with related experimental data when compared with the equivalent data from the IRDF-2002 library. (author)
Martinez, Ana Maria; Støre, Anne; Osen, Karen Sende
2018-04-01
Electrolytic production of light rare earth elements and alloys takes place in a fluoride-based electrolyte using rare earth oxides as raw material. The optimization of this method, mainly in terms of the energy efficiency and environmental impact control, is rather challenging. Anode effects, evolution of fluorine-containing compounds, and side cathode reactions could largely be minimized by a good control of the amount of rare earth oxide species dissolved in the fluoride-based electrolyte and their dissolution rate. The oxide content of the fluoride melts REF3-LiF (RE = Nd, Dy) at different compositions and temperatures were experimentally determined by carbothermal analysis of melt samples. The highest solubility values of oxide species, added as Dy2O3 and Dy2(CO3)3, were obtained to be of ca. 3 wt pct (expressed as Dy2O3) in the case of the equimolar DyF3-LiF melt at 1323 K (1050 °C). The oxide saturation values increased with the amount of REF3 present in the molten bath and the working temperature.
Cerium: an unlikely replacement of dysprosium in high performance Nd-Fe-B permanent magnets.
Pathak, Arjun K; Khan, Mahmud; Gschneidner, Karl A; McCallum, Ralph W; Zhou, Lin; Sun, Kewei; Dennis, Kevin W; Zhou, Chen; Pinkerton, Frederick E; Kramer, Matthew J; Pecharsky, Vitalij K
2015-04-24
Replacement of Dy and substitution of Nd in NdFeB-based permanent magnets by Ce, the most abundant and lowest cost rare earth element, is important because Dy and Nd are costly and critical rare earth elements. The Ce, Co co-doped alloys have excellent high-temperature magnetic properties with an intrinsic coercivity being the highest known for T ≥ 453 K. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Adsorption of dysprosium on the graphite (0001) surface: Nucleation and growth at 300 K
International Nuclear Information System (INIS)
Kwolek, Emma J.; Lii-Rosales, Ann; Lei, Huaping; Wang, Cai-Zhuang; Tringides, Michael C.; Evans, James W.; Wallingford, Mark; Zhou, Yinghui; Thiel, Patricia A.
2016-01-01
We have studied nucleation and growth of Dy islands on the basal plane of graphite at 300 K using scanning tunneling microscopy, density functional theory (DFT) in a form that includes van der Waals interactions, and analytic theory. The interaction of atomic Dy with graphite is strong, while the diffusion barrier is small. Experiment shows that at 300 K, the density of nucleated islands is close to the value predicted for homogeneous nucleation, using critical nucleus size of 1 and the DFT-derived diffusion barrier. Homogeneous nucleation is also supported by the monomodal shape of the island size distributions. Comparison with the published island density of Dy on graphene shows that the value is about two orders of magnitude smaller on graphite, which can be attributed to more effective charge screening in graphite. The base of each island is 3 atomic layers high and atomically ordered, forming a coincidence lattice with the graphite. Islands resist coalescence, probably due to multiple rotational orientations associated with the coincidence lattice. Upper levels grow as discernible single-atom layers. Analysis of the level populations reveals significant downward interlayer transport, which facilitates growth of the base. This island shape is metastable, since more compact three-dimensional islands form at elevated growth temperature.
Adsorption of dysprosium on the graphite (0001) surface: Nucleation and growth at 300 K
Energy Technology Data Exchange (ETDEWEB)
Kwolek, Emma J.; Lii-Rosales, Ann [The Ames Laboratory, Ames, Iowa 50011 (United States); Department of Chemistry, Iowa State University, Ames, Iowa 50011 (United States); Lei, Huaping; Wang, Cai-Zhuang; Tringides, Michael C.; Evans, James W. [The Ames Laboratory, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States); Wallingford, Mark; Zhou, Yinghui [The Ames Laboratory, Ames, Iowa 50011 (United States); Thiel, Patricia A., E-mail: pthiel@iastate.edu [The Ames Laboratory, Ames, Iowa 50011 (United States); Department of Chemistry, Iowa State University, Ames, Iowa 50011 (United States); Department of Materials Science and Engineering, Iowa State University, Ames, Iowa 50011 (United States)
2016-12-07
We have studied nucleation and growth of Dy islands on the basal plane of graphite at 300 K using scanning tunneling microscopy, density functional theory (DFT) in a form that includes van der Waals interactions, and analytic theory. The interaction of atomic Dy with graphite is strong, while the diffusion barrier is small. Experiment shows that at 300 K, the density of nucleated islands is close to the value predicted for homogeneous nucleation, using critical nucleus size of 1 and the DFT-derived diffusion barrier. Homogeneous nucleation is also supported by the monomodal shape of the island size distributions. Comparison with the published island density of Dy on graphene shows that the value is about two orders of magnitude smaller on graphite, which can be attributed to more effective charge screening in graphite. The base of each island is 3 atomic layers high and atomically ordered, forming a coincidence lattice with the graphite. Islands resist coalescence, probably due to multiple rotational orientations associated with the coincidence lattice. Upper levels grow as discernible single-atom layers. Analysis of the level populations reveals significant downward interlayer transport, which facilitates growth of the base. This island shape is metastable, since more compact three-dimensional islands form at elevated growth temperature.
White- and blue-light-emitting dysprosium(III) and terbium(III)-doped gadolinium titanate phosphors.
Antić, Ž; Kuzman, S; Đorđević, V; Dramićanin, M D; Thundat, T
2017-06-01
Here we report the synthesis and structural, morphological, and photoluminescence analysis of white- and blue-light-emitting Dy 3 + - and Tm 3 + -doped Gd 2 Ti 2 O 7 nanophosphors. Single-phase cubic Gd 2 Ti 2 O 7 nanopowders consist of compact, dense aggregates of nanoparticles with an average size of ~25 nm for Dy 3 + -doped and ~50 nm for Tm 3 + -doped samples. The photoluminescence results indicated that ultraviolet (UV) light excitation of the Dy 3 + -doped sample resulted in direct generation of white light, while a dominant yellow emission was obtained under blue-light excitation. Intense blue light was obtained for Tm 3 + -doped Gd 2 Ti 2 O 7 under UV excitation suggesting that this material could be used as a blue phosphor. Copyright © 2016 John Wiley & Sons, Ltd.
Energy Technology Data Exchange (ETDEWEB)
Manhas, B S; Trikha, A K; Singh, H; Chander, M
1983-11-01
Complexes of the general formulae M/sub 2/Cl/sub 6/(L)/sub 3/.C/sub 2/H/sub 5/OH and M/sub 2/(NO/sub 3/)/sub 6/(L)/sub 2/.CH/sub 3/OH have been synthesised by the reactions of chlorides and nitrates of La(III), Ce(III), Sm(III) and Dy(III) with 2-methylpiperidine, 3-methylpiperidine and 4-methylpiperidine. These complexes have been characterised on the basis of their elemental analysis, and IR and electronic reflectance spectra. IR spectral data indicate the presence of coordinated ethanol and methanol molecules and bidentate nitrate groups. Coordination numbers of the metal ions vary from 5 to 8. 19 refs.
Investigations of the Propagation of Plant Pollen by an Indicator Activation Method
Energy Technology Data Exchange (ETDEWEB)
Fendrik, I.; Glubrecht, H. [Technische Hochschule, Hanover (Germany)
1967-10-15
The study of the propagation of plant pollen is of special interest in ecology and plant breeding. Generally, radioactive labelling cannot be applied for this purpose since radioactive contamination of the materials under investigation cannot be tolerated. Instead, labelling can be performed by the use of an indicator element that has a high cross-section for neutron activation. This substance is introduced into the plant under consideration. The flying pollen is caught by polyethylene foils by means of electrostatic attraction. The foils with the pollen are irradiated in a nuclear reactor with a suitable flux of thermal neutrons. The labelled pollen grains can be detected and counted by autoradiography or by direct measurement. The method has proved satisfactory for pines and sugar beet. Indicator elements used for detection by neutron activation were manganese and dysprosium. (author)
Preparation and structural characterization of the thermoluminescent material CaSO4: Dy
International Nuclear Information System (INIS)
Sanchez R, A.; Azorin, J.; Gonzalez M, P.R.; Rivera, T.
2005-01-01
The grade of crystallinity of a material is important so that the one is presented the thermoluminescence phenomenon; for what is necessary to study those structural characteristic of a TL material and to correlate them with its TL response when being irradiated with ionizing radiation. The calcium sulfate activated with Dysprosium (CaSO 4 : Dy) it is a material that has demonstrated its efficiency in the dosimetry of the ionizing radiation for the thermoluminescence method. In this work the structural characterization of this prepared material for the recrystallization method by means of the evaporation of the solvent and their relationship with their TL response is presented. The results showed that the best material to be used in thermoluminescent dosimetry presents a crystalline structure in orthorhombic phase and a particle size in the interval of 80 μm to 200 μm. (Author)
Coercivity enhancement in Nd-Fe-B sintered permanent magnet by Dy nanoparticles doping
Energy Technology Data Exchange (ETDEWEB)
Liu, W.Q., E-mail: liuweiqiang77@hotmail.co [College of Materials Science and Engineering, Beijing University of Technology, Beijing 100124 (China); Sun, H. [College of Materials Science and Engineering, Beijing University of Technology, Beijing 100124 (China); Yi, X.F. [Anhui Earth-panda Advance Magnetic Material Co., Ltd., Anhui 231500 (China); Liu, X.C.; Zhang, D.T. [College of Materials Science and Engineering, Beijing University of Technology, Beijing 100124 (China); Yue, M., E-mail: yueming@bjut.edu.c [College of Materials Science and Engineering, Beijing University of Technology, Beijing 100124 (China); Zhang, J.X. [College of Materials Science and Engineering, Beijing University of Technology, Beijing 100124 (China)
2010-07-02
Nd-Fe-B permanent magnets with a small amount of Dysprosium (Dy) nanoparticles doping were prepared by conventional sintered method, and the microstructure and magnetic properties of the magnets were studied. Investigation shows that the coercivity rises gradually, while the remanence decreases simultaneously with increased Dy doping amount. As a result, the magnet with 1.5 wt.% Dy exhibits optimal magnetic properties. Further investigation presumed that Dy is enriched as (Nd, Dy){sub 2}Fe{sub 14}B phase in the surface region of the Nd{sub 2}Fe{sub 14}B matrix grains indicated by the enhancement of the magneto-crystalline anisotropy field of the Nd{sub 2}Fe{sub 14}B phase. As a result, the magnet doped with a small amount of Dy nanoparticles possesses remarkably enhanced coercivity without sacrificing its magnetization noticeably.
Analyses of crystal field and exchange interaction of Dy3Ga5O12 under extreme conditions
International Nuclear Information System (INIS)
Wang Wei; Qi Xin; Yue Yuan
2011-01-01
This paper theoretically investigates the effects of crystal field and exchange interaction field on magnetic properties in dysprosium gallium garnet under extreme conditions (low temperatures and high magnetic fields) based on quantum theory. Here, five sets of crystal field parameters are discussed and compared. It demonstrates that, only considering the crystal field effect, the experiments can not be successfully explained. Thus, referring to the molecular field theory, an effective exchange field associated with the Dy—Dy exchange interaction is further taken into account. Under special consideration of crystal field and the exchange interaction field, it obtains an excellent agreement between the theoretical results and experiments, and further confirms that the exchange interaction field between rare-earth ions has great importance to magnetic properties in paramagnetic rare-earth gallium garnets. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Energy Technology Data Exchange (ETDEWEB)
Sanchez R, A.; Azorin, J. [UAM-I, 09340 Mexico D.F. (Mexico); Gonzalez M, P.R. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico); Rivera, T. [CICATA-IPN, Legaria 694, 11500 Mexico D.F. (Mexico)
2005-07-01
The grade of crystallinity of a material is important so that the one is presented the thermoluminescence phenomenon; for what is necessary to study those structural characteristic of a TL material and to correlate them with its TL response when being irradiated with ionizing radiation. The calcium sulfate activated with Dysprosium (CaSO{sub 4}: Dy) it is a material that has demonstrated its efficiency in the dosimetry of the ionizing radiation for the thermoluminescence method. In this work the structural characterization of this prepared material for the recrystallization method by means of the evaporation of the solvent and their relationship with their TL response is presented. The results showed that the best material to be used in thermoluminescent dosimetry presents a crystalline structure in orthorhombic phase and a particle size in the interval of 80 {mu}m to 200 {mu}m. (Author)
Rare earth contrast agents in hepatic computed tomography
International Nuclear Information System (INIS)
Seltzer, S.E.
1981-01-01
Materials with atomic numbers ranging from the upper 50's to the lower 70's proved to have the highest computed tomography (CT) numbers when scanned at 120 kVp. Therefore, to produce particulate contrast agents possessing maximum radiopacity, suspensions of cerium oxide, gadolinium, and dysprosium oxides as well as silver iodide colloid were prepared. All 4 agents were selectively concentrated in the reticulo-endothelial system. The agents produced greater and longer opacification of the normal liver and larger liver-to-tumor differences in rabbits with hepatic tumors than did equivalent amounts of standard intravenous iodinated agents. Lesions as small as 5 mm were visible with CT. These materials have favorable characteristics as hepatic contrast agents, but their toxicity (LD 50 in mice = 5.4 g/kg for Ce) and long-term retention may limit clinical use. (Auth.)