WorldWideScience

Sample records for duplicate genes involved

  1. Temporal pattern of loss/persistence of duplicate genes involved in signal transduction and metabolic pathways after teleost-specific genome duplication

    Directory of Open Access Journals (Sweden)

    Sato Yukuto

    2009-06-01

    Full Text Available Abstract Background Recent genomic studies have revealed a teleost-specific third-round whole genome duplication (3R-WGD event occurred in a common ancestor of teleost fishes. However, it is unclear how the genes duplicated in this event were lost or persisted during the diversification of teleosts, and therefore, how many of the duplicated genes contribute to the genetic differences among teleosts. This subject is also important for understanding the process of vertebrate evolution through WGD events. We applied a comparative evolutionary approach to this question by focusing on the genes involved in long-term potentiation, taste and olfactory transduction, and the tricarboxylic acid cycle, based on the whole genome sequences of four teleosts; zebrafish, medaka, stickleback, and green spotted puffer fish. Results We applied a state-of-the-art method of maximum-likelihood phylogenetic inference and conserved synteny analyses to each of 130 genes involved in the above biological systems of human. These analyses identified 116 orthologous gene groups between teleosts and tetrapods, and 45 pairs of 3R-WGD-derived duplicate genes among them. This suggests that more than half [(45×2/(116+45] = 56.5% of the loci, probably more than ten thousand genes, present in a common ancestor of the four teleosts were still duplicated after the 3R-WGD. The estimated temporal pattern of gene loss suggested that, after the 3R-WGD, many (71/116 of the duplicated genes were rapidly lost during the initial 75 million years (MY, whereas on average more than half (27.3/45 of the duplicated genes remaining in the ancestor of the four teleosts (45/116 have persisted for about 275 MY. The 3R-WGD-derived duplicates that have persisted for a long evolutionary periods of time had significantly larger number of interacting partners and longer length of protein coding sequence, implying that they tend to be more multifunctional than the singletons after the 3R-WGD. Conclusion

  2. A Duplicated, Truncated amh Gene Is Involved in Male Sex Determination in an Old World Silverside

    Directory of Open Access Journals (Sweden)

    Dilip Kumar Bej

    2017-08-01

    Full Text Available A master sex-determining gene, the Y chromosome-linked anti-Müllerian hormone (amhy gene, has been described in two New World atheriniform species but little is known on the distribution, evolution, and function(s of this gene in other Atheriniformes. Interestingly, amhy has been found to coexist with temperature-dependent sex determination (TSD, providing a unique opportunity to explore the interplay between genotypic and environmental sex determination. In this study, the search for an amhy homolog was extended to an Old World atheriniform, the cobaltcap silverside Hypoatherina tsurugae (Atherinidae. The full sequences, including the coding and noncoding regions, of the autosomal amh (amha and a putative amhy were obtained. The deduced Amha and Amhy proteins comprised 511 and 340 amino acids (aa, respectively. PCR analysis with genomic DNA from wild adults and from laboratory-reared juveniles revealed a high, but not complete association of ∼95% between amhy and maleness. The spatiotemporal expression of amhy and amha during gonadal sex differentiation was analyzed by qRT-PCR and in situ hybridization (ISH. amhy transcription (in amhy-positive larvae started before and peaked during histological differentiation of the gonads whereas amha was negligible during the same period in both genotypes. These results demonstrate that the amhy, although with some structural differences in relation to the amhy of some New World atheriniforms, is strongly associated with maleness and probably important for testicular development in this Old World atheriniform. Thus, amhy is a candidate sex determination gene in cobaltcap silverside and it will be key to scrutinize the mechanism of sex determination in this species.

  3. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

  4. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  5. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Molecular mechanisms of gene duplication. Duplicated genes may be produced by unequal crossing over, retrotransposition, duplicated DNA transposition and polyploidization. Unequal crossing over. Unequal crossing over produces tandem repeated sequences,. i.e. continuous repeats of DNA sequence. Depending on.

  6. Repositioning-dependent fate of duplicate genes.

    Science.gov (United States)

    Rodin, Sergei N; Parkhomchuk, Dmitri V; Rodin, Andrei S; Holmquist, Gerald P; Riggs, Arthur D

    2005-09-01

    Gene duplication is the main source of evolutionary novelties. However, the problem with duplicates is that the purifying selection overlooks deleterious mutations in the redundant sequence, which therefore, instead of gaining a new function, often degrades into a functionless pseudogene. This risk of functional loss instead of gain is much higher for small populations of higher organisms with a slow and complex development. We propose that it is the epigenetic tissue/stage-complementary silencing of duplicates that makes them exposable to the purifying selection, thus saving them from pseudogenization and opening the way towards new function(s). Our genome-wide analyses of gene duplicates in several eukaryotic species combined with the phylogenetic comparison of vertebrate alpha- and beta-globin gene clusters strongly support this epigenetic complementation (EC) model. The distinctive condition for a new duplicate to survive by the EC mechanism seems to be its repositioning to an ectopic site, which is accompanied by changes in the rate and direction of mutagenesis. The most distinguished in this respect is the human genome. In this review, we extend and discuss the data on the EC- and repositioning-dependent fate of gene duplicates with the special emphasis on the problem of detecting brief postduplication period of adaptive evolution driven by positive selection. Accordingly, we propose a new CpG-focused measure of selection that is insensitive to translocation-caused biases in mutagenesis.

  7. A 21 Nucleotide Duplication on the α1- and α2-Globin Genes Involves a Variety of Hypochromic Microcytic Anemias, From Mild to Hb H Disease.

    Science.gov (United States)

    Farashi, Samaneh; Faramarzi Garous, Negin; Zeinali, Fatemeh; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Najmabadi, Hossein; Azarkeivan, Azita; Tamaddoni, Ahmad

    2015-01-01

    α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects in the α-globin gene cluster can result in α-thal that may develop into a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. Loss of one functional α gene, indicated as heterozygous α(+)-thal, shows minor hematological abnormalities. Homozygosity for α(+)- or heterozygosity for α(0)-thal have more severe hematological abnormalities due to a markedly reduced α chain output. At the molecular level, the absence of three α-globin genes resulting from the compound heterozygous state for α(0)- and α(+)-thal, lead to Hb H disease. Here we present a 21 nucleotide (nt) duplication consisting of six amino acids and 3 bp of intronic sequence at the exon-intron boundary, in both the α-globin genes, detected by direct DNA sequencing. This duplication was identified in three patients originating from two different Iranian ethnic groups and one Arab during more than 12 years. The clinical presentation of these individuals varies widely from a mild asymptomatic anemia (heterozygote in α1-globin gene) to a severely anemic state, diagnosed as an Hb H individual requiring blood transfusion (duplication on the α2-globin gene in combination with the - -(MED) double α-globin gene deletion). The third individual, who was homozygous for this nt duplication on the α1-globin gene, showed severe hypochromic microcytic anemia and splenomegaly. In the last decade, numerous α-globin mutations have demonstrated the necessity of prenatal diagnosis (PND) for α-thal, and this study has contributed another mutation as important enough that needs to be considered.

  8. Yeast genome duplication was followed by asynchronous differentiation of duplicated genes

    DEFF Research Database (Denmark)

    Langkjær, Rikke Breinhold; Cliften, P.F.; Johnston, M.

    2003-01-01

    Gene redundancy has been observed in yeast, plant and human genomes, and is thought to be a consequence of whole-genome duplications(1-3). Baker's yeast, Saccharomyces cerevisiae, contains several hundred duplicated genes(1). Duplication(s) could have occurred before or after a given speciation....... To understand the evolution of the yeast genome, we analysed orthologues of some of these genes in several related yeast species. On the basis of the inferred phylogeny of each set of genes, we were able to deduce whether the gene duplicated and/or specialized before or after the divergence of two yeast...

  9. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Abstract. Gene duplication is an important mechanism for acquiring new genes and creating genetic novelty in organisms. Many new gene functions have evolved through gene duplication and it has contributed tremendously to the evolution of developmen- tal programmes in various organisms. Gene duplication can result ...

  10. A limited role for gene duplications in the evolution of platypus venom.

    Science.gov (United States)

    Wong, Emily S W; Papenfuss, Anthony T; Whittington, Camilla M; Warren, Wesley C; Belov, Katherine

    2012-01-01

    Gene duplication followed by adaptive selection is believed to be the primary driver of venom evolution. However, to date, no studies have evaluated the importance of gene duplications for venom evolution using a genomic approach. The availability of a sequenced genome and a venom gland transcriptome for the enigmatic platypus provides a unique opportunity to explore the role that gene duplication plays in venom evolution. Here, we identify gene duplication events and correlate them with expressed transcripts in an in-season venom gland. Gene duplicates (1,508) were identified. These duplicated pairs (421), including genes that have undergone multiple rounds of gene duplications, were expressed in the venom gland. The majority of these genes are involved in metabolism and protein synthesis not toxin functions. Twelve secretory genes including serine proteases, metalloproteinases, and protease inhibitors likely to produce symptoms of envenomation such as vasodilation and pain were detected. Only 16 of 107 platypus genes with high similarity to known toxins evolved through gene duplication. Platypus venom C-type natriuretic peptides and nerve growth factor do not possess lineage-specific gene duplicates. Extensive duplications, believed to increase the potency of toxic content and promote toxin diversification, were not found. This is the first study to take a genome-wide approach in order to examine the impact of gene duplication on venom evolution. Our findings support the idea that adaptive selection acts on gene duplicates to drive the independent evolution and functional diversification of similar venom genes in venomous species. However, gene duplications alone do not explain the "venome" of the platypus. Other mechanisms, such as alternative splicing and mutation, may be important in venom innovation.

  11. Faster Evolving Primate Genes Are More Likely to Duplicate.

    Science.gov (United States)

    O'Toole, Áine N; Hurst, Laurence D; McLysaght, Aoife

    2018-01-01

    An attractive and long-standing hypothesis regarding the evolution of genes after duplication posits that the duplication event creates new evolutionary possibilities by releasing a copy of the gene from constraint. Apparent support was found in numerous analyses, particularly, the observation of higher rates of evolution in duplicated as compared with singleton genes. Could it, instead, be that more duplicable genes (owing to mutation, fixation, or retention biases) are intrinsically faster evolving? To uncouple the measurement of rates of evolution from the determination of duplicate or singleton status, we measure the rates of evolution in singleton genes in outgroup primate lineages but classify these genes as to whether they have duplicated or not in a crown group of great apes. We find that rates of evolution are higher in duplicable genes prior to the duplication event. In part this is owing to a negative correlation between coding sequence length and rate of evolution, coupled with a bias toward smaller genes being more duplicable. The effect is masked by difference in expression rate between duplicable genes and singletons. Additionally, in contradiction to the classical assumption, we find no convincing evidence for an increase in dN/dS after duplication, nor for rate asymmetry between duplicates. We conclude that high rates of evolution of duplicated genes are not solely a consequence of the duplication event, but are rather a predictor of duplicability. These results are consistent with a model in which successful gene duplication events in mammals are skewed toward events of minimal phenotypic impact. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ

    2011-12-01

    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  13. Molecular trajectories leading to the alternative fates of duplicate genes.

    Directory of Open Access Journals (Sweden)

    Michael Marotta

    Full Text Available Gene duplication generates extra gene copies in which mutations can accumulate without risking the function of pre-existing genes. Such mutations modify duplicates and contribute to evolutionary novelties. However, the vast majority of duplicates appear to be short-lived and experience duplicate silencing within a few million years. Little is known about the molecular mechanisms leading to these alternative fates. Here we delineate differing molecular trajectories of a relatively recent duplication event between humans and chimpanzees by investigating molecular properties of a single duplicate: DNA sequences, gene expression and promoter activities. The inverted duplication of the Glutathione S-transferase Theta 2 (GSTT2 gene had occurred at least 7 million years ago in the common ancestor of African great apes and is preserved in chimpanzees (Pan troglodytes, whereas a deletion polymorphism is prevalent in humans. The alternative fates are associated with expression divergence between these species, and reduced expression in humans is regulated by silencing mutations that have been propagated between duplicates by gene conversion. In contrast, selective constraint preserved duplicate divergence in chimpanzees. The difference in evolutionary processes left a unique DNA footprint in which dying duplicates are significantly more similar to each other (99.4% than preserved ones. Such molecular trajectories could provide insights for the mechanisms underlying duplicate life and death in extant genomes.

  14. Comparative genomic analysis of duplicated homoeologous regions involved in the resistance of Brassica napus to stem canker

    Directory of Open Access Journals (Sweden)

    Berline eFopa Fomeju

    2015-09-01

    Full Text Available All crop species are current or ancient polyploids. Following whole genome duplication, structural and functional modifications result in differential gene content or regulation in the duplicated regions, which can play a fundamental role in the diversification of genes underlying complex traits. We have investigated this issue in Brassica napus, a species with a highly duplicated genome, with the aim of studying the structural and functional organization of duplicated regions involved in quantitative resistance to stem canker, a disease caused by the fungal pathogen Leptosphaeria maculans. Genome-wide association analysis on two oilseed rape panels confirmed that duplicated regions of ancestral blocks E, J, R, U and W were involved in resistance to stem canker. The structural analysis of the duplicated genomic regions showed a higher gene density on the A genome than on the C genome and a better collinearity between homoeologous regions than paralogous regions, as overall in the whole B. napus genome. The three ancestral sub-genomes were involved in the resistance to stem canker and the fractionation profile of the duplicated regions corresponded to what was expected from results on the B. napus progenitors. About 60% of the genes identified in these duplicated regions were single-copy genes while less than 5% were retained in all the duplicated copies of a given ancestral block. Genes retained in several copies were mainly involved in response to stress, signaling or transcription regulation. Genes with resistance-associated markers were mainly retained in more than two copies. These results suggested that some genes underlying quantitative resistance to stem canker might be duplicated genes. Genes with a hydrolase activity that were retained in one copy or R-like genes might also account for resistance in some regions. Further analyses need to be conducted to indicate to what extent duplicated genes contribute to the expression of the

  15. Epigenetic silencing may aid evolution by gene duplication.

    Science.gov (United States)

    Rodin, Sergei N; Riggs, Arthur D

    2003-06-01

    Gene duplication is commonly regarded as the main evolutionary path toward the gain of a new function. However, even with gene duplication, there is a loss-versus-gain dilemma: most newly born duplicates degrade to pseudogenes, since degenerative mutations are much more frequent than advantageous ones. Thus, something additional seems to be needed to shift the loss versus gain equilibrium toward functional divergence. We suggest that epigenetic silencing of duplicates might play this role in evolution. This study began when we noticed in a previous publication (Lynch M, Conery JS [2000] Science 291:1151-1155) that the frequency of functional young gene duplicates is higher in organisms that have cytosine methylation (H. sapiens, M. musculus, and A. thaliana) than in organisms that do not have methylated genomes (S. cerevisiae, D. melanogaster, and C. elegans). We find that genome data analysis confirms the likelihood of much more efficient functional divergence of gene duplicates in mammals and plants than in yeast, nematode, and fly. We have also extended the classic model of gene duplication, in which newly duplicated genes have exactly the same expression pattern, to the case when they are epigenetically silenced in a tissue- and/or developmental stage-complementary manner. This exposes each of the duplicates to negative selection, thus protecting from "pseudogenization." Our analysis indicates that this kind of silencing (i) enhances evolution of duplicated genes to new functions, particularly in small populations, (ii) is quite consistent with the subfunctionalization model when degenerative but complementary mutations affect different subfunctions of the gene, and (iii) furthermore, may actually cooperate with the DDC (duplication-degeneration-complementation) process.

  16. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

    Science.gov (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

    2011-01-01

    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  17. Circular DNA intermediate in the duplication of Nile tilapia vasa genes.

    Directory of Open Access Journals (Sweden)

    Koji Fujimura

    Full Text Available vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes.

  18. The effect of functional compensation among duplicate genes can ...

    Indian Academy of Sciences (India)

    Gene duplicates have the inherent property of initially being functionally redundant. This means that they can compensate for the effect of deleterious variation occurring at one or more sister sites. Here, I present data bearing on evolutionary theory that illustrates the manner in which any functional adaptation in duplicate ...

  19. Gene duplication in the genome of parasitic Giardia lamblia

    Directory of Open Access Journals (Sweden)

    Flores Roberto

    2010-02-01

    Full Text Available Abstract Background Giardia are a group of widespread intestinal protozoan parasites in a number of vertebrates. Much evidence from G. lamblia indicated they might be the most primitive extant eukaryotes. When and how such a group of the earliest branching unicellular eukaryotes developed the ability to successfully parasitize the latest branching higher eukaryotes (vertebrates is an intriguing question. Gene duplication has long been thought to be the most common mechanism in the production of primary resources for the origin of evolutionary novelties. In order to parse the evolutionary trajectory of Giardia parasitic lifestyle, here we carried out a genome-wide analysis about gene duplication patterns in G. lamblia. Results Although genomic comparison showed that in G. lamblia the contents of many fundamental biologic pathways are simplified and the whole genome is very compact, in our study 40% of its genes were identified as duplicated genes. Evolutionary distance analyses of these duplicated genes indicated two rounds of large scale duplication events had occurred in G. lamblia genome. Functional annotation of them further showed that the majority of recent duplicated genes are VSPs (Variant-specific Surface Proteins, which are essential for the successful parasitic life of Giardia in hosts. Based on evolutionary comparison with their hosts, it was found that the rapid expansion of VSPs in G. lamblia is consistent with the evolutionary radiation of placental mammals. Conclusions Based on the genome-wide analysis of duplicated genes in G. lamblia, we found that gene duplication was essential for the origin and evolution of Giardia parasitic lifestyle. The recent expansion of VSPs uniquely occurring in G. lamblia is consistent with the increment of its hosts. Therefore we proposed a hypothesis that the increment of Giradia hosts might be the driving force for the rapid expansion of VSPs.

  20. Gene duplication and the origins of morphological complexity in pancrustacean eyes, a genomic approach

    Directory of Open Access Journals (Sweden)

    Serb Jeanne M

    2010-04-01

    Full Text Available Abstract Background Duplication and divergence of genes and genetic networks is hypothesized to be a major driver of the evolution of complexity and novel features. Here, we examine the history of genes and genetic networks in the context of eye evolution by using new approaches to understand patterns of gene duplication during the evolution of metazoan genomes. We hypothesize that 1 genes involved in eye development and phototransduction have duplicated and are retained at higher rates in animal clades that possess more distinct types of optical design; and 2 genes with functional relationships were duplicated and lost together, thereby preserving genetic networks. To test these hypotheses, we examine the rates and patterns of gene duplication and loss evident in 19 metazoan genomes, including that of Daphnia pulex - the first completely sequenced crustacean genome. This is of particular interest because the pancrustaceans (hexapods+crustaceans have more optical designs than any other major clade of animals, allowing us to test specifically whether the high amount of disparity in pancrustacean eyes is correlated with a higher rate of duplication and retention of vision genes. Results Using protein predictions from 19 metazoan whole-genome projects, we found all members of 23 gene families known to be involved in eye development or phototransduction and deduced their phylogenetic relationships. This allowed us to estimate the number and timing of gene duplication and loss events in these gene families during animal evolution. When comparing duplication/retention rates of these genes, we found that the rate was significantly higher in pancrustaceans than in either vertebrates or non-pancrustacean protostomes. Comparing patterns of co-duplication across Metazoa showed that while these eye-genes co-duplicate at a significantly higher rate than those within a randomly shuffled matrix, many genes with known functional relationships in model organisms

  1. Novel noncontiguous duplications identified with a comprehensive mutation analysis in the DMD gene by DMD gene-targeted sequencing.

    Science.gov (United States)

    Xu, Yan; Wang, Huanhuan; Xiao, Bing; Wei, Wei; Liu, Yu; Ye, Hui; Ying, Xiaomin; Chen, Yingwei; Liu, Xiaoqing; Ji, Xing; Sun, Yu

    2018-03-01

    Genomic rearrangements, such as intragenic deletions and duplications, are the most prevalent types of mutation in the DMD gene, and DMD mutations underlie Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD). Using multiplex ligation dependent probe amplification (MLPA) and DMD gene-targeted sequencing, we performed a molecular characterization of two cases of complex noncontiguous duplication rearrangements that involved inverted duplications. The breakpoint sequences were analyzed to investigate the mechanisms of the rearrangement. The two cases shared the same duplication events (Dup-nml-Dup/inv), and both involved microhomology and small insertions at the breakpoints. Additionally, in case 1, SNP sequencing results indicated that the de novo duplication mutation arose in the allele that originated from the grandfather. This study has identified a novel type of DMD complex rearrangement and provides insight into the molecular basis of this genomic rearrangement. Copyright © 2017. Published by Elsevier B.V.

  2. Does negative auto-regulation increase gene duplicability?

    Directory of Open Access Journals (Sweden)

    Lercher Martin J

    2009-08-01

    Full Text Available Abstract Background A prerequisite for a duplication to spread through and persist in a given population is retaining expression of both gene copies. Yet changing a gene's dosage is frequently detrimental to fitness. Consequently, dosage-sensitive genes are less likely to duplicate. However, in cases where the level of gene product is controlled, via negative feedback, by its own abundance, an increase in gene copy number can in principle be decoupled from an increase in protein while both copies remain expressed. Using data from the transcriptional networks of E. coli and S. cerevisiae, we test the hypothesis that genes under negative auto-regulation show enhanced duplicability. Results Controlling for several known correlates of duplicability, we find no statistically significant support in either E. coli or S. cerevisiae that transcription factors under negative auto-regulation hold a duplicability advantage over transcription factors with no auto-regulation. Conclusion Based on the analysis of transcriptional networks in E. coli and S. cerevisiae, there is no evidence that negative auto-regulation has contributed, on a genome-wide scale, to the variability in gene family sizes in these species.

  3. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins

    Science.gov (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.

    2014-01-01

    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  4. Reconstruction of ancestral metabolic enzymes reveals molecular mechanisms underlying evolutionary innovation through gene duplication.

    Directory of Open Access Journals (Sweden)

    Karin Voordeckers

    Full Text Available Gene duplications are believed to facilitate evolutionary innovation. However, the mechanisms shaping the fate of duplicated genes remain heavily debated because the molecular processes and evolutionary forces involved are difficult to reconstruct. Here, we study a large family of fungal glucosidase genes that underwent several duplication events. We reconstruct all key ancestral enzymes and show that the very first preduplication enzyme was primarily active on maltose-like substrates, with trace activity for isomaltose-like sugars. Structural analysis and activity measurements on resurrected and present-day enzymes suggest that both activities cannot be fully optimized in a single enzyme. However, gene duplications repeatedly spawned daughter genes in which mutations optimized either isomaltase or maltase activity. Interestingly, similar shifts in enzyme activity were reached multiple times via different evolutionary routes. Together, our results provide a detailed picture of the molecular mechanisms that drove divergence of these duplicated enzymes and show that whereas the classic models of dosage, sub-, and neofunctionalization are helpful to conceptualize the implications of gene duplication, the three mechanisms co-occur and intertwine.

  5. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Gene duplication can provide new genetic material for mutation, drift and selection to act upon, the result of which is specialized or new gene functions. Without ... The domain part of the email address of all email addresses used by the office of Indian Academy of Sciences, including those of the staff, the journals, various ...

  6. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    BACKGROUND: Menkes disease (MD) is an X-linked, fatal neurodegenerative disorder of copper metabolism, caused by mutations in the ATP7A gene. Thirty-three Menkes patients in whom no mutation had been detected with standard diagnostic tools were screened for exon duplications in the ATP7A gene. ME...

  7. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

    Directory of Open Access Journals (Sweden)

    Jakobek Judy L

    2007-07-01

    Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the

  8. Familial Lymphoproliferative Malignancies and Tandem Duplication of NF1 Gene

    Directory of Open Access Journals (Sweden)

    Gustavo Fernandes

    2014-01-01

    Full Text Available Background. Neurofibromatosis type 1 is a genetic disorder caused by loss-of-function mutations in a tumor suppressor gene (NF1 which codifies the protein neurofibromin. The frequent genetic alterations that modify neurofibromin function are deletions and insertions. Duplications are rare and phenotype in patients bearing duplication of NF1 gene is thought to be restricted to developmental abnormalities, with no reference to cancer susceptibility in these patients. We evaluated a patient who presented with few clinical signs of neurofibromatosis type 1 and a conspicuous personal and familiar history of different types of cancer, especially lymphoproliferative malignancies. The coding region of the NF-1 gene was analyzed by real-time polymerase chain reaction and direct sequencing. Multiplex ligation-dependent probe amplification was performed to detect the number of mutant copies. The NF1 gene analysis showed the following alterations: mosaic duplication of NF1, TRAF4, and MYO1D. Fluorescence in situ hybridization using probes (RP5-1002G3 and RP5-92689 flanking NF1 gene in 17q11.2 and CEP17 for 17q11.11.1 was performed. There were three signals (RP5-1002G3conRP5-92689 in the interphases analyzed and two signals (RP5-1002G3conRP5-92689 in 93% of cells. These findings show a tandem duplication of 17q11.2. Conclusion. The case suggests the possibility that NF1 gene duplication may be associated with a phenotype characterized by lymphoproliferative disorders.

  9. The effect of functional compensation among duplicate genes can ...

    Indian Academy of Sciences (India)

    Abstract. Gene duplicates have the inherent property of initially being functionally redundant. This means that they can compensate for the effect of deleterious variation occurring at one or more sister sites. Here, I present data bearing on evolutionary theory that illustrates the manner in which any functional adaptation in ...

  10. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  11. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  12. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  13. Root hairs, trichomes and the evolution of duplicate genes.

    Science.gov (United States)

    Kellogg, E A

    2001-12-01

    The MYB-class proteins WEREWOLF and GLABRA1 are functionally interchangeable, even though one is normally expressed solely in roots and the other only in shoots. This shows that their different functions are the result of the modification of cis-regulatory sequences over evolutionary time. The two genes thus provide an example of morphological diversification created by gene duplication and changes in regulation.

  14. On the origins of Mendelian disease genes in man: the impact of gene duplication.

    Science.gov (United States)

    Dickerson, Jonathan E; Robertson, David L

    2012-01-01

    Over 3,000 human diseases are known to be linked to heritable genetic variation, mapping to over 1,700 unique genes. Dating of the evolutionary age of these disease-associated genes has suggested that they have a tendency to be ancient, specifically coming into existence with early metazoa. The approach taken by past studies, however, assumes that the age of a disease is the same as the age of its common ancestor, ignoring the fundamental contribution of duplication events in the evolution of new genes and function. Here, we date both the common ancestor and the duplication history of known human disease-associated genes. We find that the majority of disease genes (80%) are genes that have been duplicated in their evolutionary history. Periods for which there are more disease-associated genes, for example, at the origins of bony vertebrates, are explained by the emergence of more genes at that time, and the majority of these are duplicates inferred to have arisen by whole-genome duplication. These relationships are similar for different disease types and the disease-associated gene's cellular function. This indicates that the emergence of duplication-associated diseases has been ongoing and approximately constant (relative to the retention of duplicate genes) throughout the evolution of life. This continued until approximately 390 Ma from which time relatively fewer novel genes came into existence on the human lineage, let alone disease genes. For single-copy genes associated with disease, we find that the numbers of disease genes decreases with recency. For the majority of duplicates, the disease-associated mutation is associated with just one of the duplicate copies. A universal explanation for heritable disease is, thus, that it is merely a by-product of the evolutionary process; the evolution of new genes (de novo or by duplication) results in the potential for new diseases to emerge.

  15. The Phenotypic Plasticity of Duplicated Genes in Saccharomyces cerevisiae and the Origin of Adaptations

    Directory of Open Access Journals (Sweden)

    Florian Mattenberger

    2017-01-01

    Full Text Available Gene and genome duplication are the major sources of biological innovations in plants and animals. Functional and transcriptional divergence between the copies after gene duplication has been considered the main driver of innovations . However, here we show that increased phenotypic plasticity after duplication plays a more major role than thought before in the origin of adaptations. We perform an exhaustive analysis of the transcriptional alterations of duplicated genes in the unicellular eukaryote Saccharomyces cerevisiae when challenged with five different environmental stresses. Analysis of the transcriptomes of yeast shows that gene duplication increases the transcriptional response to environmental changes, with duplicated genes exhibiting signatures of adaptive transcriptional patterns in response to stress. The mechanism of duplication matters, with whole-genome duplicates being more transcriptionally altered than small-scale duplicates. The predominant transcriptional pattern follows the classic theory of evolution by gene duplication; with one gene copy remaining unaltered under stress, while its sister copy presents large transcriptional plasticity and a prominent role in adaptation. Moreover, we find additional transcriptional profiles that are suggestive of neo- and subfunctionalization of duplicate gene copies. These patterns are strongly correlated with the functional dependencies and sequence divergence profiles of gene copies. We show that, unlike singletons, duplicates respond more specifically to stress, supporting the role of natural selection in the transcriptional plasticity of duplicates. Our results reveal the underlying transcriptional complexity of duplicated genes and its role in the origin of adaptations.

  16. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  17. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  18. Gene Duplication and Gene Expression Changes Play a Role in the Evolution of Candidate Pollen Feeding Genes in Heliconius Butterflies.

    Science.gov (United States)

    Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D

    2016-09-02

    Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  20. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  1. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  2. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

    2016-09-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  3. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

    2016-01-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  4. Pattern of gene duplication in the Cotesia congregata Bracovirus.

    Science.gov (United States)

    Friedman, Robert; Hughes, Austin L

    2006-07-01

    Polydnaviruses (PDVs) are a family of double-stranded DNA viruses genetically linked to their wasp hosts. These viruses utilize the transcriptional machinery of the wasp cells to manufacture viral particles which contain circular segments of DNA. The female wasp, hosting the polydnavirus, lays its eggs along with the viral particles inside a caterpillar. Because no replication of the virus occurs while inside the caterpillar, fixed genetic changes occur solely inside the female wasp, as an integrated portion of its genome. Therefore, evolution of the polydnavirus is expected to parallel that of the wasp. Phylogenetic analysis of the polydnavirus genome showed a pattern of gene duplication consistent with the "birth-and-death" process frequently observed in eukaryotic genomes. Phylogenies provided no unequivocal evidence of horizontal gene transfer between the wasp host and the polydnavirus, but in some cases there were suggestions of such gene transfer.

  5. The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

    Directory of Open Access Journals (Sweden)

    Luís Filipe Costa Castro

    Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

  6. Dissecting the structure and mechanism of a complex duplication-triplication rearrangement in the DMD gene.

    Science.gov (United States)

    Ishmukhametova, Aliya; Chen, Jian-Min; Bernard, Rafaëlle; de Massy, Bernard; Baudat, Frédéric; Boyer, Amandine; Méchin, Déborah; Thorel, Delphine; Chabrol, Brigitte; Vincent, Marie-Claire; Khau Van Kien, Philippe; Claustres, Mireille; Tuffery-Giraud, Sylvie

    2013-08-01

    Pathogenic complex genomic rearrangements are being increasingly characterized at the nucleotide level, providing unprecedented opportunities to evaluate the complexities of mutational mechanisms. Here, we report the molecular characterization of a complex duplication-triplication rearrangement involving exons 45-60 of the DMD gene. Inverted repeats facilitated this complex rearrangement, which shares common genomic organization with the recently described duplication-inverted triplication-duplication (DUP-TRP/INV-DUP) events; specifically, a 690-kb region comprising DMD exons from 45 to 60 was duplicated in tandem, and another 46-kb segment containing exon 51 was inserted inversely in between them. Taking into consideration (1) the presence of a predicted PRDM9 binding site in the near vicinity of the junction involving two inverted L1 elements and (2) the inherent properties of X-Y chromosome recombination during male meiosis, we proposed an alternative two-step model for the generation of this X-linked DMD DUP-TRP/INV-DUP event. © 2013 WILEY PERIODICALS, INC.

  7. Concomitant duplications of opioid peptide and receptor genes before the origin of jawed vertebrates.

    Directory of Open Access Journals (Sweden)

    Görel Sundström

    Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.

  8. The birth of a human-specific neural gene by incomplete duplication and gene fusion.

    Science.gov (United States)

    Dougherty, Max L; Nuttle, Xander; Penn, Osnat; Nelson, Bradley J; Huddleston, John; Baker, Carl; Harshman, Lana; Duyzend, Michael H; Ventura, Mario; Antonacci, Francesca; Sandstrom, Richard; Dennis, Megan Y; Eichler, Evan E

    2017-03-09

    Gene innovation by duplication is a fundamental evolutionary process but is difficult to study in humans due to the large size, high sequence identity, and mosaic nature of segmental duplication blocks. The human-specific gene hydrocephalus-inducing 2, HYDIN2, was generated by a 364 kbp duplication of 79 internal exons of the large ciliary gene HYDIN from chromosome 16q22.2 to chromosome 1q21.1. Because the HYDIN2 locus lacks the ancestral promoter and seven terminal exons of the progenitor gene, we sought to characterize transcription at this locus by coupling reverse transcription polymerase chain reaction and long-read sequencing. 5' RACE indicates a transcription start site for HYDIN2 outside of the duplication and we observe fusion transcripts spanning both the 5' and 3' breakpoints. We observe extensive splicing diversity leading to the formation of altered open reading frames (ORFs) that appear to be under relaxed selection. We show that HYDIN2 adopted a new promoter that drives an altered pattern of expression, with highest levels in neural tissues. We estimate that the HYDIN duplication occurred ~3.2 million years ago and find that it is nearly fixed (99.9%) for diploid copy number in contemporary humans. Examination of 73 chromosome 1q21 rearrangement patients reveals that HYDIN2 is deleted or duplicated in most cases. Together, these data support a model of rapid gene innovation by fusion of incomplete segmental duplications, altered tissue expression, and potential subfunctionalization or neofunctionalization of HYDIN2 early in the evolution of the Homo lineage.

  9. Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species.

    Science.gov (United States)

    Kursel, Lisa E; Malik, Harmit S

    2017-06-01

    Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Sox genes in grass carp (Ctenopharyngodon idella with their implications for genome duplication and evolution

    Directory of Open Access Journals (Sweden)

    Tong Jingou

    2006-11-01

    Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.

  11. Predominant gain of promoter TATA box after gene duplication associated with stress responses.

    Science.gov (United States)

    Zou, Yangyun; Huang, Wei; Gu, Zhenglong; Gu, Xun

    2011-10-01

    TATA box, the core promoter element, exists in a broad range of eukaryotes, and the expression of TATA-containing genes usually responds to various environmental stresses. Hence, the evolution of TATA-box in duplicate genes may provide some clues for the interrelationship among environmental stress, expression differentiation, and duplicate gene preservation. In the present study, we observed that the TATA box is significantly overrepresented in duplicate genes compared with singletons in human, worm, Arabidopsis, and yeast genomes. We then conducted an extensive functional genomic analysis to investigate the evolution of TATA box along over 700 yeast gene family phylogenies. After reconstructing the ancestral TATA-box states (presence or absence), we found that significantly higher numbers of TATA box gain events than loss events had occurred after yeast gene duplications-the overall gain-loss ratio is about 3-4 to 1. Interestingly, these TATA-gain duplicate genes on average have experienced greater expression divergence from the ancestral expression states than their most closely related TATA-less duplicate partners, but only under environmental stress conditions (asymmetric evolution); indeed, under normal physiological conditions, they have similar expression divergence (symmetric evolution). Moreover, we showed that TATA-gain duplicates are enriched in stress-associated functional categories but that is not the case for TATA-ancestral duplicates (those inherited from their ancestors prior to duplication). Together, we conclude that after the gene duplication, gain of the TATA box in duplicate promoters may have played an important role in yeast duplicate preservation by accelerating expression divergence that may facilitate the adaptive evolution of the organism in response to environmental changes.

  12. Duplication and retention biases of essential and non-essential genes revealed by systematic knockdown analyses.

    Directory of Open Access Journals (Sweden)

    Shane Woods

    2013-05-01

    Full Text Available When a duplicate gene has no apparent loss-of-function phenotype, it is commonly considered that the phenotype has been masked as a result of functional redundancy with the remaining paralog. This is supported by indirect evidence showing that multi-copy genes show loss-of-function phenotypes less often than single-copy genes and by direct tests of phenotype masking using select gene sets. Here we take a systematic genome-wide RNA interference approach to assess phenotype masking in paralog pairs in the Caenorhabditis elegans genome. Remarkably, in contrast to expectations, we find that phenotype masking makes only a minor contribution to the low knockdown phenotype rate for duplicate genes. Instead, we find that non-essential genes are highly over-represented among duplicates, leading to a low observed loss-of-function phenotype rate. We further find that duplicate pairs derived from essential and non-essential genes have contrasting evolutionary dynamics: whereas non-essential genes are both more often successfully duplicated (fixed and lost, essential genes are less often duplicated but upon successful duplication are maintained over longer periods. We expect the fundamental evolutionary duplication dynamics presented here to be broadly applicable.

  13. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  14. CG gene body DNA methylation changes and evolution of duplicated genes in cassava.

    Science.gov (United States)

    Wang, Haifeng; Beyene, Getu; Zhai, Jixian; Feng, Suhua; Fahlgren, Noah; Taylor, Nigel J; Bart, Rebecca; Carrington, James C; Jacobsen, Steven E; Ausin, Israel

    2015-11-03

    DNA methylation is important for the regulation of gene expression and the silencing of transposons in plants. Here we present genome-wide methylation patterns at single-base pair resolution for cassava (Manihot esculenta, cultivar TME 7), a crop with a substantial impact in the agriculture of subtropical and tropical regions. On average, DNA methylation levels were higher in all three DNA sequence contexts (CG, CHG, and CHH, where H equals A, T, or C) than those of the most well-studied model plant Arabidopsis thaliana. As in other plants, DNA methylation was found both on transposons and in the transcribed regions (bodies) of many genes. Consistent with these patterns, at least one cassava gene copy of all of the known components of Arabidopsis DNA methylation pathways was identified. Methylation of LTR transposons (GYPSY and COPIA) was found to be unusually high compared with other types of transposons, suggesting that the control of the activity of these two types of transposons may be especially important. Analysis of duplicated gene pairs resulting from whole-genome duplication showed that gene body DNA methylation and gene expression levels have coevolved over short evolutionary time scales, reinforcing the positive relationship between gene body methylation and high levels of gene expression. Duplicated genes with the most divergent gene body methylation and expression patterns were found to have distinct biological functions and may have been under natural or human selection for cassava traits.

  15. Epigenetic changes and repositioning determine the evolutionary fate of duplicated genes.

    Science.gov (United States)

    Rodin, S N; Parkhomchuk, D V; Riggs, A D

    2005-05-01

    Consideration of epigenetic silencing, perhaps by DNA methylation, led to an epigenetic complementation (EC) model for evolution by gene duplication (Rodin and Riggs (2003) J. Mol. Evol., 56, 718-729). This and subsequent work on genome-wide analyses of gene duplicates in several eukaryotic species pointed to a fundamental link between localization in the genome, epigenetic regulation of expression, and the evolutionary fate of new redundant gene copies, which can be either non- or neo-functionalization. Our main message in this report is that repositioning of a new duplicate to an ectopic site epigenetically alters its expression pattern, and concomitantly the rate and direction of mutations. Furthermore, comparison of syntenic vs. non-syntenic pairs of gene duplicates of different age unambiguously indicates that repositioning saves redundant gene duplicates from pseudogenization and hastens their evolution towards a new development-time and tissue-specific pattern of function.

  16. Gene duplication and divergence affecting drug content in Cannabis sativa.

    Science.gov (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  17. Gene duplication and concerted evolution of mitochondrial DNA in crane species.

    Science.gov (United States)

    Akiyama, Takuya; Nishida, Chizuko; Momose, Kunikazu; Onuma, Manabu; Takami, Kazutoshi; Masuda, Ryuichi

    2017-01-01

    The gene duplication in mitochondrial DNA (mtDNA) has been reported in diverse bird taxa so far. Although many phylogenetic and population genetic analyses of cranes were carried out based on mtDNA diversity, whether mtDNA contains duplicated regions is unknown. To address the presence or absence of gene duplication in cranes and investigate the molecular evolutionary features of crane mtDNA, we analyzed the gene organization and the molecular phylogeny of mtDNA from 13 crane species. We found that the mtDNA in 13 crane species shared a tandem duplicated region, which consists of duplicated sequence sets including cytochrome b (Cytb), NADH6, control region (CR) and three genes of tRNA. The gene order in the duplicated region was identical among all the 13 crane species, and the nucleotide sequences found within each individual showed high similarities. In addition, phylogenetic trees based on homologous sequences of CR and Cytb indicated the possibility of concerted evolution among the duplicated genes. The results suggested that the duplication event occurred in the common ancestor of crane species or some older ancestors. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Science.gov (United States)

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  19. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Directory of Open Access Journals (Sweden)

    Philippe Ganot

    2011-07-01

    Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both

  20. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  1. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  2. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  4. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Science.gov (United States)

    Guo, Yong; Qiu, Li-Juan

    2013-01-01

    The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max). In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs) were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  5. Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.

    Science.gov (United States)

    Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C

    2010-02-01

    The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

  6. Modification of gene duplicability during the evolution of protein interaction network.

    Directory of Open Access Journals (Sweden)

    Matteo D'Antonio

    2011-04-01

    Full Text Available Duplications of genes encoding highly connected and essential proteins are selected against in several species but not in human, where duplicated genes encode highly connected proteins. To understand when and how gene duplicability changed in evolution, we compare gene and network properties in four species (Escherichia coli, yeast, fly, and human that are representative of the increase in evolutionary complexity, defined as progressive growth in the number of genes, cells, and cell types. We find that the origin and conservation of a gene significantly correlates with the properties of the encoded protein in the protein-protein interaction network. All four species preserve a core of singleton and central hubs that originated early in evolution, are highly conserved, and accomplish basic biological functions. Another group of hubs appeared in metazoans and duplicated in vertebrates, mostly through vertebrate-specific whole genome duplication. Such recent and duplicated hubs are frequently targets of microRNAs and show tissue-selective expression, suggesting that these are alternative mechanisms to control their dosage. Our study shows how networks modified during evolution and contributes to explaining the occurrence of somatic genetic diseases, such as cancer, in terms of network perturbations.

  7. Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement

    International Nuclear Information System (INIS)

    Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded

    2011-01-01

    During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently

  8. Duplicated growth hormone genes in a passerine bird, the jungle crow (Corvus macrorhynchos).

    Science.gov (United States)

    Arai, Natsumi; Iigo, Masayuki

    2010-07-02

    Molecular cloning, molecular phylogeny, gene structure and expression analyses of growth hormone (GH) were performed in a passerine bird, the jungle crow (Corvus macrorhynchos). Unexpectedly, duplicated GH cDNA and genes were identified and designated as GH1A and GH1B. In silico analyses identified the zebra finch orthologs. Both GH genes encode 217 amino acid residues and consist of five exons and four introns, spanning 5.2 kbp in GH1A and 4.2 kbp in GH1B. Predicted GH proteins of the jungle crow and zebra finch contain four conserved cysteine residues, suggesting duplicated GH genes are functional. Molecular phylogenetic analysis revealed that duplication of GH genes occur after divergence of the passerine lineage from the other avian orders as has been suggested from partial genomic DNA sequences of passerine GH genes. RT-PCR analyses confirmed expression of GH1A and GH1B in the pituitary gland. In addition, GH1A gene is expressed in all the tissues examined. However, expression of GH1B is confined to several brain areas and blood cells. These results indicate that the regulatory mechanisms of duplicated GH genes are different and that duplicated GH genes exert both endocrine and autocrine/paracrine functions. Copyright 2010 Elsevier Inc. All rights reserved.

  9. Transcriptional behavior of DMD gene duplications in DMD/BMD males.

    Science.gov (United States)

    Gualandi, F; Neri, M; Bovolenta, M; Martoni, E; Rimessi, P; Fini, S; Spitali, P; Fabris, M; Pane, M; Angelini, C; Mora, M; Morandi, L; Mongini, T; Bertini, E; Ricci, E; Vattemi, G; Mercuri, E; Merlini, L; Ferlini, A

    2009-02-01

    DMD gene exons duplications account for up to 5-10 % of Duchenne (DMD) and up to 5-19% of Becker (BMD) muscular dystrophies; as for the more common deletions, the genotype-phenotype correlation and the genetic prognosis are generally based on the "reading frame rule". Nevertheless, the transcriptional profile of duplications, abridging the genomic configuration to the eventual protein effect, has been poorly studied. We describe 26 DMD gene duplications occurring in 33 unrelated patients and detected among a cohort of 194 mutation-positive DMD/BMD patients. We have characterized at the RNA level 16 of them. Four duplications (15%) behave as exception to the reading frame rule. In three BMD cases with out-of-frame mutations, the RNA analysis revealed that exon skipping events occurring in the duplicated region represent the mechanism leading to the frame re-establishment and to the milder phenotype. Differently, in a DMD patient carrying an in-frame duplication the RNA behaviour failed to explain the clinical phenotype which is probably related to post-transcriptional-translational mechanisms. We conclude that defining the RNA profile in DMD gene duplications is mandatory both for establishing the genetic prognosis and for approaching therapeutic trials based on hnRNA modulation. (c) 2008 Wiley-Liss, Inc.

  10. Subfunctionalization reduces the fitness cost of gene duplication in humans by buffering dosage imbalances

    Directory of Open Access Journals (Sweden)

    Fernández Ariel

    2011-12-01

    Full Text Available Abstract Background Driven essentially by random genetic drift, subfunctionalization has been identified as a possible non-adaptive mechanism for the retention of duplicate genes in small-population species, where widespread deleterious mutations are likely to cause complementary loss of subfunctions across gene copies. Through subfunctionalization, duplicates become indispensable to maintain the functional requirements of the ancestral locus. Yet, gene duplication produces a dosage imbalance in the encoded proteins and thus, as investigated in this paper, subfunctionalization must be subject to the selective forces arising from the fitness bottleneck introduced by the duplication event. Results We show that, while arising from random drift, subfunctionalization must be inescapably subject to selective forces, since the diversification of expression patterns across paralogs mitigates duplication-related dosage imbalances in the concentrations of encoded proteins. Dosage imbalance effects become paramount when proteins rely on obligatory associations to maintain their structural integrity, and are expected to be weaker when protein complexation is ephemeral or adventitious. To establish the buffering effect of subfunctionalization on selection pressure, we determine the packing quality of encoded proteins, an established indicator of dosage sensitivity, and correlate this parameter with the extent of paralog segregation in humans, using species with larger population -and more efficient selection- as controls. Conclusions Recognizing the role of subfunctionalization as a dosage-imbalance buffer in gene duplication events enabled us to reconcile its mechanistic nonadaptive origin with its adaptive role as an enabler of the evolution of genetic redundancy. This constructive role was established in this paper by proving the following assertion: If subfunctionalization is indeed adaptive, its effect on paralog segregation should scale with the dosage

  11. Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

    Directory of Open Access Journals (Sweden)

    Kesterson Robert A

    2003-04-01

    Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

  12. Evolution of the ability to modulate host chemokine networks via gene duplication in human cytomegalovirus (HCMV).

    Science.gov (United States)

    Scarborough, Jessica A; Paul, John R; Spencer, Juliet V

    2017-07-01

    Human cytomegalovirus (HCMV) is a widespread pathogen that is particularly skillful at evading immune detection and defense mechanisms, largely due to extensive co-evolution with its host. One aspect of this co-evolution involves the acquisition of virally encoded G protein-coupled receptors (GPCRs) with homology to the chemokine receptor family. GPCRs are the largest family of cell surface proteins, found in organisms from yeast to humans, and they regulate a variety of cellular processes including development, sensory perception, and immune cell trafficking. The US27 and US28 genes are encoded by human and primate CMVs, but homologs are not found in the genomes of viruses infecting rodents or other species. Phylogenetic analysis was used to investigate the US27 and US28 genes, which are adjacent in the unique short (US) region of the HCMV genome, and their relationship to one another and to human chemokine receptor genes. The results indicate that both US27 and US28 share the same common ancestor with human chemokine receptor CX3CR1, suggesting that a single host gene was captured and a subsequent viral gene duplication event occurred. The US28 gene product (pUS28) has maintained the function of the ancestral gene and has the ability to bind and signal in response to CX3CL1/fractalkine, the natural ligand for CX3CR1. In contrast, pUS27 does not bind to any known chemokine ligand, and the sequence has diverged significantly, highlighted by the fact that pUS27 currently exhibits greater sequence similarity to human CCR1. While the evolutionary advantage of the gene duplication and neofunctionalization event remains unclear, the US27 and US28 genes are highly conserved among different HCMV strains and retained even in laboratory strains that have lost many virulence genes, suggesting that US27 and US28 have each evolved distinct, important functions during virus infection. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Population genetics of duplicated alternatively spliced exons of the Dscam gene in Daphnia and Drosophila.

    Directory of Open Access Journals (Sweden)

    Daniela Brites

    Full Text Available In insects and crustaceans, the Down syndrome cell adhesion molecule (Dscam occurs in many different isoforms. These are produced by mutually exclusive alternative splicing of dozens of tandem duplicated exons coding for parts or whole immunoglobulin (Ig domains of the Dscam protein. This diversity plays a role in the development of the nervous system and also in the immune system. Structural analysis of the protein suggested candidate epitopes where binding to pathogens could occur. These epitopes are coded by regions of the duplicated exons and are therefore diverse within individuals. Here we apply molecular population genetics and molecular evolution analyses using Daphnia magna and several Drosophila species to investigate the potential role of natural selection in the divergence between orthologs of these duplicated exons among species, as well as between paralogous exons within species. We found no evidence for a role of positive selection in the divergence of these paralogous exons. However, the power of this test was low, and the fact that no signs of gene conversion between paralogous exons were found suggests that paralog diversity may nonetheless be maintained by selection. The analysis of orthologous exons in Drosophila and in Daphnia revealed an excess of non-synonymous polymorphisms in the epitopes putatively involved in pathogen binding. This may be a sign of balancing selection. Indeed, in Dr. melanogaster the same derived non-synonymous alleles segregate in several populations around the world. Yet other hallmarks of balancing selection were not found. Hence, we cannot rule out that the excess of non-synonymous polymorphisms is caused by segregating slightly deleterious alleles, thus potentially indicating reduced selective constraints in the putative pathogen binding epitopes of Dscam.

  14. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Directory of Open Access Journals (Sweden)

    Capra Valeria

    2012-10-01

    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  15. Molecular evolution accompanying functional divergence of duplicated genes along the plant starch biosynthesis pathway.

    Science.gov (United States)

    Nougué, Odrade; Corbi, Jonathan; Ball, Steven G; Manicacci, Domenica; Tenaillon, Maud I

    2014-05-15

    Starch is the main source of carbon storage in the Archaeplastida. The starch biosynthesis pathway (sbp) emerged from cytosolic glycogen metabolism shortly after plastid endosymbiosis and was redirected to the plastid stroma during the green lineage divergence. The SBP is a complex network of genes, most of which are members of large multigene families. While some gene duplications occurred in the Archaeplastida ancestor, most were generated during the sbp redirection process, and the remaining few paralogs were generated through compartmentalization or tissue specialization during the evolution of the land plants. In the present study, we tested models of duplicated gene evolution in order to understand the evolutionary forces that have led to the development of SBP in angiosperms. We combined phylogenetic analyses and tests on the rates of evolution along branches emerging from major duplication events in six gene families encoding sbp enzymes. We found evidence of positive selection along branches following cytosolic or plastidial specialization in two starch phosphorylases and identified numerous residues that exhibited changes in volume, polarity or charge. Starch synthases, branching and debranching enzymes functional specializations were also accompanied by accelerated evolution. However, none of the sites targeted by selection corresponded to known functional domains, catalytic or regulatory. Interestingly, among the 13 duplications tested, 7 exhibited evidence of positive selection in both branches emerging from the duplication, 2 in only one branch, and 4 in none of the branches. The majority of duplications were followed by accelerated evolution targeting specific residues along both branches. This pattern was consistent with the optimization of the two sub-functions originally fulfilled by the ancestral gene before duplication. Our results thereby provide strong support to the so-called "Escape from Adaptive Conflict" (EAC) model. Because none of the

  16. A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications.

    Science.gov (United States)

    Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R

    2010-12-01

    Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

  17. Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates.

    Science.gov (United States)

    Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe

    2015-11-01

    A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification

  18. A duplicated coxI gene is associated with cytoplasmic male sterility ...

    Indian Academy of Sciences (India)

    which have been implicated in male sterility (reviewed in. Keywords. Brassica juncea; coxI gene; cytoplasmic male sterility; somatic hybrid; transcript variation. ... drial recombination has led to duplication of coxI gene which appears to be associated with the CMS. Materials and methods. Plant material. B. juncea cv.

  19. New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): a gene duplication trail.

    Science.gov (United States)

    Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane

    2015-07-01

    The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.

  20. The role of gene duplication and unconstrained selective pressures in the melanopsin gene family evolution and vertebrate circadian rhythm regulation.

    Directory of Open Access Journals (Sweden)

    Rui Borges

    Full Text Available Melanopsin is a photosensitive cell protein involved in regulating circadian rhythms and other non-visual responses to light. The melanopsin gene family is represented by two paralogs, OPN4x and OPN4m, which originated through gene duplication early in the emergence of vertebrates. Here we studied the melanopsin gene family using an integrated gene/protein evolutionary approach, which revealed that the rhabdomeric urbilaterian ancestor had the same amino acid patterns (DRY motif and the Y and E conterions as extant vertebrate species, suggesting that the mechanism for light detection and regulation is similar to rhabdomeric rhodopsins. Both OPN4m and OPN4x paralogs are found in vertebrate genomic paralogons, suggesting that they diverged following this duplication event about 600 million years ago, when the complex eye emerged in the vertebrate ancestor. Melanopsins generally evolved under negative selection (ω = 0.171 with some minor episodes of positive selection (proportion of sites = 25% and functional divergence (θ(I = 0.349 and θ(II = 0.126. The OPN4m and OPN4x melanopsin paralogs show evidence of spectral divergence at sites likely involved in melanopsin light absorbance (200F, 273S and 276A. Also, following the teleost lineage-specific whole genome duplication (3R that prompted the teleost fish radiation, type I divergence (θ(I = 0.181 and positive selection (affecting 11% of sites contributed to amino acid variability that we related with the photo-activation stability of melanopsin. The melanopsin intracellular regions had unexpectedly high variability in their coupling specificity of G-proteins and we propose that Gq/11 and Gi/o are the two G-proteins most-likely to mediate the melanopsin phototransduction pathway. The selection signatures were mainly observed on retinal-related sites and the third and second intracellular loops, demonstrating the physiological plasticity of the melanopsin protein group. Our results provide new

  1. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  2. Duplication and relocation of the functional DPY19L2 gene within low copy repeats

    Directory of Open Access Journals (Sweden)

    Cheung Joseph

    2006-03-01

    Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.

  3. Duplication and diversification of the hypoxia-inducible IGFBP-1 gene in zebrafish.

    Directory of Open Access Journals (Sweden)

    Hiroyasu Kamei

    2008-08-01

    Full Text Available Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenability to genetic and experimental manipulation and because it possess a large number of duplicated genes.We report the identification and characterization of two hypoxia-inducible genes in zebrafish that are co-ortholgs of human IGF binding protein-1 (IGFBP-1. IGFBP-1 is a secreted protein that binds to IGF and modulates IGF actions in somatic growth, development, and aging. Like their human and mouse counterparts, in adult zebrafish igfbp-1a and igfbp-1b are exclusively expressed in the liver. During embryogenesis, the two genes are expressed in overlapping spatial domains but with distinct temporal patterns. While zebrafish IGFBP-1a mRNA was easily detected throughout embryogenesis, IGFBP-1b mRNA was detectable only in advanced stages. Hypoxia induces igfbp-1a expression in early embryogenesis, but induces the igfbp-1b expression later in embryogenesis. Both IGFBP-1a and -b are capable of IGF binding, but IGFBP-1b has much lower affinities for IGF-I and -II because of greater dissociation rates. Overexpression of IGFBP-1a and -1b in zebrafish embryos caused significant decreases in growth and developmental rates. When tested in cultured zebrafish embryonic cells, IGFBP-1a and -1b both inhibited IGF-1-induced cell proliferation but the activity of IGFBP-1b was significantly weaker.These results indicate subfunction partitioning of the duplicated IGFBP-1 genes at the levels of gene expression, physiological regulation, protein structure, and biological actions. The duplicated IGFBP-1 may provide additional flexibility in fine-tuning IGF signaling activities under hypoxia and other catabolic conditions.

  4. Pinda: a web service for detection and analysis of intraspecies gene duplication events.

    Science.gov (United States)

    Kontopoulos, Dimitrios-Georgios; Glykos, Nicholas M

    2013-09-01

    We present Pinda, a Web service for the detection and analysis of possible duplications of a given protein or DNA sequence within a source species. Pinda fully automates the whole gene duplication detection procedure, from performing the initial similarity searches, to generating the multiple sequence alignments and the corresponding phylogenetic trees, to bootstrapping the trees and producing a Z-score-based list of duplication candidates for the input sequence. Pinda has been cross-validated using an extensive set of known and bibliographically characterized duplication events. The service facilitates the automatic and dependable identification of gene duplication events, using some of the most successful bioinformatics software to perform an extensive analysis protocol. Pinda will prove of use for the analysis of newly discovered genes and proteins, thus also assisting the study of recently sequenced genomes. The service's location is http://orion.mbg.duth.gr/Pinda. The source code is freely available via https://github.com/dgkontopoulos/Pinda/. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  5. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  6. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  7. Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development.

    Directory of Open Access Journals (Sweden)

    Shuming Zou

    Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.

  8. Mechanisms involved in the functional divergence of duplicated GroEL chaperonins in Myxococcus xanthus DK1622.

    Directory of Open Access Journals (Sweden)

    Yan Wang

    Full Text Available The gene encoding the GroEL chaperonin is duplicated in nearly 30% of bacterial genomes; and although duplicated groEL genes have been comprehensively determined to have distinct physiological functions in different species, the mechanisms involved have not been characterized to date. Myxococcus xanthus DK1622 has two copies of the groEL gene, each of which can be deleted without affecting cell viability; however, the deletion of either gene does result in distinct defects in the cellular heat-shock response, predation, and development. In this study, we show that, from the expression levels of different groELs, the distinct functions of groEL1 and groEL2 in predation and development are probably the result of the substrate selectivity of the paralogous GroEL chaperonins, whereas the lethal effect of heat shock due to the deletion of groEL1 is caused by a decrease in the total groEL expression level. Following a bioinformatics analysis of the composition characteristics of GroELs from different bacteria, we performed region-swapping assays in M. xanthus, demonstrating that the differences in the apical and the C-terminal equatorial regions determine the substrate specificity of the two GroELs. Site-directed mutagenesis experiments indicated that the GGM repeat sequence at the C-terminus of GroEL1 plays an important role in functional divergence. Divergent functions of duplicated GroELs, which have similar patterns of variation in different bacterial species, have thus evolved mainly via alteration of the apical and the C-terminal equatorial regions. We identified the specific substrates of strain DK1622's GroEL1 and GroEL2 using immunoprecipitation and mass spectrometry techniques. Although 68 proteins bound to both GroEL1 and GroEL2, 83 and 46 proteins bound exclusively to GroEL1 or GroEL2, respectively. The GroEL-specific substrates exhibited distinct molecular sizes and secondary structures, providing an encouraging indication for Gro

  9. Gene duplication and divergence produce divergent MHC genotypes without disassortative mating

    Science.gov (United States)

    Dearborn, Donald C.; Gager, Andrea B.; McArthur, Andrew G.; Gilmour, Morgan E.; Mandzhukova, Elena; Mauck, Robert A.

    2016-01-01

    Genes of the major histocompatibility complex (MHC) exhibit heterozygote advantage in immune defense, which in turn can select for MHC-disassortative mate choice. However, many species lack this expected pattern of MHC-disassortative mating. A possible explanation lies in evolutionary processes following gene duplication: if two duplicated MHC genes become functionally diverged from each other, offspring will inherit diverse multilocus genotypes even under random mating. We used locus-specific primers for high throughput sequencing of two expressed MHC Class II B genes in Leach's storm-petrels, Oceanodroma leucorhoa, and found that exon 2 alleles fall into two gene-specific monophyletic clades. We tested for disassortative versus random mating at these two functionally diverged Class II B genes, using multiple metrics and different subsets of exon 2 sequence data. With good statistical power, we consistently found random assortment of mates at MHC. Despite random mating, birds had MHC genotypes with functionally diverged alleles, averaging 13 amino acid differences in pairwise comparisons of exon 2 alleles within individuals. To test whether this high MHC diversity in individuals is driven by evolutionary divergence of the two duplicated genes, we built a phylogenetic permutation model. The model showed that genotypic diversity was strongly impacted by sequence divergence between the most common allele of each gene, with a smaller additional impact of monophyly of the two genes. Divergence of allele sequences between genes may have reduced the benefits of actively seeking MHC-dissimilar mates, in which case the evolutionary history of duplicated genes is shaping the adaptive landscape of sexual selection. PMID:27376487

  10. Evolution of CONSTANS Regulation and Function after Gene Duplication Produced a Photoperiodic Flowering Switch in the Brassicaceae.

    Science.gov (United States)

    Simon, Samson; Rühl, Mark; de Montaigu, Amaury; Wötzel, Stefan; Coupland, George

    2015-09-01

    Environmental control of flowering allows plant reproduction to occur under optimal conditions and facilitates adaptation to different locations. At high latitude, flowering of many plants is controlled by seasonal changes in day length. The photoperiodic flowering pathway confers this response in the Brassicaceae, which colonized temperate latitudes after divergence from the Cleomaceae, their subtropical sister family. The CONSTANS (CO) transcription factor of Arabidopsis thaliana, a member of the Brassicaceae, is central to the photoperiodic flowering response and shows characteristic patterns of transcription required for day-length sensing. CO is believed to be widely conserved among flowering plants; however, we show that it arose after gene duplication at the root of the Brassicaceae followed by divergence of transcriptional regulation and protein function. CO has two close homologs, CONSTANS-LIKE1 (COL1) and COL2, which are related to CO by tandem duplication and whole-genome duplication, respectively. The single CO homolog present in the Cleomaceae shows transcriptional and functional features similar to those of COL1 and COL2, suggesting that these were ancestral. We detect cis-regulatory and codon changes characteristic of CO and use transgenic assays to demonstrate their significance in the day-length-dependent activation of the CO target gene FLOWERING LOCUS T. Thus, the function of CO as a potent photoperiodic flowering switch evolved in the Brassicaceae after gene duplication. The origin of CO may have contributed to the range expansion of the Brassicaceae and suggests that in other families CO genes involved in photoperiodic flowering arose by convergent evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Evolution of CONSTANS Regulation and Function after Gene Duplication Produced a Photoperiodic Flowering Switch in the Brassicaceae

    Science.gov (United States)

    Simon, Samson; Rühl, Mark; de Montaigu, Amaury; Wötzel, Stefan; Coupland, George

    2015-01-01

    Environmental control of flowering allows plant reproduction to occur under optimal conditions and facilitates adaptation to different locations. At high latitude, flowering of many plants is controlled by seasonal changes in day length. The photoperiodic flowering pathway confers this response in the Brassicaceae, which colonized temperate latitudes after divergence from the Cleomaceae, their subtropical sister family. The CONSTANS (CO) transcription factor of Arabidopsis thaliana, a member of the Brassicaceae, is central to the photoperiodic flowering response and shows characteristic patterns of transcription required for day-length sensing. CO is believed to be widely conserved among flowering plants; however, we show that it arose after gene duplication at the root of the Brassicaceae followed by divergence of transcriptional regulation and protein function. CO has two close homologs, CONSTANS-LIKE1 (COL1) and COL2, which are related to CO by tandem duplication and whole-genome duplication, respectively. The single CO homolog present in the Cleomaceae shows transcriptional and functional features similar to those of COL1 and COL2, suggesting that these were ancestral. We detect cis-regulatory and codon changes characteristic of CO and use transgenic assays to demonstrate their significance in the day-length-dependent activation of the CO target gene FLOWERING LOCUS T. Thus, the function of CO as a potent photoperiodic flowering switch evolved in the Brassicaceae after gene duplication. The origin of CO may have contributed to the range expansion of the Brassicaceae and suggests that in other families CO genes involved in photoperiodic flowering arose by convergent evolution. PMID:25972346

  12. Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-06-01

    Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.

  13. Preferential duplication of intermodular hub genes: an evolutionary signature in eukaryotes genome networks.

    Directory of Open Access Journals (Sweden)

    Ricardo M Ferreira

    Full Text Available Whole genome protein-protein association networks are not random and their topological properties stem from genome evolution mechanisms. In fact, more connected, but less clustered proteins are related to genes that, in general, present more paralogs as compared to other genes, indicating frequent previous gene duplication episodes. On the other hand, genes related to conserved biological functions present few or no paralogs and yield proteins that are highly connected and clustered. These general network characteristics must have an evolutionary explanation. Considering data from STRING database, we present here experimental evidence that, more than not being scale free, protein degree distributions of organisms present an increased probability for high degree nodes. Furthermore, based on this experimental evidence, we propose a simulation model for genome evolution, where genes in a network are either acquired de novo using a preferential attachment rule, or duplicated with a probability that linearly grows with gene degree and decreases with its clustering coefficient. For the first time a model yields results that simultaneously describe different topological distributions. Also, this model correctly predicts that, to produce protein-protein association networks with number of links and number of nodes in the observed range for Eukaryotes, it is necessary 90% of gene duplication and 10% of de novo gene acquisition. This scenario implies a universal mechanism for genome evolution.

  14. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  15. A duplicated coxI gene is associated with cytoplasmic male sterility ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 86; Issue 2. A duplicated coxI gene is associated with cytoplasmic male sterility in an alloplasmic Brassica juncea line derived from somatic hybridization with Diplotaxis catholica. Aruna Pathania Rajesh Kumar V. Dinesh Kumar Ashutosh K. K. Dwivedi P. B. Kirti P. Prakash V. L. ...

  16. A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast

    DEFF Research Database (Denmark)

    Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.

    2007-01-01

    In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...

  17. Tandem Duplication Events in the Expansion of the Small Heat Shock Protein Gene Family in Solanum lycopersicum (cv. Heinz 1706

    Directory of Open Access Journals (Sweden)

    Flavia J. Krsticevic

    2016-10-01

    Full Text Available In plants, fruit maturation and oxidative stress can induce small heat shock protein (sHSP synthesis to maintain cellular homeostasis. Although the tomato reference genome was published in 2012, the actual number and functionality of sHSP genes remain unknown. Using a transcriptomic (RNA-seq and evolutionary genomic approach, putative sHSP genes in the Solanum lycopersicum (cv. Heinz 1706 genome were investigated. A sHSP gene family of 33 members was established. Remarkably, roughly half of the members of this family can be explained by nine independent tandem duplication events that determined, evolutionarily, their functional fates. Within a mitochondrial class subfamily, only one duplicated member, Solyc08g078700, retained its ancestral chaperone function, while the others, Solyc08g078710 and Solyc08g078720, likely degenerated under neutrality and lack ancestral chaperone function. Functional conservation occurred within a cytosolic class I subfamily, whose four members, Solyc06g076570, Solyc06g076560, Solyc06g076540, and Solyc06g076520, support ∼57% of the total sHSP RNAm in the red ripe fruit. Subfunctionalization occurred within a new subfamily, whose two members, Solyc04g082720 and Solyc04g082740, show heterogeneous differential expression profiles during fruit ripening. These findings, involving the birth/death of some genes or the preferential/plastic expression of some others during fruit ripening, highlight the importance of tandem duplication events in the expansion of the sHSP gene family in the tomato genome. Despite its evolutionary diversity, the sHSP gene family in the tomato genome seems to be endowed with a core set of four homeostasis genes: Solyc05g014280, Solyc03g082420, Solyc11g020330, and Solyc06g076560, which appear to provide a baseline protection during both fruit ripening and heat shock stress in different tomato tissues.

  18. Duplication, divergence and persistence in the Phytochrome photoreceptor gene family of cottons (Gossypium spp.

    Directory of Open Access Journals (Sweden)

    Abdukarimov Abdusattor

    2010-06-01

    Full Text Available Abstract Background Phytochromes are a family of red/far-red photoreceptors that regulate a number of important developmental traits in cotton (Gossypium spp., including plant architecture, fiber development, and photoperiodic flowering. Little is known about the composition and evolution of the phytochrome gene family in diploid (G. herbaceum, G. raimondii or allotetraploid (G. hirsutum, G. barbadense cotton species. The objective of this study was to obtain a preliminary inventory and molecular-evolutionary characterization of the phytochrome gene family in cotton. Results We used comparative sequence resources to design low-degeneracy PCR primers that amplify genomic sequence tags (GSTs for members of the PHYA, PHYB/D, PHYC and PHYE gene sub-families from A- and D-genome diploid and AD-genome allotetraploid Gossypium species. We identified two paralogous PHYA genes (designated PHYA1 and PHYA2 in diploid cottons, the result of a Malvaceae-specific PHYA gene duplication that occurred approximately 14 million years ago (MYA, before the divergence of the A- and D-genome ancestors. We identified a single gene copy of PHYB, PHYC, and PHYE in diploid cottons. The allotetraploid genomes have largely retained the complete gene complements inherited from both of the diploid genome ancestors, with at least four PHYA genes and two genes encoding PHYB, PHYC and PHYE in the AD-genomes. We did not identify a PHYD gene in any cotton genomes examined. Conclusions Detailed sequence analysis suggests that phytochrome genes retained after duplication by segmental duplication and allopolyploidy appear to be evolving independently under a birth-and-death-process with strong purifying selection. Our study provides a preliminary phytochrome gene inventory that is necessary and sufficient for further characterization of the biological functions of each of the cotton phytochrome genes, and for the development of 'candidate gene' markers that are potentially useful for

  19. [Genetic diagnosis for a family without exonic deletions and duplications of dystrophin gene].

    Science.gov (United States)

    Li, Tao; Hou, Qiaofang; Wu, Dong; Wang, Hongdan; Liu, Hongyan; Yang, Yangli; Zhang, Chaoyang; Ding, Xuebing; Liao, Shixiu

    2015-02-01

    To conduct genetic diagnosis for a family in which no exonic deletions and duplications of the dystrophin gene were detected. Potential exonic deletions and duplications of the dystrophin gene were initially analyzed with using multiplex ligation-dependent probe amplification (MLPA). Subsequently, all of the 79 exons of the dystrophin gene of the proband and a pregnant woman from the family were analyzed with PCR amplification and DNA sequencing. Following identification of the causative mutation, prenatal diagnosis was provided. MLPA analysis had detected no exonic deletions and duplications of the dystrophin gene. Sequence analysis has identified a C>T mutation on the 22nd nucleotide position of the 70th exon of the dystrophin gene (c.10108 C>T), which has replaced the codon CGA to a stop codon (TGA). The patient's mother and sister were both heterozygous for the same mutation. Upon prenatal diagnosis, the fetus was found to be positive for the Y chromosome sex-determining gene (SRY) and has carried above mutation. The result of short tandem repeat linkage analysis also confirmed that the fetus has inherited the mutant X chromosome. The causative mutation of the dystrophin gene has been discovered in an affected family, which has enabled prenatal diagnosis of the disease.

  20. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno

    2007-05-01

    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  1. Ancestral duplications and highly dynamic opsin gene evolution in percomorph fishes.

    Science.gov (United States)

    Cortesi, Fabio; Musilová, Zuzana; Stieb, Sara M; Hart, Nathan S; Siebeck, Ulrike E; Malmstrøm, Martin; Tørresen, Ole K; Jentoft, Sissel; Cheney, Karen L; Marshall, N Justin; Carleton, Karen L; Salzburger, Walter

    2015-02-03

    Single-gene and whole-genome duplications are important evolutionary mechanisms that contribute to biological diversification by launching new genetic raw material. For example, the evolution of animal vision is tightly linked to the expansion of the opsin gene family encoding light-absorbing visual pigments. In teleost fishes, the most species-rich vertebrate group, opsins are particularly diverse and key to the successful colonization of habitats ranging from the bioluminescence-biased but basically dark deep sea to clear mountain streams. In this study, we report a previously unnoticed duplication of the violet-blue short wavelength-sensitive 2 (SWS2) opsin, which coincides with the radiation of highly diverse percomorph fishes, permitting us to reinterpret the evolution of this gene family. The inspection of close to 100 fish genomes revealed that, triggered by frequent gene conversion between duplicates, the evolutionary history of SWS2 is rather complex and difficult to predict. Coincidentally, we also report potential cases of gene resurrection in vertebrate opsins, whereby pseudogenized genes were found to convert with their functional paralogs. We then identify multiple novel amino acid substitutions that are likely to have contributed to the adaptive differentiation between SWS2 copies. Finally, using the dusky dottyback Pseudochromis fuscus, we show that the newly discovered SWS2A duplicates can contribute to visual adaptation in two ways: by gaining sensitivities to different wavelengths of light and by being differentially expressed between ontogenetic stages. Thus, our study highlights the importance of comparative approaches in gaining a comprehensive view of the dynamics underlying gene family evolution and ultimately, animal diversification.

  2. Ancestral duplications and highly dynamic opsin gene evolution in percomorph fishes

    Science.gov (United States)

    Cortesi, Fabio; Musilová, Zuzana; Stieb, Sara M.; Hart, Nathan S.; Siebeck, Ulrike E.; Malmstrøm, Martin; Tørresen, Ole K.; Jentoft, Sissel; Cheney, Karen L.; Marshall, N. Justin; Carleton, Karen L.; Salzburger, Walter

    2015-01-01

    Single-gene and whole-genome duplications are important evolutionary mechanisms that contribute to biological diversification by launching new genetic raw material. For example, the evolution of animal vision is tightly linked to the expansion of the opsin gene family encoding light-absorbing visual pigments. In teleost fishes, the most species-rich vertebrate group, opsins are particularly diverse and key to the successful colonization of habitats ranging from the bioluminescence-biased but basically dark deep sea to clear mountain streams. In this study, we report a previously unnoticed duplication of the violet-blue short wavelength-sensitive 2 (SWS2) opsin, which coincides with the radiation of highly diverse percomorph fishes, permitting us to reinterpret the evolution of this gene family. The inspection of close to 100 fish genomes revealed that, triggered by frequent gene conversion between duplicates, the evolutionary history of SWS2 is rather complex and difficult to predict. Coincidentally, we also report potential cases of gene resurrection in vertebrate opsins, whereby pseudogenized genes were found to convert with their functional paralogs. We then identify multiple novel amino acid substitutions that are likely to have contributed to the adaptive differentiation between SWS2 copies. Finally, using the dusky dottyback Pseudochromis fuscus, we show that the newly discovered SWS2A duplicates can contribute to visual adaptation in two ways: by gaining sensitivities to different wavelengths of light and by being differentially expressed between ontogenetic stages. Thus, our study highlights the importance of comparative approaches in gaining a comprehensive view of the dynamics underlying gene family evolution and ultimately, animal diversification. PMID:25548152

  3. Papain-like cysteine proteases in Carica papaya: lineage-specific gene duplication and expansion.

    Science.gov (United States)

    Liu, Juan; Sharma, Anupma; Niewiara, Marie Jamille; Singh, Ratnesh; Ming, Ray; Yu, Qingyi

    2018-01-06

    Papain-like cysteine proteases (PLCPs), a large group of cysteine proteases structurally related to papain, play important roles in plant development, senescence, and defense responses. Papain, the first cysteine protease whose structure was determined by X-ray crystallography, plays a crucial role in protecting papaya from herbivorous insects. Except the four major PLCPs purified and characterized in papaya latex, the rest of the PLCPs in papaya genome are largely unknown. We identified 33 PLCP genes in papaya genome. Phylogenetic analysis clearly separated plant PLCP genes into nine subfamilies. PLCP genes are not equally distributed among the nine subfamilies and the number of PLCPs in each subfamily does not increase or decrease proportionally among the seven selected plant species. Papaya showed clear lineage-specific gene expansion in the subfamily III. Interestingly, all four major PLCPs purified from papaya latex, including papain, chymopapain, glycyl endopeptidase and caricain, were grouped into the lineage-specific expansion branch in the subfamily III. Mapping PLCP genes on chromosomes of five plant species revealed that lineage-specific expansions of PLCP genes were mostly derived from tandem duplications. We estimated divergence time of papaya PLCP genes of subfamily III. The major duplication events leading to lineage-specific expansion of papaya PLCP genes in subfamily III were estimated at 48 MYA, 34 MYA, and 16 MYA. The gene expression patterns of the papaya PLCP genes in different tissues were assessed by transcriptome sequencing and qRT-PCR. Most of the papaya PLCP genes of subfamily III expressed at high levels in leaf and green fruit tissues. Tandem duplications played the dominant role in affecting copy number of PLCPs in plants. Significant variations in size of the PLCP subfamilies among species may reflect genetic adaptation of plant species to different environments. The lineage-specific expansion of papaya PLCPs of subfamily III might

  4. Transcriptional rewiring of the sex determining dmrt1 gene duplicate by transposable elements.

    Directory of Open Access Journals (Sweden)

    Amaury Herpin

    2010-02-01

    Full Text Available Control and coordination of eukaryotic gene expression rely on transcriptional and posttranscriptional regulatory networks. Evolutionary innovations and adaptations often require rapid changes of such networks. It has long been hypothesized that transposable elements (TE might contribute to the rewiring of regulatory interactions. More recently it emerged that TEs might bring in ready-to-use transcription factor binding sites to create alterations to the promoters by which they were captured. A process where the gene regulatory architecture is of remarkable plasticity is sex determination. While the more downstream components of the sex determination cascades are evolutionary conserved, the master regulators can switch between groups of organisms even on the interspecies level or between populations. In the medaka fish (Oryzias latipes a duplicated copy of dmrt1, designated dmrt1bY or DMY, on the Y chromosome was shown to be the master regulator of male development, similar to Sry in mammals. We found that the dmrt1bY gene has acquired a new feedback downregulation of its expression. Additionally, the autosomal dmrt1a gene is also able to regulate transcription of its duplicated paralog by binding to a unique target Dmrt1 site nested within the dmrt1bY proximal promoter region. We could trace back this novel regulatory element to a highly conserved sequence within a new type of TE that inserted into the upstream region of dmrt1bY shortly after the duplication event. Our data provide functional evidence for a role of TEs in transcriptional network rewiring for sub- and/or neo-functionalization of duplicated genes. In the particular case of dmrt1bY, this contributed to create new hierarchies of sex-determining genes.

  5. Characterization of a complex rearrangement involving duplication and deletion of 9p in an infant with craniofacial dysmorphism and cardiac anomalies

    Directory of Open Access Journals (Sweden)

    Di Bartolo Daniel L

    2012-07-01

    Full Text Available Abstract Partial duplication and partial deletion of the short arm of chromosome 9 have each been reported in the literature as clinically recognizable syndromes. We present clinical, cytogenetic, and molecular findings on a five-week-old female infant with concomitant duplication and terminal deletion of the short arm of chromosome 9. To our knowledge ten such cases have previously been reported. Conventional cytogenetic analysis identified additional material on chromosome 9 at band p23. FISH analysis aided in determining the additional material consisted of an inverted duplication with a terminal deletion of the short arm. Microarray analysis confirmed this interpretation and further characterized the abnormality as a duplication of about 32.7 Mb, from 9p23 to 9p11.2, and a terminal deletion of about 11.5 Mb, from 9p24.3 to 9p23. The infant displayed characteristic features of Duplication 9p Syndrome (hypotonia, bulbous nose, single transverse palmar crease, cranial anomalies, as well as features associated with Deletion 9p Syndrome (flat nasal bridge, long philtrum, cardiac anomalies despite the deletion being distal to the reported critical region for this syndrome. This case suggests that there are genes or regulatory elements that lie outside of the reported critical region responsible for certain phenotypic features associated with Deletion 9p Syndrome. It also underscores the importance of utilizing array technology to precisely define abnormalities involving the short arm of 9p in order to further refine genotype/phenotype associations and to identify additional cases of duplication/deletion.

  6. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    Science.gov (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  7. Assessment and reconstruction of novel HSP90 genes: duplications, gains and losses in fungal and animal lineages.

    Directory of Open Access Journals (Sweden)

    Chrysoula N Pantzartzi

    Full Text Available Hsp90s, members of the Heat Shock Protein class, protect the structure and function of proteins and play a significant task in cellular homeostasis and signal transduction. In order to determine the number of hsp90 gene copies and encoded proteins in fungal and animal lineages and through that key duplication events that this family has undergone, we collected and evaluated Hsp90 protein sequences and corresponding Expressed Sequence Tags and analyzed available genomes from various taxa. We provide evidence for duplication events affecting either single species or wider taxonomic groups. With regard to Fungi, duplicated genes have been detected in several lineages. In invertebrates, we demonstrate key duplication events in certain clades of Arthropoda and Mollusca, and a possible gene loss event in a hymenopteran family. Finally, we infer that the duplication event responsible for the two (a and b isoforms in vertebrates occurred probably shortly after the split of Hyperoartia and Gnathostomata.

  8. FGFR3 gene mutation plus GRB10 gene duplication in a patient with achondroplasia plus growth delay with prenatal onset.

    Science.gov (United States)

    Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman

    2016-07-02

    Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.

  9. Structure and evolution of protein interaction networks: a statistical model for link dynamics and gene duplications

    Directory of Open Access Journals (Sweden)

    Wagner Andreas

    2004-11-01

    Full Text Available Abstract Background The structure of molecular networks derives from dynamical processes on evolutionary time scales. For protein interaction networks, global statistical features of their structure can now be inferred consistently from several large-throughput datasets. Understanding the underlying evolutionary dynamics is crucial for discerning random parts of the network from biologically important properties shaped by natural selection. Results We present a detailed statistical analysis of the protein interactions in Saccharomyces cerevisiae based on several large-throughput datasets. Protein pairs resulting from gene duplications are used as tracers into the evolutionary past of the network. From this analysis, we infer rate estimates for two key evolutionary processes shaping the network: (i gene duplications and (ii gain and loss of interactions through mutations in existing proteins, which are referred to as link dynamics. Importantly, the link dynamics is asymmetric, i.e., the evolutionary steps are mutations in just one of the binding parters. The link turnover is shown to be much faster than gene duplications. Both processes are assembled into an empirically grounded, quantitative model for the evolution of protein interaction networks. Conclusions According to this model, the link dynamics is the dominant evolutionary force shaping the statistical structure of the network, while the slower gene duplication dynamics mainly affects its size. Specifically, the model predicts (i a broad distribution of the connectivities (i.e., the number of binding partners of a protein and (ii correlations between the connectivities of interacting proteins, a specific consequence of the asymmetry of the link dynamics. Both features have been observed in the protein interaction network of S. cerevisiae.

  10. Duplication of 7q36.3 encompassing the Sonic Hedgehog (SHH) gene is associated with congenital muscular hypertrophy

    DEFF Research Database (Denmark)

    Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne

    2012-01-01

    with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...

  11. Prevertebrate Local Gene Duplication Facilitated Expansion of the Neuropeptide GPCR Superfamily.

    Science.gov (United States)

    Yun, Seongsik; Furlong, Michael; Sim, Mikang; Cho, Minah; Park, Sumi; Cho, Eun Bee; Reyes-Alcaraz, Arfaxad; Hwang, Jong-Ik; Kim, Jaebum; Seong, Jae Young

    2015-11-01

    In humans, numerous genes encode neuropeptides that comprise a superfamily of more than 70 genes in approximately 30 families and act mainly through rhodopsin-like G protein-coupled receptors (GPCRs). Two rounds of whole-genome duplication (2R WGD) during early vertebrate evolution greatly contributed to proliferation within gene families; however, the mechanisms underlying the initial emergence and diversification of these gene families before 2R WGD are largely unknown. In this study, we analyzed 25 vertebrate rhodopsin-like neuropeptide GPCR families and their cognate peptides using phylogeny, synteny, and localization of these genes on reconstructed vertebrate ancestral chromosomes (VACs). Based on phylogeny, these GPCR families can be divided into five distinct clades, and members of each clade tend to be located on the same VACs. Similarly, their neuropeptide gene families also tend to reside on distinct VACs. Comparison of these GPCR genes with those of invertebrates including Drosophila melanogaster, Caenorhabditis elegans, Branchiostoma floridae, and Ciona intestinalis indicates that these GPCR families emerged through tandem local duplication during metazoan evolution prior to 2R WGD. Our study describes a presumptive evolutionary mechanism and development pathway of the vertebrate rhodopsin-like GPCR and cognate neuropeptide families from the urbilaterian ancestor to modern vertebrates. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  13. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.

    Science.gov (United States)

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J

    2011-03-01

    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  14. A rare case of plastid protein-coding gene duplication in the chloroplast genome of Euglena archaeoplastidiata (Euglenophyta).

    Science.gov (United States)

    Bennett, Matthew S; Shiu, Shin-Han; Triemer, Richard E

    2017-06-01

    Gene duplication is an important evolutionary process that allows duplicate functions to diverge, or, in some cases, allows for new functional gains. However, in contrast to the nuclear genome, gene duplications within the chloroplast are extremely rare. Here, we present the chloroplast genome of the photosynthetic protist Euglena archaeoplastidiata. Upon annotation, it was found that the chloroplast genome contained a novel tandem direct duplication that encoded a portion of RuBisCO large subunit (rbcL) followed by a complete copy of ribosomal protein L32 (rpl32), as well as the associated intergenic sequences. Analyses of the duplicated rpl32 were inconclusive regarding selective pressures, although it was found that substitutions in the duplicated region, all non-synonymous, likely had a neutral functional effect. The duplicated region did not exhibit patterns consistent with previously described mechanisms for tandem direct duplications, and demonstrated an unknown mechanism of duplication. In addition, a comparison of this chloroplast genome to other previously characterized chloroplast genomes from the same family revealed characteristics that indicated E. archaeoplastidiata was probably more closely related to taxa in the genera Monomorphina, Cryptoglena, and Euglenaria than it was to other Euglena taxa. Taken together, the chloroplast genome of E. archaeoplastidiata demonstrated multiple characteristics unique to the euglenoid world, and has justified the longstanding curiosity regarding this enigmatic taxon. © 2017 Phycological Society of America.

  15. The naked endosperm genes encode duplicate INDETERMINATE domain transcription factors required for maize endosperm cell patterning and differentiation.

    Science.gov (United States)

    Yi, Gibum; Neelakandan, Anjanasree K; Gontarek, Bryan C; Vollbrecht, Erik; Becraft, Philip W

    2015-02-01

    The aleurone is the outermost layer of cereal endosperm and functions to digest storage products accumulated in starchy endosperm cells as well as to confer important dietary health benefits. Whereas normal maize (Zea mays [Zm]) has a single aleurone layer, naked endosperm (nkd) mutants produce multiple outer cell layers of partially differentiated cells that show sporadic expression of aleurone identity markers such as a viviparous1 promoter-β-glucuronidase transgene. The 15:1 F2 segregation ratio suggested that two recessive genes were involved, and map-based cloning identified two homologous genes in duplicated regions of the genome. The nkd1 and nkd2 genes encode the INDETERMINATE1 domain (IDD) containing transcription factors ZmIDDveg9 and ZmIDD9 on chromosomes 2 and 10, respectively. Independent mutant alleles of nkd1 and nkd2, as well as nkd2-RNA interference lines in which both nkd genes were knocked down, also showed the nkd mutant phenotype, confirming the gene identities. In wild-type kernels, the nkd transcripts were most abundant around 11 to 16 d after pollination. The NKD proteins have putative nuclear localization signals, and green fluorescent protein fusion proteins showed nuclear localization. The mutant phenotype and gene identities suggest that NKD controls a gene regulatory network involved in aleurone cell fate specification and cell differentiation. © 2015 American Society of Plant Biologists. All Rights Reserved.

  16. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  17. Intron gain by tandem genomic duplication: a novel case in a potato gene encoding RNA-dependent RNA polymerase

    Directory of Open Access Journals (Sweden)

    Ming-Yue Ma

    2016-07-01

    Full Text Available The origin and subsequent accumulation of spliceosomal introns are prominent events in the evolution of eukaryotic gene structure. However, the mechanisms underlying intron gain remain unclear because there are few proven cases of recently gained introns. In an RNA-dependent RNA polymerase (RdRp gene, we found that a tandem duplication occurred after the divergence of potato and its wild relatives among other Solanum plants. The duplicated sequence crosses the intron-exon boundary of the first intron and the second exon. A new intron was detected at this duplicated region, and it includes a small previously exonic segment of the upstream copy of the duplicated sequence and the intronic segment of the downstream copy of the duplicated sequence. The donor site of this new intron was directly obtained from the small previously exonic segment. Most of the splicing signals were inherited directly from the parental intron/exon structure, including a putative branch site, the polypyrimidine tract, the 3′ splicing site, two putative exonic splicing enhancers, and the GC contents differed between the intron and exon. In the widely cited model of intron gain by tandem genomic duplication, the duplication of an AGGT-containing exonic segment provides the GT and AG splicing sites for the new intron. Our results illustrate that the tandem duplication model of intron gain should be diverse in terms of obtaining the proper splicing signals.

  18. Impact of duplicate gene copies on phylogenetic analysis and divergence time estimates in butterflies

    Directory of Open Access Journals (Sweden)

    Liswi Saif W

    2009-05-01

    Full Text Available Abstract Background The increase in availability of genomic sequences for a wide range of organisms has revealed gene duplication to be a relatively common event. Encounters with duplicate gene copies have consequently become almost inevitable in the context of collecting gene sequences for inferring species trees. Here we examine the effect of incorporating duplicate gene copies evolving at different rates on tree reconstruction and time estimation of recent and deep divergences in butterflies. Results Sequences from ultraviolet-sensitive (UVRh, blue-sensitive (BRh, and long-wavelength sensitive (LWRh opsins,EF-1α and COI were obtained from 27 taxa representing the five major butterfly families (5535 bp total. Both BRh and LWRh are present in multiple copies in some butterfly lineages and the different copies evolve at different rates. Regardless of the phylogenetic reconstruction method used, we found that analyses of combined data sets using either slower or faster evolving copies of duplicate genes resulted in a single topology in agreement with our current understanding of butterfly family relationships based on morphology and molecules. Interestingly, individual analyses of BRh and LWRh sequences also recovered these family-level relationships. Two different relaxed clock methods resulted in similar divergence time estimates at the shallower nodes in the tree, regardless of whether faster or slower evolving copies were used, with larger discrepancies observed at deeper nodes in the phylogeny. The time of divergence between the monarch butterfly Danaus plexippus and the queen D. gilippus (15.3–35.6 Mya was found to be much older than the time of divergence between monarch co-mimic Limenitis archippus and red-spotted purple L. arthemis (4.7–13.6 Mya, and overlapping with the time of divergence of the co-mimetic passionflower butterflies Heliconius erato and H. melpomene (13.5–26.1 Mya. Our family-level results are congruent with

  19. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  20. Differential contributions to the transcriptome of duplicated genes in response to abiotic stresses in natural and synthetic polyploids.

    Science.gov (United States)

    Dong, Shaowei; Adams, Keith L

    2011-06-01

    Polyploidy has occurred throughout plant evolution and can result in considerable changes to gene expression when it takes place and over evolutionary time. Little is known about the effects of abiotic stress conditions on duplicate gene expression patterns in polyploid plants. We examined the expression patterns of 60 duplicated genes in leaves, roots and cotyledons of allotetraploid Gossypium hirsutum in response to five abiotic stress treatments (heat, cold, drought, high salt and water submersion) using single-strand conformation polymorphism assays, and 20 genes in a synthetic allotetraploid. Over 70% of the genes showed stress-induced changes in the relative expression levels of the duplicates under one or more stress treatments with frequent variability among treatments. Twelve pairs showed opposite changes in expression levels in response to different abiotic stress treatments. Stress-induced expression changes occurred in the synthetic allopolyploid, but there was little correspondence in patterns between the natural and synthetic polyploids. Our results indicate that abiotic stress conditions can have considerable effects on duplicate gene expression in a polyploid, with the effects varying by gene, stress and organ type. Differential expression in response to environmental stresses may be a factor in the preservation of some duplicated genes in polyploids. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  1. Expression response of duplicated metallothionein 3 gene to copper stress in Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Nevrtalová, Eva; Baloun, Jiří; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Doležel, Jaroslav; Šafář, Jan; Milde, D.; Hobza, Roman

    2014-01-01

    Roč. 251, č. 6 (2014), s. 1427-1439 ISSN 0033-183X R&D Projects: GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GP13-34962P; GA ČR(CZ) GA522/09/0083 Institutional support: RVO:68081707 Keywords : Copper * Gene duplication * Metallothionein Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 2.651, year: 2014

  2. Functional evolution of duplicated odorant-binding protein genes, Obp57d and Obp57e, in Drosophila.

    Directory of Open Access Journals (Sweden)

    Eriko Harada

    Full Text Available Odorant-binding proteins (OBPs are extracellular proteins found in insect chemosensilla, where they participate in the sensing of odors, tastes, and pheromones. Although a large number of OBP genes have been identified in insect genomes, their molecular functions and biological roles have been clarified in limited cases. Two OBP genes, Obp57d and Obp57e, were involved in the evolution of host-plant preference in Drosophila sechellia. Comparative analyses of the Obp57d/e genomic sequences from 27 closely related species suggested that the two genes arose by tandem gene duplication and functionally diverged from each other. In this study, the functional evolution of Obp57d and Obp57e was examined by in vitro binding assays using recombinant proteins synthesized in a bacterial system. Compared to the ancestral Dpse\\OBP57de, Dmel\\OBP57d was more specialized to tridecanoic acid while Dmel\\OBP57e was generalized regarding their binding affinity, suggesting that the two OBP genes underwent subfunctionalization and neofunctionalization. A behavioral analysis using knockout flies supported that the biological role is different between OBP57d and OBP57e in vivo. Site-directed mutagenesis of the evolutionarily conserved amino acids revealed that these residues play an important role in protein folding. These findings provide a clue to understanding how the repertoire of OBP genes is maintained in a genome under natural selection.

  3. Evolution of MicroRNA Genes in Oryza sativa and Arabidopsis thaliana: An Update of the Inverted Duplication Model

    Science.gov (United States)

    Zhang, Yun; Jiang, Wen-kai; Gao, Li-zhi

    2011-01-01

    The origin and evolution of microRNA (miRNA) genes, which are of significance in tuning and buffering gene expressions in a number of critical cellular processes, have long attracted evolutionary biologists. However, genome-wide perspectives on their origins, potential mechanisms of their de novo generation and subsequent evolution remain largely unsolved in flowering plants. Here, genome-wide analyses of Oryza sativa and Arabidopsis thaliana revealed apparently divergent patterns of miRNA gene origins. A large proportion of miRNA genes in O. sativa were TE-related and MITE-related miRNAs in particular, whereas the fraction of these miRNA genes much decreased in A. thaliana. Our results show that the majority of TE-related and pseudogene-related miRNA genes have originated through inverted duplication instead of segmental or tandem duplication events. Based on the presented findings, we hypothesize and illustrate the four likely molecular mechanisms to de novo generate novel miRNA genes from TEs and pseudogenes. Our rice genome analysis demonstrates that non-MITEs and MITEs mediated inverted duplications have played different roles in de novo generating miRNA genes. It is confirmed that the previously proposed inverted duplication model may give explanations for non-MITEs mediated duplication events. However, many other miRNA genes, known from the earlier proposed model, were rather arisen from MITE transpositions into target genes to yield binding sites. We further investigated evolutionary processes spawned from de novo generated to maturely-formed miRNA genes and their regulatory systems. We found that miRNAs increase the tunability of some gene regulatory systems with low gene copy numbers. The results also suggest that gene balance effects may have largely contributed to the evolution of miRNA regulatory systems. PMID:22194805

  4. Gene duplication and adaptive evolution of digestive proteases in Drosophila arizonae female reproductive tracts.

    Directory of Open Access Journals (Sweden)

    Erin S Kelleher

    2007-08-01

    Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.

  5. Preimplantational genetic diagnosis and mutation detection in a family with duplication mutation of DMD gene.

    Science.gov (United States)

    Ye, Yinghui; Yu, Ping; Yong, Jing; Zhang, Ting; Wei, Xiaoming; Qi, Ming; Jin, Fan

    2014-01-01

    Duchenne muscular dystrophy (DMD) is an X-linked recessive neuromuscular disease caused by mutation in the DMD gene. A 38-year-old woman was referred to our hospital with her son who was diagnosed with DMD. Multiplex PCR failed to detect DMD mutations in the affected child. The female carrier underwent preimplantation genetic diagnosis by linkage analysis and gender determination. Eight embryos were biopsied after in vitro fertilization. Two healthy embryos determined both as females (E1 and E3) were transferred. Although the paternal allele was absent in E3, it was considered to be a result of allele dropout for the STR-49 marker. Surprisingly, a female and a male baby were delivered at 38 gestational weeks, suggesting that E3 was a male embryo with the allele dropout occurring at the SRY gene. Exon 2 duplication was detected in the DMD patient and the carrier mother using next-generation sequencing and multiple ligation-dependent probe amplification. Next, we verified the duplication of exon 2 by real-time PCR, using a special primer at 3' of intron 1, very close to exon 2. Finally, we confirmed that both newborns inherited the normal allele, using quantitative real-time PCR and linkage analysis. © 2014 S. Karger AG, Basel.

  6. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  7. Evolution of C2H2-zinc finger genes and subfamilies in mammals: Species-specific duplication and loss of clusters, genes and effector domains

    Directory of Open Access Journals (Sweden)

    Aubry Muriel

    2008-06-01

    Full Text Available Abstract Background C2H2 zinc finger genes (C2H2-ZNF constitute the largest class of transcription factors in humans and one of the largest gene families in mammals. Often arranged in clusters in the genome, these genes are thought to have undergone a massive expansion in vertebrates, primarily by tandem duplication. However, this view is based on limited datasets restricted to a single chromosome or a specific subset of genes belonging to the large KRAB domain-containing C2H2-ZNF subfamily. Results Here, we present the first comprehensive study of the evolution of the C2H2-ZNF family in mammals. We assembled the complete repertoire of human C2H2-ZNF genes (718 in total, about 70% of which are organized into 81 clusters across all chromosomes. Based on an analysis of their N-terminal effector domains, we identified two new C2H2-ZNF subfamilies encoding genes with a SET or a HOMEO domain. We searched for the syntenic counterparts of the human clusters in other mammals for which complete gene data are available: chimpanzee, mouse, rat and dog. Cross-species comparisons show a large variation in the numbers of C2H2-ZNF genes within homologous mammalian clusters, suggesting differential patterns of evolution. Phylogenetic analysis of selected clusters reveals that the disparity in C2H2-ZNF gene repertoires across mammals not only originates from differential gene duplication but also from gene loss. Further, we discovered variations among orthologs in the number of zinc finger motifs and association of the effector domains, the latter often undergoing sequence degeneration. Combined with phylogenetic studies, physical maps and an analysis of the exon-intron organization of genes from the SCAN and KRAB domains-containing subfamilies, this result suggests that the SCAN subfamily emerged first, followed by the SCAN-KRAB and finally by the KRAB subfamily. Conclusion Our results are in agreement with the "birth and death hypothesis" for the evolution of

  8. High time for a roll call: gene duplication and phylogenetic relationships of TCP-like genes in monocots

    Science.gov (United States)

    Mondragón-Palomino, Mariana; Trontin, Charlotte

    2011-01-01

    Background and Aims The TCP family is an ancient group of plant developmental transcription factors that regulate cell division in vegetative and reproductive structures and are essential in the establishment of flower zygomorphy. In-depth research on eudicot TCPs has documented their evolutionary and developmental role. This has not happened to the same extent in monocots, although zygomorphy has been critical for the diversification of Orchidaceae and Poaceae, the largest families of this group. Investigating the evolution and function of TCP-like genes in a wider group of monocots requires a detailed phylogenetic analysis of all available sequence information and a system that facilitates comparing genetic and functional information. Methods The phylogenetic relationships of TCP-like genes in monocots were investigated by analysing sequences from the genomes of Zea mays, Brachypodium distachyon, Oryza sativa and Sorghum bicolor, as well as EST data from several other monocot species. Key Results All available monocot TCP-like sequences are associated in 20 major groups with an average identity ≥64 % and most correspond to well-supported clades of the phylogeny. Their sequence motifs and relationships of orthology were documented and it was found that 67 % of the TCP-like genes of Sorghum, Oryza, Zea and Brachypodium are in microsyntenic regions. This analysis suggests that two rounds of whole genome duplication drove the expansion of TCP-like genes in these species. Conclusions A system of classification is proposed where putative or recognized monocot TCP-like genes are assigned to a specific clade of PCF-, CIN- or CYC/tb1-like genes. Specific biases in sequence data of this family that must be tackled when studying its molecular evolution and phylogeny are documented. Finally, the significant retention of duplicated TCP genes from Zea mays is considered in the context of balanced gene drive. PMID:21444336

  9. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  10. Structure, expression differentiation and evolution of duplicated fiber developmental genes in Gossypium barbadense and G. hirsutum.

    Science.gov (United States)

    Zhu, Huayu; Han, Xiaoyong; Lv, Junhong; Zhao, Liang; Xu, Xiaoyang; Zhang, Tianzhen; Guo, Wangzhen

    2011-02-25

    Both Gossypium hirsutum and G. barbadense probably originated from a common ancestor, but they have very different agronomic and fiber quality characters. Here we selected 17 fiber development-related genes to study their structures, tree topologies, chromosomal location and expression patterns to better understand the interspecific divergence of fiber development genes in the two cultivated tetraploid species. The sequence and structure of 70.59% genes were conserved with the same exon length and numbers in different species, while 29.41% genes showed diversity. There were 15 genes showing independent evolution between the A- and D-subgenomes after polyploid formation, while two evolved via different degrees of colonization. Chromosomal location showed that 22 duplicate genes were located in which at least one fiber quality QTL was detected. The molecular evolutionary rates suggested that the D-subgenome of the allotetraploid underwent rapid evolutionary differentiation, and selection had acted at the tetraploid level. Expression profiles at fiber initiation and early elongation showed that the transcripts levels of most genes were higher in Hai7124 than in TM-1. During the primary-secondary transition period, expression of most genes peaked earlier in TM-1 than in Hai7124. Homeolog expression profile showed that A-subgenome, or the combination of A- and D-subgenomes, played critical roles in fiber quality divergence of G. hirsutum and G. barbadense. However, the expression of D-subgenome alone also played an important role. Integrating analysis of the structure and expression to fiber development genes, suggests selective breeding for certain desirable fiber qualities played an important role in divergence of G. hirsutum and G. barbadense.

  11. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    International Nuclear Information System (INIS)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.

    2006-01-01

    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation

  12. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  13. XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication.

    Science.gov (United States)

    Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David

    2012-07-01

    Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.

  14. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

  15. Repeated Whole-Genome Duplication, Karyotype Reshuffling, and Biased Retention of Stress-Responding Genes in Buckler Mustard.

    Science.gov (United States)

    Geiser, Céline; Mandáková, Terezie; Arrigo, Nils; Lysak, Martin A; Parisod, Christian

    2016-01-01

    Whole-genome duplication (WGD) is usually followed by gene loss and karyotype repatterning. Despite evidence of new adaptive traits associated with WGD, the underpinnings and evolutionary significance of such genome fractionation remain elusive. Here, we use Buckler mustard (Biscutella laevigata) to infer processes that have driven the retention of duplicated genes after recurrent WGDs. In addition to the β- and α-WGD events shared by all Brassicaceae, cytogenetic and transcriptome analyses revealed two younger WGD events that occurred at times of environmental changes in the clade of Buckler mustard (Biscutelleae): a mesopolyploidy event from the late Miocene that was followed by considerable karyotype reshuffling and chromosome number reduction and a neopolyploidy event during the Pleistocene. Although a considerable number of the older duplicates presented signatures of retention under positive selection, the majority of retained duplicates arising from the younger mesopolyploidy WGD event matched predictions of the gene balance hypothesis and showed evidence of strong purifying selection as well as enrichment in gene categories responding to abiotic stressors. Retention of large stretches of chromosomes for both genomic copies supported the hypothesis that cycles of WGD and biased fractionation shaped the genome of this stress-tolerant polypolyloid, promoting the adaptive recruitment of stress-responding genes in the face of environmental challenges. © 2016 American Society of Plant Biologists. All rights reserved.

  16. Need-based up-regulation of protein levels in response to deletion of their duplicate genes.

    Directory of Open Access Journals (Sweden)

    Alexander DeLuna

    2010-03-01

    Full Text Available Many duplicate genes maintain functional overlap despite divergence over long evolutionary time scales. Deleting one member of a paralogous pair often has no phenotypic effect, unless its paralog is also deleted. It has been suggested that this functional compensation might be mediated by active up-regulation of expression of a gene in response to deletion of its paralog. However, it is not clear how prevalent such paralog responsiveness is, nor whether it is hardwired or dependent on feedback from environmental conditions. Here, we address these questions at the genomic scale using high-throughput flow cytometry of single-cell protein levels in differentially labeled cocultures of wild-type and paralog-knockout Saccharomyces cerevisiae strains. We find that only a modest fraction of proteins (22 out of 202 show significant up-regulation to deletion of their duplicate genes. However, these paralog-responsive proteins match almost exclusively duplicate pairs whose overlapping function is required for growth. Moreover, media conditions that add or remove requirements for the function of a duplicate gene pair specifically eliminate or create paralog responsiveness. Together, our results suggest that paralog responsiveness in yeast is need-based: it appears only in conditions in which the gene function is required. Physiologically, such need-based responsiveness could provide an adaptive mechanism for compensation of genetic, environmental, or stochastic perturbations in protein abundance.

  17. Duplications of the neuropeptide receptor gene VIPR2 confer significant risk for schizophrenia.

    LENUS (Irish Health Repository)

    Vacic, Vladimir

    2011-03-24

    Rare copy number variants (CNVs) have a prominent role in the aetiology of schizophrenia and other neuropsychiatric disorders. Substantial risk for schizophrenia is conferred by large (>500-kilobase) CNVs at several loci, including microdeletions at 1q21.1 (ref. 2), 3q29 (ref. 3), 15q13.3 (ref. 2) and 22q11.2 (ref. 4) and microduplication at 16p11.2 (ref. 5). However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia. Microduplications with variable breakpoints occurred within a 362-kilobase region and were detected in 29 of 8,290 (0.35%) patients versus 2 of 7,431 (0.03%) controls in the combined sample. All duplications overlapped or were located within 89 kilobases upstream of the vasoactive intestinal peptide receptor gene VIPR2. VIPR2 transcription and cyclic-AMP signalling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered vasoactive intestinal peptide signalling in the pathogenesis of schizophrenia and indicate the VPAC2 receptor as a potential target for the development of new antipsychotic drugs.

  18. Biological consequences of ancient gene acquisition and duplication in the large genome soil bacterium, ""solibacter usitatus"" strain Ellin6076

    Energy Technology Data Exchange (ETDEWEB)

    Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL

    2009-01-01

    Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.

  19. Cumulative Impact of Polychlorinated Biphenyl and Large Chromosomal Duplications on DNA Methylation, Chromatin, and Expression of Autism Candidate Genes.

    Science.gov (United States)

    Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M

    2016-12-13

    Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  20. A duplicate gene rooting of seed plants and the phylogenetic position of flowering plants.

    Science.gov (United States)

    Mathews, Sarah; Clements, Mark D; Beilstein, Mark A

    2010-02-12

    Flowering plants represent the most significant branch in the tree of land plants, with respect to the number of extant species, their impact on the shaping of modern ecosystems and their economic importance. However, unlike so many persistent phylogenetic problems that have yielded to insights from DNA sequence data, the mystery surrounding the origin of angiosperms has deepened with the advent and advance of molecular systematics. Strong statistical support for competing hypotheses and recent novel trees from molecular data suggest that the accuracy of current molecular trees requires further testing. Analyses of phytochrome amino acids using a duplicate gene-rooting approach yield trees that unite cycads and angiosperms in a clade that is sister to a clade in which Gingko and Cupressophyta are successive sister taxa to gnetophytes plus Pinaceae. Application of a cycads + angiosperms backbone constraint in analyses of a morphological dataset yields better resolved trees than do analyses in which extant gymnosperms are forced to be monophyletic. The results have implications both for our assessment of uncertainty in trees from sequence data and for our use of molecular constraints as a way to integrate insights from morphological and molecular evidence.

  1. The Role of Gene Duplication in the Evolution of Purine Nucleotide Salvage Pathways

    Science.gov (United States)

    Becerra, Arturo; Lazcano, Antonio

    1998-10-01

    Purine nucleotides are formed de novo by a widespread biochemical route that may be of monophyletic origin, or are synthesized from preformed purine bases and nucleosides through different salvage pathways. Three monophyletic sets of purine salvage enzymes, each of which catalyzes mechanistically similar reactions, can be identified: (a) adenine-, xanthine-, hypoxanthine- and guanine-phosphoribosyltransferases, which are all homologous among themselves, as well as to nucleoside phosphorylases; (b) adenine deaminase, adenosine deaminase, and adenosine monophophate deaminase; and (c) guanine reductase and inosine monophosphate dehydrogenase. These homologies support the idea that substrate specificity is the outcome of gene duplication, and that the purine nucleotide salvage pathways were assembled by a patchwork process that probably took place before the divergence of the three cell domains (Bacteria, Archaea, and Eucarya). Based on the ability of adenine PRTase to catalyze the condensation of PRPP with 4-aminoimidazole-5-carboxamide (AICA), a simpler scheme of purine nucleotide biosynthesis is presented. This hypothetical route requires the prior evolution of PRPP biosynthesis. Since it has been argued that PRPP, nucleosides, and nucleotides are susceptible to hydrolysis, they are very unlikely prebiotic compounds. If this is the case, it implies that many purine salvage pathways appeared only after the evolution of phosphorylated sugar biosynthetic pathways made ribosides available.

  2. Ancestral gene duplication enabled the evolution of multifunctional cellulases in stick insects (Phasmatodea).

    Science.gov (United States)

    Shelomi, Matan; Heckel, David G; Pauchet, Yannick

    2016-04-01

    The Phasmatodea (stick insects) have multiple, endogenous, highly expressed copies of glycoside hydrolase family 9 (GH9) genes. The purpose for retaining so many was unknown. We cloned and expressed the enzymes in transfected insect cell lines, and tested the individual proteins against different plant cell wall component poly- and oligosaccharides. Nearly all isolated enzymes were active against carboxymethylcellulose, however most could also degrade glucomannan, and some also either xylan or xyloglucan. The latter two enzyme groups were each monophyletic, suggesting the evolution of these novel substrate specificities in an early ancestor of the order. Such enzymes are highly unusual for Metazoa, for which no xyloglucanases had been reported. Phasmatodea gut extracts could degrade multiple plant cell wall components fully into sugar monomers, suggesting that enzymatic breakdown of plant cell walls by the entire Phasmatodea digestome may contribute to the Phasmatodea nutritional budget. The duplication and neofunctionalization of GH9s in the ancestral Phasmatodea may have enabled them to specialize as folivores and diverge from their omnivorous ancestors. The structural changes enabling these unprecedented activities in the cellulases require further study. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  4. Complete mtDNA sequences of two millipedes suggest a new model for mitochondrial gene rearrangements: Duplication and non-random loss

    Energy Technology Data Exchange (ETDEWEB)

    Lavrov, Dennis V.; Boore, Jeffrey L.; Brown, Wesley M.

    2001-11-08

    We determined the complete mtDNA sequences of the millipedes Narceus annularus and Thyropygus sp. (Arthropoda: Diplopoda) and identified in both genomes all 37 genes typical for metazoan mtDNA. The arrangement of these genes is identical in the two millipedes, but differs from that inferred to be ancestral for arthropods by the location of four genes/gene clusters. This novel gene arrangement is unusual for animal mtDNA, in that genes with opposite transcriptional polarities are clustered in the genome and the two clusters are separated by two non-coding regions. The only exception to this pattern is the gene for cysteine tRNA, which is located in the part of the genome that otherwise contains all genes with the opposite transcriptional polarity. We suggest that a mechanism involving complete mtDNA duplication followed by the loss of genes, predetermined by their transcriptional polarity and location in the genome, could generate this gene arrangement from the one ancestral for arthropods. The proposed mechanism has important implications for phylogenetic inferences that are drawn on the basis of gene arrangement comparisons.

  5. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  6. Whole genome sequencing of field isolates reveals a common duplication of the Duffy binding protein gene in Malagasy Plasmodium vivax strains.

    Directory of Open Access Journals (Sweden)

    Didier Menard

    2013-11-01

    Full Text Available Plasmodium vivax is the most prevalent human malaria parasite, causing serious public health problems in malaria-endemic countries. Until recently the Duffy-negative blood group phenotype was considered to confer resistance to vivax malaria for most African ethnicities. We and others have reported that P. vivax strains in African countries from Madagascar to Mauritania display capacity to cause clinical vivax malaria in Duffy-negative people. New insights must now explain Duffy-independent P. vivax invasion of human erythrocytes.Through recent whole genome sequencing we obtained ≥ 70× coverage of the P. vivax genome from five field-isolates, resulting in ≥ 93% of the Sal I reference sequenced at coverage greater than 20×. Combined with sequences from one additional Malagasy field isolate and from five monkey-adapted strains, we describe here identification of DNA sequence rearrangements in the P. vivax genome, including discovery of a duplication of the P. vivax Duffy binding protein (PvDBP gene. A survey of Malagasy patients infected with P. vivax showed that the PvDBP duplication was present in numerous locations in Madagascar and found in over 50% of infected patients evaluated. Extended geographic surveys showed that the PvDBP duplication was detected frequently in vivax patients living in East Africa and in some residents of non-African P. vivax-endemic countries. Additionally, the PvDBP duplication was observed in travelers seeking treatment of vivax malaria upon returning home. PvDBP duplication prevalence was highest in west-central Madagascar sites where the highest frequencies of P. vivax-infected, Duffy-negative people were reported.The highly conserved nature of the sequence involved in the PvDBP duplication suggests that it has occurred in a recent evolutionary time frame. These data suggest that PvDBP, a merozoite surface protein involved in red cell adhesion is rapidly evolving, possibly in response to constraints imposed by

  7. Duplication in the microtubule-actin cross-linking factor 1 gene causes a novel neuromuscular condition

    DEFF Research Database (Denmark)

    Jørgensen, Louise H; Mosbech, Mai-Britt; Færgeman, Nils J

    2014-01-01

    . These findings suggest that changes in the MACF1 gene is implicated in this neuromuscular condition, which is an important observation since MACF1 has not previously been associated with any human disease and thus presents a key to understanding the essential nature of this gene....... is associated with developmental retardation and embryonic lethality. Here we present a family with a novel neuromuscular condition. Genetic analyses show a heterozygous duplication resulting in reduced MACF1 gene product. The functional consequence is affected motility observed as periodic hypotonia, lax...

  8. Effects of Gene Duplication, Positive Selection, and Shifts in Gene Expression on the Evolution of the Venom Gland Transcriptome in Widow Spiders.

    Science.gov (United States)

    Haney, Robert A; Clarke, Thomas H; Gadgil, Rujuta; Fitzpatrick, Ryan; Hayashi, Cheryl Y; Ayoub, Nadia A; Garb, Jessica E

    2016-01-05

    Gene duplication and positive selection can be important determinants of the evolution of venom, a protein-rich secretion used in prey capture and defense. In a typical model of venom evolution, gene duplicates switch to venom gland expression and change function under the action of positive selection, which together with further duplication produces large gene families encoding diverse toxins. Although these processes have been demonstrated for individual toxin families, high-throughput multitissue sequencing of closely related venomous species can provide insights into evolutionary dynamics at the scale of the entire venom gland transcriptome. By assembling and analyzing multitissue transcriptomes from the Western black widow spider and two closely related species with distinct venom toxicity phenotypes, we do not find that gene duplication and duplicate retention is greater in gene families with venom gland biased expression in comparison with broadly expressed families. Positive selection has acted on some venom toxin families, but does not appear to be in excess for families with venom gland biased expression. Moreover, we find 309 distinct gene families that have single transcripts with venom gland biased expression, suggesting that the switching of genes to venom gland expression in numerous unrelated gene families has been a dominant mode of evolution. We also find ample variation in protein sequences of venom gland-specific transcripts, lineage-specific family sizes, and ortholog expression among species. This variation might contribute to the variable venom toxicity of these species. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. High frequency of additional gene mutations in acute myeloid leukemia with MLL partial tandem duplication: DNMT3A mutation is associated with poor prognosis.

    Science.gov (United States)

    Kao, Hsiao-Wen; Liang, D Cherng; Kuo, Ming-Chung; Wu, Jin-Hou; Dunn, Po; Wang, Po-Nan; Lin, Tung-Liang; Shih, Yu-Shu; Liang, Sung-Tzu; Lin, Tung-Huei; Lai, Chen-Yu; Lin, Chun-Hui; Shih, Lee-Yung

    2015-10-20

    The mutational profiles of acute myeloid leukemia (AML) with partial tandem duplication of mixed-lineage leukemia gene (MLL-PTD) have not been comprehensively studied. We studied 19 gene mutations for 98 patients with MLL-PTD AML to determine the mutation frequency and clinical correlations. MLL-PTD was screened by reverse-transcriptase PCR and confirmed by real-time quantitative PCR. The mutational analyses were performed with PCR-based assays followed by direct sequencing. Gene mutations of signaling pathways occurred in 63.3% of patients, with FLT3-ITD (44.9%) and FLT3-TKD (13.3%) being the most frequent. 66% of patients had gene mutations involving epigenetic regulation, and DNMT3A (32.7%), IDH2 (18.4%), TET2 (18.4%), and IDH1 (10.2%) mutations were most common. Genes of transcription pathways and tumor suppressors accounted for 23.5% and 10.2% of patients. RUNX1 mutation occurred in 23.5% of patients, while none had NPM1 or double CEBPA mutation. 90.8% of MLL-PTD AML patients had at least one additional gene mutation. Of 55 MLL-PTD AML patients who received standard chemotherapy, age older than 50 years and DNMT3A mutation were associated with inferior outcome. In conclusion, gene mutations involving DNA methylation and activated signaling pathway were common co-existed gene mutations. DNMT3A mutation was a poor prognostic factor in MLL-PTD AML.

  10. Positive selection and ancient duplications in the evolution of class B floral homeotic genes of orchids and grasses

    Science.gov (United States)

    Mondragón-Palomino, Mariana; Hiese, Luisa; Härter, Andrea; Koch, Marcus A; Theißen, Günter

    2009-01-01

    Background Positive selection is recognized as the prevalence of nonsynonymous over synonymous substitutions in a gene. Models of the functional evolution of duplicated genes consider neofunctionalization as key to the retention of paralogues. For instance, duplicate transcription factors are specifically retained in plant and animal genomes and both positive selection and transcriptional divergence appear to have played a role in their diversification. However, the relative impact of these two factors has not been systematically evaluated. Class B MADS-box genes, comprising DEF-like and GLO-like genes, encode developmental transcription factors essential for establishment of perianth and male organ identity in the flowers of angiosperms. Here, we contrast the role of positive selection and the known divergence in expression patterns of genes encoding class B-like MADS-box transcription factors from monocots, with emphasis on the family Orchidaceae and the order Poales. Although in the monocots these two groups are highly diverse and have a strongly canalized floral morphology, there is no information on the role of positive selection in the evolution of their distinctive flower morphologies. Published research shows that in Poales, class B-like genes are expressed in stamens and in lodicules, the perianth organs whose identity might also be specified by class B-like genes, like the identity of the inner tepals of their lily-like relatives. In orchids, however, the number and pattern of expression of class B-like genes have greatly diverged. Results The DEF-like genes from Orchidaceae form four well-supported, ancient clades of orthologues. In contrast, orchid GLO-like genes form a single clade of ancient orthologues and recent paralogues. DEF-like genes from orchid clade 2 (OMADS3-like genes) are under less stringent purifying selection than the other orchid DEF-like and GLO-like genes. In comparison with orchids, purifying selection was less stringent in DEF

  11. Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Mara Sangiovanni

    2013-12-01

    Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

  12. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

    Directory of Open Access Journals (Sweden)

    Münk Carsten

    2012-05-01

    Full Text Available Abstract Background The APOBEC3 (A3 genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure.

  13. Comparative transcriptome analysis reveals whole-genome duplications and gene selection patterns in cultivated and wild Chrysanthemum species.

    Science.gov (United States)

    Won, So Youn; Kwon, Soo-Jin; Lee, Tae-Ho; Jung, Jae-A; Kim, Jung Sun; Kang, Sang-Ho; Sohn, Seong-Han

    2017-11-01

    Comparative transcriptome analysis of wild and cultivated chrysanthemums provides valuable genomic resources and helps uncover common and divergent patterns of genome and gene evolution in these species. Plants are unique in that they employ polyploidy (or whole-genome duplication, WGD) as a key process for speciation and evolution. The Chrysanthemum genus is closely associated with hybridization and polyploidization, with Chrysanthemum species exhibiting diverse ploidy levels. The commercially important species, C. morifolium is an allohexaploid plant that is thought to have originated via the hybridization of several Chrysanthemum species, but the genomic and molecular evolutionary mechanisms remain poorly understood. In the present study, we sequenced and compared the transcriptomes of C. morifolium and the wild Korean diploid species, C. boreale. De novo transcriptome assembly revealed 11,318 genes in C. morifolium and 10,961 genes in C. boreale, whose functions were annotated by homology searches. An analysis of synonymous substitution rates (Ks) of paralogous and orthologous genes suggested that the two Chrysanthemum species commonly experienced the Asteraceae paleopolyploidization and recent genome duplication or triplication before the divergence of these species. Intriguingly, C. boreale probably underwent rapid diploidization, with a reduction in chromosome number, whereas C. morifolium maintained the original chromosome number. Analysis of the ratios of non-synonymous to synonymous nucleotide substitutions (Ka/Ks) between orthologous gene pairs indicated that 107 genes experienced positive selection, which may have been crucial for the adaptation, domestication, and speciation of Chrysanthemum.

  14. A 7-bp insertion in the 3' untranslated region suggests the duplication and concerted evolution of the rabbit SRY gene

    Directory of Open Access Journals (Sweden)

    Ferrand Nuno

    2006-04-01

    Full Text Available Abstract In this work we report the genetic polymorphism of a 7-bp insertion in the 3' untranslated region of the rabbit SRY gene. The polymorphic GAATTAA motif was found exclusively in one of the two divergent rabbit Y-chromosomal lineages, suggesting that its origin is more recent than the separation of the O. c. algirus and O. c. cuniculus Y-chromosomes. In addition, the remarkable observation of haplotypes exhibiting 0, 1 and 2 7-bp inserts in essentially all algirus populations suggests that the rabbit SRY gene is duplicated and evolving under concerted evolution.

  15. Exploring genes and pathways involved in migraine

    NARCIS (Netherlands)

    Eising, E.

    2017-01-01

    The research in this thesis was aimed at identifying genes and molecular pathways involved in migraine. To this end, two gene expression analyses were performed in brain tissue obtained from transgenic mouse models for familial hemiplegic migraine (FHM), a monogenic subtype of migraine with aura.

  16. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  17. Heterogeneous expression pattern of tandem duplicated sHsps genes during fruit ripening in two tomato species

    Science.gov (United States)

    Arce, DP; Krsticevic, FJ; Ezpeleta, J.; Ponce, SD; Pratta, GR; Tapia, E.

    2016-04-01

    The small heat shock proteins (sHSPs) have been found to play a critical role in physiological stress conditions in protecting proteins from irreversible aggregation. To characterize the gene expression profile of four sHsps with a tandem gene structure arrangement in the domesticated Solanum lycopersicum (Heinz 1706) genome and its wild close relative Solanum pimpinellifolium (LA1589), differential gene expression analysis using RNA-Seq was conducted in three ripening stages in both cultivars fruits. Gene promoter analysis was performed to explain the heterogeneous pattern of gene expression found for these tandem duplicated sHsps. In silico analysis results contribute to refocus wet experiment analysis in tomato sHsp family proteins.

  18. Duplication of the IGFBP-2 gene in teleost fish: protein structure and functionality conservation and gene expression divergence.

    Directory of Open Access Journals (Sweden)

    Jianfeng Zhou

    growth and development primarily by binding to and inhibiting IGF actions in vivo. The duplicated IGFBP-2 genes may provide additional flexibility in the regulation of IGF activities.

  19. Apolipoprotein gene involved in lipid metabolism

    Science.gov (United States)

    Rubin, Edward; Pennacchio, Len A.

    2007-07-03

    Methods and materials for studying the effects of a newly identified human gene, APOAV, and the corresponding mouse gene apoAV. The sequences of the genes are given, and transgenic animals which either contain the gene or have the endogenous gene knocked out are described. In addition, single nucleotide polymorphisms (SNPs) in the gene are described and characterized. It is demonstrated that certain SNPs are associated with diseases involving lipids and triglycerides and other metabolic diseases. These SNPs may be used alone or with SNPs from other genes to study individual risk factors. Methods for intervention in lipid diseases, including the screening of drugs to treat lipid-related or diabetic diseases are also disclosed.

  20. Population genetics of duplicated alternatively spliced exons of the Dscam gene in Daphnia and Drosophila

    NARCIS (Netherlands)

    Brites, Daniela; Encinas-Viso, Francisco; Ebert, Dieter; Du Pasquier, Louis; Haag, Christoph R.

    2011-01-01

    In insects and crustaceans, the Down syndrome cell adhesion molecule (Dscam) occurs in many different isoforms. These are produced by mutually exclusive alternative splicing of dozens of tandem duplicated exons coding for parts or whole immunoglobulin (Ig) domains of the Dscam protein. This

  1. Comparative genomic analysis reveals occurrence of genetic recombination in virulent Cryptosporidium hominis subtypes and telomeric gene duplications in Cryptosporidium parvum.

    Science.gov (United States)

    Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua

    2015-04-18

    Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to

  2. The gene for death agonist BID maps to the region of human 22q11.2 duplicated in cat eye syndrome chromosomes and to mouse chromosome 6.

    Science.gov (United States)

    Footz, T K; Birren, B; Minoshima, S; Asakawa, S; Shimizu, N; Riazi, M A; McDermid, H E

    1998-08-01

    Cat eye syndrome (CES) is associated with a duplication of a segment of human chromosome 22q11.2. Only one gene, ATP6E, has been previously mapped to this duplicated region. We now report the mapping of the human homologue of the apoptotic agonist Bid to human chromosome 22 near locus D22S57 in the CES region. Dosage analysis demonstrated that BID is located just distal to the CES region critical for the majority of malformations associated with the syndrome (CESCR), as previously defined by a single patient with an unusual supernumerary chromosome. However, BID remains a good candidate for involvement in CES-related mental impairment, and its overexpression may subtly add to the phenotype of CES patients. Our mapping of murine Bid confirms that the synteny of the CESCR and the 22q11 deletion syndrome critical region immediately telomeric on human chromosome 22 is not conserved in mice. Bid and adjacent gene Atp6e were found to map to mousechromosome 6, while the region homologous to the DGSCR is known to map to mouse chromosome 16. Copyright 1998 Academic Press.

  3. Dissecting a Hidden Gene Duplication: The Arabidopsis thaliana SEC10 Locus

    Czech Academy of Sciences Publication Activity Database

    Vukašinović, Nemanja; Cvrčková, F.; Eliáš, M.; Cole, R.; Fowler, J.E.; Žárský, Viktor; Synek, Lukáš

    2014-01-01

    Roč. 9, č. 4 (2014) E-ISSN 1932-6203 R&D Projects: GA ČR GPP501/11/P853; GA ČR(CZ) GAP305/11/1629 Grant - others:GA MŠk ME10033 Institutional support: RVO:61389030 Keywords : WHOLE-GENOME * ARABIDOPSIS -THALIANA * RECENT SEGMENTAL DUPLICATIONS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.234, year: 2014

  4. Becker Muscular Dystrophy (BMD) caused by duplication of exons 3-6 of the dystrophin gene presenting as dilated cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, A.C.; Allingham-Hawkins, D.J.; Becker, L. [Univ. of Toronto, Ontario (Canada)] [and others

    1994-09-01

    X-linked dilated cardiomyopathy (XLCM) is a progressive myocardial disease presenting with congestive heart failure in teenage males without clinical signs of skeletal myopathy. Tight linkage of XLCM to the DMD locus has been demonstrated; it has been suggested that, at least in some families, XLCM is a {open_quotes}dystrophinopathy.{close_quotes} We report a 14-year-old boy who presented with acute heart failure due to dilated cardiomyopathy. He had no history of muscle weakness, but physical examination revealed pseudohypertrophy of the calf muscles. He subsequently received a heart transplantation. Family history was negative. Serum CK level at the time of diagnosis was 10,416. Myocardial biopsy showed no evidence of carditis. Dystrophin staining of cardiac and skeletal muscle with anti-sera to COOH and NH{sub 2}termini showed a patchy distribution of positivity suggestive of Becker muscular dystrophy. Analysis of 18 of the 79 dystrophin exons detected a duplication that included exons 3-6. The proband`s mother has an elevated serum CK and was confirmed to be a carrier of the same duplication. A mutation in the muscle promotor region of the dystrophin gene has been implicated in the etiology of SLCM. However, Towbin et al. (1991) argued that other 5{prime} mutations in the dystrophin gene could cause selective cardiomyopathy. The findings in our patient support the latter hypothesis. This suggests that there are multiple regions in the dystrophin gene which, when disrupted, can cause isolated dilated cardiomyopathy.

  5. Whole-gene positive selection, elevated synonymous substitution rates, duplication, and indel evolution of the chloroplast clpP1 gene.

    Directory of Open Access Journals (Sweden)

    Per Erixon

    Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the

  6. Gene Duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a.

    Directory of Open Access Journals (Sweden)

    Keith A Hultman

    2007-01-01

    Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that

  7. Rapid transcriptional plasticity of duplicated gene clusters enables a clonally reproducing aphid to colonise diverse plant species.

    Science.gov (United States)

    Mathers, Thomas C; Chen, Yazhou; Kaithakottil, Gemy; Legeai, Fabrice; Mugford, Sam T; Baa-Puyoulet, Patrice; Bretaudeau, Anthony; Clavijo, Bernardo; Colella, Stefano; Collin, Olivier; Dalmay, Tamas; Derrien, Thomas; Feng, Honglin; Gabaldón, Toni; Jordan, Anna; Julca, Irene; Kettles, Graeme J; Kowitwanich, Krissana; Lavenier, Dominique; Lenzi, Paolo; Lopez-Gomollon, Sara; Loska, Damian; Mapleson, Daniel; Maumus, Florian; Moxon, Simon; Price, Daniel R G; Sugio, Akiko; van Munster, Manuella; Uzest, Marilyne; Waite, Darren; Jander, Georg; Tagu, Denis; Wilson, Alex C C; van Oosterhout, Cock; Swarbreck, David; Hogenhout, Saskia A

    2017-02-13

    The prevailing paradigm of host-parasite evolution is that arms races lead to increasing specialisation via genetic adaptation. Insect herbivores are no exception and the majority have evolved to colonise a small number of closely related host species. Remarkably, the green peach aphid, Myzus persicae, colonises plant species across 40 families and single M. persicae clonal lineages can colonise distantly related plants. This remarkable ability makes M. persicae a highly destructive pest of many important crop species. To investigate the exceptional phenotypic plasticity of M. persicae, we sequenced the M. persicae genome and assessed how one clonal lineage responds to host plant species of different families. We show that genetically identical individuals are able to colonise distantly related host species through the differential regulation of genes belonging to aphid-expanded gene families. Multigene clusters collectively upregulate in single aphids within two days upon host switch. Furthermore, we demonstrate the functional significance of this rapid transcriptional change using RNA interference (RNAi)-mediated knock-down of genes belonging to the cathepsin B gene family. Knock-down of cathepsin B genes reduced aphid fitness, but only on the host that induced upregulation of these genes. Previous research has focused on the role of genetic adaptation of parasites to their hosts. Here we show that the generalist aphid pest M. persicae is able to colonise diverse host plant species in the absence of genetic specialisation. This is achieved through rapid transcriptional plasticity of genes that have duplicated during aphid evolution.

  8. Improved detection of deletions and duplications in the DMD gene using the multiplex ligation-dependent probe amplification (MLPA) method.

    Science.gov (United States)

    Sansović, Ivona; Barišić, Ingeborg; Dumić, Katja

    2013-04-01

    The multiplex ligation-dependent probe amplification (MLPA) assay is the most powerful tool in screening for deletions and duplications in the dystrophin gene in patients with Duchenne and Becker muscular dystrophy (DMD/BMD). The efficacy of the assay was validated by testing 20 unrelated male patients with DMD/BMD who had already been screened by multiplex PCR (mPCR). We detected two duplications that had been missed by mPCR. In one DMD patient showing an ambiguous MLPA result, a novel mutation (c.3808_3809insG) was identified. MLPA improved the mutation detection rate of mPCR by 15 %. The results of our study (1) confirmed MLPA to be the method of choice for detecting DMD gene rearrangements in DMD/BMD patients, (2) showed that ambiguous MLPA amplification products should be verified by other methods, and (3) indicated that the MLPA method could be used in screening even for small mutations located in the probe-binding regions.

  9. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Directory of Open Access Journals (Sweden)

    Fernando Martínez-Alberola

    Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  10. A tandem segmental duplication (TSD) in green revolution gene Rht-D1b region underlies plant height variation.

    Science.gov (United States)

    Li, Yiyuan; Xiao, Jianhui; Wu, Jiajie; Duan, Jialei; Liu, Yue; Ye, Xingguo; Zhang, Xin; Guo, Xiuping; Gu, Yongqiang; Zhang, Lichao; Jia, Jizeng; Kong, Xiuying

    2012-10-01

    • Rht-D1c (Rht10) carried by Chinese wheat (Triticum aestivum) line Aibian 1 is an allele at the Rht-D1 locus. Among the Rht-1 alleles, little is known about Rht-D1c although it determines an extreme dwarf phenotype in wheat. • Here, we cloned and functionally characterized Rht-D1c using a combination of Southern blotting, target region sequencing, gene expression analysis and transgenic experiments. • We found that the Rht-D1c allele was generated through a tandem segmental duplication (TSD) of a > 1 Mb region, resulting in two copies of the Rht-D1b. Two copies of Rht-D1b in the TSD were three-fold more effective in reducing plant height than a single copy, and transformation with a segment containing the tandemly duplicated copy of Rht-D1b resulted in the same level of reduction of plant height as the original copy in Aibian 1. • Our results suggest that changes in gene copy number are one of the important sources of genetic diversity and some of these changes could be directly associated with important traits in crops. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  11. Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication

    Directory of Open Access Journals (Sweden)

    Ge Song

    2010-04-01

    Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub

  12. A case report: Becker muscular dystrophy presenting with epilepsy and dysgnosia induced by duplication mutation of Dystrophin gene.

    Science.gov (United States)

    Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan

    2016-12-12

    Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.

  13. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  14. Three duplication events and variable molecular evolution ...

    Indian Academy of Sciences (India)

    Three duplication events and variable molecular evolution characteristics involved in multiple GGPS genes of six Solanaceae species. FENG LI CHUNYANG WEI CHAN QIAO ZHENXI CHEN PENG WANG PAN WEI RAN WANG LIFENG JIN JUN YANG FUCHENG LIN ZHAOPENG LUO. RESEARCH NOTE Volume 95 Issue ...

  15. Three duplication events and variable molecular evolution ...

    Indian Academy of Sciences (India)

    Supplementary data: Three duplication events and variable molecular evolution characteristics involved in multiple GGPS genes of six Solanaceae species. Feng Li, Chunyang Wei, Chan Qiao, Zhenxi Chen, Peng Wang, Pan Wei, Ran Wang, Lifeng Jin, Jun Yang,. Fucheng Lin and Zhaopeng Luo. J. Genet. 95, 453–457.

  16. Three duplication events and variable molecular evolution ...

    Indian Academy of Sciences (India)

    RESEARCH NOTE. Three duplication events and variable molecular evolution characteristics involved in multiple GGPS genes of six Solanaceae species. FENG LI1, CHUNYANG WEI2, CHAN QIAO3, ZHENXI CHEN4, PENG WANG4, PAN WEI1, RAN WANG1,. LIFENG JIN1, JUN YANG1, FUCHENG LIN1 and ZHAOPENG ...

  17. Genomic evidence of gene duplication and adaptive evolution of Toll like receptors (TLR2 and TLR4) in reptiles.

    Science.gov (United States)

    Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai

    2018-04-01

    Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  19. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  20. Evolution of double MutT/Nudix domain-containing proteins: similar domain architectures from independent gene duplication-fusion events.

    Science.gov (United States)

    Lin, Jun; Hu, Yihuai; Tian, Bing; Hua, Yuejin

    2009-10-01

    The MutT/Nudix superfamily proteins repair DNA damage and play a role in human health and disease. In this study, we examined two different cases of double MutT/Nudix domain-containing proteins from eukaryotes and prokaryotes. Firstly, these double domain proteins were discovered in Drosophila, but only single Nudix domain proteins were found in other animals. The phylogenetic tree was constructed based on the protein sequence of Nudix_N and Nudix_C from Drosophila, and Nudix from other animals. The phylogenetic analysis suggested that the double Nudix domain proteins might have undergone a gene duplication-speciation-fusion process. Secondly, two genes of the MutT family, DR0004 and DR0329, were fused by two mutT gene segments and formed double MutT domain protein genes in Deinococcus radiodurans. The evolutionary tree of bacterial MutT proteins suggested that the double MutT domain proteins in D. radiodurans probably resulted from a gene duplication-fusion event after speciation. Gene duplication-fusion is a basic and important gene innovation mechanism for the evolution of double MutT/Nudix domain proteins. Independent gene duplication-fusion events resulted in similar domain architectures of different double MutT/Nudix domain proteins.

  1. Genes involved in cell division in mycoplasmas

    OpenAIRE

    Alarcón, Frank; Vasconcelos, Ana Tereza Ribeiro de; Yim, Lucia; Zaha, Arnaldo

    2007-01-01

    Bacterial cell division has been studied mainly in model systems such as Escherichia coli and Bacillus subtilis, where it is described as a complex process with the participation of a group of proteins which assemble into a multiprotein complex called the septal ring. Mycoplasmas are cell wall-less bacteria presenting a reduced genome. Thus, it was important to compare their genomes to analyze putative genes involved in cell division processes. The division and cell wall (dcw) cluster, which ...

  2. An ancestral MADS-box gene duplication occurred before the divergence of plants and animals

    OpenAIRE

    Alvarez-Buylla, Elena R.; Pelaz, Soraya; Liljegren, Sarah J.; Gold, Scott E.; Burgeff, Caroline; Ditta, Gary S.; Ribas de Pouplana, Lluis; Martínez-Castilla, León; Yanofsky, Martin F.

    2000-01-01

    Changes in genes encoding transcriptional regulators can alter development and are important components of the molecular mechanisms of morphological evolution. MADS-box genes encode transcriptional regulators of diverse and important biological functions. In plants, MADS-box genes regulate flower, fruit, leaf, and root development. Recent sequencing efforts in Arabidopsis have allowed a nearly complete sampling of the MADS-box gene family from a single plant, something that was lacking in pre...

  3. Distal Xq duplication and functional Xq disomy

    Directory of Open Access Journals (Sweden)

    Schluth-Bolard Caroline

    2009-02-01

    Full Text Available Abstract Distal Xq duplications refer to chromosomal disorders resulting from involvement of the long arm of the X chromosome (Xq. Clinical manifestations widely vary depending on the gender of the patient and on the gene content of the duplicated segment. Prevalence of Xq duplications remains unknown. About 40 cases of Xq28 functional disomy due to cytogenetically visible rearrangements, and about 50 cases of cryptic duplications encompassing the MECP2 gene have been reported. The most frequently reported distal duplications involve the Xq28 segment and yield a recognisable phenotype including distinctive facial features (premature closure of the fontanels or ridged metopic suture, broad face with full cheeks, epicanthal folds, large ears, small and open mouth, ear anomalies, pointed nose, abnormal palate and facial hypotonia, major axial hypotonia, severe developmental delay, severe feeding difficulties, abnormal genitalia and proneness to infections. Xq duplications may be caused either by an intrachromosomal duplication or an unbalanced X/Y or X/autosome translocation. In XY males, structural X disomy always results in functional disomy. In females, failure of X chromosome dosage compensation could result from a variety of mechanisms, including an unfavourable pattern of inactivation, a breakpoint separating an X segment from the X-inactivation centre in cis, or a small ring chromosome. The MECP2 gene in Xq28 is the most important dosage-sensitive gene responsible for the abnormal phenotype in duplications of distal Xq. Diagnosis is based on clinical features and is confirmed by CGH array techniques. Differential diagnoses include Prader-Willi syndrome and Alpha thalassaemia-mental retardation, X linked (ATR-X. The recurrence risk is significant if a structural rearrangement is present in one of the parent, the most frequent situation being that of an intrachromosomal duplication inherited from the mother. Prenatal diagnosis is performed by

  4. Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

    International Nuclear Information System (INIS)

    Essouissi, Imen

    2006-01-01

    Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

  5. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  6. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, J; Han, C; Gordon, L A; Terry, A; Prabhakar, S; She, X; Xie, G; Hellsten, U; Chan, Y M; Altherr, M; Couronne, O; Aerts, A; Bajorek, E; Black, S; Blumer, H; Branscomb, E; Brown, N; Bruno, W J; Buckingham, J; Callen, D F; Campbell, C S; Campbell, M L; Campbell, E W; Caoile, C; Challacombe, J F; Chasteen, L A; Chertkov, O; Chi, H C; Christensen, M; Clark, L M; Cohn, J D; Denys, M; Detter, J C; Dickson, M; Dimitrijevic-Bussod, M; Escobar, J; Fawcett, J J; Flowers, D; Fotopulos, D; Glavina, T; Gomez, M; Gonzales, E; Goodstein, D; Goodwin, L A; Grady, D L; Grigoriev, I; Groza, M; Hammon, N; Hawkins, T; Haydu, L; Hildebrand, C E; Huang, W; Israni, S; Jett, J; Jewett, P B; Kadner, K; Kimball, H; Kobayashi, A; Krawczyk, M; Leyba, T; Longmire, J L; Lopez, F; Lou, Y; Lowry, S; Ludeman, T; Manohar, C F; Mark, G A; McMurray, K L; Meincke, L J; Morgan, J; Moyzis, R K; Mundt, M O; Munk, A C; Nandkeshwar, R D; Pitluck, S; Pollard, M; Predki, P; Parson-Quintana, B; Ramirez, L; Rash, S; Retterer, J; Ricke, D O; Robinson, D; Rodriguez, A; Salamov, A; Saunders, E H; Scott, D; Shough, T; Stallings, R L; Stalvey, M; Sutherland, R D; Tapia, R; Tesmer, J G; Thayer, N; Thompson, L S; Tice, H; Torney, D C; Tran-Gyamfi, M; Tsai, M; Ulanovsky, L E; Ustaszewska, A; Vo, N; White, P S; Williams, A L; Wills, P L; Wu, J; Wu, K; Yang, J; DeJong, P; Bruce, D; Doggett, N A; Deaven, L; Schmutz, J; Grimwood, J; Richardson, P; Rokhsar, D S; Eichler, E E; Gilna, P; Lucas, S M; Myers, R M; Rubin, E M; Pennacchio, L A

    2005-04-06

    Human chromosome 16 features one of the highest levels of segmentally duplicated sequence among the human autosomes. We report here the 78,884,754 base pairs of finished chromosome 16 sequence, representing over 99.9% of its euchromatin. Manual annotation revealed 880 protein-coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes, and 3 RNA pseudogenes. These genes include metallothionein, cadherin, and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobase pairs were identified and result in gene content differences among humans. While the segmental duplications of chromosome 16 are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events likely to have had an impact on the evolution of primates and human disease susceptibility.

  7. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  8. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Duplications involving a conserved regulatory element downstream of BMP2 are associated with brachydactyly type A2

    DEFF Research Database (Denmark)

    Dathe, Katarina; Kjaer, Klaus W; Brehm, Anja

    2009-01-01

    Autosomal-dominant brachydactyly type A2 (BDA2), a limb malformation characterized by hypoplastic middle phalanges of the second and fifth fingers, has been shown to be due to mutations in the Bone morphogenetic protein receptor 1B (BMPR1B) or in its ligand Growth and differentiation factor 5 (GD...... within the identified duplication. Our results reveal an additional functional mechanism for the pathogenesis of BDA2, which is duplication of a regulatory element that affects the expression of BMP2 in the developing limb.......Autosomal-dominant brachydactyly type A2 (BDA2), a limb malformation characterized by hypoplastic middle phalanges of the second and fifth fingers, has been shown to be due to mutations in the Bone morphogenetic protein receptor 1B (BMPR1B) or in its ligand Growth and differentiation factor 5 (GDF5...... sequences suggestive of a long-range regulator. By using a transgenic mouse model we can show that this sequence is able to drive expression of a X-Gal reporter construct in the limbs. The almost complete overlap with endogenous Bmp2 expression indicates that a limb-specific enhancer of Bmp2 is located...

  10. A centrosome-autonomous signal that involves centriole disengagement permits centrosome duplication in G2 phase after DNA damage.

    LENUS (Irish Health Repository)

    2010-11-15

    DNA damage can induce centrosome overduplication in a manner that requires G2-to-M checkpoint function, suggesting that genotoxic stress can decouple the centrosome and chromosome cycles. How this happens is unclear. Using live-cell imaging of cells that express fluorescently tagged NEDD1\\/GCP-WD and proliferating cell nuclear antigen, we found that ionizing radiation (IR)-induced centrosome amplification can occur outside S phase. Analysis of synchronized populations showed that significantly more centrosome amplification occurred after irradiation of G2-enriched populations compared with G1-enriched or asynchronous cells, consistent with G2 phase centrosome amplification. Irradiated and control populations of G2 cells were then fused to test whether centrosome overduplication is allowed through a diffusible stimulatory signal, or the loss of a duplication-inhibiting signal. Irradiated G2\\/irradiated G2 cell fusions showed significantly higher centrosome amplification levels than irradiated G2\\/unirradiated G2 fusions. Chicken-human cell fusions demonstrated that centrosome amplification was limited to the irradiated partner. Our finding that only the irradiated centrosome can duplicate supports a model where a centrosome-autonomous inhibitory signal is lost upon irradiation of G2 cells. We observed centriole disengagement after irradiation. Although overexpression of dominant-negative securin did not affect IR-induced centrosome amplification, Plk1 inhibition reduced radiation-induced amplification. Together, our data support centriole disengagement as a licensing signal for DNA damage-induced centrosome amplification.

  11. Independent and Parallel Evolution of New Genes by Gene Duplication in Two Origins of C4 Photosynthesis Provides New Insight into the Mechanism of Phloem Loading in C4 Species.

    Science.gov (United States)

    Emms, David M; Covshoff, Sarah; Hibberd, Julian M; Kelly, Steven

    2016-07-01

    C4 photosynthesis is considered one of the most remarkable examples of evolutionary convergence in eukaryotes. However, it is unknown whether the evolution of C4 photosynthesis required the evolution of new genes. Genome-wide gene-tree species-tree reconciliation of seven monocot species that span two origins of C4 photosynthesis revealed that there was significant parallelism in the duplication and retention of genes coincident with the evolution of C4 photosynthesis in these lineages. Specifically, 21 orthologous genes were duplicated and retained independently in parallel at both C4 origins. Analysis of this gene cohort revealed that the set of parallel duplicated and retained genes is enriched for genes that are preferentially expressed in bundle sheath cells, the cell type in which photosynthesis was activated during C4 evolution. Furthermore, functional analysis of the cohort of parallel duplicated genes identified SWEET-13 as a potential key transporter in the evolution of C4 photosynthesis in grasses, and provides new insight into the mechanism of phloem loading in these C4 species. C4 photosynthesis, gene duplication, gene families, parallel evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. A duplicated coxI gene is associated with cytoplasmic male sterility ...

    Indian Academy of Sciences (India)

    The new CMS line is comparable to euplasmic lines for almost all characters, except for flowers which bear slender, needle-like anthers with aborted pollen. Detailed Southern analysis revealed two copies of coxI gene in the CMS line. One copy, coxI-1 is similar to the coxI gene of B. juncea, whereas the second copy, coxI-2 ...

  13. Inactivation of gene expression in plants as a consequence of specific sequence duplication.

    OpenAIRE

    Flavell, R B

    1994-01-01

    Numerous examples now exist in plants where the insertion of multiple copies of a transgene leads to loss of expression of some or all copies of the transgene. Where the transgene contains sequences homologous to an endogenous gene, expression of both transgene and endogenous gene is sometimes found to be impaired. Several examples of these phenomena displaying different features are reviewed. Possible explanations for the observed phenomena are outlined, drawing on known cellular processes i...

  14. Origin, evolution, and population genetics of the selfish Segregation Distorter gene duplication in European and African populations of Drosophila melanogaster.

    Science.gov (United States)

    Brand, Cara L; Larracuente, Amanda M; Presgraves, Daven C

    2015-05-01

    Meiotic drive elements are a special class of evolutionarily "selfish genes" that subvert Mendelian segregation to gain preferential transmission at the expense of homologous loci. Many drive elements appear to be maintained in populations as stable polymorphisms, their equilibrium frequencies determined by the balance between drive (increasing frequency) and selection (decreasing frequency). Here we show that a classic, seemingly balanced, drive system is instead characterized by frequent evolutionary turnover giving rise to dynamic, rather than stable, equilibrium frequencies. The autosomal Segregation Distorter (SD) system of the fruit fly Drosophila melanogaster is a selfish coadapted meiotic drive gene complex in which the major driver corresponds to a partial duplication of the gene Ran-GTPase activating protein (RanGAP). SD chromosomes segregate at similar, low frequencies of 1-5% in natural populations worldwide, consistent with a balanced polymorphism. Surprisingly, our population genetic analyses reveal evidence for parallel, independent selective sweeps of different SD chromosomes in populations on different continents. These findings suggest that, rather than persisting at a single stable equilibrium, SD chromosomes turn over frequently within populations. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

  15. Genes involved in cell division in mycoplasmas

    Directory of Open Access Journals (Sweden)

    Frank Alarcón

    2007-01-01

    Full Text Available Bacterial cell division has been studied mainly in model systems such as Escherichia coli and Bacillus subtilis, where it is described as a complex process with the participation of a group of proteins which assemble into a multiprotein complex called the septal ring. Mycoplasmas are cell wall-less bacteria presenting a reduced genome. Thus, it was important to compare their genomes to analyze putative genes involved in cell division processes. The division and cell wall (dcw cluster, which in E. coli and B. subtilis is composed of 16 and 17 genes, respectively, is represented by only three to four genes in mycoplasmas. Even the most conserved protein, FtsZ, is not present in all mycoplasma genomes analyzed so far. A model for the FtsZ protein from Mycoplasma hyopneumoniae and Mycoplasma synoviae has been constructed. The conserved residues, essential for GTP/GDP binding, are present in FtsZ from both species. A strong conservation of hydrophobic amino acid patterns is observed, and is probably necessary for the structural stability of the protein when active. M. synoviae FtsZ presents an extended amino acid sequence at the C-terminal portion of the protein, which may participate in interactions with other still unknown proteins crucial for the cell division process.

  16. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Science.gov (United States)

    Amanda L. Pendleton; Katherine E. Smith; Nicolas Feau; Francis M. Martin; Igor V. Grigoriev; Richard Hamelin; C.Dana Nelson; J.Gordon Burleigh; John M. Davis

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops . A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen...

  17. The physical map of wheat chromosome 5DS revealed gene duplications and small rearrangements

    Czech Academy of Sciences Publication Activity Database

    Akpinar, B.A.; Magni, F.; Yuce, M.; Lucas, S. J.; Šimková, Hana; Šafář, Jan; Vautrin, S.; Berges, H.; Cattonaro, F.; Doležel, Jaroslav; Budak, H.

    2015-01-01

    Roč. 16, JUN 13 (2015) ISSN 1471-2164 R&D Projects: GA ČR GBP501/12/G090; GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Triticum aestivum * 5DS * Hexaploid wheat Subject RIV: EB - Gene tics ; Molecular Biology Impact factor: 3.867, year: 2015

  18. A large duplication in the gene for lysyl hydroxylase accounts for the type VI variant of Ehlers-Danlos syndrome in two siblings

    Energy Technology Data Exchange (ETDEWEB)

    Hautala, T.; Heikkinen, J.; Kivirikko, K.I.; Myllylae, R. (Univ. of Oulu (Finland))

    1993-02-01

    Ehlers-Danlos syndrome is a deterogeneous disorder characterized by joint hypermobility, skin hyperextensibility, fragility, and other sign of connective tissue involvement. In addition to these, the type VI variant of the disease has some special characteristics such as kyphoscoliosis and ocular abnormalities. The biochemical abnormality in most patients with this autosomal recessively inherited type IV variant is a deficiency in the activity of lysyl hydroxylase (EC 1.14,11.4), the enzyme catalyzing the formation of hydroxylysine in collagens and other proteins with collagen-like amino acid sequences. The type VI variant of Ehlers-Danlos syndrome was first identified in two sisters with a reduced amount of lysyl hydroxylase activity in their skin fibroblasts (S.R. Pinnell, S.M. Krane, J.E. Kenzora, and M.J. Glimcher (1972) N. Engl. J. Med. 286; 1013-1020). Our recent molecular cloning of lysyl hydroxylase has now made it possible to study the mutations leading to the deficiency in lysyl dydroxylase activity in these cells. Our data indicate that the mRNA for lysyl hydroxylase produced in the affected cells is about 4 kb in size, whereas it is 3.2 kb in the control cells. The sequencing of the cDNA for lysyl hydroxylase from the affected cells revealed an apparently homozygous duplication rearrangement of nucleotides 1176 to 1955, corresponding to amino acids 326 to 585 in the normal sequence. From Southern blotting data, the duplicated area in the gene equals about 6-9 kb and corresponds to seven exons. 35 refs., 4 figs.

  19. Divergent evolution of cis-acting peroxisome proliferator-activated receptor elements that differentially control the tandemly duplicated fatty acid-binding protein genes, fabp1b.1 and fabp1b.2, in zebrafish.

    Science.gov (United States)

    Laprairie, Robert B; Denovan-Wright, Eileen M; Wright, Jonathan M

    2016-06-01

    Gene duplication is thought to facilitate increasing complexity in the evolution of life. The fate of most duplicated genes is nonfunctionalization: functional decay resulting from the accumulation of mutations. According to the duplication-degeneration-complementation (DDC) model, duplicated genes are retained by subfunctionalization, where the functions of the ancestral gene are sub-divided between duplicate genes, or by neofunctionalization, where one of the duplicates acquires a new function. Here, we report the differential regulation of the zebrafish tandemly duplicated fatty acid-binding protein genes, fabp1b.1 and fabp1b.2, by peroxisome proliferator-activated receptors (PPAR). fabp1b.1 mRNA levels were induced in tissue explants of liver, but not intestine, by PPAR agonists. fabp1b.1 promoter activity was induced to a greater extent by rosiglitazone (PPARγ-selective agonist) compared to WY 14,643 (PPARα-selective agonist) in HEK293A cells. Mutation of a peroxisome proliferator response element (PPRE) at -1232 bp in the fabp1b.1 promoter reduced PPAR-dependent activation. fabp1b.2 promoter activity was not affected by PPAR agonists. Differential regulation of the duplicated fabp1b promoters may be the result of PPRE loss in fabp1b.2 during a meiotic crossing-over event. Retention of PPAR inducibility in fabp1b.1 and not fabp1b.2 suggests unique regulation and function of the fabp1b duplicates.

  20. Gallbladder duplication

    Directory of Open Access Journals (Sweden)

    Yagan Pillay

    2015-01-01

    Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.

  1. Stabilized gene duplication enables long-term selection-free heterologous pathway expression.

    Science.gov (United States)

    Tyo, Keith E J; Ajikumar, Parayil Kumaran; Stephanopoulos, Gregory

    2009-08-01

    Engineering robust microbes for the biotech industry typically requires high-level, genetically stable expression of heterologous genes and pathways. Although plasmids have been used for this task, fundamental issues concerning their genetic stability have not been adequately addressed. Here we describe chemically inducible chromosomal evolution (CIChE), a plasmid-free, high gene copy expression system for engineering Escherichia coli. CIChE uses E. coli recA homologous recombination to evolve a chromosome with approximately 40 consecutive copies of a recombinant pathway. Pathway copy number is stabilized by recA knockout, and the resulting engineered strain requires no selection markers and is unaffected by plasmid instabilities. Comparison of CIChE-engineered strains with equivalent plasmids revealed that CIChE improved genetic stability approximately tenfold and growth phase-specific productivity approximately fourfold for a strain producing the high metabolic burden-biopolymer poly-3-hydroxybutyrate. We also increased the yield of the nutraceutical lycopene by 60%. CIChE should be applicable in many organisms, as it only requires having targeted genomic integration methods and a recA homolog.

  2. Cytogenetic comparison of Podocnemis expansa and Podocnemis unifilis: A case of inversion and duplication involving constitutive heterochromatin

    Science.gov (United States)

    Gunski, Ricardo José; Cunha, Isabel Souza; Degrandi, Tiago Marafiga; Ledesma, Mario; Garnero, Analía Del Valle

    2013-01-01

    Podocnemis expansa and P. unifilis present 2n = 28 chromosomes, a diploid number similar to those observed in other species of the genus. The aim of this study was to characterize these two species using conventional staining and differential CBG-, GTG and Ag-NOR banding. We analyzed specimens of P. expansa and P. unifilis from the state of Tocantins (Brazil), in which we found a 2n = 28 and karyotypes differing in the morphology of the 13th pair, which was submetacentric in P. expansa and telocentric in P. unifilis. The CBG-banding patterns revealed a heterochromatic block in the short arm of pair 13 of P. expansa and an interstitial one in pair 13 of P. unifilis, suggesting a pericentric inversion. Pair 14 of P. unifilis showed an insterstitial band in the long arm that was absent in P. expansa, suggesting a duplication in this region. Ag-NORs were observed in the first chromosome pair of both species and was associated to a secondary constriction and heterochromatic blocks. PMID:24130442

  3. Cytogenetic comparison of Podocnemis expansa and Podocnemis unifilis: a case of inversion and duplication involving constitutive heterochromatin

    Directory of Open Access Journals (Sweden)

    Ricardo José Gunski

    2013-01-01

    Full Text Available Podocnemis expansa and P. unifilis present 2n = 28 chromosomes, a diploid number similar to those observed in other species of the genus. The aim of this study was to characterize these two species using conventional staining and differential CBG-, GTG and Ag-NOR banding. We analyzed specimens of P. expansa and P. unifilis from the state of Tocantins (Brazil, in which we found a 2n = 28 and karyotypes differing in the morphology of the 13th pair, which was submetacentric in P. expansa and telocentric in P. unifilis. The CBG-banding patterns revealed a heterochromatic block in the short arm of pair 13 of P. expansa and an interstitial one in pair 13 of P. unifilis, suggesting a pericentric inversion. Pair 14 of P. unifilis showed an insterstitial band in the long arm that was absent in P. expansa, suggesting a duplication in this region. Ag-NORs were observed in the first chromosome pair of both species and was associated to a secondary constriction and heterochromatic blocks.

  4. Detection of tandam duplications and implications for linkage analysis

    Energy Technology Data Exchange (ETDEWEB)

    Matise, T.C.; Weeks, D.E. (Univ. of Pittsburgh, PA (United States)); Chakravarti, A. (Case Western Reserve Univ., Cleveland, OH (United States)); Patel, P.I.; Lupski, J.R. (Baylor College of Medicine, Houston, TX (United States)); Nelis, E.; Timmerman, V.; Van Broeckhoven, C. (Univ. of Antwerp (Belgium))

    1994-06-01

    The first demonstration of an autosomal dominant human disease caused by segmental trisomy came in 1991 for Charcot-Marie-Tooth disease type 1A (CMT1A). For this disorder, the segmental trisomy is due to a large tandem duplication of 1.5 Mb of DNA located on chromosome 17p11.2-p12. The search for the CMT1A disease gene was misdirected and impeded because some chromosome 17 genetic markers that are linked to CMT1A lie within this duplication. To better understand how such a duplication might affect genetic analyses in the context of disease gene mapping, the authors studied the effects of marker duplication on transmission probabilities of marker alleles, on linkage analysis of an autosomal dominant disease, and on tests of linkage homogeneity. They demonstrate that the undetected presence of a duplication distorts transmission ratios, hampers fine localization of the disease gene, and increases false evidence of linkage heterogeneity. In addition, they devised a likelihood-based method for detecting the presence of a tandemly duplicated marker when one is suspected. They tested their methods through computer simulations and on CMT1A pedigrees genotyped at several chromosome 17 markers. On the simulated data, the method detected 96% of duplicated markers (with a false-positive rate of 5%). On the CMT1A data the method successfully identified two of three loci that are duplicated (with no false positives). This method could be used to identify duplicated markers in other regions of the genome and could be used to delineate the extent of duplications similar to that involved in CMT1A. 18 refs., 5 figs., 6 tabs.

  5. Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers.

    Science.gov (United States)

    Manzanilla, Vincent; Bruneau, Anne

    2012-10-01

    The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Genes encoding hub and bottleneck enzymes of the Arabidopsis metabolic network preferentially retain homeologs through whole genome duplication

    Directory of Open Access Journals (Sweden)

    Qi Xiaoquan

    2010-05-01

    Full Text Available Abstract Background Whole genome duplication (WGD occurs widely in angiosperm evolution. It raises the intriguing question of how interacting networks of genes cope with this dramatic evolutionary event. Results In study of the Arabidopsis metabolic network, we assigned each enzyme (node with topological centralities (in-degree, out-degree and between-ness to measure quantitatively their centralities in the network. The Arabidopsis metabolic network is highly modular and separated into 11 interconnected modules, which correspond well to the functional metabolic pathways. The enzymes with higher in-out degree and between-ness (defined as hub and bottleneck enzymes, respectively tend to be more conserved and preferentially retain homeologs after WGD. Moreover, the simultaneous retention of homeologs encoding enzymes which catalyze consecutive steps in a pathway is highly favored and easily achieved, and enzyme-enzyme interactions contribute to the retention of one-third of WGD enzymes. Conclusions Our analyses indicate that the hub and bottleneck enzymes of metabolic network obtain great benefits from WGD, and this event grants clear evolutionary advantages in adaptation to different environments.

  7. Characterization and evolution of microRNA genes derived from repetitive elements and duplication events in plants.

    Directory of Open Access Journals (Sweden)

    Jie Sun

    Full Text Available MicroRNAs (miRNAs are a major class of small non-coding RNAs that act as negative regulators at the post-transcriptional level in animals and plants. In this study, all known miRNAs in four plant species (Arabidopsis thaliana, Populus trichocarpa, Oryza sativa and Sorghum bicolor have been analyzed, using a combination of computational and comparative genomic approaches, to systematically identify and characterize the miRNAs that were derived from repetitive elements and duplication events. The study provides a complete mapping, at the genome scale, of all the miRNAs found on repetitive elements in the four test plant species. Significant differences between repetitive element-related miRNAs and non-repeat-derived miRNAs were observed for many characteristics, including their location in protein-coding and intergenic regions in genomes, their conservation in plant species, sequence length of their hairpin precursors, base composition of their hairpin precursors and the minimum free energy of their hairpin structures. Further analysis showed that a considerable number of miRNA families in the four test plant species arose from either tandem duplication events, segmental duplication events or a combination of the two. However, comparative analysis suggested that the contribution made by these two duplication events differed greatly between the perennial tree species tested and the other three annual species. The expansion of miRNA families in A. thaliana, O. sativa and S. bicolor are more likely to occur as a result of tandem duplication events than from segmental duplications. In contrast, genomic segmental duplications contributed significantly more to the expansion of miRNA families in P. trichocarpa than did tandem duplication events. Taken together, this study has successfully characterized miRNAs derived from repetitive elements and duplication events at the genome scale and provides comprehensive knowledge and deeper insight into the

  8. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia gene family: Tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes

    Directory of Open Access Journals (Sweden)

    Petit Jean-Michel

    2008-09-01

    Full Text Available Abstract Background The animal sialyltransferases, which catalyze the transfer of sialic acid to the glycan moiety of glycoconjugates, are subdivided into four families: ST3Gal, ST6Gal, ST6GalNAc and ST8Sia, based on acceptor sugar specificity and glycosidic linkage formed. Despite low overall sequence identity between each sialyltransferase family, all sialyltransferases share four conserved peptide motifs (L, S, III and VS that serve as hallmarks for the identification of the sialyltransferases. Currently, twenty subfamilies have been described in mammals and birds. Examples of the four sialyltransferase families have also been found in invertebrates. Focusing on the ST8Sia family, we investigated the origin of the three groups of α2,8-sialyltransferases demonstrated in vertebrates to carry out poly-, oligo- and mono-α2,8-sialylation. Results We identified in the genome of invertebrate deuterostomes, orthologs to the common ancestor for each of the three vertebrate ST8Sia groups and a set of novel genes named ST8Sia EX, not found in vertebrates. All these ST8Sia sequences share a new conserved family-motif, named "C-term" that is involved in protein folding, via an intramolecular disulfide bridge. Interestingly, sequences from Branchiostoma floridae orthologous to the common ancestor of polysialyltransferases possess a polysialyltransferase domain (PSTD and those orthologous to the common ancestor of oligosialyltransferases possess a new ST8Sia III-specific motif similar to the PSTD. In osteichthyans, we have identified two new subfamilies. In addition, we describe the expression profile of ST8Sia genes in Danio rerio. Conclusion Polysialylation appeared early in the deuterostome lineage. The recent release of several deuterostome genome databases and paralogons combined with synteny analysis allowed us to obtain insight into events at the gene level that led to the diversification of the ST8Sia genes, with their corresponding enzymatic

  9. Carboxylesterase 1 gene duplication and mRNA expression in adipose tissue are linked to obesity and metabolic function

    DEFF Research Database (Denmark)

    Friedrichsen, Martin; Poulsen, Pernille; Wojtaszewski, Jørgen

    2013-01-01

    involved in the control of mRNA expression. Here, we investigated mRNA expression level in adipose tissue and its association with measures of adiposity and metabolic function in a population of elderly twins. Furthermore, the heritability of mRNA expression level in adipose tissue and the effect of gene...

  10. High mature grain phytase activity in the Triticeae has evolved by duplication followed by neofunctionalization of the purple acid phosphatase phytase (PAPhy) gene

    DEFF Research Database (Denmark)

    Madsen, Claus Krogh; Dionisio, Giuseppe; Holme, Inger

    2013-01-01

    consist of a set of paralogues, PAPhy_a and PAPhy_b, and have been mapped to Triticeae chromosomes 5 and 3, respectively. The promoters share a conserved core but the PAPhy_a promoter have acquired a novel cis-acting regulatory element for expression during grain filling while the PAPhy_b promoter has...... on Brachypodium chromosomes 1 and 2 does not extend beyond the PAPhy gene. The results indicate that a single-gene segmental duplication may have enabled the evolution of high MGPA by creating functional redundancy of the parent PAPhy gene. This implies that similar MGPA levels may be out of reach in breeding...

  11. BcMF26a and BcMF26b Are Duplicated Polygalacturonase Genes with Divergent Expression Patterns and Functions in Pollen Development and Pollen Tube Formation in Brassica campestris.

    Directory of Open Access Journals (Sweden)

    Meiling Lyu

    Full Text Available Polygalacturonase (PG is one of the cell wall hydrolytic enzymes involving in pectin degradation. A comparison of two highly conserved duplicated PG genes, namely, Brassica campestris Male Fertility 26a (BcMF26a and BcMF26b, revealed the different features of their expression patterns and functions. We found that these two genes were orthologous genes of At4g33440, and they originated from a chromosomal segmental duplication. Although structurally similar, their regulatory and intron sequences largely diverged. QRT-PCR analysis showed that the expression level of BcMF26b was higher than that of BcMF26a in almost all the tested organs and tissues in Brassica campestris. Promoter activity analysis showed that, at reproductive development stages, BcMF26b promoter was active in tapetum, pollen grains, and pistils, whereas BcMF26a promoter was only active in pistils. In the subcellular localization experiment, BcMF26a and BcMF26b proteins could be localized to the cell wall. When the two genes were co-inhibited, pollen intine was formed abnormally and pollen tubes could not grow or stretch. Moreover, the knockout mutants of At4g33440 delayed the growth of pollen tubes. Therefore, BcMF26a/b can participate in the construction of pollen wall by modulating intine information and BcMF26b may play a major role in co-inhibiting transformed plants.

  12. Phylogeny of C4-photosynthesis enzymes based on algal transcriptomic and genomic data supports an archaeal/proteobacterial origin and multiple duplication for most C4-related genes.

    Directory of Open Access Journals (Sweden)

    Shan Chi

    Full Text Available Both Calvin-Benson-Bassham (C3 and Hatch-Slack (C4 cycles are most important autotrophic CO2 fixation pathways on today's Earth. C3 cycle is believed to be originated from cyanobacterial endosymbiosis. However, studies on evolution of different biochemical variants of C4 photosynthesis are limited to tracheophytes and origins of C4-cycle genes are not clear till now. Our comprehensive analyses on bioinformatics and phylogenetics of novel transcriptomic sequencing data of 21 rhodophytes and 19 Phaeophyceae marine species and public genomic data of more algae, tracheophytes, cyanobacteria, proteobacteria and archaea revealed the origin and evolution of C4 cycle-related genes. Almost all of C4-related genes were annotated in extensive algal lineages with proteobacterial or archaeal origins, except for phosphoenolpyruvate carboxykinase (PCK and aspartate aminotransferase (AST with both cyanobacterial and archaeal/proteobacterial origin. Notably, cyanobacteria may not possess complete C4 pathway because of the flawed annotation of pyruvate orthophosphate dikinase (PPDK genes in public data. Most C4 cycle-related genes endured duplication and gave rise to functional differentiation and adaptation in different algal lineages. C4-related genes of NAD-ME (NAD-malic enzyme and PCK subtypes exist in most algae and may be primitive ones, while NADP-ME (NADP-malic enzyme subtype genes might evolve from NAD-ME subtype by gene duplication in chlorophytes and tracheophytes.

  13. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal

    2005-02-01

    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  14. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  15. Transcriptome Signatures of Selection, Drift, Introgression, and Gene Duplication in the Evolution of an Extremophile Endemic Plant.

    Science.gov (United States)

    Hawkins, Angela K; Garza, Elyssa R; Dietz, Valerie A; Hernandez, Oscar J; Hawkins, W Daryl; Burrell, A Millie; Pepper, Alan E

    2017-12-01

    Plants on serpentine soils provide extreme examples of adaptation to environment, and thus offer excellent models for the study of evolution at the molecular and genomic level. Serpentine outcrops are derived from ultramafic rock and have extremely low levels of essential plant nutrients (e.g., N, P, K, and Ca), as well as toxic levels of heavy metals (e.g., Ni, Cr, and Co) and low moisture availability. These outcrops provide habitat to a number of endemic plant species, including the annual mustard Caulanthus amplexicaulis var. barbarae (Cab) (Brassicaceae). Its sister taxon, C. amplexicaulis var. amplexicaulis (Caa), is intolerant to serpentine soils. Here, we assembled and annotated comprehensive reference transcriptomes of both Caa and Cab for use in protein coding sequence comparisons. A set of 29,443 reciprocal best Blast hit (RBH) orthologs between Caa and Cab was compared with identify coding sequence variants, revealing a high genome-wide dN/dS ratio between the two taxa (mean = 0.346). We show that elevated dN/dS likely results from the composite effects of genetic drift, positive selection, and the relaxation of negative selection. Further, analysis of paralogs within each taxon revealed the signature of a period of elevated gene duplication (∼10 Ma) that is shared with other species of the tribe Thelypodieae, and may have played a role in the striking morphological and ecological diversity of this tribe. In addition, distribution of the synonymous substitution rate, dS, is strongly bimodal, indicating a history of reticulate evolution that may have contributed to serpentine adaptation. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Opposing phenotypes in mice with Smith-Magenis deletion and Potocki-Lupski duplication syndromes suggest gene dosage effects on fluid consumption behavior.

    Science.gov (United States)

    Heck, Detlef H; Gu, Wenli; Cao, Ying; Qi, Shuhua; Lacaria, Melanie; Lupski, James R

    2012-11-01

    A quantitative long-term fluid consumption and fluid-licking assay was performed in two mouse models with either an ∼2 Mb genomic deletion, Df(11)17, or the reciprocal duplication copy number variation (CNV), Dp(11)17, analogous to the human genomic rearrangements causing either Smith-Magenis syndrome [SMS; OMIM #182290] or Potocki-Lupski syndrome [PTLS; OMIM #610883], respectively. Both mouse strains display distinct quantitative alterations in fluid consumption compared to their wild-type littermates; several of these changes are diametrically opposing between the two chromosome engineered mouse models. Mice with duplication versus deletion showed longer versus shorter intervals between visits to the waterspout, generated more versus less licks per visit and had higher versus lower variability in the number of licks per lick-burst as compared to their respective wild-type littermates. These findings suggest that copy number variation can affect long-term fluid consumption behavior in mice. Other behavioral differences were unique for either the duplication or deletion mutants; the deletion CNV resulted in increased variability of the licking rhythm, and the duplication CNV resulted in a significant slowing of the licking rhythm. Our findings document a readily quantitated complex behavioral response that can be directly and reciprocally influenced by a gene dosage effect. Copyright © 2012 Wiley Periodicals, Inc.

  17. Coverage analysis of lists of genes involved in heterogeneous ...

    Indian Academy of Sciences (India)

    Genes involved in myopathies: 82 genes, based on the disease groups 'muscular dystrophies', 'congenital muscular dystrophies',. 'congenital ..... Spinal muscular atrophy, lower extremity-predominant, AD. 158600. EGR2 .... Mental retardation, stereotypic movements, epilepsy, and/or cerebral malformations. 613443.

  18. Hormonal Involvement in Breast Cancer Gene Amplification

    Science.gov (United States)

    2010-10-01

    and s ubsequently amp lified at the Yale University sequenc ing facility for Illumina sequencing. However, it required a lot of effort to obtain this...and Polyak K. (2008). Genome-wide functi onal synergy between amp lified and mutated genes in human breast cancer. Cancer Res. 68: 9532-9540...east cancer patient samples. Other co-amp lified genes, within the HER2 amplicon and/or at other regions, could serve as additional novel target s for

  19. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica

    2013-01-01

    . Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

  20. Delineation of a new chromosome 20q11.2 duplication syndrome including the ASXL1 gene

    DEFF Research Database (Denmark)

    Avila, Magali; Kirchhoff, Eva Maria; Marle, Nathalie

    2013-01-01

    We report on three males with de novo overlapping 7.5, 9.8, and 10 Mb duplication of chromosome 20q11.2. Together with another patient previously published in the literature with overlapping 20q11 microduplication, we show that such patients display common clinical features including metopic ridg...

  1. Assessment and Reconstruction of Novel HSP90 Genes: Duplications, Gains and Losses in Fungal and Animal Lineages

    Czech Academy of Sciences Publication Activity Database

    Pantzartzi, Chrysoula; Drosopoulou, E.; Scouras, Z.

    2013-01-01

    Roč. 8, č. 9 (2013), s. 1-11 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : Hsp90s * Fungi * duplication events Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  2. Expression profiles of genes involved in tanshinone biosynthesis of ...

    Indian Academy of Sciences (India)

    Expression profiles of genes involved in tanshinone biosynthesis of two. Salvia miltiorrhiza genotypes with different tanshinone contents. Zhenqiao Song, Jianhua Wang and Xingfeng Li. J. Genet. 95, 433–439. Table 1. S. miltiorrhiza genes and primer pairs used for qRT-PCR. Gene. GenBank accession. Primer name.

  3. Phylogeny and diversification of B-function MADS-box genes in angiosperms: evolutionary and functional implications of a 260-million-year-old duplication.

    Science.gov (United States)

    Kim, Sangtae; Yoo, Mi-Jeong; Albert, Victor A; Farris, James S; Soltis, Pamela S; Soltis, Douglas E

    2004-12-01

    B-function MADS-box genes play crucial roles in floral development in model angiosperms. We reconstructed the structural and functional implications of B-function gene phylogeny in the earliest extant flowering plants based on analyses that include 25 new AP3 and PI sequences representing critical lineages of the basalmost angiosperms: Amborella, Nuphar (Nymphaeaceae), and Illicium (Austrobaileyales). The ancestral size of exon 5 in PI-homologues is 42 bp, typical of exon 5 in other plant MADS-box genes. This 42-bp length is found in PI-homologues from Amborella and Nymphaeaceae, successive sisters to all other angiosperms. Following these basalmost branches, a deletion occurred in exon 5, yielding a length of 30 bp, a condition that unites all other angiosperms. Several shared amino acid strings, including a prominent "DEAER" motif, are present in the AP3- and PI-homologues of Amborella. These may be ancestral motifs that were present before the duplication that yielded the AP3 and PI lineages and subsequently were modified after the divergence of Amborella. Other structural features were identified, including a motif that unites the previously described TM6 clade and a deletion in AP3-homologues that unites all Magnoliales. Phylogenetic analyses of AP3- and PI-homologues yielded gene trees that generally track organismal phylogeny as inferred by multigene data sets. With both AP3 and PI amino acid sequences, Amborella and Nymphaeaceae are sister to all other angiosperms. Using nonparametric rate smoothing (NPRS), we estimated that the duplication that produced the AP3 and PI lineages occurred approximately 260 mya (231-290). This places the duplication after the split between extant gymnosperms and angiosperms, but well before the oldest angiosperm fossils. A striking similarity in the multimer-signalling C domains of the Amborella proteins suggests the potential for the formation of unique transcription-factor complexes. The earliest angiosperms may have been

  4. Insights into the evolutionary history of tubercle bacilli as disclosed by genetic rearrangements within a PE_PGRS duplicated gene pair

    Directory of Open Access Journals (Sweden)

    Kurepina Natalia

    2006-12-01

    Full Text Available Abstract Background The highly homologous PE_PGRS (Proline-glutamic acid_polymorphic GC-rich repetitive sequence genes are members of the PE multigene family which is found only in mycobacteria. PE genes are particularly abundant within the genomes of pathogenic mycobacteria where they seem to have expanded as a result of gene duplication events. PE_PGRS genes are characterized by their high GC content and extensive repetitive sequences, making them prone to recombination events and genetic variability. Results Comparative sequence analysis of Mycobacterium tuberculosis genes PE_PGRS17 (Rv0978c and PE_PGRS18 (Rv0980c revealed a striking genetic variation associated with this typical tandem duplicate. In comparison to the M. tuberculosis reference strain H37Rv, the variation (named the 12/40 polymorphism consists of an in-frame 12-bp insertion invariably accompanied by a set of 40 single nucleotide polymorphisms (SNPs that occurs either in PE_PGRS17 or in both genes. Sequence analysis of the paralogous genes in a representative set of worldwide distributed tubercle bacilli isolates revealed data which supported previously proposed evolutionary scenarios for the M. tuberculosis complex (MTBC and confirmed the very ancient origin of "M. canettii" and other smooth tubercle bacilli. Strikingly, the identified polymorphism appears to be coincident with the emergence of the post-bottleneck successful clone from which the MTBC expanded. Furthermore, the findings provide direct and clear evidence for the natural occurrence of gene conversion in mycobacteria, which appears to be restricted to modern M. tuberculosis strains. Conclusion This study provides a new perspective to explore the molecular events that accompanied the evolution, clonal expansion, and recent diversification of tubercle bacilli.

  5. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  6. Gene-environment interactions involving functional variants

    DEFF Research Database (Denmark)

    Barrdahl, Myrto; Rudolph, Anja; Hopper, John L

    2017-01-01

    epidemiological breast cancer risk factors in relation to breast cancer. Analyses were conducted on up to 58,573 subjects (26,968 cases and 31,605 controls) from the Breast Cancer Association Consortium, in one of the largest studies of its kind. Analyses were carried out separately for estrogen receptor (ER.......01. The strongest interaction result in relation to overall breast cancer risk was found between CFLAR-rs7558475 and current smoking (ORint  = 0.77, 95% CI: 0.67-0.88, pint  = 1.8 × 10(-4) ). The interaction with the strongest statistical evidence was found between 5q14-rs7707921 and alcohol consumption (ORint =1.......36, 95% CI: 1.16-1.59, pint  = 1.9 × 10(-5) ) in relation to ER- disease risk. The remaining two gene-environment interactions were also identified in relation to ER- breast cancer risk and were found between 3p21-rs6796502 and age at menarche (ORint  = 1.26, 95% CI: 1.12-1.43, pint =1.8 × 10...

  7. The sequence and analysis of duplication-rich human chromosome 16.

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Chan, Yee Man; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C; Bruno, William J; Buckingham, Judith M; Callen, David F; Campbell, Connie S; Campbell, Mary L; Campbell, Evelyn W; Caoile, Chenier; Challacombe, Jean F; Chasteen, Leslie A; Chertkov, Olga; Chi, Han C; Christensen, Mari; Clark, Lynn M; Cohn, Judith D; Denys, Mirian; Detter, John C; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A; Grady, Deborah L; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip B; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Manohar, Chitra F; Mark, Graham A; McMurray, Kimberly L; Meincke, Linda J; Morgan, Jenna; Moyzis, Robert K; Mundt, Mark O; Munk, A Christine; Nandkeshwar, Richard D; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O; Robinson, Donna L; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H; Scott, Duncan; Shough, Timothy; Stallings, Raymond L; Stalvey, Malinda; Sutherland, Robert D; Tapia, Roxanne; Tesmer, Judith G; Thayer, Nina; Thompson, Linda S; Tice, Hope; Torney, David C; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E; Ustaszewska, Anna; Vo, Nu; White, P Scott; Williams, Albert L; Wills, Patricia L; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; Dejong, Pieter; Bruce, David; Doggett, Norman A; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; Rokhsar, Daniel S; Eichler, Evan E; Gilna, Paul; Lucas, Susan M; Myers, Richard M; Rubin, Edward M; Pennacchio, Len A

    2004-12-23

    Human chromosome 16 features one of the highest levels of segmentally duplicated sequence among the human autosomes. We report here the 78,884,754 base pairs of finished chromosome 16 sequence, representing over 99.9% of its euchromatin. Manual annotation revealed 880 protein-coding genes confirmed by 1,670 aligned transcripts, 19 transfer RNA genes, 341 pseudogenes and three RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukaemia. Several large-scale structural polymorphisms spanning hundreds of kilobase pairs were identified and result in gene content differences among humans. Whereas the segmental duplications of chromosome 16 are enriched in the relatively gene-poor pericentromere of the p arm, some are involved in recent gene duplication and conversion events that are likely to have had an impact on the evolution of primates and human disease susceptibility.

  8. IS21-558 Insertion Sequences Are Involved in the Mobility of the Multiresistance Gene cfr▿

    Science.gov (United States)

    Kehrenberg, Corinna; Aarestrup, Frank M.; Schwarz, Stefan

    2007-01-01

    During a study of florfenicol-resistant porcine staphylococci from Denmark, the genes cfr and fexA were detected in the chromosomal DNA or on plasmids of Staphylococcus hyicus, Staphylococcus warneri, and Staphylococcus simulans. A novel variant of the phenicol resistance transposon Tn558 was detected on the ca. 43-kb plasmid pSCFS6 in S. warneri and S. simulans isolates. Sequence analysis of a 22,010-bp segment revealed that the new Tn558 variant harbored an additional resistance gene region integrated into the tnpC reading frame. This resistance gene region consisted of the clindamycin exporter gene lsa(B) and the gene cfr for combined resistance to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A antibiotics bracketed by IS21-558 insertion sequences orientated in the same direction. A 6-bp target site duplication was detected at the integration site within tnpC. Transpositionally active forms of the IS21-558 element, known as minicircles, were detected by PCR and suggest that this insertion sequence is involved in the mobility of the multiresistance gene cfr. Based on the knowledge of the transposition pathways of IS21-like insertion sequences and the sequence features detected, the resistance gene region of plasmid pSCFS6 is believed to have developed via IS21-558-mediated cointegrate formation. The data obtained in this study identified the multiresistance gene cfr not only in three novel host species but also in a novel genetic context whose further analysis suggested that insertion sequences of the type IS21-558 are likely to be involved in the dissemination of cfr. PMID:17145796

  9. C4BPAL1, a member of the human regulator of complement activation (RCA) gene cluster that resulted from the duplication of the gene coding for the [alpha]-chain of C4b-binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez-Corral, P.; Pardo-Manuel de Villena, F.; Rey-Campos, J.; Rodriguez de Cordoba, S. (Unidad de Immunologia, Madrid (Spain))

    1993-07-01

    The regulator of complement activation (RCA) gene cluster evolved by multiple gene duplications to produce a family of genes coding for proteins that collectively control the activation of the complement system. The authors report here the characterization of C4BPAL1, a member of the human RCA gene cluster that arose from the duplication of the C4BPA gene after the separation of rodent and primate lineages. C4BPAL1 maps 20 kb downstream of the C4BPA gene and is in the same 5[prime] to 3[prime] orientation found for all RCA genes characterized thus far. It includes nine exon-like regions homologous to exons 2-8, 11, and 12 of the C4BPA gene. Analysis of the C4BPAL1 sequence suggests that it is currently a pseudogene in humans. However, comparisons between C4BPAL1 and the human and murine C4BPA genes show sequence conservation, which strongly suggests that, for a long period of time, C4BPAL1 has been a functional gene coding for a protein with structural requirements similar to those of the [alpha]-chain of C4b-binding protein. 50 refs., 5 figs., 1 tab.

  10. Disease association with two Helicobacter pylori duplicate outer membrane protein genes, homB and homA.

    Science.gov (United States)

    Oleastro, Monica; Cordeiro, Rita; Yamaoka, Yoshio; Queiroz, Dulciene; Mégraud, Francis; Monteiro, Lurdes; Ménard, Armelle

    2009-06-22

    homB encodes a Helicobacter pylori outer membrane protein. This gene was previously associated with peptic ulcer disease (PUD) and was shown to induce activation of interleukin-8 secretion in vitro, as well as contributing to bacterial adherence. Its 90%-similar gene, homA, was previously correlated with gastritis. The present study aimed to evaluate the gastric disease association with homB and homA, as well as with the H. pylori virulence factors cagA, babA and vacA, in 415 H. pylori strains isolated from patients from East Asian and Western countries. The correlation among these genotypes was also evaluated. Both homB and homA genes were heterogeneously distributed worldwide, with a marked difference between East Asian and Western strains. In Western strains (n = 234, 124 PUD and 110 non-ulcer dyspepsia (NUD), homB, cagA and vacA s1 were all significantly associated with PUD (p = 0.025, p = 0.014, p = 0.039, respectively), and homA was closely correlated with NUD (p = 0.072). In East Asian strains (n = 138, 73 PUD and 65 NUD), homB was found more frequently than homA, and none of these genes was associated with the clinical outcome. Overall, homB was associated with the presence of cagA (p = 0.043) and vacA s1 (p homA was found more frequently in cagA-negative (p = 0.062) and vacA s2 (p homA copy number were observed, with a clear geographical specificity, suggesting an involvement of these genes in host adaptation. A correlation between the homB two-copy genotype and PUD was also observed, emphasizing the role of homB in the virulence of the strain. The global results suggest that homB and homA contribute to the determination of clinical outcome.

  11. Genes Involved in Oxidation and Prostate Cancer Progression

    National Research Council Canada - National Science Library

    Platz, Elizabeth A

    2008-01-01

    We are evaluating whether polymorphisms in genes involved in the genesis of oxidative species, detoxification of oxidative species, or repair of oxidative DNA damage influence risk of prostate cancer...

  12. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))

    1990-08-28

    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

  13. Host genes involved in Agrobacterium-mediated transformation

    NARCIS (Netherlands)

    Soltani, Jalal

    2009-01-01

    Agrobacterium is the nature’s genetic engineer that can transfer genes across the kingdom barriers to both prokaryotic and eukaryotic host cells. The host genes which are involved in Agrobacterium-mediated transformatiom (AMT) are not well known. Here, I studied in a systematic way to identify the

  14. Temporal expression of genes involved in the biosynthesis of ...

    African Journals Online (AJOL)

    Gibberellins (GAs) are a large family of endogenous plant growth regulators. Bioactive GAs influence nearly all processes during plant growth and development. In the present study, we cloned and identified 10 unique genes that are potentially involved in the biosynthesis of GAs, including one BpGGDP gene, two BpCPS ...

  15. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    Directory of Open Access Journals (Sweden)

    Bertram Brenig

    Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

  16. Genes involved in sex determination and the influence of ...

    African Journals Online (AJOL)

    This review attempts to group the recent hypotheses involved in the complex system of determination and sex differentiation in fish. Based on recent literature, we relate the key genes involved in the genomic cascade as the Cyp19, Dmrt1, Sox9, Foxl2, Esr, Dax1, Sf1 and Amh1, and still little known action of temperature on ...

  17. Abundance of genes involved in mercury methylation in oceanic environments

    Science.gov (United States)

    Palumbo, A. V.; Podar, M.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Crable, B. R.; Weighill, D.; Jacobson, D. A.; Somenahally, A. C.; Elias, D. A.

    2016-02-01

    The distribution and diversity of genes involved in mercury methylation in oceanic environments is of interest in determining the source of mercury in ocean environments and may have predictive value for mercury methylation rates. The highly conserved hgcAB genes involved in mercury methylation provide an avenue for evaluating the genetic potential for mercury methylation. The genes are sporadically present in a few diverse groups of bacteria and Archaea including Deltaproteobacteria, Firmicutes and Archaea and of over 7000 sequenced species they are only present in about 100 genomes. Examination of sequence data from methylators and non-methylators indicates that these genes are associated with other genes involved in metal transformations and transport. We examined hgcAB presence in over 3500 microbial metagenomes (from all environments) and found the hgcAB genes were present in anaerobic oceanic environments but not in aerobic layers of the open ocean. The genes were common in sediments from marine, coastal and estuarine sources as well as polluted environments. The genes were rare, found in 7 of 138 samples, in metagenomes from the pelagic water column including profiles though the oxygen minimum zone. Other oxic and sub-oxic coastal waters also demonstrated a lack of hgcAB genes including the OMZ in the Eastern North Pacific Ocean. There were some unique hgcA like unique sequences found in metagenomes from depth in the Pacific and Southern Atlantic Ocean. Coastal "dead zone" waters may be important sources of MeHg as the hgcAB genes were abundant in the anoxic waters of a stratified fjord. The genes were absent in microbiomes from vertebrates but were in invertebrate microbiomes However, oceanic species were underrepresented in these samples. Climate change could provide an additional flux of MeHg to the oceans as we found the most abundant representation of hgcAB genes in arctic permafrost. Thus warming could increase flux of methyl mercury to arctic waters.

  18. Tandem Duplications and the Limits of Natural Selection in Drosophila yakuba and Drosophila simulans.

    Directory of Open Access Journals (Sweden)

    Rebekah L Rogers

    Full Text Available Tandem duplications are an essential source of genetic novelty, and their variation in natural populations is expected to influence adaptive walks. Here, we describe evolutionary impacts of recently-derived, segregating tandem duplications in Drosophila yakuba and Drosophila simulans. We observe an excess of duplicated genes involved in defense against pathogens, insecticide resistance, chorion development, cuticular peptides, and lipases or endopeptidases associated with the accessory glands across both species. The observed agreement is greater than expectations on chance alone, suggesting large amounts of convergence across functional categories. We document evidence of widespread selection on the D. simulans X, suggesting adaptation through duplication is common on the X. Despite the evidence for positive selection, duplicates display an excess of low frequency variants consistent with largely detrimental impacts, limiting the variation that can effectively facilitate adaptation. Standing variation for tandem duplications spans less than 25% of the genome in D. yakuba and D. simulans, indicating that evolution will be strictly limited by mutation, even in organisms with large population sizes. Effective whole gene duplication rates are low at 1.17 × 10-9 per gene per generation in D. yakuba and 6.03 × 10-10 per gene per generation in D. simulans, suggesting long wait times for new mutations on the order of thousands of years for the establishment of sweeps. Hence, in cases where adaptation depends on individual tandem duplications, evolution will be severely limited by mutation. We observe low levels of parallel recruitment of the same duplicated gene in different species, suggesting that the span of standing variation will define evolutionary outcomes in spite of convergence across gene ontologies consistent with rapidly evolving phenotypes.

  19. Increased copy number for methylated maternal 15q duplications leads to changes in gene and protein expression in human cortical samples

    Directory of Open Access Journals (Sweden)

    Scoles Haley A

    2011-12-01

    Full Text Available Abstract Background Duplication of chromosome 15q11-q13 (dup15q accounts for approximately 3% of autism cases. Chromosome 15q11-q13 contains imprinted genes necessary for normal mammalian neurodevelopment controlled by a differentially methylated imprinting center (imprinting center of the Prader-Willi locus, PWS-IC. Maternal dup15q occurs as both interstitial duplications and isodicentric chromosome 15. Overexpression of the maternally expressed gene UBE3A is predicted to be the primary cause of the autistic features associated with dup15q. Previous analysis of two postmortem dup15q frontal cortical samples showed heterogeneity between the two cases, with one showing levels of the GABAA receptor genes, UBE3A and SNRPN in a manner not predicted by copy number or parental imprint. Methods Postmortem human brain tissue (Brodmann area 19, extrastriate visual cortex was obtained from 8 dup15q, 10 idiopathic autism and 21 typical control tissue samples. Quantitative PCR was used to confirm duplication status. Quantitative RT-PCR and Western blot analyses were performed to measure 15q11-q13 transcript and protein levels, respectively. Methylation-sensitive high-resolution melting-curve analysis was performed on brain genomic DNA to identify the maternal:paternal ratio of methylation at PWS-IC. Results Dup15q brain samples showed a higher level of PWS-IC methylation than control or autism samples, indicating that dup15q was maternal in origin. UBE3A transcript and protein levels were significantly higher than control and autism in dup15q, as expected, although levels were variable and lower than expected based on copy number in some samples. In contrast, this increase in copy number did not result in consistently increased GABRB3 transcript or protein levels for dup15q samples. Furthermore, SNRPN was expected to be unchanged in expression in dup15q because it is expressed from the single unmethylated paternal allele, yet SNRPN levels were significantly

  20. The evolution and appearance of C3 duplications in fish originate an exclusive teleost c3 gene form with anti-inflammatory activity.

    Directory of Open Access Journals (Sweden)

    Gabriel Forn-Cuní

    Full Text Available The complement system acts as a first line of defense and promotes organism homeostasis by modulating the fates of diverse physiological processes. Multiple copies of component genes have been previously identified in fish, suggesting a key role for this system in aquatic organisms. Herein, we confirm the presence of three different previously reported complement c3 genes (c3.1, c3.2, c3.3 and identify five additional c3 genes (c3.4, c3.5, c3.6, c3.7, c3.8 in the zebrafish genome. Additionally, we evaluate the mRNA expression levels of the different c3 genes during ontogeny and in different tissues under steady-state and inflammatory conditions. Furthermore, while reconciling the phylogenetic tree with the fish species tree, we uncovered an event of c3 duplication common to all teleost fishes that gave rise to an exclusive c3 paralog (c3.7 and c3.8. These paralogs showed a distinct ability to regulate neutrophil migration in response to injury compared with the other c3 genes and may play a role in maintaining the balance between inflammatory and homeostatic processes in zebrafish.

  1. A Homozygous TPO Gene Duplication (c.1184_1187dup4) Causes Congenital Hypothyroidism in Three Siblings Born to a Consanguineous Family.

    Science.gov (United States)

    Cangul, Hakan; Aydin, Banu K; Bas, Firdevs

    2015-12-01

    Congenital hypothyroidism (CH) is the most common neonatal endocrine disease, and germ-line mutations in the TPO gene cause the inherited form of the disease. Our aim in this study was to determine the genetic basis of congenital hypothyroidism in three affected children coming from a consanguineous Turkish family. Because CH is usually inherited in autosomal recessive manner in consanguineous/multicase families, we adopted a two-stage strategy of genetic linkage studies and targeted sequencing of the candidate genes. First, we investigated the potential genetic linkage of the family to any known CH locus, using microsatellite markers, and then screened for mutations in linked-gene by conventional sequencing. The family showed potential linkage to the TPO gene and we detected a homozygous duplication (c.1184_1187dup4) in all cases. The mutation segregated with disease status in the family. This study confirms the pathogenicity of the c.1184_1187dup4 mutation in the TPO gene and helps establish a genotype/phenotype correlation associated with this mutation. It also highlights the importance of molecular genetic studies in the definitive diagnosis and accurate classification of CH.

  2. Middle ear microbiome differences in indigenous Filipinos with chronic otitis media due to a duplication in the A2ML1 gene.

    Science.gov (United States)

    Santos-Cortez, Regie Lyn P; Hutchinson, Diane S; Ajami, Nadim J; Reyes-Quintos, Ma Rina T; Tantoco, Ma Leah C; Labra, Patrick John; Lagrana, Sheryl Mae; Pedro, Melquiadesa; Llanes, Erasmo Gonzalo D V; Gloria-Cruz, Teresa Luisa; Chan, Abner L; Cutiongco-de la Paz, Eva Maria; Belmont, John W; Chonmaitree, Tasnee; Abes, Generoso T; Petrosino, Joseph F; Leal, Suzanne M; Chiong, Charlotte M

    2016-11-01

    Previously rare A2ML1 variants were identified to confer otitis media susceptibility in an indigenous Filipino community and in otitis-prone US children. The goal of this study is to describe differences in the middle ear microbiome between carriers and non-carriers of an A2ML1 duplication variant that increases risk for chronic otitis media among indigenous Filipinos with poor health care access. Ear swabs were obtained from 16 indigenous Filipino individuals with chronic otitis media, of whom 11 carry the A2ML1 duplication variant. Ear swabs were submitted for 16S rRNA gene sequencing. Genotype-based differences in microbial richness, structure, and composition were identified, but were not statistically significant. Taxonomic analysis revealed that the relative abundance of the phyla Fusobacteria and Bacteroidetes, and genus Fusobacterium were nominally increased in carriers compared to non-carriers, but were non-significant after correction for multiple testing. We also detected rare bacteria including Oligella that was reported only once in the middle ear. These findings suggest that A2ML1-related otitis media susceptibility may be mediated by changes in the middle ear microbiome. Knowledge of middle ear microbial profiles according to genetic background can be potentially useful for therapeutic and prophylactic interventions for otitis media and can guide public health interventions towards decreasing otitis media prevalence within the indigenous Filipino community.

  3. Different clinical importance of FLT3 internal tandem duplications in AML according to FAB classification: possible existence of distinct leukemogenesis involving monocyte differentiation pathway.

    Science.gov (United States)

    Koh, Youngil; Park, Juwon; Ahn, Kwang-Sung; Kim, Inho; Bang, Soo-Mee; Lee, Jae-Hoon; Yoon, Sung-Soo; Soon Lee, Dong; Yiul Lee, Young; Park, Seonyang; Kim, Byung-Kook

    2009-11-01

    Impact of FLT3 receptor tyrosine kinase activation via internal tandem duplication (ITD) of the juxtamembrane region on outcome of acute myeloid leukemia (AML) is still controversial. Recent researches reveal a role of FLT3 in monocyte differentiation in hematopoiesis. We analyzed the clinical impact of FLT3 alterations in adult AML patients excluding acute promyelocytic leukemia (APL) who received induction chemotherapy according to morphologic classification. Retrospective review of medical records from three centers in Korea between 1997 and 2007 was performed. Polymerase chain reaction was performed on genomic DNA derived from blood samples of patients before induction chemotherapy for FLT3-ITD detection. We assessed overall survival (OS), first disease-free survival (1-DFS), and response to induction chemotherapy. One hundred eighty-four patients (median age 49.1 years, range 16.0-76.5) with AML excluding APL received induction chemotherapy from three centers. FLT3-ITD was detected in 22 patients. One hundred forty-one patients were below age 60. One hundred seventy-nine patients received induction chemotherapy with cytarabine and idarubicin (AId) regimen. One hundred nineteen patients achieved complete remission (CR) after first induction chemotherapy. FLT3-ITD was not related to achievement of CR. 1-DFS was longer in patients without FLT3-ITD (median 1-DFS 16.5 vs. 8.5 months, p = 0.025). 1-DFS was not different according to FLT3-ITD status in nonmonocyte lineage leukemia (p = 0.355), while 1-DFS was shorter in monocyte lineage leukemia for FLT3-ITD positive patients (20.9 vs. 2.4 months, p < 0.001). FLT3-ITD had no impact on OS except for monocyte lineage, where OS was significantly shorter in FLT3-ITD positive group (39.4 vs. 6.0 months, p = 0.026). Moreover FLT3-ITD was stronger prognostic factors in monocyte lineage AML than risk stratification based on cytogenetics. Status of FLT3-ITD should be analyzed differently in AML patients according to

  4. Isolation of botulinolysin, a thiol-activated hemolysin, from serotype D Clostridium botulinum: A species-specific gene duplication in Clostridia.

    Science.gov (United States)

    Suzuki, Tomonori; Nagano, Thomas; Niwa, Koichi; Mutoh, Shingo; Uchino, Masataka; Tomizawa, Motohiro; Sagane, Yoshimasa; Watanabe, Toshihiro

    2016-12-01

    Botulinolysin (BLY) is a toxin produced by Clostridium botulinum that belongs to a group of thiol-activated hemolysins. In this study, a protein exhibiting hemolytic activity was purified from the culture supernatant of C. botulinum serotype D strain 4947. The purified protein displayed a single band by sodium dodecyl sulfate polyacrylamide gel electrophoresis with a molecular mass of 55kDa, and its N-terminal and internal amino acid sequences exhibited high similarity to a group of thiol-activated hemolysins produced by gram-positive bacteria. Thus, the purified protein was identified as the BLY. Using the nucleotide sequences of previously cloned genes for hemolysins, two types of genes encoding BLY-like proteins were cloned unexpectedly. Molecular modeling analysis indicated that the products of both genes displayed very similar structures, despite the low sequence similarity. In silico screening revealed a specific duplication of the hemolysin gene restricted to serotypes C and D of C. botulinum and their related species among thiol-activated hemolysin-producing bacteria. Our findings provide important insights into the genetic characteristics of pathogenic bacteria. Copyright © 2016 Elsevier GmbH. All rights reserved.

  5. Stably Expressed Genes Involved in Basic Cellular Functions.

    Directory of Open Access Journals (Sweden)

    Kejian Wang

    Full Text Available Stably Expressed Genes (SEGs whose expression varies within a narrow range may be involved in core cellular processes necessary for basic functions. To identify such genes, we re-analyzed existing RNA-Seq gene expression profiles across 11 organs at 4 developmental stages (from immature to old age in both sexes of F344 rats (n = 4/group; 320 samples. Expression changes (calculated as the maximum expression / minimum expression for each gene of >19000 genes across organs, ages, and sexes ranged from 2.35 to >109-fold, with a median of 165-fold. The expression of 278 SEGs was found to vary ≤4-fold and these genes were significantly involved in protein catabolism (proteasome and ubiquitination, RNA transport, protein processing, and the spliceosome. Such stability of expression was further validated in human samples where the expression variability of the homologous human SEGs was significantly lower than that of other genes in the human genome. It was also found that the homologous human SEGs were generally less subject to non-synonymous mutation than other genes, as would be expected of stably expressed genes. We also found that knockout of SEG homologs in mouse models was more likely to cause complete preweaning lethality than non-SEG homologs, corroborating the fundamental roles played by SEGs in biological development. Such stably expressed genes and pathways across life-stages suggest that tight control of these processes is important in basic cellular functions and that perturbation by endogenous (e.g., genetics or exogenous agents (e.g., drugs, environmental factors may cause serious adverse effects.

  6. Expression of embryonic hemoglobin genes in mice heterozygous for α-thalassemia or β-duplication traits and in mice heterozygous for both traits

    International Nuclear Information System (INIS)

    Popp, R.A.; Marsh, C.L.; Skow, L.C.

    1981-01-01

    Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues

  7. Duplication of the scapula

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez Alegre, Maria Luisa [Department of Diagnostic Imaging, Nino Jesus University Children' s Hospital, 65 Menendez Pelayo Avenue, 28009, Madrid (Spain); C/Ventura Rodrigues 6, Portal 7-4A, Boadilla del Monte, 28660, Madrid (Spain); Marin, Carlos; Mardones, Gloria G. [Department of Diagnostic Imaging, Nino Jesus University Children' s Hospital, 65 Menendez Pelayo Avenue, 28009, Madrid (Spain)

    2003-12-01

    Only three cases of scapular duplication have been described in English in the literature. We report a case of a child with duplication of the right scapula, operated on at our center with good results. (orig.)

  8. Diagnosing Smith-Magenis syndrome and duplication 17p11.2 syndrome by RAI1 gene copy number variation using quantitative real-time PCR.

    Science.gov (United States)

    Truong, Hoa T; Solaymani-Kohal, Sara; Baker, Kevin R; Girirajan, Santhosh; Williams, Stephen R; Vlangos, Christopher N; Smith, Ann C M; Bunyan, David J; Roffey, Paul E; Blanchard, Christopher L; Elsea, Sarah H

    2008-03-01

    Smith-Magenis syndrome (SMS) and duplication 17p11.2 (dup17p11.2) syndrome are multiple congenital anomalies/mental retardation disorders resulting from either a deletion or duplication of the 17p11.2 region, respectively. The retinoic acid induced 1 (RAI1) gene is the causative gene for SMS and is included in the 17p11.2 region of dup17p11.2 syndrome. Currently SMS and dup17p11.2 syndrome are diagnosed using a combination of clinically recognized phenotypes and molecular cytogenetic analyses such as fluorescent in situ hybridization (FISH). However, these methods have proven to be highly expensive, time consuming, and dependent upon the low resolving capabilities of the assay. To address the need for improved diagnostic methods for SMS and dup17p11.2 syndrome, we designed a quantitative real-time PCR (Q-PCR) assay that measures RAI1 copy number using the comparative C(t) method, DeltaDeltaC(t). We tested our assay with samples blinded to their previous SMS or dup17p11.2 syndrome status. In all cases, we were able to determine RAI1 copy number status and render a correct diagnosis accordingly. We validated these results by both FISH and multiplex ligation-dependent probe amplification (MLPA). We conclude that Q-PCR is an accurate, reproducible, low-cost, and reliable assay that can be employed for routine use in SMS and dup17p11.2 diagnosis.

  9. Temporal expression of genes involved in the biosynthesis of ...

    African Journals Online (AJOL)

    Jane

    2011-10-10

    Oct 10, 2011 ... Gibberellins (GAs) are a large family of endogenous plant growth regulators. Bioactive GAs influence nearly all processes during plant growth and development. In the present study, we cloned and identified 10 unique genes that are potentially involved in the biosynthesis of GAs, including one. BpGGDP ...

  10. Identification of Phytophthora sojae genes involved in asexual ...

    Indian Academy of Sciences (India)

    ual sporulation or germination. But molecular details about asexual spore development in P. sojae are limited (Tyler et al. 2006). In the present study, to understand the molecular basis of asexual spore development in P. sojae, we investigated gene expression changes involved in asexual sporulation after ul- traviolet (UV) ...

  11. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

    Science.gov (United States)

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  12. Genetic diversity of MHC class I loci in six non-model frogs is shaped by positive selection and gene duplication

    Science.gov (United States)

    Kiemnec-Tyburczy, K M; Richmond, J Q; Savage, A E; Lips, K R; Zamudio, K R

    2012-01-01

    Comparative studies of major histocompatibility complex (MHC) genes across vertebrate species can reveal the evolutionary processes that shape the structure and function of immune regulatory proteins. In this study, we characterized MHC class I sequences from six frog species representing three anuran families (Hylidae, Centrolenidae and Ranidae). Using cDNA from our focal species, we amplified a total of 79 unique sequences spanning exons 2–4 that encode the extracellular domains of the functional alpha chain protein. We compared intra- and interspecific nucleotide and amino-acid divergence, tested for recombination, and identified codon sites under selection by estimating the rate of non-synonymous to synonymous substitutions with multiple codon-based maximum likelihood methods. We determined that positive (diversifying) selection was acting on specific amino-acid sites located within the domains that bind pathogen-derived peptides. We also found significant signals of recombination across the physical distance of the genes. Finally, we determined that all the six species expressed two or three putative classical class I loci, in contrast to the single locus condition of Xenopus laevis. Our results suggest that MHC evolution in anurans is a dynamic process and that variation in numbers of loci and genetic diversity can exist among taxa. Thus, the accumulation of genetic data for more species will be useful in further characterizing the relative importance of processes such as selection, recombination and gene duplication in shaping MHC loci among amphibian lineages. PMID:22549517

  13. Genes Involved in the Biosynthesis and Transport of Acinetobactin in

    Directory of Open Access Journals (Sweden)

    Tarik Hasan

    2015-03-01

    Full Text Available Pathogenic bacteria survive in iron-limited host environments by using several iron acquisition mechanisms. Acinetobacter baumannii, causing serious infections in compromised patients, produces an iron-chelating molecule, called acinetobactin, which is composed of equimolar quantities of 2,3-dihydroxybenzoic acid (DHBA, L-threonine, and N-hydroxyhistamine, to compete with host cells for iron. Genes that are involved in the production and transport of acinetobactin are clustered within the genome of A. baumannii. A recent study showed that entA, located outside of the acinetobactin gene cluster, plays important roles in the biosynthesis of the acinetobactin precursor DHBA and in bacterial pathogenesis. Therefore, understanding the genes that are associated with the biosynthesis and transport of acinetobactin in the bacterial genome is required. This review is intended to provide a general overview of the genes in the genome of A. baumannii that are required for acinetobactin biosynthesis and transport.

  14. Recombination Events Involving the atp9 Gene Are Associated with Male Sterility of CMS PET2 in Sunflower

    Directory of Open Access Journals (Sweden)

    Antje Reddemann

    2018-03-01

    Full Text Available Cytoplasmic male sterility (CMS systems represent ideal mutants to study the role of mitochondria in pollen development. In sunflower, CMS PET2 also has the potential to become an alternative CMS source for commercial sunflower hybrid breeding. CMS PET2 originates from an interspecific cross of H. petiolaris and H. annuus as CMS PET1, but results in a different CMS mechanism. Southern analyses revealed differences for atp6, atp9 and cob between CMS PET2, CMS PET1 and the male-fertile line HA89. A second identical copy of atp6 was present on an additional CMS PET2-specific fragment. In addition, the atp9 gene was duplicated. However, this duplication was followed by an insertion of 271 bp of unknown origin in the 5′ coding region of the atp9 gene in CMS PET2, which led to the creation of two unique open reading frames orf288 and orf231. The first 53 bp of orf288 are identical to the 5′ end of atp9. Orf231 consists apart from the first 3 bp, being part of the 271-bp-insertion, of the last 228 bp of atp9. These CMS PET2-specific orfs are co-transcribed. All 11 editing sites of the atp9 gene present in orf231 are fully edited. The anther-specific reduction of the co-transcript in fertility-restored hybrids supports the involvement in male-sterility based on CMS PET2.

  15. Characterisation of Campylobacter jejuni genes potentially involved in phosphonate degradation

    Directory of Open Access Journals (Sweden)

    Hartley Lauren E

    2009-06-01

    Full Text Available Abstract Potential biological roles of the Campylobacter jejuni genes cj0641, cj0774c and cj1663 were investigated. The proteins encoded by these genes showed sequence similarities to the phosphonate utilisation PhnH, K and L gene products of Escherichia coli. The genes cj0641, cj0774c and cj1663 were amplified from the pathogenic C. jejuni strain 81116, sequenced, and cloned into pGEM-T Easy vectors. Recombinant plasmids were used to disrupt each one of the genes by inserting a kanamycin resistance (KmR cassette employing site-directed mutagenesis or inverse PCR. Campylobacter jejuni 81116 isogenic mutants were generated by integration of the mutated genes into the genome of the wild-type strain. The C. jejuni mutants grew on primary isolation plates, but they could not be purified by subsequent passages owing to cell death. The mutant C. jejuni strains survived and proliferated in co-cultures with wild-type bacteria or in media in which wild-type C. jejuni had been previously grown. PCR analyses of mixed wild-type/mutant cultures served to verify the presence of the mutated gene in the genome of a fraction of the total bacterial population. The data suggested that each mutation inactivated a gene essential for survival. Rates of phosphonate catabolism in lysates of E. coli strain DH5α were determined using proton nuclear magnetic resonance spectroscopy. Whole-cell lysates of the wild-type degraded phosphonoacetate, phenylphosphonate and aminomethylphosphonate. Significant differences in the rates of phosphonate degradation were observed between lysates of wild-type E. coli, and of bacteria transformed with each one of the vectors carrying one of the C. jejuni genes, suggesting that these genes were involved in phosphonate catabolism.

  16. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia

    2016-01-01

    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... condition (subjects n = 12). Patients with MECP2 gain-of-function mutations showed increased oxidative stress marker levels (plasma non-protein bound iron, intraerythrocyte non-protein bound iron, F2-isoprostanes, and F4-neuroprostanes), as compared to healthy controls (P ≤ 0.05). Such increases were...

  17. Genes involved in translation of Mycoplasma hyopneumoniae and Mycoplasma synoviae

    Directory of Open Access Journals (Sweden)

    Mônica de Oliveira Santos

    2007-01-01

    Full Text Available This is a report on the analysis of genes involved in translation of the complete genomes of Mycoplasma hyopneumoniae strain J and 7448 and Mycoplasma synoviae. In both genomes 31 ORFs encoding large ribosomal subunit proteins and 19 ORFs encoding small ribosomal subunit proteins were found. Ten ribosomal protein gene clusters encoding 42 ribosomal proteins were found in M. synoviae, while 8 clusters encoding 39 ribosomal proteins were found in both M. hyopneumoniae strains. The L33 gene of the M. hyopneumoniae strain 7448 presented two copies in different locations. The genes encoding initiation factors (IF-1, IF-2 and IF-3, elongation factors (EF-G, EF-Tu, EF-Ts and EF-P, and the genes encoding the ribosome recycling factor (frr and one polypeptide release factor (prfA were present in the genomes of M. hyopneumoniae and M. synoviae. Nineteen aminoacyl-tRNA synthases had been previously identified in both mycoplasmas. In the two strains of M. hyopneumoniae, J and 7448, only one set of 5S, 16S and 23S rRNAs had been identified. Two sets of 16S and 23S rRNA genes and three sets of 5S rRNA genes had been identified in the M. synoviae genome.

  18. Mutation analysis of the gene involved in adrenoleukodystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Oost, B.A. van; Ligtenberg, M.J.L. [Univ. Hospital Nijmegen (Netherlands); Kemp, S.; Bolhuis, P.A. [Academic Medical Center, Amsterdam (Netherlands)

    1994-09-01

    A gene responsible for the X-linked genetic disorder adrenoleukodystrophy (ALD) that is characterized by demyelination of the nervous system and adrenocortical insufficiency has been identified by positional cloning. The gene encodes an ATP-binding transporter which is located in the peroxisomal membrane. Deficiency of the gene leads to accumulation of unsaturated very long chain fatty acids due to impaired peroxisomal {beta}-oxidation. A systematic analysis of the open reading frame of the ALD gene unraveled the mutations in 28 different families using reverse transcriptase-PCR followed by direct sequencing. No entire gene deletions or drastic promoter mutations have been detected. Only in one family did the mutation involved multiple exons. The remaining mutations were subtle alterations leading to missense (about 50%) or nonsense mutations, frameshifts or splice acceptor site defects. In one patient a single codon was missing. Mutations affecting a single amino acid were concentrated in the region between the third and fourth putative membrane spanning fragments and in the ATP-binding domain. This overview of mutations aids in the determination of structural and functional important regions and facilitates the screening for mutations in other ALD patients. The detection of mutations in virtually all ALD families tested indicates that the isolated gene is the only gene responsible for ALD located in Xq28.

  19. Polymorphisms of Saccharomyces cerevisiae genes involved in wine production.

    Science.gov (United States)

    Vigentini, Ileana; Fracassetti, Daniela; Picozzi, Claudia; Foschino, Roberto

    2009-03-01

    The setting up of new molecular methods for Saccharomyces cerevisiae typing is valuable in enology. Actually, the ability to discriminate different strains in wine making can have a benefit both for the control of the fermentation process and for the preservation of wine typicity. This study focused on the screening of single-nucleotide polymorphisms in genes involved in wine production that could evolve rapidly considering the selective pressure of the isolation environment. Preliminary screening of 30 genes in silico was performed, followed by the selection of 10 loci belonging to 8 genes. The sequence analysis showed a low polymorphism and a degree of heterozygosity. However, a new potential molecular target was recognized in the TPS1 gene coding for the trehalose-6-phosphate synthase enzyme involved in the ethanol resistance mechanism. This gene showed a 1.42% sequence diversity with seven different nucleotide substitutions. Moreover, classic techniques were applied to a collection of 50 S. cerevisiae isolates, mostly with enologic origin. Our results confirmed that the wine making was not carried out only by the inoculated commercial starter because indigenous strains of S. cerevisiae present during fermentation were detected. In addition, a high genetic relationship among some commercial cultures was found, highlighting imprecision or fraudulent practices by starter manufacturers.

  20. Role of the duplicated CCAAT box region in γ-globin gene regulation and hereditary persistence of fetal haemoglobin.

    NARCIS (Netherlands)

    A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)

    1996-01-01

    textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly

  1. Manipulating duckweed through genome duplication.

    Science.gov (United States)

    Vunsh, R; Heinig, U; Malitsky, S; Aharoni, A; Avidov, A; Lerner, A; Edelman, M

    2015-01-01

    Significant inter- and intraspecific genetic variation exists in duckweed, thus the potential for genome plasticity and manipulation is high. Polyploidy is recognised as a major mechanism of adaptation and speciation in plants. We produced several genome-duplicated lines of Landoltia punctata (Spirodela oligorrhiza) from both whole plants and regenerating explants using a colchicine-based cocktail. These lines stably maintained an enlarged frond and root morphology. DNA ploidy levels determined by florescence-activated cell sorting indicated genome duplication. Line A4 was analysed after 75 biomass doublings. Frond area, fresh and dry weights, rhizoid number and length were significantly increased versus wild type, while the growth rate was unchanged. This resulted in accumulation of biomass 17-20% faster in the A4 plants. We sought to determine if specific differences in gene products are found in the genome duplicated lines. Non-targeted ultra performance LC-quadrupole time of flight mass spectrometry was employed to compare some of the lines and the wild type to seek identification of up-regulated metabolites. We putatively identified differential metabolites in Line A65 as caffeoyl hexoses. The combination of directed genome duplication and metabolic profiling might offer a path for producing stable gene expression, leading to altered production of secondary metabolites. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  2. Short stature homeobox-containing gene duplications in 3.7% of girls with tall stature and normal karyotypes

    DEFF Research Database (Denmark)

    Upners, Emmie N; Jensen, Rikke B; Rajpert-De Meyts, Ewa

    2017-01-01

    AIM: The short stature homeobox containing gene (SHOX) plays an important role in short stature, but has not been explored in detail in a tall stature population before. This study explored the prevalence of SHOX aberrations in girls diagnosed with idiopathic tall stature with a normal karyotype...... in three girls with tall stature and normal karyotypes. This article is protected by copyright. All rights reserved....

  3. Evolution of the bHLH genes involved in stomatal development: implications for the expansion of developmental complexity of stomata in land plants.

    Directory of Open Access Journals (Sweden)

    Jin-Hua Ran

    Full Text Available Stomata play significant roles in plant evolution. A trio of closely related basic Helix-Loop-Helix (bHLH subgroup Ia genes, SPCH, MUTE and FAMA, mediate sequential steps of stomatal development, and their functions may be conserved in land plants. However, the evolutionary history of the putative SPCH/MUTE/FAMA genes is still greatly controversial, especially the phylogenetic positions of the bHLH Ia members from basal land plants. To better understand the evolutionary pattern and functional diversity of the bHLH genes involved in stomatal development, we made a comprehensive evolutionary analysis of the homologous genes from 54 species representing the major lineages of green plants. The phylogenetic analysis indicated: (1 All bHLH Ia genes from the two basal land plants Physcomitrella and Selaginella were closely related to the FAMA genes of seed plants; and (2 the gymnosperm 'SPCH' genes were sister to a clade comprising the angiosperm SPCH and MUTE genes, while the FAMA genes of gymnosperms and angiosperms had a sister relationship. The revealed phylogenetic relationships are also supported by the distribution of gene structures and previous functional studies. Therefore, we deduce that the function of FAMA might be ancestral in the bHLH Ia subgroup. In addition, the gymnosperm "SPCH" genes may represent an ancestral state and have a dual function of SPCH and MUTE, two genes that could have originated from a duplication event in the common ancestor of angiosperms. Moreover, in angiosperms, SPCHs have experienced more duplications and harbor more copies than MUTEs and FAMAs, which, together with variation of the stomatal development in the entry division, implies that SPCH might have contributed greatly to the diversity of stomatal development. Based on the above, we proposed a model for the correlation between the evolution of stomatal development and the genes involved in this developmental process in land plants.

  4. Evolution of the bHLH genes involved in stomatal development: implications for the expansion of developmental complexity of stomata in land plants.

    Science.gov (United States)

    Ran, Jin-Hua; Shen, Ting-Ting; Liu, Wen-Juan; Wang, Xiao-Quan

    2013-01-01

    Stomata play significant roles in plant evolution. A trio of closely related basic Helix-Loop-Helix (bHLH) subgroup Ia genes, SPCH, MUTE and FAMA, mediate sequential steps of stomatal development, and their functions may be conserved in land plants. However, the evolutionary history of the putative SPCH/MUTE/FAMA genes is still greatly controversial, especially the phylogenetic positions of the bHLH Ia members from basal land plants. To better understand the evolutionary pattern and functional diversity of the bHLH genes involved in stomatal development, we made a comprehensive evolutionary analysis of the homologous genes from 54 species representing the major lineages of green plants. The phylogenetic analysis indicated: (1) All bHLH Ia genes from the two basal land plants Physcomitrella and Selaginella were closely related to the FAMA genes of seed plants; and (2) the gymnosperm 'SPCH' genes were sister to a clade comprising the angiosperm SPCH and MUTE genes, while the FAMA genes of gymnosperms and angiosperms had a sister relationship. The revealed phylogenetic relationships are also supported by the distribution of gene structures and previous functional studies. Therefore, we deduce that the function of FAMA might be ancestral in the bHLH Ia subgroup. In addition, the gymnosperm "SPCH" genes may represent an ancestral state and have a dual function of SPCH and MUTE, two genes that could have originated from a duplication event in the common ancestor of angiosperms. Moreover, in angiosperms, SPCHs have experienced more duplications and harbor more copies than MUTEs and FAMAs, which, together with variation of the stomatal development in the entry division, implies that SPCH might have contributed greatly to the diversity of stomatal development. Based on the above, we proposed a model for the correlation between the evolution of stomatal development and the genes involved in this developmental process in land plants.

  5. Genes involved in barley yellow dwarf virus resistance of maize.

    Science.gov (United States)

    Horn, Frederike; Habekuß, Antje; Stich, Benjamin

    2014-12-01

    The results of our study suggest that genes involved in general resistance mechanisms of plants contribute to variation of BYDV resistance in maize. With increasing winter temperatures in Europe, Barley yellow dwarf virus (BYDV) is expected to become a prominent problem in maize cultivation. Breeding for resistance is the best strategy to control the disease and break the transmission cycle of the virus. The objectives of our study were (1) to determine genetic variation with respect to BYDV resistance in a broad germplasm set and (2) to identify single nucleotide polymorphism (SNP) markers linked to genes that are involved in BYDV resistance. An association mapping population with 267 genotypes representing the world's maize gene pool was grown in the greenhouse. Plants were inoculated with BYDV-PAV using viruliferous Rhopalosiphum padi. In the association mapping population, we observed considerable genotypic variance for the trait virus extinction as measured by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and the infection rate. In a genome-wide association study, we observed three SNPs significantly [false discovery rate (FDR) = 0.05] associated with the virus extinction on chromosome 10 explaining together 25 % of the phenotypic variance and five SNPs for the infection rate on chromosomes 4 and 10 explaining together 33 % of the phenotypic variance. The SNPs significantly associated with BYDV resistance can be used in marker assisted selection and will accelerate the breeding process for the development of BYDV resistant maize genotypes. Furthermore, these SNPs were located within genes which were in other organisms described to play a role in general resistance mechanisms. This suggests that these genes contribute to variation of BYDV resistance in maize.

  6. Startling mosaicism of the Y-chromosome and tandem duplication of the SRY and DAZ genes in patients with Turner Syndrome.

    Directory of Open Access Journals (Sweden)

    Sanjay Premi

    Full Text Available Presence of the human Y-chromosome in females with Turner Syndrome (TS enhances the risk of development of gonadoblastoma besides causing several other phenotypic abnormalities. In the present study, we have analyzed the Y chromosome in 15 clinically diagnosed Turner Syndrome (TS patients and detected high level of mosaicisms ranging from 45,XO:46,XY = 100:0% in 4; 45,XO:46,XY:46XX = 4:94:2 in 8; and 45,XO:46,XY:46XX = 50:30:20 cells in 3 TS patients, unlike previous reports showing 5-8% cells with Y- material. Also, no ring, marker or di-centric Y was observed in any of the cases. Of the two TS patients having intact Y chromosome in >85% cells, one was exceptionally tall. Both the patients were positive for SRY, DAZ, CDY1, DBY, UTY and AZFa, b and c specific STSs. Real Time PCR and FISH demonstrated tandem duplication/multiplication of the SRY and DAZ genes. At sequence level, the SRY was normal in 8 TS patients while the remaining 7 showed either absence of this gene or known and novel mutations within and outside of the HMG box. SNV/SFV analysis showed normal four copies of the DAZ genes in these 8 patients. All the TS patients showed aplastic uterus with no ovaries and no symptom of gonadoblastoma. Present study demonstrates new types of polymorphisms indicating that no two TS patients have identical genotype-phenotype. Thus, a comprehensive analysis of more number of samples is warranted to uncover consensus on the loci affected, to be able to use them as potential diagnostic markers.

  7. Duplicated Gephyrin Genes Showing Distinct Tissue Distribution and Alternative Splicing Patterns Mediate Molybdenum Cofactor Biosynthesis, Glycine Receptor Clustering, and Escape Behavior in Zebrafish*

    Science.gov (United States)

    Ogino, Kazutoyo; Ramsden, Sarah L.; Keib, Natalie; Schwarz, Günter; Harvey, Robert J.; Hirata, Hiromi

    2011-01-01

    Gephyrin mediates the postsynaptic clustering of glycine receptors (GlyRs) and GABAA receptors at inhibitory synapses and molybdenum-dependent enzyme (molybdoenzyme) activity in non-neuronal tissues. Gephyrin knock-out mice show a phenotype resembling both defective glycinergic transmission and molybdenum cofactor (Moco) deficiency and die within 1 day of birth due to starvation and dyspnea resulting from deficits in motor and respiratory networks, respectively. To address whether gephyrin function is conserved among vertebrates and whether gephyrin deficiency affects molybdoenzyme activity and motor development, we cloned and characterized zebrafish gephyrin genes. We report here that zebrafish have two gephyrin genes, gphna and gphnb. The former is expressed in all tissues and has both C3 and C4 cassette exons, and the latter is expressed predominantly in the brain and spinal cord and harbors only C4 cassette exons. We confirmed that all of the gphna and gphnb splicing isoforms have Moco synthetic activity. Antisense morpholino knockdown of either gphna or gphnb alone did not disturb synaptic clusters of GlyRs in the spinal cord and did not affect touch-evoked escape behaviors. However, on knockdown of both gphna and gphnb, embryos showed impairments in GlyR clustering in the spinal cord and, as a consequence, demonstrated touch-evoked startle response behavior by contracting antagonistic muscles simultaneously, instead of displaying early coiling and late swimming behaviors, which are executed by side-to-side muscle contractions. These data indicate that duplicated gephyrin genes mediate Moco biosynthesis and control postsynaptic clustering of GlyRs, thereby mediating key escape behaviors in zebrafish. PMID:20843816

  8. Strategies to identify long noncoding RNAs involved in gene regulation

    Directory of Open Access Journals (Sweden)

    Lee Catherine

    2012-11-01

    Full Text Available Abstract Long noncoding RNAs (lncRNAs have been detected in nearly every cell type and found to be fundamentally involved in many biological processes. The characterization of lncRNAs has immense potential to advance our comprehensive understanding of cellular processes and gene regulation, along with implications for the treatment of human disease. The recent ENCODE (Encyclopedia of DNA Elements study reported 9,640 lncRNA loci in the human genome, which corresponds to around half the number of protein-coding genes. Because of this sheer number and their functional diversity, it is crucial to identify a pool of potentially relevant lncRNAs early on in a given study. In this review, we evaluate the methods for isolating lncRNAs by immunoprecipitation and review the advantages, disadvantages, and applications of three widely used approaches – microarray, tiling array, and RNA-seq – for identifying lncRNAs involved in gene regulation. We also look at ways in which data from publicly available databases such as ENCODE can support the study of lncRNAs.

  9. Myxococcus xanthus DK1622 Coordinates Expressions of the Duplicate groEL and Single groES Genes for Synergistic Functions of GroELs and GroES

    Directory of Open Access Journals (Sweden)

    Yue-zhong Li

    2017-04-01

    Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.

  10. MC1R gene variants involvement in human OCA phenotype

    Directory of Open Access Journals (Sweden)

    Saleha Shamim

    2016-01-01

    Full Text Available Oculocutaneous albinism (OCA is a genetic disorder of melanin synthesis that results in hypopigmentation in hair, skin and eyes. OCA has been reported in individuals from all ethnic backgrounds but it is more common among those with Europeans ancestry. OCA is heterogeneous group of disorders and seven types of OCA are caused by mutations in TYR (OCA1, OCA2 (OCA2, TYRP1 (OCA3, SLC45A2 (OCA4, SLC24A5 (OCA6 and C10oRF11 (OCA7 genes. However, MC1R gene variants have been reported that modify OCA2 phenotype but the knowledge about the function ofMC1R gene in melanogenesis, and genotype-phenotype association, in case of OCA, is limited. In this review article we present a comprehensive description of classification of OCA, role of MSH-R in melanin synthesis, the sequence variations in MC1R and their association with OCA. This review will enhance our understanding of MC1R gene variants involved in human OCA2 phenotype.

  11. Nitrate reductase gene involvement in hexachlorobiphenyl dechlorination by Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    De, Supriyo; Perkins, Michael; Dutta, Sisir K.

    2006-01-01

    Polychlorobiphenyl (PCB) degradation usually occurs through reductive dechlorination under anaerobic conditions and phenolic ring cleavage under aerobic conditions. In this paper, we provide evidence of nitrate reductase (NaR) mediated dechlorination of hexachlorobiphenyl (PCB-153) in Phanerochaete chrysosporium under non-ligninolytic condition and the gene involved. The NaR enzyme and its cofactor, molybdenum (Mo), were found to mediate reductive dechlorination of PCBs even in aerobic condition. Tungsten (W), a competitive inhibitor of this enzyme, was found to suppress this dechlorination. Chlorine release assay provided further evidence of this nitrate reductase mediated dechlorination. Commercially available pure NaR enzyme from Aspergillus was used to confirm these results. Through homology search using TBLASTN program, NaR gene was identified, primers were designed and the RT-PCR product was sequenced. The NaR gene was then annotated in the P. chrysosporium genome (GenBank accession no. AY700576). This is the first report regarding the presence of nitrate reductase gene in this fungus with the explanation why this fungus can dechlorinate PCBs even in aerobic condition. These fungal inoculums are used commercially as pellets in sawdust for enhanced bioremediation of PCBs at the risk of depleting soil nitrates. Hence, the addition of nitrates to the pellets will reduce this risk as well as enhance its activity

  12. Gene duplication and genetic exchange drive the evolution of S-RNase-based self-incompatibility in Petunia.

    Science.gov (United States)

    Kubo, Ken-Ichi; Paape, Timothy; Hatakeyama, Masaomi; Entani, Tetsuyuki; Takara, Akie; Kajihara, Kie; Tsukahara, Mai; Shimizu-Inatsugi, Rie; Shimizu, Kentaro K; Takayama, Seiji

    2015-01-08

    Self-incompatibility (SI) systems in flowering plants distinguish self- and non-self pollen to prevent inbreeding. While other SI systems rely on the self-recognition between specific male- and female-determinants, the Solanaceae family has a non-self recognition system resulting in the detoxification of female-determinants of S-ribonucleases (S-RNases), expressed in pistils, by multiple male-determinants of S-locus F-box proteins (SLFs), expressed in pollen. It is not known how many SLF components of this non-self recognition system there are in Solanaceae species, or how they evolved. We identified 16-20 SLFs in each S-haplotype in SI Petunia, from a total of 168 SLF sequences using large-scale next-generation sequencing and genomic polymerase chain reaction (PCR) techniques. We predicted the target S-RNases of SLFs by assuming that a particular S-allele must not have a conserved SLF that recognizes its own S-RNase, and validated these predictions by transformation experiments. A simple mathematical model confirmed that 16-20 SLF sequences would be adequate to recognize the vast majority of target S-RNases. We found evidence of gene conversion events, which we suggest are essential to the constitution of a non-self recognition system and also contribute to self-compatible mutations.

  13. The ERI-6/7 Helicase Acts at the First Stage of an siRNA Amplification Pathway That Targets Recent Gene Duplications

    Science.gov (United States)

    Fischer, Sylvia E. J.; Montgomery, Taiowa A.; Zhang, Chi; Fahlgren, Noah; Breen, Peter C.; Hwang, Alexia; Sullivan, Christopher M.; Carrington, James C.; Ruvkun, Gary

    2011-01-01

    Endogenous small interfering RNAs (siRNAs) are a class of naturally occuring regulatory RNAs found in fungi, plants, and animals. Some endogenous siRNAs are required to silence transposons or function in chromosome segregation; however, the specific roles of most endogenous siRNAs are unclear. The helicase gene eri-6/7 was identified in the nematode Caenorhabditis elegans by the enhanced response to exogenous double-stranded RNAs (dsRNAs) of the null mutant. eri-6/7 encodes a helicase homologous to small RNA factors Armitage in Drosophila, SDE3 in Arabidopsis, and Mov10 in humans. Here we show that eri-6/7 mutations cause the loss of 26-nucleotide (nt) endogenous siRNAs derived from genes and pseudogenes in oocytes and embryos, as well as deficiencies in somatic 22-nucleotide secondary siRNAs corresponding to the same loci. About 80 genes are eri-6/7 targets that generate the embryonic endogenous siRNAs that silence the corresponding mRNAs. These 80 genes share extensive nucleotide sequence homology and are poorly conserved, suggesting a role for these endogenous siRNAs in silencing of and thereby directing the fate of recently acquired, duplicated genes. Unlike most endogenous siRNAs in C. elegans, eri-6/7–dependent siRNAs require Dicer. We identify that the eri-6/7–dependent siRNAs have a passenger strand that is ∼19 nt and is inset by ∼3–4 nts from both ends of the 26 nt guide siRNA, suggesting non-canonical Dicer processing. Mutations in the Argonaute ERGO-1, which associates with eri-6/7–dependent 26 nt siRNAs, cause passenger strand stabilization, indicating that ERGO-1 is required to separate the siRNA duplex, presumably through endonucleolytic cleavage of the passenger strand. Thus, like several other siRNA–associated Argonautes with a conserved RNaseH motif, ERGO-1 appears to be required for siRNA maturation. PMID:22102828

  14. The ERI-6/7 helicase acts at the first stage of an siRNA amplification pathway that targets recent gene duplications.

    Directory of Open Access Journals (Sweden)

    Sylvia E J Fischer

    2011-11-01

    Full Text Available Endogenous small interfering RNAs (siRNAs are a class of naturally occuring regulatory RNAs found in fungi, plants, and animals. Some endogenous siRNAs are required to silence transposons or function in chromosome segregation; however, the specific roles of most endogenous siRNAs are unclear. The helicase gene eri-6/7 was identified in the nematode Caenorhabditis elegans by the enhanced response to exogenous double-stranded RNAs (dsRNAs of the null mutant. eri-6/7 encodes a helicase homologous to small RNA factors Armitage in Drosophila, SDE3 in Arabidopsis, and Mov10 in humans. Here we show that eri-6/7 mutations cause the loss of 26-nucleotide (nt endogenous siRNAs derived from genes and pseudogenes in oocytes and embryos, as well as deficiencies in somatic 22-nucleotide secondary siRNAs corresponding to the same loci. About 80 genes are eri-6/7 targets that generate the embryonic endogenous siRNAs that silence the corresponding mRNAs. These 80 genes share extensive nucleotide sequence homology and are poorly conserved, suggesting a role for these endogenous siRNAs in silencing of and thereby directing the fate of recently acquired, duplicated genes. Unlike most endogenous siRNAs in C. elegans, eri-6/7-dependent siRNAs require Dicer. We identify that the eri-6/7-dependent siRNAs have a passenger strand that is ∼19 nt and is inset by ∼3-4 nts from both ends of the 26 nt guide siRNA, suggesting non-canonical Dicer processing. Mutations in the Argonaute ERGO-1, which associates with eri-6/7-dependent 26 nt siRNAs, cause passenger strand stabilization, indicating that ERGO-1 is required to separate the siRNA duplex, presumably through endonucleolytic cleavage of the passenger strand. Thus, like several other siRNA-associated Argonautes with a conserved RNaseH motif, ERGO-1 appears to be required for siRNA maturation.

  15. Ancestral genomic duplication of the insulin gene in tilapia: An analysis of possible implications for clinical islet xenotransplantation using donor islets from transgenic tilapia expressing a humanized insulin gene.

    Science.gov (United States)

    Hrytsenko, Olga; Pohajdak, Bill; Wright, James R

    2016-07-03

    Tilapia, a teleost fish, have multiple large anatomically discrete islets which are easy to harvest, and when transplanted into diabetic murine recipients, provide normoglycemia and mammalian-like glucose tolerance profiles. Tilapia insulin differs structurally from human insulin which could preclude their use as islet donors for xenotransplantation. Therefore, we produced transgenic tilapia with islets expressing a humanized insulin gene. It is now known that fish genomes may possess an ancestral duplication and so tilapia may have a second insulin gene. Therefore, we cloned, sequenced, and characterized the tilapia insulin 2 transcript and found that its expression is negligible in islets, is not islet-specific, and would not likely need to be silenced in our transgenic fish.

  16. [Duplication of the scapula].

    Science.gov (United States)

    Martini, A K; Neusel, E

    1986-09-01

    Complete duplication of the shoulder blade has not been described so far in the literature. Two case reports with a duplication of the right shoulder blade in multiple malformations of the locomotor and postural apparatus are presented. In both children, the shoulder blades were mobilized and fused. The late examination shows good functional and cosmetic results.

  17. IS21-558 insertion sequences are involved in the mobility of the multiresistance gene cfr

    DEFF Research Database (Denmark)

    Kehrenberg, Corinna; Aarestrup, Frank Møller; Schwarz, Stefan

    2007-01-01

    During a study of florfenicol-resistant porcine staphylococci from Denmark, the genes cfr and fexA were detected in the chromosomal DNA or on plasmids of Staphylococcus hyicus, Staphylococcus warneri, and Staphylococcus simulans. A novel variant of the phenicol resistance transposon Tn558...... exporter gene lsa(B) and the gene cfr for combined resistance to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A antibiotics bracketed by IS21-558 insertion sequences orientated in the same direction. A 6-bp target site duplication was detected at the integration site within...

  18. Differentially expressed genes and gene networks involved in pig ovarian follicular atresia.

    Science.gov (United States)

    Terenina, Elena; Fabre, Stephane; Bonnet, Agnès; Monniaux, Danielle; Robert-Granié, Christèle; SanCristobal, Magali; Sarry, Julien; Vignoles, Florence; Gondret, Florence; Monget, Philippe; Tosser-Klopp, Gwenola

    2017-02-01

    Ovarian folliculogenesis corresponds to the development of follicles leading to either ovulation or degeneration, this latter process being called atresia. Even if atresia involves apoptosis, its mechanism is not well understood. The objective of this study was to analyze global gene expression in pig granulosa cells of ovarian follicles during atresia. The transcriptome analysis was performed on a 9,216 cDNA microarray to identify gene networks and candidate genes involved in pig ovarian follicular atresia. We found 1,684 significantly regulated genes to be differentially regulated between small healthy follicles and small atretic follicles. Among them, 287 genes had a fold-change higher than two between the two follicle groups. Eleven genes (DKK3, GADD45A, CAMTA2, CCDC80, DAPK2, ECSIT, MSMB, NUPR1, RUNX2, SAMD4A, and ZNF628) having a fold-change higher than five between groups could likely serve as markers of follicular atresia. Moreover, automatic confrontation of deregulated genes with literature data highlighted 93 genes as regulatory candidates of pig granulosa cell atresia. Among these genes known to be inhibitors of apoptosis, stimulators of apoptosis, or tumor suppressors INHBB, HNF4, CLU, different interleukins (IL5, IL24), TNF-associated receptor (TNFR1), and cytochrome-c oxidase (COX) were suggested as playing an important role in porcine atresia. The present study also enlists key upstream regulators in follicle atresia based on our results and on a literature review. The novel gene candidates and gene networks identified in the current study lead to a better understanding of the molecular regulation of ovarian follicular atresia. Copyright © 2017 the American Physiological Society.

  19. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template [v1; ref status: indexed, http://f1000r.es/48i

    Directory of Open Access Journals (Sweden)

    Hossein Gouran

    2014-09-01

    Full Text Available Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC, implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF. In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  20. The Stress-Inducible Peroxidase TSA2 Underlies a Conditionally Beneficial Chromosomal Duplication in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Robert A. Linder

    2017-09-01

    Full Text Available Although chromosomal duplications are often deleterious, in some cases they enhance cells’ abilities to tolerate specific genetic or environmental challenges. Identifying the genes that confer these conditionally beneficial effects to particular chromosomal duplications can improve our understanding of the genetic and molecular mechanisms that enable certain aneuploidies to persist in cell populations and contribute to disease and evolution. Here, we perform a screen for spontaneous mutations that improve the tolerance of haploid Saccharomyces cerevisiae to hydrogen peroxide. Chromosome IV duplication is the most frequent mutation, as well as the only change in chromosomal copy number seen in the screen. Using a genetic mapping strategy that involves systematically deleting segments of a duplicated chromosome, we show that the chromosome IV’s duplication effect is largely due to the generation of a second copy of the stress-inducible cytoplasmic thioredoxin peroxidase TSA2. Our findings add to a growing body of literature that shows the conditionally beneficial effects of chromosomal duplication are typically mediated by a small number of genes that enhance tolerance to specific stresses when their copy numbers are increased.

  1. Identification of duplicated and stress-inducible Aox2b gene co-expressed with Aox1 in species of the Medicago genus reveals a regulation linked to gene rearrangement in leguminous genomes.

    Science.gov (United States)

    Cavalcanti, João Henrique Frota; Oliveira, Georgia Mesquita; Saraiva, Kátia Daniella da Cruz; Torquato, José Pedro Pires; Maia, Ivan G; de Melo, Dirce Fernandes; Costa, José Hélio

    2013-12-15

    In flowering plants, alternative oxidase (Aox) is encoded by 3-5 genes distributed in 2 subfamilies (Aox1 and Aox2). In several species only Aox1 is reported as a stress-responsive gene, but in the leguminous Vigna unguiculata Aox2b is also induced by stress. In this work we investigated the Aox genes from two leguminous species of the Medicago genus (Medicago sativa and Medicago truncatula) which present one Aox1, one Aox2a and an Aox2b duplication (named here Aox2b1 and Aox2b2). Expression analyses by semi-quantitative RT-PCR in M. sativa revealed that Aox1, Aox2b1 and Aox2b2 transcripts increased during seed germination. Similar analyses in leaves and roots under different treatments (SA, PEG, H2O2 and cysteine) revealed that these genes are also induced by stress, but with peculiar spatio-temporal differences. Aox1 and Aox2b1 showed basal levels of expression under control conditions and were induced by stress in leaves and roots. Aox2b2 presented a dual behavior, i.e., it was expressed only under stress conditions in leaves, and showed basal expression levels in roots that were induced by stress. Moreover, Aox2a was expressed at higher levels in leaves and during seed germination than in roots and appeared to be not responsive to stress. The Aox expression profiles obtained from a M. truncatula microarray dataset also revealed a stress-induced co-expression of Aox1, Aox2b1 and Aox2b2 in leaves and roots. These results reinforce the stress-inducible co-expression of Aox1/Aox2b in some leguminous plants. Comparative genomic analysis indicates that this regulation is linked to Aox1/Aox2b proximity in the genome as a result of the gene rearrangement that occurred in some leguminous plants during evolution. The differential expression of Aox2b1/2b2 suggests that a second gene has been originated by recent gene duplication with neofunctionalization. Copyright © 2013 Elsevier GmbH. All rights reserved.

  2. Neofunctionalization of Duplicated Tic40 Genes Caused a Gain-of-Function Variation Related to Male Fertility in Brassica oleracea Lineages1[W][OPEN

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-01-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. PMID:25185122

  3. Neofunctionalization of duplicated Tic40 genes caused a gain-of-function variation related to male fertility in Brassica oleracea lineages.

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-11-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. © 2014 American Society of Plant Biologists. All Rights Reserved.

  4. Current incidence of duplicate publication in otolaryngology.

    Science.gov (United States)

    Cheung, Veronique Wan Fook; Lam, Gilbert O A; Wang, Yun Fan; Chadha, Neil K

    2014-03-01

    Duplicate publication--deemed highly unethical--is the reproduction of substantial content in another article by the same authors. In 1999, Rosenthal et al. identified an 8.5% incidence of duplicate articles in two otolaryngology journals. We explored the current incidence in three otolaryngology journals in North America and Europe. Retrospective literature review. Index articles in 2008 in Archives of Otolaryngology-Head and Neck Surgery, Laryngoscope, and Clinical Otolaryngology were searched using MEDLINE. Potential duplicate publications in 2006 through 2010 were identified using the first, second, and last authors' names. Three authors independently investigated suspected duplicate publications--classifying them by degree of duplication. Of 358 index articles screened, 75 (20.9%) had 119 potential duplicates from 2006 to 2010. Full review of these 119 potential duplicates revealed a total of 40 articles with some form of redundancy (33.6% of the potential duplicates) involving 27 index articles (7.5% of 358 index articles); one (0.8%) "dual" publication (identical or nearly identical data and conclusions to the index article); three (2.5%) "suspected" dual publications (less than 50% new data and same conclusions); and 36 (30.3%) publications with "salami-slicing" (portion of the index article data repeated) were obtained. Further analysis compared the likelihood of duplicate publication by study source and subspecialty within otolaryngology. The incidence of duplicate publication has not significantly changed over 10 years. "Salami-slicing" was a concerning practice, with no cross-referencing in 61% of these cases. Detecting and eliminating redundant publications is a laborious task, but it is essential in upholding the journal quality and research integrity. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  5. HLA genes and other candidate genes involved in susceptibility for (pre)neoplastic cervical disease

    NARCIS (Netherlands)

    Zoodsma, M; Nolte, IM; Meerman, GJT; De Vries, EGE; Van Der Zee, AGJ

    This review focuses on common and genetic risk factors such as HLA and other genes that may be involved in susceptibility for (pre)neoplastic cervical disease. The goal of this review is the evaluation of polymorphisms that are either associated with cervical intraepithelial neoplasia (CIN) and/or

  6. The transcriptional repressor DREAM is involved in thyroid gene expression

    International Nuclear Information System (INIS)

    D'Andrea, Barbara; Di Palma, Tina; Mascia, Anna; Motti, Maria Letizia; Viglietto, Giuseppe; Nitsch, Lucio; Zannini, Mariastella

    2005-01-01

    Downstream regulatory element antagonistic modulator (DREAM) was originally identified in neuroendocrine cells as a calcium-binding protein that specifically binds to downstream regulatory elements (DRE) on DNA, and represses transcription of its target genes. To explore the possibility that DREAM may regulate the endocrine activity of the thyroid gland, we analyzed its mRNA expression in undifferentiated and differentiated thyroid cells. We demonstrated that DREAM is expressed in the normal thyroid tissue as well as in differentiated thyroid cells in culture while it is absent in FRT poorly differentiated cells. In the present work, we also show that DREAM specifically binds to DRE sites identified in the 5' untranslated region (UTR) of the thyroid-specific transcription factors Pax8 and TTF-2/FoxE1 in a calcium-dependent manner. By gel retardation assays we demonstrated that thapsigargin treatment increases the binding of DREAM to the DRE sequences present in Pax8 and TTF-2/Foxe1 5' UTRs, and this correlates with a significant reduction of the expression of these genes. Interestingly, in poorly differentiated thyroid cells overexpression of exogenous DREAM strongly inhibits Pax8 expression. Moreover, we provide evidence that a mutated form of DREAM unable to bind Ca 2+ interferes with thyroid cell proliferation. Therefore, we propose that in thyroid cells DREAM is a mediator of the calcium-signaling pathway and it is involved in the regulation of thyroid cell function

  7. Partial Duplication of Chromosome 8p

    African Journals Online (AJOL)

    rme

    duplication.13,23-29. A number of authors suggested that a candidate gene/or a cluster of genes located in 8p23 region behaves as a dominant mutation that .... Partial trisomy of short arm of chromosome 8 (46,XY, inv dup (8) (p21- ->pter) in a Bedouin child with multiple congenital anomalies and mental retardation.

  8. Clustering of two genes putatively involved in cyanate detoxification evolved recently and independently in multiple fungal lineages

    Science.gov (United States)

    Fungi that have the enzymes cyanase and carbonic anhydrase show a limited capacity to detoxify cyanate, a fungicide employed by both plants and humans. Here, we describe a novel two-gene cluster that comprises duplicated cyanase and carbonic anhydrase copies, which we name the CCA gene cluster, trac...

  9. Identifying genes and gene networks involved in chromium metabolism and detoxification in Crambe abyssinica

    Energy Technology Data Exchange (ETDEWEB)

    Zulfiqar, Asma, E-mail: asmazulfiqar08@yahoo.com [Department of Plant, Soil, and Insect Sciences, 270 Stockbridge Road, University of Massachusetts Amherst, MA 01003 (United States); Paulose, Bibin, E-mail: bpaulose@psis.umass.edu [Department of Plant, Soil, and Insect Sciences, 270 Stockbridge Road, University of Massachusetts Amherst, MA 01003 (United States); Chhikara, Sudesh, E-mail: sudesh@psis.umass.edu [Department of Plant, Soil, and Insect Sciences, 270 Stockbridge Road, University of Massachusetts Amherst, MA 01003 (United States); Dhankher, Om Parkash, E-mail: parkash@psis.umass.edu [Department of Plant, Soil, and Insect Sciences, 270 Stockbridge Road, University of Massachusetts Amherst, MA 01003 (United States)

    2011-10-15

    Chromium pollution is a serious environmental problem with few cost-effective remediation strategies available. Crambe abyssinica (a member of Brassicaseae), a non-food, fast growing high biomass crop, is an ideal candidate for phytoremediation of heavy metals contaminated soils. The present study used a PCR-Select Suppression Subtraction Hybridization approach in C. abyssinica to isolate differentially expressed genes in response to Cr exposure. A total of 72 differentially expressed subtracted cDNAs were sequenced and found to represent 43 genes. The subtracted cDNAs suggest that Cr stress significantly affects pathways related to stress/defense, ion transporters, sulfur assimilation, cell signaling, protein degradation, photosynthesis and cell metabolism. The regulation of these genes in response to Cr exposure was further confirmed by semi-quantitative RT-PCR. Characterization of these differentially expressed genes may enable the engineering of non-food, high-biomass plants, including C. abyssinica, for phytoremediation of Cr-contaminated soils and sediments. - Highlights: > Molecular mechanism of Cr uptake and detoxification in plants is not well known. > We identified differentially regulated genes upon Cr exposure in Crambe abyssinica. > 72 Cr-induced subtracted cDNAs were sequenced and found to represent 43 genes. > Pathways linked to stress, ion transport, and sulfur assimilation were affected. > This is the first Cr transcriptome study in a crop with phytoremediation potential. - This study describes the identification and isolation of differentially expressed genes involved in chromium metabolism and detoxification in a non-food industrial oil crop Crambe abyssinica.

  10. Genome Duplication in Soybean (Glycine Subgenus Soja)

    Science.gov (United States)

    Shoemaker, R. C.; Polzin, K.; Labate, J.; Specht, J.; Brummer, E. C.; Olson, T.; Young, N.; Concibido, V.; Wilcox, J.; Tamulonis, J. P.; Kochert, G.; Boerma, H. R.

    1996-01-01

    Restriction fragment length polymorphism mapping data from nine populations (Glycine max X G. soja and G. max X G. max) of the Glycine subgenus soja genome led to the identification of many duplicated segments of the genome. Linkage groups contained up to 33 markers that were duplicated on other linkage groups. The size of homoeologous regions ranged from 1.5 to 106.4 cM, with an average size of 45.3 cM. We observed segments in the soybean genome that were present in as many as six copies with an average of 2.55 duplications per segment. The presence of nested duplications suggests that at least one of the original genomes may have undergone an additional round of tetraploidization. Tetraploidization, along with large internal duplications, accounts for the highly duplicated nature of the genome of the subgenus. Quantitative trait loci for seed protein and oil showed correspondence across homoeologous regions, suggesting that the genes or gene families contributing to seed composition have retained similar functions throughout the evolution of the chromosomes. PMID:8878696

  11. Brain evolution by brain pathway duplication.

    Science.gov (United States)

    Chakraborty, Mukta; Jarvis, Erich D

    2015-12-19

    Understanding the mechanisms of evolution of brain pathways for complex behaviours is still in its infancy. Making further advances requires a deeper understanding of brain homologies, novelties and analogies. It also requires an understanding of how adaptive genetic modifications lead to restructuring of the brain. Recent advances in genomic and molecular biology techniques applied to brain research have provided exciting insights into how complex behaviours are shaped by selection of novel brain pathways and functions of the nervous system. Here, we review and further develop some insights to a new hypothesis on one mechanism that may contribute to nervous system evolution, in particular by brain pathway duplication. Like gene duplication, we propose that whole brain pathways can duplicate and the duplicated pathway diverge to take on new functions. We suggest that one mechanism of brain pathway duplication could be through gene duplication, although other mechanisms are possible. We focus on brain pathways for vocal learning and spoken language in song-learning birds and humans as example systems. This view presents a new framework for future research in our understanding of brain evolution and novel behavioural traits. © 2015 The Authors.

  12. Segmental duplications: evolution and impact among the current Lepidoptera genomes.

    Science.gov (United States)

    Zhao, Qian; Ma, Dongna; Vasseur, Liette; You, Minsheng

    2017-07-06

    Structural variation among genomes is now viewed to be as important as single nucleoid polymorphisms in influencing the phenotype and evolution of a species. Segmental duplication (SD) is defined as segments of DNA with homologous sequence. Here, we performed a systematic analysis of segmental duplications (SDs) among five lepidopteran reference genomes (Plutella xylostella, Danaus plexippus, Bombyx mori, Manduca sexta and Heliconius melpomene) to understand their potential impact on the evolution of these species. We find that the SDs content differed substantially among species, ranging from 1.2% of the genome in B. mori to 15.2% in H. melpomene. Most SDs formed very high identity (similarity higher than 90%) blocks but had very few large blocks. Comparative analysis showed that most of the SDs arose after the divergence of each linage and we found that P. xylostella and H. melpomene showed more duplications than other species, suggesting they might be able to tolerate extensive levels of variation in their genomes. Conserved ancestral and species specific SD events were assessed, revealing multiple examples of the gain, loss or maintenance of SDs over time. SDs content analysis showed that most of the genes embedded in SDs regions belonged to species-specific SDs ("Unique" SDs). Functional analysis of these genes suggested their potential roles in the lineage-specific evolution. SDs and flanking regions often contained transposable elements (TEs) and this association suggested some involvement in SDs formation. Further studies on comparison of gene expression level between SDs and non-SDs showed that the expression level of genes embedded in SDs was significantly lower, suggesting that structure changes in the genomes are involved in gene expression differences in species. The results showed that most of the SDs were "unique SDs", which originated after species formation. Functional analysis suggested that SDs might play different roles in different species. Our

  13. Pyloroduodenal duplication cyst

    Directory of Open Access Journals (Sweden)

    Venkatesh M Annigeri

    2012-01-01

    Full Text Available A 4-year-old girl presented with non-bilious vomiting and loss of appetite and weight. At laparotomy, a non-communicating pyloroduodenal duplication cyst was present. Subtotal excision of the cyst and cauterization of the mucosal lining of the common wall was performed. The post-operative recovery was uneventful.

  14. A Duplicate Construction Experiment.

    Science.gov (United States)

    Bridgeman, Brent

    This experiment was designed to assess the ability of item writers to construct truly parallel tests based on a "duplicate-construction experiment" in which Cronbach argues that if the universe description and sampling are ideally refined, the two independently constructed tests will be entirely equivalent, and that within the limits of item…

  15. Investigation of yeast genes possibly involved in mtDNA stability ...

    African Journals Online (AJOL)

    Screening of Caenorhabditis elegans genes possibly involved in the mitochondrial genome maintenance was performed using our previous validated method of RNAi combined with ethidium bromide. This was to knock down C. elegans genes homologous to yeast genes known to be involved in mtDNA stability but of ...

  16. Thioridazine affects transcription of genes involved in cell wall biosynthesis in methicillin-resistant Staphylococcus aureus

    DEFF Research Database (Denmark)

    Bonde, Mette; Højland, Dorte Heidi; Kolmos, Hans Jørn

    2011-01-01

    have previously shown that the expression of some resistance genes is abolished after treatment with thioridazine and oxacillin. To further understand the mechanism underlying the reversal of resistance, we tested the expression of genes involved in antibiotic resistance and cell wall biosynthesis...... reversal of resistance by thioridazine relies on decreased expression of specific genes involved in cell wall biosynthesis....

  17. Identification of sugarcane genes involved in the purine synthesis pathway

    Directory of Open Access Journals (Sweden)

    Mario A. Jancso

    2001-12-01

    Full Text Available Nucleotide synthesis is of central importance to all cells. In most organisms, the purine nucleotides are synthesized de novo from non-nucleotide precursors such as amino acids, ammonia and carbon dioxide. An understanding of the enzymes involved in sugarcane purine synthesis opens the possibility of using these enzymes as targets for chemicals which may be effective in combating phytopathogen. Such an approach has already been applied to several parasites and types of cancer. The strategy described in this paper was applied to identify sugarcane clusters for each step of the de novo purine synthesis pathway. Representative sequences of this pathway were chosen from the National Center for Biotechnology Information (NCBI database and used to search the translated sugarcane expressed sequence tag (SUCEST database using the available basic local alignment search tool (BLAST facility. Retrieved clusters were further tested for the statistical significance of the alignment by an implementation (PRSS3 of the Monte Carlo shuffling algorithm calibrated using known protein sequences of divergent taxa along the phylogenetic tree. The sequences were compared to each other and to the sugarcane clusters selected using BLAST analysis, with the resulting table of p-values indicating the degree of divergence of each enzyme within different taxa and in relation to the sugarcane clusters. The results obtained by this strategy allowed us to identify the sugarcane proteins participating in the purine synthesis pathway.A via de síntese de purino nucleotídeos é considerada uma via de central importância para todas as células. Na maioria dos organismos, os purino nucleotídeos são sintetizados ''de novo'' a partir de precursores não-nucleotídicos como amino ácidos, amônia e dióxido de carbono. O conhecimento das enzimas envolvidas na via de síntese de purinas da cana-de-açúcar vai abrir a possibilidade do uso dessas enzimas como alvos no desenho

  18. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

    2011-01-01

    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...... for reconstructing the evolutionary history of a set of species. In this paper we present methods to compute all sorting TDRLs for two given gene orders. In addition, a closed formula for the number of sorting TDRLs is derived and further properties of sorting TDRLs are investigated. It is also shown...

  19. Gastric, pancreatic, and ureteric duplication

    Directory of Open Access Journals (Sweden)

    Chattopadhyay Anindya

    2010-01-01

    Full Text Available We report a case of an 8-month-old, asymptomatic child who was incidentally detected to have two cystic structures in the abdomen. Surgical exploration revealed a gastric and pancreatic duplication cyst along with a blind-ending duplication of the right ureter. Excision of the duplications was relatively straightforward, and the child made an uneventful recovery. This constellation of duplications has not been reported before.

  20. Duplication of Vermiform Appendix.

    Science.gov (United States)

    Bhat, Gulzar Ahmad; Reshi, Tarooq Ahmad; Rashid, Asiya

    2016-02-01

    The vermiform appendix is a tubular, narrow, worm-shaped part of the alimentary canal that lies near the ileocecal junction and communicates with the caecum. Duplication of the vermiform appendix is rare, with a reported incidence of 0.004 %. Till now, fewer than 100 cases have been reported. We present a case of an 8-year-old male child with duplex appendix who presented to the emergency department of our institution with features of acute appendicitis.

  1. Is Gene Transcription Involved in Seed Dry After-Ripening?

    Science.gov (United States)

    Meimoun, Patrice; Mordret, Ernest; Langlade, Nicolas B.; Balzergue, Sandrine; Arribat, Sandrine; Bailly, Christophe; El-Maarouf-Bouteau, Hayat

    2014-01-01

    Orthodox seeds are living organisms that survive anhydrobiosis and may display dormancy, an inability to germinate at harvest. Seed germination potential can be acquired during a prolonged period of dry storage called after-ripening. The aim of this work was to determine if gene transcription is an underlying regulatory mechanism for dormancy alleviation during after-ripening. To identify changes in gene transcription strictly associated with the acquisition of germination potential but not with storage, we used seed storage at low relative humidity that maintains dormancy as control. Transcriptome profiling was performed using DNA microarray to compare change in gene transcript abundance between dormant (D), after-ripened non-dormant (ND) and after-ripened dormant seeds (control, C). Quantitative real-time polymerase chain reaction (qPCR) was used to confirm gene expression. Comparison between D and ND showed the differential expression of 115 probesets at cut-off values of two-fold change (p<0.05). Comparisons between both D and C with ND in transcript abundance showed that only 13 transcripts, among 115, could be specific to dormancy alleviation. qPCR confirms the expression pattern of these transcripts but without significant variation between conditions. Here we show that sunflower seed dormancy alleviation in the dry state is not related to regulated changes in gene expression. PMID:24466101

  2. Is gene transcription involved in seed dry after-ripening?

    Directory of Open Access Journals (Sweden)

    Patrice Meimoun

    Full Text Available Orthodox seeds are living organisms that survive anhydrobiosis and may display dormancy, an inability to germinate at harvest. Seed germination potential can be acquired during a prolonged period of dry storage called after-ripening. The aim of this work was to determine if gene transcription is an underlying regulatory mechanism for dormancy alleviation during after-ripening. To identify changes in gene transcription strictly associated with the acquisition of germination potential but not with storage, we used seed storage at low relative humidity that maintains dormancy as control. Transcriptome profiling was performed using DNA microarray to compare change in gene transcript abundance between dormant (D, after-ripened non-dormant (ND and after-ripened dormant seeds (control, C. Quantitative real-time polymerase chain reaction (qPCR was used to confirm gene expression. Comparison between D and ND showed the differential expression of 115 probesets at cut-off values of two-fold change (p<0.05. Comparisons between both D and C with ND in transcript abundance showed that only 13 transcripts, among 115, could be specific to dormancy alleviation. qPCR confirms the expression pattern of these transcripts but without significant variation between conditions. Here we show that sunflower seed dormancy alleviation in the dry state is not related to regulated changes in gene expression.

  3. Analysis of cosmid clones of nuclear DNA from Trypanosome brucei shows that the genes for variant surface glycoproteins are clustered in the genome.

    NARCIS (Netherlands)

    D. Valerio (Dinko); T. de Lange; P. Borst (Piet); F.G. Grosveld (Frank); L.H.T. van der Ploeg

    1982-01-01

    textabstractTrypanosoma brucei contains more than a hundred genes coding for the different variant surface glycoproteins (VSGs). Activation of some of these genes involves the duplication of the gene (the basic copy or BC) and transposition of the duplicate to an expression site (yielding the

  4. RESEARCH NOTE Identification of genes involved in cold-shock ...

    Indian Academy of Sciences (India)

    Navya

    2017-01-04

    Jan 4, 2017 ... A rapid decline in temperature poses a major challenge for poikilothermic fish, as their entire metabolism depends on ambient temperature. We compared the gene expression of rainbow trout (Oncorhynchus mykiss) having undergone such a cold shock (0 °C) to a control (5 °C) using microarrays and ...

  5. Expression profiles of genes involved in tanshinone biosynthesis of ...

    Indian Academy of Sciences (India)

    tanshinone biosynthetic gene; quantitative real-time PCR; Salvia miltiorrhiza. Abstract. Author Affiliations. ZHENQIAO SONG1 2 JIANHUA WANG1 2 XINGFENG LI1 2. State Key Laboratory of Crop Biology, Shandong Key Laboratory of Crop Biology, a; Agronomy College, Shandong Agricultural University, Taian 271018, ...

  6. Genes involved in bovine milk-fat composition

    NARCIS (Netherlands)

    Schennink, A.

    2009-01-01

    The aim of the research described in this thesis was to identify genes that underlie the genetic variation in bovine milk-fat composition. The fat composition of milk samples from approximately 2,000 Dutch Holstein Friesian cows in their first lactation was measured by gas chromatography.

  7. Coverage analysis of lists of genes involved in heterogeneous ...

    Indian Academy of Sciences (India)

    Exome sequencing (ES) has been proven efficient for clinical applications in heterogeneous genetic diseases (Neveling et al. 2013; Biesecker and Green 2014), including ES asso- ciated with data filtering for selected genes (Dias et al. 2012; Bartoli et al. 2014). However, previous reports have been based mainly on the ...

  8. Involvement of calcitonin gene-related peptide in migraine

    DEFF Research Database (Denmark)

    Lassen, L H; Jacobsen, V B; Haderslev, P A

    2008-01-01

    Calcitonin gene-related peptide (CGRP)-containing nerves are closely associated with cranial blood vessels. CGRP is the most potent vasodilator known in isolated cerebral blood vessels. CGRP can induce migraine attacks, and two selective CGRP receptor antagonists are effective in the treatment...

  9. The E2F-DP1 Transcription Factor Complex Regulates Centriole Duplication in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Jacqueline G. Miller

    2016-03-01

    Full Text Available Centrioles play critical roles in the organization of microtubule-based structures, from the mitotic spindle to cilia and flagella. In order to properly execute their various functions, centrioles are subjected to stringent copy number control. Central to this control mechanism is a precise duplication event that takes place during S phase of the cell cycle and involves the assembly of a single daughter centriole in association with each mother centriole . Recent studies have revealed that posttranslational control of the master regulator Plk4/ZYG-1 kinase and its downstream effector SAS-6 is key to ensuring production of a single daughter centriole. In contrast, relatively little is known about how centriole duplication is regulated at a transcriptional level. Here we show that the transcription factor complex EFL-1-DPL-1 both positively and negatively controls centriole duplication in the Caenorhabditis elegans embryo. Specifically, we find that down regulation of EFL-1-DPL-1 can restore centriole duplication in a zyg-1 hypomorphic mutant and that suppression of the zyg-1 mutant phenotype is accompanied by an increase in SAS-6 protein levels. Further, we find evidence that EFL-1-DPL-1 promotes the transcription of zyg-1 and other centriole duplication genes. Our results provide evidence that in a single tissue type, EFL-1-DPL-1 sets the balance between positive and negative regulators of centriole assembly and thus may be part of a homeostatic mechanism that governs centriole assembly.

  10. Disruption of rcsB by a duplicated sequence in a curli-producing Escherichia coli O157:H7 results in differential gene expression in relation to biofilm formation, stress responses and metabolism.

    Science.gov (United States)

    Sharma, V K; Bayles, D O; Alt, D P; Looft, T; Brunelle, B W; Stasko, J A

    2017-03-08

    Escherichia coli O157:H7 (O157) strain 86-24, linked to a 1986 disease outbreak, displays curli- and biofilm-negative phenotypes that are correlated with the lack of Congo red (CR) binding and formation of white colonies (CR - ) on a CR-containing medium. However, on a CR medium this strain produces red isolates (CR + ) capable of producing curli fimbriae and biofilms. To identify genes controlling differential expression of curli fimbriae and biofilm formation, the RNA-Seq profile of a CR + isolate was compared to the CR - parental isolate. Of the 242 genes expressed differentially in the CR + isolate, 201 genes encoded proteins of known functions while the remaining 41 encoded hypothetical proteins. Among the genes with known functions, 149 were down- and 52 were up-regulated. Some of the upregulated genes were linked to biofilm formation through biosynthesis of curli fimbriae and flagella. The genes encoding transcriptional regulators, such as CsgD, QseB, YkgK, YdeH, Bdm, CspD, BssR and FlhDC, which modulate biofilm formation, were significantly altered in their expression. Several genes of the envelope stress (cpxP), heat shock (rpoH, htpX, degP), oxidative stress (ahpC, katE), nutrient limitation stress (phoB-phoR and pst) response pathways, and amino acid metabolism were downregulated in the CR + isolate. Many genes mediating acid resistance and colanic acid biosynthesis, which influence biofilm formation directly or indirectly, were also down-regulated. Comparative genomics of CR + and CR - isolates revealed the presence of a short duplicated sequence in the rcsB gene of the CR + isolate. The alignment of the amino acid sequences of RcsB of the two isolates showed truncation of RcsB in the CR + isolate at the insertion site of the duplicated sequence. Complementation of CR + isolate with rcsB of the CR - parent restored parental phenotypes to the CR + isolate. The results of this study indicate that RcsB is a global regulator affecting bacterial survival in

  11. Finding candidate genes under positive selection in Non-model species: examples of genes involved in host specialization in pathogens.

    Science.gov (United States)

    Aguileta, G; Lengelle, J; Marthey, S; Chiapello, H; Rodolphe, F; Gendrault, A; Yockteng, R; Vercken, E; Devier, B; Fontaine, M C; Wincker, P; Dossat, C; Cruaud, C; Couloux, A; Giraud, T

    2010-01-01

    Numerous genes in diverse organisms have been shown to be under positive selection, especially genes involved in reproduction, adaptation to contrasting environments, hybrid inviability, and host-pathogen interactions. Looking for genes under positive selection in pathogens has been a priority in efforts to investigate coevolution dynamics and to develop vaccines or drugs. To elucidate the functions involved in host specialization, here we aimed at identifying candidate sequences that could have evolved under positive selection among closely related pathogens specialized on different hosts. For this goal, we sequenced c. 17,000-32,000 ESTs from each of four Microbotryum species, which are fungal pathogens responsible for anther smut disease on host plants in the Caryophyllaceae. Forty-two of the 372 predicted orthologous genes showed significant signal of positive selection, which represents a good number of candidate genes for further investigation. Sequencing 16 of these genes in 9 additional Microbotryum species confirmed that they have indeed been rapidly evolving in the pathogen species specialized on different hosts. The genes showing significant signals of positive selection were putatively involved in nutrient uptake from the host, secondary metabolite synthesis and secretion, respiration under stressful conditions and stress response, hyphal growth and differentiation, and regulation of expression by other genes. Many of these genes had transmembrane domains and may therefore also be involved in pathogen recognition by the host. Our approach thus revealed fruitful and should be feasible for many non-model organisms for which candidate genes for diversifying selection are needed.

  12. Uncovering genes and ploidy involved in the high diversity in root hair density, length and response to local scarce phosphate in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Markus G Stetter

    Full Text Available Plant root hairs increase the root surface to enhance the uptake of sparingly soluble and immobile nutrients, such as the essential nutrient phosphorus, from the soil. Here, root hair traits and the response to scarce local phosphorus concentration were studied in 166 accessions of Arabidopsis thaliana using split plates. Root hair density and length were correlated, but highly variable among accessions. Surprisingly, the well-known increase in root hair density under low phosphorus was mostly restricted to genotypes that had less and shorter root hairs under P sufficient conditions. By contrast, several accessions with dense and long root hairs even had lower hair density or shorter hairs in local scarce phosphorus. Furthermore, accessions with whole-genome duplications developed more dense but phosphorus-insensitive root hairs. The impact of genome duplication on root hair density was confirmed by comparing tetraploid accessions with their diploid ancestors. Genome-wide association mapping identified candidate genes potentially involved in root hair responses tp scarce local phosphate. Knock-out mutants in identified candidate genes (CYR1, At1g32360 and RLP48 were isolated and differences in root hair traits in the mutants were confirmed. The large diversity in root hair traits among accessions and the diverse response when local phosphorus is scarce is a rich resource for further functional analyses.

  13. Identification of Phytophthora sojae genes involved in asexual ...

    Indian Academy of Sciences (India)

    predicted to encode proteins involved in metabolism, cell cycle, protein biosynthesis, cell signalling, cell defence, and tran- scription regulation. Seven clones were selected for temporal expression ..... idative lipid metabolism was shown necessary for antheridial induction, gametangial fusion, meiosis, and oospore matura-.

  14. Novel partial duplication of EYA1 causes branchiootic syndrome in a large Brazilian family.

    Science.gov (United States)

    Dantas, Vitor G L; Freitas, Erika L; Della-Rosa, Valter A; Lezirovitz, Karina; de Moraes, Ana Maria S M; Ramos, Silvia B; Oiticica, Jeanne; Alves, Leandro U; Pearson, Peter L; Rosenberg, Carla; Mingroni-Netto, Regina C

    2015-01-01

    To identify novel genetic causes of syndromic hearing loss in Brazil. To map a candidate chromosomal region through linkage studies in an extensive Brazilian family and identify novel pathogenic variants using sequencing and array-CGH. Brazilian pedigree with individuals affected by BO syndrome characterized by deafness and malformations of outer, middle and inner ear, auricular and cervical fistulae, but no renal abnormalities. Whole genome microarray-SNP scanning on samples of 11 affected individuals detected a multipoint Lod score of 2.6 in the EYA1 gene region (chromosome 8). Sequencing of EYA1 in affected patients did not reveal pathogenic mutations. However, oligonucleotide-array-CGH detected a duplication of 71.8Kb involving exons 4 to 10 of EYA1 (heterozygous state). Real-time-PCR confirmed the duplication in fourteen of fifteen affected individuals and absence in 13 unaffected individuals. The exception involved a consanguineous parentage and was assumed to involve a different genetic mechanism. Our findings implicate this EYA1 partial duplication segregating with BO phenotype in a Brazilian pedigree and is the first description of a large duplication leading to the BOR/BO syndrome.

  15. Catalytic activity, duplication and evolution of the CYP98 cytochrome P450 family in wheat.

    Science.gov (United States)

    Morant, Marc; Schoch, Guillaume A; Ullmann, Pascaline; Ertunç, Tanya; Little, Dawn; Olsen, Carl Erik; Petersen, Maike; Negrel, Jonathan; Werck-Reichhart, Danièle

    2007-01-01

    A burst of evolutionary duplication upon land colonization seems to have led to the large superfamily of cytochromes P450 in higher plants. Within this superfamily some clans and families are heavily duplicated. Others, such as genes involved in the phenylpropanoid pathway have led to fewer duplication events. Eight coding sequences belonging to the CYP98 family reported to catalyze the 3-hydroxylation step in this pathway were isolated from Triticum aestivum (wheat) and expressed in yeast. Comparison of the catalytic properties of the recombinant enzymes with those of CYP98s from other plant taxa was coupled to phylogenetic analyses. Our results indicate that the unusually high frequency of gene duplication in the wheat CYP98 family is a direct or indirect result from ploidization. While ancient duplication led to evolution of enzymes with different substrate preferences, most of recent duplicates underwent silencing via degenerative mutations. Three of the eight tested CYP98s from wheat have phenol meta-hydroxylase activity, with p-coumaroylshikimate being the primary substrate for all of these, as it is the case for CYP98s from sweet basil and Arabidopsis thaliana. However, CYP98s from divergent taxa have acquired different additional subsidiary activities. Some of them might be significant in the metabolism of various free or conjugated phenolics in different plant species. One of the most significant is meta-hydroxylation of p-coumaroyltyramine, predominantly by the wheat enzymes, for the synthesis of suberin phenolic monomers. Homology modeling, confirmed by directed mutagenesis, provides information on the protein regions and structural features important for some observed changes in substrate selectivity. They indicate that the metabolism of quinate ester and tyramine amide of p-coumaric acid rely on the same recognition site in the protein.

  16. Genes involved in yeast survival after irradiation with fast neutrons

    International Nuclear Information System (INIS)

    Bozin, D.; Milosevic, M.J.

    2001-01-01

    Life on the Earth has evolved against a continuous background of ionizing radiation. It would be expected, therefore, that all possible mutations have been produced at some time or another; man-made radiation from medical or industrial sources will not result in any new types of mutation but will simply increase the whole spectrum of mutations that occur spontaneously. Any such lesion can be mutagenic and, in principle, lethal. To counteract the consequences of DNA damage, evolution has equipped all living cells with an intricate network of defense and repair systems. Together, these systems act as a kind of nuclear 'immune system' that is able to recognize and eliminate many types of DNA lesions. In the case of the yeast Saccharomyces cerevisiae, in these processes over 30 RAD genes participate. We tested the survival of haploid and diploid rad1 yeast mutant strains at a dose of 15 Gy of γ or fast neutron radiation. We demonstrated that the lethality of rad1 mutants both haploid and diploid are significantly higher after fast neutron irradiation. The results indicate to the role and position of these genes in the DNA repair of damages specifically induced by fast neutrons. (authors)

  17. Enzymes and Genes Involved in Aerobic Alkane Degradation

    Directory of Open Access Journals (Sweden)

    Zongze eShao

    2013-05-01

    Full Text Available Alkanes are major constituents of crude oil. They are also present at low concentrations in diverse non-contaminated because many living organisms produce them as chemo-attractants or as protecting agents against water loss. Alkane degradation is a widespread phenomenon in nature. The numerous microorganisms, both prokaryotic and eukaryotic, capable of utilizing alkanes as a carbon and energy source, have been isolated and characterized. This review summarizes the current knowledge of how bacteria metabolize alkanes aerobically, with a particular emphasis on the oxidation of long-chain alkanes, including factors that are responsible for chemotaxis to alkanes , transport across cell membrane of alkanes , the regulation of alkane degradation gene and initial oxidation.

  18. Sorting duplicated loci disentangles complexities of polyploid genomes masked by genotyping by sequencing

    DEFF Research Database (Denmark)

    Limborg, Morten; Seeb, Lisa W.; Seeb, J. E.

    2016-01-01

    of duplicated loci impoverishes the interpretation of genomic data as signals from contiguous duplicated genes are ignored. We review existing strategies to genotype and map duplicated loci; we focus in detail on an overlooked strategy of using gynogenetic haploids (1N) as a part of new genotyping by sequencing...

  19. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.

    2013-01-01

    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  20. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  1. The hnRNP 2H9 gene, which is involved in the splicing reaction, is a multiply spliced gene

    DEFF Research Database (Denmark)

    Honoré, B

    2000-01-01

    The hnRNP 2H9 gene products are involved in the splicing process and participate in early heat shock-induced splicing arrest. By combining low/high stringency hybridisation, database search, Northern and Western blotting it is shown that the gene is alternatively spliced into at least six transcr...

  2. Are Hox genes ancestrally involved in axial patterning? Evidence from the hydrozoan Clytia hemisphaerica (Cnidaria.

    Directory of Open Access Journals (Sweden)

    Roxane Chiori

    Full Text Available BACKGROUND: The early evolution and diversification of Hox-related genes in eumetazoans has been the subject of conflicting hypotheses concerning the evolutionary conservation of their role in axial patterning and the pre-bilaterian origin of the Hox and ParaHox clusters. The diversification of Hox/ParaHox genes clearly predates the origin of bilaterians. However, the existence of a "Hox code" predating the cnidarian-bilaterian ancestor and supporting the deep homology of axes is more controversial. This assumption was mainly based on the interpretation of Hox expression data from the sea anemone, but growing evidence from other cnidarian taxa puts into question this hypothesis. METHODOLOGY/PRINCIPAL FINDINGS: Hox, ParaHox and Hox-related genes have been investigated here by phylogenetic analysis and in situ hybridisation in Clytia hemisphaerica, an hydrozoan species with medusa and polyp stages alternating in the life cycle. Our phylogenetic analyses do not support an origin of ParaHox and Hox genes by duplication of an ancestral ProtoHox cluster, and reveal a diversification of the cnidarian HOX9-14 genes into three groups called A, B, C. Among the 7 examined genes, only those belonging to the HOX9-14 and the CDX groups exhibit a restricted expression along the oral-aboral axis during development and in the planula larva, while the others are expressed in very specialised areas at the medusa stage. CONCLUSIONS/SIGNIFICANCE: Cross species comparison reveals a strong variability of gene expression along the oral-aboral axis and during the life cycle among cnidarian lineages. The most parsimonious interpretation is that the Hox code, collinearity and conservative role along the antero-posterior axis are bilaterian innovations.

  3. Two duplicated chicken-type lysozyme genes in disc abalone Haliotis discus discus: molecular aspects in relevance to structure, genomic organization, mRNA expression and bacteriolytic function.

    Science.gov (United States)

    Umasuthan, Navaneethaiyer; Bathige, S D N K; Kasthuri, Saranya Revathy; Wan, Qiang; Whang, Ilson; Lee, Jehee

    2013-08-01

    Lysozymes are crucial antibacterial proteins that are associated with catalytic cleavage of peptidoglycan and subsequent bacteriolysis. The present study describes the identification of two lysozyme genes from disc abalone Haliotis discus discus and their characterization at sequence-, genomic-, transcriptional- and functional-levels. Two cDNAs and BAC clones bearing lysozyme genes were isolated from abalone transcriptome and BAC genomic libraries, respectively and sequences were determined. Corresponding deduced amino acid sequences harbored a chicken-type lysozyme (LysC) family profile and exhibited conserved characteristics of LysC family members including active residues (Glu and Asp) and GS(S/T)DYGIFQINS motif suggested that they are LysC counterparts in disc abalone and designated as abLysC1 and abLysC2. While abLysC1 represented the homolog recently reported in Ezo abalone [1], abLysC2 shared significant identity with LysC homologs. Unlike other vertebrate LysCs, coding sequence of abLysCs were distributed within five exons interrupted by four introns. Both abLysCs revealed a broader mRNA distribution with highest levels in mantle (abLysC1) and hepatopancreas (abLysC2) suggesting their likely main role in defense and digestion, respectively. Investigation of temporal transcriptional profiles post-LPS and -pathogen challenges revealed induced-responses of abLysCs in gills and hemocytes. The in vitro muramidase activity of purified recombinant (r) abLysCs proteins was evaluated, and findings indicated that they are active in acidic pH range (3.5-6.5) and over a broad temperature range (20-60 °C) and influenced by ionic strength. When the antibacterial spectra of (r)abLysCs were examined, they displayed differential activities against both Gram positive and Gram negative strains providing evidence for their involvement in bacteriolytic function in abalone physiology. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Co-existence of other copy number variations with 22q11.2 deletion or duplication: a modifier for variable phenotypes of the syndrome?

    Directory of Open Access Journals (Sweden)

    Li Deling

    2012-04-01

    Full Text Available Abstract Background The phenotype in patients with a 22q11.2 deletion or duplication can be extremely variable, and the causes of such as variations are not well known. Results We observed additional copy number variations (CNVs in 2 of 15 cases with a 22q11.2 deletion or duplication. Both cases were newborn babies referred for severe congenital heart defects. The first case had a deletion with a size of approximately 1.56 Mb involving multiple genes including STS in the Xp22.31 region along with a 22q11.2 deletion. The second case had a duplication of 605 kb in the 15q13.3 region encompassing CHRNA7 and a deletion of 209 kb involving the RBFOX1 gene in the 16p13.2 region, in addition to 22q11.2 duplication. Discussion Our observations have shown that additional CNVs are not rare (2/15, 13% in patients with a 22q11.2 deletion or duplication. We speculate that these CNVs may contribute to phenotype variations of 22q11.2 microdeletion/duplication syndromes as genomic modifiers.

  5. Discovery of a novel gene involved in autolysis of Clostridium cells.

    Science.gov (United States)

    Yang, Liejian; Bao, Guanhui; Zhu, Yan; Dong, Hongjun; Zhang, Yanping; Li, Yin

    2013-06-01

    Cell autolysis plays important physiological roles in the life cycle of clostridial cells. Understanding the genetic basis of the autolysis phenomenon of pathogenic Clostridium or solvent producing Clostridium cells might provide new insights into this important species. Genes that might be involved in autolysis of Clostridium acetobutylicum, a model clostridial species, were investigated in this study. Twelve putative autolysin genes were predicted in C. acetobutylicum DSM 1731 genome through bioinformatics analysis. Of these 12 genes, gene SMB_G3117 was selected for testing the in tracellular autolysin activity, growth profile, viable cell numbers, and cellular morphology. We found that overexpression of SMB_G3117 gene led to earlier ceased growth, significantly increased number of dead cells, and clear electrolucent cavities, while disruption of SMB_G3117 gene exhibited remarkably reduced intracellular autolysin activity. These results indicate that SMB_G3117 is a novel gene involved in cellular autolysis of C. acetobutylicum.

  6. 17q23.2q23.3 de novo duplication in association with speech and language disorder, learning difficulties, incoordination, motor skill impairment, and behavioral disturbances: a case report.

    Science.gov (United States)

    Wessel, Karen; Suleiman, Jehan; Khalaf, Tamam E; Kishore, Shivendra; Rolfs, Arndt; El-Hattab, Ayman W

    2017-10-25

    Chromosomal rearrangements involving 17q23 have been described rarely. Deletions at 17q23.1q23.2 have been reported in individuals with developmental delay and growth retardation, whereas duplications at 17q23.1q23.2 appear to segregate with clubfoot. Dosage alterations in the TBX2 and TBX4 genes, located in 17q23.2, have been proposed to be responsible for the phenotypes observed in individuals with 17q23.1q23.2 deletions and duplications. In this report, we present the clinical phenotype of a child with a previously unreported de novo duplication at 17q23.2q23.3 located distal to the TBX2 and TBX4 region. We report a 7.5-year-old boy with speech and language disorder, learning difficulties, incoordination, fine motor skill impairment, infrequent seizures with abnormal EEG, and behavior disturbances (mild self-inflicted injuries, hyperactivity-inattention, and stereotyped hand movements). Chromosomal microarray revealed a 2-Mb duplication of chromosome 17q23.2q23.3. Both parents did not have the duplication indicating that this duplication is de novo in the child. The duplicated region encompasses 16 genes. It is possible that increased dosage of one or more genes in this region is responsible for the observed phenotype. The TANC2 gene is one of the genes in the duplicated region.It encodes a member of the TANC (tetratricopeptide repeat, ankyrin repeat and coiled-coil containing) family which includes TANC1 and TANC2. These proteins are highly expressed in brain and play major roles in synapsis regulation. Hence, it is suggestive that TANC2 is the likely candidate gene responsible for the observed phenotype as an increased TANC2 dosage can potentially alter synapsis, resulting in neuronal dysfunction and the neurobehavioral phenotype observed in this child with 17q23.2q23.3 duplication.

  7. Duplicated middle cerebral artery

    Science.gov (United States)

    Perez, Jesus; Machado, Calixto; Scherle, Claudio; Hierro, Daniel

    2009-01-01

    Duplicated middle cerebral artery (DMCA) is an anomalous vessel arising from the internal carotid artery. The incidence DMCA is relatively law, and an association between this anomaly and cerebral aneurysms has been documented. There is a controversy whether DMCA may have perforating arteries. This is an important fact to consider in aneurysm surgery. We report the case of a 34-year-old black woman who suffered a subarachnoid hemorrhage and the angiography a left DMCA, and an aneurysm in an inferior branch of the main MCA. The DMCA and the MCA had perforating arteries. The aneurysm was clipped without complications. The observation of perforating arteries in our patient confirms that the DMCA may have perforating arteries. This is very important to be considered in cerebral aneurysms surgery. Moreover, the DMCA may potentially serve as a collateral blood supply to the MCA territory in cases of MCA occlusion. PMID:22140405

  8. Predicting Genes Involved in Human Cancer Using Network Contextual Information

    Directory of Open Access Journals (Sweden)

    Rahmani Hossein

    2012-03-01

    Full Text Available Protein-Protein Interaction (PPI networks have been widely used for the task of predicting proteins involved in cancer. Previous research has shown that functional information about the protein for which a prediction is made, proximity to specific other proteins in the PPI network, as well as local network structure are informative features in this respect. In this work, we introduce two new types of input features, reflecting additional information: (1 Functional Context: the functions of proteins interacting with the target protein (rather than the protein itself; and (2 Structural Context: the relative position of the target protein with respect to specific other proteins selected according to a novel ANOVA (analysis of variance based measure. We also introduce a selection strategy to pinpoint the most informative features. Results show that the proposed feature types and feature selection strategy yield informative features. A standard machine learning method (Naive Bayes that uses the features proposed here outperforms the current state-of-the-art methods by more than 5% with respect to F-measure. In addition, manual inspection confirms the biological relevance of the top-ranked features.

  9. Tandem duplications lead to novel expression patterns through exon shuffling in Drosophila yakuba.

    Directory of Open Access Journals (Sweden)

    Rebekah L Rogers

    2017-05-01

    Full Text Available One common hypothesis to explain the impacts of tandem duplications is that whole gene duplications commonly produce additive changes in gene expression due to copy number changes. Here, we use genome wide RNA-seq data from a population sample of Drosophila yakuba to test this 'gene dosage' hypothesis. We observe little evidence of expression changes in response to whole transcript duplication capturing 5' and 3' UTRs. Among whole gene duplications, we observe evidence that dosage sharing across copies is likely to be common. The lack of expression changes after whole gene duplication suggests that the majority of genes are subject to tight regulatory control and therefore not sensitive to changes in gene copy number. Rather, we observe changes in expression level due to both shuffling of regulatory elements and the creation of chimeric structures via tandem duplication. Additionally, we observe 30 de novo gene structures arising from tandem duplications, 23 of which form with expression in the testes. Thus, the value of tandem duplications is likely to be more intricate than simple changes in gene dosage. The common regulatory effects from chimeric gene formation after tandem duplication may explain their contribution to genome evolution.

  10. New genes involved in osmotic stress tolerance in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Ramon Gonzalez

    2016-09-01

    Full Text Available Adaptation to changes in osmolarity is fundamental for the survival of living cells, and has implications in food and industrial biotechnology. It has been extensively studied in the yeast Saccharomyces cerevisiae, where the Hog1 stress activated protein kinase was discovered about 20 years ago. Hog1 is the core of the intracellular signaling pathway that governs the adaptive response to osmotic stress in this species. The main endpoint of this program is synthesis and intracellular retention of glycerol, as a compatible osmolyte. Despite many details of the signaling pathways and yeast responses to osmotic challenges have already been described, genome-wide approaches are contributing to refine our knowledge of yeast adaptation to hypertonic media. In this work, we used a quantitative fitness analysis approach in order to deepen our understanding of the interplay between yeast cells and the osmotic environment. Genetic requirements for proper growth under osmotic stress showed both common and specific features when hypertonic conditions were induced by either glucose or sorbitol. Tolerance to high-glucose content requires mitochondrial function, while defective protein targeting to peroxisome, GID-complex function (involved in negative regulation of gluconeogenesis, or chromatin dynamics, result in poor survival to sorbitol-induced osmotic stress. On the other side, the competitive disadvantage of yeast strains defective in the endomembrane system is relieved by hypertonic conditions. This finding points to the Golgi-endosome system as one of the main cell components negatively affected by hyperosmolarity. Most of the biological processes highlighted in this analysis had not been previously related to osmotic stress but are probably relevant in an ecological and evolutionary context.

  11. New Genes Involved in Osmotic Stress Tolerance in Saccharomyces cerevisiae

    Science.gov (United States)

    Gonzalez, Ramon; Morales, Pilar; Tronchoni, Jordi; Cordero-Bueso, Gustavo; Vaudano, Enrico; Quirós, Manuel; Novo, Maite; Torres-Pérez, Rafael; Valero, Eva

    2016-01-01

    Adaptation to changes in osmolarity is fundamental for the survival of living cells, and has implications in food and industrial biotechnology. It has been extensively studied in the yeast Saccharomyces cerevisiae, where the Hog1 stress activated protein kinase was discovered about 20 years ago. Hog1 is the core of the intracellular signaling pathway that governs the adaptive response to osmotic stress in this species. The main endpoint of this program is synthesis and intracellular retention of glycerol, as a compatible osmolyte. Despite many details of the signaling pathways and yeast responses to osmotic challenges have already been described, genome-wide approaches are contributing to refine our knowledge of yeast adaptation to hypertonic media. In this work, we used a quantitative fitness analysis approach in order to deepen our understanding of the interplay between yeast cells and the osmotic environment. Genetic requirements for proper growth under osmotic stress showed both common and specific features when hypertonic conditions were induced by either glucose or sorbitol. Tolerance to high-glucose content requires mitochondrial function, while defective protein targeting to peroxisome, GID-complex function (involved in negative regulation of gluconeogenesis), or chromatin dynamics, result in poor survival to sorbitol-induced osmotic stress. On the other side, the competitive disadvantage of yeast strains defective in the endomembrane system is relieved by hypertonic conditions. This finding points to the Golgi-endosome system as one of the main cell components negatively affected by hyperosmolarity. Most of the biological processes highlighted in this analysis had not been previously related to osmotic stress but are probably relevant in an ecological and evolutionary context. PMID:27733850

  12. Identification of genes involved in regulatory mechanism of pigments in broiler chickens.

    Science.gov (United States)

    Tarique, T M; Yang, S; Mohsina, Z; Qiu, J; Yan, Z; Chen, G; Chen, A

    2014-09-05

    Chicken is an important model organism that unites the evolutionary gap between mammals and other vertebrates and provide major source of protein from meat and eggs for all over the world population. However, specific genes underlying the regulatory mechanism of broiler pigmentation have not yet been determined. In order to better understand the genes involved in the mechanism of pigmentation in the muscle tissues of broilers, the Affymetrix microarray hybridization experiment platform was used to identify gene expression profiles at 7 weeks of age. Broilers fed canthaxanthin, natural lutein, and orangeII pigments (100 mg/kg) were used to explore gene expression profiles). Our data showed that the 7th week of age was a very important phase with regard to gene expression profiles. We identified a number of differentially expressed genes; in canthaxanthin, natural lutein, and orangeII, there were 54 (32 upregulated and 22 downregulated), 23 (15 upregulated and 8 downregulated), and 7 (5 upregulated and 2 downregulated) known genes, respectively. Our data indicate that the numbers of differentially expressed genes were more upregulated than downregulated, and several genes showed conserved signaling to previously known functions. Thus, functional characterization of differentially expressed genes revealed several categories that are involved in important biological processes, including pigmentation, growth, molecular mechanisms, fat metabolism, cell proliferation, immune response, lipid metabolism, and protein synthesis and degradation. The results of the present study demonstrate that the genes associated with canthaxanthin, natural lutein, and orangeII are key regulatory genes that control the regulatory mechanisms of pigmentation.

  13. Genes involved in immunity and apoptosis are associated with human presbycusis based on microarray analysis.

    Science.gov (United States)

    Dong, Yang; Li, Ming; Liu, Puzhao; Song, Haiyan; Zhao, Yuping; Shi, Jianrong

    2014-06-01

    Genes involved in immunity and apoptosis were associated with human presbycusis. CCR3 and GILZ played an important role in the pathogenesis of presbycusis, probably through regulating chemokine receptor, T-cell apoptosis, or T-cell activation pathways. To identify genes associated with human presbycusis and explore the molecular mechanism of presbycusis. Hearing function was tested by pure-tone audiometry. Microarray analysis was performed to identify presbycusis-correlated genes by Illumina Human-6 BeadChip using the peripheral blood samples of subjects. To identify biological process categories and pathways associated with presbycusis-correlated genes, bioinformatics analysis was carried out by Gene Ontology Tree Machine (GOTM) and database for annotation, visualization, and integrated discovery (DAVID). Quantitative RT-PCR (qRT-PCR) was used to validate the microarray data. Microarray analysis identified 469 up-regulated genes and 323 down-regulated genes. Both the dominant biological processes by Gene Ontology (GO) analysis and the enriched pathways by Kyoto encyclopedia of genes and genomes (KEGG) and BIOCARTA showed that genes involved in immunity and apoptosis were associated with presbycusis. In addition, CCR3, GILZ, CXCL10, and CX3CR1 genes showed consistent difference between groups for both the gene chip and qRT-PCR data. The differences of CCR3 and GILZ between presbycusis patients and controls were statistically significant (p < 0.05).

  14. Isolation and characterization of two herpes simplex virus type 1 variants containing duplication of sequences within the unique long component of their genomes

    International Nuclear Information System (INIS)

    Fareed, M.U.; Maclean, A.R.; Maclean, C.A.; Fu, A.; Brown, S.M.

    1995-01-01

    This paper reports the first spontaneous isolation of two DNA duplication variants in the unique long (U L ) component of herpes simplex virus type 1 (HSV-1) strain 17 + genome, one (1719) with a duplication of 7.5 kb DNA sequences centered around Ori L and the other (1740In) with a 356 bp DNA duplication between the UL19 (MCP and UL20 open reading frames (ORFs). The variant 1719 is stable with the rare isolation of a wild type (strain 17 + ) genome presumably generated by the excision of the duplicated sequences during homologous recombination. Because of the 7.5 kb duplication, UL29 (DBP is diploid and UL30 (DNA polymerase) is present as one partial copy. Although duplication in the variant 1740In involved sequences from the UL20 ORF, the virus produces an intact UL20 gene product. Both variants show normal growth characteristics when compared with the parental viruses. DNA duplications in these variants suggest a link between replication and recombination in HSV-1. (author)

  15. The novel flightless-I gene brings together two gene families, actin-binding proteins related to gelsolin and leucine-rich-repeat proteins involved in Ras signal transduction.

    Science.gov (United States)

    Claudianos, C; Campbell, H D

    1995-05-01

    The Drosophila melanogaster gene flightless-I, involved in gastrulation and muscle degeneration, has Caenorhabditis elegans and human homologues. In these highly conserved genes, two previously known gene families have been brought together, families encoding the actin-binding proteins related to gelsolin and the leucine-rich-repeat (LRR) group of proteins involved in protein-protein interactions. Both these gene families exhibit characteristics of molecular changes involving replication slippage and exon shuffling. Phylogenetic analyses of 19 amino acid sequences of 6 related protein types indicate that actin-associated proteins related to gelsolin are monophyletic to a common ancestor and include flightless proteins. Conversely, comparison of 24 amino acid sequences of LRR proteins including the flightless proteins indicates that flightless proteins are members of a structurally related subgroup. Included in the flightless cluster are human and mouse rsp-1 proteins involved in suppressing v-Ras transformation of cells and the membrane-associated yeast (Saccharomyces cerevisae) adenylate cyclase whose analogous LRRs are required for interaction with Ras proteins. There is a strong possibility that ligands for this group could be related and that flightless may have a similar role in Ras signal transduction. It is hypothesized that an ancestral monomeric gelsolin precursor protein has undergone at least four independent gene reorganization events to account for the structural diversity of the extant family of gelsolin-related proteins and that gene duplication and exon shuffling events occurred prior to or at the beginning of multicellular life, resulting in the evolution of some members of the family soon after the appearance of actin-type proteins.

  16. Colonic duplication in an adult

    International Nuclear Information System (INIS)

    Baro, P.; Dario Casas, J.; Sanchez, D.

    1988-01-01

    A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)

  17. Genes Involved in Initial Follicle Recruitment May Be Associated with Age at Menopause

    NARCIS (Netherlands)

    Voorhuis, Marlies; Broekmans, Frank J.; Fauser, Bart C. J. M.; Onland-Moret, N. Charlotte; van der Schouw, Yvonne T.

    Context: Timing of menopause is largely influenced by genetic factors. Because menopause occurs when the follicle pool in the ovaries has become exhausted, genes involved in primordial follicle recruitment can be considered as candidate genes for timing of menopause. Objective: The aim was to study

  18. Investigation of yeast genes possibly involved in mtDNA stability ...

    African Journals Online (AJOL)

    Phelim Isichei

    large number of possible candidate genes, these approaches most often remains laborious (De Lonlay et ... RNA interference of genes involved in mtDNA replication such as polg-1, encoding the mitochondrial DNA .... adult worms were independently picked up and transferred to fresh. RNAi plates with or without different ...

  19. Identification of four genes involved in suppression of the pre-mRNA ...

    Indian Academy of Sciences (India)

    Unknown

    Switching gene swi6, involved in repression of silent mating type loci in fission yeast, encodes a homology of chromatin associated proteins from Drosophila and mammals. Gene. 143, 139–143. Moreno S., Klar A. and Nurse P. 1991 Molecular genetic analysis of fission yeast: guide to yeast genetics and molecu- lar biology.

  20. Tourette Syndrome and Klippel-Feil Anomaly in a Child with Chromosome 22q11 Duplication

    Directory of Open Access Journals (Sweden)

    Raymond A. Clarke

    2009-01-01

    Full Text Available This is the first case description of the association of Klippel-Feil Syndrome (KFS, Tourette Syndrome (TS, Motor Stereotypies, and Obsessive Compulsive Behavior, with chromosome 22q11.2 Duplication Syndrome (22q11DupS. Neuropsychiatric symptoms in persons with 22q11.2 deletion, including obsessive compulsiveness, anxiety, hyperactivity, and one prior case report of TS, have been attributed to low copy number effects on Catechol-O-Methyltransferase (COMT. However, the present unique case of 22q11DupS and TS suggests a more complex relationship involving another gene(s at or near this locus.

  1. Identification of genes directly involved in shell formation and their functions in pearl oyster, Pinctada fucata.

    Directory of Open Access Journals (Sweden)

    Dong Fang

    Full Text Available Mollusk shell formation is a fascinating aspect of biomineralization research. Shell matrix proteins play crucial roles in the control of calcium carbonate crystallization during shell formation in the pearl oyster, Pinctada fucata. Characterization of biomineralization-related genes during larval development could enhance our understanding of shell formation. Genes involved in shell biomineralization were isolated by constructing three suppression subtractive hybridization (SSH libraries that represented genes expressed at key points during larval shell formation. A total of 2,923 ESTs from these libraries were sequenced and gave 990 unigenes. Unigenes coding for secreted proteins and proteins with tandem-arranged repeat units were screened in the three SSH libraries. A set of sequences coding for genes involved in shell formation was obtained. RT-PCR and in situ hybridization assays were carried out on five genes to investigate their spatial expression in several tissues, especially the mantle tissue. They all showed a different expression pattern from known biomineralization-related genes. Inhibition of the five genes by RNA interference resulted in different defects of the nacreous layer, indicating that they all were involved in aragonite crystallization. Intriguingly, one gene (UD_Cluster94.seq.Singlet1 was restricted to the 'aragonitic line'. The current data has yielded for the first time, to our knowledge, a suite of biomineralization-related genes active during the developmental stages of P. fucata, five of which were responsible for nacreous layer formation. This provides a useful starting point for isolating new genes involved in shell formation. The effects of genes on the formation of the 'aragonitic line', and other areas of the nacreous layer, suggests a different control mechanism for aragonite crystallization initiation from that of mature aragonite growth.

  2. Identification of Genes Directly Involved in Shell Formation and Their Functions in Pearl Oyster, Pinctada fucata

    Science.gov (United States)

    Fang, Dong; Xu, Guangrui; Hu, Yilin; Pan, Cong; Xie, Liping; Zhang, Rongqing

    2011-01-01

    Mollusk shell formation is a fascinating aspect of biomineralization research. Shell matrix proteins play crucial roles in the control of calcium carbonate crystallization during shell formation in the pearl oyster, Pinctada fucata. Characterization of biomineralization-related genes during larval development could enhance our understanding of shell formation. Genes involved in shell biomineralization were isolated by constructing three suppression subtractive hybridization (SSH) libraries that represented genes expressed at key points during larval shell formation. A total of 2,923 ESTs from these libraries were sequenced and gave 990 unigenes. Unigenes coding for secreted proteins and proteins with tandem-arranged repeat units were screened in the three SSH libraries. A set of sequences coding for genes involved in shell formation was obtained. RT-PCR and in situ hybridization assays were carried out on five genes to investigate their spatial expression in several tissues, especially the mantle tissue. They all showed a different expression pattern from known biomineralization-related genes. Inhibition of the five genes by RNA interference resulted in different defects of the nacreous layer, indicating that they all were involved in aragonite crystallization. Intriguingly, one gene (UD_Cluster94.seq.Singlet1) was restricted to the ‘aragonitic line’. The current data has yielded for the first time, to our knowledge, a suite of biomineralization-related genes active during the developmental stages of P.fucata, five of which were responsible for nacreous layer formation. This provides a useful starting point for isolating new genes involved in shell formation. The effects of genes on the formation of the ‘aragonitic line’, and other areas of the nacreous layer, suggests a different control mechanism for aragonite crystallization initiation from that of mature aragonite growth. PMID:21747964

  3. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  4. Genes and Gut Bacteria Involved in Luminal Butyrate Reduction Caused by Diet and Loperamide

    Directory of Open Access Journals (Sweden)

    Nakwon Hwang

    2017-11-01

    Full Text Available Unbalanced dietary habits and gut dysmotility are causative factors in metabolic and functional gut disorders, including obesity, diabetes, and constipation. Reduction in luminal butyrate synthesis is known to be associated with gut dysbioses, and studies have suggested that restoring butyrate formation in the colon may improve gut health. In contrast, shifts in different types of gut microbiota may inhibit luminal butyrate synthesis, requiring different treatments to restore colonic bacterial butyrate synthesis. We investigated the influence of high-fat diets (HFD and low-fiber diets (LFD, and loperamide (LPM administration, on key bacteria and genes involved in reduction of butyrate synthesis in mice. MiSeq-based microbiota analysis and HiSeq-based differential gene analysis indicated that different types of bacteria and genes were involved in butyrate metabolism in each treatment. Dietary modulation depleted butyrate kinase and phosphate butyryl transferase by decreasing members of the Bacteroidales and Parabacteroides. The HFD also depleted genes involved in succinate synthesis by decreasing Lactobacillus. The LFD and LPM treatments depleted genes involved in crotonoyl-CoA synthesis by decreasing Roseburia and Oscilllibacter. Taken together, our results suggest that different types of bacteria and genes were involved in gut dysbiosis, and that selected treatments may be needed depending on the cause of gut dysfunction.

  5. Genes and Gut Bacteria Involved in Luminal Butyrate Reduction Caused by Diet and Loperamide.

    Science.gov (United States)

    Hwang, Nakwon; Eom, Taekil; Gupta, Sachin K; Jeong, Seong-Yeop; Jeong, Do-Youn; Kim, Yong Sung; Lee, Ji-Hoon; Sadowsky, Michael J; Unno, Tatsuya

    2017-11-28

    Unbalanced dietary habits and gut dysmotility are causative factors in metabolic and functional gut disorders, including obesity, diabetes, and constipation. Reduction in luminal butyrate synthesis is known to be associated with gut dysbioses, and studies have suggested that restoring butyrate formation in the colon may improve gut health. In contrast, shifts in different types of gut microbiota may inhibit luminal butyrate synthesis, requiring different treatments to restore colonic bacterial butyrate synthesis. We investigated the influence of high-fat diets (HFD) and low-fiber diets (LFD), and loperamide (LPM) administration, on key bacteria and genes involved in reduction of butyrate synthesis in mice. MiSeq-based microbiota analysis and HiSeq-based differential gene analysis indicated that different types of bacteria and genes were involved in butyrate metabolism in each treatment. Dietary modulation depleted butyrate kinase and phosphate butyryl transferase by decreasing members of the Bacteroidales and Parabacteroides . The HFD also depleted genes involved in succinate synthesis by decreasing Lactobacillus . The LFD and LPM treatments depleted genes involved in crotonoyl-CoA synthesis by decreasing Roseburia and Oscilllibacter . Taken together, our results suggest that different types of bacteria and genes were involved in gut dysbiosis, and that selected treatments may be needed depending on the cause of gut dysfunction.

  6. Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development.

    Science.gov (United States)

    Kenwrick, Sue; Amaya, Enrique; Papalopulu, Nancy

    2004-02-01

    The diploid frog X. tropicalis has recently been adopted as a model genetic system, but loss-of-function screens in Xenopus have not yet been performed. We have undertaken a pilot functional knockdown screen in X. tropicalis for genes involved in nervous system development by injecting antisense morpholino (MO) oligos directed against X. tropicalis mRNAs. Twenty-six genes with primary expression in the nervous system were selected as targets based on an expression screen previously conducted in X. laevis. Reproducible phenotypes were observed for six and for four of these, a second MO gave a similar result. One of these genes encodes a novel protein with previously unknown function. Knocking down this gene, designated pinhead, results in severe microcephaly, whereas, overexpression results in macrocephaly. Together with the early embryonic expression in the anterior neural plate, these data indicate that pinhead is a novel gene involved in controlling head development. Copyright 2003 Wiley-Liss, Inc.

  7. A Meiotic Uv-Sensitive Mutant That Causes Deletion of Duplications in Neurospora

    Science.gov (United States)

    Newmeyer, Dorothy; Galeazzi, Donna R.

    1978-01-01

    The meiotic-3 (mei-3) mutant of Neurospora crassa has several effects: (1) When homozygous, it almost completely blocks meiosis and ascospore formation, (2) it is sensitive to UV, (3) its growth is inhibited by histidine and, (4) it increases the instability of nontandem duplications. This was shown for duplications produced by five different rearrangements and was demonstrated by two different criteria. The effects on meiosis and duplication instability are expressed strongly at 25°; the effects on sensitivity to UV and to histidine are expressed strongly at 38.5° but only slightly at 25°. Nevertheless, all four effects were shown to be due to a single gene. mei-3 is not allelic with previously reported UV-sensitive mutants.—Two other results were obtained that are not necessarily due to mei-3: (1) A cross involving mei-3 produced a new unlinked meiotic mutant, mei-4, which is not sensitive to UV or histidine, and (2) a burst of several new mutants occurred in a different mei-3 stock, including a partial revertant of mei-3.—mei-3 has previously been shown to cause frequent complete loss of a terminal duplicate segment, beginning exactly at the original rearrangement breakpoint. Possible mechanisms are discussed by which a UV-sensitive mutant could cause such precise deletions. PMID:17248837

  8. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  9. Examination of Signatures of Recent Positive Selection on Genes Involved in Human Sialic Acid Biology.

    Science.gov (United States)

    Moon, Jiyun M; Aronoff, David M; Capra, John A; Abbot, Patrick; Rokas, Antonis

    2018-03-28

    Sialic acids are nine carbon sugars ubiquitously found on the surfaces of vertebrate cells and are involved in various immune response-related processes. In humans, at least 58 genes spanning diverse functions, from biosynthesis and activation to recycling and degradation, are involved in sialic acid biology. Because of their role in immunity, sialic acid biology genes have been hypothesized to exhibit elevated rates of evolutionary change. Consistent with this hypothesis, several genes involved in sialic acid biology have experienced higher rates of non-synonymous substitutions in the human lineage than their counterparts in other great apes, perhaps in response to ancient pathogens that infected hominins millions of years ago (paleopathogens). To test whether sialic acid biology genes have also experienced more recent positive selection during the evolution of the modern human lineage, reflecting adaptation to contemporary cosmopolitan or geographically-restricted pathogens, we examined whether their protein-coding regions showed evidence of recent hard and soft selective sweeps. This examination involved the calculation of four measures that quantify changes in allele frequency spectra, extent of population differentiation, and haplotype homozygosity caused by recent hard and soft selective sweeps for 55 sialic acid biology genes using publicly available whole genome sequencing data from 1,668 humans from three ethnic groups. To disentangle evidence for selection from confounding demographic effects, we compared the observed patterns in sialic acid biology genes to simulated sequences of the same length under a model of neutral evolution that takes into account human demographic history. We found that the patterns of genetic variation of most sialic acid biology genes did not significantly deviate from neutral expectations and were not significantly different among genes belonging to different functional categories. Those few sialic acid biology genes that

  10. Pathways and genes involved in steroid hormone metabolism in male pigs: a review and update.

    Science.gov (United States)

    Robic, Annie; Faraut, Thomas; Prunier, Armelle

    2014-03-01

    This paper reviews state-of-the-art knowledge on steroid biosynthesis pathways in the pig and provides an updated characterization of the porcine genes involved in these pathways with particular focus on androgens, estrogens, and 16-androstenes. At least 21 different enzymes appear to be involved in these pathways in porcine tissues together with at least five cofactors. Until now, data on several porcine genes were scarce or confusing. We characterized the complete genomic and transcript sequences of the single porcine CYP11B gene. We analyzed the porcine AKR1 gene cluster and identified four AKR1C, one AKR1C like genes and one AKR1E2 gene. We provide evidence that porcine AKR1C genes are not orthologous to human AKR1C. A new nomenclature is thus needed for this gene family in the pig. Thirty-two genes are now described: transcript (30+2 characterized in this study) and genomic (complete: 18+1 and partial: 12+1) sequences are identified. However, despite increasing knowledge on steroid metabolism in the pig, there is still no explanation of why porcine testes can produce androstenone and epiandrosterone, but not dihydrotestosterone (DHT), which is also a reduced steroid. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  11. Transcriptome analysis reveals key differentially expressed genes involved in wheat grain development

    Directory of Open Access Journals (Sweden)

    Yonglong Yu

    2016-04-01

    Full Text Available Wheat seed development is an important physiological process of seed maturation and directly affects wheat yield and quality. In this study, we performed dynamic transcriptome microarray analysis of an elite Chinese bread wheat cultivar (Jimai 20 during grain development using the GeneChip Wheat Genome Array. Grain morphology and scanning electron microscope observations showed that the period of 11–15 days post-anthesis (DPA was a key stage for the synthesis and accumulation of seed starch. Genome-wide transcriptional profiling and significance analysis of microarrays revealed that the period from 11 to 15 DPA was more important than the 15–20 DPA stage for the synthesis and accumulation of nutritive reserves. Series test of cluster analysis of differential genes revealed five statistically significant gene expression profiles. Gene ontology annotation and enrichment analysis gave further information about differentially expressed genes, and MapMan analysis revealed expression changes within functional groups during seed development. Metabolic pathway network analysis showed that major and minor metabolic pathways regulate one another to ensure regular seed development and nutritive reserve accumulation. We performed gene co-expression network analysis to identify genes that play vital roles in seed development and identified several key genes involved in important metabolic pathways. The transcriptional expression of eight key genes involved in starch and protein synthesis and stress defense was further validated by qRT-PCR. Our results provide new insight into the molecular mechanisms of wheat seed development and the determinants of yield and quality.

  12. Transcription profiling provides insights into gene pathways involved in horn and scurs development in cattle

    Directory of Open Access Journals (Sweden)

    Lehnert Sigrid A

    2010-06-01

    Full Text Available Abstract Background Two types of horns are evident in cattle - fixed horns attached to the skull and a variation called scurs, which refers to small loosely attached horns. Cattle lacking horns are referred to as polled. Although both the Poll and Scurs loci have been mapped to BTA1 and 19 respectively, the underlying genetic basis of these phenotypes is unknown, and so far, no candidate genes regulating these developmental processes have been described. This study is the first reported attempt at transcript profiling to identify genes and pathways contributing to horn and scurs development in Brahman cattle, relative to polled counterparts. Results Expression patterns in polled, horned and scurs tissues were obtained using the Agilent 44 k bovine array. The most notable feature when comparing transcriptional profiles of developing horn tissues against polled was the down regulation of genes coding for elements of the cadherin junction as well as those involved in epidermal development. We hypothesize this as a key event involved in keratinocyte migration and subsequent horn development. In the polled-scurs comparison, the most prevalent differentially expressed transcripts code for genes involved in extracellular matrix remodelling, which were up regulated in scurs tissues relative to polled. Conclusion For this first time we describe networks of genes involved in horn and scurs development. Interestingly, we did not observe differential expression in any of the genes present on the fine mapped region of BTA1 known to contain the Poll locus.

  13. Deciphering the onychophoran 'segmentation gene cascade': Gene expression reveals limited involvement of pair rule gene orthologs in segmentation, but a highly conserved segment polarity gene network.

    Science.gov (United States)

    Janssen, Ralf; Budd, Graham E

    2013-10-01

    The hallmark of the arthropods is their segmented body, although origin of segmentation, however, is unresolved. In order to shed light on the origin of segmentation we investigated orthologs of pair rule genes (PRGs) and segment polarity genes (SPGs) in a member of the closest related sister-group to the arthropods, the onychophorans. Our gene expression data analysis suggests that most of the onychophoran PRGs do not play a role in segmentation. One possible exception is the even-skipped (eve) gene that is expressed in the posterior end of the onychophoran where new segments are likely patterned, and is also expressed in segmentation-gene typical transverse stripes in at least a number of newly formed segments. Other onychophoran PRGs such as runt (run), hairy/Hes (h/Hes) and odd-skipped (odd) do not appear to have a function in segmentation at all. Onychophoran PRGs that act low in the segmentation gene cascade in insects, however, are potentially involved in segment-patterning. Most obvious is that from the expression of the pairberry (pby) gene ortholog that is expressed in a typical SPG-pattern. Since this result suggested possible conservation of the SPG-network we further investigated SPGs (and associated factors) such as Notum in the onychophoran. We find that the expression patterns of SPGs in arthropods and the onychophoran are highly conserved, suggesting a conserved SPG-network in these two clades, and indeed also in an annelid. This may suggest that the common ancestor of lophotrochozoans and ecdysozoans was already segmented utilising the same SPG-network, or that the SPG-network was recruited independently in annelids and onychophorans/arthropods. © 2013 Elsevier Inc. All rights reserved.

  14. Intelligent Scheduled Backup Using Duplicity

    OpenAIRE

    Matland, Håkon Nymo

    2015-01-01

    Digital information has rapidly become an important part of everyday human life. Consequently, backup solutions are important to ensure digital property is safely stored and protected. This thesis will do an in-depth study of Duplicity, a backup solution providing encrypted, bandwidth-efficient backup to both local and remote storage. The first part of the thesis investigate Duplicity in different use case scenarios, reporting on the advantages and disadvantages of the software. Research...

  15. Identification of key genes involved in polysaccharide bioflocculant synthesis in Bacillus licheniformis.

    Science.gov (United States)

    Chen, Zhen; Liu, Peize; Li, Zhipeng; Yu, Wencheng; Wang, Zhi; Yao, Haosheng; Wang, Yuanpeng; Li, Qingbiao; Deng, Xu; He, Ning

    2017-03-01

    The present study reports the sequenced genome of Bacillus licheniformis CGMCC 2876, which is composed of a 4,284,461 bp chromosome that contains 4,188 protein-coding genes, 72 tRNA genes, and 21 rRNA genes. Additional analysis revealed an eps gene cluster with 16 open reading frames. Conserved Domains Database analysis combined with qPCR experiments indicated that all genes in this cluster were involved in polysaccharide bioflocculant synthesis. Phosphoglucomutase and UDP-glucose pyrophosphorylase were supposed to be key enzymes in polysaccharide secretion in B. licheniformis. A biosynthesis pathway for the production of polysaccharide bioflocculant involving the integration of individual genes was proposed based on functional analysis. Overexpression of epsDEF from the eps gene cluster in B. licheniformis CGMCC 2876 increased the flocculating activity of the recombinant strain by 90% compared to the original strain. Similarly, the crude yield of polysaccharide bioflocculant was enhanced by 27.8%. Overexpression of the UDP-glucose pyrophosphorylase gene not only increased the flocculating activity by 71% but also increased bioflocculant yield by 13.3%. Independent of UDP-N-acetyl-D-mannosamine dehydrogenase gene, flocculating activity, and polysaccharide yield were negatively impacted by overexpression of the UDP-N-acetylglucosamine 2-epimerase gene. Overall, epsDEF and gtaB2 were identified as key genes for polysaccharide bioflocculant synthesis in B. licheniformis. These results will be useful for further engineering of B. licheniformis for industrial bioflocculant production. Biotechnol. Bioeng. 2017;114: 645-655. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. sugE: A gene involved in tributyltin (TBT) resistance of Aeromonas molluscorum Av27.

    Science.gov (United States)

    Cruz, Andreia; Micaelo, Nuno; Félix, Vitor; Song, Jun-Young; Kitamura, Shin-Ichi; Suzuki, Satoru; Mendo, Sónia

    2013-01-01

    The mechanism of bacterial resistance to tributyltin (TBT) is still unclear. The results herein presented contribute to clarify that mechanism in the TBT-resistant bacterium Aeromonas molluscorum Av27. We have identified and cloned a new gene that is involved in TBT resistance in this strain. The gene is highly homologous (84%) to the Aeromonas hydrophila-sugE gene belonging to the small multidrug resistance gene family (SMR), which includes genes involved in the transport of lipophilic drugs. In Av27, expression of the Av27-sugE was observed at the early logarithmic growth phase in the presence of a high TBT concentration (500 μM), thus suggesting the contribution of this gene for TBT resistance. E. coli cells transformed with Av27-sugE become resistant to ethidium bromide (EtBr), chloramphenicol (CP) and tetracycline (TE), besides TBT. According to the Moriguchi logP (miLogP) values, EtBr, CP and TE have similar properties and are substrates for the sugE-efflux system. Despite the different miLogP of TBT, E. coli cells transformed with Av27-sugE become resistant to this compound. So it seems that TBT is also a substrate for the SugE protein. The modelling studies performed also support this hypothesis. The data herein presented clearly indicate that sugE is involved in TBT resistance of this bacterium.

  17. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  18. The idic(X)(q13) in myeloid malignancies: breakpoint clustering in segmental duplications and association with TET2 mutations

    DEFF Research Database (Denmark)

    Paulsson, Kajsa; Haferlach, Claudia; Fonatsch, Christa

    2010-01-01

    of additional aberrations. We here present an SNP array study of 14 idic(X)-positive myeloid malignancies, collected through an international collaborative effort. The breakpoints clustered in two regions of segmental duplications and were not in a gene, making dosage effects from the concurrent gain of Xpter......-q13 and loss of Xq13-qter, rather than a fusion gene, the most likely pathogenetic outcome. Methylation analysis revealed involvement of the inactive X chromosomes in five cases and of the active in two. The ABCB7 gene, mutated in X-linked sideroblastic anemia and spinocerebellar ataxia...

  19. Identification and Heterologous Expression of Genes Involved in Anaerobic Dissimilatory Phosphite Oxidation by Desulfotignum phosphitoxidans▿

    Science.gov (United States)

    Simeonova, Diliana Dancheva; Wilson, Marlena Marie; Metcalf, William W.; Schink, Bernhard

    2010-01-01

    Desulfotignum phosphitoxidans is a strictly anaerobic, Gram-negative bacterium that utilizes phosphite as the sole electron source for homoacetogenic CO2 reduction or sulfate reduction. A genomic library of D. phosphitoxidans, constructed using the fosmid vector pJK050, was screened for clones harboring the genes involved in phosphite oxidation via PCR using primers developed based on the amino acid sequences of phosphite-induced proteins. Sequence analysis of two positive clones revealed a putative operon of seven genes predicted to be involved in phosphite oxidation. Four of these genes (ptxD-ptdFCG) were cloned and heterologously expressed in Desulfotignum balticum, a related strain that cannot use phosphite as either an electron donor or as a phosphorus source. The ptxD-ptdFCG gene cluster was sufficient to confer phosphite uptake and oxidation ability to the D. balticum host strain but did not allow use of phosphite as an electron donor for chemolithotrophic growth. Phosphite oxidation activity was measured in cell extracts of D. balticum transconjugants, suggesting that all genes required for phosphite oxidation were cloned. Genes of the phosphite gene cluster were assigned putative functions on the basis of sequence analysis and enzyme assays. PMID:20622064

  20. Identification and heterologous expression of genes involved in anaerobic dissimilatory phosphite oxidation by Desulfotignum phosphitoxidans.

    Science.gov (United States)

    Simeonova, Diliana Dancheva; Wilson, Marlena Marie; Metcalf, William W; Schink, Bernhard

    2010-10-01

    Desulfotignum phosphitoxidans is a strictly anaerobic, Gram-negative bacterium that utilizes phosphite as the sole electron source for homoacetogenic CO2 reduction or sulfate reduction. A genomic library of D. phosphitoxidans, constructed using the fosmid vector pJK050, was screened for clones harboring the genes involved in phosphite oxidation via PCR using primers developed based on the amino acid sequences of phosphite-induced proteins. Sequence analysis of two positive clones revealed a putative operon of seven genes predicted to be involved in phosphite oxidation. Four of these genes (ptxD-ptdFCG) were cloned and heterologously expressed in Desulfotignum balticum, a related strain that cannot use phosphite as either an electron donor or as a phosphorus source. The ptxD-ptdFCG gene cluster was sufficient to confer phosphite uptake and oxidation ability to the D. balticum host strain but did not allow use of phosphite as an electron donor for chemolithotrophic growth. Phosphite oxidation activity was measured in cell extracts of D. balticum transconjugants, suggesting that all genes required for phosphite oxidation were cloned. Genes of the phosphite gene cluster were assigned putative functions on the basis of sequence analysis and enzyme assays.

  1. Differential Gene Expression by Lactobacillus plantarum WCFS1 in Response to Phenolic Compounds Reveals New Genes Involved in Tannin Degradation.

    Science.gov (United States)

    Reverón, Inés; Jiménez, Natalia; Curiel, José Antonio; Peñas, Elena; López de Felipe, Félix; de Las Rivas, Blanca; Muñoz, Rosario

    2017-04-01

    Lactobacillus plantarum is a lactic acid bacterium that can degrade food tannins by the successive action of tannase and gallate decarboxylase enzymes. In the L. plantarum genome, the gene encoding the catalytic subunit of gallate decarboxylase ( lpdC , or lp_2945 ) is only 6.5 kb distant from the gene encoding inducible tannase ( L. plantarum tanB [ tanB Lp ], or lp_2956 ). This genomic context suggests concomitant activity and regulation of both enzymatic activities. Reverse transcription analysis revealed that subunits B ( lpdB , or lp_0271 ) and D ( lpdD , or lp_0272 ) of the gallate decarboxylase are cotranscribed, whereas subunit C ( lpdC , or lp_2945 ) is cotranscribed with a gene encoding a transport protein ( gacP , or lp_2943 ). In contrast, the tannase gene is transcribed as a monocistronic mRNA. Investigation of knockout mutations of genes located in this chromosomal region indicated that only mutants of the gallate decarboxylase (subunits B and C), tannase, GacP transport protein, and TanR transcriptional regulator ( lp_2942 ) genes exhibited altered tannin metabolism. The expression profile of genes involved in tannin metabolism was also analyzed in these mutants in the presence of methyl gallate and gallic acid. It is noteworthy that inactivation of tanR suppresses the induction of all genes overexpressed in the presence of methyl gallate and gallic acid. This transcriptional regulator was also induced in the presence of other phenolic compounds, such as kaempferol and myricetin. This study complements the catalog of L. plantarum expression profiles responsive to phenolic compounds, which enable this bacterium to adapt to a plant food environment. IMPORTANCE Lactobacillus plantarum is a bacterial species frequently found in the fermentation of vegetables when tannins are present. L. plantarum strains degrade tannins to the less-toxic pyrogallol by the successive action of tannase and gallate decarboxylase enzymes. The genes encoding these enzymes are

  2. Transducin Duplicates in the Zebrafish Retina and Pineal Complex: Differential Specialisation after the Teleost Tetraploidisation

    Science.gov (United States)

    Lagman, David; Callado-Pérez, Amalia; Franzén, Ilkin E.

    2015-01-01

    Gene duplications provide raw materials that can be selected for functional adaptations by evolutionary mechanisms. We describe here the results of 350 million years of evolution of three functionally related gene families: the alpha, beta and gamma subunits of transducins, the G protein involved in vision. Early vertebrate tetraploidisations resulted in separate transducin heterotrimers: gnat1/gnb1/gngt1 for rods, and gnat2/gnb3/gngt2 for cones. The teleost-specific tetraploidisation generated additional duplicates for gnb1, gnb3 and gngt2. We report here that the duplicates have undergone several types of subfunctionalisation or neofunctionalisation in the zebrafish. We have found that gnb1a and gnb1b are co-expressed at different levels in rods; gnb3a and gnb3b have undergone compartmentalisation restricting gnb3b to the dorsal and medial retina, however, gnb3a expression was detected only at very low levels in both larvae and adult retina; gngt2b expression is restricted to the dorsal and medial retina, whereas gngt2a is expressed ventrally. This dorsoventral distinction could be an adaptation to protect the lower part of the retina from intense light damage. The ontogenetic analysis shows earlier onset of expression in the pineal complex than in the retina, in accordance with its earlier maturation. Additionally, gnb1a but not gnb1b is expressed in the pineal complex, and gnb3b and gngt2b are transiently expressed in the pineal during ontogeny, thus showing partial temporal subfunctionalisation. These retina-pineal distinctions presumably reflect their distinct functional roles in vision and circadian rhythmicity. In summary, this study describes several functional differences between transducin gene duplicates resulting from the teleost-specific tetraploidisation. PMID:25806532

  3. ESTs analysis reveals putative genes involved in symbiotic seed germination in Dendrobium officinale.

    Directory of Open Access Journals (Sweden)

    Ming-Ming Zhao

    Full Text Available Dendrobiumofficinale (Orchidaceae is one of the world's most endangered plants with great medicinal value. In nature, D. officinale seeds must establish symbiotic relationships with fungi to germinate. However, the molecular events involved in the interaction between fungus and plant during this process are poorly understood. To isolate the genes involved in symbiotic germination, a suppression subtractive hybridization (SSH cDNA library of symbiotically germinated D. officinale seeds was constructed. From this library, 1437 expressed sequence tags (ESTs were clustered to 1074 Unigenes (including 902 singletons and 172 contigs, which were searched against the NCBI non-redundant (NR protein database (E-value cutoff, e(-5. Based on sequence similarity with known proteins, 579 differentially expressed genes in D. officinale were identified and classified into different functional categories by Gene Ontology (GO, Clusters of orthologous Groups of proteins (COGs and Kyoto Encyclopedia of Genes and Genomes (KEGG pathways. The expression levels of 15 selected genes emblematic of symbiotic germination were confirmed via real-time quantitative PCR. These genes were classified into various categories, including defense and stress response, metabolism, transcriptional regulation, transport process and signal transduction pathways. All transcripts were upregulated in the symbiotically germinated seeds (SGS. The functions of these genes in symbiotic germination were predicted. Furthermore, two fungus-induced calcium-dependent protein kinases (CDPKs, which were upregulated 6.76- and 26.69-fold in SGS compared with un-germinated seeds (UGS, were cloned from D. officinale and characterized for the first time. This study provides the first global overview of genes putatively involved in D. officinale symbiotic seed germination and provides a foundation for further functional research regarding symbiotic relationships in orchids.

  4. In silico reversal of repeat-induced point mutation (RIP identifies the origins of repeat families and uncovers obscured duplicated genes

    Directory of Open Access Journals (Sweden)

    Hane James K

    2010-11-01

    Full Text Available Abstract Background Repeat-induced point mutation (RIP is a fungal genome defence mechanism guarding against transposon invasion. RIP mutates the sequence of repeated DNA and over time renders the affected regions unrecognisable by similarity search tools such as BLAST. Results DeRIP is a new software tool developed to predict the original sequence of a RIP-mutated region prior to the occurrence of RIP. In this study, we apply deRIP to the genome of the wheat pathogen Stagonospora nodorum SN15 and predict the origin of several previously uncharacterised classes of repetitive DNA. Conclusions Five new classes of transposon repeats and four classes of endogenous gene repeats were identified after deRIP. The deRIP process is a new tool for fungal genomics that facilitates the identification and understanding of the role and origin of fungal repetitive DNA. DeRIP is open-source and is available as part of the RIPCAL suite at http://www.sourceforge.net/projects/ripcal.

  5. Cold Shock as a Screen for Genes Involved in Cold Acclimatization in Neurospora crassa.

    Science.gov (United States)

    Watters, Michael K; Manzanilla, Victor; Howell, Holly; Mehreteab, Alexander; Rose, Erik; Walters, Nicole; Seitz, Nicholas; Nava, Jacob; Kekelik, Sienna; Knuth, Laura; Scivinsky, Brianna

    2018-03-21

    When subjected to rapid drops of temperature (cold shock), Neurospora responds with a temporary shift in its morphology. This report is the first to examine this response genetically. We report here the results of a screen of selected mutants from the Neurospora knockout library for alterations in their morphological response to cold shock. Three groups of knockouts were selected to be subject to this screen: genes previously suspected to be involved in hyphal development as well as knockouts resulting in morphological changes; transcription factors; and genes homologous to E. coli genes known to alter their expression in response to cold shock. A total of 344 knockout strains were subjected to cold shock. Of those, 118 strains were identified with altered responses. We report here the cold shock morphologies and GO categorizations of strains subjected to this screen. Of strains with knockouts in genes associated with hyphal growth or morphology, 33 of 131 tested (25%) showed an altered response to cold shock. Of strains with knockouts in transcription factor genes, 30 of 145 (20%) showed an altered response to cold shock. Of strains with knockouts in genes homologous to E. coli genes which display altered levels of transcription in response to cold shock, a total of 55 of 68 tested (81%) showed an altered cold shock response. This suggests that the response to cold shock in these two organisms is largely shared in common. Copyright © 2018, G3: Genes, Genomes, Genetics.

  6. Insertional Mutagenesis for Genes involved in Otic/Vestibular Development and Function in Xenopus Tropicalis

    Science.gov (United States)

    Torrejon, Marcela; Li, Erica; Nguyen, Minh; Winfree, Seth; Wang, Esther; Reinsch, Sigrid; Dalton, Bonnie (Technical Monitor)

    2002-01-01

    Sensitivity to gravity is essential for spatial orientation. Consequently, the gravity receptor system is one of the phylogenetically oldest sensory systems, and the special adaptations that enhance sensitivity to gravity are highly conserved. The main goal of this project is to use Xenopus (frog) to identify genes expressed during vestibular and auditory development. These studies will lead a better understanding of the molecular mechanisms involved in vestibular and auditory development and function. We are using a gene-trap approach in Xenopus tropicalis with the green fluorescent protein (GFP) gene as the transgene reporter. GFP expression occurs only when the GFP gene is correctly integrated in actively transcribed genes. Using the GFP as a tag we can easily identify and clone the mutated gene. In addition, we can study the function of the mutated gene by analyzing the defects generated by insertion of the GFP transgene. To date we have tissue specific GFP expression in X. tropicalis including expression in ear, neural tube, kidney, muscle, eyes and nose. Our transgenic animals will soon reach maturity so that we can outcross them and analyze their progeny. Our next goal is to isolate RNA from our transgenics and clone the tagged genes using RACE-PCR. Currently we are optimizing the RACE-PCR method using transgenics with crystallin GFP expression.

  7. Transcriptome analysis of genes involved in defence response in Polyporus umbellatus with Armillaria mellea infection.

    Science.gov (United States)

    Liu, Meng-Meng; Xing, Yong-Mei; Zhang, Da-Wei; Guo, Shun-Xing

    2015-11-03

    Polyporus umbellatus, a species symbiotic with Armillaria mellea and it also exhibits substantial defence response to Armillaria mellea infection. There are no genomics resources databases for understanding the molecular mechanism underlying the infection stress of P. umbellatus. Therefore, we performed a large-scale transcriptome sequencing of this fungus with A. mellea infection using Illumina sequencing technology. The assembly of the clean reads resulted in 120,576 transcripts, including 38,444 unigenes. Additionally, we performed a gene expression profiling analysis upon infection treatment. The results indicated significant differences in the gene expression profiles between the control and the infection group. In total, 10933 genes were identified between the two groups. Based on the differentially expressed genes, a Gene Ontology annotation analysis showed many defence-relevant categories. Meanwhile, the Kyoto Encyclopedia of Genes and Genomes pathway analysis uncovered some important pathways. Furthermore, the expression patterns of 13 putative genes that are involved in defence response resulting from quantitative real-time PCR were consistent with their transcript abundance changes as identified by RNA-seq. The sequenced genes covered a considerable proportion of the P. umbellatus transcriptome, and the expression results may be useful to strengthen the knowledge on the defence response of this fungus defend against Armillaria mellea invasion.

  8. Alcohol-induced histone acetylation reveals a gene network involved in alcohol tolerance.

    Directory of Open Access Journals (Sweden)

    Alfredo Ghezzi

    Full Text Available Sustained or repeated exposure to sedating drugs, such as alcohol, triggers homeostatic adaptations in the brain that lead to the development of drug tolerance and dependence. These adaptations involve long-term changes in the transcription of drug-responsive genes as well as an epigenetic restructuring of chromosomal regions that is thought to signal and maintain the altered transcriptional state. Alcohol-induced epigenetic changes have been shown to be important in the long-term adaptation that leads to alcohol tolerance and dependence endophenotypes. A major constraint impeding progress is that alcohol produces a surfeit of changes in gene expression, most of which may not make any meaningful contribution to the ethanol response under study. Here we used a novel genomic epigenetic approach to find genes relevant for functional alcohol tolerance by exploiting the commonalities of two chemically distinct alcohols. In Drosophila melanogaster, ethanol and benzyl alcohol induce mutual cross-tolerance, indicating that they share a common mechanism for producing tolerance. We surveyed the genome-wide changes in histone acetylation that occur in response to these drugs. Each drug induces modifications in a large number of genes. The genes that respond similarly to either treatment, however, represent a subgroup enriched for genes important for the common tolerance response. Genes were functionally tested for behavioral tolerance to the sedative effects of ethanol and benzyl alcohol using mutant and inducible RNAi stocks. We identified a network of genes that are essential for the development of tolerance to sedation by alcohol.

  9. Lactose metabolism in Lactobacillus bulgaricus: analysis of the primary structure and expression of the genes involved.

    Science.gov (United States)

    Leong-Morgenthaler, P; Zwahlen, M C; Hottinger, H

    1991-01-01

    The genes coding for the lactose permease and beta-galactosidase, two proteins involved in the metabolism of lactose by Lactobacillus bulgaricus, have been cloned, expressed, and found functional in Escherichia coli. The nucleotide sequences of these genes and their flanking regions have been determined, showing the presence of two contiguous open reading frames (ORFs). One of these ORFs codes for the lactose permease gene, and the other codes for the beta-galactosidase gene. The lactose permease gene is located in front of the beta-galactosidase gene, with 3 bp in the intergenic region. The two genes are probably transcribed as one operon. Primer extension studies have mapped a promoter upstream from the lactose permease gene but not the beta-galactosidase gene. This promoter is similar to those found in E. coli with general characteristics of GC-rich organisms. In addition, the sequences around the promoter contain a significantly higher number of AT base pairs (80%) than does the overall L. bulgaricus genome, which is rich in GC (GC content of 54%). The amino acid sequences obtained from translation of the ORFs are found to be highly homologous (similarity of 75%) to those from Streptococcus thermophilus. The first 460 amino acids of the lactose permease shows homology to the melibiose transport protein of E. coli. Little homology was found between the lactose permease of L. bulgaricus and E. coli, but the residues which are involved in the binding and the transport of lactose are conserved. The carboxy terminus is similar to that of the enzyme III of several phosphoenolpyruvate-dependent phosphotransferase systems. Images PMID:1705929

  10. Differential expression of the virulence-associated protein p57 and characterization of its duplicated gene rosa in virulent and attenuated strains of Renibacterium salmoninarum

    Science.gov (United States)

    O'Farrell, C. L.; Strom, M.S.

    1999-01-01

    Virulence mechanisms utilized by the salmonid fish pathogen Renibacterium salmoninarum are poorly understood. One potential virulence factor is p57 (also designated MSA for major soluble antigen), an abundant 57 kDa soluble protein that is predominately localized on the bacterial cell surface with significant levels released into the extracellular milieu. Previous studies of an attenuated strain, MT 239, indicated that it differs from virulent strains in the amount of surface-associated p57. In this report, we show overall expression of p57 in R. salmoninarum MT 239 is considerably reduced as compared to a virulent strain, ATCC 33209. The amount of cell-associated p57 is decreased while the level of p57 in the culture supernatant is nearly equivalent between the strains. To determine if lowered amount of cell-associated p57 was due to a sequence defect in p57, a genetic comparison was performed. Two copies of the gene encoding p57 (msa1 and msa2) were found in 33209 and MT 239, as well as in several other virulent isolates. Both copies from 33209 and MT 239 were cloned and sequenced and found to be identical to each other, and identical between the 2 strains. A comparison of msa1 and msa2 within each strain showed that their sequences diverge 40 base pairs 5, to the open reading frame, while sequences 3' to the open reading frame are essentially identical for at least 225 base pairs. Northern blot analysis showed no difference in steady state levels of rosa mRNA between the 2 strains. These data suggest that while cell-surface localization of p57 may be important for R. salmoninarum virulence, the differences in localization, and total p57 expression between 33209 anti MT 239 are not due to differences in rosa sequence or differences in steady state transcript levels.

  11. Promoter polymorphisms in genes involved in porcine myogenesis influence their transcriptional activity.

    Science.gov (United States)

    Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio

    2014-11-07

    Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and

  12. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...

  13. Modulation of genes involved in inflammation and cell death in atherosclerosis-susceptible mice

    NARCIS (Netherlands)

    Zadelaar, Anna Susanne Maria

    2006-01-01

    In this thesis we focus on atherosclerosis as the main cause of cardiovascular disease. Since inflammation and cell death are important processes in the onset and progression of atherosclerosis, we investigate the role of several genes involved in inflammation and cell death in the vessel wall and

  14. Positional cloning of genes involved in the Beckwith-Wiedemann syndrome, hemihypertrophy, and associated childhood tumors

    NARCIS (Netherlands)

    Mannens, M.; Alders, M.; Redeker, B.; Bliek, J.; Steenman, M.; Wiesmeyer, C.; de Meulemeester, M.; Ryan, A.; Kalikin, L.; Voûte, T.; de Kraker, J.; Hoovers, J.; Slater, R.; Feinberg, A.; Little, P.; Westerveld, A.

    1996-01-01

    The Beckwith-Wiedemann syndrome (BWS) is an overgrowth malformation syndrome that occurs with an incidence of 1:13,700 births. There is a striking incidence of childhood tumors found in BWS patients. Various lines of investigation have localized "imprinted" genes involved in BWS and associated

  15. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...

  16. Evidence for the involvement of the Gli gene family in embryonic mouse lung development.

    Science.gov (United States)

    Grindley, J C; Bellusci, S; Perkins, D; Hogan, B L

    1997-08-15

    Murine Gli, Gli2, and Gli3 are zinc finger genes related to Drosophila cubitus interuptus, a component of the hedgehog signal transduction pathway. In the embryonic lung, all three Gli genes are strongly expressed at the pseudoglandular stage, in distinct but overlapping domains of the mesoderm. Expression of Gli and Gli3, but not of Gli2, is subsequently downregulated at the canalicular stage, coincident with a decline in the expression of sonic hedgehog (Shh) and the hedgehog receptor gene, patched (Ptc). Overexpression of Shh in the lung results in increased levels of Ptc mRNA. Gli, but not Gli2, is also upregulated, suggesting a differential involvement of the Gli genes in the regulation of Ptc by SHH during lung development. Gli3 is not upregulated by Shh overexpression. However, its importance for lung development is shown by the finding that Gli3XtJ embryos, homozygous for a mutation involving a deletion of the Gli3 gene, have a stereotypic pattern of abnormalities in lung morphogenesis. The pulmonary defects in these embryos, consisting of localized shape changes and size reductions, correlate with normal Gli3 expression. Thus, our data indicate that one of the Gli genes, Gli3, is essential for normal lung development, and that another, Gli, can be placed downstream of Shh signaling in the lung.

  17. Identification and characterization of nuclear genes involved in photosynthesis in Populus

    Science.gov (United States)

    2014-01-01

    Background The gap between the real and potential photosynthetic rate under field conditions suggests that photosynthesis could potentially be improved. Nuclear genes provide possible targets for improving photosynthetic efficiency. Hence, genome-wide identification and characterization of the nuclear genes affecting photosynthetic traits in woody plants would provide key insights on genetic regulation of photosynthesis and identify candidate processes for improvement of photosynthesis. Results Using microarray and bulked segregant analysis strategies, we identified differentially expressed nuclear genes for photosynthesis traits in a segregating population of poplar. We identified 515 differentially expressed genes in this population (FC ≥ 2 or FC ≤ 0.5, P photosynthesis by the nuclear genome mainly involves transport, metabolism and response to stimulus functions. Conclusions This study provides new genome-scale strategies for the discovery of potential candidate genes affecting photosynthesis in Populus, and for identification of the functions of genes involved in regulation of photosynthesis. This work also suggests that improving photosynthetic efficiency under field conditions will require the consideration of multiple factors, such as stress responses. PMID:24673936

  18. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  19. A de novo 11p12-p15.4 duplication in a patient with pharmacoresistant epilepsy, mental retardation, and dysmorphisms.

    Science.gov (United States)

    Coppola, Antonietta; Striano, Pasquale; Gimelli, Stefania; Ciampa, Clotilde; Santulli, Lia; Caranci, Ferdinando; Zuffardi, Orsetta; Gimelli, Giorgio; Striano, Salvatore; Zara, Federico

    2010-03-01

    We report a 22-year-old male patient with pharmacoresistant epilepsy, mental retardation and dysmorphisms. Standard cytogenetic analysis revealed a de novo interstitial duplication of the short arm of chromosome 11 (11p). High density array-CGH analysis showed that the rearrangement spans about 35Mb on chromosome 11p12-p15.4. Duplications of 11p are rare and usually involve the distal part of the chromosome arm (11p15), being not associated with epilepsy, whereas our patient showed a unique epileptic phenotype associated with mental retardation and dysmorphic features. The role of some rearranged genes in epilepsy pathogenesis in this patient is also discussed.

  20. Polyphyly, gene-duplication and extensive allopolyploidy framed the evolution of the ephemeral Vulpia grasses and other fine-leaved Loliinae (Poaceae).

    Science.gov (United States)

    Díaz-Pérez, A J; Sharifi-Tehrani, M; Inda, L A; Catalán, P

    2014-10-01

    The fine-leaved Loliinae is one of the temperate grass lineages that is richest in number of evolutionary switches from perennial to annual life-cycle, and also shows one of the most complex reticulate patterns involving distinct diploid and allopolyploid lineages. Eight distinct annual lineages, that have traditionally been placed in the genus Vulpia and in other fine-leaved ephemeral genera, have apparently emerged from different perennial Festuca ancestors. The phenotypically similar Vulpia taxa have been reconstructed as polyphyletic, with polyploid lineages showing unclear relationships to their purported diploid relatives. Interspecific and intergeneric hybridization is, however, rampant across different lineages. An evolutionary analysis based on cloned nuclear low-copy GBSSI (Granule-Bound Starch Synthase I) and multicopy ITS (Internal Transcribed Spacer) sequences has been conducted on representatives of most Vulpia species and other fine-leaved lineages, using Bayesian consensus and agreement trees, networking split graphs and species tree-based approaches, to disentangle their phylogenetic relationships and to identify the parental genome donors of the allopolyploids. Both data sets were able to reconstruct a congruent phylogeny in which Vulpia was resolved as polyphyletic from at least three main ancestral diploid lineages. These, in turn, participated in the origin of the derived allopolyploid Vulpia lineages together with other Festuca-like, Psilurus-like and some unknown genome donors. Long-distance dispersal events were inferred to explain the polytopic origin of the Mediterranean and American Vulpia lineages. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Identification of new genes involved in human adipogenesis and fat storage.

    Directory of Open Access Journals (Sweden)

    Jörn Söhle

    Full Text Available Since the worldwide increase in obesity represents a growing challenge for health care systems, new approaches are needed to effectively treat obesity and its associated diseases. One prerequisite for advances in this field is the identification of genes involved in adipogenesis and/or lipid storage. To provide a systematic analysis of genes that regulate adipose tissue biology and to establish a target-oriented compound screening, we performed a high throughput siRNA screen with primary (preadipocytes, using a druggable siRNA library targeting 7,784 human genes. The primary screen showed that 459 genes affected adipogenesis and/or lipid accumulation after knock-down. Out of these hits, 333 could be validated in a secondary screen using independent siRNAs and 110 genes were further regulated on the gene expression level during adipogenesis. Assuming that these genes are involved in neutral lipid storage and/or adipocyte differentiation, we performed InCell-Western analysis for the most striking hits to distinguish between the two phenotypes. Beside well known regulators of adipogenesis and neutral lipid storage (i.e. PPARγ, RXR, Perilipin A the screening revealed a large number of genes which have not been previously described in the context of fatty tissue biology such as axonemal dyneins. Five out of ten axonemal dyneins were identified in our screen and quantitative RT-PCR-analysis revealed that these genes are expressed in preadipocytes and/or maturing adipocytes. Finally, to show that the genes identified in our screen are per se druggable we performed a proof of principle experiment using an antagonist for HTR2B. The results showed a very similar phenotype compared to knock-down experiments proofing the "druggability". Thus, we identified new adipogenesis-associated genes and those involved in neutral lipid storage. Moreover, by using a druggable siRNA library the screen data provides a very attractive starting point to identify anti

  2. Identification and expression analysis of candidate genes involved in carotenoid biosynthesis in chickpea seeds

    Directory of Open Access Journals (Sweden)

    Mohammad Kazem Rezaei

    2016-12-01

    Full Text Available Plant carotenoids have a key role in preventing various diseases in human because of their antioxidant and provitamin A properties. Chickpea is a good source of carotenoid among legumes and its diverse germplasm and genome accessibility makes it a good model for carotenogenesis studies. The structure, location and copy numbers of genes involved in carotenoid biosynthesis were retrieved from the chickpea genome. The majority of the single nucleotide polymorphism (SNPs within these genes across five diverse chickpea cultivars was synonymous mutation. We examined the expression of the carotenogenesis genes and their association with carotenoid concentration at different seed development stages of five chickpea cultivars. Total carotenoid concentration ranged from 22 μg g-1 in yellow cotyledon kabuli to 44 μg g-1 in green cotyledon desi at 32 days post anthesis (DPA. The majority of carotenoids in chickpea seeds consists of lutein and zeaxanthin. The expression of the selected 19 genes involved in carotenoid biosynthesis pathway showed common pattern across five cultivars with higher expression at 8 and/or 16 DPA then dropped considerably at 24 and 32 DPA. Almost all genes were up-regulated in CDC Jade cultivar. Correlation analysis between gene expression and carotenoid concentration showed that the genes involved in the primary step of carotenoid biosynthesis pathway including carotenoid desaturase and isomerase positively correlated with various carotenoid components in chickpea seeds. A negative correlation was found between hydroxylation activity and provitamin A concentration in the seeds. The highest provitamin A concentration including β-carotene and β-cryptoxanthin were found in green cotyledon chickpea cultivars.

  3. Transcriptome profiling of the Plutella xylostella (Lepidoptera: Plutellidae) ovary reveals genes involved in oogenesis.

    Science.gov (United States)

    Peng, Lu; Wang, Lei; Yang, Yi-Fan; Zou, Ming-Min; He, Wei-Yi; Wang, Yue; Wang, Qing; Vasseur, Liette; You, Min-Sheng

    2017-12-30

    As a specialized organ, the insect ovary performs valuable functions by ensuring fecundity and population survival. Oogenesis is the complex physiological process resulting in the production of mature eggs, which are involved in epigenetic programming, germ cell behavior, cell cycle regulation, etc. Identification of the genes involved in ovary development and oogenesis is critical to better understand the reproductive biology and screening for the potential molecular targets in Plutella xylostella, a worldwide destructive pest of economically major crops. Based on transcriptome sequencing, a total of 7.88Gb clean nucleotides was obtained, with 19,934 genes and 1861 new transcripts being identified. Expression profiling indicated that 61.7% of the genes were expressed (FPKM≥1) in the P. xylostella ovary. GO annotation showed that the pathways of multicellular organism reproduction and multicellular organism reproduction process, as well as gamete generation and chorion were significantly enriched. Processes that were most likely relevant to reproduction included the spliceosome, ubiquitin mediated proteolysis, endocytosis, PI3K-Akt signaling pathway, insulin signaling pathway, cAMP signaling pathway, and focal adhesion were identified in the top 20 'highly represented' KEGG pathways. Functional genes involved in oogenesis were further analyzed and validated by qRT-PCR to show their potential predominant roles in P. xylostella reproduction. Our newly developed P. xylostella ovary transcriptome provides an overview of the gene expression profiling in this specialized tissue and the functional gene network closely related to the ovary development and oogenesis. This is the first genome-wide transcriptome dataset of P. xylostella ovary that includes a subset of functionally activated genes. This global approach will be the basis for further studies on molecular mechanisms of P. xylostella reproduction aimed at screening potential molecular targets for integrated pest

  4. Involvement of plastid, mitochondrial and nuclear genomes in plant-to-plant horizontal gene transfer

    Directory of Open Access Journals (Sweden)

    Maria Virginia Sanchez-Puerta

    2014-12-01

    Full Text Available This review focuses on plant-to-plant horizontal gene transfer (HGT involving the three DNA-containing cellular compartments. It highlights the great incidence of HGT in the mitochondrial genome (mtDNA of angiosperms, the increasing number of examples in plant nuclear genomes, and the lack of any convincing evidence for HGT in the well-studied plastid genome of land plants. Most of the foreign mitochondrial genes are non-functional, generally found as pseudogenes in the recipient plant mtDNA that maintains its functional native genes. The few exceptions involve chimeric HGT, in which foreign and native copies recombine leading to a functional and single copy of the gene. Maintenance of foreign genes in plant mitochondria is probably the result of genetic drift, but a possible evolutionary advantage may be conferred through the generation of genetic diversity by gene conversion between native and foreign copies. Conversely, a few cases of nuclear HGT in plants involve functional transfers of novel genes that resulted in adaptive evolution. Direct cell-to-cell contact between plants (e.g. host-parasite relationships or natural grafting facilitate the exchange of genetic material, in which HGT has been reported for both nuclear and mitochondrial genomes, and in the form of genomic DNA, instead of RNA. A thorough review of the literature indicates that HGT in mitochondrial and nuclear genomes of angiosperms is much more frequent than previously expected and that the evolutionary impact and mechanisms underlying plant-to-plant HGT remain to be uncovered.

  5. Parallel Gene Expression Changes in Sarcoidosis Involving the Lacrimal Gland, Orbital Tissue, or Blood.

    Science.gov (United States)

    Rosenbaum, James T; Choi, Dongseok; Wilson, David J; Grossniklaus, Hans E; Harrington, Christina A; Sibley, Cailin H; Dailey, Roger A; Ng, John D; Steele, Eric A; Czyz, Craig N; Foster, Jill A; Tse, David; Alabiad, Chris; Dubovy, Sander; Parekh, Prashant; Harris, Gerald J; Kazim, Michael; Patel, Payal; White, Valerie; Dolman, Peter; Korn, Bobby S; Kikkawa, Don; Edward, Deepak P; Alkatan, Hind; Al-Hussain, Hailah; Yeatts, R Patrick; Selva, Dinesh; Stauffer, Patrick; Planck, Stephen R

    2015-07-01

    -response factor 2, and nuclear factor κB, were strongly implicated in the expression of messenger RNA upregulated in common in the 3 tissues. Gene expression in sarcoidosis involving the orbit or lacrimal gland can be distinguished from gene expression patterns in control tissue and overlaps with many transcripts upregulated or downregulated in the peripheral blood of patients with sarcoidosis. These observations suggest that common pathogenic mechanisms contribute to sarcoidosis in different sites. The observations support the hypothesis that a pattern of gene expression profiles could provide diagnostic information in patients with sarcoidosis.

  6. Phenotype Analysis Method for Identification of Gene Functions Involved in Asymmetric Division of Caenorhabditis elegans.

    Science.gov (United States)

    Yang, Sihai; Han, Xianhua; Tohsato, Yukako; Kyoda, Koji; Onami, Shuichi; Nishikawa, Ikuko; Chen, Yenwei

    2017-05-01

    In gene function analysis, it is arduous to identify gene function individually, and the way to screen out all involved genes according to a particular phenotype or disease usually shows us little information for a specific problem. We present a data-driven analysis system based on wild type (WT) embryos to study the concrete function of each gene associated with certain category of abnormal phenotypes. It can be applied to genes with very few RNAi embryos. Instead of presupposing the particular function of a gene, its function is confirmed by the statistical testing of built models. The scheme includes the following five: first, verify the to be detected genes and determine related recognized features according to the given category; second, compute the value of each feature based on WT embryos and merge them by principal component analysis (PCA); third, for each of the selected components of PCA, build a normal distribution and verify its normality; fourth, project the RNAi embryos to each component and probe them; and finally, analyze the more detailed functions of each gene based on the physical or biological meaning of each component. Choosing the first-round asymmetric division process of Caenorhabditis elegans as the phenotype, experimental results show that on the different aspects of the asymmetric division process, par-2, par-3, and let-754 are related to scalar differences; dcn-1 and mcm-5 are associated with the divergences of scalar variation, which may reflect the disaccord in development; and dcn-1, par-2, and par-3 are involved with morphological discrepancies.

  7. Genes involved in complex adaptive processes tend to have highly conserved upstream regions in mammalian genomes

    Directory of Open Access Journals (Sweden)

    Kohane Isaac

    2005-11-01

    Full Text Available Abstract Background Recent advances in genome sequencing suggest a remarkable conservation in gene content of mammalian organisms. The similarity in gene repertoire present in different organisms has increased interest in studying regulatory mechanisms of gene expression aimed at elucidating the differences in phenotypes. In particular, a proximal promoter region contains a large number of regulatory elements that control the expression of its downstream gene. Although many studies have focused on identification of these elements, a broader picture on the complexity of transcriptional regulation of different biological processes has not been addressed in mammals. The regulatory complexity may strongly correlate with gene function, as different evolutionary forces must act on the regulatory systems under different biological conditions. We investigate this hypothesis by comparing the conservation of promoters upstream of genes classified in different functional categories. Results By conducting a rank correlation analysis between functional annotation and upstream sequence alignment scores obtained by human-mouse and human-dog comparison, we found a significantly greater conservation of the upstream sequence of genes involved in development, cell communication, neural functions and signaling processes than those involved in more basic processes shared with unicellular organisms such as metabolism and ribosomal function. This observation persists after controlling for G+C content. Considering conservation as a functional signature, we hypothesize a higher density of cis-regulatory elements upstream of genes participating in complex and adaptive processes. Conclusion We identified a class of functions that are associated with either high or low promoter conservation in mammals. We detected a significant tendency that points to complex and adaptive processes were associated with higher promoter conservation, despite the fact that they have emerged

  8. Comparative Transcriptome Analysis to Reveal Genes Involved in Wheat Hybrid Necrosis

    Directory of Open Access Journals (Sweden)

    Yong Zhang

    2014-12-01

    Full Text Available Wheat hybrid necrosis is an interesting genetic phenomenon that is found frequently and results in gradual death or loss of productivity of wheat. However, the molecular basis and mechanisms of this genetic phenomenon are still not well understood. In this study, the transcriptomes of wheat hybrid necrosis F1 and its parents (Neimai 8 and II469 were investigated using digital gene expression (DGE. A total of 1300 differentially expressed genes were identified, indicating that the response to hybrid necrosis in wheat is complicated. The assignments of the annotated genes based on Gene Ontology (GO revealed that most of the up-regulated genes belong to “universal stress related”, “DNA/RNA binding”, “protein degradation” functional groups, while the down-regulated genes belong to “carbohydrate metabolism” and “translation regulation” functional groups. These findings suggest that these pathways were affected by hybrid necrosis. Our results provide preliminarily new insight into the underlying molecular mechanisms of hybrid necrosis and will help to identify important candidate genes involved in wheat hybrid necrosis.

  9. Comparative transcriptome analysis to reveal genes involved in wheat hybrid necrosis.

    Science.gov (United States)

    Zhang, Yong; Cheng, Yan; Guo, Jiahui; Yang, Ennian; Liu, Cheng; Zheng, Xuelian; Deng, Kejun; Zhou, Jianping

    2014-12-16

    Wheat hybrid necrosis is an interesting genetic phenomenon that is found frequently and results in gradual death or loss of productivity of wheat. However, the molecular basis and mechanisms of this genetic phenomenon are still not well understood. In this study, the transcriptomes of wheat hybrid necrosis F1 and its parents (Neimai 8 and II469) were investigated using digital gene expression (DGE). A total of 1300 differentially expressed genes were identified, indicating that the response to hybrid necrosis in wheat is complicated. The assignments of the annotated genes based on Gene Ontology (GO) revealed that most of the up-regulated genes belong to "universal stress related", "DNA/RNA binding", "protein degradation" functional groups, while the down-regulated genes belong to "carbohydrate metabolism" and "translation regulation" functional groups. These findings suggest that these pathways were affected by hybrid necrosis. Our results provide preliminarily new insight into the underlying molecular mechanisms of hybrid necrosis and will help to identify important candidate genes involved in wheat hybrid necrosis.

  10. Characterization of Pneumococcal Genes Involved in Bloodstream Invasion in a Mouse Model.

    Directory of Open Access Journals (Sweden)

    Layla K Mahdi

    Full Text Available Streptococcus pneumoniae (the pneumococcus continues to account for significant morbidity and mortality worldwide, causing life-threatening diseases such as pneumonia, bacteremia and meningitis, as well as less serious infections such as sinusitis, conjunctivitis and otitis media. Current polysaccharide vaccines are strictly serotype-specific and also drive the emergence of non-vaccine serotype strains. In this study, we used microarray analysis to compare gene expression patterns of either serotype 4 or serotype 6A pneumococci in the nasopharynx and blood of mice, as a model to identify genes involved in invasion of blood in the context of occult bacteremia in humans. In this manner, we identified 26 genes that were significantly up-regulated in the nasopharynx and 36 genes that were significantly up-regulated in the blood that were common to both strains. Gene Ontology classification revealed that transporter and DNA binding (transcription factor activities constitute the significantly different molecular functional categories for genes up-regulated in the nasopharynx and blood. Targeted mutagenesis of selected genes from both niches and subsequent virulence and pathogenesis studies identified the manganese-dependent superoxide dismutase (SodA as most likely to be essential for colonization, and the cell wall-associated serine protease (PrtA as important for invasion of blood. This work extends our previous analyses and suggests that both PrtA and SodA warrant examination in future studies aimed at prevention and/or control of pneumococcal disease.

  11. Mapping of Candidate Genes Involved in Bud Dormancy and Flowering Time in Sweet Cherry (Prunus avium).

    Science.gov (United States)

    Castède, Sophie; Campoy, José Antonio; Le Dantec, Loïck; Quero-García, José; Barreneche, Teresa; Wenden, Bénédicte; Dirlewanger, Elisabeth

    2015-01-01

    The timing of flowering in perennial plants is crucial for their survival in temperate climates and is regulated by the duration of bud dormancy. Bud dormancy release and bud break depend on the perception of cumulative chilling during endodormancy and heat during the bud development. The objectives of this work were to identify candidate genes involved in dormancy and flowering processes in sweet cherry, their mapping in two mapping progenies 'Regina' × 'Garnet' and 'Regina' × 'Lapins', and to select those candidate genes which co-localized with quantitative trait loci (QTLs) associated with temperature requirements for bud dormancy release and flowering. Based on available data on flowering processes in various species, a list of 79 candidate genes was established. The peach and sweet cherry orthologs were identified and primers were designed to amplify sweet cherry candidate gene fragments. Based on the amplified sequences of the three parents of the mapping progenies, SNPs segregations in the progenies were identified. Thirty five candidate genes were genetically mapped in at least one of the two progenies and all were in silico mapped. Co-localization between candidate genes and QTLs associated with temperature requirements and flowering date were identified for the first time in sweet cherry. The allelic composition of the candidate genes located in the major QTL for heat requirements and flowering date located on linkage group 4 have a significant effect on these two traits indicating their potential use for breeding programs in sweet cherry to select new varieties adapted to putative future climatic conditions.

  12. Erythropoietin Increases Myelination in Oligodendrocytes: Gene Expression Profiling Reveals Early Induction of Genes Involved in Lipid Transport and Metabolism

    Directory of Open Access Journals (Sweden)

    Georgina Gyetvai

    2017-10-01

    Full Text Available Several studies have shown that erythropoietin (EPO has neuroprotective or neuroreparative actions on diseases of the nervous system and that improves oligodendrocyte (OL differentiation and myelination in vivo and in vitro. This study aims at investigating the early molecular mechanisms for the pro-myelinating action of EPO at the gene expression level. For this purpose, we used a differentiating OL precursor cell line, rat central glia-4 cells. Cells were differentiated or not, and then treated with EPO for 1 or 20 h. RNA was extracted and changes in the gene expression profile were assessed using microarray analysis. Experiments were performed in biological replicates of n = 4. Differentiation alone changed the expression of 11% of transcripts (2,663 out of 24,272, representing 2,436 genes, half of which were upregulated and half downregulated. At 20 h of treatment, EPO significantly affected the expression of 99 genes that were already regulated by differentiation and of 150 genes that were not influenced by differentiation alone. Analysis of the transcripts most upregulated by EPO identified several genes involved in lipid transport (e.g., Cd36 and lipid metabolism (Ppargc1a/Pgc1alpha, Lpin1, Pnlip, Lpin2, Ppard, Plin2 along with Igf1 and Igf2, growth factors known for their pro-myelinating action. All these genes were only induced by EPO and not by differentiation alone, except for Pnlip which was highly induced by differentiation and augmented by EPO. Results were validated by quantitative PCR. These findings suggest that EPO might increase remyelination by inducing insulin-like growth factors and increasing lipid metabolism.

  13. Identification of putative candidate genes involved in cuticle formation in Prunus avium (sweet cherry) fruit.

    Science.gov (United States)

    Alkio, Merianne; Jonas, Uwe; Sprink, Thorben; van Nocker, Steven; Knoche, Moritz

    2012-07-01

    The cuticular membrane (CM) of Prunus avium (sweet cherry) and other fleshy fruit is under stress. Previous research indicates that the resultant strain promotes microscopic cuticular cracking. Microcracks impair the function of the CM as a barrier against pathogens and uncontrolled water loss/uptake. Stress and strain result from a cessation of CM deposition during early development, while the fruit surface continues to expand. The cessation of CM deposition, in turn, may be related to an early downregulation of CM-related genes. The aims of this study were to identify genes potentially involved in CM formation in sweet cherry fruit and to quantify their expression levels. Fruit growth and CM deposition were quantified weekly from anthesis to maturity and rates of CM deposition were calculated. Sequences of genes expressed in the sweet cherry fruit skin (exocarp) were generated using high-throughput sequencing of cDNA and de novo assembly and analysed using bioinformatics tools. Relative mRNA levels of selected genes were quantified in the exocarp and fruit flesh (mesocarp) weekly using reverse transcriptase-quantitative real-time PCR and compared with the calculated CM deposition rate over time. The rate of CM deposition peaked at 93 (±5) μg per fruit d(-1) about 19 d after anthesis. Based on sequence analyses, 18 genes were selected as potentially involved in CM formation. Selected sweet cherry genes shared up to 100 and 98 % similarity with the respective Prunus persica (peach) and Arabidopsis thaliana genes. Expression of 13 putative CM-related genes was restricted to the exocarp and correlated positively with the CM deposition rate. The results support the view that the cessation of CM deposition during early sweet cherry fruit development is accounted for by a downregulation of genes involved in CM deposition. Genes that merit further investigation include PaWINA, PaWINB, PaLipase, PaLTPG1, PaATT1, PaLCR, PaGPAT4/8, PaLACS2, PaLACS1 and PaCER1.

  14. “Clavicular duplication causing thoracic outlet obstruction”: Unique ...

    African Journals Online (AJOL)

    A 22‑year‑old female student reported with features of neurogenic thoracic outlet syndrome mainly involving C8‑T1 components of the brachial plexus, seemingly originating from involvement in costo‑clavicular space. Radiograph of the shoulder revealed clavicular duplication. Neuro‑physiological studies corroborated the ...

  15. Modeling protein network evolution under genome duplication and domain shuffling

    Directory of Open Access Journals (Sweden)

    Isambert Hervé

    2007-11-01

    Full Text Available Abstract Background Successive whole genome duplications have recently been firmly established in all major eukaryote kingdoms. Such exponential evolutionary processes must have largely contributed to shape the topology of protein-protein interaction (PPI networks by outweighing, in particular, all time-linear network growths modeled so far. Results We propose and solve a mathematical model of PPI network evolution under successive genome duplications. This demonstrates, from first principles, that evolutionary conservation and scale-free topology are intrinsically linked properties of PPI networks and emerge from i prevailing exponential network dynamics under duplication and ii asymmetric divergence of gene duplicates. While required, we argue that this asymmetric divergence arises, in fact, spontaneously at the level of protein-binding sites. This supports a refined model of PPI network evolution in terms of protein domains under exponential and asymmetric duplication/divergence dynamics, with multidomain proteins underlying the combinatorial formation of protein complexes. Genome duplication then provides a powerful source of PPI network innovation by promoting local rearrangements of multidomain proteins on a genome wide scale. Yet, we show that the overall conservation and topology of PPI networks are robust to extensive domain shuffling of multidomain proteins as well as to finer details of protein interaction and evolution. Finally, large scale features of direct and indirect PPI networks of S. cerevisiae are well reproduced numerically with only two adjusted parameters of clear biological significance (i.e. network effective growth rate and average number of protein-binding domains per protein. Conclusion This study demonstrates the statistical consequences of genome duplication and domain shuffling on the conservation and topology of PPI networks over a broad evolutionary scale across eukaryote kingdoms. In particular, scale

  16. Evaluation of common variants in 16 genes involved in the regulation of neurotransmitter release in ADHD.

    Science.gov (United States)

    Sánchez-Mora, Cristina; Cormand, Bru; Ramos-Quiroga, Josep Antoni; Hervás, Amaia; Bosch, Rosa; Palomar, Glòria; Nogueira, Mariana; Gómez-Barros, Núria; Richarte, Vanesa; Corrales, Montse; Garcia-Martinez, Iris; Corominas, Roser; Guijarro, Silvina; Bigorra, Aitana; Bayés, Mònica; Casas, Miguel; Ribasés, Marta

    2013-06-01

    Attention-deficit hyperactivity disorder (ADHD) is a neurobehavioral disorder characterized by inappropriate difficulties to sustain attention, control impulses and modulate activity level. Although ADHD is one of the most prevalent childhood psychiatric disorders, it also persists into adulthood in around 30-50% of the cases. Based on the effect of psychostimulants used in the pharmacological treatment of ADHD, dysfunctions in neuroplasticity mechanisms and synapses have been postulated to be involved in the pathophysiology of ADHD. With this background, we evaluated, both in childhood and adulthood ADHD, the role of several genes involved in the control of neurotransmitter release through synaptic vesicle docking, fusion and recycling processes by means of a population-based association study. We analyzed single nucleotide polymorphisms across 16 genes in a clinical sample of 950 ADHD patients (506 adults and 444 children) and 905 controls. Single and multiple-marker analyses identified several significant associations after correcting for multiple testing with a false discovery rate (FDR) of 15%: (i) the SYT2 gene was strongly associated with both adulthood and childhood ADHD (p=0.001, OR=1.49 (1.18-1.89) and p=0.007, OR=1.37 (1.09-1.72), respectively) and (ii) STX1A was found associated with ADHD only in adults (p=0.0041; OR=1.28 (1.08-1.51)). These data provide preliminary evidence for the involvement of genes that participate in the control of neurotransmitter release in the genetic predisposition to ADHD through a gene-system association study. Further follow-up studies in larger cohorts and deep-sequencing of the associated genomic regions are required to identify sequence variants directly involved in ADHD. Copyright © 2012 Elsevier B.V. and ECNP. All rights reserved.

  17. An evolutionary genomic approach to identify genes involved in human birth timing.

    Directory of Open Access Journals (Sweden)

    Jevon Plunkett

    2011-04-01

    Full Text Available Coordination of fetal maturation with birth timing is essential for mammalian reproduction. In humans, preterm birth is a disorder of profound global health significance. The signals initiating parturition in humans have remained elusive, due to divergence in physiological mechanisms between humans and model organisms typically studied. Because of relatively large human head size and narrow birth canal cross-sectional area compared to other primates, we hypothesized that genes involved in parturition would display accelerated evolution along the human and/or higher primate phylogenetic lineages to decrease the length of gestation and promote delivery of a smaller fetus that transits the birth canal more readily. Further, we tested whether current variation in such accelerated genes contributes to preterm birth risk. Evidence from allometric scaling of gestational age suggests human gestation has been shortened relative to other primates. Consistent with our hypothesis, many genes involved in reproduction show human acceleration in their coding or adjacent noncoding regions. We screened >8,400 SNPs in 150 human accelerated genes in 165 Finnish preterm and 163 control mothers for association with preterm birth. In this cohort, the most significant association was in FSHR, and 8 of the 10 most significant SNPs were in this gene. Further evidence for association of a linkage disequilibrium block of SNPs in FSHR, rs11686474, rs11680730, rs12473870, and rs1247381 was found in African Americans. By considering human acceleration, we identified a novel gene that may be associated with preterm birth, FSHR. We anticipate other human accelerated genes will similarly be associated with preterm birth risk and elucidate essential pathways for human parturition.

  18. Identification and analysis of novel genes involved in gravitropism of Arabidopsis thaliana.

    Science.gov (United States)

    Morita, Miyo T.; Tasaka, Masao; Masatoshi Taniguchi, .

    2012-07-01

    Gravitropism is a continuous control with regard to the orientation and juxtaposition of the various parts of the plant body in response to gravity. In higher plants, the relative directional change of gravity is mainly suscepted in specialized cells called statocytes, followed by signal conversion from physical information into physiological information within the statocytes. We have studied the early process of shoot gravitropism, gravity sensing and signaling process, mainly by molecular genetic approach. In Arabidopsis shoot, statocytes are the endodermal cells. sgr1/scarcrow (scr) and sgr7/short-root (shr) mutants fail to form the endodermis and to respond to gravity in their inflorescence stems. Since both SGR1/SCR and SGR7/SHR are transcriptional factors, at least a subset of their downstream genes can be expected to be involved in gravitropism. In addition, eal1 (endodermal-amyloplast less 1), which exhibits no gravitropism in inflorescence stem but retains ability to form endodermis, is a hypomorphic allele of sgr7/shr. Take advantage of these mutants, we performed DNA microarray analysis and compared gene expression profiles between wild type and the mutants. We found that approx. 40 genes were commonly down-regulated in these mutants and termed them DGE (DOWN-REGULATED GENE IN EAL1) genes. DGE1 has sequence similarity to Oryza sativa LAZY1 that is involved in shoot gravitropism of rice. DGE2 has a short region homologous to DGE1. DTL (DGE TWO-LIKE}) that has 54% identity to DGE2 is found in Arabidopsis genome. All three genes are conserved in angiosperm but have no known functional domains or motifs. We analyzed T-DNA insertion for these genes in single or multiple combinations. In dge1 dge2 dtl triple mutant, gravitropic response of shoot, hypocotyl and root dramatically reduced. Now we are carrying out further physiological and molecular genetic analysis of the triple mutant.

  19. Growth rate regulated genes and their wide involvement in the Lactococcus lactis stress responses

    Directory of Open Access Journals (Sweden)

    Redon Emma

    2008-07-01

    Full Text Available Abstract Background The development of transcriptomic tools has allowed exhaustive description of stress responses. These responses always superimpose a general response associated to growth rate decrease and a specific one corresponding to the stress. The exclusive growth rate response can be achieved through chemostat cultivation, enabling all parameters to remain constant except the growth rate. Results We analysed metabolic and transcriptomic responses of Lactococcus lactis in continuous cultures at different growth rates ranging from 0.09 to 0.47 h-1. Growth rate was conditioned by isoleucine supply. Although carbon metabolism was constant and homolactic, a widespread transcriptomic response involving 30% of the genome was observed. The expression of genes encoding physiological functions associated with biogenesis increased with growth rate (transcription, translation, fatty acid and phospholipids metabolism. Many phages, prophages and transposon related genes were down regulated as growth rate increased. The growth rate response was compared to carbon and amino-acid starvation transcriptomic responses, revealing constant and significant involvement of growth rate regulations in these two stressful conditions (overlap 27%. Two regulators potentially involved in the growth rate regulations, llrE and yabB, have been identified. Moreover it was established that genes positively regulated by growth rate are preferentially located in the vicinity of replication origin while those negatively regulated are mainly encountered at the opposite, thus indicating the relationship between genes expression and their location on chromosome. Although stringent response mechanism is considered as the one governing growth deceleration in bacteria, the rigorous comparison of the two transcriptomic responses clearly indicated the mechanisms are distinct. Conclusion This work of integrative biology was performed at the global level using transcriptomic analysis

  20. Intrathoracic enteric foregut duplication cyst.

    Directory of Open Access Journals (Sweden)

    Birmole B

    1994-10-01

    Full Text Available A one month old male child presented with respiratory distress since day 10 of life. There was intercostal retraction and decreased air entry on the right side. Investigations revealed a well defined cystic mass in the posterior mediastinum with vertebral anomalies, the cyst was excised by posterolateral thoracotomy. Histopathology revealed it to be an enteric foregut duplication cyst.

  1. Identification of Bradyrhizobium elkanii Genes Involved in Incompatibility with Vigna radiata

    Directory of Open Access Journals (Sweden)

    Hien P. Nguyen

    2017-12-01

    Full Text Available The establishment of a root nodule symbiosis between a leguminous plant and a rhizobium requires complex molecular interactions between the two partners. Compatible interactions lead to the formation of nitrogen-fixing nodules, however, some legumes exhibit incompatibility with specific rhizobial strains and restrict nodulation by the strains. Bradyrhizobium elkanii USDA61 is incompatible with mung bean (Vigna radiata cv. KPS1 and soybean cultivars carrying the Rj4 allele. Here, we explored genetic loci in USDA61 that determine incompatibility with V. radiata KPS1. We identified five novel B. elkanii genes that contribute to this incompatibility. Four of these genes also control incompatibility with soybean cultivars carrying the Rj4 allele, suggesting that a common mechanism underlies nodulation restriction in both legumes. The fifth gene encodes a hypothetical protein that contains a tts box in its promoter region. The tts box is conserved in genes encoding the type III secretion system (T3SS, which is known for its delivery of virulence effectors by pathogenic bacteria. These findings revealed both common and unique genes that are involved in the incompatibility of B. elkanii with mung bean and soybean. Of particular interest is the novel T3SS-related gene, which causes incompatibility specifically with mung bean cv. KPS1.

  2. New Genes Involved in Mild Stress Response Identified by Transposon Mutagenesis in Lactobacillus paracasei

    Directory of Open Access Journals (Sweden)

    Aurore Palud

    2018-03-01

    Full Text Available Lactic acid bacteria (LAB are associated with various plant, animal, and human niches and are also present in many fermented foods and beverages. Thus, they are subjected to several stress conditions and have developed advanced response mechanisms to resist, adapt, and grow. This work aimed to identify the genes involved in some stress adaptation mechanisms in LAB. For this purpose, global reverse genetics was applied by screening a library of 1287 Lactobacillus paracasei transposon mutants for mild monofactorial stresses. This library was submitted independently to heat (52°C, 30 min, ethanol (170 g.L−1, 30 min, salt (NaCl 0.8 M, 24 h, acid (pH 4.5, 24 h, and oxidative (2 mM H2O2, 24 h perturbations which trigger mild monofactorial stresses compatible with bacterial adaptation. Stress sensitivity of mutants was determined either by evaluating viability using propidium iodide (PI staining, or by following growth inhibition through turbidity measurement. The screening for heat and ethanol stresses lead respectively to the identification of 63 and 27 genes/putative promoters whose disruption lead to an increased sensitivity. Among them, 14 genes or putative promoters were common for both stresses. For salt, acid and oxidative stresses, respectively 8, 6, and 9 genes or putative promoters were identified as essential for adaptation to these unfavorable conditions, with only three genes common to at least two stresses. Then, RT-qPCR was performed on selected stress response genes identified by mutant screenings in order to evaluate if their expression was modified in response to stresses in the parental strain. Eleven genes (membrane, transposase, chaperone, nucleotide and carbohydrate metabolism, and hypothetical protein genes were upregulated during stress adaptation for at least two stresses. Seven genes, encoding membrane functions, were upregulated in response to a specific stress and thus could represent potential transcriptomic biomarkers

  3. Radiological findings of male urethral duplication associated with bladder duplication: case report

    International Nuclear Information System (INIS)

    Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae

    2004-01-01

    Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication

  4. A genome-wide RNAi screen to dissect centriole duplication and centrosome maturation in Drosophila.

    Directory of Open Access Journals (Sweden)

    Jeroen Dobbelaere

    2008-09-01

    Full Text Available Centrosomes comprise a pair of centrioles surrounded by an amorphous pericentriolar material (PCM. Here, we have performed a microscopy-based genome-wide RNA interference (RNAi screen in Drosophila cells to identify proteins required for centriole duplication and mitotic PCM recruitment. We analysed 92% of the Drosophila genome (13,059 genes and identified 32 genes involved in centrosome function. An extensive series of secondary screens classified these genes into four categories: (1 nine are required for centriole duplication, (2 11 are required for centrosome maturation, (3 nine are required for both functions, and (4 three genes regulate centrosome separation. These 32 hits include several new centrosomal components, some of which have human homologs. In addition, we find that the individual depletion of only two proteins, Polo and Centrosomin (Cnn can completely block centrosome maturation. Cnn is phosphorylated during mitosis in a Polo-dependent manner, suggesting that the Polo-dependent phosphorylation of Cnn initiates centrosome maturation in flies.

  5. Gestational diabetes mellitus epigenetically affects genes predominantly involved in metabolic diseases

    Science.gov (United States)

    Ruchat, Stephanie-May; Houde, Andrée-Anne; Voisin, Grégory; St-Pierre, Julie; Perron, Patrice; Baillargeon, Jean-Patrice; Gaudet, Daniel; Hivert, Marie-France; Brisson, Diane; Bouchard, Luigi

    2013-01-01

    Offspring exposed to gestational diabetes mellitus (GDM) have an increased risk for chronic diseases, and one promising mechanism for fetal metabolic programming is epigenetics. Therefore, we postulated that GDM exposure impacts the offspring’s methylome and used an epigenomic approach to explore this hypothesis. Placenta and cord blood samples were obtained from 44 newborns, including 30 exposed to GDM. Women were recruited at first trimester of pregnancy and followed until delivery. GDM was assessed after a 75-g oral glucose tolerance test at 24–28 weeks of pregnancy. DNA methylation was measured at > 485,000 CpG sites (Infinium HumanMethylation450 BeadChips). Ingenuity Pathway Analysis was conducted to identify metabolic pathways epigenetically affected by GDM. Our results showed that 3,271 and 3,758 genes in placenta and cord blood, respectively, were potentially differentially methylated between samples exposed or not to GDM (p-values down to 1 × 10−06; none reached the genome-wide significance levels), with more than 25% (n = 1,029) being common to both tissues. Mean DNA methylation differences between groups were 5.7 ± 3.2% and 3.4 ± 1.9% for placenta and cord blood, respectively. These genes were likely involved in the metabolic diseases pathway (up to 115 genes (11%), p-values for pathways = 1.9 × 10−13 < p < 4.0 × 10−03; including diabetes mellitus p = 4.3 × 10−11). Among the differentially methylated genes, 326 in placenta and 117 in cord blood were also associated with newborn weight. Our results therefore suggest that GDM has epigenetic effects on genes preferentially involved in the metabolic diseases pathway, with consequences on fetal growth and development, and provide supportive evidence that DNA methylation is involved in fetal metabolic programming. PMID:23975224

  6. UFO: an Arabidopsis gene involved in both floral meristem and floral organ development.

    Science.gov (United States)

    Levin, J Z; Meyerowitz, E M

    1995-05-01

    We describe the role of the UNUSUAL FLORAL ORGANS (UFO) gene in Arabidopsis floral development based on a genetic and molecular characterization of the phenotypes of nine ufo alleles. UFO is required for the proper identity of the floral meristem and acts in three different aspects of the process that distinguishes flowers from shoots. UFO is involved in establishing the whorled pattern of floral organs, controlling the determinacy of the floral meristem, and activating the APETALA3 and PISTILLATA genes required for petal and stamen identity. In many respects, UFO acts in a manner similar to LEAFY, but the ufo mutant phenotype also suggests an additional role for UFO in defining boundaries within the floral primordia or controlling cell proliferation during floral organ growth. Finally, genetic interactions that prevent flower formation and lead to the generation of filamentous structures implicate UFO as a member of a new, large, and diverse class of genes in Arabidopsis necessary for flower formation.

  7. Association analysis of schizophrenia on 18 genes involved in neuronal migration

    DEFF Research Database (Denmark)

    Kähler, Anna K; Djurovic, Srdjan; Kulle, Bettina

    2008-01-01

    Several lines of evidence support the theory of schizophrenia (SZ) being a neurodevelopmental disorder. The structural, cytoarchitectural and functional brain abnormalities reported in patients with SZ, might be due to aberrant neuronal migration, since the final position of neurons affects...... neuronal function, morphology, and formation of synaptic connections. We have investigated the putative association between SZ and gene variants engaged in the neuronal migration process, by performing an association study on 839 cases and 1,473 controls of Scandinavian origin. Using a gene-wide approach...... significant. Further studies in independent samples are needed, including upcoming genome wide association study results, but our data suggest that MDGA1 is a new SZ susceptibility gene, and that altered neuronal migration is involved in SZ pathology....

  8. Association analysis of schizophrenia on 18 genes involved in neuronal migration

    DEFF Research Database (Denmark)

    Kähler, Anna K; Djurovic, Srdjan; Kulle, Bettina

    2008-01-01

    , tagSNPs in 18 candidate genes have been genotyped, with gene products involved in the neuron-to-glial cell adhesion, interactions with the DISC1 protein and/or rearrangements of the cytoskeleton. Of the 289 markers tested, 19 markers located in genes MDGA1, RELN, ITGA3, DLX1, SPARCL1, and ASTN1......, attained nominal significant P-values (P glial cells. Eight markers obtained nominal significance in both tests, and were located......Several lines of evidence support the theory of schizophrenia (SZ) being a neurodevelopmental disorder. The structural, cytoarchitectural and functional brain abnormalities reported in patients with SZ, might be due to aberrant neuronal migration, since the final position of neurons affects...

  9. Identification of genes involved in the biology of atypical teratoid/rhabdoid tumours using Drosophila melanogaster

    Science.gov (United States)

    Jeibmann, Astrid; Eikmeier, Kristin; Linge, Anna; Kool, Marcel; Koos, Björn; Schulz, Jacqueline; Albrecht, Stefanie; Bartelheim, Kerstin; Frühwald, Michael C.; Pfister, Stefan M.; Paulus, Werner; Hasselblatt, Martin

    2014-06-01

    Atypical teratoid/rhabdoid tumours (AT/RT) are malignant brain tumours. Unlike most other human brain tumours, AT/RT are characterized by inactivation of one single gene, SMARCB1. SMARCB1 is a member of the evolutionarily conserved SWI/SNF chromatin remodelling complex, which has an important role in the control of cell differentiation and proliferation. Little is known, however, about the pathways involved in the oncogenic effects of SMARCB1 inactivation, which might also represent targets for treatment. Here we report a comprehensive genetic screen in the fruit fly that revealed several genes not yet associated with loss of snr1, the Drosophila homologue of SMARCB1. We confirm the functional role of identified genes (including merlin, kibra and expanded, known to regulate hippo signalling pathway activity) in human rhabdoid tumour cell lines and AT/RT tumour samples. These results demonstrate that fly models can be employed for the identification of clinically relevant pathways in human cancer.

  10. Identification of Genes Involved in Pseudomonas aeruginosa Biofilm-Specific Resistance to Antibiotics

    OpenAIRE

    Zhang, Li; Fritsch, Meredith; Hammond, Lisa; Landreville, Ryan; Slatculescu, Cristina; Colavita, Antonio; Mah, Thien-Fah

    2013-01-01

    Pseudomonas aeruginosa is a key opportunistic pathogen characterized by its biofilm formation ability and high-level multiple antibiotic resistance. By screening a library of random transposon insertion mutants with an increased biofilm-specifc antibiotic susceptibility, we previously identified 3 genes or operons of P. aeruginosa UCBPP-PA14 (ndvB, PA1875-1877 and tssC1) that do not affect biofilm formation but are involved in biofilm-specific antibiotic resistance. In this study, we demonstr...

  11. Identification of Listeria monocytogenes Genes Involved in Salt and Alkaline-pH Tolerance

    OpenAIRE

    Gardan, Rozenn; Cossart, Pascale; Labadie, Jean

    2003-01-01

    The capacity of Listeria monocytogenes to tolerate salt and alkaline stresses is of particular importance, as this pathogen is often exposed to such environments during food processing and food preservation. We screened a library of Tn917-lacZ insertional mutants in order to identify genes involved in salt and/or alkaline tolerance. We isolated six mutants sensitive to salt stress and 12 mutants sensitive to salt and alkaline stresses. The position of the insertion of the transposon was locat...

  12. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  13. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus

    2011-01-01

    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic ...

  14. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus

    2011-01-01

    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic...

  15. Polymorphisms of genes involved in polycyclic aromatic hydrocarbons' biotransformation and atherosclerosis.

    Science.gov (United States)

    Marinković, Natalija; Pasalić, Daria; Potocki, Slavica

    2013-01-01

    Polycyclic aromatic hydrocarbons (PAHs) are among the most prevalent environmental pollutants and result from the incomplete combustion of hydrocarbons (coal and gasoline, fossil fuel combustion, byproducts of industrial processing, natural emission, cigarette smoking, etc.). The first phase of xenobiotic biotransformation in the PAH metabolism includes activities of cytochrome P450 from the CYP1 family and microsomal epoxide hydrolase. The products of this biotransformation are reactive oxygen species that are transformed in the second phase through the formation of conjugates with glutathione, glucuronate or sulphates. PAH exposure may lead to PAH-DNA adduct formation or induce an inflammatory atherosclerotic plaque phenotype. Several genetic polymorphisms of genes encoded for enzymes involved in PAH biotransformation have been proven to lead to the development of diseases. Enzyme CYP P450 1A1, which is encoded by the CYP1A1 gene, is vital in the monooxygenation of lipofilic substrates, while GSTM1 and GSTT1 are the most abundant isophorms that conjugate and neutralize oxygen products. Some single nucleotide polymorphisms of the CYP1A1 gene as well as the deletion polymorphisms of GSTT1 and GSTM1 may alter the final specific cellular inflammatory respond. Occupational exposure or conditions from the living environment can contribute to the production of PAH metabolites with adverse effects on human health. The aim of this study was to obtain data on biotransformation and atherosclerosis, as well as data on the gene polymorphisms involved in biotransformation, in order to better study gene expression and further elucidate the interaction between genes and the environment.

  16. Identification of Host Genes Involved in Geminivirus Infection Using a Reverse Genetics Approach

    Science.gov (United States)

    Luna, Ana P.; Bejarano, Eduardo R.

    2011-01-01

    Geminiviruses, like all viruses, rely on the host cell machinery to establish a successful infection, but the identity and function of these required host proteins remain largely unknown. Tomato yellow leaf curl Sardinia virus (TYLCSV), a monopartite geminivirus, is one of the causal agents of the devastating Tomato yellow leaf curl disease (TYLCD). The transgenic 2IRGFP N. benthamiana plants, used in combination with Virus Induced Gene Silencing (VIGS), entail an important potential as a tool in reverse genetics studies to identify host factors involved in TYLCSV infection. Using these transgenic plants, we have made an accurate description of the evolution of TYLCSV replication in the host in both space and time. Moreover, we have determined that TYLCSV and Tobacco rattle virus (TRV) do not dramatically influence each other when co-infected in N. benthamiana, what makes the use of TRV-induced gene silencing in combination with TYLCSV for reverse genetic studies feasible. Finally, we have tested the effect of silencing candidate host genes on TYLCSV infection, identifying eighteen genes potentially involved in this process, fifteen of which had never been implicated in geminiviral infections before. Seven of the analyzed genes have a potential anti-viral effect, whereas the expression of the other eleven is required for a full infection. Interestingly, almost half of the genes altering TYLCSV infection play a role in postranslational modifications. Therefore, our results provide new insights into the molecular mechanisms underlying geminivirus infections, and at the same time reveal the 2IRGFP/VIGS system as a powerful tool for functional reverse genetics studies. PMID:21818318

  17. Positional cloning of genes involved in the Beckwith-Wiedemann syndrome, hemihypertrophy, and associated childhood tumors.

    Science.gov (United States)

    Mannens, M; Alders, M; Redeker, B; Bliek, J; Steenman, M; Wiesmeyer, C; de Meulemeester, M; Ryan, A; Kalikin, L; Voûte, T; De Kraker, J; Hoovers, J; Slater, R; Feinberg, A; Little, P; Westerveld, A

    1996-11-01

    The Beckwith-Wiedemann syndrome (BWS) is an overgrowth malformation syndrome that occurs with an incidence of 1:13,700 births. There is a striking incidence of childhood tumors found in BWS patients. Various lines of investigation have localized "imprinted" genes involved in BWS and associated childhood tumors to 11p15. High resolution mapping of 8 rare balanced chromosomal BWS rearrangements enabled us to identify three distinct regions on chromosome 11p15 that might harbor genes involved in the above-mentioned disorders. These results suggest genetic heterogeneity that correlates with the clinical heterogeneity seen in the patients studied. Expressed candidate gene sequences from these regions have been cloned and partly sequenced. These transcripts are either disrupted by or are at least within a few kb of these BWS chromosome breakpoints. So far, zinc-finger sequences and one Kruppel-associated box (KRAB) domain were found in independent candidate genes which are compatible with a regulating function of growth promoting genes. The abundance of expression of these genes varies from low abundant in all adult and fetal tissues tested to detectable on Northern blots of adult tissues. In addition to our 11p15 studies we have analyzed additional chromosome regions, in particular 1p. Cytogenetic, loss of heterozygosity (LOH) and comparative genomic hybridization (CGH) studies have identified 1p35 as a region of interest. A positional cloning effort to identify a balanced 1p35 translocation found in a Wilms tumor has led to the isolation of a YAC, crossing this breakpoint.

  18. Polymorphisms of genes involved in polycyclic aromatic hydrocarbons’ biotransformation and atherosclerosis

    Science.gov (United States)

    Marinković, Natalija; Pašalić, Daria; Potočki, Slavica

    2013-01-01

    Polycyclic aromatic hydrocarbons (PAHs) are among the most prevalent environmental pollutants and result from the incomplete combustion of hydrocarbons (coal and gasoline, fossil fuel combustion, byproducts of industrial processing, natural emission, cigarette smoking, etc.). The first phase of xenobiotic biotransformation in the PAH metabolism includes activities of cytochrome P450 from the CYP1 family and microsomal epoxide hydrolase. The products of this biotransformation are reactive oxygen species that are transformed in the second phase through the formation of conjugates with glutathione, glucuronate or sulphates. PAH exposure may lead to PAH-DNA adduct formation or induce an inflammatory atherosclerotic plaque phenotype. Several genetic polymorphisms of genes encoded for enzymes involved in PAH biotransformation have been proven to lead to the development of diseases. Enzyme CYP P450 1A1, which is encoded by the CYP1A1 gene, is vital in the monooxygenation of lipofilic substrates, while GSTM1 and GSTT1 are the most abundant isophorms that conjugate and neutralize oxygen products. Some single nucleotide polymorphisms of the CYP1A1 gene as well as the deletion polymorphisms of GSTT1 and GSTM1 may alter the final specific cellular inflammatory respond. Occupational exposure or conditions from the living environment can contribute to the production of PAH metabolites with adverse effects on human health. The aim of this study was to obtain data on biotransformation and atherosclerosis, as well as data on the gene polymorphisms involved in biotransformation, in order to better study gene expression and further elucidate the interaction between genes and the environment. PMID:24266295

  19. Comparative Transcriptome Analysis Identifies Putative Genes Involved in the Biosynthesis of Xanthanolides in Xanthium strumarium L.

    Directory of Open Access Journals (Sweden)

    Yuanjun Li

    2016-08-01

    Full Text Available Xanthium strumarium L. is a traditional Chinese herb belonging to the Asteraceae family. The major bioactive components of this plant are sesquiterpene lactones, which include the xanthanolides. To date, the biogenesis of xanthanolides, especiallytheir downstream pathway, remains largely unknown. In X. strumarium, xanthanolides primarily accumulate in its glandular trichomes. To identify putative gene candidates involved in the biosynthesis of xanthanolides, three X. strumarium transcriptomes, which were derived from the young leaves of two different cultivars and the purified glandular trichomes from one of the cultivars, were constructed in this study. In total, 157 million clean reads were generated and assembled into 91,861 unigenes, of which 59,858 unigenes were successfully annotated. All the genes coding for known enzymes in the upstream pathway to the biosynthesis of xanthanolides were present in the X. strumarium transcriptomes. From a comparative analysis of the X. strumarium transcriptomes, this study identified a number of gene candidates that are putatively involved in the downstream pathway to the synthesis of xanthanolides, such as four unigenes encoding CYP71 P450s, 50 unigenes for dehydrogenases, and 27 genes for acetyltransferases. The possible functions of these four CYP71 candidates are extensively discussed. In addition, 116 transcription factors that were highly expressed in X. strumarium glandular trichomes were also identified. Their possible regulatory roles in the biosynthesis of sesquiterpene lactones are discussed. The global transcriptomic data for X. strumarium should provide a valuable resource for further research into the biosynthesis of xanthanolides.

  20. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy

    2010-06-01

    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  1. Identification of Pseudomonas aeruginosa Genes Involved in Virulence and Anaerobic Growth

    Science.gov (United States)

    Filiatrault, Melanie J.; Picardo, Kristin F.; Ngai, Helen; Passador, Luciano; Iglewski, Barbara H.

    2006-01-01

    Pseudomonas aeruginosa is a gram-negative, opportunistic pathogen and a significant cause of acute and chronic infections in patients with compromised host defenses. Evidence suggests that within infections P. aeruginosa encounters oxygen limitation and exists in microbial aggregates known as biofilms. However, there is little information that describes genes involved in anaerobic growth of P. aeruginosa and their association with virulence of this pathogen. To identify genes required for anaerobic growth, random transposon (Tn) mutagenesis was used to screen for mutants that demonstrated the inability to grow anaerobically using nitrate as a terminal electron acceptor. Of approximately 35,000 mutants screened, 57 mutants were found to exhibit no growth anaerobically using nitrate. Identification of the genes disrupted by the Tn revealed 24 distinct loci required for anaerobic growth on nitrate, including several genes not previously associated with anaerobic growth of P. aeruginosa. Several of these mutants were capable of growing anaerobically using nitrite and/or arginine, while five mutants were unable to grow anaerobically under any of the conditions tested. Three mutants were markedly attenuated in virulence in the lettuce model of P. aeruginosa infection. These studies have identified novel genes important for anaerobic growth and demonstrate that anaerobic metabolism influences virulence of P. aeruginosa. PMID:16790798

  2. Transcriptomic analysis illuminates genes involved in chlorophyll synthesis after nitrogen starvation in Acaryochloris sp. CCMEE 5410.

    Science.gov (United States)

    Yoneda, Aki; Wittmann, Bruce J; King, Jeremy D; Blankenship, Robert E; Dantas, Gautam

    2016-08-01

    Acaryochloris species are a genus of cyanobacteria that utilize chlorophyll (chl) d as their primary chlorophyll molecule during oxygenic photosynthesis. Chl d allows Acaryochloris to harvest red-shifted light, which gives them the ability to live in filtered light environments that are depleted in visible light. Although genomes of multiple Acaryochloris species have been sequenced, their analysis has not revealed how chl d is synthesized. Here, we demonstrate that Acaryochloris sp. CCMEE 5410 cells undergo chlorosis by nitrogen depletion and exhibit robust regeneration of chl d by nitrogen repletion. We performed a time course RNA-Seq experiment to quantify global transcriptomic changes during chlorophyll recovery. We observed upregulation of numerous known chl biosynthesis genes and also identified an oxygenase gene with a similar transcriptional profile as these chl biosynthesis genes, suggesting its possible involvement in chl d biosynthesis. Moreover, our data suggest that multiple prochlorophyte chlorophyll-binding homologs are important during chlorophyll recovery, and light-independent chl synthesis genes are more dominant than the light-dependent gene at the transcription level. Transcriptomic characterization of this organism provides crucial clues toward mechanistic elucidation of chl d biosynthesis.

  3. Modulation of Type III Secretion System in Pseudomonas aeruginosa: Involvement of the PA4857 Gene Product

    Science.gov (United States)

    Zhu, Miao; Zhao, Jingru; Kang, Huaping; Kong, Weina; Zhao, Yuanyu; Wu, Min; Liang, Haihua

    2016-01-01

    Pseudomonas aeruginosa is an opportunistic pathogen that causes serious acute or chronic infections in humans. Acute infections typically involve the type III secretion systems (T3SSs) and bacterial motility, whereas chronic infections are often associated with biofilm formation and the type VI secretion system. To identify new genes required for pathogenesis, a transposon mutagenesis library was constructed and the gene PA4857, named tspR, was found to modulate T3SS gene expression. Deletion of P. aeruginosa tspR reduced the virulence in a mouse acute lung infection model and diminished cytotoxicity. Suppression of T3SS gene expression in the tspR mutant resulted from compromised translation of the T3SS master regulator ExsA. TspR negatively regulated two small RNAs, RsmY and RsmZ, which control RsmA. Our data demonstrated that defects in T3SS expression and biofilm formation in retS mutant could be partially restored by overexpression of tspR. Taken together, our results demonstrated that the newly identified retS-tspR pathway is coordinated with the retS-gacS system, which regulates the genes associated with acute and chronic infections and controls the lifestyle choice of P. aeruginosa. PMID:26858696

  4. Identification of substituent groups and related genes involved in salecan biosynthesis in Agrobacterium sp. ZX09.

    Science.gov (United States)

    Xu, Linxiang; Cheng, Rui; Li, Jing; Wang, Yang; Zhu, Bin; Ma, Shihong; Zhang, Weiming; Dong, Wei; Wang, Shiming; Zhang, Jianfa

    2017-01-01

    Salecan, a soluble β-1,3-D-glucan produced by a salt-tolerant strain Agrobacterium sp. ZX09, has been the subject of considerable interest in recent years because of its multiple bioactivities and unusual rheological properties in solution. In this study, both succinyl and pyruvyl substituent groups on salecan were identified by an enzymatic hydrolysis following nuclear magnetic resonance (NMR), HPLC, and MS analysis. The putative succinyltransferase gene (sleA) and pyruvyltransferase gene (sleV) were determined and cloned. Disruption of the sleA gene resulted in the absence of succinyl substituent groups on salecan. This defect could be complemented by expressing the sleA cloned in a plasmid. Thus, the sleA and sleV genes located in a 19.6-kb gene cluster may be involved in salecan biosynthesis. Despite the lack of succinyl substituents, the molecular mass of salecan generated by the sleA mutant did not substantially differ from that generated by the wild-type strain. Loss of succinyl substituents on salecan changed its rheological characteristics, especially a decrease in intrinsic viscosity.

  5. Involvement of the Gli3 (Extra-Toes Gene Region in Body Weight in Mice

    Directory of Open Access Journals (Sweden)

    Benoît Martin

    2007-01-01

    Full Text Available The mutation extra-toes (Gli3Xt-J on chromosome (Chr 13 of the mouse is known to be involved in the development of the skeleton. The only visible manifestation is the presence of an extra digit on each hind foot. Here we report evidence from several experiments that Gli3XtJ/+ mice weigh more than littermate Gli3+/+ mice, suggesting an effect on body weight of Gli3 or of a gene tightly linked to it on Chr 13. Four independent experiments in different environments were conducted on mice with different genetic backgrounds derived from the C3XtEso Gli3Xt-J/+ Eso/+ linkage testing strain and the JE/Le strain at adult age. The analyses have shown an association between the Gli3Xt-J allele and a body weight increase of about 6.5%. This effect is genetically dominant. It would appear that if the gene of interest is not Gli3 itself, it must be very close to this locus. Indeed, the expected size for this fragment is 7.9 ± 5.3 cM. The manifestation of this gene, observed in two animal facilities and on different genetic backgrounds, is consistent with the idea that the effect of the gene(s is displayed in a stable manner. It accounts for a variation of 6.5% of body weight.

  6. Identification of genes involved in the drought adaptation and recovery in Portulaca oleracea by differential display.

    Science.gov (United States)

    D'Andrea, Rodrigo Matías; Triassi, Agustina; Casas, María Isabel; Andreo, Carlos Santiago; Lara, María Valeria

    2015-05-01

    Portulaca oleracea is one of the richest plant sources of ω-3 and ω-6 fatty acids and other compounds potentially valuable for nutrition. It is broadly established in arid, semiarid and well-watered fields, thus making it a promising candidate for research on abiotic stress resistance mechanisms. It is capable of withstanding severe drought and then of recovering upon rehydration. Here, the adaptation to drought and the posterior recovery was evaluated at transcriptomic level by differential display validated by qRT-PCR. Of the 2279 transcript-derived fragments amplified, 202 presented differential expression. Ninety of them were successfully isolated and sequenced. Selected genes were tested against different abiotic stresses in P. oleracea and the behavior of their orthologous genes in Arabidopsis thaliana was also explored to seek for conserved response mechanisms. In drought adapted and in recovered plants changes in expression of many protein metabolism-, lipid metabolism- and stress-related genes were observed. Many genes with unknown function were detected, which also respond to other abiotic stresses. Some of them are also involved in the seed desiccation/imbibition process and thus would be of great interest for further research. The potential use of candidate genes to engineer drought tolerance improvement and recovery is discussed. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  7. TBK1 duplication is found in normal tension and not in high tension ...

    Indian Academy of Sciences (India)

    Duplication in TANK-binding kinase 1 (TBK1) gene has been shown to be associated with normal tension glaucoma. (NTG), a subtype of the neurodegenerative disease glau- coma, which is the largest cause of irreversible blindness. A specific Taqman assay was used in exploring the genetic contribution of the duplication ...

  8. Characterization of Aldehyde Oxidase (AO Genes Involved in the Accumulation of Carotenoid Pigments in Wheat Grain

    Directory of Open Access Journals (Sweden)

    Pasqualina Colasuonno

    2017-05-01

    Full Text Available Aldehyde Oxidase (AO enzyme (EC 1.2.3.1 catalyzes the final steps of carotenoid catabolism and it is a key enzyme in the abscisic acid (ABA biosynthesis. AO isoforms are located in the cytosolic compartment of tissues in many plants, where induce the oxidation of aldehydes into carboxylic acid, and in addition, catalyze the hydroxylation of some heterocycles. The goal of the present study was to characterize the AO genes involved in the accumulation of carotenoid pigments in wheat grain, an important quantitative trait controlled by multiple genes. The cDNAs corresponding to the four AO isoforms from Arabidopsis thaliana and five AO isoforms from Brachypodium distachyon were used as query in 454 sequence assemblies data for Triticum aestivum cv. Chinese Spring (https://urgi.versailles.inra.fr/blast/blast.php to obtain the partial or whole orthologous wheat AO sequences. Three wheat isoforms, designated AO1, AO2, and AO3 were located on the chromosome groups 2, 5, and 7, respectively, and mapped on two consensus wheat maps by SNP markers located within the AO gene sequences. To validate the possible relationships between AO3 genes and carotenoid accumulation in wheat, the expression levels of AO-A3 and AO-B3 gene were determined during the kernel maturation stage of two durum wheat cultivars, Ciccio and Svevo, characterized by a low and high carotenoid content, respectively. Different AO-A3 gene expression values were observed between the two cultivars indicating that the AO-A3 allele present in Ciccio was more active in carotenoid degradation. A gene marker was developed and can be used for marker-assisted selection in wheat breeding programs.

  9. Transcriptomic analysis using olive varieties and breeding progenies identify candidate genes involved in plant architecture

    Directory of Open Access Journals (Sweden)

    Juan José eGonzález Plaza

    2016-03-01

    Full Text Available Plant architecture is a critical trait in fruit crops that can significantly influence yield, pruning, planting density and harvesting. Little is known about how plant architecture is genetically determined in olive, were most of the existing varieties are traditional with an architecture poorly suited for modern growing and harvesting systems. In the present study, we have carried out microarray analysis of meristematic tissue to compare expression profiles of olive varieties displaying differences in architecture, as well as seedlings from their cross pooled on the basis of their sharing architecture-related phenotypes. The microarray used, previously developed by our group has already been applied to identify candidates genes involved in regulating juvenile to adult transition in the shoot apex of seedlings. Varieties with distinct architecture phenotypes and individuals from segregating progenies displaying opposite architecture features were used to link phenotype to expression. Here, we identify 2,252 differentially expressed genes associated to differences in plant architecture. Microarray results were validated by quantitative RT-PCR carried out on genes with functional annotation likely related to plant architecture. Twelve of these genes were further analyzed in individual seedlings of the corresponding pool. We also examined Arabidopsis mutants in putative orthologs of these targeted candidate genes, finding altered architecture for most of them. This supports a functional conservation between species and potential biological relevance of the candidate genes identified. This study is the first to identify genes associated to plant architecture in olive, and the results obtained could be of great help in future programs aimed at selecting phenotypes adapted to modern cultivation practices in this species.

  10. Characterization of Aldehyde Oxidase (AO) Genes Involved in the Accumulation of Carotenoid Pigments in Wheat Grain.

    Science.gov (United States)

    Colasuonno, Pasqualina; Marcotuli, Ilaria; Lozito, Maria L; Simeone, Rosanna; Blanco, Antonio; Gadaleta, Agata

    2017-01-01

    Aldehyde Oxidase (AO) enzyme (EC 1.2.3.1) catalyzes the final steps of carotenoid catabolism and it is a key enzyme in the abscisic acid (ABA) biosynthesis. AO isoforms are located in the cytosolic compartment of tissues in many plants, where induce the oxidation of aldehydes into carboxylic acid, and in addition, catalyze the hydroxylation of some heterocycles. The goal of the present study was to characterize the AO genes involved in the accumulation of carotenoid pigments in wheat grain, an important quantitative trait controlled by multiple genes. The cDNAs corresponding to the four AO isoforms from Arabidopsis thaliana and five AO isoforms from Brachypodium distachyon were used as query in 454 sequence assemblies data for Triticum aestivum cv. Chinese Spring (https://urgi.versailles.inra.fr/blast/blast.php) to obtain the partial or whole orthologous wheat AO sequences. Three wheat isoforms, designated AO1, AO2 , and AO3 were located on the chromosome groups 2, 5, and 7, respectively, and mapped on two consensus wheat maps by SNP markers located within the AO gene sequences. To validate the possible relationships between AO3 genes and carotenoid accumulation in wheat, the expression levels of AO-A3 and AO-B3 gene were determined during the kernel maturation stage of two durum wheat cultivars, Ciccio and Svevo, characterized by a low and high carotenoid content, respectively. Different AO-A3 gene expression values were observed between the two cultivars indicating that the AO-A3 allele present in Ciccio was more active in carotenoid degradation. A gene marker was developed and can be used for marker-assisted selection in wheat breeding programs.

  11. Transcriptomic Analysis Using Olive Varieties and Breeding Progenies Identifies Candidate Genes Involved in Plant Architecture.

    Science.gov (United States)

    González-Plaza, Juan J; Ortiz-Martín, Inmaculada; Muñoz-Mérida, Antonio; García-López, Carmen; Sánchez-Sevilla, José F; Luque, Francisco; Trelles, Oswaldo; Bejarano, Eduardo R; De La Rosa, Raúl; Valpuesta, Victoriano; Beuzón, Carmen R

    2016-01-01

    Plant architecture is a critical trait in fruit crops that can significantly influence yield, pruning, planting density and harvesting. Little is known about how plant architecture is genetically determined in olive, were most of the existing varieties are traditional with an architecture poorly suited for modern growing and harvesting systems. In the present study, we have carried out microarray analysis of meristematic tissue to compare expression profiles of olive varieties displaying differences in architecture, as well as seedlings from their cross pooled on the basis of their sharing architecture-related phenotypes. The microarray used, previously developed by our group has already been applied to identify candidates genes involved in regulating juvenile to adult transition in the shoot apex of seedlings. Varieties with distinct architecture phenotypes and individuals from segregating progenies displaying opposite architecture features were used to link phenotype to expression. Here, we identify 2252 differentially expressed genes (DEGs) associated to differences in plant architecture. Microarray results were validated by quantitative RT-PCR carried out on genes with functional annotation likely related to plant architecture. Twelve of these genes were further analyzed in individual seedlings of the corresponding pool. We also examined Arabidopsis mutants in putative orthologs of these targeted candidate genes, finding altered architecture for most of them. This supports a functional conservation between species and potential biological relevance of the candidate genes identified. This study is the first to identify genes associated to plant architecture in olive, and the results obtained could be of great help in future programs aimed at selecting phenotypes adapted to modern cultivation practices in this species.

  12. Gene-environment interaction involving recently identified colorectal cancer susceptibility loci

    Science.gov (United States)

    Kantor, Elizabeth D.; Hutter, Carolyn M.; Minnier, Jessica; Berndt, Sonja I.; Brenner, Hermann; Caan, Bette J.; Campbell, Peter T.; Carlson, Christopher S.; Casey, Graham; Chan, Andrew T.; Chang-Claude, Jenny; Chanock, Stephen J.; Cotterchio, Michelle; Du, Mengmeng; Duggan, David; Fuchs, Charles S.; Giovannucci, Edward L.; Gong, Jian; Harrison, Tabitha A.; Hayes, Richard B.; Henderson, Brian E.; Hoffmeister, Michael; Hopper, John L.; Jenkins, Mark A.; Jiao, Shuo; Kolonel, Laurence N.; Le Marchand, Loic; Lemire, Mathieu; Ma, Jing; Newcomb, Polly A.; Ochs-Balcom, Heather M.; Pflugeisen, Bethann M.; Potter, John D.; Rudolph, Anja; Schoen, Robert E.; Seminara, Daniela; Slattery, Martha L.; Stelling, Deanna L.; Thomas, Fridtjof; Thornquist, Mark; Ulrich, Cornelia M.; Warnick, Greg S.; Zanke, Brent W.; Peters, Ulrike; Hsu, Li; White, Emily

    2014-01-01

    BACKGROUND Genome-wide association studies have identified several single nucleotide polymorphisms (SNPs) that are associated with risk of colorectal cancer (CRC). Prior research has evaluated the presence of gene-environment interaction involving the first 10 identified susceptibility loci, but little work has been conducted on interaction involving SNPs at recently identified susceptibility loci, including: rs10911251, rs6691170, rs6687758, rs11903757, rs10936599, rs647161, rs1321311, rs719725, rs1665650, rs3824999, rs7136702, rs11169552, rs59336, rs3217810, rs4925386, and rs2423279. METHODS Data on 9160 cases and 9280 controls from the Genetics and Epidemiology of Colorectal Cancer Consortium (GECCO) and Colon Cancer Family Registry (CCFR) were used to evaluate the presence of interaction involving the above-listed SNPs and sex, body mass index (BMI), alcohol consumption, smoking, aspirin use, post-menopausal hormone (PMH) use, as well as intake of dietary calcium, dietary fiber, dietary folate, red meat, processed meat, fruit, and vegetables. Interaction was evaluated using a fixed-effects meta-analysis of an efficient Empirical Bayes estimator, and permutation was used to account for multiple comparisons. RESULTS None of the permutation-adjusted p-values reached statistical significance. CONCLUSIONS The associations between recently identified genetic susceptibility loci and CRC are not strongly modified by sex, BMI, alcohol, smoking, aspirin, PMH use, and various dietary factors. IMPACT Results suggest no evidence of strong gene-environment interactions involving the recently identified 16 susceptibility loci for CRC taken one at a time. PMID:24994789

  13. Gastric Duplication Cyst: A Rare Congenital Disease Often Misdiagnosed in Adults

    Directory of Open Access Journals (Sweden)

    Jessica Falleti

    2013-01-01

    Full Text Available Gastrointestinal duplication is a rare congenital disease which affected more commonly the ileum, while the stomach is rarely involved. Generally diagnosed in paediatric or young age, it could be difficult to suspect a gastrointestinal duplication in adults. Herein, we report a 55-year-old male with a gastric duplication cyst found on routinely checkup for chronic hepatitis and first misdiagnosed as a gastrointestinal stromal tumor (GIST; we also discuss its embryology.

  14. [Acute abdomen caused by infected duodenal duplication].

    Science.gov (United States)

    Gonzálvez Piñera, J; Fernández Córdoba, M S; Hernández Anselmi, E

    2008-07-01

    Infected cystic duplications of the duodenum are unusual lesions. We report two cases of duodenal duplications complicated by infection. The literature is reviewed, and the diagnostic modalities and management options for this unusual pathology are discussed.

  15. Genes and genetic variations involved in the development of hypertension: focusing on a Greek patient cohort.

    Science.gov (United States)

    Kouremenos, Nikolaos; Zacharopoulou, Ioanna V; Triantafyllidi, Helen; Zacharopoulos, Georgios V; Mornos, Cristian; Filippatos, Gerasimos; Lekakis, John; Kremastinos, Dimitrios; Manolis, Athanasios I; Gavras, Haralambos

    2014-01-01

    Essential hypertension (HTN) is a multifactorial disease involving environmental, genetic and other factors. Over the past years, genetic studies of essential HTN have increased dramatically but the molecular mechanisms involved are still unknown. As part of a research program coordinated by Boston university (USA), we studied the role of various genes and single nucleotide polymorphisms (SNPs) in the inheritance or the onset of HTN in African-American, Caucasian-American and Greek families. Among 128 Greek families with a history of HTN, we studied 1474 people. Of the total examined, 273 men and 286 women were hypertensive. Based on 410 DNA samples from the hypertensive subjects, different SNPs were examined. An overall meta-analysis of the results from the Greek families, as well as a comparison with the 2 other groups (African-Americans and Caucasian-Americans), was performed. We report SNPs that are associated with the inheritance of HTN and are located either at the promoters of N-methyltransferase and catalase genes, or within the coding region of NEDD4L ubiquitin ligase gene, or SNPs in mitochondrial DNA of hypertensive probands. Furthermore, we clarified the role of hereditary predisposition in the development of HTN, showing that the presence of maternal HTN was significantly higher in African-Americans and Greeks compared to Caucasian-Americans (81.7%, 84.8%, and 65%), while the paternal HTN showed no such difference (50%, 48.3% and 44.9%), respectively. Although genetic factors that were correlated with HTN were identified, it was not possible to identify a single gene that should be targeted for the treatment of HTN. Nevertheless, the important role of the maternal hereditary predisposition to HTN in the Greek patients and the responsible genetic factors involved should be further examined.

  16. Expanding the MTM1 mutational spectrum: novel variants including the first multi-exonic duplication and development of a locus-specific database.

    Science.gov (United States)

    Oliveira, Jorge; Oliveira, Márcia E; Kress, Wolfram; Taipa, Ricardo; Pires, Manuel Melo; Hilbert, Pascale; Baxter, Peter; Santos, Manuela; Buermans, Henk; den Dunnen, Johan T; Santos, Rosário

    2013-05-01

    Myotubular myopathy (MIM#310400), the X-linked form of Centronuclear myopathy (CNM) is mainly characterized by neonatal hypotonia and inability to maintain unassisted respiration. The MTM1 gene, responsible for this disease, encodes myotubularin - a lipidic phosphatase involved in vesicle trafficking regulation and maturation. Recently, it was shown that myotubularin interacts with desmin, being a major regulator of intermediate filaments. We report the development of a locus-specific database for MTM1 using the Leiden Open Variation database software (http://www.lovd.nl/MTM1), with data collated for 474 mutations identified in 472 patients (by June 2012). Among the entries are a total of 25 new mutations, including a large deletion encompassing introns 2-15. During database implementation it was noticed that no large duplications had been reported. We tested a group of eight uncharacterized CNM patients for this specific type of mutation, by multiple ligation-dependent probe amplification (MLPA) analysis. A large duplication spanning exons 1-5 was identified in a boy with a mild phenotype, with results pointing toward possible somatic mosaicism. Further characterization revealed that this duplication causes an in-frame deletion at the mRNA level (r.343_444del). Results obtained with a next generation sequencing approach suggested that the duplication extends into the neighboring MAMLD1 gene and subsequent cDNA analysis detected the presence of a MTM1/MAMLD1 fusion transcript. A complex rearrangement involving the duplication of exon 10 has since been reported, with detection also enabled by MLPA analysis. It is thus conceivable that large duplications in MTM1 may account for a number of CNM cases that have remained genetically unresolved.

  17. SETDB1 is involved in postembryonic DNA methylation and gene silencing in Drosophila.

    Directory of Open Access Journals (Sweden)

    Dawei Gou

    2010-05-01

    Full Text Available DNA methylation is fundamental for the stability and activity of genomes. Drosophila melanogaster and vertebrates establish a global DNA methylation pattern of their genome during early embryogenesis. Large-scale analyses of DNA methylation patterns have uncovered revealed that DNA methylation patterns are dynamic rather than static and change in a gene-specific fashion during development and in diseased cells. However, the factors and mechanisms involved in dynamic, postembryonic DNA methylation remain unclear. Methylation of lysine 9 in histone H3 (H3-K9 by members of the Su(var3-9 family of histone methyltransferases (HMTs triggers embryonic DNA methylation in Arthropods and Chordates. Here, we demonstrate that Drosophila SETDB1 (dSETDB1 can mediate DNA methylation and silencing of genes and retrotransposons. We found that dSETDB1 tri-methylates H3-K9 and binds methylated CpA motifs. Tri-methylation of H3-K9 by dSETDB1 mediates recruitment of DNA methyltransferase 2 (Dnmt2 and Su(var205, the Drosophila ortholog of mammalian "Heterochromatin Protein 1", to target genes for dSETDB1. By enlisting Dnmt2 and Su(var205, dSETDB1 triggers DNA methylation and silencing of genes and retrotransposons in Drosophila cells. DSETDB1 is involved in postembryonic DNA methylation and silencing of Rt1b{} retrotransposons and the tumor suppressor gene retinoblastoma family protein 1 (Rb in imaginal discs. Collectively, our findings implicate dSETDB1 in postembryonic DNA methylation, provide a model for silencing of the tumor suppressor Rb, and uncover a role for cell type-specific DNA methylation in Drosophila development.

  18. Expression profiling of Crambe abyssinica under arsenate stress identifies genes and gene networks involved in arsenic metabolism and detoxification

    Directory of Open Access Journals (Sweden)

    Kandasamy Suganthi

    2010-06-01

    Full Text Available Abstract Background Arsenic contamination is widespread throughout the world and this toxic metalloid is known to cause cancers of organs such as liver, kidney, skin, and lung in human. In spite of a recent surge in arsenic related studies, we are still far from a comprehensive understanding of arsenic uptake, detoxification, and sequestration in plants. Crambe abyssinica, commonly known as 'abyssinian mustard', is a non-food, high biomass oil seed crop that is naturally tolerant to heavy metals. Moreover, it accumulates significantly higher levels of arsenic as compared to other species of the Brassicaceae family. Thus, C. abyssinica has great potential to be utilized as an ideal inedible crop for phytoremediation of heavy metals and metalloids. However, the mechanism of arsenic metabolism in higher plants, including C. abyssinica, remains elusive. Results To identify the differentially expressed transcripts and the pathways involved in arsenic metabolism and detoxification, C. abyssinica plants were subjected to arsenate stress and a PCR-Select Suppression Subtraction Hybridization (SSH approach was employed. A total of 105 differentially expressed subtracted cDNAs were sequenced which were found to represent 38 genes. Those genes encode proteins functioning as antioxidants, metal transporters, reductases, enzymes involved in the protein degradation pathway, and several novel uncharacterized proteins. The transcripts corresponding to the subtracted cDNAs showed strong upregulation by arsenate stress as confirmed by the semi-quantitative RT-PCR. Conclusions Our study revealed novel insights into the plant defense mechanisms and the regulation of genes and gene networks in response to arsenate toxicity. The differential expression of transcripts encoding glutathione-S-transferases, antioxidants, sulfur metabolism, heat-shock proteins, metal transporters, and enzymes in the ubiquitination pathway of protein degradation as well as several unknown

  19. Contrasted patterns of selective pressure in three recent paralogous gene pairs in the Medicago genus (L.

    Directory of Open Access Journals (Sweden)

    Ho-Huu Joan

    2012-10-01

    Full Text Available Abstract Background Gene duplications are a molecular mechanism potentially mediating generation of functional novelty. However, the probabilities of maintenance and functional divergence of duplicated genes are shaped by selective pressures acting on gene copies immediately after the duplication event. The ratio of non-synonymous to synonymous substitution rates in protein-coding sequences provides a means to investigate selective pressures based on genic sequences. Three molecular signatures can reveal early stages of functional divergence between gene copies: change in the level of purifying selection between paralogous genes, occurrence of positive selection, and transient relaxed purifying selection following gene duplication. We studied three pairs of genes that are known to be involved in an interaction with symbiotic bacteria and were recently duplicated in the history of the Medicago genus (Fabaceae. We sequenced two pairs of polygalacturonase genes (Pg11-Pg3 and Pg11a-Pg11c and one pair of auxine transporter-like genes (Lax2-Lax4 in 17 species belonging to the Medicago genus, and sought for molecular signatures of differentiation between copies. Results Selective histories revealed by these three signatures of molecular differentiation were found to be markedly different between each pair of paralogs. We found sites under positive selection in the Pg11 paralogs while Pg3 has mainly evolved under purifying selection. The most recent paralogs examined Pg11a and Pg11c, are both undergoing positive selection and might be acquiring new functions. Lax2 and Lax4 paralogs are both under strong purifying selection, but still underwent a temporary relaxation of purifying selection immediately after duplication. Conclusions This study illustrates the variety of selective pressures undergone by duplicated genes and the effect of age of the duplication. We found that relaxation of selective constraints immediately after duplication might promote

  20. Characterization, expression, and mutation of the Lactococcus lactis galPMKTE genes, involved in galactose utilization via the Leloir pathway

    NARCIS (Netherlands)

    Groossiord, B.P.; Luesink, E.J.; Vaughan, E.E.; Arnaud, A.; Vos, de W.M.

    2003-01-01

    A cluster containing five similarly oriented genes involved in the metabolism of galactose via the Leloir pathway in Lactococcus lactis subsp. cremoris MG1363 was cloned and characterized. The order of the genes is galPMKTE, and these genes encode a galactose permease (GalP), an aldose I-epimerase

  1. Association of Polymorphisms in BDNF, MTHFR, and Genes Involved in the Dopaminergic Pathway with Memory in a Healthy Chinese Population

    Science.gov (United States)

    Yeh, Ting-Kuang; Hu, Chung-Yi; Yeh, Ting-Chi; Lin, Pei-Jung; Wu, Chung-Hsin; Lee, Po-Lei; Chang, Chun-Yen

    2012-01-01

    The contribution of genetic factors to the memory is widely acknowledged. Research suggests that these factors include genes involved in the dopaminergic pathway, as well as the genes for brain-derived neurotrophic factor (BDNF) and methylenetetrahydrofolate reductase (MTHFR). The activity of the products of these genes is affected by single…

  2. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  3. Noncommunicating Isolated Enteric Duplication Cyst in the ...

    African Journals Online (AJOL)

    Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their own blood supply. We report a case of a noncommunicating isolated ileal duplication in a 10-month-old boy. He was admitted because of severe abdominal distension and developed irritability ...

  4. Evaluation of Different Normalization and Analysis Procedures for Illumina Gene Expression Microarray Data Involving Small Changes

    Directory of Open Access Journals (Sweden)

    Pablo Moscato

    2013-05-01

    Full Text Available While Illumina microarrays can be used successfully for detecting small gene expression changes due to their high degree of technical replicability, there is little information on how different normalization and differential expression analysis strategies affect outcomes. To evaluate this, we assessed concordance across gene lists generated by applying different combinations of normalization strategy and analytical approach to two Illumina datasets with modest expression changes. In addition to using traditional statistical approaches, we also tested an approach based on combinatorial optimization. We found that the choice of both normalization strategy and analytical approach considerably affected outcomes, in some cases leading to substantial differences in gene lists and subsequent pathway analysis results. Our findings suggest that important biological phenomena may be overlooked when there is a routine practice of using only one approach to investigate all microarray datasets. Analytical artefacts of this kind are likely to be especially relevant for datasets involving small fold changes, where inherent technical variation—if not adequately minimized by effective normalization—may overshadow true biological variation. This report provides some basic guidelines for optimizing outcomes when working with Illumina datasets involving small expression changes.

  5. Brownie, a gene involved in building complex respiratory devices in insect eggshells.

    Directory of Open Access Journals (Sweden)

    Paula Irles

    Full Text Available BACKGROUND: Insect eggshells must combine protection for the yolk and embryo with provisions for respiration and for the entry of sperm, which are ensured by aeropyles and micropyles, respectively. Insects which oviposit the eggs in an egg-case have a double problem of respiration as gas exchange then involves two barriers. An example of this situation is found in the cockroach Blattella germanica, where the aeropyle and the micropyle are combined in a complex structure called the sponge-like body. The sponge-like body has been well described morphologically, but nothing is known about how it is built up. METHODOLOGY/PRINCIPAL FINDINGS: In a library designed to find genes expressed during late chorion formation in B. germanica, we isolated the novel sequence Bg30009 (now called Brownie, which was outstanding due to its high copy number. In the present work, we show that Brownie is expressed in the follicle cells localized in the anterior pole of the oocyte in late choriogenesis. RNA interference (RNAi of Brownie impaired correct fo