RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

[PIWI protein as a nucleolus visitor in Drosophila melanogaster].

Science.gov (United States)

Mikhaleva, E A; Iakushev, E Iu; Stoliarenko, A D; Klenov, M S; Pozovskiĭ, Ia M; Gvozdev, V A

2015-01-01

The evolutionarily conserved nuclear Piwi protein of Drosophila melanogaster is a representative of the Argonaute small RNA binding protein family. Guided by small piRNAs, Piwi functions in transposon silencing in somatic and germ cells of the gonad. We found that in ovarian somatic and germ cells, as well as in the established ovarian somatic cell line, Piwi is concentrated predominantly in the nucleolus--the main nuclear compartment, participating not only in rRNA synthesis, but also in various cell stress responses. We demonstrated the colocalization of Piwi with nucleolar marker proteins--fibrillarin and Nopp140. A mutation preventing Piwi transport to the nucleus and disturbing transposon silencing (piwi(Nt)) leads to 6-8-fold upregulation of rRNA genes expression, as evaluated by the level of transcripts of transposon insertions in 28S rRNA genes. RNase treatment of live cultured ovarian somatic cells depletes Piwi from the nucleolus. The same effect is observed upon inhibiting RNA polymerase I which transcribes rRNA, but not RNA polymerase II. In contrast, upon heat shock Piwi is concentrated in the nucleolus and is depleted from the nucleoplasm. These results implicate Piwi in RNA polymerase activity modulation and stress response in the nucleolus. We discuss possible noncanonical Piwi functions along with its canonical role in transposon silencing by piRNAs.

Cadmium resistance in Drosophila: a small cadmium binding substance

International Nuclear Information System (INIS)

Jacobson, K.B.; Williams, M.W.; Richter, L.J.; Holt, S.E.; Hook, G.J.; Knoop, S.M.; Sloop, F.V.; Faust, J.B.

1985-01-01

A small cadmium-binding substance (CdBS) has been observed in adult Drosophila melanogaster that were raised for their entire growth cycle on a diet that contained 0.15 mM CdCl 2 . Induction of CdBS was observed in strains that differed widely in their sensitivity of CdCl 2 . This report describes the induction of CdBS and some of its characteristics. 17 refs., 4 figs., 1 tab

An Algorithm for Generating Small RNAs Capable of Epigenetically Modulating Transcriptional Gene Silencing and Activation in Human Cells

Directory of Open Access Journals (Sweden)

Amanda Ackley

2013-01-01

Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.

Sleep deprivation specifically impairs short-term olfactory memory in Drosophila.

Science.gov (United States)

Li, Xinjian; Yu, Feng; Guo, Aike

2009-11-01

Sleep is crucial to memory consolidation in humans and other animals; however, the effect of insufficient sleep on subsequent learning and memory remains largely elusive. Learning and memory after 1-day sleep deprivation (slpD) was evaluated using Pavlovian olfactory conditioning in Drosophila, and locomotor activity was measured using the Drosophila Activity Monitoring System in a 12:12 light-dark cycle. We found that slpD specifically impaired 1-h memory in wild type Canton-S flies, and this effect could persist for at least 2 h. However, alternative stresses (heat stress, oxidative stress, starvation, and rotation stress) did not result in a similar effect and left the flies' memory intact. Mechanistic studies demonstrated that flies with either silenced transmission of the mushroom body (MB) during slpD or down-regulated cAMP levels in the MB demonstrated no slpD-induced 1-h memory impairment. We found that slpD specifically impaired 1-h memory in Drosophila, and either silencing of MB transmission during slpD or down-regulation of the cAMP level in the MB protected the flies from slpD-induced impairment.

Modeling Monogenic Human Nephrotic Syndrome in the Drosophila Garland Cell Nephrocyte.

Science.gov (United States)

Hermle, Tobias; Braun, Daniela A; Helmstädter, Martin; Huber, Tobias B; Hildebrandt, Friedhelm

2017-05-01

Steroid-resistant nephrotic syndrome is characterized by podocyte dysfunction. Drosophila garland cell nephrocytes are podocyte-like cells and thus provide a potential in vivo model in which to study the pathogenesis of nephrotic syndrome. However, relevant pathomechanisms of nephrotic syndrome have not been studied in nephrocytes. Here, we discovered that two Drosophila slit diaphragm proteins, orthologs of the human genes encoding nephrin and nephrin-like protein 1, colocalize within a fingerprint-like staining pattern that correlates with ultrastructural morphology. Using RNAi and conditional CRISPR/Cas9 in nephrocytes, we found this pattern depends on the expression of both orthologs. Tracer endocytosis by nephrocytes required Cubilin and reflected size selectivity analogous to that of glomerular function. Using RNAi and tracer endocytosis as a functional read-out, we screened Drosophila orthologs of human monogenic causes of nephrotic syndrome and observed conservation of the central pathogenetic alterations. We focused on the coenzyme Q 10 (CoQ 10 ) biosynthesis gene Coq2 , the silencing of which disrupted slit diaphragm morphology. Restoration of CoQ 10 synthesis by vanillic acid partially rescued the phenotypic and functional alterations induced by Coq2 -RNAi. Notably, Coq2 colocalized with mitochondria, and Coq2 silencing increased the formation of reactive oxygen species (ROS). Silencing of ND75 , a subunit of the mitochondrial respiratory chain that controls ROS formation independently of CoQ 10 , phenocopied the effect of Coq2 -RNAi. Moreover, the ROS scavenger glutathione partially rescued the effects of Coq2 -RNAi. In conclusion, Drosophila garland cell nephrocytes provide a model with which to study the pathogenesis of nephrotic syndrome, and ROS formation may be a pathomechanism of COQ2 -nephropathy. Copyright © 2017 by the American Society of Nephrology.

Cytochrome P450-Dependent Metabolism of Caffeine in Drosophila melanogaster

Science.gov (United States)

Coelho, Alexandra; Fraichard, Stephane; Le Goff, Gaëlle; Faure, Philippe; Artur, Yves; Ferveur, Jean-François; Heydel, Jean-Marie

2015-01-01

Caffeine (1, 3, 7-trimethylxanthine), an alkaloid produced by plants, has antioxidant and insecticide properties that can affect metabolism and cognition. In vertebrates, the metabolites derived from caffeine have been identified, and their functions have been characterized. However, the metabolites of caffeine in insects remain unknown. Thus, using radiolabelled caffeine, we have identified some of the primary caffeine metabolites produced in the body of Drosophila melanogaster males, including theobromine, paraxanthine and theophylline. In contrast to mammals, theobromine was the predominant metabolite (paraxanthine in humans; theophylline in monkeys; 1, 3, 7-trimethyluric acid in rodents). A transcriptomic screen of Drosophila flies exposed to caffeine revealed the coordinated variation of a large set of genes that encode xenobiotic-metabolizing proteins, including several cytochromes P450s (CYPs) that were highly overexpressed. Flies treated with metyrapone—an inhibitor of CYP enzymes—showed dramatically decreased caffeine metabolism, indicating that CYPs are involved in this process. Using interference RNA genetic silencing, we measured the metabolic and transcriptomic effect of three candidate CYPs. Silencing of CYP6d5 completely abolished theobromine synthesis, whereas CYP6a8 and CYP12d1 silencing induced different consequences on metabolism and gene expression. Therefore, we characterized several metabolic products and some enzymes potentially involved in the degradation of caffeine. In conclusion, this pioneer approach to caffeine metabolism in insects opens novel perspectives for the investigation of the physiological effects of caffeine metabolites. It also indicates that caffeine could be used as a biomarker to evaluate CYP phenotypes in Drosophila and other insects. PMID:25671424

Cytochrome P450-dependent metabolism of caffeine in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Alexandra Coelho

Full Text Available Caffeine (1, 3, 7-trimethylxanthine, an alkaloid produced by plants, has antioxidant and insecticide properties that can affect metabolism and cognition. In vertebrates, the metabolites derived from caffeine have been identified, and their functions have been characterized. However, the metabolites of caffeine in insects remain unknown. Thus, using radiolabelled caffeine, we have identified some of the primary caffeine metabolites produced in the body of Drosophila melanogaster males, including theobromine, paraxanthine and theophylline. In contrast to mammals, theobromine was the predominant metabolite (paraxanthine in humans; theophylline in monkeys; 1, 3, 7-trimethyluric acid in rodents. A transcriptomic screen of Drosophila flies exposed to caffeine revealed the coordinated variation of a large set of genes that encode xenobiotic-metabolizing proteins, including several cytochromes P450s (CYPs that were highly overexpressed. Flies treated with metyrapone--an inhibitor of CYP enzymes--showed dramatically decreased caffeine metabolism, indicating that CYPs are involved in this process. Using interference RNA genetic silencing, we measured the metabolic and transcriptomic effect of three candidate CYPs. Silencing of CYP6d5 completely abolished theobromine synthesis, whereas CYP6a8 and CYP12d1 silencing induced different consequences on metabolism and gene expression. Therefore, we characterized several metabolic products and some enzymes potentially involved in the degradation of caffeine. In conclusion, this pioneer approach to caffeine metabolism in insects opens novel perspectives for the investigation of the physiological effects of caffeine metabolites. It also indicates that caffeine could be used as a biomarker to evaluate CYP phenotypes in Drosophila and other insects.

Small ubiquitin-like modifier (SUMO) conjugation impedes transcriptional silencing by the polycomb group repressor Sex Comb on Midleg.

Science.gov (United States)

Smith, Matthew; Mallin, Daniel R; Simon, Jeffrey A; Courey, Albert J

2011-04-01

The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE.

Small Ubiquitin-like Modifier (SUMO) Conjugation Impedes Transcriptional Silencing by the Polycomb Group Repressor Sex Comb on Midleg*

Science.gov (United States)

Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.

2011-01-01

The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE. PMID:21278366

The Drosophila Su(var)3-7 gene is required for oogenesis and female fertility, genetically interacts with piwi and aubergine, but impacts only weakly transposon silencing.

Science.gov (United States)

Basquin, Denis; Spierer, Anne; Begeot, Flora; Koryakov, Dmitry E; Todeschini, Anne-Laure; Ronsseray, Stéphane; Vieira, Cristina; Spierer, Pierre; Delattre, Marion

2014-01-01

Heterochromatin is made of repetitive sequences, mainly transposable elements (TEs), the regulation of which is critical for genome stability. We have analyzed the role of the heterochromatin-associated Su(var)3-7 protein in Drosophila ovaries. We present evidences that Su(var)3-7 is required for correct oogenesis and female fertility. It accumulates in heterochromatic domains of ovarian germline and somatic cells nuclei, where it co-localizes with HP1. Homozygous mutant females display ovaries with frequent degenerating egg-chambers. Absence of Su(var)3-7 in embryos leads to defects in meiosis and first mitotic divisions due to chromatin fragmentation or chromosome loss, showing that Su(var)3-7 is required for genome integrity. Females homozygous for Su(var)3-7 mutations strongly impair repression of P-transposable element induced gonadal dysgenesis but have minor effects on other TEs. Su(var)3-7 mutations reduce piRNA cluster transcription and slightly impact ovarian piRNA production. However, this modest piRNA reduction does not correlate with transposon de-silencing, suggesting that the moderate effect of Su(var)3-7 on some TE repression is not linked to piRNA production. Strikingly, Su(var)3-7 genetically interacts with the piwi and aubergine genes, key components of the piRNA pathway, by strongly impacting female fertility without impairing transposon silencing. These results lead us to propose that the interaction between Su(var)3-7 and piwi or aubergine controls important developmental processes independently of transposon silencing.

Structural insights into mechanisms of the small RNA methyltransferase HEN1

Energy Technology Data Exchange (ETDEWEB)

Huang, Ying; Ji, Lijuan; Huang, Qichen; Vassylyev, Dmitry G.; Chen, Xuemei; Ma, Jin-Biao; (UAB); (UCR)

2010-02-22

RNA silencing is a conserved regulatory mechanism in fungi, plants and animals that regulates gene expression and defence against viruses and transgenes. Small silencing RNAs of {approx}20-30 nucleotides and their associated effector proteins, the Argonaute family proteins, are the central components in RNA silencing. A subset of small RNAs, such as microRNAs and small interfering RNAs (siRNAs) in plants, Piwi-interacting RNAs in animals and siRNAs in Drosophila, requires an additional crucial step for their maturation; that is, 2'-O-methylation on the 3' terminal nucleotide. A conserved S-adenosyl-L-methionine-dependent RNA methyltransferase, HUA ENHANCER 1 (HEN1), and its homologues are responsible for this specific modification. Here we report the 3.1 {angstrom} crystal structure of full-length HEN1 from Arabidopsis in complex with a 22-nucleotide small RNA duplex and cofactor product S-adenosyl-L-homocysteine. Highly cooperative recognition of the small RNA substrate by multiple RNA binding domains and the methyltransferase domain in HEN1 measures the length of the RNA duplex and determines the substrate specificity. Metal ion coordination by both 2' and 3' hydroxyls on the 3'-terminal nucleotide and four invariant residues in the active site of the methyltransferase domain suggests a novel Mg{sup 2+}-dependent 2'-O-methylation mechanism.

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Science.gov (United States)

Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

2012-01-01

RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

Fermitins, the orthologs of mammalian Kindlins, regulate the development of a functional cardiac syncytium in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

James H Catterson

Full Text Available The vertebrate Kindlins are an evolutionarily conserved family of proteins critical for integrin signalling and cell adhesion. Kindlin-2 (KIND2 is associated with intercalated discs in mice, suggesting a role in cardiac syncytium development; however, deficiency of Kind2 leads to embryonic lethality. Morpholino knock-down of Kind2 in zebrafish has a pleiotropic effect on development that includes the heart. It therefore remains unclear whether cardiomyocyte Kind2 expression is required for cardiomyocyte junction formation and the development of normal cardiac function. To address this question, the expression of Fermitin 1 and Fermitin 2 (Fit1, Fit2, the two Drosophila orthologs of Kind2, was silenced in Drosophila cardiomyocytes. Heart development was assessed in adult flies by immunological methods and videomicroscopy. Silencing both Fit1 and Fit2 led to a severe cardiomyopathy characterised by the failure of cardiomyocytes to develop as a functional syncytium and loss of synchrony between cardiomyocytes. A null allele of Fit1 was generated but this had no impact on the heart. Similarly, the silencing of Fit2 failed to affect heart function. In contrast, the silencing of Fit2 in the cardiomyocytes of Fit1 null flies disrupted syncytium development, leading to severe cardiomyopathy. The data definitively demonstrate a role for Fermitins in the development of a functional cardiac syncytium in Drosophila. The findings also show that the Fermitins can functionally compensate for each other in order to control syncytium development. These findings support the concept that abnormalities in cardiomyocyte KIND2 expression or function may contribute to cardiomyopathies in humans.

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Directory of Open Access Journals (Sweden)

Adrian Valli

Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

The Drosophila Su(var)3–7 Gene Is Required for Oogenesis and Female Fertility, Genetically Interacts with piwi and aubergine, but Impacts Only Weakly Transposon Silencing

Science.gov (United States)

Begeot, Flora; Koryakov, Dmitry E.; Todeschini, Anne-Laure; Ronsseray, Stéphane; Vieira, Cristina; Spierer, Pierre; Delattre, Marion

2014-01-01

Heterochromatin is made of repetitive sequences, mainly transposable elements (TEs), the regulation of which is critical for genome stability. We have analyzed the role of the heterochromatin-associated Su(var)3–7 protein in Drosophila ovaries. We present evidences that Su(var)3–7 is required for correct oogenesis and female fertility. It accumulates in heterochromatic domains of ovarian germline and somatic cells nuclei, where it co-localizes with HP1. Homozygous mutant females display ovaries with frequent degenerating egg-chambers. Absence of Su(var)3–7 in embryos leads to defects in meiosis and first mitotic divisions due to chromatin fragmentation or chromosome loss, showing that Su(var)3–7 is required for genome integrity. Females homozygous for Su(var)3–7 mutations strongly impair repression of P-transposable element induced gonadal dysgenesis but have minor effects on other TEs. Su(var)3–7 mutations reduce piRNA cluster transcription and slightly impact ovarian piRNA production. However, this modest piRNA reduction does not correlate with transposon de-silencing, suggesting that the moderate effect of Su(var)3–7 on some TE repression is not linked to piRNA production. Strikingly, Su(var)3–7 genetically interacts with the piwi and aubergine genes, key components of the piRNA pathway, by strongly impacting female fertility without impairing transposon silencing. These results lead us to propose that the interaction between Su(var)3–7 and piwi or aubergine controls important developmental processes independently of transposon silencing. PMID:24820312

Small RNA-Seq analysis reveals microRNA-regulation of the Imd pathway during Escherichia coli infection in Drosophila.

Science.gov (United States)

Li, Shengjie; Shen, Li; Sun, Lianjie; Xu, Jiao; Jin, Ping; Chen, Liming; Ma, Fei

2017-05-01

Drosophila have served as a model for research on innate immunity for decades. However, knowledge of the post-transcriptional regulation of immune gene expression by microRNAs (miRNAs) remains rudimentary. In the present study, using small RNA-seq and bioinformatics analysis, we identified 67 differentially expressed miRNAs in Drosophila infected with Escherichia coli compared to injured flies at three time-points. Furthermore, we found that 21 of these miRNAs were potentially involved in the regulation of Imd pathway-related genes. Strikingly, based on UAS-miRNAs line screening and Dual-luciferase assay, we identified that miR-9a and miR-981 could both negatively regulate Drosophila antibacterial defenses and decrease the level of the antibacterial peptide, Diptericin. Taken together, these data support the involvement of miRNAs in the regulation of the Drosophila Imd pathway. Copyright © 2017 Elsevier Ltd. All rights reserved.

The molecular basis for stability of heterochromatin-mediated silencing in mammals.

Science.gov (United States)

Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard

2009-11-04

The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

The molecular basis for stability of heterochromatin-mediated silencing in mammals

Directory of Open Access Journals (Sweden)

Hiragami-Hamada Kyoko

2009-11-01

Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

A Circadian Clock Gene, Cry, Affects Heart Morphogenesis and Function in Drosophila as Revealed by Optical Coherence Microscopy.

Directory of Open Access Journals (Sweden)

Aneesh Alex

Full Text Available Circadian rhythms are endogenous, entrainable oscillations of physical, mental and behavioural processes in response to local environmental cues such as daylight, which are present in the living beings, including humans. Circadian rhythms have been related to cardiovascular function and pathology. However, the role that circadian clock genes play in heart development and function in a whole animal in vivo are poorly understood. The Drosophila cryptochrome (dCry is a circadian clock gene that encodes a major component of the circadian clock negative feedback loop. Compared to the embryonic stage, the relative expression levels of dCry showed a significant increase (>100-fold in Drosophila during the pupa and adult stages. In this study, we utilized an ultrahigh resolution optical coherence microscopy (OCM system to perform non-invasive and longitudinal analysis of functional and morphological changes in the Drosophila heart throughout its post-embryonic lifecycle for the first time. The Drosophila heart exhibited major morphological and functional alterations during its development. Notably, heart rate (HR and cardiac activity period (CAP of Drosophila showed significant variations during the pupa stage, when heart remodeling took place. From the M-mode (2D + time OCM images, cardiac structural and functional parameters of Drosophila at different developmental stages were quantitatively determined. In order to study the functional role of dCry on Drosophila heart development, we silenced dCry by RNAi in the Drosophila heart and mesoderm, and quantitatively measured heart morphology and function in those flies throughout its development. Silencing of dCry resulted in slower HR, reduced CAP, smaller heart chamber size, pupal lethality and disrupted posterior segmentation that was related to increased expression of a posterior compartment protein, wingless. Collectively, our studies provided novel evidence that the circadian clock gene, dCry, plays

A Circadian Clock Gene, Cry, Affects Heart Morphogenesis and Function in Drosophila as Revealed by Optical Coherence Microscopy

Science.gov (United States)

Zeng, Xianxu; Tate, Rebecca E.; McKee, Mary L.; Capen, Diane E.; Zhang, Zhan; Tanzi, Rudolph E.; Zhou, Chao

2015-01-01

Circadian rhythms are endogenous, entrainable oscillations of physical, mental and behavioural processes in response to local environmental cues such as daylight, which are present in the living beings, including humans. Circadian rhythms have been related to cardiovascular function and pathology. However, the role that circadian clock genes play in heart development and function in a whole animal in vivo are poorly understood. The Drosophila cryptochrome (dCry) is a circadian clock gene that encodes a major component of the circadian clock negative feedback loop. Compared to the embryonic stage, the relative expression levels of dCry showed a significant increase (>100-fold) in Drosophila during the pupa and adult stages. In this study, we utilized an ultrahigh resolution optical coherence microscopy (OCM) system to perform non-invasive and longitudinal analysis of functional and morphological changes in the Drosophila heart throughout its post-embryonic lifecycle for the first time. The Drosophila heart exhibited major morphological and functional alterations during its development. Notably, heart rate (HR) and cardiac activity period (CAP) of Drosophila showed significant variations during the pupa stage, when heart remodeling took place. From the M-mode (2D + time) OCM images, cardiac structural and functional parameters of Drosophila at different developmental stages were quantitatively determined. In order to study the functional role of dCry on Drosophila heart development, we silenced dCry by RNAi in the Drosophila heart and mesoderm, and quantitatively measured heart morphology and function in those flies throughout its development. Silencing of dCry resulted in slower HR, reduced CAP, smaller heart chamber size, pupal lethality and disrupted posterior segmentation that was related to increased expression of a posterior compartment protein, wingless. Collectively, our studies provided novel evidence that the circadian clock gene, dCry, plays an essential

The Drosophila homolog of the mammalian imprint regulator, CTCF, maintains the maternal genomic imprint in Drosophila melanogaster

Directory of Open Access Journals (Sweden)

Rasheva Vanya

2010-07-01

Full Text Available Abstract Background CTCF is a versatile zinc finger DNA-binding protein that functions as a highly conserved epigenetic transcriptional regulator. CTCF is known to act as a chromosomal insulator, bind promoter regions, and facilitate long-range chromatin interactions. In mammals, CTCF is active in the regulatory regions of some genes that exhibit genomic imprinting, acting as insulator on only one parental allele to facilitate parent-specific expression. In Drosophila, CTCF acts as a chromatin insulator and is thought to be actively involved in the global organization of the genome. Results To determine whether CTCF regulates imprinting in Drosophila, we generated CTCF mutant alleles and assayed gene expression from the imprinted Dp(1;fLJ9 mini-X chromosome in the presence of reduced CTCF expression. We observed disruption of the maternal imprint when CTCF levels were reduced, but no effect was observed on the paternal imprint. The effect was restricted to maintenance of the imprint and was specific for the Dp(1;fLJ9 mini-X chromosome. Conclusions CTCF in Drosophila functions in maintaining parent-specific expression from an imprinted domain as it does in mammals. We propose that Drosophila CTCF maintains an insulator boundary on the maternal X chromosome, shielding genes from the imprint-induced silencing that occurs on the paternally inherited X chromosome. See commentary: http://www.biomedcentral.com/1741-7007/8/104

Bicaudal is a conserved substrate for Drosophila and mammalian caspases and is essential for cell survival.

LENUS (Irish Health Repository)

Creagh, Emma M

2009-01-01

Members of the caspase family of cysteine proteases coordinate cell death through restricted proteolysis of diverse protein substrates and play a conserved role in apoptosis from nematodes to man. However, while numerous substrates for the mammalian cell death-associated caspases have now been described, few caspase substrates have been identified in other organisms. Here, we have utilized a proteomics-based approach to identify proteins that are cleaved by caspases during apoptosis in Drosophila D-Mel2 cells, a subline of the Schneider S2 cell line. This approach identified multiple novel substrates for the fly caspases and revealed that bicaudal\\/betaNAC is a conserved substrate for Drosophila and mammalian caspases. RNAi-mediated silencing of bicaudal expression in Drosophila D-Mel2 cells resulted in a block to proliferation, followed by spontaneous apoptosis. Similarly, silencing of expression of the mammalian bicaudal homologue, betaNAC, in HeLa, HEK293T, MCF-7 and MRC5 cells also resulted in spontaneous apoptosis. These data suggest that bicaudal\\/betaNAC is essential for cell survival and is a conserved target of caspases from flies to man.

Overlapping functions of argonaute proteins in patterning and morphogenesis of Drosophila embryos.

Directory of Open Access Journals (Sweden)

Wibke J Meyer

2006-08-01

Full Text Available Argonaute proteins are essential components of the molecular machinery that drives RNA silencing. In Drosophila, different members of the Argonaute family of proteins have been assigned to distinct RNA silencing pathways. While Ago1 is required for microRNA function, Ago2 is a crucial component of the RNA-induced silencing complex in siRNA-triggered RNA interference. Drosophila Ago2 contains an unusual amino-terminus with two types of imperfect glutamine-rich repeats (GRRs of unknown function. Here we show that the GRRs of Ago2 are essential for the normal function of the protein. Alleles with reduced numbers of GRRs cause specific disruptions in two morphogenetic processes associated with the midblastula transition: membrane growth and microtubule-based organelle transport. These defects do not appear to result from disruption of siRNA-dependent processes but rather suggest an interference of the mutant Ago2 proteins in an Ago1-dependent pathway. Using loss-of-function alleles, we further demonstrate that Ago1 and Ago2 act in a partially redundant manner to control the expression of the segment-polarity gene wingless in the early embryo. Our findings argue against a strict separation of Ago1 and Ago2 functions and suggest that these proteins act in concert to control key steps of the midblastula transition and of segmental patterning.

Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis

Directory of Open Access Journals (Sweden)

Rita Marta

2014-10-01

Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.

Drosophila interspecific hybrids phenocopy piRNA-pathway mutants.

Directory of Open Access Journals (Sweden)

Erin S Kelleher

Full Text Available The Piwi-interacting RNA (piRNA pathway defends the germline of animals from the deleterious activity of selfish transposable elements (TEs through small-RNA mediated silencing. Adaptation to novel invasive TEs is proposed to occur by incorporating their sequences into the piRNA pool that females produce and deposit into their eggs, which then propagates immunity against specific TEs to future generations. In support of this model, the F1 offspring of crosses between strains of the same Drosophila species sometimes suffer from germline derepression of paternally inherited TE families, caused by a failure of the maternal strain to produce the piRNAs necessary for their regulation. However, many protein components of the Drosophila piRNA pathway exhibit signatures of positive selection, suggesting that they also contribute to the evolution of host genome defense. Here we investigate piRNA pathway function and TE regulation in the F1 hybrids of interspecific crosses between D. melanogaster and D. simulans and compare them with intraspecific control crosses of D. melanogaster. We confirm previous reports showing that intraspecific crosses are characterized by derepression of paternally inherited TE families that are rare or absent from the maternal genome and piRNA pool, consistent with the role of maternally deposited piRNAs in shaping TE silencing. In contrast to the intraspecific cross, we discover that interspecific hybrids are characterized by widespread derepression of both maternally and paternally inherited TE families. Furthermore, the pattern of derepression of TE families in interspecific hybrids cannot be attributed to their paucity or absence from the piRNA pool of the maternal species. Rather, we demonstrate that interspecific hybrids closely resemble piRNA effector-protein mutants in both TE misregulation and aberrant piRNA production. We suggest that TE derepression in interspecific hybrids largely reflects adaptive divergence of pi

GABAA receptor-expressing neurons promote consumption in Drosophila melanogaster.

Science.gov (United States)

Cheung, Samantha K; Scott, Kristin

2017-01-01

Feeding decisions are highly plastic and bidirectionally regulated by neurons that either promote or inhibit feeding. In Drosophila melanogaster, recent studies have identified four GABAergic interneurons that act as critical brakes to prevent incessant feeding. These GABAergic neurons may inhibit target neurons that drive consumption. Here, we tested this hypothesis by examining GABA receptors and neurons that promote consumption. We find that Resistance to dieldrin (RDL), a GABAA type receptor, is required for proper control of ingestion. Knockdown of Rdl in a subset of neurons causes overconsumption of tastants. Acute activation of these neurons is sufficient to drive consumption of appetitive substances and non-appetitive substances and acute silencing of these neurons decreases consumption. Taken together, these studies identify GABAA receptor-expressing neurons that promote Drosophila ingestive behavior and provide insight into feeding regulation.

Silencing of Transposable Elements by piRNAs in Drosophila: An Evolutionary Perspective.

Science.gov (United States)

Luo, Shiqi; Lu, Jian

2017-06-01

Transposable elements (TEs) are DNA sequences that can move within the genome. TEs have greatly shaped the genomes, transcriptomes, and proteomes of the host organisms through a variety of mechanisms. However, TEs generally disrupt genes and destabilize the host genomes, which substantially reduce fitness of the host organisms. Understanding the genomic distribution and evolutionary dynamics of TEs will greatly deepen our understanding of the TE-mediated biological processes. Most TE insertions are highly polymorphic in Drosophila melanogaster, providing us a good system to investigate the evolution of TEs at the population level. Decades of theoretical and experimental studies have well established "transposition-selection" population genetics model, which assumes that the equilibrium between TE replication and purifying selection determines the copy number of TEs in the genome. In the last decade, P-element-induced wimpy testis (PIWI)-interacting RNAs (piRNAs) were demonstrated to be master repressors of TE activities in Drosophila. The discovery of piRNAs revolutionized our understanding of TE repression, because it reveals that the host organisms have evolved an adaptive mechanism to defend against TE invasion. Tremendous progress has been made to understand the molecular mechanisms by which piRNAs repress active TEs, although many details in this process remain to be further explored. The interaction between piRNAs and TEs well explains the molecular mechanisms underlying hybrid dysgenesis for the I-R and P-M systems in Drosophila, which have puzzled evolutionary biologists for decades. The piRNA repression pathway provides us an unparalleled system to study the co-evolutionary process between parasites and host organisms. Copyright © 2017 Beijing Institute of Genomics, Chinese Academy of Sciences and Genetics Society of China. Production and hosting by Elsevier B.V. All rights reserved.

Dosage compensation and demasculinization of X chromosomes in Drosophila.

Science.gov (United States)

Bachtrog, Doris; Toda, Nicholas R T; Lockton, Steven

2010-08-24

The X chromosome of Drosophila shows a deficiency of genes with male-biased expression, whereas mammalian X chromosomes are enriched for spermatogenesis genes expressed premeiosis and multicopy testis genes. Meiotic X-inactivation and sexual antagonism can only partly account for these patterns. Here, we show that dosage compensation (DC) in Drosophila may contribute substantially to the depletion of male genes on the X. To equalize expression between X-linked and autosomal genes in the two sexes, male Drosophila hypertranscribe their single X, whereas female mammals silence one of their two X chromosomes. We combine fine-scale mapping data of dosage compensated regions with genome-wide expression profiles and show that most male-biased genes on the D. melanogaster X are located outside dosage compensated regions. Additionally, X-linked genes that have newly acquired male-biased expression in D. melanogaster are less likely to be dosage compensated, and parental X-linked genes that gave rise to an autosomal male-biased retrocopy are more likely located within compensated regions. This suggests that DC contributes to the observed demasculinization of X chromosomes in Drosophila, both by limiting the emergence of male-biased expression patterns of existing X genes, and by contributing to gene trafficking of male genes off the X. Copyright 2010 Elsevier Ltd. All rights reserved.

Role of serotonergic neurons in the Drosophila larval response to light

Directory of Open Access Journals (Sweden)

Campos Ana

2009-06-01

Full Text Available Abstract Background Drosophila larval locomotion consists of forward peristalsis interrupted by episodes of pausing, turning and exploratory behavior (head swinging. This behavior can be regulated by visual input as seen by light-induced increase in pausing, head swinging and direction change as well as reduction of linear speed that characterizes the larval photophobic response. During 3rd instar stage, Drosophila larvae gradually cease to be repelled by light and are photoneutral by the time they wander in search for a place to undergo metamorphosis. Thus, Drosophila larval photobehavior can be used to study control of locomotion. Results We used targeted neuronal silencing to assess the role of candidate neurons in the regulation of larval photobehavior. Inactivation of DOPA decarboxylase (Ddc neurons increases the response to light throughout larval development, including during the later stages of the 3rd instar characterized by photoneutral response. Increased response to light is characterized by increase in light-induced direction change and associated pause, and reduction of linear movement. Amongst Ddc neurons, suppression of the activity of corazonergic and serotonergic but not dopaminergic neurons increases the photophobic response observed during 3rd instar stage. Silencing of serotonergic neurons does not disrupt larval locomotion or the response to mechanical stimuli. Reduced serotonin (5-hydroxytryptamine, 5-HT signaling within serotonergic neurons recapitulates the results obtained with targeted neuronal silencing. Ablation of serotonergic cells in the ventral nerve cord (VNC does not affect the larval response to light. Similarly, disruption of serotonergic projections that contact the photoreceptor termini in the brain hemispheres does not impact the larval response to light. Finally, pan-neural over-expression of 5-HT1ADro receptors, but not of any other 5-HT receptor subtype, causes a significant decrease in the response to

Functional specialization of the small interfering RNA pathway in response to virus infection.

Directory of Open Access Journals (Sweden)

Joao Trindade Marques

Full Text Available In Drosophila, post-transcriptional gene silencing occurs when exogenous or endogenous double stranded RNA (dsRNA is processed into small interfering RNAs (siRNAs by Dicer-2 (Dcr-2 in association with a dsRNA-binding protein (dsRBP cofactor called Loquacious (Loqs-PD. siRNAs are then loaded onto Argonaute-2 (Ago2 by the action of Dcr-2 with another dsRBP cofactor called R2D2. Loaded Ago2 executes the destruction of target RNAs that have sequence complementarity to siRNAs. Although Dcr-2, R2D2, and Ago2 are essential for innate antiviral defense, the mechanism of virus-derived siRNA (vsiRNA biogenesis and viral target inhibition remains unclear. Here, we characterize the response mechanism mediated by siRNAs against two different RNA viruses that infect Drosophila. In both cases, we show that vsiRNAs are generated by Dcr-2 processing of dsRNA formed during viral genome replication and, to a lesser extent, viral transcription. These vsiRNAs seem to preferentially target viral polyadenylated RNA to inhibit viral replication. Loqs-PD is completely dispensable for silencing of the viruses, in contrast to its role in silencing endogenous targets. Biogenesis of vsiRNAs is independent of both Loqs-PD and R2D2. R2D2, however, is required for sorting and loading of vsiRNAs onto Ago2 and inhibition of viral RNA expression. Direct injection of viral RNA into Drosophila results in replication that is also independent of Loqs-PD. This suggests that triggering of the antiviral pathway is not related to viral mode of entry but recognition of intrinsic features of virus RNA. Our results indicate the existence of a vsiRNA pathway that is separate from the endogenous siRNA pathway and is specifically triggered by virus RNA. We speculate that this unique framework might be necessary for a prompt and efficient antiviral response.

High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..

Directory of Open Access Journals (Sweden)

Livia Donaire

Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.

The Drosophila small GTPase Rac2 is required for normal feeding and mating behaviour.

Science.gov (United States)

Goergen, Philip; Kasagiannis, Anna; Schiöth, Helgi B; Williams, Michael J

2014-03-01

All multicellular organisms require the ability to regulate bodily processes in order to maintain a stable condition, which necessitates fluctuations in internal metabolics, as well as modifications of outward behaviour. Understanding the genetics behind this modulation is important as a general model for the metabolic modification of behaviour. This study demonstrates that the activity of the small GTPase Rac2 is required in Drosophila for the proper regulation of lipid storage and feeding behaviour, as well as aggression and mating behaviours. Rac2 mutant males and females are susceptible to starvation and contain considerably less lipids than controls. Furthermore, Rac2 mutants also have disrupted feeding behaviour, eating fewer but larger meals than controls. Intriguingly, Rac2 mutant males rarely initiate aggressive behaviour and display significantly increased levels of courtship behaviour towards other males and mated females. From these results we conclude that Rac2 has a central role in regulating the Drosophila homeostatic system.

A mighty small heart: the cardiac proteome of adult Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Anthony Cammarato

2011-04-01

Full Text Available Drosophila melanogaster is emerging as a powerful model system for the study of cardiac disease. Establishing peptide and protein maps of the Drosophila heart is central to implementation of protein network studies that will allow us to assess the hallmarks of Drosophila heart pathogenesis and gauge the degree of conservation with human disease mechanisms on a systems level. Using a gel-LC-MS/MS approach, we identified 1228 protein clusters from 145 dissected adult fly hearts. Contractile, cytostructural and mitochondrial proteins were most abundant consistent with electron micrographs of the Drosophila cardiac tube. Functional/Ontological enrichment analysis further showed that proteins involved in glycolysis, Ca(2+-binding, redox, and G-protein signaling, among other processes, are also over-represented. Comparison with a mouse heart proteome revealed conservation at the level of molecular function, biological processes and cellular components. The subsisting peptidome encompassed 5169 distinct heart-associated peptides, of which 1293 (25% had not been identified in a recent Drosophila peptide compendium. PeptideClassifier analysis was further used to map peptides to specific gene-models. 1872 peptides provide valuable information about protein isoform groups whereas a further 3112 uniquely identify specific protein isoforms and may be used as a heart-associated peptide resource for quantitative proteomic approaches based on multiple-reaction monitoring. In summary, identification of excitation-contraction protein landmarks, orthologues of proteins associated with cardiovascular defects, and conservation of protein ontologies, provides testimony to the heart-like character of the Drosophila cardiac tube and to the utility of proteomics as a complement to the power of genetics in this growing model of human heart disease.

Positive Selection Drives the Evolution of rhino, a Member of the Heterochromatin Protein 1 Family in Drosophila.

Directory of Open Access Journals (Sweden)

2005-07-01

Full Text Available Heterochromatin comprises a significant component of many eukaryotic genomes. In comparison to euchromatin, heterochromatin is gene poor, transposon rich, and late replicating. It serves many important biological roles, from gene silencing to accurate chromosome segregation, yet little is known about the evolutionary constraints that shape heterochromatin. A complementary approach to the traditional one of directly studying heterochromatic DNA sequence is to study the evolution of proteins that bind and define heterochromatin. One of the best markers for heterochromatin is the heterochromatin protein 1 (HP1, which is an essential, nonhistone chromosomal protein. Here we investigate the molecular evolution of five HP1 paralogs present in Drosophila melanogaster. Three of these paralogs have ubiquitous expression patterns in adult Drosophila tissues, whereas HP1D/rhino and HP1E are expressed predominantly in ovaries and testes respectively. The HP1 paralogs also have distinct localization preferences in Drosophila cells. Thus, Rhino localizes to the heterochromatic compartment in Drosophila tissue culture cells, but in a pattern distinct from HP1A and lysine-9 dimethylated H3. Using molecular evolution and population genetic analyses, we find that rhino has been subject to positive selection in all three domains of the protein: the N-terminal chromo domain, the C-terminal chromo-shadow domain, and the hinge region that connects these two modules. Maximum likelihood analysis of rhino sequences from 20 species of Drosophila reveals that a small number of residues of the chromo and shadow domains have been subject to repeated positive selection. The rapid and positive selection of rhino is highly unusual for a gene encoding a chromosomal protein and suggests that rhino is involved in a genetic conflict that affects the germline, belying the notion that heterochromatin is simply a passive recipient of "junk DNA" in eukaryotic genomes.

Positive selection drives the evolution of rhino, a member of the heterochromatin protein 1 family in Drosophila.

Directory of Open Access Journals (Sweden)

Danielle Vermaak

2005-07-01

Full Text Available Heterochromatin comprises a significant component of many eukaryotic genomes. In comparison to euchromatin, heterochromatin is gene poor, transposon rich, and late replicating. It serves many important biological roles, from gene silencing to accurate chromosome segregation, yet little is known about the evolutionary constraints that shape heterochromatin. A complementary approach to the traditional one of directly studying heterochromatic DNA sequence is to study the evolution of proteins that bind and define heterochromatin. One of the best markers for heterochromatin is the heterochromatin protein 1 (HP1, which is an essential, nonhistone chromosomal protein. Here we investigate the molecular evolution of five HP1 paralogs present in Drosophila melanogaster. Three of these paralogs have ubiquitous expression patterns in adult Drosophila tissues, whereas HP1D/rhino and HP1E are expressed predominantly in ovaries and testes respectively. The HP1 paralogs also have distinct localization preferences in Drosophila cells. Thus, Rhino localizes to the heterochromatic compartment in Drosophila tissue culture cells, but in a pattern distinct from HP1A and lysine-9 dimethylated H3. Using molecular evolution and population genetic analyses, we find that rhino has been subject to positive selection in all three domains of the protein: the N-terminal chromo domain, the C-terminal chromo-shadow domain, and the hinge region that connects these two modules. Maximum likelihood analysis of rhino sequences from 20 species of Drosophila reveals that a small number of residues of the chromo and shadow domains have been subject to repeated positive selection. The rapid and positive selection of rhino is highly unusual for a gene encoding a chromosomal protein and suggests that rhino is involved in a genetic conflict that affects the germline, belying the notion that heterochromatin is simply a passive recipient of "junk DNA" in eukaryotic genomes.

Anti-viral RNA silencing: do we look like plants ?

Directory of Open Access Journals (Sweden)

Lecellier Charles-Henri

2006-01-01

Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

FlyMAD: rapid thermogenetic control of neuronal activity in freely walking Drosophila.

Science.gov (United States)

Bath, Daniel E; Stowers, John R; Hörmann, Dorothea; Poehlmann, Andreas; Dickson, Barry J; Straw, Andrew D

2014-07-01

Rapidly and selectively modulating the activity of defined neurons in unrestrained animals is a powerful approach in investigating the circuit mechanisms that shape behavior. In Drosophila melanogaster, temperature-sensitive silencers and activators are widely used to control the activities of genetically defined neuronal cell types. A limitation of these thermogenetic approaches, however, has been their poor temporal resolution. Here we introduce FlyMAD (the fly mind-altering device), which allows thermogenetic silencing or activation within seconds or even fractions of a second. Using computer vision, FlyMAD targets an infrared laser to freely walking flies. As a proof of principle, we demonstrated the rapid silencing and activation of neurons involved in locomotion, vision and courtship. The spatial resolution of the focused beam enabled preferential targeting of neurons in the brain or ventral nerve cord. Moreover, the high temporal resolution of FlyMAD allowed us to discover distinct timing relationships for two neuronal cell types previously linked to courtship song.

Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.

Science.gov (United States)

Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide

2017-10-13

Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Substrates for Neuronal Cotransmission With Neuropeptides and Small Molecule Neurotransmitters in Drosophila

Directory of Open Access Journals (Sweden)

Dick R. Nässel

2018-03-01

Full Text Available It has been known for more than 40 years that individual neurons can produce more than one neurotransmitter and that neuropeptides often are colocalized with small molecule neurotransmitters (SMNs. Over the years much progress has been made in understanding the functional consequences of cotransmission in the nervous system of mammals. There are also some excellent invertebrate models that have revealed roles of coexpressed neuropeptides and SMNs in increasing complexity, flexibility, and dynamics in neuronal signaling. However, for the fly Drosophila there are surprisingly few functional studies on cotransmission, although there is ample evidence for colocalization of neuroactive compounds in neurons of the CNS, based both on traditional techniques and novel single cell transcriptome analysis. With the hope to trigger interest in initiating cotransmission studies, this review summarizes what is known about Drosophila neurons and neuronal circuits where different neuropeptides and SMNs are colocalized. Coexistence of neuroactive substances has been recorded in different neuron types such as neuroendocrine cells, interneurons, sensory cells and motor neurons. Some of the circuits highlighted here are well established in the analysis of learning and memory, circadian clock networks regulating rhythmic activity and sleep, as well as neurons and neuroendocrine cells regulating olfaction, nociception, feeding, metabolic homeostasis, diuretic functions, reproduction, and developmental processes. One emerging trait is the broad role of short neuropeptide F in cotransmission and presynaptic facilitation in a number of different neuronal circuits. This review also discusses the functional relevance of coexisting peptides in the intestine. Based on recent single cell transcriptomics data, it is likely that the neuronal systems discussed in this review are just a fraction of the total set of circuits where cotransmission occurs in Drosophila. Thus, a

Substrates for Neuronal Cotransmission With Neuropeptides and Small Molecule Neurotransmitters in Drosophila

Science.gov (United States)

Nässel, Dick R.

2018-01-01

It has been known for more than 40 years that individual neurons can produce more than one neurotransmitter and that neuropeptides often are colocalized with small molecule neurotransmitters (SMNs). Over the years much progress has been made in understanding the functional consequences of cotransmission in the nervous system of mammals. There are also some excellent invertebrate models that have revealed roles of coexpressed neuropeptides and SMNs in increasing complexity, flexibility, and dynamics in neuronal signaling. However, for the fly Drosophila there are surprisingly few functional studies on cotransmission, although there is ample evidence for colocalization of neuroactive compounds in neurons of the CNS, based both on traditional techniques and novel single cell transcriptome analysis. With the hope to trigger interest in initiating cotransmission studies, this review summarizes what is known about Drosophila neurons and neuronal circuits where different neuropeptides and SMNs are colocalized. Coexistence of neuroactive substances has been recorded in different neuron types such as neuroendocrine cells, interneurons, sensory cells and motor neurons. Some of the circuits highlighted here are well established in the analysis of learning and memory, circadian clock networks regulating rhythmic activity and sleep, as well as neurons and neuroendocrine cells regulating olfaction, nociception, feeding, metabolic homeostasis, diuretic functions, reproduction, and developmental processes. One emerging trait is the broad role of short neuropeptide F in cotransmission and presynaptic facilitation in a number of different neuronal circuits. This review also discusses the functional relevance of coexisting peptides in the intestine. Based on recent single cell transcriptomics data, it is likely that the neuronal systems discussed in this review are just a fraction of the total set of circuits where cotransmission occurs in Drosophila. Thus, a systematic search for

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

Science.gov (United States)

Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

The genetic makeup of the Drosophila piRNA pathway.

Science.gov (United States)

Handler, Dominik; Meixner, Katharina; Pizka, Manfred; Lauss, Kathrin; Schmied, Christopher; Gruber, Franz Sebastian; Brennecke, Julius

2013-06-06

The piRNA (PIWI-interacting RNA) pathway is a small RNA silencing system that acts in animal gonads and protects the genome against the deleterious influence of transposons. A major bottleneck in the field is the lack of comprehensive knowledge of the factors and molecular processes that constitute this pathway. We conducted an RNAi screen in Drosophila and identified ~50 genes that strongly impact the ovarian somatic piRNA pathway. Many identified genes fall into functional categories that indicate essential roles for mitochondrial metabolism, RNA export, the nuclear pore, transcription elongation, and chromatin regulation in the pathway. Follow-up studies on two factors demonstrate that components acting at distinct hierarchical levels of the pathway were identified. Finally, we define CG2183/Gasz as an essential primary piRNA biogenesis factor in somatic and germline cells. Based on the similarities between insect and vertebrate piRNA pathways, our results have far-reaching implications for the understanding of this conserved genome defense system. Copyright © 2013 Elsevier Inc. All rights reserved.

Comparative Analysis of Chromatin Binding by Sex Comb on Midleg (SCM) and Other Polycomb Group Repressors at a Drosophila Hox Gene▿

OpenAIRE

Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.

2010-01-01

Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and othe...

Rapid and highly accurate detection of Drosophila suzukii, spotted wing Drosophila (Diptera: Drosophilidae) by loop-mediated isothermal amplification assays

Science.gov (United States)

Drosophila suzukii, the spotted wing drosophila (SWD), is currently a major pest that causes severe economic losses to thin-skinned, small fruit growers in North America and Europe. The monitoring and early detection of SWD in the field is of the utmost importance for its proper management. Althou...

Silence multiple

DEFF Research Database (Denmark)

Søndergaard, Katia Dupret

The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

Polymer nanoparticles for drug and small silencing RNA delivery to treat cancers of different phenotypes

Science.gov (United States)

Devulapally, Rammohan; Paulmurugan, Ramasamy

2013-01-01

Advances in nanotechnology have provided powerful and efficient tools in development of cancer diagnosis and therapy. There are numerous nanocarriers that are currently approved for clinical use in cancer therapy. In recent years, biodegradable polymer nanoparticles (NPs) have attracted a considerable attention for their ability to function as a possible carrier for target-specific delivery of various drugs, genes, proteins, peptides, vaccines, and other biomolecules in humans without much toxicity. This review will specifically focus on the recent advances in polymer-based nanocarriers for various drugs and small silencing RNA’s loading and delivery to treat different types of cancer. PMID:23996830

Gender-specific hierarchy in nuage localization of PIWI-interacting RNA factors in Drosophila

Directory of Open Access Journals (Sweden)

Mikiko C Siomi

2011-08-01

Full Text Available PIWI-interacting RNAs (piRNAs are germline-specific small non-coding RNAs that form piRNA-induced silencing complexes (piRISCs by associating with PIWI proteins, a subclade of the Argonaute proteins predominantly expressed in the germline. piRISCs protect the integrity of the germline genome from invasive transposable DNA elements by silencing them. Multiple piRNA biogenesis factors have been identified in Drosophila. The majority of piRNA factors are localized in the nuage, electron-dense non-membranous cytoplasmic structures located in the perinuclear regions of germ cells. Thus, piRNA biogenesis is thought to occur in the nuage in germ cells. Immunofluorescence analyses of ovaries from piRNA factor mutants have revealed a localization hierarchy of piRNA factors in female nuage. However, whether this hierarchy is female-specific or can also be applied in male gonads remains undetermined. Here, we show by immunostaining of both ovaries and testes from piRNA factor mutants that the molecular hierarchy of piRNA factors shows gender-specificity, especially for Krimper (Krimp, a Tudor-domain containing protein of unknown function(s: Krimp is dispensable for PIWI protein Aubergine (Aub nuage localization in ovaries but Krimp and Aub require each other for their proper nuage localization in testes. This suggests that the functional requirement of Krimp in piRNA biogenesis may be different in male and female gonads.

A novel assay reveals hygrotactic behavior in Drosophila.

Directory of Open Access Journals (Sweden)

Feiteng Ji

Full Text Available Humidity is one of the most important factors that determines the geographical distribution and survival of terrestrial animals. The ability to detect variation in humidity is conserved across many species. Here, we established a novel behavioral assay that revealed the thirsty Drosophila exhibits strong hygrotactic behavior, and it can locate water by detecting humidity gradient. In addition, exposure to high levels of moisture was sufficient to elicit proboscis extension reflex behavior in thirsty flies. Furthermore, we found that the third antennal segment was necessary for hygrotactic behavior in thirsty flies, while arista was required for the avoidance of moist air in hydrated flies. These results indicated that two types of hygroreceptor cells exist in Drosophila: one located in the third antennal segment that mediates hygrotactic behavior in thirst status, and the other located in arista which is responsible for the aversive behavior toward moist air in hydration status. Using a neural silencing screen, we demonstrated that synaptic output from the mushroom body α/β surface and posterior neurons was required for both hygrotactic behavior and moisture-aversive behavior.

A complex small RNA repertoire is generated by a plant/fungal-like machinery and effected by a metazoan-like Argonaute in the single-cell human parasite Toxoplasma gondii.

Directory of Open Access Journals (Sweden)

Laurence Braun

2010-05-01

Full Text Available In RNA silencing, small RNAs produced by the RNase-III Dicer guide Argonaute-like proteins as part of RNA-induced silencing complexes (RISC to regulate gene expression transcriptionally or post-transcriptionally. Here, we have characterized the RNA silencing machinery and exhaustive small RNAome of Toxoplasma gondii, member of the Apicomplexa, a phylum of animal- and human-infecting parasites that cause extensive health and economic damages to human populations worldwide. Remarkably, the small RNA-generating machinery of Toxoplasma is phylogenetically and functionally related to that of plants and fungi, and accounts for an exceptionally diverse array of small RNAs. This array includes conspicuous populations of repeat-associated small interfering RNA (siRNA, which, as in plants, likely generate and maintain heterochromatin at DNA repeats and satellites. Toxoplasma small RNAs also include many microRNAs with clear metazoan-like features whose accumulation is sometimes extremely high and dynamic, an unexpected finding given that Toxoplasma is a unicellular protist. Both plant-like heterochromatic small RNAs and metazoan-like microRNAs bind to a single Argonaute protein, Tg-AGO. Toxoplasma miRNAs co-sediment with polyribosomes, and thus, are likely to act as translational regulators, consistent with the lack of catalytic residues in Tg-AGO. Mass spectrometric analyses of the Tg-AGO protein complex revealed a common set of virtually all known RISC components so far characterized in human and Drosophila, as well as novel proteins involved in RNA metabolism. In agreement with its loading with heterochromatic small RNAs, Tg-AGO also associates substoichiometrically with components of known chromatin-repressing complexes. Thus, a puzzling patchwork of silencing processor and effector proteins from plant, fungal and metazoan origin accounts for the production and action of an unsuspected variety of small RNAs in the single-cell parasite Toxoplasma and

Abolishment of Spontaneous Flight Turns in Visually Responsive Drosophila.

Science.gov (United States)

Ferris, Bennett Drew; Green, Jonathan; Maimon, Gaby

2018-01-22

Animals react rapidly to external stimuli, such as an approaching predator, but in other circumstances, they seem to act spontaneously, without any obvious external trigger. How do the neural processes mediating the execution of reflexive and spontaneous actions differ? We studied this question in tethered, flying Drosophila. We found that silencing a large but genetically defined set of non-motor neurons virtually eliminates spontaneous flight turns while preserving the tethered flies' ability to perform two types of visually evoked turns, demonstrating that, at least in flies, these two modes of action are almost completely dissociable. Copyright © 2017 Elsevier Ltd. All rights reserved.

Downregulation of DmMANF in Glial Cells Results in Neurodegeneration and Affects Sleep and Lifespan in Drosophila melanogaster

Directory of Open Access Journals (Sweden)

Lucyna Walkowicz

2017-11-01

Full Text Available In Drosophila melanogaster, mesencephalic astrocyte-derived neurotrophic factor (DmMANF is an evolutionarily conserved ortholog of mammalian MANF and cerebral dopamine neurotrophic factor (CDNF, which have been shown to promote the survival of dopaminergic neurons in the brain. We observed especially high levels of DmMANF in the visual system of Drosophila, particularly in the first optic neuropil (lamina. In the lamina, DmMANF was found in glial cells (surface and epithelial glia, photoreceptors and interneurons. Interestingly, silencing of DmMANF in all neurons or specifically in photoreceptors or L2 interneurons had no impact on the structure of the visual system. However, downregulation of DmMANF in glial cells induced degeneration of the lamina. Remarkably, this degeneration in the form of holes and/or tightly packed membranes was observed only in the lamina epithelial glial cells. Those membranes seem to originate from the endoplasmic reticulum, which forms autophagosome membranes. Moreover, capitate projections, the epithelial glia invaginations into photoreceptor terminals that are involved in recycling of the photoreceptor neurotransmitter histamine, were less numerous after DmMANF silencing either in neurons or glial cells. The distribution of the alpha subunit of Na+/K+-ATPase protein in the lamina cell membranes was also changed. At the behavioral level, silencing of DmMANF either in neurons or glial cells affected the daily activity/sleep pattern, and flies showed less activity during the day but higher activity during the night than did controls. In the case of silencing in glia, the lifespan of flies was also shortened. The obtained results showed that DmMANF regulates many functions in the brain, particularly those dependent on glial cells.

Dopaminergic neurons encode a distributed, asymmetric representation of temperature in Drosophila.

Science.gov (United States)

Tomchik, Seth M

2013-01-30

Dopaminergic circuits modulate a wide variety of innate and learned behaviors in animals, including olfactory associative learning, arousal, and temperature-preference behavior. It is not known whether distinct or overlapping sets of dopaminergic neurons modulate these behaviors. Here, I have functionally characterized the dopaminergic circuits innervating the Drosophila mushroom body with in vivo calcium imaging and conditional silencing of genetically defined subsets of neurons. Distinct subsets of PPL1 dopaminergic neurons innervating the vertical lobes of the mushroom body responded to decreases in temperature, but not increases, with rapidly adapting bursts of activity. PAM neurons innervating the horizontal lobes did not respond to temperature shifts. Ablation of the antennae and maxillary palps reduced, but did not eliminate, the responses. Genetic silencing of dopaminergic neurons innervating the vertical mushroom body lobes substantially reduced behavioral cold avoidance, but silencing smaller subsets of these neurons had no effect. These data demonstrate that overlapping dopaminergic circuits encode a broadly distributed, asymmetric representation of temperature that overlays regions implicated previously in learning, memory, and forgetting. Thus, diverse behaviors engage overlapping sets of dopaminergic neurons that encode multimodal stimuli and innervate a single anatomical target, the mushroom body.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

OpenAIRE

Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

Drosophila suzukii population response to environment and management strategies

Science.gov (United States)

Spotted wing drosophila, Drosophila suzukii, quickly emerged as a devastating invasive pest of small and stone fruits in the Americas and Europe. To better understand the population dynamics of D. suzukii, we reviewed recent work on juvenile development, adult reproduction, and seasonal variation in...

A Polymorphism in the Processing Body Component Ge-1 Controls Resistance to a Naturally Occurring Rhabdovirus in Drosophila.

Directory of Open Access Journals (Sweden)

Chuan Cao

2016-01-01

Full Text Available Hosts encounter an ever-changing array of pathogens, so there is continual selection for novel ways to resist infection. A powerful way to understand how hosts evolve resistance is to identify the genes that cause variation in susceptibility to infection. Using high-resolution genetic mapping we have identified a naturally occurring polymorphism in a gene called Ge-1 that makes Drosophila melanogaster highly resistant to its natural pathogen Drosophila melanogaster sigma virus (DMelSV. By modifying the sequence of the gene in transgenic flies, we identified a 26 amino acid deletion in the serine-rich linker region of Ge-1 that is causing the resistance. Knocking down the expression of the susceptible allele leads to a decrease in viral titre in infected flies, indicating that Ge-1 is an existing restriction factor whose antiviral effects have been increased by the deletion. Ge-1 plays a central role in RNA degradation and the formation of processing bodies (P bodies. A key effector in antiviral immunity, the RNAi induced silencing complex (RISC, localises to P bodies, but we found that Ge-1-based resistance is not dependent on the small interfering RNA (siRNA pathway. However, we found that Decapping protein 1 (DCP1 protects flies against sigma virus. This protein interacts with Ge-1 and commits mRNA for degradation by removing the 5' cap, suggesting that resistance may rely on this RNA degradation pathway. The serine-rich linker domain of Ge-1 has experienced strong selection during the evolution of Drosophila, suggesting that this gene may be under long-term selection by viruses. These findings demonstrate that studying naturally occurring polymorphisms that increase resistance to infections enables us to identify novel forms of antiviral defence, and support a pattern of major effect polymorphisms controlling resistance to viruses in Drosophila.

A synthetic maternal-effect selfish genetic element drives population replacement in Drosophila.

Science.gov (United States)

Chen, Chun-Hong; Huang, Haixia; Ward, Catherine M; Su, Jessica T; Schaeffer, Lorian V; Guo, Ming; Hay, Bruce A

2007-04-27

One proposed strategy for controlling the transmission of insect-borne pathogens uses a drive mechanism to ensure the rapid spread of transgenes conferring disease refractoriness throughout wild populations. Here, we report the creation of maternal-effect selfish genetic elements in Drosophila that drive population replacement and are resistant to recombination-mediated dissociation of drive and disease refractoriness functions. These selfish elements use microRNA-mediated silencing of a maternally expressed gene essential for embryogenesis, which is coupled with early zygotic expression of a rescuing transgene.

Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia.

Science.gov (United States)

Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira

2013-01-30

Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

First foreign exploration for asian parasitoids of Drosophila suzukii

Science.gov (United States)

The invasive spotted wing drosophila, Drosophila suzukii Matsumura (Dipt.: Drosophilidae), is a native of East Asia and is now widely established in North America and Europe, where it is a serious pest of small and stone fruit crops. The lack of effective indigenous parasitoids of D. suzukii in the ...

Effects of siRNA Silencing of TUG1 and LCAL6 Long Non-coding RNAs on Patient-derived Xenograft of Non-small Cell Lung Cancer.

Science.gov (United States)

Fang, Tian; Huang, Hairong; Li, Xiaoyou; Liao, Jing; Yang, Zhijian; Hoffman, Robert M; Cheng, X I; Liang, Lei; Hu, Wenjuan; Yun, Shifeng

2018-01-01

The aim of the present study was to establish a patient-derived xenograft (PDX) mouse model of non-small cell lung cancer (NSCLC) and investigate the anti-tumor efficacy of silencing of TUG1 and LCAL6 long non-coding RNA in the PDX model. PDXs were established by subcutaneously implanting NSCLC surgical tumor fragments into immunodeficient mice. PDX characterization was performed by histopathological, immunohistochemical and real-time polymerase chain reaction (RT-PCR) analyses for NSCLC subtype-specific markers and expression of LCAL6 and TUG1. Anti-tumor efficacy of siRNA silencing of TUG1 and LCAL6 was also investigated in the PDX model. The effect of TUG1 and LCAL6 silencing on protein expression of proliferation marker Ki67 and HOX-gene family HOXB7 in the tumors was assessed by immunohistochemical staining and Western blotting. Establishment of NSCLC PDX models resulted in 9 of 26 cases (34.6%). Lung squamous cell carcinomas (SCC) had a higher engraftment rate (58.3%) than lung adenocarcinomas (ADC) (18.2%) (pTUG1. The tumor volume and weight were significantly reduced in the TUG1-silenced group as compared to the control group (p0.05). Expression of both TUG1and LCAL6 was reduced by siRNA treatment. Expression of Ki67 and HOXB7 was significantly suppressed in both the TUG1- and LCAL6-silenced groups compared to the control group (pTUG1-silenced group showed more reduced Ki67 expression than the LCAL6-silenced group (pTUG1 and LCAL6. Silencing of TUG1 inhibited both tumor growth and expression of the proliferation marker Ki67 and HOX-gene family HOXB7 in the PDX model of NSCLC. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Distinct functions for the Drosophila piRNA pathway in genome maintenance and telomere protection.

Directory of Open Access Journals (Sweden)

Jaspreet S Khurana

2010-12-01

Full Text Available Transposons and other selfish DNA elements can be found in all phyla, and mobilization of these elements can compromise genome integrity. The piRNA (PIWI-interacting RNA pathway silences transposons in the germline, but it is unclear if this pathway has additional functions during development. Here we show that mutations in the Drosophila piRNA pathway genes, armi, aub, ago3, and rhi, lead to extensive fragmentation of the zygotic genome during the cleavage stage of embryonic divisions. Additionally, aub and armi show defects in telomere resolution during meiosis and the cleavage divisions; and mutations in lig-IV, which disrupt non-homologous end joining, suppress these fusions. By contrast, lig-IV mutations enhance chromosome fragmentation. Chromatin immunoprecipitation studies show that aub and armi mutations disrupt telomere binding of HOAP, which is a component of the telomere protection complex, and reduce expression of a subpopulation of 19- to 22-nt telomere-specific piRNAs. Mutations in rhi and ago3, by contrast, do not block HOAP binding or production of these piRNAs. These findings uncover genetically separable functions for the Drosophila piRNA pathway. The aub, armi, rhi, and ago3 genes silence transposons and maintain chromosome integrity during cleavage-stage embryonic divisions. However, the aub and armi genes have an additional function in assembly of the telomere protection complex.

Metabolome analysis of Drosophila melanogaster during embryogenesis.

Science.gov (United States)

An, Phan Nguyen Thuy; Yamaguchi, Masamitsu; Bamba, Takeshi; Fukusaki, Eiichiro

2014-01-01

The Drosophila melanogaster embryo has been widely utilized as a model for genetics and developmental biology due to its small size, short generation time, and large brood size. Information on embryonic metabolism during developmental progression is important for further understanding the mechanisms of Drosophila embryogenesis. Therefore, the aim of this study is to assess the changes in embryos' metabolome that occur at different stages of the Drosophila embryonic development. Time course samples of Drosophila embryos were subjected to GC/MS-based metabolome analysis for profiling of low molecular weight hydrophilic metabolites, including sugars, amino acids, and organic acids. The results showed that the metabolic profiles of Drosophila embryo varied during the course of development and there was a strong correlation between the metabolome and different embryonic stages. Using the metabolome information, we were able to establish a prediction model for developmental stages of embryos starting from their high-resolution quantitative metabolite composition. Among the important metabolites revealed from our model, we suggest that different amino acids appear to play distinct roles in different developmental stages and an appropriate balance in trehalose-glucose ratio is crucial to supply the carbohydrate source for the development of Drosophila embryo.

The RNA silencing pathway: the bits and pieces that matter.

Directory of Open Access Journals (Sweden)

2005-07-01

Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

Slicer-independent mechanism drives small-RNA strand separation during human RISC assembly.

Science.gov (United States)

Park, June Hyun; Shin, Chanseok

2015-10-30

Small RNA silencing is mediated by the effector RNA-induced silencing complex (RISC) that consists of an Argonaute protein (AGOs 1-4 in humans). A fundamental step during RISC assembly involves the separation of two strands of a small RNA duplex, whereby only the guide strand is retained to form the mature RISC, a process not well understood. Despite the widely accepted view that 'slicer-dependent unwinding' via passenger-strand cleavage is a prerequisite for the assembly of a highly complementary siRNA into the AGO2-RISC, here we show by careful re-examination that 'slicer-independent unwinding' plays a more significant role in human RISC maturation than previously appreciated, not only for a miRNA duplex, but, unexpectedly, for a highly complementary siRNA as well. We discovered that 'slicer-dependency' for the unwinding was affected primarily by certain parameters such as temperature and Mg(2+). We further validate these observations in non-slicer AGOs (1, 3 and 4) that can be programmed with siRNAs at the physiological temperature of humans, suggesting that slicer-independent mechanism is likely a common feature of human AGOs. Our results now clearly explain why both miRNA and siRNA are found in all four human AGOs, which is in striking contrast to the strict small-RNA sorting system in Drosophila. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Igf2/H19 Imprinting Control Region (ICR: An Insulator or a Position-Dependent Silencer?

Directory of Open Access Journals (Sweden)

Subhasis Banerjee

2001-01-01

Full Text Available The imprinting control region (ICR located far upstream of the H19 gene, in conjunction with enhancers, modulates the transcription of Igf2 and H19 genes in an allele-specific manner. On paternal inheritance, the methylated ICR silences the H19 gene and indirectly facilitates transcription from the distant Igf2 promoter, whereas on the maternal chromosome the unmethylated ICR, together with enhancers, activates transcription of the H19 gene and thereby contributes to the repression of Igf2. This repression of maternal Igf2 has recently been postulated to be due to a chromatin boundary or insulator function of the unmethylated ICR. Central to the insulator model is the site-specific binding of a ubiquitous nuclear factor CTCF which exhibits remarkable flexibility in functioning as transcriptional activator or silencer. We suggest that the ICR positioned close to the enhancers in an episomal context might function as a transcriptional silencer by virtue of interaction of CTCF with its modifiers such as SIN3A and histone deacetylases. Furthermore, a localised folded chromatin structure resulting from juxtaposition of two disparate regulatory sequences (enhancer ICR could be the mechanistic basis of ICR-mediated position-dependent (ICR-promoter transcriptional repression in transgenic Drosophila.

Modeling Fragile X Syndrome in Drosophila

Science.gov (United States)

Drozd, Małgorzata; Bardoni, Barbara; Capovilla, Maria

2018-01-01

Intellectual disability (ID) and autism are hallmarks of Fragile X Syndrome (FXS), a hereditary neurodevelopmental disorder. The gene responsible for FXS is Fragile X Mental Retardation gene 1 (FMR1) encoding the Fragile X Mental Retardation Protein (FMRP), an RNA-binding protein involved in RNA metabolism and modulating the expression level of many targets. Most cases of FXS are caused by silencing of FMR1 due to CGG expansions in the 5′-UTR of the gene. Humans also carry the FXR1 and FXR2 paralogs of FMR1 while flies have only one FMR1 gene, here called dFMR1, sharing the same level of sequence homology with all three human genes, but functionally most similar to FMR1. This enables a much easier approach for FMR1 genetic studies. Drosophila has been widely used to investigate FMR1 functions at genetic, cellular, and molecular levels since dFMR1 mutants have many phenotypes in common with the wide spectrum of FMR1 functions that underlay the disease. In this review, we present very recent Drosophila studies investigating FMRP functions at genetic, cellular, molecular, and electrophysiological levels in addition to research on pharmacological treatments in the fly model. These studies have the potential to aid the discovery of pharmacological therapies for FXS. PMID:29713264

Mapping of gene mutations in drosophila melanogaster

OpenAIRE

Halvorsen, Charlotte Marie

2004-01-01

In this experiment, mutant genes of a given unknown mutant strain of Drosophila melanogaster were mapped to specific chromosomes. Drosophila melanogaster, commonly known as the fruit fly, was the appropriate choice for the organism to use in this specific experiment because of its relatively rapid life cycle of 10-14 days and because of the small amount of space and food neccessary for maintaining thousands of flies. The D. Melanogaster unknown strain specifically used in this experiment wa...

A conserved small RNA promotes silencing of the outer membrane protein YbfM

DEFF Research Database (Denmark)

Rasmussen, Anders Aamann; Johansen, Jesper; Nielsen, Jesper S

2009-01-01

important physiological role of regulatory RNA molecules in Gram-negative bacteria is to modulate the cell surface and/or to prevent accumulation of OMPs in the envelope. Here, we extend the OMP-sRNA network by showing that the expression of the outer membrane protein YbfM is silenced by a conserved sRNA......In the past few years an increasing number of small non-coding RNAs (sRNAs) in enterobacteria have been found to negatively regulate the expression of outer membrane proteins (OMPs) at the post-transcriptional level. These RNAs act under various growth and stress conditions, suggesting that one......, designated MicM (also known as RybC/SroB). The regulation is strictly dependent on the RNA chaperone Hfq, and mutational analysis indicates that MicM sequesters the ribosome binding site of ybfM mRNA by an antisense mechanism. Furthermore, we provide evidence that Hfq strongly enhances the on-rate of duplex...

Transposon defense by endo-siRNAs, piRNAs and somatic pilRNAs in Drosophila: contributions of Loqs-PD and R2D2.

Directory of Open Access Journals (Sweden)

Milijana Mirkovic-Hösle

Full Text Available Transposable elements are a serious threat for genome integrity and their control via small RNA mediated silencing pathways is an ancient strategy. The fruit fly Drosophila melanogaster has two silencing activities that target transposons: endogenous siRNAs (esiRNAs or endo-siRNAs and Piwi-interacting small RNAs (piRNAs. The biogenesis of endo-siRNAs involves the Dicer-2 co-factors Loqs-PD, which acts predominantly during processing of dsRNA by Dcr-2, and R2D2, which primarily helps to direct siRNAs into the RNA interference effector Ago2. Nonetheless, loss of either protein is not sufficient to produce a phenotype comparable with a dcr-2 mutation. We provide further deep sequencing evidence supporting the notion that R2D2 and Loqs-PD have partially overlapping function. Certain transposons display a preference for either dsRBD-protein during production or loading; this appeared to correlate neither with overall abundance, classification of the transposon or a specific site of genomic origin. The endo-siRNA biogenesis pathway in germline operates according to the same principles as the existing model for the soma, and its impairment does not significantly affect piRNAs. Expanding the analysis, we confirmed the occurrence of somatic piRNA-like RNAs (pilRNAs that show a ping-pong signature. We detected expression of the Piwi-family protein mRNAs only barely above background, indicating that the somatic pilRNAs may arise from a small sub-population of somatic cells that express a functional piRNA pathway.

Sex chromosome-specific regulation in the Drosophila male germline but little evidence for chromosomal dosage compensation or meiotic inactivation.

Directory of Open Access Journals (Sweden)

Colin D Meiklejohn

2011-08-01

Full Text Available The evolution of heteromorphic sex chromosomes (e.g., XY in males or ZW in females has repeatedly elicited the evolution of two kinds of chromosome-specific regulation: dosage compensation--the equalization of X chromosome gene expression in males and females--and meiotic sex chromosome inactivation (MSCI--the transcriptional silencing and heterochromatinization of the X during meiosis in the male (or Z in the female germline. How the X chromosome is regulated in the Drosophila melanogaster male germline is unclear. Here we report three new findings concerning gene expression from the X in Drosophila testes. First, X chromosome-wide dosage compensation appears to be absent from most of the Drosophila male germline. Second, microarray analysis provides no evidence for X chromosome-specific inactivation during meiosis. Third, we confirm the previous discovery that the expression of transgene reporters driven by autosomal spermatogenesis-specific promoters is strongly reduced when inserted on the X chromosome versus the autosomes; but we show that this chromosomal difference in expression is established in premeiotic cells and persists in meiotic cells. The magnitude of the X-autosome difference in transgene expression cannot be explained by the absence of dosage compensation, suggesting that a previously unrecognized mechanism limits expression from the X during spermatogenesis in Drosophila. These findings help to resolve several previously conflicting reports and have implications for patterns of genome evolution and speciation in Drosophila.

RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

Science.gov (United States)

Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

2016-12-01

Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

Performative Silences

DEFF Research Database (Denmark)

Dupret, Katia

2018-01-01

static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

CalpB modulates border cell migration in Drosophila egg chambers

Directory of Open Access Journals (Sweden)

Kókai Endre

2012-07-01

Full Text Available Abstract Background Calpains are calcium regulated intracellular cysteine proteases implicated in a variety of physiological functions and pathological conditions. The Drosophila melanogaster genome contains only two genes, CalpA and CalpB coding for canonical, active calpain enzymes. The movement of the border cells in Drosophila egg chambers is a well characterized model of the eukaryotic cell migration. Using this genetically pliable model we can investigate the physiological role of calpains in cell motility. Results We demonstrate at the whole organism level that CalpB is implicated in cell migration, while the structurally related CalpA paralog can not fulfill the same function. The downregulation of the CalpB gene by mutations or RNA interference results in a delayed migration of the border cells in Drosophila egg chambers. This phenotype is significantly enhanced when the focal adhesion complex genes encoding for α-PS2 integrin ( if, β-PS integrin ( mys and talin ( rhea are silenced. The reduction of CalpB activity diminishes the release of integrins from the rear end of the border cells. The delayed migration and the reduced integrin release phenotypes can be suppressed by expressing wild-type talin-head in the border cells but not talin-headR367A, a mutant form which is not able to bind β-PS integrin. CalpB can cleave talin in vitro, and the two proteins coimmunoprecipitate from Drosophila extracts. Conclusions The physiological function of CalpB in border cell motility has been demonstrated in vivo. The genetic interaction between the CalpB and the if, mys, as well as rhea genes, the involvement of active talin head-domains in the process, and the fact that CalpB and talin interact with each other collectively suggest that the limited proteolytic cleavage of talin is one of the possible mechanisms through which CalpB regulates cell migration.

The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster.

Science.gov (United States)

Webster, Claire L; Waldron, Fergal M; Robertson, Shaun; Crowson, Daisy; Ferrari, Giada; Quintana, Juan F; Brouqui, Jean-Michel; Bayne, Elizabeth H; Longdon, Ben; Buck, Amy H; Lazzaro, Brian P; Akorli, Jewelna; Haddrill, Penelope R; Obbard, Darren J

2015-07-01

Drosophila melanogaster is a valuable invertebrate model for viral infection and antiviral immunity, and is a focus for studies of insect-virus coevolution. Here we use a metagenomic approach to identify more than 20 previously undetected RNA viruses and a DNA virus associated with wild D. melanogaster. These viruses not only include distant relatives of known insect pathogens but also novel groups of insect-infecting viruses. By sequencing virus-derived small RNAs, we show that the viruses represent active infections of Drosophila. We find that the RNA viruses differ in the number and properties of their small RNAs, and we detect both siRNAs and a novel miRNA from the DNA virus. Analysis of small RNAs also allows us to identify putative viral sequences that lack detectable sequence similarity to known viruses. By surveying >2,000 individually collected wild adult Drosophila we show that more than 30% of D. melanogaster carry a detectable virus, and more than 6% carry multiple viruses. However, despite a high prevalence of the Wolbachia endosymbiont--which is known to be protective against virus infections in Drosophila--we were unable to detect any relationship between the presence of Wolbachia and the presence of any virus. Using publicly available RNA-seq datasets, we show that the community of viruses in Drosophila laboratories is very different from that seen in the wild, but that some of the newly discovered viruses are nevertheless widespread in laboratory lines and are ubiquitous in cell culture. By sequencing viruses from individual wild-collected flies we show that some viruses are shared between D. melanogaster and D. simulans. Our results provide an essential evolutionary and ecological context for host-virus interaction in Drosophila, and the newly reported viral sequences will help develop D. melanogaster further as a model for molecular and evolutionary virus research.

Resources for Functional Genomics Studies in Drosophila melanogaster

Science.gov (United States)

Mohr, Stephanie E.; Hu, Yanhui; Kim, Kevin; Housden, Benjamin E.; Perrimon, Norbert

2014-01-01

Drosophila melanogaster has become a system of choice for functional genomic studies. Many resources, including online databases and software tools, are now available to support design or identification of relevant fly stocks and reagents or analysis and mining of existing functional genomic, transcriptomic, proteomic, etc. datasets. These include large community collections of fly stocks and plasmid clones, “meta” information sites like FlyBase and FlyMine, and an increasing number of more specialized reagents, databases, and online tools. Here, we introduce key resources useful to plan large-scale functional genomics studies in Drosophila and to analyze, integrate, and mine the results of those studies in ways that facilitate identification of highest-confidence results and generation of new hypotheses. We also discuss ways in which existing resources can be used and might be improved and suggest a few areas of future development that would further support large- and small-scale studies in Drosophila and facilitate use of Drosophila information by the research community more generally. PMID:24653003

Quantification of Drosophila Grooming Behavior.

Science.gov (United States)

Barradale, Francesca; Sinha, Kairav; Lebestky, Tim

2017-07-19

Drosophila grooming behavior is a complex multi-step locomotor program that requires coordinated movement of both forelegs and hindlegs. Here we present a grooming assay protocol and novel chamber design that is cost-efficient and scalable for either small or large-scale studies of Drosophila grooming. Flies are dusted all over their body with Brilliant Yellow dye and given time to remove the dye from their bodies within the chamber. Flies are then deposited in a set volume of ethanol to solubilize the dye. The relative spectral absorbance of dye-ethanol samples for groomed versus ungroomed animals are measured and recorded. The protocol yields quantitative data of dye accumulation for individual flies, which can be easily averaged and compared across samples. This allows experimental designs to easily evaluate grooming ability for mutant animal studies or circuit manipulations. This efficient procedure is both versatile and scalable. We show work-flow of the protocol and comparative data between WT animals and mutant animals for the Drosophila type I Dopamine Receptor (DopR).

[Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

Science.gov (United States)

Mo, Xianchao; Li, Weizhong

2014-05-01

To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

A Genetic Toolkit for Dissecting Dopamine Circuit Function in Drosophila

Directory of Open Access Journals (Sweden)

Tingting Xie

2018-04-01

Full Text Available Summary: The neuromodulator dopamine (DA plays a key role in motor control, motivated behaviors, and higher-order cognitive processes. Dissecting how these DA neural networks tune the activity of local neural circuits to regulate behavior requires tools for manipulating small groups of DA neurons. To address this need, we assembled a genetic toolkit that allows for an exquisite level of control over the DA neural network in Drosophila. To further refine targeting of specific DA neurons, we also created reagents that allow for the conversion of any existing GAL4 line into Split GAL4 or GAL80 lines. We demonstrated how this toolkit can be used with recently developed computational methods to rapidly generate additional reagents for manipulating small subsets or individual DA neurons. Finally, we used the toolkit to reveal a dynamic interaction between a small subset of DA neurons and rearing conditions in a social space behavioral assay. : The rapid analysis of how dopaminergic circuits regulate behavior is limited by the genetic tools available to target and manipulate small numbers of these neurons. Xie et al. present genetic tools in Drosophila that allow rational targeting of sparse dopaminergic neuronal subsets and selective knockdown of dopamine signaling. Keywords: dopamine, genetics, behavior, neural circuits, neuromodulation, Drosophila

Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

Directory of Open Access Journals (Sweden)

Sirjana Devi Shrestha

Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

Selective elimination/RNAi silencing of FMRF-related peptides and their receptors decreases the locomotor activity in Drosophila melanogaster

Czech Academy of Sciences Publication Activity Database

Kiss, B.; Szlanka, T.; Zvara, Á.; Žurovec, Michal; Šerý, Michal; Kakaš, Štefan; Ramasz, B.; Hegedűs, Z.; Lukacsovich, T.; Puskás, L.; Fónagy, A.; Kiss, I.

2013-01-01

Roč. 191, SEP 15 (2013), s. 137-145 ISSN 0016-6480 Institutional support: RVO:60077344 Keywords : Drosophila melanogaster * FMRF-related peptides * G protein-coupled receptors Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.674, year: 2013 http://www.sciencedirect.com/science/article/pii/S0016648013002621

"Listening Silence" and Its Discursive Effects

Science.gov (United States)

Applebaum, Barbara

2016-01-01

While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…

Spotted wing drosophila prefer low hanging fruit: insights into foraging behavior and management strategies

Science.gov (United States)

Spotted wing drosophila (SWD), Drosophila suzukii, is an invasive insect that attacks ripe, small fruit such as raspberries, blackberries, and blueberries. Little is known about SWD foraging ecology, and current trapping and monitoring systems are ineffective at commercial scales. In caged foragin...

Overcoming cisplatin resistance in non-small cell lung cancer with Mad2 silencing siRNA delivered systemically using EGFR-targeted chitosan nanoparticles.

Science.gov (United States)

Nascimento, Ana Vanessa; Singh, Amit; Bousbaa, Hassan; Ferreira, Domingos; Sarmento, Bruno; Amiji, Mansoor M

2017-01-01

Efficiency of chemotherapy is often limited by low therapeutic index of the drug as well as emergence of inherent and acquired drug resistance in cancer cells. As a common strategy to overcome drug resistance, higher doses of chemo-agents are administered. However, adverse side effects are usually increased as a consequence. A potentially effective approach is to combine chemotherapy with other therapeutic strategies such as small interfering RNAs (siRNAs) that allow the use of lower yet efficient doses of the anticancer drugs. We previously developed epidermal growth factor receptor (EGFR)-targeted chitosan (CS) nanoparticles as a versatile delivery system for silencing the essential mitotic checkpoint gene Mad2, and induce cell death. Here, we tested this system as a single therapy and in combination with cisplatin in cisplatin sensitive and resistant lung cancer models, and characterized its in vivo efficacy and safety. Combination treatment resulted in significant improvement in tumor inhibition that was strikingly more effective in cisplatin-resistant tumors. Importantly, effective cisplatin dosage was dramatically reduced in the co-therapy regimen resulting in negligible toxic effects from the drug as confirmed by parameters such as body weight gain, biochemical markers of hepatic and renal function, and histopathology of liver/kidney/spleen tissues. Overall, we demonstrate that the combination of Mad2 siRNA-loaded CS nanoparticles strategy with chemotherapeutic agents such as cisplatin constitutes an efficient and safe approach for the treatment of drug resistant tumors. Lung cancer remains one of the leading killers in the United States and around the world. Platinum agents, including cisplatin, are the first line treatment in lung cancer, including non-small cell lung cancer (NSCLC), which is the predominant form of lung cancer. In this study, we have evaluated Mad2 cell-cycle checkpoint gene silencing using small interfering RNA (siRNA) delivered

The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

Science.gov (United States)

Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

2013-12-23

Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

Silencing of SARS-CoV spike gene by small interfering RNA in HEK 293T cells

International Nuclear Information System (INIS)

Qin Zhaoling; Zhao Ping; Zhang Xiaolian; Yu Jianguo; Cao Mingmei; Zhao Lanjuan; Luan Jie; Qi Zhongtian

2004-01-01

Two candidate small interfering RNAs (siRNAs) corresponding to severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike gene were designed and in vitro transcribed to explore the possibility of silencing SARS-CoV S gene. The plasmid pEGFP-optS, which contains the codon-optimized SARS-CoV S gene and expresses spike-EGFP fusion protein (S-EGFP) as silencing target and expressing reporter, was transfected with siRNAs into HEK 293T cells. At various time points of posttransfection, the levels of S-EGFP expression and amounts of spike mRNA transcript were detected by fluorescence microscopy, flow cytometry, Western blot, and real-time quantitative PCR, respectively. The results showed that the cells transfected with pEGFP-optS expressed S-EGFP fusion protein at a higher level compared with those transfected with pEGFP-S, which contains wildtype SARS-CoV spike gene sequence. The green fluorescence, mean fluorescence intensity, and SARS-CoV S RNA transcripts were found significantly reduced, and the expression of SARS-CoV S glycoprotein was strongly inhibited in those cells co-transfected with either EGFP- or S-specific siRNAs. Our findings demonstrated that the S-specific siRNAs used in this study were able to specifically and effectively inhibit SARS-CoV S glycoprotein expression in cultured cells through blocking the accumulation of S mRNA, which may provide an approach for studies on the functions of SARS-CoV S gene and development of novel prophylactic or therapeutic agents for SARS-CoV

Histone methylation-mediated silencing of miR-139 enhances invasion of non-small-cell lung cancer

International Nuclear Information System (INIS)

Watanabe, Kousuke; Amano, Yosuke; Ishikawa, Rie; Sunohara, Mitsuhiro; Kage, Hidenori; Ichinose, Junji; Sano, Atsushi; Nakajima, Jun; Fukayama, Masashi; Yatomi, Yutaka; Nagase, Takahide; Ohishi, Nobuya; Takai, Daiya

2015-01-01

MicroRNA expression is frequently altered in human cancers, and some microRNAs act as oncogenes or tumor suppressors. MiR-139-5p (denoted thereafter as miR-139) has recently been reported to function as a tumor suppressor in several types of human cancer (hepatocellular carcinoma, colorectal cancer, breast cancer, and gastric cancer), but its function in non-small-cell lung cancer (NSCLC) and the mechanism of its suppression have not been studied in detail. MiR-139 was suppressed frequently in primary NSCLCs. MiR-139 is located within the intron of PDE2A and its expression was significantly correlated with the expression of PDE2A. A chromatin immunoprecipitation assay revealed that miR-139 was epigenetically silenced by histone H3 lysine 27 trimethylation (H3K27me3) of its host gene PDE2A and this process was independent of promoter DNA methylation. Pharmacological inhibition of both histone methylation and deacetylation-induced miR-139 with its host gene PDE2A. Ectopic expression of miR-139 in lung cancer cell lines did not affect the proliferation nor the migration but significantly suppressed the invasion through the extracellular matrix. In primary NSCLCs, decreased expression of miR-139 was significantly associated with distant lymph node metastasis and histological invasiveness (lymphatic invasion and vascular invasion) on both univariate and multivariate analyses. Collectively, these results suggest that H3K27me3-mediated silencing of miR-139 enhances an invasive and metastatic phenotype of NSCLC

Biotic and abiotic factors impacting development, behavior, phenology, and reproductive biology of Drosophila suzukii

Science.gov (United States)

Spotted wing drosophila, Drosophila suzukii, quickly emerged as a devastating invasive pest of small and stone fruits in the Americas and Europe. To better understand the population dynamics of D. suzukii, we reviewed recent work on juvenile development, adult reproduction, and seasonal variation in...

Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing

Czech Academy of Sciences Publication Activity Database

Crhák Khaitová, Lucie; Fojtová, M.; Křížová, Kateřina; Lunerová Bedřichová, Jana; Fulneček, Jaroslav; Depicker, A.; Kovařík, Aleš

2011-01-01

Roč. 6, č. 5 (2011), s. 650-660 ISSN 1559-2294 R&D Projects: GA ČR(CZ) GD204/09/H002; GA MŠk(CZ) LC06004 Grant - others:GA ČR(CZ) GPP501/11/P667 Program:GP Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : transcriptional gene silencing * transgene epialleles * DNA methylation Subject RIV: BO - Biophysics Impact factor: 4.318, year: 2011

Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

Science.gov (United States)

Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

2011-12-01

Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

Science.gov (United States)

Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

2016-03-01

Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

Novel synthetic Medea selfish genetic elements drive population replacement in Drosophila; a theoretical exploration of Medea-dependent population suppression.

Science.gov (United States)

Akbari, Omar S; Chen, Chun-Hong; Marshall, John M; Huang, Haixia; Antoshechkin, Igor; Hay, Bruce A

2014-12-19

Insects act as vectors for diseases of plants, animals, and humans. Replacement of wild insect populations with genetically modified individuals unable to transmit disease provides a potentially self-perpetuating method of disease prevention. Population replacement requires a gene drive mechanism in order to spread linked genes mediating disease refractoriness through wild populations. We previously reported the creation of synthetic Medea selfish genetic elements able to drive population replacement in Drosophila. These elements use microRNA-mediated silencing of myd88, a maternally expressed gene required for embryonic dorso-ventral pattern formation, coupled with early zygotic expression of a rescuing transgene, to bring about gene drive. Medea elements that work through additional mechanisms are needed in order to be able to carry out cycles of population replacement and/or remove existing transgenes from the population, using second-generation elements that spread while driving first-generation elements out of the population. Here we report the synthesis and population genetic behavior of two new synthetic Medea elements that drive population replacement through manipulation of signaling pathways involved in cellular blastoderm formation or Notch signaling, demonstrating that in Drosophila Medea elements can be generated through manipulation of diverse signaling pathways. We also describe the mRNA and small RNA changes in ovaries and early embryos associated from Medea-bearing females. Finally, we use modeling to illustrate how Medea elements carrying genes that result in diapause-dependent female lethality could be used to bring about population suppression.

E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing.

Directory of Open Access Journals (Sweden)

Minami Mazda

Full Text Available RNA activation has been reported to be induced by small interfering RNAs (siRNAs that act on the promoters of several genes containing E-cadherin. In this study, we present an alternative mechanism of E-cadherin activation in human PC-3 cells by siRNAs previously reported to possess perfect-complementary sequences to E-cadherin promoter. We found that activation of E-cadherin can be also induced via suppression of ZEB1, which is a transcriptional repressor of E-cadherin, by seed-dependent silencing mechanism of these siRNAs. The functional seed-complementary sites of the siRNAs were found in the coding region in addition to the 3' untranslated region of ZEB1 mRNA. Promoter analyses indicated that E-boxes, which are ZEB1-binding sites, in the upstream promoter region are indispensable for E-cadherin transcription by the siRNAs. Thus, the results caution against ignoring siRNA seed-dependent silencing effects in genome-wide transcriptional regulation. In addition, members of miR-302/372/373/520 family, which have the same seed sequences with one of the siRNAs containing perfect-complementarity to E-cadherin promoter, are also found to activate E-cadherin transcription. Thus, E-cadherin could be upregulated by the suppression of ZEB1 transcriptional repressor by miRNAs in vivo.

Or47b receptor neurons mediate sociosexual interactions in the fruit fly Drosophila melanogaster.

Science.gov (United States)

Lone, Shahnaz Rahman; Sharma, Vijay Kumar

2012-04-01

In the fruit fly Drosophila melanogaster, social interactions especially among heterosexual couples have been shown to have significant impact on the circadian timing system. Olfaction plays a major role in such interactions; however, we do not know yet specifically which receptor(s) are involved. Further, the role of circadian clock neurons in the rhythmic regulation of such sociosexual interactions (SSIs) is not fully understood. Here, we report the results of our study in which we assayed the locomotor activity and sleep-wake behaviors of male-male (MM), female-female (FF), and male-female (MF) couples from several wild-type and mutant strains of Drosophila with an aim to identify specific olfactory receptor(s) and circadian clock neurons involved in the rhythmic regulation of SSI. The results indicate that Or47b receptor neurons are necessary for SSI, as ablation or silencing of these neurons has a severe impact on SSI. Further, the neuropeptide pigment dispersing factor (PDF) and PDF-positive ventral lateral (LN(v)) clock neurons appear to be dispensable for the regulation of SSI; however, dorsal neurons may be involved.

Mechanosensitive neurons on the internal reproductive tract contribute to egg-laying-induced acetic acid attraction in Drosophila

Science.gov (United States)

Gou, Bin; Liu, Ying; Guntur, Ananya R.; Stern, Ulrich; Yang, Chung-Hui

2014-01-01

Selecting a suitable site to deposit their eggs is an important reproductive need of Drosophila females. While their choosiness towards egg-laying sites is well documented, the specific neural mechanism that activates females’ search for attractive egg-laying sites is not known. Here we show that distention/contraction of females’ internal reproductive tract triggered by egg-delivery through the tract plays a critical role in activating such search. We found that females start to exhibit acetic acid attraction prior to depositing each egg but no attraction when they are not laying eggs. Artificially distending the reproductive tract triggers acetic acid attraction in non-egg-laying females whereas silencing the mechanosensitive neurons we identified that can sense the contractile status of the tract eliminates such attraction. Our work uncovers the circuit basis of an important reproductive need of Drosophila females and provides a simple model to dissect the neural mechanism that underlies a reproductive need-induced behavioral modification. PMID:25373900

Novel Synthetic Medea selfish genetic elements drive population replacement in Drosophila, and a theoretical exploration of Medea-dependent population suppression

Science.gov (United States)

Akbari, Omar S.; Chen, Chun-Hong; Marshall, John M.; Huang, Haixia; Antoshechkin, Igor; Hay, Bruce A.

2013-01-01

Insects act as vectors for diseases of plants, animals and humans. Replacement of wild insect populations with genetically modified individuals unable to transmit disease provides a potentially self-perpetuating method of disease prevention. Population replacement requires a gene drive mechanism in order to spread linked genes mediating disease refractoriness through wild populations. We previously reported the creation of synthetic Medea selfish genetic elements able to drive population replacement in Drosophila. These elements use microRNA-mediated silencing of myd88, a maternally expressed gene required for embryonic dorso-ventral pattern formation, coupled with early zygotic expression of a rescuing transgene, to bring about gene drive. Medea elements that work through additional mechanisms are needed in order to be able to carry out cycles of population replacement and/or remove existing transgenes from the population, using second-generation elements that spread while driving first-generation elements out of the population. Here we report the synthesis and population genetic behavior of two new synthetic Medea elements that drive population replacement through manipulation of signaling pathways involved in cellular blastoderm formation or Notch signaling, demonstrating that in Drosophila Medea elements can be generated through manipulation of diverse signaling pathways. We also describe the mRNA and small RNA changes in ovaries and early embryos associated from Medea-bearing females. Finally, we use modeling to illustrate how Medea elements carrying genes that result in diapause-dependent female lethality could be used to bring about population suppression. PMID:23654248

Comparative analysis of chromatin binding by Sex Comb on Midleg (SCM) and other polycomb group repressors at a Drosophila Hox gene.

Science.gov (United States)

Wang, Liangjun; Jahren, Neal; Miller, Ellen L; Ketel, Carrie S; Mallin, Daniel R; Simon, Jeffrey A

2010-06-01

Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets.

Comparative Analysis of Chromatin Binding by Sex Comb on Midleg (SCM) and Other Polycomb Group Repressors at a Drosophila Hox Gene▿

Science.gov (United States)

Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.

2010-01-01

Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets. PMID:20351181

A Convenient In Vivo Model Using Small Interfering RNA Silencing to Rapidly Assess Skeletal Gene Function.

Directory of Open Access Journals (Sweden)

Wen Zhang

Full Text Available It is difficult to study bone in vitro because it contains various cell types that engage in cross-talk. Bone biologically links various organs, and it has thus become increasingly evident that skeletal physiology must be studied in an integrative manner in an intact animal. We developed a model using local intraosseous small interfering RNA (siRNA injection to rapidly assess the effects of a target gene on the local skeletal environment. In this model, 160-g male Sprague-Dawley rats were treated for 1-2 weeks. The left tibia received intraosseous injection of a parathyroid hormone 1 receptor (Pth1r or insulin-like growth factor 1 receptor (Igf-1r siRNA transfection complex loaded in poloxamer 407 hydrogel, and the right tibia received the same volume of control siRNA. All the tibias received an intraosseous injection of recombinant human parathyroid hormone (1-34 (rhPTH (1-34 or insulin-like growth factor-1 (IGF-1. Calcein green and alizarin red were injected 6 and 2 days before euthanasia, respectively. IGF-1R and PTH1R expression levels were detected via RT-PCR assays and immunohistochemistry. Bone mineral density (BMD, microstructure, mineral apposition rates (MARs, and strength were determined by dual-energy X-ray absorptiometry, micro-CT, histology and biomechanical tests. The RT-PCR and immunohistochemistry results revealed that IGF-1R and PTH1R expression levels were dramatically diminished in the siRNA-treated left tibias compared to the right tibias (both p<0.05. Using poloxamer 407 hydrogel as a controlled-release system prolonged the silencing effect of a single dose of siRNA; the mRNA expression levels of IGF-1R were lower at two weeks than at one week (p<0.01. The BMD, bone microstructure parameters, MAR and bone strength were significantly decreased in the left tibias compared to the right tibias (all p<0.05. This simple and convenient local intraosseous siRNA injection model achieved gene silencing with very small quantities of

Genome-wide analysis of Polycomb targets in Drosophila

Energy Technology Data Exchange (ETDEWEB)

Schwartz, Yuri B.; Kahn, Tatyana G.; Nix, David A.; Li,Xiao-Yong; Bourgon, Richard; Biggin, Mark; Pirrotta, Vincenzo

2006-04-01

Polycomb Group (PcG) complexes are multiprotein assemblages that bind to chromatin and establish chromatin states leading to epigenetic silencing. PcG proteins regulate homeotic genes in flies and vertebrates but little is known about other PcG targets and the role of the PcG in development, differentiation and disease. We have determined the distribution of the PcG proteins PC, E(Z) and PSC and of histone H3K27 trimethylation in the Drosophila genome. At more than 200 PcG target genes, binding sites for the three PcG proteins colocalize to presumptive Polycomb Response Elements (PREs). In contrast, H3 me3K27 forms broad domains including the entire transcription unit and regulatory regions. PcG targets are highly enriched in genes encoding transcription factors but receptors, signaling proteins, morphogens and regulators representing all major developmental pathways are also included.

CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.

Science.gov (United States)

Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun

2014-09-05

Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.

SUMOylation in Drosophila Development

Directory of Open Access Journals (Sweden)

Albert J. Courey

2012-07-01

Full Text Available Small ubiquitin-related modifier (SUMO, an ~90 amino acid ubiquitin-like protein, is highly conserved throughout the eukaryotic domain. Like ubiquitin, SUMO is covalently attached to lysine side chains in a large number of target proteins. In contrast to ubiquitin, SUMO does not have a direct role in targeting proteins for proteasomal degradation. However, like ubiquitin, SUMO does modulate protein function in a variety of other ways. This includes effects on protein conformation, subcellular localization, and protein–protein interactions. Significant insight into the in vivo role of SUMOylation has been provided by studies in Drosophila that combine genetic manipulation, proteomic, and biochemical analysis. Such studies have revealed that the SUMO conjugation pathway regulates a wide variety of critical cellular and developmental processes, including chromatin/chromosome function, eggshell patterning, embryonic pattern formation, metamorphosis, larval and pupal development, neurogenesis, development of the innate immune system, and apoptosis. This review discusses our current understanding of the diverse roles for SUMO in Drosophila development.

Silêncios Silences

Directory of Open Access Journals (Sweden)

Luciano Marcondes Godoy

1999-01-01

Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.

Voice and silence in organizations

Directory of Open Access Journals (Sweden)

Moaşa, H.

2011-01-01

Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.

Natural variation of the amino-terminal glutamine-rich domain in Drosophila argonaute2 is not associated with developmental defects.

Directory of Open Access Journals (Sweden)

Daniel Hain

2010-12-01

Full Text Available The Drosophila argonaute2 (ago2 gene plays a major role in siRNA mediated RNA silencing pathways. Unlike mammalian Argonaute proteins, the Drosophila protein has an unusual amino-terminal domain made up largely of multiple copies of glutamine-rich repeats (GRRs. We report here that the ago2 locus produces an alternative transcript that encodes a putative short isoform without this amino-terminal domain. Several ago2 mutations previously reported to be null alleles only abolish expression of the long, GRR-containing isoform. Analysis of drop out (dop mutations had previously suggested that variations in GRR copy number result in defects in RNAi and embryonic development. However, we find that dop mutations genetically complement transcript-null alleles of ago2 and that ago2 alleles with variant GRR copy numbers support normal development. In addition, we show that the assembly of the central RNAi machinery, the RISC (RNA induced silencing complex, is unimpaired in embryos when GRR copy number is altered. In fact, we find that GRR copy number is highly variable in natural D. melanogaster populations as well as in laboratory strains. Finally, while many other insects share an extensive, glutamine-rich Ago2 amino-terminal domain, its primary sequence varies drastically between species. Our data indicate that GRR variation does not modulate an essential function of Ago2 and that the amino-terminal domain of Ago2 is subject to rapid evolution.

Two pests overlap: Drosophila suzukii (Diptera: Drosophilidae) use of fruit exposed to Halyomorpha halys (Hemiptera: Pentatomidae)

Science.gov (United States)

Spotted wing drosophila, Drosophila suzukii (Matsumura) (Diptera: Drosophilidae), and brown marmorated stink bug, Halyomorpha halys (Stål) (Hemiptera: Pentatomidae) are global economic pests. Both pests may co-occur on small fruits, and we investigated whether fruit recently exposed to H. halys woul...

Klf15 Is Critical for the Development and Differentiation of Drosophila Nephrocytes.

Directory of Open Access Journals (Sweden)

Jessica R Ivy

Full Text Available Insect nephrocytes are highly endocytic scavenger cells that represent the only invertebrate model for the study of human kidney podocytes. Despite their importance, nephrocyte development is largely uncharacterised. This work tested whether the insect ortholog of mammalian Kidney Krüppel-Like Factor (Klf15, a transcription factor required for mammalian podocyte differentiation, was required for insect nephrocyte development. It was found that expression of Drosophila Klf15 (dKlf15, previously known as Bteb2 was restricted to the only two nephrocyte populations in Drosophila, the garland cells and pericardial nephrocytes. Loss of dKlf15 function led to attrition of both nephrocyte populations and sensitised larvae to the xenotoxin silver nitrate. Although pericardial nephrocytes in dKlf15 loss of function mutants were specified during embryogenesis, they failed to express the slit diaphragm gene sticks and stones and did not form slit diaphragms. Conditional silencing of dKlf15 in adults led to reduced surface expression of the endocytic receptor Amnionless and loss of in vivo scavenger function. Over-expression of dKlf15 increased nephrocyte numbers and rescued age-dependent decline in nephrocyte function. The data place dKlf15 upstream of sns and Amnionless in a nephrocyte-restricted differentiation pathway and suggest dKlf15 expression is both necessary and sufficient to sustain nephrocyte differentiation. These findings explain the physiological relevance of dKlf15 in Drosophila and imply that the role of KLF15 in human podocytes is evolutionarily conserved.

The developmental transcriptome of Drosophila melanogaster

Energy Technology Data Exchange (ETDEWEB)

University of Connecticut; Graveley, Brenton R.; Brooks, Angela N.; Carlson, Joseph W.; Duff, Michael O.; Landolin, Jane M.; Yang, Li; Artieri, Carlo G.; van Baren, Marijke J.; Boley, Nathan; Booth, Benjamin W.; Brown, James B.; Cherbas, Lucy; Davis, Carrie A.; Dobin, Alex; Li, Renhua; Lin, Wei; Malone, John H.; Mattiuzzo, Nicolas R.; Miller, David; Sturgill, David; Tuch, Brian B.; Zaleski, Chris; Zhang, Dayu; Blanchette, Marco; Dudoit, Sandrine; Eads, Brian; Green, Richard E.; Hammonds, Ann; Jiang, Lichun; Kapranov, Phil; Langton, Laura; Perrimon, Norbert; Sandler, Jeremy E.; Wan, Kenneth H.; Willingham, Aarron; Zhang, Yu; Zou, Yi; Andrews, Justen; Bicke, Peter J.; Brenner, Steven E.; Brent, Michael R.; Cherbas, Peter; Gingeras, Thomas R.; Hoskins, Roger A.; Kaufman, Thomas C.; Oliver, Brian; Celniker, Susan E.

2010-12-02

. Whereas, 20% of Drosophila genes are annotated as encoding alternatively spliced premRNAs, splice-junction microarray experiments indicate that this number is at least 40% (ref. 7). Determining the diversity of mRNAs generated by alternative promoters, alternative splicing and RNA editing will substantially increase the inferred protein repertoire. Non-coding RNA genes (ncRNAs) including short interfering RNAs (siRNAs) and microRNAS (miRNAs) (reviewed in ref. 10), and longer ncRNAs such as bxd (ref. 11) and rox (ref. 12), have important roles in gene regulation, whereas others such as small nucleolar RNAs (snoRNAs)and small nuclear RNAs (snRNAs) are important components of macromolecular machines such as the ribosome and spliceosome. The transcription and processing of these ncRNAs must also be fully documented and mapped. As part of the modENCODE project to annotate the functional elements of the D. melanogaster and Caenorhabditis elegans genomes, we used RNA-Seq and tiling microarrays to sample the Drosophila transcriptome at unprecedented depth throughout development from early embryo to ageing male and female adults. We report on a high-resolution view of the discovery, structure and dynamic expression of the D. melanogaster transcriptome.

Small RNAs were involved in homozygous state-associated silencing of a marker gene (Neomycin phosphotransferase II: nptII) in transgenic tomato plants.

Science.gov (United States)

Deng, Lei; Pan, Yu; Chen, Xuqing; Chen, Guoping; Hu, Zongli

2013-07-01

Homozygous state-associated co-suppression is not a very common phenomenon. In our experiments, two transgenic plants 3A29 and 1195A were constructed by being transformed with the constructs pBIN-353A and pBIN119A containing nptII gene as a marker respectively. The homozygous progeny from these two independent transgenic lines 3A29 and 1195A, displayed kanamycin-sensitivity and produced a short main root without any lateral roots as untransformed control (wild-type) seedlings when germinated on kanamycin media. For the seedlings derived from putative hemizygous plants, the percentage of the seedlings showing normal growth on kanamycin media was about 50% and lower than the expected percentage (75%). Southern analysis of the genomic DNA confirmed that the homozygous and hemizygous plants derived from the same lines contained the same multiple nptII transgenes, which were located on the same site of chromosome. Northern analysis suggested that the marker nptII gene was expressed in the primary and the hemizygous transformants, but it was silenced in the homozygous transgenic plants. Further Northern analysis indicated that antisense and sense small nptII-derived RNAs were present in the transgenic plants and the blotting signal of nptII-derived small RNA was much higher in the homozygous transgenic plants than that of hemizygous transgenic plants. Additionally, read-through transcripts from the TRAMP gene to the nptII gene were detected. These results suggest that the read-through transcripts may be involved in homozygous state-associated silencing of the nptII transgene in transgenic tomato plants and a certain threshold level of the nptII-derived small RNAs is required for the homozygous state-associated co-suppression of the nptII transgene. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.

Science.gov (United States)

Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M

2017-10-10

The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.

Silence, an Eye of Knowledge

Directory of Open Access Journals (Sweden)

Mehdi Aghamohammadi

2017-04-01

Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where  has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.

Simulation and Measurements of Small Arms Blast Wave Overpressure in the Process of Designing a Silencer

Directory of Open Access Journals (Sweden)

Hristov Nebojša

2015-02-01

Full Text Available Simulation and measurements of muzzle blast overpressure and its physical manifestations are studied in this paper. The use of a silencer can have a great influence on the overpressure intensity. A silencer is regarded as an acoustic transducer and a waveguide. Wave equations for an acoustic dotted source of directed effect are used for physical interpretation of overpressure as an acoustic phenomenon. Decomposition approach has proven to be suitable to describe the formation of the output wave of the wave transducer. Electroacoustic analogies are used for simulations. A measurement chain was used to compare the simulation results with the experimental ones.

A Small RNA-Based Immune System Defends Germ Cells against Mobile Genetic Elements

Directory of Open Access Journals (Sweden)

Astrid D. Haase

2016-01-01

Full Text Available Transposons are mobile genetic elements that threaten the survival of species by destabilizing the germline genomes. Limiting the spread of these selfish elements is imperative. Germ cells employ specialized small regulatory RNA pathways to restrain transposon activity. PIWI proteins and Piwi-interacting RNAs (piRNAs silence transposons at the transcriptional and posttranscriptional level with loss-of-function mutant animals universally exhibiting sterility often associated with germ cell defects. This short review aims to illustrate basic strategies of piRNA-guided defense against transposons. Mechanisms of piRNA silencing are most readily studied in Drosophila melanogaster, which serves as a model to delineate molecular concepts and as a reference for mammalian piRNA systems. PiRNA pathways utilize two major strategies to handle the challenges of transposon control: (1 the hard-wired molecular memory of prior transpositions enables recognition of mobile genetic elements and discriminates transposons from host genes; (2 a feed-forward adaptation mechanism shapes piRNA populations to selectively combat the immediate threat of transposon transcripts. In flies, maternally contributed PIWI-piRNA complexes bolster both of these lines of defense and ensure transgenerational immunity. While recent studies have provided a conceptual framework of what could be viewed as an ancient immune system, we are just beginning to appreciate its many molecular innovations.

In vitro reconstitution of chaperone-mediated human RISC assembly.

Science.gov (United States)

Naruse, Ken; Matsuura-Suzuki, Eriko; Watanabe, Mariko; Iwasaki, Shintaro; Tomari, Yukihide

2018-01-01

To silence target mRNAs, small RNAs and Argonaute (Ago) proteins need to be assembled into RNA-induced silencing complexes (RISCs). Although the assembly of Drosophila melanogaster RISC was recently reconstituted by Ago2, the Dicer-2/R2D2 heterodimer, and five chaperone proteins, the absence of a reconstitution system for mammalian RISC assembly has posed analytical challenges. Here we describe reconstitution of human RISC assembly using Ago2 and five recombinant chaperone proteins: Hsp90β, Hsc70, Hop, Dnaja2, and p23. Our data show that ATP hydrolysis by both Hsp90β and Hsc70 is required for RISC assembly of small RNA duplexes but not for that of single-stranded RNAs. The reconstitution system lays the groundwork for further studies of small RNA-mediated gene silencing in mammals. © 2018 Naruse et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

Science.gov (United States)

Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

2018-02-01

Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Ombuds’ corner: Employee silence

CERN Multimedia

Vincent Vuillemin

2013-01-01

Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct.   For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...

Silencing the epigenetic silencer KDM4A for TRAIL and DR5 simultaneous induction and antitumor therapy.

Science.gov (United States)

Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu

2016-11-01

Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.

Mapping Second Chromosome Mutations to Defined Genomic Regions in Drosophila melanogaster.

Science.gov (United States)

Kahsai, Lily; Cook, Kevin R

2018-01-04

Hundreds of Drosophila melanogaster stocks are currently maintained at the Bloomington Drosophila Stock Center with mutations that have not been associated with sequence-defined genes. They have been preserved because they have interesting loss-of-function phenotypes. The experimental value of these mutations would be increased by tying them to specific genomic intervals so that geneticists can more easily associate them with annotated genes. Here, we report the mapping of 85 second chromosome complementation groups in the Bloomington collection to specific, small clusters of contiguous genes or individual genes in the sequenced genome. This information should prove valuable to Drosophila geneticists interested in processes associated with particular phenotypes and those searching for mutations affecting specific sequence-defined genes. Copyright © 2018 Kahsai,Cook.

Mapping Second Chromosome Mutations to Defined Genomic Regions in Drosophila melanogaster

Directory of Open Access Journals (Sweden)

Lily Kahsai

2018-01-01

Full Text Available Hundreds of Drosophila melanogaster stocks are currently maintained at the Bloomington Drosophila Stock Center with mutations that have not been associated with sequence-defined genes. They have been preserved because they have interesting loss-of-function phenotypes. The experimental value of these mutations would be increased by tying them to specific genomic intervals so that geneticists can more easily associate them with annotated genes. Here, we report the mapping of 85 second chromosome complementation groups in the Bloomington collection to specific, small clusters of contiguous genes or individual genes in the sequenced genome. This information should prove valuable to Drosophila geneticists interested in processes associated with particular phenotypes and those searching for mutations affecting specific sequence-defined genes.

Behavioral Teratogenesis in Drosophila melanogaster.

Science.gov (United States)

Mishra, Monalisa; Barik, Bedanta Kumar

2018-01-01

Developmental biology is a fascinating branch of science which helps us to understand the mechanism of development, thus the findings are used in various therapeutic approach. Drosophila melanogaster served as a model to find the key molecules that initiate and regulate the mechanism of development. Various genes, transcription factors, and signaling pathways helping in development are identified in Drosophila. Many toxic compounds, which can affect the development, are also recognized using Drosophila model. These compounds, which can affect the development, are named as a teratogen. Many teratogens identified using Drosophila may also act as a teratogen for a human being since 75% of conservation exist between the disease genes present in Drosophila and human. There are certain teratogens, which do not cause developmental defect if exposed during pregnancy, however; behavioral defect appears in later part of development. Such compounds are named as a behavioral teratogen. Thus, it is worthy to identify the potential behavioral teratogen using Drosophila model. Drosophila behavior is well studied in various developmental stages. This chapter describes various methods which can be employed to test behavioral teratogenesis in Drosophila.

The silence.

Science.gov (United States)

Millenson, Michael L

2003-01-01

Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.

Combinatorial effect of maytansinol and radiation in Drosophila and human cancer cells

Directory of Open Access Journals (Sweden)

Anthony Edwards

2011-07-01

Combination therapy, in which two or more agents are applied, is more effective than single therapies for combating cancer. For this reason, combinations of chemotherapy with radiation are being explored in clinical trials, albeit with an empirical approach. We developed a screen to identify, from the onset, molecules that act in vivo in conjunction with radiation, using Drosophila as a model. Screens through two small molecule libraries from the NCI Developmental Therapeutics Program yielded microtubule poisons; this class of agents is known to enhance the effect of radiation in mammalian cancer models. Here we report an analysis of one microtubule depolymerizing agent, maytansinol isobutyrate (NSC292222; maytansinol, in Drosophila and in human cancer cells. We find that the effect of maytansinol is p53 dependent in Drosophila cells and human cancer cells, that maytansinol enhances the effect of radiation in both systems, and that the combinatorial effect of drug and radiation is additive. We also uncover a differential sensitivity to maytansinol between Drosophila cells and Drosophila larvae, which illustrates the value of studying cell behavior in the context of a whole organism. On the basis of these results, we propose that Drosophila might be a useful model for unbiased screens through new molecule libraries to find cancer drugs for combination therapy.

F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function

Science.gov (United States)

Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique

2006-01-01

Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454

The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing

Directory of Open Access Journals (Sweden)

Adriana F. Fusaro

2017-10-01

Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.

FMAj: a tool for high content analysis of muscle dynamics in Drosophila metamorphosis.

Science.gov (United States)

Kuleesha, Yadav; Puah, Wee Choo; Lin, Feng; Wasser, Martin

2014-01-01

During metamorphosis in Drosophila melanogaster, larval muscles undergo two different developmental fates; one population is removed by cell death, while the other persistent subset undergoes morphological remodeling and survives to adulthood. Thanks to the ability to perform live imaging of muscle development in transparent pupae and the power of genetics, metamorphosis in Drosophila can be used as a model to study the regulation of skeletal muscle mass. However, time-lapse microscopy generates sizeable image data that require new tools for high throughput image analysis. We performed targeted gene perturbation in muscles and acquired 3D time-series images of muscles in metamorphosis using laser scanning confocal microscopy. To quantify the phenotypic effects of gene perturbations, we designed the Fly Muscle Analysis tool (FMAj) which is based on the ImageJ and MySQL frameworks for image processing and data storage, respectively. The image analysis pipeline of FMAj contains three modules. The first module assists in adding annotations to time-lapse datasets, such as genotypes, experimental parameters and temporal reference points, which are used to compare different datasets. The second module performs segmentation and feature extraction of muscle cells and nuclei. Users can provide annotations to the detected objects, such as muscle identities and anatomical information. The third module performs comparative quantitative analysis of muscle phenotypes. We applied our tool to the phenotypic characterization of two atrophy related genes that were silenced by RNA interference. Reduction of Drosophila Tor (Target of Rapamycin) expression resulted in enhanced atrophy compared to control, while inhibition of the autophagy factor Atg9 caused suppression of atrophy and enlarged muscle fibers of abnormal morphology. FMAj enabled us to monitor the progression of atrophic and hypertrophic phenotypes of individual muscles throughout metamorphosis. We designed a new tool to

FMAj: a tool for high content analysis of muscle dynamics in Drosophila metamorphosis

Science.gov (United States)

2014-01-01

Background During metamorphosis in Drosophila melanogaster, larval muscles undergo two different developmental fates; one population is removed by cell death, while the other persistent subset undergoes morphological remodeling and survives to adulthood. Thanks to the ability to perform live imaging of muscle development in transparent pupae and the power of genetics, metamorphosis in Drosophila can be used as a model to study the regulation of skeletal muscle mass. However, time-lapse microscopy generates sizeable image data that require new tools for high throughput image analysis. Results We performed targeted gene perturbation in muscles and acquired 3D time-series images of muscles in metamorphosis using laser scanning confocal microscopy. To quantify the phenotypic effects of gene perturbations, we designed the Fly Muscle Analysis tool (FMAj) which is based on the ImageJ and MySQL frameworks for image processing and data storage, respectively. The image analysis pipeline of FMAj contains three modules. The first module assists in adding annotations to time-lapse datasets, such as genotypes, experimental parameters and temporal reference points, which are used to compare different datasets. The second module performs segmentation and feature extraction of muscle cells and nuclei. Users can provide annotations to the detected objects, such as muscle identities and anatomical information. The third module performs comparative quantitative analysis of muscle phenotypes. We applied our tool to the phenotypic characterization of two atrophy related genes that were silenced by RNA interference. Reduction of Drosophila Tor (Target of Rapamycin) expression resulted in enhanced atrophy compared to control, while inhibition of the autophagy factor Atg9 caused suppression of atrophy and enlarged muscle fibers of abnormal morphology. FMAj enabled us to monitor the progression of atrophic and hypertrophic phenotypes of individual muscles throughout metamorphosis

How Silent is the Right to Silence?

Directory of Open Access Journals (Sweden)

Katherine Biber

2012-11-01

Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.

Preliminary small-angle X-ray scattering and X-ray diffraction studies of the BTB domain of lola protein from Drosophila melanogaster

Science.gov (United States)

Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Dorovatovskii, P. V.; Popov, V. O.

2017-11-01

The Drosophila genome has several dozens of transcription factors (TTK group) containing BTB domains assembled into octamers. The LOLA protein belongs to this family. The purification, crystallization, and preliminary X-ray diffraction and small-angle X-ray scattering (SAXS) studies of the BTB domain of this protein are reported. The crystallization conditions were found by the vapor-diffusion technique. A very low diffraction resolution (8.7 Å resolution) of the crystals was insufficient for the determination of the threedimensional structure of the BTB domain. The SAXS study demonstrated that the BTB domain of the LOLA protein exists as an octamer in solution.

Muscleblind, BSF and TBPH are mislocalized in the muscle sarcomere of a Drosophila myotonic dystrophy model

Directory of Open Access Journals (Sweden)

Beatriz Llamusi

2013-01-01

Myotonic dystrophy type 1 (DM1 is a genetic disease caused by the pathological expansion of a CTG trinucleotide repeat in the 3′ UTR of the DMPK gene. In the DMPK transcripts, the CUG expansions sequester RNA-binding proteins into nuclear foci, including transcription factors and alternative splicing regulators such as MBNL1. MBNL1 sequestration has been associated with key features of DM1. However, the basis behind a number of molecular and histological alterations in DM1 remain unclear. To help identify new pathogenic components of the disease, we carried out a genetic screen using a Drosophila model of DM1 that expresses 480 interrupted CTG repeats, i(CTG480, and a collection of 1215 transgenic RNA interference (RNAi fly lines. Of the 34 modifiers identified, two RNA-binding proteins, TBPH (homolog of human TAR DNA-binding protein 43 or TDP-43 and BSF (Bicoid stability factor; homolog of human LRPPRC, were of particular interest. These factors modified i(CTG480 phenotypes in the fly eye and wing, and TBPH silencing also suppressed CTG-induced defects in the flight muscles. In Drosophila flight muscle, TBPH, BSF and the fly ortholog of MBNL1, Muscleblind (Mbl, were detected in sarcomeric bands. Expression of i(CTG480 resulted in changes in the sarcomeric patterns of these proteins, which could be restored by coexpression with human MBNL1. Epistasis studies showed that Mbl silencing was sufficient to induce a subcellular redistribution of TBPH and BSF proteins in the muscle, which mimicked the effect of i(CTG480 expression. These results provide the first description of TBPH and BSF as targets of Mbl-mediated CTG toxicity, and they suggest an important role of these proteins in DM1 muscle pathology.

Judicial review of administrative silence

Directory of Open Access Journals (Sweden)

Radošević Ratko S.

2015-01-01

Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.

Durability of timber silencers at Wairakei geothermal steam field

Energy Technology Data Exchange (ETDEWEB)

Hedley, M E

1979-02-01

After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.

Assessment of RNAi-induced silencing in banana (Musa spp.).

Science.gov (United States)

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

Silencing the lettuce homologs of small rubber particle protein does not influence natural rubber biosynthesis in lettuce (Lactuca sativa).

Science.gov (United States)

Chakrabarty, Romit; Qu, Yang; Ro, Dae-Kyun

2015-05-01

Natural rubber, cis-1,4-polyisoprene, is an important raw material in chemical industries, but its biosynthetic mechanism remains elusive. Natural rubber is known to be synthesized in rubber particles suspended in laticifer cells in the Brazilian rubber tree (Hevea brasiliensis). In the rubber tree, rubber elongation factor (REF) and its homolog, small rubber particle protein (SRPP), were found to be the most abundant proteins in rubber particles, and they have been implicated in natural rubber biosynthesis. As lettuce (Lactuca sativa) can synthesize natural rubber, we utilized this annual, transformable plant to examine in planta roles of the lettuce REF/SRPP homologs by RNA interference. Among eight lettuce REF/SRPP homologs identified, transcripts of two genes (LsSRPP4 and LsSRPP8) accounted for more than 90% of total transcripts of REF/SRPP homologs in lettuce latex. LsSRPP4 displays a typical primary protein sequence as other REF/SRPP, while LsSRPP8 is twice as long as LsSRPP4. These two major LsSRPP transcripts were individually and simultaneously silenced by RNA interference, and relative abundance, polymer molecular weight, and polydispersity of natural rubber were analyzed from the LsSRPP4- and LsSRPP8-silenced transgenic lettuce. Despite previous data suggesting the implications of REF/SRPP in natural rubber biosynthesis, qualitative and quantitative alterations of natural rubber could not be observed in transgenic lettuce lines. It is concluded that lettuce REF/SRPP homologs are not critically important proteins in natural rubber biosynthesis in lettuce. Copyright © 2014 Elsevier Ltd. All rights reserved.

The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

Science.gov (United States)

Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

2014-02-13

Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

The Role of Silence at the Retreats of a Buddhist Community

Directory of Open Access Journals (Sweden)

Orsolya Huszár

2016-12-01

Full Text Available The purpose of the study is to establish that the definition of silence as simply an absence of something or as the background of communication proves to be inadequate in a number of communicative instances. The interpretation of silence is culturally determined, and the underappreciation of its role is typical in low-context Western cultures; this is also evinced by the neglect of the topic in the literature. The present study will describe the communicative functions of silence through the findings of field work conducted at the retreats of a Buddhist community in Hungary, providing empirical input for the relevant theoretical constructs. The research findings show that silence is accorded a central role in essentially every component of the retreat (meditations, relaxation, ceremonies, teachings, small-group sharings, meals and rest; and while each event at the retreat focuses primarily on a different specific function of communication, the entire retreat does involve the linkage, affecting, revelational and – to a certain extent – activating functions (to follow the five-element typology of J. Vernon Jensen, as well as – to a lesser extent – the judgmental function. The research also shows that it requires time for individuals in a low-context culture to recognize the “point” of silence – something that the retreats provide the right opportunity for. In fact, the insights the individuals arrived at through these occasions could be put to use in their daily lives, helping their problem-solving and social relationships and in general improving their quality of life.

Systems neuroscience in Drosophila: Conceptual and technical advantages.

Science.gov (United States)

Kazama, H

2015-06-18

The fruit fly Drosophila melanogaster is ideally suited for investigating the neural circuit basis of behavior. Due to the simplicity and genetic tractability of the fly brain, neurons and circuits are identifiable across animals. Additionally, a large set of transgenic lines has been developed with the aim of specifically labeling small subsets of neurons and manipulating them in sophisticated ways. Electrophysiology and imaging can be applied in behaving individuals to examine the computations performed by each neuron, and even the entire population of relevant neurons in a particular region, because of the small size of the brain. Moreover, a rich repertoire of behaviors that can be studied is expanding to include those requiring cognitive abilities. Thus, the fly brain is an attractive system in which to explore both computations and mechanisms underlying behavior at levels spanning from genes through neurons to circuits. This review summarizes the advantages Drosophila offers in achieving this objective. A recent neurophysiology study on olfactory behavior is also introduced to demonstrate the effectiveness of these advantages. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

Directory of Open Access Journals (Sweden)

Tatiana I Novobrantseva

2012-01-01

Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

Modeling Human Cancers in Drosophila.

Science.gov (United States)

Sonoshita, M; Cagan, R L

2017-01-01

Cancer is a complex disease that affects multiple organs. Whole-body animal models provide important insights into oncology that can lead to clinical impact. Here, we review novel concepts that Drosophila studies have established for cancer biology, drug discovery, and patient therapy. Genetic studies using Drosophila have explored the roles of oncogenes and tumor-suppressor genes that when dysregulated promote cancer formation, making Drosophila a useful model to study multiple aspects of transformation. Not limited to mechanism analyses, Drosophila has recently been showing its value in facilitating drug development. Flies offer rapid, efficient platforms by which novel classes of drugs can be identified as candidate anticancer leads. Further, we discuss the use of Drosophila as a platform to develop therapies for individual patients by modeling the tumor's genetic complexity. Drosophila provides both a classical and a novel tool to identify new therapeutics, complementing other more traditional cancer tools. © 2017 Elsevier Inc. All rights reserved.

Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

Directory of Open Access Journals (Sweden)

Elisabeth H. Vollmann

2017-06-01

Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

Semi-automated quantitative Drosophila wings measurements.

Science.gov (United States)

Loh, Sheng Yang Michael; Ogawa, Yoshitaka; Kawana, Sara; Tamura, Koichiro; Lee, Hwee Kuan

2017-06-28

Drosophila melanogaster is an important organism used in many fields of biological research such as genetics and developmental biology. Drosophila wings have been widely used to study the genetics of development, morphometrics and evolution. Therefore there is much interest in quantifying wing structures of Drosophila. Advancement in technology has increased the ease in which images of Drosophila can be acquired. However such studies have been limited by the slow and tedious process of acquiring phenotypic data. We have developed a system that automatically detects and measures key points and vein segments on a Drosophila wing. Key points are detected by performing image transformations and template matching on Drosophila wing images while vein segments are detected using an Active Contour algorithm. The accuracy of our key point detection was compared against key point annotations of users. We also performed key point detection using different training data sets of Drosophila wing images. We compared our software with an existing automated image analysis system for Drosophila wings and showed that our system performs better than the state of the art. Vein segments were manually measured and compared against the measurements obtained from our system. Our system was able to detect specific key points and vein segments from Drosophila wing images with high accuracy.

The Drosophila surface glia transcriptome: evolutionary conserved blood-brain barrier processes.

Directory of Open Access Journals (Sweden)

Michael K DeSalvo

2014-11-01

Full Text Available AbstractCentral nervous system (CNS function is dependent on the stringent regulation of metabolites, drugs, cells, and pathogens exposed to the CNS space. Cellular blood-brain barrier (BBB structures are highly specific checkpoints governing entry and exit of all small molecules to and from the brain interstitial space, but the precise mechanisms that regulate the BBB are not well understood. In addition, the BBB has long been a challenging obstacle to the pharmacologic treatment of CNS diseases; thus model systems that can parse the functions of the BBB are highly desirable. In this study, we sought to define the transcriptome of the adult Drosophila melanogaster BBB by isolating the BBB surface glia with FACS and profiling their gene expression with microarrays. By comparing the transcriptome of these surface glia to that of all brain glia, brain neurons, and whole brains, we present a catalog of transcripts that are selectively enriched at the Drosophila BBB. We found that the fly surface glia show high expression of many ABC and SLC transporters, cell adhesion molecules, metabolic enzymes, signaling molecules, and components of xenobiotic metabolism pathways. Using gene sequence-based alignments, we compare the Drosophila and Murine BBB transcriptomes and discover many shared chemoprotective and small molecule control pathways, thus affirming the relevance of invertebrate models for studying evolutionary conserved BBB properties. The Drosophila BBB transcriptome is valuable to vertebrate and insect biologists alike as a resource for studying proteins underlying diffusion barrier development and maintenance, glial biology, and regulation of drug transport at tissue barriers.

The Drosophila surface glia transcriptome: evolutionary conserved blood-brain barrier processes.

Science.gov (United States)

DeSalvo, Michael K; Hindle, Samantha J; Rusan, Zeid M; Orng, Souvinh; Eddison, Mark; Halliwill, Kyle; Bainton, Roland J

2014-01-01

Central nervous system (CNS) function is dependent on the stringent regulation of metabolites, drugs, cells, and pathogens exposed to the CNS space. Cellular blood-brain barrier (BBB) structures are highly specific checkpoints governing entry and exit of all small molecules to and from the brain interstitial space, but the precise mechanisms that regulate the BBB are not well understood. In addition, the BBB has long been a challenging obstacle to the pharmacologic treatment of CNS diseases; thus model systems that can parse the functions of the BBB are highly desirable. In this study, we sought to define the transcriptome of the adult Drosophila melanogaster BBB by isolating the BBB surface glia with fluorescence activated cell sorting (FACS) and profiling their gene expression with microarrays. By comparing the transcriptome of these surface glia to that of all brain glia, brain neurons, and whole brains, we present a catalog of transcripts that are selectively enriched at the Drosophila BBB. We found that the fly surface glia show high expression of many ATP-binding cassette (ABC) and solute carrier (SLC) transporters, cell adhesion molecules, metabolic enzymes, signaling molecules, and components of xenobiotic metabolism pathways. Using gene sequence-based alignments, we compare the Drosophila and Murine BBB transcriptomes and discover many shared chemoprotective and small molecule control pathways, thus affirming the relevance of invertebrate models for studying evolutionary conserved BBB properties. The Drosophila BBB transcriptome is valuable to vertebrate and insect biologists alike as a resource for studying proteins underlying diffusion barrier development and maintenance, glial biology, and regulation of drug transport at tissue barriers.

Two Components of Aversive Memory in Drosophila, Anesthesia-Sensitive and Anesthesia-Resistant Memory, Require Distinct Domains Within the Rgk1 Small GTPase.

Science.gov (United States)

Murakami, Satoshi; Minami-Ohtsubo, Maki; Nakato, Ryuichiro; Shirahige, Katsuhiko; Tabata, Tetsuya

2017-05-31

Multiple components have been identified that exhibit different stabilities for aversive olfactory memory in Drosophila These components have been defined by behavioral and genetic studies and genes specifically required for a specific component have also been identified. Intermediate-term memory generated after single cycle conditioning is divided into anesthesia-sensitive memory (ASM) and anesthesia-resistant memory (ARM), with the latter being more stable. We determined that the ASM and ARM pathways converged on the Rgk1 small GTPase and that the N-terminal domain-deleted Rgk1 was sufficient for ASM formation, whereas the full-length form was required for ARM formation. Rgk1 is specifically accumulated at the synaptic site of the Kenyon cells (KCs), the intrinsic neurons of the mushroom bodies, which play a pivotal role in olfactory memory formation. A higher than normal Rgk1 level enhanced memory retention, which is consistent with the result that Rgk1 suppressed Rac-dependent memory decay; these findings suggest that rgk1 bolsters ASM via the suppression of forgetting. We propose that Rgk1 plays a pivotal role in the regulation of memory stabilization by serving as a molecular node that resides at KC synapses, where the ASM and ARM pathway may interact. SIGNIFICANCE STATEMENT Memory consists of multiple components. Drosophila olfactory memory serves as a fundamental model with which to investigate the mechanisms that underlie memory formation and has provided genetic and molecular means to identify the components of memory, namely short-term, intermediate-term, and long-term memory, depending on how long the memory lasts. Intermediate memory is further divided into anesthesia-sensitive memory (ASM) and anesthesia-resistant memory (ARM), with the latter being more stable. We have identified a small GTPase in Drosophila , Rgk1, which plays a pivotal role in the regulation of olfactory memory stability. Rgk1 is required for both ASM and ARM. Moreover, N

ATP-dependent human RISC assembly pathways.

Science.gov (United States)

Yoda, Mayuko; Kawamata, Tomoko; Paroo, Zain; Ye, Xuecheng; Iwasaki, Shintaro; Liu, Qinghua; Tomari, Yukihide

2010-01-01

The assembly of RNA-induced silencing complex (RISC) is a key process in small RNA-mediated gene silencing. In humans, small interfering RNAs (siRNAs) and microRNAs (miRNAs) are incorporated into RISCs containing the Argonaute (AGO) subfamily proteins Ago1-4. Previous studies have proposed that, unlike Drosophila melanogaster RISC assembly pathways, human RISC assembly is coupled with dicing and is independent of ATP. Here we show by careful reexamination that, in humans, RISC assembly and dicing are uncoupled, and ATP greatly facilitates RISC loading of small-RNA duplexes. Moreover, all four human AGO proteins show remarkably similar structural preferences for small-RNA duplexes: central mismatches promote RISC loading, and seed or 3'-mid (guide position 12-15) mismatches facilitate unwinding. All these features of human AGO proteins are highly reminiscent of fly Ago1 but not fly Ago2.

The biochemical adaptations of spotted wing drosophila (Diptera: Drosophilidae) to fresh fruits reduced fructose concentrations and glutathione-S transferase activities

Science.gov (United States)

Spotted wing drosophila (SWD), Drosophila suzukii, is an invasive and economically damaging pest in Europe and North America, because the females have a serrated ovipositor enabling them to infest ripening almost all small fruits before harvest. Also flies are strongly attracted to fresh fruits rath...

Odor Discrimination in Drosophila: From Neural Population Codes to Behavior

Science.gov (United States)

Parnas, Moshe; Lin, Andrew C.; Huetteroth, Wolf; Miesenböck, Gero

2013-01-01

Summary Taking advantage of the well-characterized olfactory system of Drosophila, we derive a simple quantitative relationship between patterns of odorant receptor activation, the resulting internal representations of odors, and odor discrimination. Second-order excitatory and inhibitory projection neurons (ePNs and iPNs) convey olfactory information to the lateral horn, a brain region implicated in innate odor-driven behaviors. We show that the distance between ePN activity patterns is the main determinant of a fly’s spontaneous discrimination behavior. Manipulations that silence subsets of ePNs have graded behavioral consequences, and effect sizes are predicted by changes in ePN distances. ePN distances predict only innate, not learned, behavior because the latter engages the mushroom body, which enables differentiated responses to even very similar odors. Inhibition from iPNs, which scales with olfactory stimulus strength, enhances innate discrimination of closely related odors, by imposing a high-pass filter on transmitter release from ePN terminals that increases the distance between odor representations. PMID:24012006

Breaching cultural silence: enhancing resilience among Ugandan ...

African Journals Online (AJOL)

Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...

Scavenger receptors mediate the role of SUMO and Ftz-f1 in Drosophila steroidogenesis.

Directory of Open Access Journals (Sweden)

Ana Talamillo

2013-04-01

Full Text Available SUMOylation participates in ecdysteroid biosynthesis at the onset of metamorphosis in Drosophila melanogaster. Silencing the Drosophila SUMO homologue smt3 in the prothoracic gland leads to reduced lipid content, low ecdysone titers, and a block in the larval-pupal transition. Here we show that the SR-BI family of Scavenger Receptors mediates SUMO functions. Reduced levels of Snmp1 compromise lipid uptake in the prothoracic gland. In addition, overexpression of Snmp1 is able to recover lipid droplet levels in the smt3 knockdown prothoracic gland cells. Snmp1 expression depends on Ftz-f1 (an NR5A-type orphan nuclear receptor, the expression of which, in turn, depends on SUMO. Furthermore, we show by in vitro and in vivo experiments that Ftz-f1 is SUMOylated. RNAi-mediated knockdown of ftz-f1 phenocopies that of smt3 at the larval to pupal transition, thus Ftz-f1 is an interesting candidate to mediate some of the functions of SUMO at the onset of metamorphosis. Additionally, we demonstrate that the role of SUMOylation, Ftz-f1, and the Scavenger Receptors in lipid capture and mobilization is conserved in other steroidogenic tissues such as the follicle cells of the ovary. smt3 knockdown, as well as ftz-f1 or Scavenger knockdown, depleted the lipid content of the follicle cells, which could be rescued by Snmp1 overexpression. Therefore, our data provide new insights into the regulation of metamorphosis via lipid homeostasis, showing that Drosophila Smt3, Ftz-f1, and SR-BIs are part of a general mechanism for uptake of lipids such as cholesterol, required during development in steroidogenic tissues.

Ebi/AP-1 suppresses pro-apoptotic genes expression and permits long-term survival of Drosophila sensory neurons.

Directory of Open Access Journals (Sweden)

Young-Mi Lim

Full Text Available Sensory organs are constantly exposed to physical and chemical stresses that collectively threaten the survival of sensory neurons. Failure to protect stressed neurons leads to age-related loss of neurons and sensory dysfunction in organs in which the supply of new sensory neurons is limited, such as the human auditory system. Transducin β-like protein 1 (TBL1 is a candidate gene for ocular albinism with late-onset sensorineural deafness, a form of X-linked age-related hearing loss. TBL1 encodes an evolutionarily conserved F-box-like and WD40 repeats-containing subunit of the nuclear receptor co-repressor/silencing mediator for retinoid and thyroid hormone receptor and other transcriptional co-repressor complexes. Here we report that a Drosophila homologue of TBL1, Ebi, is required for maintenance of photoreceptor neurons. Loss of ebi function caused late-onset neuronal apoptosis in the retina and increased sensitivity to oxidative stress. Ebi formed a complex with activator protein 1 (AP-1 and was required for repression of Drosophila pro-apoptotic and anti-apoptotic genes expression. These results suggest that Ebi/AP-1 suppresses basal transcription levels of apoptotic genes and thereby protects sensory neurons from degeneration.

Organizational Silence in Sports Employees

Science.gov (United States)

Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker

2016-01-01

Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…

Calcium signalling silencing in atrial fibrillation.

Science.gov (United States)

Greiser, Maura

2017-06-15

Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

Silence, an Eye of Knowledge

Science.gov (United States)

Aghamohammadi, Mehdi

2017-01-01

One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

International Nuclear Information System (INIS)

Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

2012-01-01

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

Energy Technology Data Exchange (ETDEWEB)

Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

2012-05-10

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

Optical silencing of C. elegans cells with arch proton pump.

Directory of Open Access Journals (Sweden)

Ayako Okazaki

Full Text Available BACKGROUND: Optogenetic techniques using light-driven ion channels or ion pumps for controlling excitable cells have greatly facilitated the investigation of nervous systems in vivo. A model organism, C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. METHODOLOGY/PRINCIPAL FINDINGS: We describe the application of archaerhodopsin-3 (Arch, a recently reported optical neuronal silencer, to C. elegans. Arch::GFP expressed either in all neurons or body wall muscles of the entire body by means of transgenes were localized, at least partially, to the cell membrane without adverse effects, and caused locomotory paralysis of worms when illuminated by green light (550 nm. Pan-neuronal expression of Arch endowed worms with quick and sustained responsiveness to such light. Worms reliably responded to repeated periods of illumination and non-illumination, and remained paralyzed under continuous illumination for 30 seconds. Worms expressing Arch in different subsets of motor neurons exhibited distinct defects in the locomotory behavior under green light: selective silencing of A-type motor neurons affected backward movement while silencing of B-type motor neurons affected forward movement more severely. Our experiments using a heat-shock-mediated induction system also indicate that Arch becomes fully functional only 12 hours after induction and remains functional for more than 24 hour. CONCLUSIONS/SGNIFICANCE: Arch can be used for silencing neurons and muscles, and may be a useful alternative to currently widely used halorhodopsin (NpHR in optogenetic studies of C. elegans.

The Drosophila melanogaster host model

Science.gov (United States)

Igboin, Christina O.; Griffen, Ann L.; Leys, Eugene J.

2012-01-01

The deleterious and sometimes fatal outcomes of bacterial infectious diseases are the net result of the interactions between the pathogen and the host, and the genetically tractable fruit fly, Drosophila melanogaster, has emerged as a valuable tool for modeling the pathogen–host interactions of a wide variety of bacteria. These studies have revealed that there is a remarkable conservation of bacterial pathogenesis and host defence mechanisms between higher host organisms and Drosophila. This review presents an in-depth discussion of the Drosophila immune response, the Drosophila killing model, and the use of the model to examine bacterial–host interactions. The recent introduction of the Drosophila model into the oral microbiology field is discussed, specifically the use of the model to examine Porphyromonas gingivalis–host interactions, and finally the potential uses of this powerful model system to further elucidate oral bacterial-host interactions are addressed. PMID:22368770

The Drosophila melanogaster host model

Directory of Open Access Journals (Sweden)

Christina O. Igboin

2012-02-01

Full Text Available The deleterious and sometimes fatal outcomes of bacterial infectious diseases are the net result of the interactions between the pathogen and the host, and the genetically tractable fruit fly, Drosophila melanogaster, has emerged as a valuable tool for modeling the pathogen–host interactions of a wide variety of bacteria. These studies have revealed that there is a remarkable conservation of bacterial pathogenesis and host defence mechanisms between higher host organisms and Drosophila. This review presents an in-depth discussion of the Drosophila immune response, the Drosophila killing model, and the use of the model to examine bacterial–host interactions. The recent introduction of the Drosophila model into the oral microbiology field is discussed, specifically the use of the model to examine Porphyromonas gingivalis–host interactions, and finally the potential uses of this powerful model system to further elucidate oral bacterial-host interactions are addressed.

The Drosophila melanogaster host model.

Science.gov (United States)

Igboin, Christina O; Griffen, Ann L; Leys, Eugene J

2012-01-01

The deleterious and sometimes fatal outcomes of bacterial infectious diseases are the net result of the interactions between the pathogen and the host, and the genetically tractable fruit fly, Drosophila melanogaster, has emerged as a valuable tool for modeling the pathogen-host interactions of a wide variety of bacteria. These studies have revealed that there is a remarkable conservation of bacterial pathogenesis and host defence mechanisms between higher host organisms and Drosophila. This review presents an in-depth discussion of the Drosophila immune response, the Drosophila killing model, and the use of the model to examine bacterial-host interactions. The recent introduction of the Drosophila model into the oral microbiology field is discussed, specifically the use of the model to examine Porphyromonas gingivalis-host interactions, and finally the potential uses of this powerful model system to further elucidate oral bacterial-host interactions are addressed.

Development of a gene silencing DNA vector derived from a broad host range geminivirus

Directory of Open Access Journals (Sweden)

Hancock Leandria C

2009-07-01

Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

Chinanteco children’s silences in different classroom situations

Directory of Open Access Journals (Sweden)

Valeria Rebolledo Angulo

2016-01-01

Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.

The ecology of the Drosophila-yeast mutualism in wineries

Science.gov (United States)

2018-01-01

The fruit fly, Drosophila melanogaster, is preferentially found on fermenting fruits. The yeasts that dominate the microbial communities of these substrates are the primary food source for developing D. melanogaster larvae, and adult flies manifest a strong olfactory system-mediated attraction for the volatile compounds produced by these yeasts during fermentation. Although most work on this interaction has focused on the standard laboratory yeast Saccharomyces cerevisiae, a wide variety of other yeasts naturally ferment fallen fruit. Here we address the open question of whether D. melanogaster preferentially associates with distinct yeasts in different, closely-related environments. We characterized the spatial and temporal dynamics of Drosophila-associated fungi in Northern California wineries that use organic grapes and natural fermentation using high-throughput, short-amplicon sequencing. We found that there is nonrandom structure in the fungal communities that are vectored by flies both between and within vineyards. Within wineries, the fungal communities associated with flies in cellars, fermentation tanks, and pomace piles are distinguished by varying abundances of a small number of yeast species. To investigate the origins of this structure, we assayed Drosophila attraction to, oviposition on, larval development in, and longevity when consuming the yeasts that distinguish vineyard microhabitats from each other. We found that wild fly lines did not respond differentially to the yeast species that distinguish winery habitats in habitat specific manner. Instead, this subset of yeast shares traits that make them attractive to and ensure their close association with Drosophila. PMID:29768432

Organization and evolution of Drosophila terminin: similarities and differences between Drosophila and human telomeres

Directory of Open Access Journals (Sweden)

Grazia Daniela Raffa

2013-05-01

Full Text Available Drosophila lacks telomerase and fly telomeres are elongated by occasional transposition of three specialized retroelements. Drosophila telomeres do not terminate with GC-rich repeats and are assembled independently of the sequence of chromosome ends. Recent work has shown that Drosophila telomeres are capped by the terminin complex, which includes the fast-evolving proteins HOAP, HipHop, Moi and Ver. These proteins are not conserves outside Drosophilidae and localize and function exclusively at telomeres, protecting them from fusion events. Other proteins required to prevent end-to-end fusion in flies include HP1, Eff/UbcD1, ATM, the components of the Mre11-Rad50-Nbs (MRN complex, and the Woc transcription factor. These proteins do not share the terminin properties; they are evolutionarily conserved non-fast-evolving proteins that do not accumulate only telomeres and do not serve telomere-specific functions. We propose that following telomerase loss, Drosophila rapidly evolved terminin to bind chromosome ends in a sequence-independent manner. This hypothesis suggests that terminin is the functional analog of the shelterin complex that protects human telomeres. The non-terminin proteins are instead likely to correspond to ancestral telomere-associated proteins that did not evolve as rapidly as terminin because of the functional constraints imposed by their involvement in diverse cellular processes. Thus, it appears that the main difference between Drosophila and human telomeres is in the protective complexes that specifically associate with the DNA termini. We believe that Drosophila telomeres offer excellent opportunities for investigations on human telomere biology. The identification of additional Drosophila genes encoding non-terminin proteins involved in telomere protection might lead to the discovery of novel components of human telomeres.

Sucrose Improves Insecticide Activity Against Drosophila suzukii (Diptera: Drosophilidae).

Science.gov (United States)

Cowles, Richard S; Rodriguez-Saona, Cesar; Holdcraft, Robert; Loeb, Gregory M; Elsensohn, Johanna E; Hesler, Steven P

2015-04-01

The addition of sucrose to insecticides targeting spotted wing drosophila, Drosophila suzukii (Matsumura), enhanced lethality in laboratory, semifield, and field tests. In the laboratory, 0.1% sucrose added to a spray solution enhanced spotted wing drosophila feeding. Flies died 120 min earlier when exposed to spinosad residues at label rates enhanced with sucrose. Added sucrose reduced the LC50 for dried acetamiprid residues from 82 to 41 ppm in the spray solution. Laboratory bioassays of spotted wing drosophila mortality followed exposure to grape and blueberry foliage and/or fruit sprayed and aged in the field. On grape foliage, the addition of 2.4 g/liter of sugar with insecticide sprays resulted in an 11 and 6% increase of spotted wing drosophila mortality at 1 and 2 d exposures to residues, respectively, averaged over seven insecticides with three concentrations. In a separate experiment, spinetoram and cyantraniliprole reduced by 95-100% the larval infestation of blueberries, relative to the untreated control, 7 d after application at labeled rates when applied with 1.2 g/liter sucrose in a spray mixture, irrespective of rainfall; without sucrose infestation was reduced by 46-91%. Adding sugar to the organically acceptable spinosyn, Entrust, reduced larval infestation of strawberries by >50% relative to without sugar for five of the six sample dates during a season-long field trial. In a small-plot field test with blueberries, weekly applications in alternating sprays of sucrose plus reduced-risk insecticides, spinetoram or acetamiprid, reduced larval infestation relative to the untreated control by 76%; alternating bifenthrin and phosmet (without sucrose) reduced infestation by 65%. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Hermann Muller and Mutations in Drosophila

Science.gov (United States)

dropdown arrow Site Map A-Z Index Menu Synopsis Hermann Muller and Mutations in Drosophila Resources with University of Texas. In Austin his experiments on fruit flies (Drosophila) first showed that exposure to September to spend a year at the only Drosophila laboratory in Europe which was doing parallel work

Virus-induced gene silencing in diverse maize lines using the Brome Mosaic virus-based silencing vector

Science.gov (United States)

Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...

Titration and hysteresis in epigenetic chromatin silencing

International Nuclear Information System (INIS)

Dayarian, Adel; Sengupta, Anirvan M

2013-01-01

Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)

Genetic or pharmacological activation of the Drosophila PGC-1α ortholog spargel rescues the disease phenotypes of genetic models of Parkinson's disease.

Science.gov (United States)

Ng, Chee-Hoe; Basil, Adeline H; Hang, Liting; Tan, Royston; Goh, Kian-Leong; O'Neill, Sharon; Zhang, Xiaodong; Yu, Fengwei; Lim, Kah-Leong

2017-07-01

Despite intensive research, the etiology of Parkinson's disease (PD) remains poorly understood and the disease remains incurable. However, compelling evidence gathered over decades of research strongly support a role for mitochondrial dysfunction in PD pathogenesis. Related to this, PGC-1α, a key regulator of mitochondrial biogenesis, has recently been proposed to be an attractive target for intervention in PD. Here, we showed that silencing of expression of the Drosophila PGC-1α ortholog spargel results in PD-related phenotypes in flies and also seem to negate the effects of AMPK activation, which we have previously demonstrated to be neuroprotective, that is, AMPK-mediated neuroprotection appears to require PGC-1α. Importantly, we further showed that genetic or pharmacological activation of the Drosophila PGC-1α ortholog spargel is sufficient to rescue the disease phenotypes of Parkin and LRRK2 genetic fly models of PD, thus supporting the proposed use of PGC-1α-related strategies for neuroprotection in PD. Copyright © 2017 National Neuroscience Institute. Published by Elsevier Inc. All rights reserved.

Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.

Directory of Open Access Journals (Sweden)

Jiexiong Feng

Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.

Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.

Science.gov (United States)

Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R

2017-05-01

Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification of four Drosophila allatostatins as the cognate ligands for the Drosophila orphan receptor DAR-2

DEFF Research Database (Denmark)

Lenz, C; Williamson, M; Hansen, G N

2001-01-01

The allatostatins are generally inhibitory insect neuropeptides. The Drosophila orphan receptor DAR-2 is a G-protein-coupled receptor, having 47% amino acid residue identity with another Drosophila receptor, DAR-1 (which is also called dros. GPCR, or DGR) that was previously shown...... to be the receptor for an intrinsic Drosophila A-type (cockroach-type) allatostatin. Here, we have permanently expressed DAR-2 in CHO cells and found that it is the cognate receptor for four Drosophila A-type allatostatins, the drostatins-A1 to -A4. Of all the drostatins, drostatin-A4 (Thr...... weakly in the brain. The Drosophila larval gut also contains about 20-30 endocrine cells, expressing the gene for the drostatins-A1 to -A4. We suggest, therefore, that DAR-2 mediates an allatostatin (drostatin)-induced inhibition of gut motility. This is the first report on the permanent and functional...

Choosing Silence for Equality in and through Schooling

Science.gov (United States)

Lees, Helen E.

2016-01-01

This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…

Hypergravity-induced altered behavior in Drosophila

Science.gov (United States)

Hosamani, Ravikumar; Wan, Judy; Marcu, Oana; Bhattacharya, Sharmila

2012-07-01

Microgravity and mechanical stress are important factors of the spaceflight environment, and affect astronaut health and behavior. Structural, functional, and behavioral mechanisms of all cells and organisms are adapted to Earth's gravitational force, 1G, while altered gravity can pose challenges to their adaptability to this new environment. On ground, hypergravity paradigms have been used to predict and complement studies on microgravity. Even small changes that take place at a molecular and genetic level during altered gravity may result in changes in phenotypic behavior. Drosophila provides a robust and simple, yet very reliable model system to understand the complexity of hypergravity-induced altered behavior, due to availability of a plethora of genetic tools. Locomotor behavior is a sensitive parameter that reflects the array of molecular adaptive mechanisms recruited during exposure to altered gravity. Thus, understanding the genetic basis of this behavior in a hypergravity environment could potentially extend our understanding of mechanisms of adaptation in microgravity. In our laboratory we are trying to dissect out the cellular and molecular mechanisms underlying hypergravity-induced oxidative stress, and its potential consequences on behavioral alterations by using Drosophila as a model system. In the present study, we employed pan-neuronal and mushroom body specific knock-down adult flies by using Gal4/UAS system to express inverted repeat transgenes (RNAi) to monitor and quantify the hypergravity-induced behavior in Drosophila. We established that acute hypergravity (3G for 60 min) causes a significant and robust decrease in the locomotor behavior in adult Drosophila, and that this change is dependent on genes related to Parkinson's disease, such as DJ-1α , DJ-1β , and parkin. In addition, we also showed that anatomically the control of this behavior is significantly processed in the mushroom body region of the fly brain. This work links a molecular

A Miniaturized Video System for Monitoring Drosophila Behavior

Science.gov (United States)

Bhattacharya, Sharmila; Inan, Omer; Kovacs, Gregory; Etemadi, Mozziyar; Sanchez, Max; Marcu, Oana

2011-01-01

Long-term spaceflight may induce a variety of harmful effects in astronauts, resulting in altered motor and cognitive behavior. The stresses experienced by humans in space - most significantly weightlessness (microgravity) and cosmic radiation - are difficult to accurately simulate on Earth. In fact, prolonged and concomitant exposure to microgravity and cosmic radiation can only be studied in space. Behavioral studies in space have focused on model organisms, including Drosophila melanogaster. Drosophila is often used due to its short life span and generational cycle, small size, and ease of maintenance. Additionally, the well-characterized genetics of Drosophila behavior on Earth can be applied to the analysis of results from spaceflights, provided that the behavior in space is accurately recorded. In 2001, the BioExplorer project introduced a low-cost option for researchers: the small satellite. While this approach enabled multiple inexpensive launches of biological experiments, it also imposed stringent restrictions on the monitoring systems in terms of size, mass, data bandwidth, and power consumption. Suggested parameters for size are on the order of 100 mm3 and 1 kg mass for the entire payload. For Drosophila behavioral studies, these engineering requirements are not met by commercially available systems. One system that does meet many requirements for behavioral studies in space is the actimeter. Actimeters use infrared light gates to track the number of times a fly crosses a boundary within a small container (3x3x40 mm). Unfortunately, the apparatus needed to monitor several flies at once would be larger than the capacity of the small satellite. A system is presented, which expands on the actimeter approach to achieve a highly compact, low-power, ultra-low bandwidth solution for simultaneous monitoring of the behavior of multiple flies in space. This also provides a simple, inexpensive alternative to the current systems for monitoring Drosophila

Basic leucine zipper protein Cnc-C is a substrate and transcriptional regulator of the Drosophila 26S proteasome.

Science.gov (United States)

Grimberg, Kristian Björk; Beskow, Anne; Lundin, Daniel; Davis, Monica M; Young, Patrick

2011-02-01

While the 26S proteasome is a key proteolytic complex, little is known about how proteasome levels are maintained in higher eukaryotic cells. Here we describe an RNA interference (RNAi) screen of Drosophila melanogaster that was used to identify transcription factors that may play a role in maintaining levels of the 26S proteasome. We used an RNAi library against 993 Drosophila transcription factor genes to identify genes whose suppression in Schneider 2 cells stabilized a ubiquitin-green fluorescent protein reporter protein. This screen identified Cnc (cap 'n' collar [CNC]; basic region leucine zipper) as a candidate transcriptional regulator of proteasome component expression. In fact, 20S proteasome activity was reduced in cells depleted of cnc. Immunoblot assays against proteasome components revealed a general decline in both 19S regulatory complex and 20S proteasome subunits after RNAi depletion of this transcription factor. Transcript-specific silencing revealed that the longest of the seven transcripts for the cnc gene, cnc-C, was needed for proteasome and p97 ATPase production. Quantitative reverse transcription-PCR confirmed the role of Cnc-C in activation of transcription of genes encoding proteasome components. Expression of a V5-His-tagged form of Cnc-C revealed that the transcription factor is itself a proteasome substrate that is stabilized when the proteasome is inhibited. We propose that this single cnc gene in Drosophila resembles the ancestral gene family of mammalian nuclear factor erythroid-derived 2-related transcription factors, which are essential in regulating oxidative stress and proteolysis.

Evasion of short interfering RNA-directed antiviral silencing in Musa acuminata persistently infected with six distinct banana streak pararetroviruses.

Science.gov (United States)

Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M

2014-10-01

Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing

[E. M. Jellinek's silenced and silencing transgenerational story].

Science.gov (United States)

Kelemen, Gábor; Márk, Mónika

2013-01-01

Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.

Things talked about while we remain silence and things we’re silence about while talking: The starting assumptions for an anthropology of silence about the nearest past

Directory of Open Access Journals (Sweden)

Đerić Gordana

2007-01-01

Full Text Available Wars of the last decade of the 20th century in former Yugoslavia have brought the whole region into the center of media attention and, accordingly, have aroused interest of the western academic theory. Since the latest ′discovery of the Balkans′ was brought into being precisely due to wars, one shouldn’t be surprised to find that many academic approaches to questions of Yugoslavia dismemberment are biased, superficial or exotic. On the other hand, Serbian academic auditorium was far from being active in elaborating questions of its own contemporality and closest past - for various reasons, but mostly because of its detachment from systematic explorations. Thus, acknowledgement and presentations of mentioned issues were left to be the job of media publicists, others outside of academic community or were left to be treated in the time to come. Domestic scholars were rarely intrigued to deal with these matters, despite the fact that images of recent wars were often built on stereotypes and propaganda and that the formed knowledge of the entire subject suffered from severe simplification. The themes of great violence were particularly avoided which left some of the crucial war events out of the academic focus - the reason being, very probably, the estimation that what made Serbia and the region worldwide known is best to be forgotten. Contemporary academic silence on recent wars, in retrospection, could easily be placed within the continuum of silence during the socialist period and war which preceded it. Having all mentioned in mind, this paper not only investigates reasons for avoiding the issues of the nearest past and influences of silence in socialism on what came afterwards, but also highlights the importance of exploring semantics and functions of silence and silencing in recent wars, as well as the relationship between silence and social memory constructions.

Transcriptional Silencing of Retroviral Vectors

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

1996-01-01

. Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

Duplication of an upstream silencer of FZP increases grain yield in rice.

Science.gov (United States)

Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong

2017-11-01

Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

Neural circuit components of the Drosophila OFF motion vision pathway.

Science.gov (United States)

Meier, Matthias; Serbe, Etienne; Maisak, Matthew S; Haag, Jürgen; Dickson, Barry J; Borst, Alexander

2014-02-17

Detecting the direction of visual motion is an essential task of the early visual system. The Reichardt detector has been proven to be a faithful description of the underlying computation in insects. A series of recent studies addressed the neural implementation of the Reichardt detector in Drosophila revealing the overall layout in parallel ON and OFF channels, its input neurons from the lamina (L1→ON, and L2→OFF), and the respective output neurons to the lobula plate (ON→T4, and OFF→T5). While anatomical studies showed that T4 cells receive input from L1 via Mi1 and Tm3 cells, the neurons connecting L2 to T5 cells have not been identified so far. It is, however, known that L2 contacts, among others, two neurons, called Tm2 and L4, which show a pronounced directionality in their wiring. We characterized the visual response properties of both Tm2 and L4 neurons via Ca(2+) imaging. We found that Tm2 and L4 cells respond with an increase in activity to moving OFF edges in a direction-unselective manner. To investigate their participation in motion vision, we blocked their output while recording from downstream tangential cells in the lobula plate. Silencing of Tm2 and L4 completely abolishes the response to moving OFF edges. Our results demonstrate that both cell types are essential components of the Drosophila OFF motion vision pathway, prior to the computation of directionality in the dendrites of T5 cells. Copyright © 2014 Elsevier Ltd. All rights reserved.

The invasive spotted-wing Drosophila (Diptera, Drosophilidae has been found in the city of São Paulo (Brazil

Directory of Open Access Journals (Sweden)

Carlos Ribeiro Vilela

2014-12-01

Full Text Available The invasive spotted-wing Drosophila (Diptera, Drosophilidae has been found in the city of São Paulo (Brazil. Drosophila suzukii (Matsumura, 1931, the cherry fly or spotted-wing Drosophila, a pest species from the Oriental and southeastern Palaearctic regions belonging to the melanogaster group, invaded the Nearctic and western countries of the Palaearctic regions late last decade (2008 and, more recently (2013, the southern Brazilian states of Rio Grande do Sul and Santa Catarina. Early in 2014 it was reared from blueberries produced in São Joaquim, state of Santa Catarina, that were bought at a São Paulo city grocery store. Despite being a cold-adapted species, after having arrived to the southeastern state of São Paulo, this invasive fly will probably expand its territory to other Brazilian states and South American countries through trade of cultivated soft skin small fruits, such as blueberries and strawberries, as well as naturally through the use of small wild fruits as breeding sites.

Listen and the question of silence

DEFF Research Database (Denmark)

Doubinsky, Sebastien

2018-01-01

Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...

Myoblast fusion in Drosophila

Energy Technology Data Exchange (ETDEWEB)

Haralalka, Shruti [Stowers Institute for Medical Research, Kansas City, MO 64110 (United States); Abmayr, Susan M., E-mail: sma@stowers.org [Stowers Institute for Medical Research, Kansas City, MO 64110 (United States); Department of Anatomy and Cell Biology, University of Kansas Medical Center, Kansas City, MO 66160 (United States)

2010-11-01

The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral side of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.

Myoblast fusion in Drosophila

International Nuclear Information System (INIS)

Haralalka, Shruti; Abmayr, Susan M.

2010-01-01

The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral side of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.

Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

Science.gov (United States)

Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

2005-07-20

Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

RISC assembly: Coordination between small RNAs and Argonaute proteins.

Science.gov (United States)

Kobayashi, Hotaka; Tomari, Yukihide

2016-01-01

Non-coding RNAs generally form ribonucleoprotein (RNP) complexes with their partner proteins to exert their functions. Small RNAs, including microRNAs, small interfering RNAs, and PIWI-interacting RNAs, assemble with Argonaute (Ago) family proteins into the effector complex called RNA-induced silencing complex (RISC), which mediates sequence-specific target gene silencing. RISC assembly is not a simple binding between a small RNA and Ago; rather, it follows an ordered multi-step pathway that requires specific accessory factors. Some steps of RISC assembly and RISC-mediated gene silencing are dependent on or facilitated by particular intracellular platforms, suggesting their spatial regulation. In this review, we summarize the currently known mechanisms for RISC assembly of each small RNA class and propose a revised model for the role of the chaperone machinery in the duplex-initiated RISC assembly pathway. This article is part of a Special Issue entitled: Clues to long noncoding RNA taxonomy1, edited by Dr. Tetsuro Hirose and Dr. Shinichi Nakagawa. Copyright © 2015 Elsevier B.V. All rights reserved.

The ethics of silence: Does conflict of interest explain employee silence?

Science.gov (United States)

Anderson, James

2018-03-01

Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.

Silence as a Response to Everyday Violence

DEFF Research Database (Denmark)

Gammeltoft, Tine

2016-01-01

Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...

Metabolomic Studies in Drosophila.

Science.gov (United States)

Cox, James E; Thummel, Carl S; Tennessen, Jason M

2017-07-01

Metabolomic analysis provides a powerful new tool for studies of Drosophila physiology. This approach allows investigators to detect thousands of chemical compounds in a single sample, representing the combined contributions of gene expression, enzyme activity, and environmental context. Metabolomics has been used for a wide range of studies in Drosophila , often providing new insights into gene function and metabolic state that could not be obtained using any other approach. In this review, we survey the uses of metabolomic analysis since its entry into the field. We also cover the major methods used for metabolomic studies in Drosophila and highlight new directions for future research. Copyright © 2017 by the Genetics Society of America.

Biological effects of radon in Drosophila; Efectos biologicos del radon en Drosophila

Energy Technology Data Exchange (ETDEWEB)

Pimentel P, A E; Tavera D, L; Cruces M, M P; Arceo M, C; Rosa D, M.E. de la

1992-04-15

The main objective of this investigation, is to study the biological effects of the Radon-222 at low dose in 'Drosophila melanogaster'. It is necessary to mention that these effects will analyze from the genetic point of view for: 1) To evaluate in which form the Radon-222 to low dose it influences in some genetic components of the adaptation in Drosophila, such as: fecundity, viability egg-adult and sex proportion. 2) To evaluate which is the genetic effect that induces the Radon to low dose by means of the SMART technique in Drosophila melanogaster, and this way to try of to identify which is the possible mechanism that causes the genetic damage to somatic level. The carried out investigation was divided in three stages: 1. Tests to the vacuum resistance. 2. Test of somatic mutation, and 3. Determination of the presence of radon daughters on the adult of Drosophila. It is necessary to point out that all the experiments were made by triplicate and in each one of them was placed detectors in preset places. Those obtained results are presented inside the 4 charts included in the present work. (Author)

Biological effects of radon in Drosophila; Efectos biologicos del radon en Drosophila

Energy Technology Data Exchange (ETDEWEB)

Pimentel P, A.E.; Tavera D, L.; Cruces M, M.P.; Arceo M, C.; Rosa D, M.E. de la

1992-04-15

The main objective of this investigation, is to study the biological effects of the Radon-222 at low dose in 'Drosophila melanogaster'. It is necessary to mention that these effects will analyze from the genetic point of view for: 1) To evaluate in which form the Radon-222 to low dose it influences in some genetic components of the adaptation in Drosophila, such as: fecundity, viability egg-adult and sex proportion. 2) To evaluate which is the genetic effect that induces the Radon to low dose by means of the SMART technique in Drosophila melanogaster, and this way to try of to identify which is the possible mechanism that causes the genetic damage to somatic level. The carried out investigation was divided in three stages: 1. Tests to the vacuum resistance. 2. Test of somatic mutation, and 3. Determination of the presence of radon daughters on the adult of Drosophila. It is necessary to point out that all the experiments were made by triplicate and in each one of them was placed detectors in preset places. Those obtained results are presented inside the 4 charts included in the present work. (Author)

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

Science.gov (United States)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

Evaluation of Off-season Potential Breeding Sources for Spotted Wing Drosophila (Drosophila suzukii Matsumura) in Michigan.

Science.gov (United States)

Bal, Harit K; Adams, Christopher; Grieshop, Matthew

2017-12-05

It has been suggested that fruit wastes including dropped and unharvested fruits, and fruit byproducts (i.e., pomace) found in fruit plantings and cideries or wine-making facilities could serve as potential off-season breeding sites for spotted wing Drosophila (Drosophila suzukii Matsumura (Diptera: Drosophilidae)). This idea, however, has yet to be widely tested. The goal of our study was to determine the potential of dropped fruit and fruit wastes as Fall spotted wing Drosophila breeding resources in Michigan, USA. Fruit waste samples were collected from 15 farms across the lower peninsula of Michigan and were evaluated for spotted wing Drosophila and other drosophilid emergence and used in host suitability bioassays. All of the dropped apples, pears, grapes, and raspberries and 40% of apple and 100% of grape fruit pomace evaluated were found to contain spotted wing Drosophila with the highest numbers collected from dropped grapes and pears. Greater spotted wing Drosophila recovery was found in fruit wastes at sites attached with cideries and wine-making facilities and with multiple cultivated fruit crops than sites with no cideries and only one crop. Females oviposited in raspberry, pear, apple, grape, apple pomace and grape pomace samples with the highest rates of reproduction in raspberries. Our results demonstrate that fruit wastes including dropped berry, pomme and stone fruits, as well as fruit compost may be important late season reproductive resources for spotted wing Drosophila. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Drosophila learn efficient paths to a food source

OpenAIRE

Stewart, James; Lim, Terrence; Claridge-Chang, Adam; Wang, Zhiping; Toh, Alicia; Rahman, Mashiur; Navawongse, Rapeechai; Raczkowska, Marlena; Choudhury, Deepak

2016-01-01

Elucidating the genetic, and neuronal bases for learned behavior is a central problem in neuroscience. A leading system for neurogenetic discovery is the vinegar fly Drosophila melanogaster; fly memory research has identified genes and circuits that mediate aversive and appetitive learning. However, methods to study adaptive food-seeking behavior in this animal have lagged decades behind rodent feeding analysis, largely due to the challenges presented by their small scale. There is currently ...

Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

Science.gov (United States)

Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

2016-11-29

Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

Use of Drosophila to study DNA repair

International Nuclear Information System (INIS)

Boyd, J.B.; Harris, P.V.; Sakaguchi, K.

1988-01-01

This paper discusses Drosophila, the premier metazoan organism for analyzing many fundamental features of eukaryotic gene regulation. The authors present adaptations of several approaches for studying DNA repair to an analysis of repair-defective mutants in Drosophila. A current understanding of Drosophila DNA repair is described

Electrophysiological Recordings from Lobula Plate Tangential Cells in Drosophila.

Science.gov (United States)

Mauss, Alex S; Borst, Alexander

2016-01-01

Drosophila has emerged as an important model organism for the study of the neural basis of behavior. Its main asset is the experimental accessibility of identified neurons by genetic manipulation and physiological recordings. Drosophila therefore offers the opportunity to reach an integrative understanding of the development and neural underpinnings of behavior at all processing stages, from sensing to motor control, in a single species. Here, we will provide an account of the procedures involved in recording the electrical potential of individual neurons in the visual system of adult Drosophila using the whole-cell patch-clamp method. To this end, animals are fixed to a holder and mounted below a recording chamber. The head capsule is cut open and the glial sheath covering the brain is ruptured by a combination of shearing and enzymatic digest. Neuronal somata are thus exposed and targeted by low-resistance patch electrodes. After formation of a high resistance seal, electrical access to the cell is gained by small current pulses and suction. Stable recordings of large neurons are feasible for >1 h and can be combined with controlled visual stimulation as well as genetic and pharmacological manipulation of upstream circuit elements to infer circuit function in great detail.

RNA interference silencing of CHS greatly alters the growth pattern of apple (Malus x domestica).

Science.gov (United States)

Dare, Andrew P; Hellens, Roger P

2013-08-01

Plants produce a vast array of phenolic compounds which are essential for their survival on land. One major class of polyphenols are the flavonoids and their formation is dependent on the enzyme chalcone synthase (CHS). In a recent study we silenced the CHS genes of apple (Malus × domestica Borkh.) and observed a loss of pigmentation in the fruit skin, flowers and stems. More surprisingly, highly silenced lines were significantly reduced in size, with small leaves and shortened internode lengths. Chemical analysis also revealed that the transgenic shoots contained greatly reduced concentrations of flavonoids which are known to modulate auxin flow. An auxin transport study verified this, with an increased auxin transport in the CHS-silenced lines. Overall, these findings suggest that auxin transport in apple has adapted to take place in the presence of high endogenous concentrations of flavonoids. Removal of these compounds therefore results in abnormal auxin movement and a highly disrupted growth pattern.

U bodies respond to nutrient stress in Drosophila

International Nuclear Information System (INIS)

Buckingham, Mickey; Liu, Ji-Long

2011-01-01

The neurodegenerative disease spinal muscular atrophy (SMA) is caused by mutation of the survival motor neuron 1 (SMN1) gene. Cytoplasmic SMN protein-containing granules, known as U snRNP bodies (U bodies), are thought to be responsible for the assembly and storage of small nuclear ribonucleoproteins (snRNPs) which are essential for pre-mRNA splicing. U bodies exhibit close association with cytoplasmic processing bodies (P bodies), which are involved in mRNA decay and translational repression. The close association of the U body and P body in Drosophila resemble that of the stress granule and P body in yeast and mammalian cells. However, it is unknown whether the U body is responsive to any stress. Using Drosophila oogenesis as a model, here we show that U bodies increase in size following nutritional deprivation. Despite nutritional stress, U bodies maintain their close association with P bodies. Our results show that U bodies are responsive to nutrition changes, presumably through the U body–P body pathway.

U bodies respond to nutrient stress in Drosophila

Energy Technology Data Exchange (ETDEWEB)

Buckingham, Mickey; Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk

2011-12-10

The neurodegenerative disease spinal muscular atrophy (SMA) is caused by mutation of the survival motor neuron 1 (SMN1) gene. Cytoplasmic SMN protein-containing granules, known as U snRNP bodies (U bodies), are thought to be responsible for the assembly and storage of small nuclear ribonucleoproteins (snRNPs) which are essential for pre-mRNA splicing. U bodies exhibit close association with cytoplasmic processing bodies (P bodies), which are involved in mRNA decay and translational repression. The close association of the U body and P body in Drosophila resemble that of the stress granule and P body in yeast and mammalian cells. However, it is unknown whether the U body is responsive to any stress. Using Drosophila oogenesis as a model, here we show that U bodies increase in size following nutritional deprivation. Despite nutritional stress, U bodies maintain their close association with P bodies. Our results show that U bodies are responsive to nutrition changes, presumably through the U body-P body pathway.

MicroRNA silencing in primates: towards development of novel therapeutics

DEFF Research Database (Denmark)

Petri, Andreas; Lindow, Morten; Kauppinen, Sakari

2009-01-01

MicroRNAs (miRNA) comprise an abundant class of small noncoding RNAs that act as important posttranscriptional regulators of gene expression. Accumulating evidence showing that aberrantly expressed miRNAs play important roles in human cancers underscores them as potential targets for therapeutic ...... intervention. Recent reports on efficient miRNA silencing in rodents and nonhuman primates using high-affinity targeting by chemically modified antisense oligonucleotides highlight the utility of such compounds in the development of miRNA-based cancer therapeutics....

Analysis of blastomogenic activity of mammal carcinogens in Drosophila using the wts (P4) allele and RNA interference-induced P53 silencing

Czech Academy of Sciences Publication Activity Database

Kirsanov, K. I.; Lesovaya, E. A.; Sidorov, Roman; Belitsky, G. A.; Yakubovskaya, M. G.

2011-01-01

Roč. 47, č. 4 (2011), s. 409-416 ISSN 1022-7954 R&D Projects: GA AV ČR IAA500070601 Grant - others:Russian Foundation for Basic Research(RU) 08-04-01596_a; Russian Foundation for Basic Research(RU) 11-04-01978_a Institutional research plan: CEZ:AV0Z50070508 Keywords : Drosophila Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.427, year: 2011

Molecular landscape of modified histones in Drosophila heterochromatic genes and euchromatin-heterochromatin transition zones.

Directory of Open Access Journals (Sweden)

Jiro C Yasuhara

2008-01-01

Full Text Available Constitutive heterochromatin is enriched in repetitive sequences and histone H3-methylated-at-lysine 9. Both components contribute to heterochromatin's ability to silence euchromatic genes. However, heterochromatin also harbors hundreds of expressed genes in organisms such as Drosophila. Recent studies have provided a detailed picture of sequence organization of D. melanogaster heterochromatin, but how histone modifications are associated with heterochromatic sequences at high resolution has not been described. Here, distributions of modified histones in the vicinity of heterochromatic genes of normal embryos and embryos homozygous for a chromosome rearrangement were characterized using chromatin immunoprecipitation and genome tiling arrays. We found that H3-di-methylated-at-lysine 9 (H3K9me2 was depleted at the 5' ends but enriched throughout transcribed regions of heterochromatic genes. The profile was distinct from that of euchromatic genes and suggests that heterochromatic genes are integrated into, rather than insulated from, the H3K9me2-enriched domain. Moreover, the profile was only subtly affected by a Su(var3-9 null mutation, implicating a histone methyltransferase other than SU(VAR3-9 as responsible for most H3K9me2 associated with heterochromatic genes in embryos. On a chromosomal scale, we observed a sharp transition to the H3K9me2 domain, which coincided with increased retrotransposon density in the euchromatin-heterochromatin (eu-het transition zones on the long chromosome arms. Thus, a certain density of retrotransposons, rather than specific boundary elements, may demarcate Drosophila pericentric heterochromatin. We also demonstrate that a chromosome rearrangement that created a new eu-het junction altered H3K9me2 distribution and induced new euchromatic sites of enrichment as far as several megabases away from the breakpoint. Taken together, the findings argue against simple classification of H3K9me as the definitive signature

Detecting novel low-abundant transcripts in Drosophila

DEFF Research Database (Denmark)

Lee, Sanggyu; Bao, Jingyue; Zhou, Guolin

2005-01-01

Increasing evidence suggests that low-abundant transcripts may play fundamental roles in biological processes. In an attempt to estimate the prevalence of low-abundant transcripts in eukaryotic genomes, we performed a transcriptome analysis in Drosophila using the SAGE technique. We collected 244......,313 SAGE tags from transcripts expressed in Drosophila embryonic, larval, pupae, adult, and testicular tissue. From these SAGE tags, we identified 40,823 unique SAGE tags. Our analysis showed that 55% of the 40,823 unique SAGE tags are novel without matches in currently known Drosophila transcripts...... in the Drosophila genome. Our study reveals the presence of a significant number of novel low-abundant transcripts in Drosophila, and highlights the need to isolate these novel low-abundant transcripts for further biological studies. Udgivelsesdato: 2005-Jun...

Silencing of cytosolic NADP(+)-dependent isocitrate dehydrogenase by small interfering RNA enhances the sensitivity of HeLa cells toward staurosporine.

Science.gov (United States)

Lee, Su-Min; Park, Sin Young; Shin, Seoung Woo; Kil, In Sup; Yang, Eun Sun; Park, Jeen-Woo

2009-02-01

Staurosporine induces the production of reactive oxygen species, which play an important causative role in apoptotic cell death. Recently, it was demonstrated that the control of cellular redox balance and the defense against oxidative damage is one of the primary functions of cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) by supplying NADPH for antioxidant systems. The present report shows that silencing of IDPc expression in HeLa cells greatly enhances apoptosis induced by staurosporine. Transfection of HeLa cells with an IDPc small interfering RNA (siRNA) markedly decreased activity of IDPc, enhancing the susceptibility of staurosporine-induced apoptosis reflected by DNA fragmentation, cellular redox status and the modulation of apoptotic marker proteins. These results indicate that IDPc may play an important role in regulating the apoptosis induced by staurosporine and the sensitizing effect of IDPc siRNA on the apoptotic cell death of HeLa cells offers the possibility of developing a modifier of cancer chemotherapy.

Mutuality, Self-Silencing, and Disordered Eating in College Women

Science.gov (United States)

Wechsler, Lisa S.; Riggs, Shelley A.; Stabb, Sally D.; Marshall, David M.

2006-01-01

The current study examined patterns of association among mutuality, self-silencing, and disordered eating in an ethnically diverse sample of college women (N = 149). Partner mutuality and overall self-silencing were negatively correlated and together were associated with six disordered eating indices. All four self-silencing subscales were…

After the Blackbird Whistles: Listening to Silence in Classrooms

Science.gov (United States)

Schultz, Katherine

2010-01-01

Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…

Memories Persist in Silence

Directory of Open Access Journals (Sweden)

Sandra Patricia Arenas Grisales

2012-08-01

Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.

Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

Directory of Open Access Journals (Sweden)

Ivyna Pau Ni Bong

2016-11-01

Full Text Available Multiple myeloma (MM is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST genes are localized, respectively. This led us to further study the functions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05. NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05. Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01. Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM.

Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

Science.gov (United States)

Bong, Ivyna Pau Ni; Ng, Ching Ching; Fakiruddin, Shaik Kamal; Lim, Moon Nian; Zakaria, Zubaidah

2016-01-01

Multiple myeloma (MM) is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM) phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) genes are localized, respectively. This led us to further study the fprotein expression in unctions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA)-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05). NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05). Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01). Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM. PMID:27754828

Organizational Silence in Universities as the Predictor of Organizational Culture

Directory of Open Access Journals (Sweden)

Erkan YAMAN

2014-04-01

Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and

Tospovirus : induction and suppression of RNA silencing

NARCIS (Netherlands)

Hedil, Marcio

2016-01-01

While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

Endogenous small RNAs and antibacterial immunity in plants.

Science.gov (United States)

Jin, Hailing

2008-08-06

Small RNAs are non-coding regulatory RNA molecules that control gene expression by mediating mRNA degradation, translational inhibition, or chromatin modification. Virus-derived small RNAs induce silencing of viral RNAs and are essential for antiviral defense in both animal and plant systems. The role of host endogenous small RNAs on antibacterial immunity has only recently been recognized. Host disease resistance and defense responses are achieved by activation and repression of a large array of genes. Certain endogenous small RNAs in plants, including microRNAs (miRNAs) and small interfering RNAs (siRNAs), are induced or repressed in response to pathogen attack and subsequently regulate the expression of genes involved in disease resistance and defense responses by mediating transcriptional or post-transcriptional gene silencing. Thus, these small RNAs play an important role in gene expression reprogramming in plant disease resistance and defense responses. This review focuses on the recent findings of plant endogenous small RNAs in antibacterial immunity.

Identification of a novel Drosophila gene, beltless, using injectable embryonic and adult RNA interference (RNAi

Directory of Open Access Journals (Sweden)

Manev Hari

2003-08-01

Full Text Available Abstract Background RNA interference (RNAi is a process triggered by a double-stranded RNA that leads to targeted down-regulation/silencing of gene expression and can be used for functional genomics; i.e. loss-of-function studies. Here we report on the use of RNAi in the identification of a developmentally important novel Drosophila (fruit fly gene (corresponding to a putative gene CG5652/GM06434, that we named beltless based on an embryonic loss-of-function phenotype. Results Beltless mRNA is expressed in all developmental stages except in 0–6 h embryos. In situ RT-PCR localized beltless mRNA in the ventral cord and brain of late stage embryos and in the nervous system, ovaries, and the accessory glands of adult flies. RNAi was induced by injection of short (22 bp beltless double-stranded RNAs into embryos or into adult flies. Embryonic RNAi altered cuticular phenotypes ranging from partially-formed to missing denticle belts (thus beltless of the abdominal segments A2–A4. Embryonic beltless RNAi was lethal. Adult RNAi resulted in the shrinkage of the ovaries by half and reduced the number of eggs laid. We also examined Df(1RK4 flies in which deletion removes 16 genes, including beltless. In some embryos, we observed cuticular abnormalities similar to our findings with beltless RNAi. After differentiating Df(1RK4 embryos into those with visible denticle belts and those missing denticle belts, we assayed the presence of beltless mRNA; no beltless mRNA was detectable in embryos with missing denticle belts. Conclusions We have identified a developmentally important novel Drosophila gene, beltless, which has been characterized in loss-of-function studies using RNA interference. The putative beltless protein shares homologies with the C. elegans nose resistant to fluoxetine (NRF NRF-6 gene, as well as with several uncharacterized C. elegans and Drosophila melanogaster genes, some with prominent acyltransferase domains. Future studies should

The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.

Science.gov (United States)

Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique

2007-09-18

Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.

Functional architecture of reward learning in mushroom body extrinsic neurons of larval Drosophila.

Science.gov (United States)

Saumweber, Timo; Rohwedder, Astrid; Schleyer, Michael; Eichler, Katharina; Chen, Yi-Chun; Aso, Yoshinori; Cardona, Albert; Eschbach, Claire; Kobler, Oliver; Voigt, Anne; Durairaja, Archana; Mancini, Nino; Zlatic, Marta; Truman, James W; Thum, Andreas S; Gerber, Bertram

2018-03-16

The brain adaptively integrates present sensory input, past experience, and options for future action. The insect mushroom body exemplifies how a central brain structure brings about such integration. Here we use a combination of systematic single-cell labeling, connectomics, transgenic silencing, and activation experiments to study the mushroom body at single-cell resolution, focusing on the behavioral architecture of its input and output neurons (MBINs and MBONs), and of the mushroom body intrinsic APL neuron. Our results reveal the identity and morphology of almost all of these 44 neurons in stage 3 Drosophila larvae. Upon an initial screen, functional analyses focusing on the mushroom body medial lobe uncover sparse and specific functions of its dopaminergic MBINs, its MBONs, and of the GABAergic APL neuron across three behavioral tasks, namely odor preference, taste preference, and associative learning between odor and taste. Our results thus provide a cellular-resolution study case of how brains organize behavior.

RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops

OpenAIRE

Guo, Qigao; Liu, Qing; Smith, Neil A.; Liang, Guolu; Wang, Ming-Bo

2016-01-01

Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing ...

Effect of non-nutritive sugars to decrease the survivorship of spotted wing drosophila, Drosophila suzukii

Science.gov (United States)

In this study, we investigated the effects of non-nutritive sugars and sugar alcohols on the survivorship of spotted wing drosophila, Drosophila suzukii, and found erythritol and erythrose as potentially toxic to the fly. In a dose-dependent study, erythritol and erythrose significantly reduced fly ...

A molecularly defined duplication set for the X chromosome of Drosophila melanogaster

Energy Technology Data Exchange (ETDEWEB)

Venken, Koen J. T.; Popodi, Ellen; Holtzman, Stacy L.; Schulze, Karen L.; Park, Soo; Carlson, Joseph W.; Hoskins, Roger A.; Bellen, Hugo J.; Kaufman, Thomas C.

2010-07-22

We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using C31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers

Science.gov (United States)

Ussher, Jane M.; Perz, Janette

2010-01-01

This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…

Hsc70/Hsp90 chaperone machinery mediates ATP-dependent RISC loading of small RNA duplexes.

Science.gov (United States)

Iwasaki, Shintaro; Kobayashi, Maki; Yoda, Mayuko; Sakaguchi, Yuriko; Katsuma, Susumu; Suzuki, Tsutomu; Tomari, Yukihide

2010-07-30

Small silencing RNAs--small interfering RNAs (siRNAs) or microRNAs (miRNAs)--direct posttranscriptional gene silencing of their mRNA targets as guides for the RNA-induced silencing complex (RISC). Both siRNAs and miRNAs are born double stranded. Surprisingly, loading these small RNA duplexes into Argonaute proteins, the core components of RISC, requires ATP, whereas separating the two small RNA strands within Argonaute does not. Here we show that the Hsc70/Hsp90 chaperone machinery is required to load small RNA duplexes into Argonaute proteins, but not for subsequent strand separation or target cleavage. We envision that the chaperone machinery uses ATP and mediates a conformational opening of Ago proteins so that they can receive bulky small RNA duplexes. Our data suggest that the chaperone machinery may serve as the driving force for the RISC assembly pathway. Copyright 2010 Elsevier Inc. All rights reserved.

Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway*

Science.gov (United States)

Foda, Bardees M.; Singh, Upinder

2015-01-01

RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683

Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway.

Science.gov (United States)

Foda, Bardees M; Singh, Upinder

2015-08-21

RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5'-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

Directory of Open Access Journals (Sweden)

Michelle S Lewis

2007-08-01

Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

The physics of chromatin silencing: Bi-stability and front propagation

Science.gov (United States)

Sedighi, Mohammad

A mean-field dynamical model of chromatin silencing in budding yeast is provided and the conditions giving rise to two states: one silenced and another un-silenced, is studied. Based on these conditions, the space of control parameters is divided into two distinct regions of mono-stable and bi-stable solutions (the bifurcation diagram). Then, considering both the discrete and continuous versions of the model, the formation of a stable boundary between the silenced and un-silenced areas on DNA is investigated. As a result, a richer phase diagram is provided. The dynamics of the boundary is also studied under different conditions. Consequently, assuming negative feedback due to possible depletion of silencing proteins, the model explains a paradoxical epigenetic behavior of yeast that happens under some mutation. A stochastic treatment of the model is also considered to verify the results of the mean-field approximation and also to understand the role of intrinsic noise at single cell level. This model could be used as a general guide to discuss chromatin silencing in many organisms.

Mapping of cis-regulatory sites in the promoter of testis-specific stellate genes of Drosophila melanogaster.

Science.gov (United States)

Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V

2012-11-01

Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.

Control of thermoacoustic instability with a drum-like silencer

Science.gov (United States)

Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng

2017-10-01

Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.

Metal-metal interaction mediates the iron induction of Drosophila MtnB

International Nuclear Information System (INIS)

Qiang, Wenjia; Huang, Yunpeng; Wan, Zhihui; Zhou, Bing

2017-01-01

Metallothionein (MT) protein families are a class of small and universal proteins rich in cysteine residues. They are synthesized in response to heavy metal stresses to sequester the toxic ions by metal-thiolate bridges. Five MT family members, namely MtnA, MtnB, MtnC, MtnD and MtnE, have been discovered and identified in Drosophila. These five isoforms of MTs are regulated by metal responsive transcription factor dMTF-1 and play differentiated but overlapping roles in detoxification of metal ions. Previous researches have shown that Drosophila MtnB responds to copper (Cu), cadmium (Cd) and zinc (Zn). Interestingly in this study we found that Drosophila MtnB expression also responds to elevated iron levels in the diet. Further investigations revealed that MtnB plays limited roles in iron detoxification, and the direct binding of MtnB to ferrous iron in vitro is also weak. The induction of MtnB by iron turns out to be mediated by iron interference of other metals, because EDTA at even a partial concentration of that of iron can suppress this induction. Indeed, in the presence of iron, zinc homeostasis is altered, as reflected by expression changes of zinc transporters dZIP1 and dZnT1. Thus, iron-mediated MtnB induction appears resulting from interrupted homeostasis of other metals such as zinc, which in turns induced MtnB expression. Metal-metal interaction may more widely exist than we expected. - Highlights: • Metallothionein B expression is regulated by iron in Drosophila melanogaster. • MtnB has limited physiological roles in iron detoxification. • Binding affinity of MtnB to iron is weak in vitro. • Induction of Drosophila MtnB by iron is mediated indirectly through metal-metal interaction.

Body-weight and chromosome aberrations induced by X-rays in somatic cells of Drosophila melanogaster

International Nuclear Information System (INIS)

Marco, A. de; Belloni, M.P.

1976-01-01

Body-weight has been shown to influence the final expression of genetic damage by X-rays in Drosophila melanogaster. If larvae of Drosophila were raised up to the third instar in media containing different amounts of the same nutrient and in different conditions of crowding a positive correlation was observed between body-weight and frequency of chromosome aberrations induced by a given dose of X-rays in the somatic cells of their nerve ganglia. This effect, present in both sexes, is most plausibly attributed to a different capacity of big and small larvae for repairing radiation damage. (orig.) [de

First record of spotted wing drosophila Drosophila suzukii (Diptera: Drosophilidae in Montenegro

Directory of Open Access Journals (Sweden)

Snježana Hrnčić

2015-01-01

Full Text Available The spotted wing drosophila Drosophila suzukii Matsumura (Diptera: Drosophilidae is an invasive pest originating from Southeast Asia. It was detected for the first time in Europe in 2008 (Spain and Italy and subsequently in other European countries. It is a highly polyphagous pest that infests healthy, ripening fruit and presents a serious threat to fruit production, particularly of soft skinned fruit. In the first half of October 2013, a new fruit fly species was unexpectedly detected in Tephri traps baited with the three-component female-biased attractant BioLure that is regularly used for monitoring the Mediterranean fruit fly Ceratitis capitata Wiedem. (Diptera: Tephritidae in Montenegro. Brief visual inspection identified the new species as the spotted wing drosophila D. suzukii. The pest was first recorded in several localities on the Montenegrin seacoast around Boka Kotor Bay. After the finding, all Drosophila specimens were collected from traps for further laboratory observation. A quick follow-up monitoring of other Tephri traps was carried out within the next few days on the rest of the seacoast (localities from Tivat to Ulcinj. Additionally, Tephri traps were set up around Lake Skadar and in the city of Podgorica, as well as on fresh fruit markets in Podgorica. The results of this preliminary study showed that D. suzukii was present in all surveyed locations and adults were captured until late December. Both sexes were found in traps with BioLure. Our data show that D. suzukii is present in southern parts of Montenegro and there is a serious threat of its further spreading, particularly towards northern parts of the country where the main raspberry and blueberry production is placed. The results also show that Tephri traps baited with BioLure can be used for detection and monitoring of spotted wing drosophila.

Histone Methylation and Epigenetic Silencing in Breast Cancer

National Research Council Canada - National Science Library

Simon, Jeffrey A; Lange, Carol A

2008-01-01

.... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

NARCIS (Netherlands)

Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

Efficient gene knock-out and knock-in with transgenic Cas9 in Drosophila.

Science.gov (United States)

Xue, Zhaoyu; Ren, Mengda; Wu, Menghua; Dai, Junbiao; Rong, Yikang S; Gao, Guanjun

2014-03-21

Bacterial Cas9 nuclease induces site-specific DNA breaks using small gRNA as guides. Cas9 has been successfully introduced into Drosophila for genome editing. Here, we improve the versatility of this method by developing a transgenic system that expresses Cas9 in the Drosophila germline. Using this system, we induced inheritable knock-out mutations by injecting only the gRNA into embryos, achieved highly efficient mutagenesis by expressing gRNA from the promoter of a novel non-coding RNA gene, and recovered homologous recombination-based knock-in of a fluorescent marker at a rate of 4.5% by co-injecting gRNA with a circular DNA donor. Copyright © 2014 Xue et al.

No-Big-Silence teeb klubituuri / Urmas Hännile

Index Scriptorium Estoniae

Hännile, Urmas

2009-01-01

Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar

Breaking the silence

DEFF Research Database (Denmark)

Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette

2012-01-01

and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...

Antisense gene silencing

DEFF Research Database (Denmark)

Nielsen, Troels T; Nielsen, Jørgen E

2013-01-01

Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

Toward a science of silence: The consequences of leaving a memory unsaid

DEFF Research Database (Denmark)

Stone, Charles; Coman, Alin; Brown, Adam

2012-01-01

of the silence—and listeners—those attending to the speaker. Although the topic of silence is widely discussed, it is rarely mentioned in the empirical literature on memory. Three factors are employed to classify silence into different types: whether a silence is accompanied by covert remembering, whether...... the silence is intentional or unintentional, and whether the silenced memory is related or unrelated to the memories emerging in a conversation. These factors appear to be critical when considering the mnemonic consequences. Moreover, the influence of silence on memory varies between speaker and listener...

A dual function for Deep orange in programmed autophagy in the Drosophila melanogaster fat body

International Nuclear Information System (INIS)

Lindmo, Karine; Simonsen, Anne; Brech, Andreas; Finley, Kim; Rusten, Tor Erik; Stenmark, Harald

2006-01-01

Lysosomal degradation of cytoplasm by way of autophagy is essential for cellular amino acid homeostasis and for tissue remodeling. In insects such as Drosophila, autophagy is developmentally upregulated in the larval fat body prior to metamorphosis. Here, autophagy is induced by the hormone ecdysone through down-regulation of the autophagy-suppressive phosphoinositide 3-kinase (PI3K) signaling pathway. In yeast, Vps18 and other members of the HOPS complex have been found essential for autophagic degradation. In Drosophila, the Vps18 homologue Deep orange (Dor) has previously been shown to mediate fusion of multivesicular endosomes with lysosomes. A requirement of Dor for ecdysone-mediated chromosome puffing has also been reported. In the present report, we have tested the hypothesis that Dor may control programmed autophagy at the level of ecdysone signaling as well as by mediating autophagosome-to-lysosome fusion. We show that dor mutants are defective in programmed autophagy and provide evidence that autophagy is blocked at two levels. First, PI3K activity was not down-regulated correctly in dor larvae, which correlated with a decrease in ecdysone reporter activity. The down-regulation of PI3K activity was restored by feeding ecdysone to the mutant larvae. Second, neither exogenous ecdysone nor overexpression of PTEN, a silencer of PI3K signaling, restored fusion of autophagosomes with lysosomes in the fat body of dor mutants. These results indicate that Dor controls autophagy indirectly, via ecdysone signaling, as well as directly, via autolysosomal fusion

Maggot Instructor: Semi-Automated Analysis of Learning and Memory in Drosophila Larvae

Directory of Open Access Journals (Sweden)

Urte Tomasiunaite

2018-06-01

Full Text Available For several decades, Drosophila has been widely used as a suitable model organism to study the fundamental processes of associative olfactory learning and memory. More recently, this condition also became true for the Drosophila larva, which has become a focus for learning and memory studies based on a number of technical advances in the field of anatomical, molecular, and neuronal analyses. The ongoing efforts should be mentioned to reconstruct the complete connectome of the larval brain featuring a total of about 10,000 neurons and the development of neurogenic tools that allow individual manipulation of each neuron. By contrast, standardized behavioral assays that are commonly used to analyze learning and memory in Drosophila larvae exhibit no such technical development. Most commonly, a simple assay with Petri dishes and odor containers is used; in this method, the animals must be manually transferred in several steps. The behavioral approach is therefore labor-intensive and limits the capacity to conduct large-scale genetic screenings in small laboratories. To circumvent these limitations, we introduce a training device called the Maggot Instructor. This device allows automatic training up to 10 groups of larvae in parallel. To achieve such goal, we used fully automated, computer-controlled optogenetic activation of single olfactory neurons in combination with the application of electric shocks. We showed that Drosophila larvae trained with the Maggot Instructor establish an odor-specific memory, which is independent of handling and non-associative effects. The Maggot Instructor will allow to investigate the large collections of genetically modified larvae in a short period and with minimal human resources. Therefore, the Maggot Instructor should be able to help extensive behavioral experiments in Drosophila larvae to keep up with the current technical advancements. In the longer term, this condition will lead to a better understanding of

New record for the invasive Spotted Wing Drosophila, Drosophila suzukii Matsumura (Diptera: Drosophilidae) in Anillaco, Argentina

Science.gov (United States)

The invasive Spotted Wing Drosophila (SWD), Drosophila suzukii Matsumura, is reported for the first time in La Rioja, Argentina. This represents a major range expansion for this species. The natural enemies of SWD, Leptopilina clavipes and Ganaspis hookeri were also collected with the SWD at the s...

The influence of sterol metabolism upon radiation-induced aneuploidy of Drosophila melanogaster in the yeast-drosophila system

International Nuclear Information System (INIS)

Savitsij, V.V.; Luchnikova, E.M.; Inge-Vechtomov, S.I.

1985-01-01

The influence of sterol metabolism upon induced Drosophila melanogaster mutagenesis in an ecology-genetic yeast-drosophila system has been studied. The sterol deficit in fly organism has been created for account of using as food substrate for fremales of biomass of saccharomyces cerevisiae living cells of 9-2-PZ12 train with nyssup(r1) locus mutation which blocks the ergosterol synthesis. It has been found that the Drosophila females content on mutant yeast increases the frequency of losses and non discrepancy of X-chromosomes induced by X-radiation (1000 R). Addition into yeast biomass of 0.1 % cholesterol solution in 10 %-ethanol reduces the oocytes resistance to X-radiation up to control level. Possible hormonal and membrane mechanisms of increasing radiation-induced aneuploidy of Drosophila and the role of sterol metabolism in organism resistance to damaging factors are discussed

Neuronal control of locomotor handedness in Drosophila.

Science.gov (United States)

Buchanan, Sean M; Kain, Jamey S; de Bivort, Benjamin L

2015-05-26

Genetically identical individuals display variability in their physiology, morphology, and behaviors, even when reared in essentially identical environments, but there is little mechanistic understanding of the basis of such variation. Here, we investigated whether Drosophila melanogaster displays individual-to-individual variation in locomotor behaviors. We developed a new high-throughout platform capable of measuring the exploratory behavior of hundreds of individual flies simultaneously. With this approach, we find that, during exploratory walking, individual flies exhibit significant bias in their left vs. right locomotor choices, with some flies being strongly left biased or right biased. This idiosyncrasy was present in all genotypes examined, including wild-derived populations and inbred isogenic laboratory strains. The biases of individual flies persist for their lifetime and are nonheritable: i.e., mating two left-biased individuals does not yield left-biased progeny. This locomotor handedness is uncorrelated with other asymmetries, such as the handedness of gut twisting, leg-length asymmetry, and wing-folding preference. Using transgenics and mutants, we find that the magnitude of locomotor handedness is under the control of columnar neurons within the central complex, a brain region implicated in motor planning and execution. When these neurons are silenced, exploratory laterality increases, with more extreme leftiness and rightiness. This observation intriguingly implies that the brain may be able to dynamically regulate behavioral individuality.

Distribution of DNA replication proteins in Drosophila cells

Science.gov (United States)

Easwaran, Hariharan P; Leonhardt, Heinrich; Cardoso, M Cristina

2007-01-01

Background DNA replication in higher eukaryotic cells is organized in discrete subnuclear sites called replication foci (RF). During the S phase, most replication proteins assemble at the RF by interacting with PCNA via a PCNA binding domain (PBD). This has been shown to occur for many mammalian replication proteins, but it is not known whether this mechanism is conserved in evolution. Results Fluorescent fusions of mammalian replication proteins, Dnmt1, HsDNA Lig I and HsPCNA were analyzed for their ability to target to RF in Drosophila cells. Except for HsPCNA, none of the other proteins and their deletions showed any accumulation at RF in Drosophila cells. We hypothesized that in Drosophila cells there might be some other peptide sequence responsible for targeting proteins to RF. To test this, we identified the DmDNA Lig I and compared the protein sequence with HsDNA Lig I. The two orthologs shared the PBD suggesting a functionally conserved role for this domain in the Drosophila counterpart. A series of deletions of DmDNA Lig I were analyzed for their ability to accumulate at RF in Drosophila and mammalian cells. Surprisingly, no accumulation at RF was observed in Drosophila cells, while in mammalian cells DmDNA Lig I accumulated at RF via its PBD. Further, GFP fusions with the PBD domains from Dnmt1, HsDNA Lig I and DmDNA Lig I, were able to target to RF only in mammalian cells but not in Drosophila cells. Conclusion We show that S phase in Drosophila cells is characterized by formation of RF marked by PCNA like in mammalian cells. However, other than PCNA none of the replication proteins and their deletions tested here showed accumulation at RF in Drosophila cells while the same proteins and deletions are capable of accumulating at RF in mammalian cells. We hypothesize that unlike mammalian cells, in Drosophila cells, replication proteins do not form long-lasting interactions with the replication machinery, and rather perform their functions via very

Male killing Spiroplasma protects Drosophila melanogaster against two parasitoid wasps

Science.gov (United States)

Xie, J; Butler, S; Sanchez, G; Mateos, M

2014-01-01

Maternally transmitted associations between endosymbiotic bacteria and insects are diverse and widespread in nature. Owing to imperfect vertical transmission, many heritable microbes have evolved compensational mechanisms to enhance their persistence in host lineages, such as manipulating host reproduction and conferring fitness benefits to host. Symbiont-mediated defense against natural enemies of hosts is increasingly recognized as an important mechanism by which endosymbionts enhance host fitness. Members of the genus Spiroplasma associated with distantly related Drosophila hosts are known to engage in either reproductive parasitism (i.e., male killing) or defense against natural enemies (the parasitic wasp Leptopilina heterotoma and a nematode). A male-killing strain of Spiroplasma (strain Melanogaster Sex Ratio Organism (MSRO)) co-occurs with Wolbachia (strain wMel) in certain wild populations of the model organism Drosophila melanogaster. We examined the effects of Spiroplasma MSRO and Wolbachia wMel on Drosophila survival against parasitism by two common wasps, Leptopilina heterotoma and Leptopilina boulardi, that differ in their host ranges and host evasion strategies. The results indicate that Spiroplasma MSRO prevents successful development of both wasps, and confers a small, albeit significant, increase in larva-to-adult survival of flies subjected to wasp attacks. We modeled the conditions under which defense can contribute to Spiroplasma persistence. Wolbachia also confers a weak, but significant, survival advantage to flies attacked by L. heterotoma. The host protective effects exhibited by Spiroplasma and Wolbachia are additive and may provide the conditions for such cotransmitted symbionts to become mutualists. Occurrence of Spiroplasma-mediated protection against distinct parasitoids in divergent Drosophila hosts suggests a general protection mechanism. PMID:24281548

[Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism].

Science.gov (United States)

Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin

2014-06-01

To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.

Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia

Directory of Open Access Journals (Sweden)

Sateesh Krishnamurthy

2012-01-01

Full Text Available The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE or human airway epithelia (HAE grown at the air–liquid interface (ALI, the delivery of a Dicer-substrate small-interfering RNA (DsiRNA duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF, a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi responses.

The Drosophila melanogaster circadian pacemaker circuit

Indian Academy of Sciences (India)

2016-08-26

Aug 26, 2016 ... Keywords. circadian rhythm; neuronal network; ion channel; behaviour; neurotransmitter; electrophysiology; Drosophila. Abstract. As an experimental model system, the fruit fly Drosophila melanogaster has been seminal in shaping our understanding of the circadian clockwork. The wealth of genetic tools ...

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2004-01-01

...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2005-01-01

...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2006-01-01

...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...

Validation of RNAi Silencing Efficiency Using Gene Array Data shows 18.5% Failure Rate across 429 Independent Experiments

Directory of Open Access Journals (Sweden)

Gyöngyi Munkácsy

2016-01-01

Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.

Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

Science.gov (United States)

Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

2012-03-01

Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

Spatial pattern analysis of nuclear migration in remodelled muscles during Drosophila metamorphosis.

Science.gov (United States)

Kuleesha; Feng, Lin; Wasser, Martin

2017-07-10

Many human muscle wasting diseases are associated with abnormal nuclear localization. During metamorphosis in Drosophila melanogaster, multi-nucleated larval dorsal abdominal muscles either undergo cell death or are remodeled to temporary adult muscles. Muscle remodeling is associated with anti-polar nuclear migration and atrophy during early pupation followed by polar migration and muscle growth during late pupation. Muscle remodeling is a useful model to study genes involved in myonuclear migration. Previously, we showed that loss of Cathepsin-L inhibited anti-polar movements, while knockdown of autophagy-related genes affected nuclear positioning along the medial axis in late metamorphosis. To compare the phenotypic effects of gene perturbations on nuclear migration more objectively, we developed new descriptors of myonuclear distribution. To obtain nuclear pattern features, we designed an algorithm to detect and track nuclear regions inside live muscles. Nuclear tracks were used to distinguish between fast moving nuclei associated with fragments of dead muscles (sarcolytes) and slow-moving nuclei inside remodelled muscles. Nuclear spatial pattern features, such as longitudinal (lonNS) and lateral nuclear spread (latNS), allowed us to compare nuclear migration during muscle remodelling in different genetic backgrounds. Anti-polar migration leads to a lonNS decrease. As expected, lack of myonuclear migration caused by the loss of Cp1 was correlated with a significantly lower lonNS decrease. Unexpectedly, the decrease in lonNS was significantly enhanced by Atg9, Atg5 and Atg18 silencing, indicating that the loss of autophagy promotes the migration and clustering of nuclei. Loss of autophagy also caused a scattering of nuclei along the lateral axis, leading to a two-row as opposed to single row distribution in control muscles. Increased latNS resulting from knockdown of Atg9 and Atg18 was correlated with increased muscle diameter, suggesting that the wider muscle

Phylogeny of the Genus Drosophila

Science.gov (United States)

O’Grady, Patrick M.; DeSalle, Rob

2018-01-01

Understanding phylogenetic relationships among taxa is key to designing and implementing comparative analyses. The genus Drosophila, which contains over 1600 species, is one of the most important model systems in the biological sciences. For over a century, one species in this group, Drosophila melanogaster, has been key to studies of animal development and genetics, genome organization and evolution, and human disease. As whole-genome sequencing becomes more cost-effective, there is increasing interest in other members of this morphologically, ecologically, and behaviorally diverse genus. Phylogenetic relationships within Drosophila are complicated, and the goal of this paper is to provide a review of the recent taxonomic changes and phylogenetic relationships in this genus to aid in further comparative studies. PMID:29716983

A molecularly defined duplication set for the X chromosome of Drosophila melanogaster.

Science.gov (United States)

Venken, Koen J T; Popodi, Ellen; Holtzman, Stacy L; Schulze, Karen L; Park, Soo; Carlson, Joseph W; Hoskins, Roger A; Bellen, Hugo J; Kaufman, Thomas C

2010-12-01

We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using ΦC31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

The Rho-family GTPase Rac1 regulates integrin localization in Drosophila immunosurveillance cells.

Directory of Open Access Journals (Sweden)

Miguel J Xavier

Full Text Available BACKGROUND: When the parasitoid wasp Leptopilina boulardi lays an egg in a Drosophila larva, phagocytic cells called plasmatocytes and specialized cells known as lamellocytes encapsulate the egg. The Drosophila β-integrin Myospheroid (Mys is necessary for lamellocytes to adhere to the cellular capsule surrounding L. boulardi eggs. Integrins are heterodimeric adhesion receptors consisting of α and β subunits, and similar to other plasma membrane receptors undergo ligand-dependent endocytosis. In mammalian cells it is known that integrin binding to the extracellular matrix induces the activation of Rac GTPases, and we have previously shown that Rac1 and Rac2 are necessary for a proper encapsulation response in Drosophila larvae. We wanted to test the possibility that Myospheroid and Rac GTPases interact during the Drosophila anti-parasitoid immune response. RESULTS: In the current study we demonstrate that Rac1 is required for the proper localization of Myospheroid to the cell periphery of haemocytes after parasitization. Interestingly, the mislocalization of Myospheroid in Rac1 mutants is rescued by hyperthermia, involving the heat shock protein Hsp83. From these results we conclude that Rac1 and Hsp83 are required for the proper localization of Mys after parasitization. SIGNIFICANCE: We show for the first time that the small GTPase Rac1 is required for Mysopheroid localization. Interestingly, the necessity of Rac1 in Mys localization was negated by hyperthermia. This presents a problem, in Drosophila we quite often raise larvae at 29°C when using the GAL4/UAS misexpression system. If hyperthermia rescues receptor endosomal recycling defects, raising larvae in hyperthermic conditions may mask potentially interesting phenotypes.

Carbon nanopipette electrodes for dopamine detection in Drosophila.

Science.gov (United States)

Rees, Hillary R; Anderson, Sean E; Privman, Eve; Bau, Haim H; Venton, B Jill

2015-04-07

Small, robust, sensitive electrodes are desired for in vivo neurotransmitter measurements. Carbon nanopipettes have been previously manufactured and used for single-cell drug delivery and electrophysiological measurements. Here, a modified fabrication procedure was developed to produce batches of solid carbon nanopipette electrodes (CNPEs) with ∼250 nm diameter tips, and controllable lengths of exposed carbon, ranging from 5 to 175 μm. The electrochemical properties of CNPEs were characterized with fast-scan cyclic voltammetry (FSCV) for the first time. CNPEs were used to detect the electroactive neurotransmitters dopamine, serotonin, and octopamine. CNPEs were significantly more sensitive for serotonin detection than traditional carbon-fiber microelectrodes (CFMEs). Similar to CFMEs, CNPEs have a linear response for dopamine concentrations ranging from 0.1 to 10 μM and a limit of detection of 25 ± 5 nM. Recordings with CNPEs were stable for over 3 h when the applied triangle waveform was scanned between -0.4 and +1.3 V vs Ag/AgCl/Cl(-) at 400 V/s. CNPEs were used to detect endogenous dopamine release in Drosophila larvae using optogenetics, which verified the utility of CNPEs for in vivo neuroscience studies. CNPEs are advantageous because they are 1 order of magnitude smaller in diameter than typical CFMEs and have a sharp, tunable geometry that facilitates penetration and implantation for localized measurements in distinct regions of small organisms, such as the Drosophila brain.

Antiviral RNA silencing viral counter defense in plants

NARCIS (Netherlands)

Bucher, E.C.

2006-01-01

The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

Radioresistance and radiosensitivity in Drosophila melanogaster

International Nuclear Information System (INIS)

Reguly, M.L.

1983-01-01

Studying the mechanisms controlling radioresistant in Drosophila the sensibility of four strains of Drosophila melanogaster to sex-linked recessive lethal mutations induced by 5kR Cobalt-60 gamma radiation and 0,006 M EMS or 0,25% of caffeine was determined. (M.A.C.) [pt

Characterization of Autophagic Responses in Drosophila melanogaster.

Science.gov (United States)

Xu, T; Kumar, S; Denton, D

2017-01-01

Drosophila is an excellent model system for studying autophagy during animal development due to the availability of genetic reagents and opportunity for in vivo cell biological analysis. The regulation and mechanism of autophagy are highly evolutionarily conserved and the role of autophagy has been characterized during various stages of Drosophila development as well as following starvation. Studies in Drosophila have revealed novel insights into the role of distinct components of the autophagy machinery. This chapter describes protocols for examining autophagy during Drosophila development. A crucial step in the induction of autophagy is the incorporation of Atg8a into the autophagosome. This can be measured as autophagic puncta using live fluorescent imaging, immunostaining, or immunoblot analysis of LC3/Atg8a processing. The level of autophagy can also be examined using other specific components of the autophagy pathway as markers detected by immunofluorescent imaging. Based on the distinct morphology of autophagy, it can also be examined by transmission electron microscopy. In addition, one of the advantages of using Drosophila as a model is the ability to undertake genetic analysis of individual components of the autophagy machinery. Current approaches that can be used to monitor autophagy, including the overall flux and individual steps in Drosophila melanogaster, will be discussed. © 2017 Elsevier Inc. All rights reserved.

MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

Science.gov (United States)

Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

2014-01-01

Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

Biases in Drosophila melanogaster protein trap screens

Directory of Open Access Journals (Sweden)

Müller Ilka

2009-05-01

Full Text Available Abstract Background The ability to localise or follow endogenous proteins in real time in vivo is of tremendous utility for cell biology or systems biology studies. Protein trap screens utilise the random genomic insertion of a transposon-borne artificial reporter exon (e.g. encoding the green fluorescent protein, GFP into an intron of an endogenous gene to generate a fluorescent fusion protein. Despite recent efforts aimed at achieving comprehensive coverage of the genes encoded in the Drosophila genome, the repertoire of genes that yield protein traps is still small. Results We analysed the collection of available protein trap lines in Drosophila melanogaster and identified potential biases that are likely to restrict genome coverage in protein trap screens. The protein trap screens investigated here primarily used P-element vectors and thus exhibit some of the same positional biases associated with this transposon that are evident from the comprehensive Drosophila Gene Disruption Project. We further found that protein trap target genes usually exhibit broad and persistent expression during embryonic development, which is likely to facilitate better detection. In addition, we investigated the likely influence of the GFP exon on host protein structure and found that protein trap insertions have a significant bias for exon-exon boundaries that encode disordered protein regions. 38.8% of GFP insertions land in disordered protein regions compared with only 23.4% in the case of non-trapping P-element insertions landing in coding sequence introns (p -4. Interestingly, even in cases where protein domains are predicted, protein trap insertions frequently occur in regions encoding surface exposed areas that are likely to be functionally neutral. Considering the various biases observed, we predict that less than one third of intron-containing genes are likely to be amenable to trapping by the existing methods. Conclusion Our analyses suggest that the

Phytophthora have distinct endogenous small RNA populations that include short interfering and microRNAs.

Directory of Open Access Journals (Sweden)

Noah Fahlgren

Full Text Available In eukaryotes, RNA silencing pathways utilize 20-30-nucleotide small RNAs to regulate gene expression, specify and maintain chromatin structure, and repress viruses and mobile genetic elements. RNA silencing was likely present in the common ancestor of modern eukaryotes, but most research has focused on plant and animal RNA silencing systems. Phytophthora species belong to a phylogenetically distinct group of economically important plant pathogens that cause billions of dollars in yield losses annually as well as ecologically devastating outbreaks. We analyzed the small RNA-generating components of the genomes of P. infestans, P. sojae and P. ramorum using bioinformatics, genetic, phylogenetic and high-throughput sequencing-based methods. Each species produces two distinct populations of small RNAs that are predominantly 21- or 25-nucleotides long. The 25-nucleotide small RNAs were primarily derived from loci encoding transposable elements and we propose that these small RNAs define a pathway of short-interfering RNAs that silence repetitive genetic elements. The 21-nucleotide small RNAs were primarily derived from inverted repeats, including a novel microRNA family that is conserved among the three species, and several gene families, including Crinkler effectors and type III fibronectins. The Phytophthora microRNA is predicted to target a family of amino acid/auxin permeases, and we propose that 21-nucleotide small RNAs function at the post-transcriptional level. The functional significance of microRNA-guided regulation of amino acid/auxin permeases and the association of 21-nucleotide small RNAs with Crinkler effectors remains unclear, but this work provides a framework for testing the role of small RNAs in Phytophthora biology and pathogenesis in future work.

Phytophthora have distinct endogenous small RNA populations that include short interfering and microRNAs.

Science.gov (United States)

Fahlgren, Noah; Bollmann, Stephanie R; Kasschau, Kristin D; Cuperus, Josh T; Press, Caroline M; Sullivan, Christopher M; Chapman, Elisabeth J; Hoyer, J Steen; Gilbert, Kerrigan B; Grünwald, Niklaus J; Carrington, James C

2013-01-01

In eukaryotes, RNA silencing pathways utilize 20-30-nucleotide small RNAs to regulate gene expression, specify and maintain chromatin structure, and repress viruses and mobile genetic elements. RNA silencing was likely present in the common ancestor of modern eukaryotes, but most research has focused on plant and animal RNA silencing systems. Phytophthora species belong to a phylogenetically distinct group of economically important plant pathogens that cause billions of dollars in yield losses annually as well as ecologically devastating outbreaks. We analyzed the small RNA-generating components of the genomes of P. infestans, P. sojae and P. ramorum using bioinformatics, genetic, phylogenetic and high-throughput sequencing-based methods. Each species produces two distinct populations of small RNAs that are predominantly 21- or 25-nucleotides long. The 25-nucleotide small RNAs were primarily derived from loci encoding transposable elements and we propose that these small RNAs define a pathway of short-interfering RNAs that silence repetitive genetic elements. The 21-nucleotide small RNAs were primarily derived from inverted repeats, including a novel microRNA family that is conserved among the three species, and several gene families, including Crinkler effectors and type III fibronectins. The Phytophthora microRNA is predicted to target a family of amino acid/auxin permeases, and we propose that 21-nucleotide small RNAs function at the post-transcriptional level. The functional significance of microRNA-guided regulation of amino acid/auxin permeases and the association of 21-nucleotide small RNAs with Crinkler effectors remains unclear, but this work provides a framework for testing the role of small RNAs in Phytophthora biology and pathogenesis in future work.

Phytophthora Have Distinct Endogenous Small RNA Populations That Include Short Interfering and microRNAs

Science.gov (United States)

Fahlgren, Noah; Bollmann, Stephanie R.; Kasschau, Kristin D.; Cuperus, Josh T.; Press, Caroline M.; Sullivan, Christopher M.; Chapman, Elisabeth J.; Hoyer, J. Steen; Gilbert, Kerrigan B.; Grünwald, Niklaus J.; Carrington, James C.

2013-01-01

In eukaryotes, RNA silencing pathways utilize 20-30-nucleotide small RNAs to regulate gene expression, specify and maintain chromatin structure, and repress viruses and mobile genetic elements. RNA silencing was likely present in the common ancestor of modern eukaryotes, but most research has focused on plant and animal RNA silencing systems. Phytophthora species belong to a phylogenetically distinct group of economically important plant pathogens that cause billions of dollars in yield losses annually as well as ecologically devastating outbreaks. We analyzed the small RNA-generating components of the genomes of P. infestans, P. sojae and P. ramorum using bioinformatics, genetic, phylogenetic and high-throughput sequencing-based methods. Each species produces two distinct populations of small RNAs that are predominantly 21- or 25-nucleotides long. The 25-nucleotide small RNAs were primarily derived from loci encoding transposable elements and we propose that these small RNAs define a pathway of short-interfering RNAs that silence repetitive genetic elements. The 21-nucleotide small RNAs were primarily derived from inverted repeats, including a novel microRNA family that is conserved among the three species, and several gene families, including Crinkler effectors and type III fibronectins. The Phytophthora microRNA is predicted to target a family of amino acid/auxin permeases, and we propose that 21-nucleotide small RNAs function at the post-transcriptional level. The functional significance of microRNA-guided regulation of amino acid/auxin permeases and the association of 21-nucleotide small RNAs with Crinkler effectors remains unclear, but this work provides a framework for testing the role of small RNAs in Phytophthora biology and pathogenesis in future work. PMID:24204767

Neural stem cell-encoded temporal patterning delineates an early window of malignant susceptibility in Drosophila.

Science.gov (United States)

Narbonne-Reveau, Karine; Lanet, Elodie; Dillard, Caroline; Foppolo, Sophie; Chen, Ching-Huan; Parrinello, Hugues; Rialle, Stéphanie; Sokol, Nicholas S; Maurange, Cédric

2016-06-14

Pediatric neural tumors are often initiated during early development and can undergo very rapid transformation. However, the molecular basis of this early malignant susceptibility remains unknown. During Drosophila development, neural stem cells (NSCs) divide asymmetrically and generate intermediate progenitors that rapidly differentiate in neurons. Upon gene inactivation, these progeny can dedifferentiate and generate malignant tumors. Here, we find that intermediate progenitors are prone to malignancy only when born during an early window of development while expressing the transcription factor Chinmo, and the mRNA-binding proteins Imp/IGF2BP and Lin-28. These genes compose an oncogenic module that is coopted upon dedifferentiation of early-born intermediate progenitors to drive unlimited tumor growth. In late larvae, temporal transcription factor progression in NSCs silences the module, thereby limiting mitotic potential and terminating the window of malignant susceptibility. Thus, this study identifies the gene regulatory network that confers malignant potential to neural tumors with early developmental origins.

Eloquent silences: A musical and lexical analysis of conversation between oncologists and their patients.

Science.gov (United States)

Bartels, Josef; Rodenbach, Rachel; Ciesinski, Katherine; Gramling, Robert; Fiscella, Kevin; Epstein, Ronald

2016-10-01

Silences in doctor-patient communication can be "connectional" and communicative, in contrast to silences that indicate awkwardness or distraction. Musical and lexical analyses can identify and characterize connectional silences in consultations between oncologists and patients. Two medical students and a professor of voice screened all 1211 silences over 2s in length from 124 oncology office visits. We developed a "strength of connection" taxonomy and examined ten connectional silences for lexical and musical features including pitch, volume, and speaker turn-taking rhythm. We identified connectional silences with good reliability. Typical dialog rhythms surrounding connectional silences are characterized by relatively equal turn lengths and frequent short vocalizations. We found no pattern of volume and pitch variability around these silences. Connectional silences occurred in a wide variety of lexical contexts. Particular patterns of dialog rhythm mark connectional silences. Exploring structures of connectional silence extends our understanding of the audio-linguistic conditions that mark patient-clinician connection. Communicating with an awareness of pitch, rhythm, and silence - in addition to lexical content - can facilitate shared understanding and emotional connection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

Directory of Open Access Journals (Sweden)

Yao Han

Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

Science.gov (United States)

Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong

2015-01-01

MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC.

Science.gov (United States)

Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt

2017-07-27

In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

The dynamics and efficacy of antiviral RNA silencing: A model study

Directory of Open Access Journals (Sweden)

Hogeweg Paulien

2008-03-01

Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

The organisational silence of midwives and nurses: reasons and results.

Science.gov (United States)

Yurdakul, Mine; Beşen, Meltem Aydin; Erdoğan, Semra

2016-07-01

The study was conducted to determine the issues about which nurses and midwives remain silent and the reasons for it and the perceived results of silence. Organisational silence is a vitally important issue in the health sector, due to the risks and mistakes that are not reported, and proposals for improvement that are not made. The sample of this descriptive survey, which investigated a cause and effect relationship, was 159 nurses and midwives. The data were collected using a questionnaire and the organisational silence scale. Of the study participants, 84.9% were nurses and 15.1% were midwives. Of all participants 88.7% were women. 8.8% of participants stated that they never remained silent about issues related to work and the workplace. Respondents most often remained silent about issues related to ethics and responsibility. 'Limited improvement and development' was frequently mentioned as a perceived result of organisational silence. Our study determined that organisational silence is quite common among nurses and midwives. Activities that raise the awareness of hospital administrations and employees about preventing the factors that cause and maintain silence in hospitals should be planned. © 2016 John Wiley & Sons Ltd.

Intestinal stem cells in the adult Drosophila midgut

International Nuclear Information System (INIS)

Jiang, Huaqi; Edgar, Bruce A.

2011-01-01

Drosophila has long been an excellent model organism for studying stem cell biology. Notably, studies of Drosophila's germline stem cells have been instrumental in developing the stem cell niche concept. The recent discovery of somatic stem cells in adult Drosophila, particularly the intestinal stem cells (ISCs) of the midgut, has established Drosophila as an exciting model to study stem cell-mediated adult tissue homeostasis and regeneration. Here, we review the major signaling pathways that regulate the self-renewal, proliferation and differentiation of Drosophila ISCs, discussing how this regulation maintains midgut homeostasis and mediates regeneration of the intestinal epithelium after injury. -- Highlights: ► The homeostasis and regeneration of adult fly midguts are mediated by ISCs. ► Damaged enterocytes induce the proliferation of intestinal stem cells (ISC). ► EGFR and Jak/Stat signalings mediate compensatory ISC proliferation. ► Notch signaling regulates ISC self-renewal and differentiation.

Drosophila Neprilysins Are Involved in Middle-Term and Long-Term Memory.

Science.gov (United States)

Turrel, Oriane; Lampin-Saint-Amaux, Aurélie; Préat, Thomas; Goguel, Valérie

2016-09-14

Neprilysins are type II metalloproteinases known to degrade and inactivate a number of small peptides. Neprilysins in particular are the major amyloid-β peptide-degrading enzymes. In mouse models of Alzheimer's disease, neprilysin overexpression improves learning and memory deficits, whereas neprilysin deficiency aggravates the behavioral phenotypes. However, whether these enzymes are involved in memory in nonpathological conditions is an open question. Drosophila melanogaster is a well suited model system with which to address this issue. Several memory phases have been characterized in this organism and the neuronal circuits involved are well described. The fly genome contains five neprilysin-encoding genes, four of which are expressed in the adult. Using conditional RNA interference, we show here that all four neprilysins are involved in middle-term and long-term memory. Strikingly, all four are required in a single pair of neurons, the dorsal paired medial (DPM) neurons that broadly innervate the mushroom bodies (MBs), the center of olfactory memory. Neprilysins are also required in the MB, reflecting the functional relationship between the DPM neurons and the MB, a circuit believed to stabilize memories. Together, our data establish a role for neprilysins in two specific memory phases and further show that DPM neurons play a critical role in the proper targeting of neuropeptides involved in these processes. Neprilysins are endopeptidases known to degrade a number of small peptides. Neprilysin research has essentially focused on their role in Alzheimer's disease and heart failure. Here, we use Drosophila melanogaster to study whether neprilysins are involved in memory. Drosophila can form several types of olfactory memory and the neuronal structures involved are well described. Four neprilysin genes are expressed in adult Drosophila Using conditional RNA interference, we show that all four are specifically involved in middle-term memory (MTM) and long

Systematic Evaluation of Promising Clinical Trials-Gene Silencing for the Treatment of Glioblastoma.

Science.gov (United States)

Karaarslan, Numan; Yilmaz, Ibrahim; Ozbek, Hanefi; Caliskan, Tezcan; Topuk, Savas; Sirin, Duygu Yasar; Ates, Ozkan

2018-04-06

The aim of this study was to systematically investigate the role of artificial small interfering RNA (siRNA) molecules in glioblastoma treatment and to give a detailed overview of the literature concerning studies performed in this field worldwide in the last 31 years. Articles about clinical trials conducted between December 1, 1949 and November 8, 2017, were identified from the Cochrane Collaboration, the Cochrane Library, Ovid MEDLINE, ProQuest, the National Library of Medicine, and PubMed electronic databases, using the terms "post transcriptional gene silencing," "small interfering RNA," "siRNA," and "glioblastoma," either individually or combined (\\"OR\\" and \\"AND"), without language and country restrictions. Articles that met the examination criteria were included in the study. After descriptive statistical evaluation, the results were reported in frequency (%). After scanning 2.752 articles, five articles were found that met the research criteria. Examination of full texts of the five identified articles provided no sufficient evidence for research conducted with regard to the use of gene silencing via siRNAs in glioblastoma treatment. To be able to evaluate the clinical use of siRNAs, there is an urgent need for in-vivo studies and for trials with randomized, controlled, and clinical designs that provide long-term functional outcomes.

Interorgan Communication Pathways in Physiology: Focus on Drosophila

OpenAIRE

Droujinine, Ilia A.; Perrimon, Norbert

2016-01-01

Studies in mammals and Drosophila have demonstrated the existence and significance of secreted factors involved in communication between distal organs. In this review, primarily focusing on Drosophila, we examine the known interorgan communication factors and their functions, physiological inducers, and integration in regulating physiology. Moreover, we describe how organ-sensing screens in Drosophila can systematically identify novel conserved interorgan communication factors. Finally, we di...

A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

Science.gov (United States)

Pompey, Justine M; Foda, Bardees; Singh, Upinder

2015-01-01

Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

Directory of Open Access Journals (Sweden)

Justine M Pompey

Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

Effect of sterol metabolism in the yeast-Drosophila system on the frequency of radiation-induced aneuploidy in the Drosophila melanogaster oocytes

International Nuclear Information System (INIS)

Savitskii, V.V.; Luchnikova, E.M.; Inge-Vechtomov, S.G.

1986-01-01

The effect of sterol metabolism on induced mutagenesis of Drosophila melanogaster was studied in the ecogenetic system of yeast-Drosophila. Sterol deficiency was created in Drosophila by using the biomass of live cells of Saccharomyces cerevisiae strain 9-2-P712 till mutation in locus nys/sup r1/ blocking the synthesis of ergosterol as the food. It was found that rearing of Drosophila females on the mutant yeast increases the frequency of loss and nondisjunction of X chromosomes induced in mature oocytes by X rays (1000 R). Addition of 0.1% of cholesterol solution in 10% ethanol to the yeast biomass restores the resistance of oocyte to X irradiation to the control level. The possible hormonal effect on membrane leading to increased radiation-induced aneuploidy in Drosophila and the role of sterol metabolism in determining the resistance to various damaging factors are discussed

Silencing criticism in Mexico

Directory of Open Access Journals (Sweden)

Ximena Suárez

2017-10-01

Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.

An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

Science.gov (United States)

Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

2016-06-28

Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

Two Pairs of Mushroom Body Efferent Neurons Are Required for Appetitive Long-Term Memory Retrieval in Drosophila

Directory of Open Access Journals (Sweden)

Pierre-Yves Plaçais

2013-11-01

Full Text Available One of the challenges facing memory research is to combine network- and cellular-level descriptions of memory encoding. In this context, Drosophila offers the opportunity to decipher, down to single-cell resolution, memory-relevant circuits in connection with the mushroom bodies (MBs, prominent structures for olfactory learning and memory. Although the MB-afferent circuits involved in appetitive learning were recently described, the circuits underlying appetitive memory retrieval remain unknown. We identified two pairs of cholinergic neurons efferent from the MB α vertical lobes, named MB-V3, that are necessary for the retrieval of appetitive long-term memory (LTM. Furthermore, LTM retrieval was correlated to an enhanced response to the rewarded odor in these neurons. Strikingly, though, silencing the MB-V3 neurons did not affect short-term memory (STM retrieval. This finding supports a scheme of parallel appetitive STM and LTM processing.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Suppressors of RNA silencing encoded by tomato leaf curl ...

Indian Academy of Sciences (India)

2013-01-06

Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells.

Science.gov (United States)

Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju

2016-01-01

This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.

Crystal structure of Diedel, a marker of the immune response of Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Franck Coste

Full Text Available The Drosophila melanogaster gene CG11501 is up regulated after a septic injury and was proposed to act as a negative regulator of the JAK/STAT signaling pathway. Diedel, the CG11501 gene product, is a small protein of 115 residues with 10 cysteines.We have produced Diedel in Drosophila S2 cells as an extra cellular protein thanks to its own signal peptide and solved its crystal structure at 1.15 Å resolution by SIRAS using an iodo derivative. Diedel is composed of two sub domains SD1 and SD2. SD1 is made of an antiparallel β-sheet covered by an α-helix and displays a ferredoxin-like fold. SD2 reveals a new protein fold made of loops connected by four disulfide bridges. Further structural analysis identified conserved hydrophobic residues on the surface of Diedel that may constitute a potential binding site. The existence of two conformations, cis and trans, for the proline 52 may be of interest as prolyl peptidyl isomerisation has been shown to play a role in several physiological mechanisms. The genome of D. melanogaster contains two other genes coding for proteins homologous to Diedel, namely CG43228 and CG34329. Strikingly, apart from Drosophila and the pea aphid Acyrthosiphon pisum, Diedel-related sequences were exclusively identified in a few insect DNA viruses of the Baculoviridae and Ascoviridae families.Diedel, a marker of the Drosophila antimicrobial/antiviral response, is a member of a small family of proteins present in drosophilids, aphids and DNA viruses infecting lepidopterans. Diedel is an extracellular protein composed of two sub-domains. Two special structural features (hydrophobic surface patch and cis/trans conformation for proline 52 may indicate a putative interaction site, and support an extra cellular signaling function for Diedel, which is in accordance with its proposed role as negative regulator of the JAK/STAT signaling pathway.

Intestinal stem cells in the adult Drosophila midgut

Energy Technology Data Exchange (ETDEWEB)

Jiang, Huaqi, E-mail: Huaqi.Jiang@UTSouthwestern.edu [Department of Developmental Biology, UT Southwestern Medical Center, 6000 Harry Hines Blvd., Dallas, TX, 75235 (United States); Edgar, Bruce A., E-mail: b.edgar@dkfz.de [ZMBH-DKFZ Alliance, Im Neuenheimer Feld 282, D-69120 Heidelberg (Germany); Division of Basic Sciences, Fred Hutchinson Cancer Research Center, 1100 Fairview Ave. N., Seattle, WA 98109 (United States)

2011-11-15

Drosophila has long been an excellent model organism for studying stem cell biology. Notably, studies of Drosophila's germline stem cells have been instrumental in developing the stem cell niche concept. The recent discovery of somatic stem cells in adult Drosophila, particularly the intestinal stem cells (ISCs) of the midgut, has established Drosophila as an exciting model to study stem cell-mediated adult tissue homeostasis and regeneration. Here, we review the major signaling pathways that regulate the self-renewal, proliferation and differentiation of Drosophila ISCs, discussing how this regulation maintains midgut homeostasis and mediates regeneration of the intestinal epithelium after injury. -- Highlights: Black-Right-Pointing-Pointer The homeostasis and regeneration of adult fly midguts are mediated by ISCs. Black-Right-Pointing-Pointer Damaged enterocytes induce the proliferation of intestinal stem cells (ISC). Black-Right-Pointing-Pointer EGFR and Jak/Stat signalings mediate compensatory ISC proliferation. Black-Right-Pointing-Pointer Notch signaling regulates ISC self-renewal and differentiation.

Early Olfactory Processing in Drosophila: Mechanisms and Principles

OpenAIRE

Wilson, Rachel I.

2013-01-01

In the olfactory system of Drosophila melanogaster, it is relatively straightforward to make in vivo measurements of activity in neurons corresponding to targeted processing. This, together with the numerical simplicity of the Drosophila olfactory system, has produced rapid gains in our understanding of Drosophila olfaction. This review summarizes the neurophysiology of the first two layers of this system: the peripheral olfactory receptor neurons and their postsynaptic targets in the antenna...

Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

Science.gov (United States)

Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

2016-09-15

Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Isolation of protease-free alcohol dehydrogenase (ADH) from Drosophila simulans and several homozygous and heterozygous Drosophila melanogaster variants

NARCIS (Netherlands)

Smilda, T; Lamme, DA; Collu, G; Jekel, PA; Reinders, P; Beintema, JJ

The enzyme alcohol dehydrogenase (ADH) from several naturally occurring ADH variants of Drosophila melanogaster and Drosophila simulans Lc,as isolated. Affinity chromatography with the ligand Cibacron Blue and elution with NAD(+) showed similar behavior for D. melanogaster ADH-FF, ADH-71k, and D.

Adaptive genic evolution in the Drosophila genomes

DEFF Research Database (Denmark)

Shapiro, Joshua A; Huang, Wei; Zhang, Chenhui

2007-01-01

and stable population. In this study, we sequenced 419 genes from 24 lines of Drosophila melanogaster and its close relatives. Together with data from Drosophila simulans, these data reveal the following. (i) Approximately 10% of the loci in regions of normal recombination are much less polymorphic at silent...... sites than expected, hinting at the action of selective sweeps. (ii) The level of polymorphism is negatively correlated with the rate of nonsynonymous divergence across loci. Thus, even under strict neutrality, the ratio of amino acid to silent nucleotide changes (A:S) between Drosophila species...

History and Structure of Sub-Saharan Populations of Drosophila melanogaster

OpenAIRE

Pool, John E.; Aquadro, Charles F.

2006-01-01

Drosophila melanogaster is an important model organism in evolutionary genetics, yet little is known about the population structure and the demographic history of this species within sub-Saharan Africa, which is thought to contain its ancestral range. We surveyed nucleotide variation at four 1-kb fragments in 240 individual lines representing 21 sub-Saharan and 4 Palearctic population samples of D. melanogaster. In agreement with recent studies, we find a small but significant level of geneti...

In Vitro Culturing and Live Imaging of Drosophila Egg Chambers: A History and Adaptable Method.

Science.gov (United States)

Peters, Nathaniel C; Berg, Celeste A

2016-01-01

The development of the Drosophila egg chamber encompasses a myriad of diverse germline and somatic events, and as such, the egg chamber has become a widely used and influential developmental model. Advantages of this system include physical accessibility, genetic tractability, and amenability to microscopy and live culturing, the last of which is the focus of this chapter. To provide adequate context, we summarize the structure of the Drosophila ovary and egg chamber, the morphogenetic events of oogenesis, the history of egg-chamber live culturing, and many of the important discoveries that this culturing has afforded. Subsequently, we discuss various culturing methods that have facilitated analyses of different stages of egg-chamber development and different types of cells within the egg chamber, and we present an optimized protocol for live culturing Drosophila egg chambers.We designed this protocol for culturing late-stage Drosophila egg chambers and live imaging epithelial tube morphogenesis, but with appropriate modifications, it can be used to culture egg chambers of any stage. The protocol employs a liquid-permeable, weighted "blanket" to gently hold egg chambers against the coverslip in a glass-bottomed culture dish so the egg chambers can be imaged on an inverted microscope. This setup provides a more buffered, stable, culturing environment than previously published methods by using a larger volume of culture media, but the setup is also compatible with small volumes. This chapter should aid researchers in their efforts to culture and live-image Drosophila egg chambers, further augmenting the impressive power of this model system.

AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Changho Eun

Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.

Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

Science.gov (United States)

Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

2016-08-08

Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

40 CFR 798.5955 - Heritable translocation test in drosophila melanogaster.

Science.gov (United States)

2010-07-01

... drosophila melanogaster. 798.5955 Section 798.5955 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY....5955 Heritable translocation test in drosophila melanogaster. (a) Purpose. The heritable translocation test in Drosophila measures the induction of chromosomal translocations in germ cells of insects...

Single Nucleotide Polymorphism Markers for Genetic Mapping in Drosophila melanogaster

OpenAIRE

Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.

2001-01-01

For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that recently have revolutionized human, mouse, and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila by using a sequence tagged site-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that sp...

Medium-term changes in Drosophila subobscura chromosomal ...

Indian Academy of Sciences (India)

2015-06-02

Jun 2, 2015 ... Krimbas C. B. 1993 Drosophila subobscura: biology, genetics and inversion polymorphism. Verlag Dr, Kovac, Hamburg. Menozzi P. and Krimbas C. B. 1992 The inversion polymorphism of Drosophila subobscura revisited: synthetic maps of gene arrangements frequencies and their interpretation. J. Evol.

Stability of RNA silencing-based traits after virus infection

DEFF Research Database (Denmark)

Jørgensen, Bodil; Albrechtsen, Merete

2007-01-01

with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

The origin and effect of small RNA signaling in plants

Directory of Open Access Journals (Sweden)

Jean-Sébastien eParent

2012-08-01

Full Text Available Given their sessile condition, land plants need to integrate environmental cues rapidly and send signal throughout the organism to modify their metabolism accordingly. Small RNA (sRNA molecules are among the messengers that plant cells use to carry such signals. These molecules originate from fold-back stem-loops transcribed from endogenous loci or from perfect double-stranded RNA produced through the action of RNA-dependent RNA polymerases. Once produced, sRNAs associate with Argonaute and other proteins to form the RNA-induced silencing complex (RISC that executes silencing of complementary RNA molecules. Depending on the nature of the RNA target and the Argonaute protein involved, RISC triggers either DNA methylation and chromatin modification (leading to transcriptional gene silencing, TGS or RNA cleavage or translational inhibition (leading to post-transcriptional gene silencing, PTGS. In some cases, sRNAs move to neighboring cells and/or to the vascular tissues for long-distance trafficking. Many genes are involved in the biogenesis of sRNAs and recent studies have shown that both their origin and their protein partners have great influence on their activity and range. Here we summarize the work done to uncover the mode of action of the different classes of small RNA with special emphasis on their movement and how plants can take advantage of their mobility. We also review the various genetic requirements needed for production, movement and perception of the silencing signal.

Gut-associated microbes of Drosophila melanogaster

Science.gov (United States)

Broderick, Nichole; Lemaitre, Bruno

2012-01-01

There is growing interest in using Drosophila melanogaster to elucidate mechanisms that underlie the complex relationships between a host and its microbiota. In addition to the many genetic resources and tools Drosophila provides, its associated microbiota is relatively simple (1–30 taxa), in contrast to the complex diversity associated with vertebrates (> 500 taxa). These attributes highlight the potential of this system to dissect the complex cellular and molecular interactions that occur between a host and its microbiota. In this review, we summarize what is known regarding the composition of gut-associated microbes of Drosophila and their impact on host physiology. We also discuss these interactions in the context of their natural history and ecology and describe some recent insights into mechanisms by which Drosophila and its gut microbiota interact. “Workers with Drosophila have been considered fortunate in that they deal with the first multicellular invertebrate to be cultured monoxenically (Delcourt and Guyenot, 1910); the first to be handled axenically on a semisynthetic diet (Guyenot, 1917); and the first to be grown on a defined diet (Schultz et al., 1946). This list of advantages is somewhat embarrassing, since it implies an interest in nutrition that, in reality, was only secondary. The very first studies were concerned with the reduction of variability in genetic experiments (Delcourt and Guyenot, 1910) and standardization of the nutritional environment.” -James Sang, 1959 Ann NY Acad 1 PMID:22572876

Distinct types of glial cells populate the Drosophila antenna

Directory of Open Access Journals (Sweden)

Jhaveri Dhanisha

2005-11-01

Full Text Available Abstract Background The development of nervous systems involves reciprocal interactions between neurons and glia. In the Drosophila olfactory system, peripheral glial cells arise from sensory lineages specified by the basic helix-loop-helix transcription factor, Atonal. These glia wrap around the developing olfactory axons early during development and pattern the three distinct fascicles as they exit the antenna. In the moth Manduca sexta, an additional set of central glia migrate to the base of the antennal nerve where axons sort to their glomerular targets. In this work, we have investigated whether similar types of cells exist in the Drosophila antenna. Results We have used different P(Gal4 lines to drive Green Fluorescent Protein (GFP in distinct populations of cells within the Drosophila antenna. Mz317::GFP, a marker for cell body and perineural glia, labels the majority of peripheral glia. An additional ~30 glial cells detected by GH146::GFP do not derive from any of the sensory lineages and appear to migrate into the antenna from the brain. Their appearance in the third antennal segment is regulated by normal function of the Epidermal Growth Factor receptor and small GTPases. We denote these distinct populations of cells as Mz317-glia and GH146-glia respectively. In the adult, processes of GH146-glial cells ensheath the olfactory receptor neurons directly, while those of the Mz317-glia form a peripheral layer. Ablation of GH146-glia does not result in any significant effects on the patterning of the olfactory receptor axons. Conclusion We have demonstrated the presence of at least two distinct populations of glial cells within the Drosophila antenna. GH146-glial cells originate in the brain and migrate to the antenna along the newly formed olfactory axons. The number of cells populating the third segment of the antenna is regulated by signaling through the Epidermal Growth Factor receptor. These glia share several features of the sorting

Unveiling the Dual Role of the Dopaminergic System on Locomotion and the Innate Value for an Aversive Olfactory Stimulus in Drosophila.

Science.gov (United States)

Fuenzalida-Uribe, Nicolás; Campusano, Jorge M

2018-02-10

The communication between sensory systems and the specific brain centers that process this information is crucial to develop adequate behavioral responses. Modulatory systems, including dopaminergic circuits, regulate this communication to finely tune the behavioral response associated to any given stimulus. For instance, the Mushroom Body (MB), an insect brain integration center that receives and processes several sensory stimuli and organizes the execution of motor programs, communicates with MB output neurons (MBONs) to develop behavioral responses associated to olfactory stimuli. This communication is modulated by dopaminergic neural systems. Here we show that silencing dopaminergic neurons increases the aversive response observed in adult flies exposed to Benzaldehyde (Bz) or octanol. We studied the contribution of two dopaminergic clusters that innervate different zones of MB, Protocerebral anterior medial (PAM) and Protocerebral posterior lateral 1 (PPL1), on the innate value to the aversive stimulus and the associated locomotor behavior. In order to do this, we manipulated the synaptic transmission of these neural clusters through the expression of Tetanus toxin, Kir2.1 and Transient receptor potential cation channel A1 (TrpA1) channels. Our results show that neurons in PPL1 and PAM differentially modulate the innate value to Bz in adult flies. On the other hand, blocking neurotransmission or genetic silencing of PAM neurons results in decreased locomotor behavior in flies, an effect not observed when silencing PPL1. Our results suggest that as in mammals, specific dopaminergic pathways differentially modulate locomotor behavior and the innate value for an odorant, a limbic-like response in Drosophila. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.

An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

KAUST Repository

Zheng, Zhimin

2010-01-06

RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

Large-scale isolation and fractionation of organs of Drosophila melanogaster larvae.

Science.gov (United States)

Zweidler, A; Cohen, L H

1971-10-01

Methods for the mass isolation of diverse organs from small animals are described. They involve novel devices: a mechanical dissecting system, a centrifugal agitator for the separation of fibrillar from globular particles, and a settling chamber for the fractionation at unit gravity of particles with sedimentation velocities above the useful range for centrifugation. The application of these methods to the isolation of polytene and nonpolytene nuclei from Drosophila melanogaster larvae is described.

Effect of silencing of ATM expression by siRNA on radiosensitivity of human lung adenocarcinoma A549 cells

International Nuclear Information System (INIS)

Liu Xiaoqun; Qiao Tiankui

2014-01-01

Objective: To investigate the effect of silencing of ataxia-telangiectasia mutated (ATM) expression by plasmid-mediated RNA interference on the radiosensitivity of human lung adenocarcinoma A 549 cells. Methods: Eukaryotic expression plasmid containing ATM small interfering RNA (siRNA) (pSilencer2.1-ATM), as well as pSilencer2.1-nonspecific, was constructed.Lung adenocarcinoma A 549 cells were divided into positive group, negative group,and control group to be transfected with pSilencer2.1-ATM, pSilencer2.1-nonspecific, and no plasmid, respectively. The mRNA and protein expression of ATM was measured by RT-PCR and Western blot, respectively. The change in cell radiosensitivity was observed by colony-forming assay. Cell cycle and cell apoptosis were analyzed by flow cytometry. Results: The eukaryotic expression plasmid containing ATM siRNA was successfully constructed. The RT-PCR and Western blot demonstrated that the expression of ATM was down-regulated in the positive group. The sensitization enhancement ratios (D 0 ratios) for the positive group and negative group were 1.50 and 1.01, respectively. The flow cytometry revealed that the proportions of A 549 cells in G 1 and G 2 /M phases were significantly lower in the positive group than in the control group (51.27% vs 61.85%, P = 0.012; 6.34% vs 10.91%, P = 0.008) and that the apoptosis rate was significantly higher in the positive group than in the control group and negative group (49.31% vs 13.58%, P = 0.000; 49.31% vs 13.17%, P = 0.000). Conclusions: Silencing of ATM expression may increase the radiosensitivity of human lung adenocarcinoma A 549 cells, probably by affecting the cell cycle and promoting cell apoptosis. (authors)

Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

Science.gov (United States)

Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

2016-06-17

In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

Science.gov (United States)

Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

2010-11-01

The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

Drosophila SMN complex proteins Gemin2, Gemin3, and Gemin5 are components of U bodies

International Nuclear Information System (INIS)

Cauchi, Ruben J.; Sanchez-Pulido, Luis; Liu, Ji-Long

2010-01-01

Uridine-rich small nuclear ribonucleoproteins (U snRNPs) play key roles in pre-mRNA processing in the nucleus. The assembly of most U snRNPs takes place in the cytoplasm and is facilitated by the survival motor neuron (SMN) complex. Discrete cytoplasmic RNA granules called U bodies have been proposed to be specific sites for snRNP assembly because they contain U snRNPs and SMN. U bodies invariably associate with P bodies, which are involved in mRNA decay and translational control. However, it remains unknown whether other SMN complex proteins also localise to U bodies. In Drosophila there are four SMN complex proteins, namely SMN, Gemin2/CG10419, Gemin3 and Gemin5/Rigor mortis. Drosophila Gemin3 was originally identified as the Drosophila orthologue of human and yeast Dhh1, a component of P bodies. Through an in silico analysis of the DEAD-box RNA helicases we confirmed that Gemin3 is the bona fide Drosophila orthologue of vertebrate Gemin3 whereas the Drosophila orthologue of Dhh1 is Me31B. We then made use of the Drosophila egg chamber as a model system to study the subcellular distribution of the Gemin proteins as well as Me31B. Our cytological investigations show that Gemin2, Gemin3 and Gemin5 colocalise with SMN in U bodies. Although they are excluded from P bodies, as components of U bodies, Gemin2, Gemin3 and Gemin5 are consistently found associated with P bodies, wherein Me31B resides. In addition to a role in snRNP biogenesis, SMN complexes residing in U bodies may also be involved in mRNP assembly and/or transport.

Drosophila SMN complex proteins Gemin2, Gemin3, and Gemin5 are components of U bodies

Energy Technology Data Exchange (ETDEWEB)

Cauchi, Ruben J.; Sanchez-Pulido, Luis [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3QX (United Kingdom); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3QX (United Kingdom)

2010-08-15

Uridine-rich small nuclear ribonucleoproteins (U snRNPs) play key roles in pre-mRNA processing in the nucleus. The assembly of most U snRNPs takes place in the cytoplasm and is facilitated by the survival motor neuron (SMN) complex. Discrete cytoplasmic RNA granules called U bodies have been proposed to be specific sites for snRNP assembly because they contain U snRNPs and SMN. U bodies invariably associate with P bodies, which are involved in mRNA decay and translational control. However, it remains unknown whether other SMN complex proteins also localise to U bodies. In Drosophila there are four SMN complex proteins, namely SMN, Gemin2/CG10419, Gemin3 and Gemin5/Rigor mortis. Drosophila Gemin3 was originally identified as the Drosophila orthologue of human and yeast Dhh1, a component of P bodies. Through an in silico analysis of the DEAD-box RNA helicases we confirmed that Gemin3 is the bona fide Drosophila orthologue of vertebrate Gemin3 whereas the Drosophila orthologue of Dhh1 is Me31B. We then made use of the Drosophila egg chamber as a model system to study the subcellular distribution of the Gemin proteins as well as Me31B. Our cytological investigations show that Gemin2, Gemin3 and Gemin5 colocalise with SMN in U bodies. Although they are excluded from P bodies, as components of U bodies, Gemin2, Gemin3 and Gemin5 are consistently found associated with P bodies, wherein Me31B resides. In addition to a role in snRNP biogenesis, SMN complexes residing in U bodies may also be involved in mRNP assembly and/or transport.

Nanoliter hemolymph sampling and analysis of individual adult Drosophila melanogaster.

Science.gov (United States)

Piyankarage, Sujeewa C; Featherstone, David E; Shippy, Scott A

2012-05-15

The fruit fly (Drosophila melanogaster) is an extensively used and powerful, genetic model organism. However, chemical studies using individual flies have been limited by the animal's small size. Introduced here is a method to sample nanoliter hemolymph volumes from individual adult fruit-flies for chemical analysis. The technique results in an ability to distinguish hemolymph chemical variations with developmental stage, fly sex, and sampling conditions. Also presented is the means for two-point monitoring of hemolymph composition for individual flies.

Undesired small RNAs originate from an artificial microRNA precursor in transgenic petunia (Petunia hybrida.

Directory of Open Access Journals (Sweden)

Yulong Guo

Full Text Available Although artificial microRNA (amiRNA technology has been used frequently in gene silencing in plants, little research has been devoted to investigating the accuracy of amiRNA precursor processing. In this work, amiRNAchs1 (amiRchs1, based on the Arabidopsis miR319a precursor, was expressed in order to suppress the expression of CHS genes in petunia. The transgenic plants showed the CHS gene-silencing phenotype. A modified 5' RACE technique was used to map small-RNA-directed cleavage sites and to detect processing intermediates of the amiRchs1 precursor. The results showed that the target CHS mRNAs were cut at the expected sites and that the amiRchs1 precursor was processed from loop to base. The accumulation of small RNAs in amiRchs1 transgenic petunia petals was analyzed using the deep-sequencing technique. The results showed that, alongside the accumulation of the desired artificial microRNAs, additional small RNAs that originated from other regions of the amiRNA precursor were also accumulated at high frequency. Some of these had previously been found to be accumulated at low frequency in the products of ath-miR319a precursor processing and some of them were accompanied by 3'-tailing variant. Potential targets of the undesired small RNAs were discovered in petunia and other Solanaceae plants. The findings draw attention to the potential occurrence of undesired target silencing induced by such additional small RNAs when amiRNA technology is used. No appreciable production of secondary small RNAs occurred, despite the fact that amiRchs1 was designed to have perfect complementarity to its CHS-J target. This confirmed that perfect pairing between an amiRNA and its targets is not the trigger for secondary small RNA production. In conjunction with the observation that amiRNAs with perfect complementarity to their target genes show high efficiency and specificity in gene silencing, this finding has an important bearing on future applications of ami

Undesired small RNAs originate from an artificial microRNA precursor in transgenic petunia (Petunia hybrida).

Science.gov (United States)

Guo, Yulong; Han, Yao; Ma, Jing; Wang, Huiping; Sang, Xianchun; Li, Mingyang

2014-01-01

Although artificial microRNA (amiRNA) technology has been used frequently in gene silencing in plants, little research has been devoted to investigating the accuracy of amiRNA precursor processing. In this work, amiRNAchs1 (amiRchs1), based on the Arabidopsis miR319a precursor, was expressed in order to suppress the expression of CHS genes in petunia. The transgenic plants showed the CHS gene-silencing phenotype. A modified 5' RACE technique was used to map small-RNA-directed cleavage sites and to detect processing intermediates of the amiRchs1 precursor. The results showed that the target CHS mRNAs were cut at the expected sites and that the amiRchs1 precursor was processed from loop to base. The accumulation of small RNAs in amiRchs1 transgenic petunia petals was analyzed using the deep-sequencing technique. The results showed that, alongside the accumulation of the desired artificial microRNAs, additional small RNAs that originated from other regions of the amiRNA precursor were also accumulated at high frequency. Some of these had previously been found to be accumulated at low frequency in the products of ath-miR319a precursor processing and some of them were accompanied by 3'-tailing variant. Potential targets of the undesired small RNAs were discovered in petunia and other Solanaceae plants. The findings draw attention to the potential occurrence of undesired target silencing induced by such additional small RNAs when amiRNA technology is used. No appreciable production of secondary small RNAs occurred, despite the fact that amiRchs1 was designed to have perfect complementarity to its CHS-J target. This confirmed that perfect pairing between an amiRNA and its targets is not the trigger for secondary small RNA production. In conjunction with the observation that amiRNAs with perfect complementarity to their target genes show high efficiency and specificity in gene silencing, this finding has an important bearing on future applications of amiRNAs in gene

Silence of the Genes

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

Science.gov (United States)

Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

2015-01-01

In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

Maternal Silences: Motherhood and Voluntary Childlessness in Contemporary Christianity

Directory of Open Access Journals (Sweden)

Dawn Llewellyn

2016-06-01

Full Text Available In Christianity, there is an ideology of motherhood that pervades scripture, ritual, and doctrine, yet there is an academic silence that means relatively little space has been given to motherhood and mothering, and even less to voluntary childlessness, from a faith perspective. By drawing on qualitative in-depth interviews with Christian women living in Britain, narrating their experiences of motherhood and voluntary childlessness, I suggest there are also lived maternal silences encountered by women in contemporary Christianity. There is a maternal expectation produced through church teaching, liturgy and culture that constructs women as ‘maternal bodies’ (Gatrell 2008; this silences and marginalises women from articulating their complex relationship with religion, motherhood, and childlessness in ways that challenge their spiritual development. However, this article also introduces the everyday and intentional tactics women employ to disrupt the maternal expectation, and hereby interrupt the maternal silence.

Identification of functional elements and regulatory circuits by Drosophila modENCODE

Energy Technology Data Exchange (ETDEWEB)

Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

2010-12-22

To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

Bodies, Spaces, Voices, Silences

Directory of Open Access Journals (Sweden)

Donatella Mazzoleni

2013-07-01

Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.

Hyperactive locomotion in a Drosophila model is a functional readout for the synaptic abnormalities underlying fragile X syndrome.

Science.gov (United States)

Kashima, Risa; Redmond, Patrick L; Ghatpande, Prajakta; Roy, Sougata; Kornberg, Thomas B; Hanke, Thomas; Knapp, Stefan; Lagna, Giorgio; Hata, Akiko

2017-05-02

Fragile X syndrome (FXS) is the most common cause of heritable intellectual disability and autism and affects ~1 in 4000 males and 1 in 8000 females. The discovery of effective treatments for FXS has been hampered by the lack of effective animal models and phenotypic readouts for drug screening. FXS ensues from the epigenetic silencing or loss-of-function mutation of the fragile X mental retardation 1 ( FMR1 ) gene, which encodes an RNA binding protein that associates with and represses the translation of target mRNAs. We previously found that the activation of LIM kinase 1 (LIMK1) downstream of augmented synthesis of bone morphogenetic protein (BMP) type 2 receptor (BMPR2) promotes aberrant synaptic development in mouse and Drosophila models of FXS and that these molecular and cellular markers were correlated in patients with FXS. We report that larval locomotion is augmented in a Drosophila FXS model. Genetic or pharmacological intervention on the BMPR2-LIMK pathway ameliorated the synaptic abnormality and locomotion phenotypes of FXS larvae, as well as hyperactivity in an FXS mouse model. Our study demonstrates that (i) the BMPR2-LIMK pathway is a promising therapeutic target for FXS and (ii) the locomotion phenotype of FXS larvae is a quantitative functional readout for the neuromorphological phenotype associated with FXS and is amenable to the screening novel FXS therapeutics. Copyright © 2017, American Association for the Advancement of Science.

DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

Science.gov (United States)

Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

2003-04-24

Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

Biological effects of radon in Drosophila

International Nuclear Information System (INIS)

Pimentel P, A.E.; Tavera D, L.; Cruces M, M.P.; Arceo M, C.; Rosa D, M.E. de la

1992-04-01

The main objective of this investigation, is to study the biological effects of the Radon-222 at low dose in 'Drosophila melanogaster'. It is necessary to mention that these effects will analyze from the genetic point of view for: 1) To evaluate in which form the Radon-222 to low dose it influences in some genetic components of the adaptation in Drosophila, such as: fecundity, viability egg-adult and sex proportion. 2) To evaluate which is the genetic effect that induces the Radon to low dose by means of the SMART technique in Drosophila melanogaster, and this way to try of to identify which is the possible mechanism that causes the genetic damage to somatic level. The carried out investigation was divided in three stages: 1. Tests to the vacuum resistance. 2. Test of somatic mutation, and 3. Determination of the presence of radon daughters on the adult of Drosophila. It is necessary to point out that all the experiments were made by triplicate and in each one of them was placed detectors in preset places. Those obtained results are presented inside the 4 charts included in the present work. (Author)

Drosophila melanogaster as a model organism to study nanotoxicity.

Science.gov (United States)

Ong, Cynthia; Yung, Lin-Yue Lanry; Cai, Yu; Bay, Boon-Huat; Baeg, Gyeong-Hun

2015-05-01

Drosophila melanogaster has been used as an in vivo model organism for the study of genetics and development since 100 years ago. Recently, the fruit fly Drosophila was also developed as an in vivo model organism for toxicology studies, in particular, the field of nanotoxicity. The incorporation of nanomaterials into consumer and biomedical products is a cause for concern as nanomaterials are often associated with toxicity in many in vitro studies. In vivo animal studies of the toxicity of nanomaterials with rodents and other mammals are, however, limited due to high operational cost and ethical objections. Hence, Drosophila, a genetically tractable organism with distinct developmental stages and short life cycle, serves as an ideal organism to study nanomaterial-mediated toxicity. This review discusses the basic biology of Drosophila, the toxicity of nanomaterials, as well as how the Drosophila model can be used to study the toxicity of various types of nanomaterials.

DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

Directory of Open Access Journals (Sweden)

Sizolwenkosi Mlotshwa

2008-03-01

Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

Drosophila's contribution to stem cell research [version 2; referees: 2 approved

Directory of Open Access Journals (Sweden)

Gyanesh Singh

2016-08-01

Full Text Available The discovery of Drosophila stem cells with striking similarities to mammalian stem cells has brought new hope for stem cell research. Recent developments in Drosophila stem cell research is bringing wider opportunities for contemporary stem cell biologists. In this regard, Drosophila germ cells are becoming a popular model of stem cell research. In several cases, genes that controlled Drosophila stem cells were later discovered to have functional homologs in mammalian stem cells. Like mammals, Drosophila germline stem cells (GSCs are controlled by both intrinsic as well as external signals. Inside the Drosophila testes, germline and somatic stem cells form a cluster of cells (the hub. Hub cells depend on JAK-STAT signaling, and, in absence of this signal, they do not self-renew. In Drosophila, significant changes occur within the stem cell niche that contributes to a decline in stem cell number over time. In case of aging Drosophila, somatic niche cells show reduced DE-cadherin and unpaired (Upd proteins. Unpaired proteins are known to directly decrease stem cell number within the niches, and, overexpression of upd within niche cells restored GSCs in older males also . Stem cells in the midgut of Drosophila are also very promising. Reduced Notch signaling was found to increase the number of midgut progenitor cells. On the other hand, activation of the Notch pathway decreased proliferation of these cells. Further research in this area should lead to the discovery of additional factors that regulate stem and progenitor cells in Drosophila.

A Medicago truncatula rdr6 allele impairs transgene silencing and endogenous phased siRNA production but not development.

Science.gov (United States)

Bustos-Sanmamed, Pilar; Hudik, Elodie; Laffont, Carole; Reynes, Christelle; Sallet, Erika; Wen, Jiangqi; Mysore, Kirankumar S; Camproux, Anne-Claude; Hartmann, Caroline; Gouzy, Jérome; Frugier, Florian; Crespi, Martin; Lelandais-Brière, Christine

2014-12-01

RNA-dependent RNA polymerase 6 (RDR6) and suppressor of gene silencing 3 (SGS3) act together in post-transcriptional transgene silencing mediated by small interfering RNAs (siRNAs) and in biogenesis of various endogenous siRNAs including the tasiARFs, known regulators of auxin responses and plant development. Legumes, the third major crop family worldwide, has been widely improved through transgenic approaches. Here, we isolated rdr6 and sgs3 mutants in the model legume Medicago truncatula. Two sgs3 and one rdr6 alleles led to strong developmental defects and impaired biogenesis of tasiARFs. In contrast, the rdr6.1 homozygous plants produced sufficient amounts of tasiARFs to ensure proper development. High throughput sequencing of small RNAs from this specific mutant identified 354 potential MtRDR6 substrates, for which siRNA production was significantly reduced in the mutant. Among them, we found a large variety of novel phased loci corresponding to protein-encoding genes or transposable elements. Interestingly, measurement of GFP expression revealed that post-transcriptional transgene silencing was reduced in rdr6.1 roots. Hence, this novel mis-sense mutation, affecting a highly conserved amino acid residue in plant RDR6s, may be an interesting tool both to analyse endogenous pha-siRNA functions and to improve transgene expression, at least in legume species. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Viruses and Antiviral Immunity in Drosophila

Science.gov (United States)

Xu, Jie; Cherry, Sara

2013-01-01

Viral pathogens present many challenges to organisms, driving the evolution of a myriad of antiviral strategies to combat infections. A wide variety of viruses infect invertebrates, including both natural pathogens that are insect-restricted, and viruses that are transmitted to vertebrates. Studies using the powerful tools available in the model organism Drosophila have expanded our understanding of antiviral defenses against diverse viruses. In this review, we will cover three major areas. First, we will describe the tools used to study viruses in Drosophila. Second, we will survey the major viruses that have been studied in Drosophila. And lastly, we will discuss the well-characterized mechanisms that are active against these diverse pathogens, focusing on non-RNAi mediated antiviral mechanisms. Antiviral RNAi is discussed in another paper in this issue. PMID:23680639

Receptor Tyrosine Kinases in Drosophila Development

Science.gov (United States)

Sopko, Richelle; Perrimon, Norbert

2013-01-01

Tyrosine phosphorylation plays a significant role in a wide range of cellular processes. The Drosophila genome encodes more than 20 receptor tyrosine kinases and extensive studies in the past 20 years have illustrated their diverse roles and complex signaling mechanisms. Although some receptor tyrosine kinases have highly specific functions, others strikingly are used in rather ubiquitous manners. Receptor tyrosine kinases regulate a broad expanse of processes, ranging from cell survival and proliferation to differentiation and patterning. Remarkably, different receptor tyrosine kinases share many of the same effectors and their hierarchical organization is retained in disparate biological contexts. In this comprehensive review, we summarize what is known regarding each receptor tyrosine kinase during Drosophila development. Astonishingly, very little is known for approximately half of all Drosophila receptor tyrosine kinases. PMID:23732470

Engineering of small interfering RNA-loaded lipidoid-poly(DL-lactic-co-glycolic acid) hybrid nanoparticles for highly efficient and safe gene silencing: A quality by design-based approach.

Science.gov (United States)

Thanki, Kaushik; Zeng, Xianghui; Justesen, Sarah; Tejlmann, Sarah; Falkenberg, Emily; Van Driessche, Elize; Mørck Nielsen, Hanne; Franzyk, Henrik; Foged, Camilla

2017-11-01

Safety and efficacy of therapeutics based on RNA interference, e.g., small interfering RNA (siRNA), are dependent on the optimal engineering of the delivery technology, which is used for intracellular delivery of siRNA to the cytosol of target cells. We investigated the hypothesis that commonly used and poorly tolerated cationic lipids might be replaced with more efficacious and safe lipidoids as the lipid component of siRNA-loaded lipid-polymer hybrid nanoparticles (LPNs) for achieving more efficient gene silencing at lower and safer doses. However, formulation design of such a complex formulation is highly challenging due to a strong interplay between several contributing factors. Hence, critical formulation variables, i.e. the lipidoid content and siRNA:lipidoid ratio, were initially identified, followed by a systematic quality-by-design approach to define the optimal operating space (OOS), eventually resulting in the identification of a robust, highly efficacious and safe formulation. A 17-run design of experiment with an I-optimal approach was performed to systematically assess the effect of selected variables on critical quality attributes (CQAs), i.e. physicochemical properties (hydrodynamic size, zeta potential, siRNA encapsulation/loading) and the biological performance (in vitro gene silencing and cell viability). Model fitting of the obtained data to construct predictive models revealed non-linear relationships for all CQAs, which can be readily overlooked in one-factor-at-a-time optimization approaches. The response surface methodology further enabled the identification of an OOS that met the desired quality target product profile. The optimized lipidoid-modified LPNs revealed more than 50-fold higher in vitro gene silencing at well-tolerated doses and approx. a twofold increase in siRNA loading as compared to reference LPNs modified with the commonly used cationic lipid dioleyltrimethylammonium propane (DOTAP). Thus, lipidoid-modified LPNs show highly

Effect of Hawthorn on Drosophila Melanogaster Antioxidant-Related ...

African Journals Online (AJOL)

Results: The results indicate that hawthorn extract prolonged the life span of Drosophila, with 50 % survival time of 0.8 ... Drosophila's aging gene is highly similar to humans [4,5]. ..... reduces lipid peroxidation in senescence-accelerated mice .

Salicylic acid-mediated and RNA-silencing defense mechanisms cooperate in the restriction of systemic spread of plum pox virus in tobacco.

Science.gov (United States)

Alamillo, Josefa M; Saénz, Pilar; García, Juan Antonio

2006-10-01

Plum pox virus (PPV) is able to replicate in inoculated leaves of Nicotiana tabacum, but is defective in systemic movement in this host. However, PPV produces a systemic infection in transgenic tobacco expressing the silencing suppressor P1/HC-Pro from tobacco etch virus (TEV). In this work we show that PPV is able to move to upper non-inoculated leaves of tobacco plants expressing bacterial salicylate hydroxylase (NahG) that degrades salicylic acid (SA). Replication and accumulation of PPV is higher in the locally infected leaves of plants deficient in SA or expressing TEV P1/HC-Pro silencing suppressor. Accumulation of viral derived small RNAs was reduced in the NahG transgenic plants, suggesting that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco. Besides, expression of SA-mediated defense transcripts, such as those of pathogenesis-related (PR) proteins PR-1 and PR-2 or alternative oxidase-1, as well as that of the putative RNA-dependent RNA polymerase NtRDR1, is induced in response to PPV infection, and the expression patterns of these defense transcripts are altered in the TEV P1/HC-Pro transgenic plants. Long-distance movement of PPV is highly enhanced in NahG x P1/HC-Pro double-transgenic plants and systemic symptoms in these plants reveal that the expression of an RNA-silencing suppressor and the lack of SA produce additive but distinct effects. Our results suggest that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco, and that silencing suppressors, such as P1/HC-Pro, also alter the SA-mediated defense. Both an RNA-silencing and an SA-mediated defense mechanism could act together to limit PPV infection.

Ctr9, a Key Component of the Paf1 Complex, Affects Proliferation and Terminal Differentiation in the Developing Drosophila Nervous System

Directory of Open Access Journals (Sweden)

Shahrzad Bahrampour

2016-10-01

Full Text Available The Paf1 protein complex (Paf1C is increasingly recognized as a highly conserved and broadly utilized regulator of a variety of transcriptional processes. These include the promotion of H3K4 and H3K36 trimethylation, H2BK123 ubiquitination, RNA Pol II transcriptional termination, and also RNA-mediated gene silencing. Paf1C contains five canonical protein components, including Paf1 and Ctr9, which are critical for overall complex integrity, as well as Rtf1, Leo1, and Cdc73/Parafibromin(Hrpt2/Hyrax. In spite of a growing appreciation for the importance of Paf1C from yeast and mammalian studies, there has only been limited work in Drosophila. Here, we provide the first detailed phenotypic study of Ctr9 function in Drosophila. We found that Ctr9 mutants die at late embryogenesis or early larval life, but can be partly rescued by nervous system reexpression of Ctr9. We observed a number of phenotypes in Ctr9 mutants, including increased neuroblast numbers, increased nervous system proliferation, as well as downregulation of many neuropeptide genes. Analysis of cell cycle and regulatory gene expression revealed upregulation of the E2f1 cell cycle factor, as well as changes in Antennapedia and Grainy head expression. We also found reduction of H3K4me3 modification in the embryonic nervous system. Genome-wide transcriptome analysis points to additional downstream genes that may underlie these Ctr9 phenotypes, revealing gene expression changes in Notch pathway target genes, cell cycle genes, and neuropeptide genes. In addition, we find significant effects on the gene expression of metabolic genes. These findings reveal that Ctr9 is an essential gene that is necessary at multiple stages of nervous system development, and provides a starting point for future studies of the Paf1C in Drosophila.

Investigating the effects of nanoparticles on reproduction and development in Drosophila melanogaster and CD-1 mice

Science.gov (United States)

Philbrook, Nicola Anne

Manufactured nanoparticles (NPs) are a class of small (≤ 100 nm) materials that are being used for a variety of purposes, including industrial lubricants, food additives, antibacterial agents, as well as delivery systems for drug and gene therapies. Their unique characteristics due to their small size as well as their parent materials allow them to be exploited in convenience applications; however, some of these properties also allow them to interact with and invade biological systems. Few studies have been performed to determine the potential harm that NPs can inflict on reproductive and developmental processes in organisms. In this study, Drosophila melanogaster and CD-1 mice were orally exposed to varying doses of titanium dioxide (TiO 2) NPs, silver (Ag) NPs, or hydroxyl-functionalized carbon nanotubes (fCNTs) and Drosophila were also exposed to microparticles (MPs) as a control for particle size. The subsequent effect of these materials on reproduction and development were evaluated. Strikingly, each type of NP studied negatively affected either reproduction or development in one or both of the two model systems. TiO2 NPs significantly negative effected both CD-1 mouse development (100 mg/kg or 1000 mg/kg) as well as Drosophila female fecundity (0.005%-0.5% w/v). Ag NPs significantly reduced mouse fetus viability after prenatal exposure to10 mg/kg. Ag NPs also significantly decreased the developmental success of Drosophila when they were directly exposed to these NPs (0.05% - 0.5% w/v) compared to both the vehicle and MP controls. fCNTs significantly increased the presence of morphological defects, resorptions and skeletal abnormalities in CD-1 mice, but had little effect on Drosophila. We speculate that the differences seen in the effects of NP types may be partially due to differences in reproductive physiology as well as each organism's ability to internalize these NPs. Whereas the differing response of each organism to a NP type was likely due in part to

Phytophthora effector targets a novel component of small RNA pathway in plants to promote infection.

Science.gov (United States)

Qiao, Yongli; Shi, Jinxia; Zhai, Yi; Hou, Yingnan; Ma, Wenbo

2015-05-05

A broad range of parasites rely on the functions of effector proteins to subvert host immune response and facilitate disease development. The notorious Phytophthora pathogens evolved effectors with RNA silencing suppression activity to promote infection in plant hosts. Here we report that the Phytophthora Suppressor of RNA Silencing 1 (PSR1) can bind to an evolutionarily conserved nuclear protein containing the aspartate-glutamate-alanine-histidine-box RNA helicase domain in plants. This protein, designated PSR1-Interacting Protein 1 (PINP1), regulates the accumulation of both microRNAs and endogenous small interfering RNAs in Arabidopsis. A null mutation of PINP1 causes embryonic lethality, and silencing of PINP1 leads to developmental defects and hypersusceptibility to Phytophthora infection. These phenotypes are reminiscent of transgenic plants expressing PSR1, supporting PINP1 as a direct virulence target of PSR1. We further demonstrate that the localization of the Dicer-like 1 protein complex is impaired in the nucleus of PINP1-silenced or PSR1-expressing cells, indicating that PINP1 may facilitate small RNA processing by affecting the assembly of dicing complexes. A similar function of PINP1 homologous genes in development and immunity was also observed in Nicotiana benthamiana. These findings highlight PINP1 as a previously unidentified component of RNA silencing that regulates distinct classes of small RNAs in plants. Importantly, Phytophthora has evolved effectors to target PINP1 in order to promote infection.

Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

Science.gov (United States)

Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-09-01

The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence

Directory of Open Access Journals (Sweden)

Michael Gary Duncan

2012-03-01

Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.

Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.

Science.gov (United States)

Suhor, Charles

1991-01-01

Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)

Double-stranded RNA delivery through soaking mediates silencing of the muscle protein 20 and increases mortality to the Asian citrus psyllid, Diaphorina citri.

Science.gov (United States)

Yu, Xiudao; Gowda, Siddarame; Killiny, Nabil

2017-09-01

Asian citrus psyllid, Diaphorina citri Kuwayama, is the most important economic pest of citrus because it transmits Candidatus Liberibacter asiaticus (CLas), the causal agent of huanglongbing (HLB). Silencing genes by RNA interference (RNAi) is a promising approach for controlling D. citri. RNAi-based insect management strategies depend on the selection of suitable target genes. The muscle protein 20 gene DcMP20 was characterized from D. citri in an effort to impair proper muscle development through RNAi. Phylogenetic analysis showed that DcMP20 was more closely related to MP20 from Drosophila compared with its counterpart from other insect species. Developmental expression analysis revealed that transcription of DcMP20 was development dependent and reached a maximum level in the last instar (fourth-fifth) of the nymphal stage. The extent of RNAi in D. citri was dose dependent, with dsRNA-DcMP20 at 75 ng µL -1 being sufficient to knock down endogenous DcMP20 expression, which resulted in significant mortality and reduced body weight that positively correlated with the silencing of DcMP20. No effect was found when dsRNA-GFP or water was used, indicating the specific effect of dsRNA-DcMP20. Our results suggest that dsRNA can be delivered to D. citri through soaking, and DcMP20 is an effective RNAi target to be used in the management of D. citri. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Strategy of gene silencing in cassava for validation of resistance genes

International Nuclear Information System (INIS)

Cortes, Simon; Lopez, Camilo

2010-01-01

Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

Directory of Open Access Journals (Sweden)

Logan M. Decker

2017-04-01

Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.

OpenAIRE

Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki

2011-01-01

Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...

SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

Science.gov (United States)

Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

2011-01-01

In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

Active compressor engine silencer reduces exhaust noise

International Nuclear Information System (INIS)

Denenberg, J.N.; Miller, S.K.; Jay, M.A.

1994-01-01

An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project

A genome-wide analysis of the RNA-guided silencing pathway in coffee reveals insights into its regulatory mechanisms.

Directory of Open Access Journals (Sweden)

Christiane Noronha Fernandes-Brum

Full Text Available microRNAs (miRNAs are derived from self-complementary hairpin structures, while small-interfering RNAs (siRNAs are derived from double-stranded RNA (dsRNA or hairpin precursors. The core mechanism of sRNA production involves DICER-like (DCL in processing the smallRNAs (sRNAs and ARGONAUTE (AGO as effectors of silencing, and siRNA biogenesis also involves action of RNA-Dependent RNA Polymerase (RDR, Pol IV and Pol V in biogenesis. Several other proteins interact with the core proteins to guide sRNA biogenesis, action, and turnover. We aimed to unravel the components and functions of the RNA-guided silencing pathway in a non-model plant species of worldwide economic relevance. The sRNA-guided silencing complex members have been identified in the Coffea canephora genome, and they have been characterized at the structural, functional, and evolutionary levels by computational analyses. Eleven AGO proteins, nine DCL proteins (which include a DCL1-like protein that was not previously annotated, and eight RDR proteins were identified. Another 48 proteins implicated in smallRNA (sRNA pathways were also identified. Furthermore, we identified 235 miRNA precursors and 317 mature miRNAs from 113 MIR families, and we characterized ccp-MIR156, ccp-MIR172, and ccp-MIR390. Target prediction and gene ontology analyses of 2239 putative targets showed that significant pathways in coffee are targeted by miRNAs. We provide evidence of the expansion of the loci related to sRNA pathways, insights into the activities of these proteins by domain and catalytic site analyses, and gene expression analysis. The number of MIR loci and their targeted pathways highlight the importance of miRNAs in coffee. We identified several roles of sRNAs in C. canephora, which offers substantial insight into better understanding the transcriptional and post-transcriptional regulation of this major crop.

Marie Nimier, au cœur du silence

Directory of Open Access Journals (Sweden)

Joëlle Papillon

2012-01-01

Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.

The efficiency of aerodynamic force production in Drosophila.

Science.gov (United States)

Lehmann, F O

2001-12-01

Total efficiency of aerodynamic force production in insect flight depends on both the efficiency with which flight muscles turn metabolic energy into muscle mechanical power and the efficiency with which this power is converted into aerodynamic flight force by the flapping wings. Total efficiency has been estimated in tethered flying fruit flies Drosophila by modulating their power expenditures in a virtual reality flight simulator while simultaneously measuring stroke kinematics, locomotor performance and metabolic costs. During flight, muscle efficiency increases with increasing flight force production, whereas aerodynamic efficiency of lift production decreases with increasing forces. As a consequence of these opposite trends, total flight efficiency in Drosophila remains approximately constant within the kinematic working range of the flight motor. Total efficiency is broadly independent of different profile power estimates and typically amounts to 2-3%. The animal achieves maximum total efficiency near hovering flight conditions, when the beating wings produce flight forces that are equal to the body weight of the insect. It remains uncertain whether this small advantage in total efficiency during hovering flight was shaped by evolutionary factors or results from functional constraints on both the production of mechanical power by the indirect flight muscles and the unsteady aerodynamic mechanisms in flapping flight.

Hemolymph amino acid analysis of individual Drosophila larvae.

Science.gov (United States)

Piyankarage, Sujeewa C; Augustin, Hrvoje; Grosjean, Yael; Featherstone, David E; Shippy, Scott A

2008-02-15

One of the most widely used transgenic animal models in biology is Drosophila melanogaster, the fruit fly. Chemical information from this exceedingly small organism is usually accomplished by studying populations to attain sample volumes suitable for standard analysis methods. This paper describes a direct sampling technique capable of obtaining 50-300 nL of hemolymph from individual Drosophila larvae. Hemolymph sampling performed under mineral oil and in air at 30 s intervals up to 120 s after piercing larvae revealed that the effect of evaporation on amino acid concentrations is insignificant when the sample was collected within 60 s. Qualitative and quantitative amino acid analyses of obtained hemolymph were carried out in two optimized buffer conditions by capillary electrophoresis with laser-induced fluorescence detection after derivatizing with fluorescamine. Thirteen amino acids were identified from individual hemolymph samples of both wild-type (WT) control and the genderblind (gb) mutant larvae. The levels of glutamine, glutamate, and taurine in the gb hemolymph were significantly lower at 35%, 38%, and 57% of WT levels, respectively. The developed technique that samples only the hemolymph fluid is efficient and enables accurate organism-level chemical information while minimizing errors associated with possible sample contaminations, estimations, and effects of evaporation compared to the traditional hemolymph-sampling techniques.

Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

Directory of Open Access Journals (Sweden)

Sha Lu

Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

Patterns of mutation and selection at synonymous sites in Drosophila

DEFF Research Database (Denmark)

Singh, Nadia D; Bauer DuMont, Vanessa L; Hubisz, Melissa J

2007-01-01

, when applied to 18 coding sequences in 3 species of Drosophila, confirmed an earlier report that the Notch gene in Drosophila melanogaster was evolving under selection in favor of those codons defined as unpreferred in this species. This finding opened the possibility that synonymous sites may...... be subject to a variety of selective pressures beyond weak selection for increased frequencies of the codons currently defined as "preferred" in D. melanogaster. To further explore patterns of synonymous site evolution in Drosophila in a lineage-specific manner, we expanded the application of the maximum...... likelihood framework to 8,452 protein coding sequences with well-defined orthology in D. melanogaster, Drosophila sechellia, and Drosophila yakuba. Our analyses reveal intragenomic and interspecific variation in mutational patterns as well as in patterns and intensity of selection on synonymous sites. In D...

Gendered Communication in Iranian University Classrooms: The Relationship between Politeness and Silence in Persian Culture

Directory of Open Access Journals (Sweden)

Saeedeh Shafiee Nahrkhalaji

2013-05-01

Full Text Available This study examined naturally-occurring university classroominteractions at Iranian universities and provided an analysis ofsilence patterns as politeness strategies used by male andfemale students. Since empirical studies of silence inclassroom settings are scarce, this paper aimed to explainsuch phenomena using participant interviews, classroomobservation and detailed discourse analysis of classroominteraction. Silence patterns and their interpretations werescrutinized in these observations and were discussed inrelation to specific conceptualization of politeness anddevices employed to exercise it. The study found that femalesseem to be the most silent in the cross-sex classrooms, whilethe distribution of silence is more nearly equal in the same sexclassrooms. Based on the comments from follow-upinterviews, reasons for intentional silence as a politenessstrategy were categorized into four groups: silence as a face savingstrategy, silence as a ‘don’t do the FTA’ strategy,silence as a power strategy, and silence as an off-recordstrategy.

Evolution of genes and genomes on the Drosophila phylogeny

DEFF Research Database (Denmark)

Clark, Andrew G; Eisen, Michael B; Smith, Douglas R

2007-01-01

Comparative analysis of multiple genomes in a phylogenetic framework dramatically improves the precision and sensitivity of evolutionary inference, producing more robust results than single-genome analyses can provide. The genomes of 12 Drosophila species, ten of which are presented here for the ......Comparative analysis of multiple genomes in a phylogenetic framework dramatically improves the precision and sensitivity of evolutionary inference, producing more robust results than single-genome analyses can provide. The genomes of 12 Drosophila species, ten of which are presented here...... tools that have made Drosophila melanogaster a pre-eminent model for animal genetics, and will further catalyse fundamental research on mechanisms of development, cell biology, genetics, disease, neurobiology, behaviour, physiology and evolution. Despite remarkable similarities among these Drosophila...

Communicative Silences: Forms and Functions

Science.gov (United States)

Bruneau, Thomas J.

1973-01-01

The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)

Nematocytes: Discovery and characterization of a novel anculeate hemocyte in Drosophila falleni and Drosophila phalerata.

Directory of Open Access Journals (Sweden)

Julianna Bozler

Full Text Available Immune challenges, such as parasitism, can be so pervasive and deleterious that they constitute an existential threat to a species' survival. In response to these ecological pressures, organisms have developed a wide array of novel behavioral, cellular, and molecular adaptations. Research into these immune defenses in model systems has resulted in a revolutionary understanding of evolution and functional biology. As the field has expanded beyond the limited number of model organisms our appreciation of evolutionary innovation and unique biology has widened as well. With this in mind, we have surveyed the hemolymph of several non-model species of Drosophila. Here we identify and describe a novel hemocyte, type-II nematocytes, found in larval stages of numerous Drosophila species. Examined in detail in Drosophila falleni and Drosophila phalerata, we find that these remarkable cells are distinct from previously described hemocytes due to their anucleate state (lacking a nucleus and unusual morphology. Type-II nematocytes are long, narrow cells with spindle-like projections extending from a cell body with high densities of mitochondria and microtubules, and exhibit the ability to synthesize proteins. These properties are unexpected for enucleated cells, and together with our additional characterization, we demonstrate that these type-II nematocytes represent a biological novelty. Surprisingly, despite the absence of a nucleus, we observe through live cell imaging that these cells remain motile with a highly dynamic cellular shape. Furthermore, these cells demonstrate the ability to form multicellular structures, which we suggest may be a component of the innate immune response to macro-parasites. In addition, live cell imaging points to a large nucleated hemocyte, type-I nematocyte, as the progenitor cell, leading to enucleation through a budding or asymmetrical division process rather than nuclear ejection: This study is the first to report such a

Interorgan Communication Pathways in Physiology: Focus on Drosophila.

Science.gov (United States)

Droujinine, Ilia A; Perrimon, Norbert

2016-11-23

Studies in mammals and Drosophila have demonstrated the existence and significance of secreted factors involved in communication between distal organs. In this review, primarily focusing on Drosophila, we examine the known interorgan communication factors and their functions, physiological inducers, and integration in regulating physiology. Moreover, we describe how organ-sensing screens in Drosophila can systematically identify novel conserved interorgan communication factors. Finally, we discuss how interorgan communication enabled and evolved as a result of specialization of organs. Together, we anticipate that future studies will establish a model for metazoan interorgan communication network (ICN) and how it is deregulated in disease.

Argonaute: The executor of small RNA function.

Science.gov (United States)

Azlan, Azali; Dzaki, Najat; Azzam, Ghows

2016-08-20

The discovery of small non-coding RNAs - microRNA (miRNA), short interfering RNA (siRNA) and PIWI-interacting RNA (piRNA) - represents one of the most exciting frontiers in biology specifically on the mechanism of gene regulation. In order to execute their functions, these small RNAs require physical interactions with their protein partners, the Argonaute (AGO) family proteins. Over the years, numerous studies have made tremendous progress on understanding the roles of AGO in gene silencing in various organisms. In this review, we summarize recent progress of AGO-mediated gene silencing and other cellular processes in which AGO proteins have been implicated with a particular focus on progress made in flies, humans and other model organisms as compliment. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

ORGANIZATIONAL SILENCE: SUATU PENGHAMBAT DALAM MEWUJUDKAN KREATIFITAS ORGANISASIONAL

Directory of Open Access Journals (Sweden)

Berta Bekti Retnawati

2016-11-01

Full Text Available There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and system of an organization. Keywords: organizational silence, organizational creativity

The Gift of Silence

Science.gov (United States)

Haskins, Cathleen

2011-01-01

Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…

Genomic and karyotypic variation in Drosophila parasitoids (Hymenoptera, Cynipoidea, Figitidae

Directory of Open Access Journals (Sweden)

Vladimir Gokhman

2011-08-01

Full Text Available Drosophila melanogaster Meigen, 1830 has served as a model insect for over a century. Sequencing of the 11 additional Drosophila Fallen, 1823 species marks substantial progress in comparative genomics of this genus. By comparison, practically nothing is known about the genome size or genome sequences of parasitic wasps of Drosophila. Here, we present the first comparative analysis of genome size and karyotype structures of Drosophila parasitoids of the Leptopilina Förster, 1869 and Ganaspis Förster, 1869 species. The gametic genome size of Ganaspis xanthopoda (Ashmead, 1896 is larger than those of the three Leptopilina species studied. The genome sizes of all parasitic wasps studied here are also larger than those known for all Drosophila species. Surprisingly, genome sizes of these Drosophila parasitoids exceed the average value known for all previously studied Hymenoptera. The haploid chromosome number of both Leptopilina heterotoma (Thomson, 1862 and L. victoriae Nordlander, 1980 is ten. A chromosomal fusion appears to have produced a distinct karyotype for L. boulardi (Barbotin, Carton et Keiner-Pillault, 1979 (n = 9, whose genome size is smaller than that of wasps of the L. heterotoma clade. Like L. boulardi, the haploid chromosome number for G. xanthopoda is also nine. Our studies reveal a positive, but non linear, correlation between the genome size and total chromosome length in Drosophila parasitoids. These Drosophila parasitoids differ widely in their host range, and utilize different infection strategies to overcome host defense. Their comparative genomics, in relation to their exceptionally well-characterized hosts, will prove to be valuable for understanding the molecular basis of the host-parasite arms race and how such mechanisms shape the genetic structures of insect communities.

Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

Directory of Open Access Journals (Sweden)

Néstor García

2017-12-01

Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

Strategies underlying RNA silencing suppression by negative strand RNA viruses

NARCIS (Netherlands)

Hemmes, J.C.

2007-01-01

The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

Le silence, ce cri qui résonne dans l’écriture de Viviane Forrester

Directory of Open Access Journals (Sweden)

Amelia Peral Crespo

2015-11-01

Full Text Available The Holocaust Literature is tied to Silence from its beginning as the writing to silence. Write about the Holocaust and relate the experiences lived in first person or transmit them to the coming generations means leaving the silence which, for years, was the ideal refuge. This research focuses on the literary production of Viviane Forrester. The different expressions of silence that characterize her writings are analyzed. Silence is the cry that underlies in the most profound of the human being that return from the concentration camps, as Lazarus from the dead. It is a silence that grows to a cry because Forrester’s writing, almost in parallel to the fragmentary writing of Blanchot, an-nounces livre à venir, expressing the cry in silence without the ending of the word

The bacterial communities of Drosophila suzukii collected from undamaged cherries

Directory of Open Access Journals (Sweden)

James Angus Chandler

2014-07-01

Full Text Available Drosophila suzukii is an introduced pest insect that feeds on undamaged, attached fruit. This diet is distinct from the fallen, discomposing fruits utilized by most other species of Drosophila. Since the bacterial microbiota of Drosophila, and of many other animals, is affected by diet, we hypothesized that the bacteria associated with D. suzukii are distinct from that of other Drosophila. Using 16S rDNA PCR and Illumina sequencing, we characterized the bacterial communities of larval and adult D. suzukii collected from undamaged, attached cherries in California, USA. We find that the bacterial communities associated with these samples of D. suzukii contain a high frequency of Tatumella. Gluconobacter and Acetobacter, two taxa with known associations with Drosophila, were also found, although at lower frequency than Tatumella in four of the five samples examined. Sampling D. suzukii from different locations and/or while feeding on different fruits is needed to determine the generality of the results determined by these samples. Nevertheless this is, to our knowledge, the first study characterizing the bacterial communities of this ecologically unique and economically important species of Drosophila.

Maximum likelihood estimation of ancestral codon usage bias parameters in Drosophila

DEFF Research Database (Denmark)

Nielsen, Rasmus; Bauer DuMont, Vanessa L; Hubisz, Melissa J

2007-01-01

: the selection coefficient for optimal codon usage (S), allowing joint maximum likelihood estimation of S and the dN/dS ratio. We apply the method to previously published data from Drosophila melanogaster, Drosophila simulans, and Drosophila yakuba and show, in accordance with previous results, that the D...

HMGA1 silencing reduces stemness and temozolomide resistance in glioblastoma stem cells.

Science.gov (United States)

Colamaio, Marianna; Tosti, Nadia; Puca, Francesca; Mari, Alessia; Gattordo, Rosaria; Kuzay, Yalçın; Federico, Antonella; Pepe, Anna; Sarnataro, Daniela; Ragozzino, Elvira; Raia, Maddalena; Hirata, Hidenari; Gemei, Marica; Mimori, Koshi; Del Vecchio, Luigi; Battista, Sabrina; Fusco, Alfredo

2016-10-01

Glioblastoma multiforme (GBM) develops from a small subpopulation of stem-like cells, which are endowed with the ability to self-renew, proliferate and give rise to progeny of multiple neuroepithelial lineages. These cells are resistant to conventional chemo- and radiotherapy and are hence also responsible for tumor recurrence. HMGA1 overexpression has been shown to correlate with proliferation, invasion, and angiogenesis of GBMs and to affect self-renewal of cancer stem cells from colon cancer. The role of HMGA1 in GBM tumor stem cells is not completely understood. We have investigated the role of HMGA1 in brain tumor stem cell (BTSC) self-renewal, stemness and resistance to temozolomide by shRNA- mediated HMGA1 silencing. We first report that HMGA1 is overexpressed in a subset of BTSC lines from human GBMs. Then, we show that HMGA1 knockdown reduces self-renewal, sphere forming efficiency and stemness, and sensitizes BTSCs to temozolomide. Interestingly, HMGA1 silencing also leads to reduced tumor initiation ability in vivo. These results demonstrate a pivotal role of HMGA1 in cancer stem cell gliomagenesis and endorse HMGA1 as a suitable target for CSC-specific GBM therapy.

Functional Gustatory Role of Chemoreceptors in Drosophila Wings.

Science.gov (United States)

Raad, Hussein; Ferveur, Jean-François; Ledger, Neil; Capovilla, Maria; Robichon, Alain

2016-05-17

Neuroanatomical evidence argues for the presence of taste sensilla in Drosophila wings; however, the taste physiology of insect wings remains hypothetical, and a comprehensive link to mechanical functions, such as flight, wing flapping, and grooming, is lacking. Our data show that the sensilla of the Drosophila anterior wing margin respond to both sweet and bitter molecules through an increase in cytosolic Ca(2+) levels. Conversely, genetically modified flies presenting a wing-specific reduction in chemosensory cells show severe defects in both wing taste signaling and the exploratory guidance associated with chemodetection. In Drosophila, the chemodetection machinery includes mechanical grooming, which facilitates the contact between tastants and wing chemoreceptors, and the vibrations of flapping wings that nebulize volatile molecules as carboxylic acids. Together, these data demonstrate that the Drosophila wing chemosensory sensilla are a functional taste organ and that they may have a role in the exploration of ecological niches. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Induction of the early-late Ddc gene during Drosophila metamorphosis by the ecdysone receptor.

Science.gov (United States)

Chen, Li; Reece, Christian; O'Keefe, Sandra L; Hawryluk, Gregory W L; Engstrom, Monica M; Hodgetts, Ross B

2002-06-01

During Drosophila metamorphosis, the 'early-late' genes constitute a unique class regulated by the steroid hormone 20-hydroxyecdysone. Their induction is comprised of both a primary and a secondary response to ecdysone. Previous work has suggested that the epidermal expression of the dopa decarboxylase gene (Ddc) is likely that of a typical early-late gene. Accumulation of the Ddc transcript is rapidly initiated in the absence of protein synthesis, which implies that the ecdysone receptor plays a direct role in induction. However, full Ddc expression requires the participation of one of the transcription factors encoded by the Broad-Complex. In this paper, we characterize an ecdysone response element (EcRE) that contributes to the primary response. Using gel mobility shift assays and transgenic assays, we identified a single functional EcRE, located at position -97 to -83 bp relative to the transcription initiation site. This is the first report of an EcRE associated with an early-late gene in Drosophila. Competition experiments indicated that the affinity of the Ddc EcRE for the ecdysone receptor complex was at least four-fold less than that of the canonical EcRE of the hsp27 gene. Using in vitro mutagenesis, we determined that the reduced affinity of the EcRE resided at two positions where the nucleotides differed from those found in the canonical sequence. The ecdysone receptor, acting through this EcRE, releases Ddc from a silencing mechanism, whose cis-acting domain we have mapped to the 5'-upstream region between -2067 and -1427 bp. Deletion of this repressive element resulted in precocious expression of Ddc in both epidermis and imaginal discs. Thus, epidermal Ddc induction at pupariation is under the control of an extended genomic region that contains both positive and negative regulatory elements. Copyright 2002 Elsevier Science Ireland Ltd.

Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.

Science.gov (United States)

Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand

2011-05-01

There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.

Targeted transfection increases siRNA uptake and gene silencing of primary endothelial cells in vitro--a quantitative study.

Science.gov (United States)

Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje

2010-01-25

Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.

Modelling Cooperative Tumorigenesis in Drosophila

Science.gov (United States)

2018-01-01

The development of human metastatic cancer is a multistep process, involving the acquisition of several genetic mutations, tumour heterogeneity, and interactions with the surrounding microenvironment. Due to the complexity of cancer development in mammals, simpler model organisms, such as the vinegar fly, Drosophila melanogaster, are being utilized to provide novel insights into the molecular mechanisms involved. In this review, we highlight recent advances in modelling tumorigenesis using the Drosophila model, focusing on the cooperation of oncogenes or tumour suppressors, and the interaction of mutant cells with the surrounding tissue in epithelial tumour initiation and progression. PMID:29693007

Modelling Cooperative Tumorigenesis in Drosophila

Directory of Open Access Journals (Sweden)

Helena E. Richardson

2018-01-01

Full Text Available The development of human metastatic cancer is a multistep process, involving the acquisition of several genetic mutations, tumour heterogeneity, and interactions with the surrounding microenvironment. Due to the complexity of cancer development in mammals, simpler model organisms, such as the vinegar fly, Drosophila melanogaster, are being utilized to provide novel insights into the molecular mechanisms involved. In this review, we highlight recent advances in modelling tumorigenesis using the Drosophila model, focusing on the cooperation of oncogenes or tumour suppressors, and the interaction of mutant cells with the surrounding tissue in epithelial tumour initiation and progression.

Super Resolution Imaging of Genetically Labeled Synapses in Drosophila Brain Tissue.

Science.gov (United States)

Spühler, Isabelle A; Conley, Gaurasundar M; Scheffold, Frank; Sprecher, Simon G

2016-01-01

Understanding synaptic connectivity and plasticity within brain circuits and their relationship to learning and behavior is a fundamental quest in neuroscience. Visualizing the fine details of synapses using optical microscopy remains however a major technical challenge. Super resolution microscopy opens the possibility to reveal molecular features of synapses beyond the diffraction limit. With direct stochastic optical reconstruction microscopy, dSTORM, we image synaptic proteins in the brain tissue of the fruit fly, Drosophila melanogaster. Super resolution imaging of brain tissue harbors difficulties due to light scattering and the density of signals. In order to reduce out of focus signal, we take advantage of the genetic tools available in the Drosophila and have fluorescently tagged synaptic proteins expressed in only a small number of neurons. These neurons form synapses within the calyx of the mushroom body, a distinct brain region involved in associative memory formation. Our results show that super resolution microscopy, in combination with genetically labeled synaptic proteins, is a powerful tool to investigate synapses in a quantitative fashion providing an entry point for studies on synaptic plasticity during learning and memory formation.

Inverse regulation of two classic Hippo pathway target genes in Drosophila by the dimerization hub protein Ctp.

Science.gov (United States)

Barron, Daniel A; Moberg, Kenneth

2016-03-14

The LC8 family of small ~8 kD proteins are highly conserved and interact with multiple protein partners in eukaryotic cells. LC8-binding modulates target protein activity, often through induced dimerization via LC8:LC8 homodimers. Although many LC8-interactors have roles in signaling cascades, LC8's role in developing epithelia is poorly understood. Using the Drosophila wing as a developmental model, we find that the LC8 family member Cut up (Ctp) is primarily required to promote epithelial growth, which correlates with effects on the pro-growth factor dMyc and two genes, diap1 and bantam, that are classic targets of the Hippo pathway coactivator Yorkie. Genetic tests confirm that Ctp supports Yorkie-driven tissue overgrowth and indicate that Ctp acts through Yorkie to control bantam (ban) and diap1 transcription. Quite unexpectedly however, Ctp loss has inverse effects on ban and diap1: it elevates ban expression but reduces diap1 expression. In both cases these transcriptional changes map to small segments of these promoters that recruit Yorkie. Although LC8 complexes with Yap1, a Yorkie homolog, in human cells, an orthologous interaction was not detected in Drosophila cells. Collectively these findings reveal that that Drosophila Ctp is a required regulator of Yorkie-target genes in vivo and suggest that Ctp may interact with a Hippo pathway protein(s) to exert inverse transcriptional effects on Yorkie-target genes.

Low-resolution structure of Drosophila translin

Science.gov (United States)

Kumar, Vinay; Gupta, Gagan D.

2012-01-01

Crystals of native Drosophila melanogaster translin diffracted to 7 Å resolution. Reductive methylation of the protein improved crystal quality. The native and methylated proteins showed similar profiles in size-exclusion chromatography analyses but the methylated protein displayed reduced DNA-binding activity. Crystals of the methylated protein diffracted to 4.2 Å resolution at BM14 of the ESRF synchrotron. Crystals with 49% solvent content belonged to monoclinic space group P21 with eight protomers in the asymmetric unit. Only 2% of low-resolution structures with similar low percentage solvent content were found in the PDB. The crystal structure, solved by molecular replacement method, refined to Rwork (Rfree) of 0.24 (0.29) with excellent stereochemistry. The crystal structure clearly shows that drosophila protein exists as an octamer, and not as a decamer as expected from gel-filtration elution profiles. The similar octameric quaternary fold in translin orthologs and in translin–TRAX complexes suggests an up-down dimer as the basic structural subunit of translin-like proteins. The drosophila oligomer displays asymmetric assembly and increased radius of gyration that accounts for the observed differences between the elution profiles of human and drosophila proteins on gel-filtration columns. This study demonstrates clearly that low-resolution X-ray structure can be useful in understanding complex biological oligomers. PMID:23650579

Efficient identification of Y chromosome sequences in the human and Drosophila genomes

Science.gov (United States)

Carvalho, Antonio Bernardo; Clark, Andrew G.

2013-01-01

Notwithstanding their biological importance, Y chromosomes remain poorly known in most species. A major obstacle to their study is the identification of Y chromosome sequences; due to its high content of repetitive DNA, in most genome projects, the Y chromosome sequence is fragmented into a large number of small, unmapped scaffolds. Identification of Y-linked genes among these fragments has yielded important insights about the origin and evolution of Y chromosomes, but the process is labor intensive, restricting studies to a small number of species. Apart from these fragmentary assemblies, in a few mammalian species, the euchromatic sequence of the Y is essentially complete, owing to painstaking BAC mapping and sequencing. Here we use female short-read sequencing and k-mer comparison to identify Y-linked sequences in two very different genomes, Drosophila virilis and human. Using this method, essentially all D. virilis scaffolds were unambiguously classified as Y-linked or not Y-linked. We found 800 new scaffolds (totaling 8.5 Mbp), and four new genes in the Y chromosome of D. virilis, including JYalpha, a gene involved in hybrid male sterility. Our results also strongly support the preponderance of gene gains over gene losses in the evolution of the Drosophila Y. In the intensively studied human genome, used here as a positive control, we recovered all previously known genes or gene families, plus a small amount (283 kb) of new, unfinished sequence. Hence, this method works in large and complex genomes and can be applied to any species with sex chromosomes. PMID:23921660

Efficient identification of Y chromosome sequences in the human and Drosophila genomes.

Science.gov (United States)

Carvalho, Antonio Bernardo; Clark, Andrew G

2013-11-01

Notwithstanding their biological importance, Y chromosomes remain poorly known in most species. A major obstacle to their study is the identification of Y chromosome sequences; due to its high content of repetitive DNA, in most genome projects, the Y chromosome sequence is fragmented into a large number of small, unmapped scaffolds. Identification of Y-linked genes among these fragments has yielded important insights about the origin and evolution of Y chromosomes, but the process is labor intensive, restricting studies to a small number of species. Apart from these fragmentary assemblies, in a few mammalian species, the euchromatic sequence of the Y is essentially complete, owing to painstaking BAC mapping and sequencing. Here we use female short-read sequencing and k-mer comparison to identify Y-linked sequences in two very different genomes, Drosophila virilis and human. Using this method, essentially all D. virilis scaffolds were unambiguously classified as Y-linked or not Y-linked. We found 800 new scaffolds (totaling 8.5 Mbp), and four new genes in the Y chromosome of D. virilis, including JYalpha, a gene involved in hybrid male sterility. Our results also strongly support the preponderance of gene gains over gene losses in the evolution of the Drosophila Y. In the intensively studied human genome, used here as a positive control, we recovered all previously known genes or gene families, plus a small amount (283 kb) of new, unfinished sequence. Hence, this method works in large and complex genomes and can be applied to any species with sex chromosomes.

Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus.

Science.gov (United States)

Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong

2017-09-26

Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.

Giving Voice: Narrating silence, history and memory in André Brink ...

African Journals Online (AJOL)

Giving Voice: Narrating silence, history and memory in André Brink\\'s The Other Side of Silence and Before I Forget. ... Both narrators, though, draw attention to the problems associated with this reconstructive and potentially ... Article Metrics.

Transposable Element Misregulation Is Linked to the Divergence between Parental piRNA Pathways in Drosophila Hybrids.

Science.gov (United States)

Romero-Soriano, Valèria; Modolo, Laurent; Lopez-Maestre, Hélène; Mugat, Bruno; Pessia, Eugénie; Chambeyron, Séverine; Vieira, Cristina; Garcia Guerreiro, Maria Pilar

2017-06-01

Interspecific hybridization is a genomic stress condition that leads to the activation of transposable elements (TEs) in both animals and plants. In hybrids between Drosophila buzzatii and Drosophila koepferae, mobilization of at least 28 TEs has been described. However, the molecular mechanisms underlying this TE release remain poorly understood. To give insight on the causes of this TE activation, we performed a TE transcriptomic analysis in ovaries (notorious for playing a major role in TE silencing) of parental species and their F1 and backcrossed (BC) hybrids. We find that 15.2% and 10.6% of the expressed TEs are deregulated in F1 and BC1 ovaries, respectively, with a bias toward overexpression in both cases. Although differences between parental piRNA (Piwi-interacting RNA) populations explain only partially these results, we demonstrate that piRNA pathway proteins have divergent sequences and are differentially expressed between parental species. Thus, a functional divergence of the piRNA pathway between parental species, together with some differences between their piRNA pools, might be at the origin of hybrid instabilities and ultimately cause TE misregulation in ovaries. These analyses were complemented with the study of F1 testes, where TEs tend to be less expressed than in D. buzzatii. This can be explained by an increase in piRNA production, which probably acts as a defence mechanism against TE instability in the male germline. Hence, we describe a differential impact of interspecific hybridization in testes and ovaries, which reveals that TE expression and regulation are sex-biased. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

AF-6 Protects Against Dopaminergic Dysfunction and Mitochondrial Abnormalities in Drosophila Models of Parkinson’s Disease

Directory of Open Access Journals (Sweden)

Adeline H. Basil

2017-08-01

Full Text Available Afadin 6 (AF-6 is an F-actin binding multidomain-containing scaffolding protein that is known for its function in cell-cell adhesion. Interestingly, besides this well documented role, we recently found that AF-6 is a Parkin-interacting protein that augments Parkin/PINK1-mediated mitophagy. Notably, mutations in Parkin and PINK1 are causative of recessively inherited forms of Parkinson’s disease (PD and aberrant mitochondrial homeostasis is thought to underlie PD pathogenesis. Given the novel role of AF-6 in mitochondrial quality control (QC, we hypothesized that AF-6 overexpression may be beneficial to PD. Using the Drosophila melanogaster as a model system, we demonstrate in this study that transgenic overexpression of human AF-6 in parkin and also pink1 null flies rescues their mitochondrial pathology and associated locomotion deficit, which results in their improved survival over time. Similarly, AF-6 overexpression also ameliorates the pathological phenotypes in flies expressing the Leucine Rich Repeat Kinase 2 (LRRK2 G2019S mutant, a mutation that is associated with dominantly-inherited PD cases in humans. Conversely, when endogenous AF-6 expression is silenced, it aggravates the disease phenotypes of LRRK2 mutant flies. Aside from these genetic models, we also found that AF-6 overexpression is protective against the loss of dopaminergic neurons in flies treated with rotenone, a mitochondrial complex I inhibitor commonly used to generate animal models of PD. Taken together, our results demonstrate that AF-6 protects against dopaminergic dysfunction and mitochondrial abnormalities in multiple Drosophila models of PD, and suggest the therapeutic value of AF-6-related pathways in mitigating PD pathogenesis.

Self-Silencing, Emotional Awareness, and Eating Behaviors in College Women

Science.gov (United States)

Shouse, Sarah H.; Nilsson, Johanna

2011-01-01

Self-silencing (or the suppression of expressing one's thoughts, feelings, and needs) can have a negative impact on the mental health of women, from depression to disordered eating behaviors. The authors examined the relationship between self-silencing and disordered eating as well as intuitive eating. The authors also explored whether emotional…

Generation of genome-modified Drosophila cell lines using SwAP.

Science.gov (United States)

Franz, Alexandra; Brunner, Erich; Basler, Konrad

2017-10-02

The ease of generating genetically modified animals and cell lines has been markedly increased by the recent development of the versatile CRISPR/Cas9 tool. However, while the isolation of isogenic cell populations is usually straightforward for mammalian cell lines, the generation of clonal Drosophila cell lines has remained a longstanding challenge, hampered by the difficulty of getting Drosophila cells to grow at low densities. Here, we describe a highly efficient workflow to generate clonal Cas9-engineered Drosophila cell lines using a combination of cell pools, limiting dilution in conditioned medium and PCR with allele-specific primers, enabling the efficient selection of a clonal cell line with a suitable mutation profile. We validate the protocol by documenting the isolation, selection and verification of eight independently Cas9-edited armadillo mutant Drosophila cell lines. Our method provides a powerful and simple workflow that improves the utility of Drosophila cells for genetic studies with CRISPR/Cas9.

RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells

Directory of Open Access Journals (Sweden)

Liu X

2016-04-01

Full Text Available Xiaoxia Liu, Guiling Sun, Xiuju Sun Department of Nephrology, Affiliated Hospital of Weifang Medical University, Weifang, People’s Republic of China Abstract: This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP gene on renal cell cancer (RCC cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05. The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial

L’architecture du silence de la Shoah dans les fictions de Sylvie Germain

Directory of Open Access Journals (Sweden)

José Luis Arráez Llobregat

2015-11-01

Full Text Available Silences concerning the Shoah constitute a leitmotiv in Sylvie Germain’s narrative work. Motive and motivation intentionally emerge as a proteiform phenomenon from the writer-philosopher’s genius and from the historical and ideological substance, which imbue the novelist in every sec-tion of her literary creation. The pur-pose of this study is to interpret those silences in a set of selected novels where the Shoah takes up either a primary or a secondary role, but in any case a relevant one. To this end this study carries out a detailed study of the silence coming from the narrator’s origin, the victims, the murderers or God. Beyond the silence in humans and supreme beings, this study also investigates the spatial silence in that apocalyptic world.

Cancer in Drosophila

DEFF Research Database (Denmark)

Herranz, Héctor; Eichenlaub, Teresa; Cohen, Stephen M

2016-01-01

Cancer genomics has greatly increased our understanding of the complexity of the genetic and epigenetic changes found in human tumors. Understanding the functional relationships among these elements calls for the use of flexible genetic models. We discuss the use of Drosophila models to study...

Precedents and consequences of prosocial behaviors of voice and silence

Directory of Open Access Journals (Sweden)

Alicia Omar

2015-09-01

Full Text Available Prosocial behavior is that which that encourages solidarity and harmony in interpersonal relationships, and produce personal or collective benefits. Although early research on job prosociality was focused on the study of conventional behaviors such as help, courtesy and sportsmanship, the identification and operationalization of new dimensions is rapidly expanding this nomological network. Such is the case of prosocial voice and prosocial silence, recently introduced in the scientific literature. The aim of this study is to explore possible relationships between employee’s voice and employee’s silence, and their personality structure; and examine the role of interpersonal justice perceptions on such relationships. We worked with a sample of 316 employees- aged 37 years and holding a 4.2-year signority working at public and private companies in southern and central Rosario (Argentina. The subjects completed Colquitt’ Justice Organizational Scale, Eysenck Personality Questionnaire, and Van Dyne’s Prosocial Voice and Prosocial Silence Scales. Extraversion and neuroticism emerged as the strongest predictors of prosocial voice and prosocial silence, respectively. Interpersonal justice perceptions emerged as moderators of the ‘natural’ tendency of extraverted workers to engage in prosocial voice, and emotionally controlled workers to engage in prosocial silence. Such findings would indicate that the promotion of high levels of interpersonal justice on job contexts could help workers to engage in more prosocial behavior with positive effects for the organization. 

Role of transposon-derived small RNAs in the interplay between genomes and parasitic DNA in rice.

Directory of Open Access Journals (Sweden)

Misuzu Nosaka

2012-09-01

Full Text Available RNA silencing is a defense system against "genomic parasites" such as transposable elements (TE, which are potentially harmful to host genomes. In plants, transcripts from TEs induce production of double-stranded RNAs (dsRNAs and are processed into small RNAs (small interfering RNAs, siRNAs that suppress TEs by RNA-directed DNA methylation. Thus, the majority of TEs are epigenetically silenced. On the other hand, most of the eukaryotic genome is composed of TEs and their remnants, suggesting that TEs have evolved countermeasures against host-mediated silencing. Under some circumstances, TEs can become active and increase in copy number. Knowledge is accumulating on the mechanisms of TE silencing by the host; however, the mechanisms by which TEs counteract silencing are poorly understood. Here, we show that a class of TEs in rice produces a microRNA (miRNA to suppress host silencing. Members of the microRNA820 (miR820 gene family are located within CACTA DNA transposons in rice and target a de novo DNA methyltransferase gene, OsDRM2, one of the components of epigenetic silencing. We confirmed that miR820 negatively regulates the expression of OsDRM2. In addition, we found that expression levels of various TEs are increased quite sensitively in response to decreased OsDRM2 expression and DNA methylation at TE loci. Furthermore, we found that the nucleotide sequence of miR820 and its recognition site within the target gene in some Oryza species have co-evolved to maintain their base-pairing ability. The co-evolution of these sequences provides evidence for the functionality of this regulation. Our results demonstrate how parasitic elements in the genome escape the host's defense machinery. Furthermore, our analysis of the regulation of OsDRM2 by miR820 sheds light on the action of transposon-derived small RNAs, not only as a defense mechanism for host genomes but also as a regulator of interactions between hosts and their parasitic elements.

RELATIONSHIP BETWEEN AFFECTIVE COMMITMENT ANDORGANIZATIONAL SILENCE: A CONCEPTUAL DISCUSSION

Directory of Open Access Journals (Sweden)

Fitnat Nazlı Sayğan

2011-07-01

Full Text Available In this study, the affective commitment that is oneof the components oforganizational commitment put forth by Allen and Meyer (Allen, Meyer 1996will be differentiated from the other commitment components. The importance ofcreating an emotional commitment to organizations will be examined and theorganizational factors needed to form organizational commitment will beinvestigated. Also, organizational silence is a situation that the company avoided.In the study, the reasons and the drawbacks of silence are focused on and thefactors that cause employees to remain silent are discussed.The aim of this study is intended to manifest the relationship of ‘organizationalsilence' with affective commitment’ which is one ofthe components of‘organizational commitment’ on the basis of literature. In this study, a negativecorrelation between affective commitment and organizational silence is suggested

The dopaminergic system in the aging brain of Drosophila

Directory of Open Access Journals (Sweden)

Katherine E White

2010-12-01

Full Text Available Drosophila models of Parkinson’s disease are characterised by two principal phenotypes: the specific loss of dopaminergic neurons in the aging brain and defects in motor behavior. However, an age-related analysis of these baseline parameters in wildtype Drosophila is lacking. Here we analysed the dopaminergic system and motor behavior in aging Drosophila. Dopaminergic neurons in the adult brain can be grouped into bilateral symmetric clusters, each comprising a stereotypical number of cells. Analysis of TH>mCD8::GFP and cell type-specific MARCM clones revealed that dopaminergic neurons show cluster-specific, stereotypical projection patterns with terminal arborization in target regions that represent distinct functional areas of the adult brain. Target areas include the mushroom bodies, involved in memory formation and motivation, and the central complex, involved in the control of motor behavior, indicating that similar to the mammalian brain, dopaminergic neurons in the fly brain are involved in the regulation of specific behaviors. Behavioral analysis revealed that Drosophila show an age-related decline in startle-induced locomotion and negative geotaxis. Motion tracking however, revealed that walking activity and exploration behavior, but not centrophobism increase at late stages of life. Analysis of TH>Dcr2, mCD8::GFP revealed a specific effect of Dcr2 expression on walking activity but not on exploratory or centrophobic behavior, indicating that the siRNA pathway may modulate distinct dopaminergic behaviors in Drosophila. Moreover, dopaminergic neurons were maintained between early- and late life, as quantified by TH>mCD8::GFP and anti-TH labelling, indicating that adult onset, age-related degeneration of dopaminergic neurons does not occur in the aging brain of Drosophila. Taken together, our data establish baseline parameters in Drosophila for the study of Parkinson’s disease as well as other disorders affecting dopaminergic neurons

AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

Science.gov (United States)

Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

2013-05-01

AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

Gas turbine exhaust system silencing design

International Nuclear Information System (INIS)

Ozgur, D.

1991-01-01

Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting

Research progress on Drosophila visual cognition in China

Institute of Scientific and Technical Information of China (English)

无

2010-01-01

Visual cognition,as one of the fundamental aspects of cognitive neuroscience,is generally associated with high-order brain functions in animals and human.Drosophila,as a model organism,shares certain features of visual cognition in common with mammals at the genetic,molecular,cellular,and even higher behavioral levels.From learning and memory to decision making,Drosophila covers a broad spectrum of higher cognitive behaviors beyond what we had expected.Armed with powerful tools of genetic manipulation in Drosophila,an increasing number of studies have been conducted in order to elucidate the neural circuit mechanisms underlying these cognitive behaviors from a genes-brain-behavior perspective.The goal of this review is to integrate the most important studies on visual cognition in Drosophila carried out in mainland China during the last decade into a body of knowledge encompassing both the basic neural operations and circuitry of higher brain function in Drosophila.Here,we consider a series of the higher cognitive behaviors beyond learning and memory,such as visual pattern recognition,feature and context generalization,different feature memory traces,salience-based decision,attention-like behavior,and cross-modal leaning and memory.We discuss the possible general gain-gating mechanism implementing by dopamine-mushroom body circuit in fly’s visual cognition.We hope that our brief review on this aspect will inspire further study on visual cognition in flies,or even beyond.

Research progress on Drosophila visual cognition in China.

Science.gov (United States)

Guo, AiKe; Zhang, Ke; Peng, YueQin; Xi, Wang

2010-03-01

Visual cognition, as one of the fundamental aspects of cognitive neuroscience, is generally associated with high-order brain functions in animals and human. Drosophila, as a model organism, shares certain features of visual cognition in common with mammals at the genetic, molecular, cellular, and even higher behavioral levels. From learning and memory to decision making, Drosophila covers a broad spectrum of higher cognitive behaviors beyond what we had expected. Armed with powerful tools of genetic manipulation in Drosophila, an increasing number of studies have been conducted in order to elucidate the neural circuit mechanisms underlying these cognitive behaviors from a genes-brain-behavior perspective. The goal of this review is to integrate the most important studies on visual cognition in Drosophila carried out in mainland China during the last decade into a body of knowledge encompassing both the basic neural operations and circuitry of higher brain function in Drosophila. Here, we consider a series of the higher cognitive behaviors beyond learning and memory, such as visual pattern recognition, feature and context generalization, different feature memory traces, salience-based decision, attention-like behavior, and cross-modal leaning and memory. We discuss the possible general gain-gating mechanism implementing by dopamine - mushroom body circuit in fly's visual cognition. We hope that our brief review on this aspect will inspire further study on visual cognition in flies, or even beyond.

DNA topoisomerase 1α promotes transcriptional silencing of transposable elements through DNA methylation and histone lysine 9 dimethylation in Arabidopsis.

Directory of Open Access Journals (Sweden)

Thanh Theresa Dinh

2014-07-01

Full Text Available RNA-directed DNA methylation (RdDM and histone H3 lysine 9 dimethylation (H3K9me2 are related transcriptional silencing mechanisms that target transposable elements (TEs and repeats to maintain genome stability in plants. RdDM is mediated by small and long noncoding RNAs produced by the plant-specific RNA polymerases Pol IV and Pol V, respectively. Through a chemical genetics screen with a luciferase-based DNA methylation reporter, LUCL, we found that camptothecin, a compound with anti-cancer properties that targets DNA topoisomerase 1α (TOP1α was able to de-repress LUCL by reducing its DNA methylation and H3K9me2 levels. Further studies with Arabidopsis top1α mutants showed that TOP1α silences endogenous RdDM loci by facilitating the production of Pol V-dependent long non-coding RNAs, AGONAUTE4 recruitment and H3K9me2 deposition at TEs and repeats. This study assigned a new role in epigenetic silencing to an enzyme that affects DNA topology.

Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

Science.gov (United States)

Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

2017-10-01

ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

Functional requirements driving the gene duplication in 12 Drosophila species.

Science.gov (United States)

Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

2013-08-15

Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

Science.gov (United States)

Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

2018-01-01

Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly.

Directory of Open Access Journals (Sweden)

Oliver A Zill

Full Text Available Co-evolution of transcriptional regulatory proteins and their sites of action has been often hypothesized but rarely demonstrated. Here we provide experimental evidence of such co-evolution in yeast silent chromatin, a finding that emerged from studies of hybrids formed between two closely related Saccharomyces species. A unidirectional silencing incompatibility between S. cerevisiae and S. bayanus led to a key discovery: asymmetrical complementation of divergent orthologs of the silent chromatin component Sir4. In S. cerevisiae/S. bayanus interspecies hybrids, ChIP-Seq analysis revealed a restriction against S. cerevisiae Sir4 associating with most S. bayanus silenced regions; in contrast, S. bayanus Sir4 associated with S. cerevisiae silenced loci to an even greater degree than did S. cerevisiae's own Sir4. Functional changes in silencer sequences paralleled changes in Sir4 sequence and a reduction in Sir1 family members in S. cerevisiae. Critically, species-specific silencing of the S. bayanus HMR locus could be reconstituted in S. cerevisiae by co-transfer of the S. bayanus Sir4 and Kos3 (the ancestral relative of Sir1 proteins. As Sir1/Kos3 and Sir4 bind conserved silencer-binding proteins, but not specific DNA sequences, these rapidly evolving proteins served to interpret differences in the two species' silencers presumably involving emergent features created by the regulatory proteins that bind sequences within silencers. The results presented here, and in particular the high resolution ChIP-Seq localization of the Sir4 protein, provided unanticipated insights into the mechanism of silent chromatin assembly in yeast.

The transcriptional diversity of 25 Drosophila cell lines

Energy Technology Data Exchange (ETDEWEB)

Cherbas, Lucy [Indiana Univ., Bloomington, IN (United States); Willingham, Aarron [Affymetrix Inc., Santa Clara, CA (United States); Zhang, Dayu [Indiana Univ., Bloomington, IN (United States); Yang, Li [University of Connecticut Health Center, Farmington, Connecticut (United States); Zou, Yi [Indiana Univ., Bloomington, IN (United States); Eads, Brian D. [Indiana Univ., Bloomington, IN (United States); Carlson, Joseph W. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Landolin, Jane M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Kapranov, Philipp [Affymetrix Inc., Santa Clara, CA (United States); Dumais, Jacqueline [Affymetrix Inc., Santa Clara, CA (United States); Samsonova, Anastasia [Harvard Medical School, Boston, MA (United States); Choi, Jeong-Hyeon [Indiana Univ., Bloomington, IN (United States); Roberts, Johnny [Indiana Univ., Bloomington, IN (United States); Davis, Carrie A. [Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (United States); Tang, Haixu [Indiana Univ., Bloomington, IN (United States); van Baren, Marijke J. [Washington Univ., St. Louis, MO (United States); Ghosh, Srinka [Affymetrix Inc., Santa Clara, CA (United States); Dobin, Alexander [Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (United States); Bell, Kim [Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (United States); Lin, Wei [Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (United States); Langton, Laura [Washington Univ., St. Louis, MO (United States); Duff, Michael O. [University of Connecticut Health Center, Farmington, Connecticut (United States); Tenney, Aaron E. [Washington Univ., St. Louis, MO (United States); Zaleski, Chris [Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (United States); Brent, Michael R. [Washington Univ., St. Louis, MO (United States); Hoskins, Roger A. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Kaufman, Thomas C. [Indiana University, Bloomington, Indiana (United States); Andrews, Justen [Indiana University, Bloomington, Indiana (United States); Graveley, Brenton R. [University of Connecticut Health Center, Farmington, Connecticut (United States); Perrimon, Norbert [Harvard Medical School, Boston, MA (United States); Howard Hughes Medical Institute, Boston, MA (United States); Celniker, Susan E. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Gingeras, Thomas R. [Affymetrix Inc., Santa Clara, CA (United States); Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (United States); Cherbas, Peter [Indiana Univ., Bloomington, IN (United States)

2010-12-22

Drosophila melanogaster cell lines are important resources for cell biologists. In this article, we catalog the expression of exons, genes, and unannotated transcriptional signals for 25 lines. Unannotated transcription is substantial (typically 19% of euchromatic signal). Conservatively, we identify 1405 novel transcribed regions; 684 of these appear to be new exons of neighboring, often distant, genes. Sixty-four percent of genes are expressed detectably in at least one line, but only 21% are detected in all lines. Each cell line expresses, on average, 5885 genes, including a common set of 3109. Expression levels vary over several orders of magnitude. Major signaling pathways are well represented: most differentiation pathways are ‘‘off’’ and survival/growth pathways ‘‘on.’’ Roughly 50% of the genes expressed by each line are not part of the common set, and these show considerable individuality. Thirty-one percent are expressed at a higher level in at least one cell line than in any single developmental stage, suggesting that each line is enriched for genes characteristic of small sets of cells. Most remarkable is that imaginal disc-derived lines can generally be assigned, on the basis of expression, to small territories within developing discs. These mappings reveal unexpected stability of even fine-grained spatial determination. No two cell lines show identical transcription factor expression. We conclude that each line has retained features of an individual founder cell superimposed on a common ‘‘cell line‘‘ gene expression pattern. We report the transcriptional profiles of 25 Drosophila melanogaster cell lines, principally by whole-genome tiling microarray analysis of total RNA, carried out as part of the modENCODE project. The data produced in this study add to our knowledge of the cell lines and of the Drosophila transcriptome in several ways. We summarize the expression of previously annotated genes in each of the 25

deep-orange and carnation define distinct stages in late endosomal biogenesis in Drosophila melanogaster

OpenAIRE

Sriram, V.; Krishnan, K.S.; Mayor, Satyajit

2003-01-01

Endosomal degradation is severely impaired in primary hemocytes from larvae of eye color mutants of Drosophila. Using high resolution imaging and immunofluorescence microscopy in these cells, products of eye color genes, deep-orange (dor) and carnation (car), are localized to large multivesicular Rab7-positive late endosomes containing Golgi-derived enzymes. These structures mature into small sized Dor-negative, Car-positive structures, which subsequently fuse to form tubular lysosomes. Defec...

Sex comb on midleg (Scm) is a functional link between PcG-repressive complexes in Drosophila.

Science.gov (United States)

Kang, Hyuckjoon; McElroy, Kyle A; Jung, Youngsook Lucy; Alekseyenko, Artyom A; Zee, Barry M; Park, Peter J; Kuroda, Mitzi I

2015-06-01

The Polycomb group (PcG) proteins are key regulators of development in Drosophila and are strongly implicated in human health and disease. How PcG complexes form repressive chromatin domains remains unclear. Using cross-linked affinity purifications of BioTAP-Polycomb (Pc) or BioTAP-Enhancer of zeste [E(z)], we captured all PcG-repressive complex 1 (PRC1) or PRC2 core components and Sex comb on midleg (Scm) as the only protein strongly enriched with both complexes. Although previously not linked to PRC2, we confirmed direct binding of Scm and PRC2 using recombinant protein expression and colocalization of Scm with PRC1, PRC2, and H3K27me3 in embryos and cultured cells using ChIP-seq (chromatin immunoprecipitation [ChIP] combined with deep sequencing). Furthermore, we found that RNAi knockdown of Scm and overexpression of the dominant-negative Scm-SAM (sterile α motif) domain both affected the binding pattern of E(z) on polytene chromosomes. Aberrant localization of the Scm-SAM domain in long contiguous regions on polytene chromosomes revealed its independent ability to spread on chromatin, consistent with its previously described ability to oligomerize in vitro. Pull-downs of BioTAP-Scm captured PRC1 and PRC2 and additional repressive complexes, including PhoRC, LINT, and CtBP. We propose that Scm is a key mediator connecting PRC1, PRC2, and transcriptional silencing. Combined with previous structural and genetic analyses, our results strongly suggest that Scm coordinates PcG complexes and polymerizes to produce broad domains of PcG silencing. © 2015 Kang et al.; Published by Cold Spring Harbor Laboratory Press.

High-Level Accumulation of Exogenous Small RNAs Not Affecting Endogenous Small RNA Biogenesis and Function in Plants

Institute of Scientific and Technical Information of China (English)

SHEN Wan-xia; Neil A Smith; ZHOU Chang-yong; WANG Ming-bo

2014-01-01

RNA silencing is a fundamental plant defence and gene control mechanism in plants that are directed by 20-24 nucleotide (nt) small interfering RNA (siRNA) and microRNA (miRNA). Infection of plants with viral pathogens or transformation of plants with RNA interference (RNAi) constructs is usually associated with high levels of exogenous siRNAs, but it is unclear if these siRNAs interfere with endogenous small RNA pathways and hence affect plant development. Here we provide evidence that viral satellite RNA (satRNA) infection does not affect siRNA and miRNA biogenesis or plant growth despite the extremely high level of satRNA-derived siRNAs. We generated transgenic Nicotiana benthamiana plants that no longer develop the speciifc yellowing symptoms generally associated with infection by Cucumber mosaic virus (CMV) Y-satellite RNA (Y-Sat). We then used these plants to show that CMV Y-Sat infection did not cause any visible phenotypic changes in comparison to uninfected plants, despite the presence of high-level Y-Sat siRNAs. Furthermore, we showed that the accumulation of hairpin RNA (hpRNA)-derived siRNAs or miRNAs, and the level of siRNA-directed transgene silencing, are not signiifcantly affected by CMV Y-Sat infection. Taken together, our results suggest that the high levels of exogenous siRNAs associated with viral infection or RNAi-inducing transgenes do not saturate the endogenous RNA silencing machineries and have no signiifcant impact on normal plant development.

A comparison of Frost expression among species and life stages of Drosophila.

Science.gov (United States)

Bing, X; Zhang, J; Sinclair, Brent J

2012-02-01

Frost (Fst) is a gene associated with cold exposure in Drosophila melanogaster. We used real-time PCR to assess whether cold exposure induces expression of Fst in 10 different life stages of D. melanogaster, and adults of seven other Drosophila species. We exposed groups of individuals to 0 °C (2 h), followed by 1 h recovery (22 °C). Frost was significantly upregulated in response to cold in eggs, third instar larvae, and 2- and 5-day-old male and female adults in D. melanogaster. Life stages in which cold did not upregulate Fst had high constitutive expression. Frost is located on the opposite strand of an intron of Diuretic hormone (DH), but cold exposure did not upregulate DH. Frost orthologues were identified in six other species within the Melanogaster group (Drosophila sechellia, Drosophila simulans, Drosophila yakuba, Drosophila erecta, Drosophila ananassae and Drosophila mauritiana). Frost orthologues were upregulated in response to cold exposure in both sexes in adults of all of these species. The predicted structure of a putative Frost consensus protein shows highly conserved tandem repeats of motifs involved in cell signalling (PEST and TRAF2), suggesting that Fst might encode an adaptor protein involved in acute stress or apoptosis signalling in vivo. © 2011 The Authors. Insect Molecular Biology © 2011 The Royal Entomological Society.

Drosophila melanogaster as a Versatile Model Organism in Food and Nutrition Research.

Science.gov (United States)

Staats, Stefanie; Lüersen, Kai; Wagner, Anika E; Rimbach, Gerald

2018-04-18

Drosophila melanogaster has been widely used in the biological sciences as a model organism. Drosophila has a relatively short life span of 60-80 days, which makes it attractive for life span studies. Moreover, approximately 60% of the fruit fly genes are orthologs to mammals. Thus, metabolic and signal transduction pathways are highly conserved. Maintenance and reproduction of Drosophila do not require sophisticated equipment and are rather cheap. Furthermore, there are fewer ethical issues involved in experimental Drosophila research compared with studies in laboratory rodents, such as rats and mice. Drosophila is increasingly recognized as a model organism in food and nutrition research. Drosophila is often fed complex solid diets based on yeast, corn, and agar. There are also so-called holidic diets available that are defined in terms of their amino acid, fatty acid, carbohydrate, vitamin, mineral, and trace element compositions. Feed intake, body composition, locomotor activity, intestinal barrier function, microbiota, cognition, fertility, aging, and life span can be systematically determined in Drosophila in response to dietary factors. Furthermore, diet-induced pathophysiological mechanisms including inflammation and stress responses may be evaluated in the fly under defined experimental conditions. Here, we critically evaluate Drosophila melanogaster as a versatile model organism in experimental food and nutrition research, review the corresponding data in the literature, and make suggestions for future directions of research.

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

Directory of Open Access Journals (Sweden)

Marcio Hedil

2016-07-01

Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Two classes of silencing RNAs move between C. elegans tissues

Science.gov (United States)

Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

2011-01-01

Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

Science.gov (United States)

Hedil, Marcio; Kormelink, Richard

2016-07-23

The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

The Drosophila gene CG9918 codes for a pyrokinin-1 receptor

DEFF Research Database (Denmark)

Cazzamali, Giuseppe; Torp, Malene; Hauser, Frank

2005-01-01

The database from the Drosophila Genome Project contains a gene, CG9918, annotated to code for a G protein-coupled receptor. We cloned the cDNA of this gene and functionally expressed it in Chinese hamster ovary cells. We tested a library of about 25 Drosophila and other insect neuropeptides......, and seven insect biogenic amines on the expressed receptor and found that it was activated by low concentrations of the Drosophila neuropeptide, pyrokinin-1 (TGPSASSGLWFGPRLamide; EC50, 5 x 10(-8) M). The receptor was also activated by other Drosophila neuropeptides, terminating with the sequence PRLamide...... (Hug-gamma, ecdysis-triggering-hormone-1, pyrokinin-2), but in these cases about six to eight times higher concentrations were needed. The receptor was not activated by Drosophila neuropeptides, containing a C-terminal PRIamide sequence (such as ecdysis-triggering-hormone-2), or PRVamide (such as capa...

Adaptation of the Four Forms of Employee Silence Scale in a Polish sample

Directory of Open Access Journals (Sweden)

Krystyna Adamska

2017-06-01

Full Text Available Background Silence is understood as a decision not to speak up in situations of observed irregularities both in productivity and ethics. The study examined the validity of the Four Forms of Employee Silence Scale (FFESS in the Polish population. The scale is a four-factor measure designed to capture differently motivated tendencies to be silent in organizations. The scale distinguishes acquiescent, quiescent, prosocial and opportunistic silence. Employee silence has been linked to many important individual outcomes: failure to react to ethical transgressions, stress and depression, and lower creativity and productivity. Participants and procedure A total of 1044 employees of various organizations working for at least six months at a given position provided the responses for the validation study. Results The results confirmed the superiority of the four-factor model shown by adequate fit indexes: The FFESS has adequate internal consistency at both the scale and item levels. The criterion-related validity of the scale was established by correlating four forms of silence with measures of emotional attitude toward organization, procedural justice, relational contract and turnover intention. Conclusions The four forms of employee silence are empirically distinct concepts in the Polish sample. The scale may be used as the measurement of individual differences. It can also serve as a tool for diagnosing a climate of silence in an organization.

Decreasing erucic acid level by RNAi-mediated silencing of fatty ...

African Journals Online (AJOL)

To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...

Study of radioadaptive response in Drosophila melanogaster at different oogenesis stages

International Nuclear Information System (INIS)

Glushkova, I.V.; Aksyutik, T.V.

2005-01-01

We study radioadaptive response in the Canton-S strain of Drosophila melanogaster at different oogenesis stages using the test of dominant lethal mutations (DLM). AR was not revealed at the stages of 14-7 and 7--1 oocytes in the studied Drosophila stock. It is likely to be associated with a genetic constitution of the Drosophila strain under study. (authors)

Genome-wide comparative analysis of four Indian Drosophila species.

Science.gov (United States)

Mohanty, Sujata; Khanna, Radhika

2017-12-01

Comparative analysis of multiple genomes of closely or distantly related Drosophila species undoubtedly creates excitement among evolutionary biologists in exploring the genomic changes with an ecology and evolutionary perspective. We present herewith the de novo assembled whole genome sequences of four Drosophila species, D. bipectinata, D. takahashii, D. biarmipes and D. nasuta of Indian origin using Next Generation Sequencing technology on an Illumina platform along with their detailed assembly statistics. The comparative genomics analysis, e.g. gene predictions and annotations, functional and orthogroup analysis of coding sequences and genome wide SNP distribution were performed. The whole genome of Zaprionus indianus of Indian origin published earlier by us and the genome sequences of previously sequenced 12 Drosophila species available in the NCBI database were included in the analysis. The present work is a part of our ongoing genomics project of Indian Drosophila species.

Small heat shock proteins mediate cell-autonomous and -nonautonomous protection in a Drosophila model for environmental-stress-induced degeneration.

Science.gov (United States)

Kawasaki, Fumiko; Koonce, Noelle L; Guo, Linda; Fatima, Shahroz; Qiu, Catherine; Moon, Mackenzie T; Zheng, Yunzhen; Ordway, Richard W

2016-09-01

Cell and tissue degeneration, and the development of degenerative diseases, are influenced by genetic and environmental factors that affect protein misfolding and proteotoxicity. To better understand the role of the environment in degeneration, we developed a genetic model for heat shock (HS)-stress-induced degeneration in Drosophila This model exhibits a unique combination of features that enhance genetic analysis of degeneration and protection mechanisms involving environmental stress. These include cell-type-specific failure of proteostasis and degeneration in response to global stress, cell-nonautonomous interactions within a simple and accessible network of susceptible cell types, and precise temporal control over the induction of degeneration. In wild-type flies, HS stress causes selective loss of the flight ability and degeneration of three susceptible cell types comprising the flight motor: muscle, motor neurons and associated glia. Other motor behaviors persist and, accordingly, the corresponding cell types controlling leg motor function are resistant to degeneration. Flight motor degeneration was preceded by a failure of muscle proteostasis characterized by diffuse ubiquitinated protein aggregates. Moreover, muscle-specific overexpression of a small heat shock protein (HSP), HSP23, promoted proteostasis and protected muscle from HS stress. Notably, neurons and glia were protected as well, indicating that a small HSP can mediate cell-nonautonomous protection. Cell-autonomous protection of muscle was characterized by a distinct distribution of ubiquitinated proteins, including perinuclear localization and clearance of protein aggregates associated with the perinuclear microtubule network. This network was severely disrupted in wild-type preparations prior to degeneration, suggesting that it serves an important role in muscle proteostasis and protection. Finally, studies of resistant leg muscles revealed that they sustain proteostasis and the microtubule

Drosophila increase exploration after visually detecting predators.

Directory of Open Access Journals (Sweden)

Miguel de la Flor

Full Text Available Novel stimuli elicit behaviors that are collectively known as specific exploration. These behaviors allow the animal to become more familiar with the novel objects within its environment. Specific exploration is frequently suppressed by defensive reactions to predator cues. Herein, we examine if this suppression occurs in Drosophila melanogaster by measuring the response of these flies to wild harvested predators. The flies used in our experiments have been cultured and had not lived under predator threat for multiple decades. In a circular arena with centrally-caged predators, wild type Drosophila actively avoided the pantropical jumping spider, Plexippus paykulli, and the Texas unicorn mantis, Phyllovates chlorophaena, indicating an innate defensive reaction to these predators. Interestingly, wild type Drosophila males also avoided a centrally-caged mock spider, and the avoidance of the mock spider became exaggerated when it was made to move within the cage. Visually impaired Drosophila failed to detect and avoid the Plexippus paykulli and the moving mock spider, while the broadly anosmic orco2 mutants were fully capable of detecting and avoiding Plexippus paykulli, indicating that these flies principally relied upon vison to perceive the predator stimuli. During early exploration of the arena, exploratory activity increased in the presence of Plexippus paykulli and the moving mock spider. The elevated activity induced by Plexippus paykulli disappeared after the fly had finished exploring, suggesting the flies were capable of habituating the predator cues. Taken together, these results indicate that despite being isolated from predators for decades Drosophila will visually detect these predators, retain innate defensive behaviors, respond by increasing exploratory activity in the arena rather than suppressing activity, and may habituate to normal predator cues.

Optogenetic pacing in Drosophila melanogaster (Conference Presentation)

Science.gov (United States)

Alex, Aneesh; Li, Airong; Men, Jing; Jerwick, Jason; Tanzi, Rudolph E.; Zhou, Chao

2016-03-01

A non-invasive, contact-less cardiac pacing technology can be a powerful tool in basic cardiac research and in clinics. Currently, electrical pacing is the gold standard for cardiac pacing. Although highly effective in controlling the cardiac function, the invasive nature, non-specificity to cardiac tissues and possible tissue damage limits its capabilities. Optical pacing of heart is a promising alternative, which is non-invasive and more specific, has high spatial and temporal precision, and avoids shortcomings in electrical stimulation. Optical coherence tomography has been proved to be an effective technique in non-invasive imaging in vivo with ultrahigh resolution and imaging speed. In the last several years, non-invasive specific optical pacing in animal hearts has been reported in quail, zebrafish, and rabbit models. However， Drosophila Melanogaster, which is a significant model with orthologs of 75% of human disease genes, has rarely been studied concerning their optical pacing in heart. Here, we combined optogenetic control of Drosophila heartbeat with optical coherence microscopy (OCM) technique for the first time. The light-gated cation channel, channelrhodopsin-2 (ChR2) was specifically expressed by transgene as a pacemaker in drosophila heart. By stimulating the pacemaker with 472 nm pulsed laser light at different frequencies, we achieved non-invasive and more specific optical control of the Drosophila heart rhythm, which demonstrates the wide potential of optical pacing for studying cardiac dynamics and development. Imaging capability of our customized OCM system was also involved to observe the pacing effect visually. No tissue damage was found after long exposure to laser pulses, which proved the safety of optogenetic control of Drosophila heart.

Cytoplasmic Streaming in the Drosophila Oocyte.

Science.gov (United States)

Quinlan, Margot E

2016-10-06

Objects are commonly moved within the cell by either passive diffusion or active directed transport. A third possibility is advection, in which objects within the cytoplasm are moved with the flow of the cytoplasm. Bulk movement of the cytoplasm, or streaming, as required for advection, is more common in large cells than in small cells. For example, streaming is observed in elongated plant cells and the oocytes of several species. In the Drosophila oocyte, two stages of streaming are observed: relatively slow streaming during mid-oogenesis and streaming that is approximately ten times faster during late oogenesis. These flows are implicated in two processes: polarity establishment and mixing. In this review, I discuss the underlying mechanism of streaming, how slow and fast streaming are differentiated, and what we know about the physiological roles of the two types of streaming.

RNA silencing is required for Arabidopsis defence against Verticillium wilt disease

NARCIS (Netherlands)

Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.

2009-01-01

RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,

Apoptosis in Drosophila: which role for mitochondria?

Science.gov (United States)

Clavier, Amandine; Rincheval-Arnold, Aurore; Colin, Jessie; Mignotte, Bernard; Guénal, Isabelle

2016-03-01

It is now well established that the mitochondrion is a central regulator of mammalian cell apoptosis. However, the importance of this organelle in non-mammalian apoptosis has long been regarded as minor, mainly because of the absence of a crucial role for cytochrome c in caspase activation. Recent results indicate that the control of caspase activation and cell death in Drosophila occurs at the mitochondrial level. Numerous proteins, including RHG proteins and proteins of the Bcl-2 family that are key regulators of Drosophila apoptosis, constitutively or transiently localize in mitochondria. These proteins participate in the cell death process at different levels such as degradation of Diap1, a Drosophila IAP, production of mitochondrial reactive oxygen species or stimulation of the mitochondrial fission machinery. Here, we review these mitochondrial events that might have their counterpart in human.

Erythritol and Lufenuron detrimentally alter age structure of Wild Spotted Wing Drosophila (SWD) Drosophila suzukii (Diptera: Drosophilidae) populations in blueberry and blackberry

Science.gov (United States)

We report on the efficacy of 0.5 M (61,000 ppm) Erythritol (E) in Truvia Baking Blend®, 10 ppm Lufenuron (L), and their combination (LE) to reduce egg and larval densities of wild populations of spotted wing Drosophila, Drosophila suzukii (Matsumura) (SWD) infesting fields of rabbiteye blueberries (...

Driving in unheard silence: Disability and the politics of shutting up.

Science.gov (United States)

Lourens, Heidi

2018-03-01

The politics of silence is central to disability experience and the field of disability studies. In this analytical autoethnography, I write about my silences as a visually impaired woman. I explore and make sense of personal life stories through a theoretical perspective. The analysis of these personal experiences lead me to argue that disability-related silences are mostly created through the confluence of inaccessible physical and social environments and the psychological internalisation of these worlds. I also discuss the ways in which I am currently regaining my voice. Further research on resistance by disabled persons is recommended.

Drosophila Studies on Autism Spectrum Disorders

Institute of Scientific and Technical Information of China (English)

Yao Tian; Zi Chao Zhang; Junhai Han

2017-01-01

In the past decade,numerous genes associated with autism spectrum disorders (ASDs) have been identified.These genes encode key regulators of synaptogenesis,synaptic function,and synaptic plasticity.Drosophila is a prominent model system for ASD studies to define novel genes linked to ASDs and decipher their molecular roles in synaptogenesis,synaptic function,synaptic plasticity,and neural circuit assembly and consolidation.Here,we review Drosophila studies on ASD genes that regulate synaptogenesis,synaptic function,and synaptic plasticity through modulating chromatin remodeling,transcription,protein synthesis and degradation,cytoskeleton dynamics,and synaptic scaffolding.

NOVEL ASPECTS OF SPOTTED WING DROSOPHILA BIOLOGY AND IMPROVED METHODS OF REARING

Science.gov (United States)

Drosophila suzukii (Mats.) or the spotted wing Drosophila (SWD), is a global pest of soft fruits that can now be reared on a standard Drosophila diet containing the fly's own natural food: soft-skinned berries. The techniques tested here can thwart bacterial and fungal disease that can destroy more ...

Piecing Together Past and Present in Bhutan: Narration, Silence and Forgetting in Conflict

Directory of Open Access Journals (Sweden)

Line Kikkenborg Christensen

2018-02-01

Full Text Available What happens when conflict is silenced in official narratives but not forgotten among a population? This article explores this question using interview data from anthropological fieldwork in Bhutan. In Bhutan, the ethnic conflict of the early 1990s is surrounded by silence and is not openly discussed. Despite this silence, young Bhutanese have formed a multiplicity of narratives about the conflict. The article highlights three different narratives of conflict, as well as the oblivion found among informants. The main argument is that the silence surrounding the conflict in Bhutan has contributed to two forms of societal rift: between the authorities and the people, and between people themselves. The article contributes to the discussion about what role social memories play in conflicts, by suggesting that silence may cause wariness and hinder processes that help societies to move past conflict in a constructive way.

Drosophila melanogaster as a Model for Lead Neurotoxicology and Toxicogenomics Research

Directory of Open Access Journals (Sweden)

Douglas Mark Ruden

2012-05-01

Full Text Available Drosophila melanogaster is an excellent model animal for studying the neurotoxicology of lead. It has been known since ancient Roman times that long-term exposure to low levels of lead results in behavioral abnormalities, such as what is now known as attention deficit hyperactivity disorder (ADHD. Because lead alters mechanisms that underlie developmental neuronal plasticity, chronic exposure of children, even at blood lead levels below the current CDC community action level (10 µg/dl, can result in reduced cognitive ability, increased likelihood of delinquency, behaviors associated with ADHD, changes in activity level, altered sensory function, delayed onset of sexual maturity in girls, and changes in immune function. In order to better understand how lead affects neuronal plasticity, we will describe recent findings from a Drosophila behavioral genetics laboratory, a Drosophila neurophysiology laboratory, and a Drosophila quantitative genetics laboratory who have joined forces to study the effects of lead on the Drosophila nervous system. Studying the effects of lead on Drosophila nervous system development will give us a better understanding of the mechanisms of Pb neurotoxicity in the developing human nervous system.

Bioimage Informatics in the context of Drosophila research.

Science.gov (United States)

Jug, Florian; Pietzsch, Tobias; Preibisch, Stephan; Tomancak, Pavel

2014-06-15

Modern biological research relies heavily on microscopic imaging. The advanced genetic toolkit of Drosophila makes it possible to label molecular and cellular components with unprecedented level of specificity necessitating the application of the most sophisticated imaging technologies. Imaging in Drosophila spans all scales from single molecules to the entire populations of adult organisms, from electron microscopy to live imaging of developmental processes. As the imaging approaches become more complex and ambitious, there is an increasing need for quantitative, computer-mediated image processing and analysis to make sense of the imagery. Bioimage Informatics is an emerging research field that covers all aspects of biological image analysis from data handling, through processing, to quantitative measurements, analysis and data presentation. Some of the most advanced, large scale projects, combining cutting edge imaging with complex bioimage informatics pipelines, are realized in the Drosophila research community. In this review, we discuss the current research in biological image analysis specifically relevant to the type of systems level image datasets that are uniquely available for the Drosophila model system. We focus on how state-of-the-art computer vision algorithms are impacting the ability of Drosophila researchers to analyze biological systems in space and time. We pay particular attention to how these algorithmic advances from computer science are made usable to practicing biologists through open source platforms and how biologists can themselves participate in their further development. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Oligomerization and chaperone-like activity of Drosophila melanogaster small heat shock protein DmHsp27 and three arginine mutants in the alpha-crystallin domain.

Science.gov (United States)

Moutaoufik, Mohamed Taha; Morrow, Geneviève; Maaroufi, Halim; Férard, Céline; Finet, Stéphanie; Tanguay, Robert M

2017-07-01

The small Hsp DmHsp27 from Drosophila melanogaster is one of the few small heat shock proteins (sHsps) found within the nucleus. We report that its dimerization is independent of disulfide bond formation and seems to rely on salt bridges. Unlike metazoan sHsps, DmHsp27 forms two populations of oligomers not in equilibrium. Mutations at highly conserved arginine residues in mammalian sHsps have been reported to be associated with protein conformational defects and intracellular aggregation. Independent mutation of three highly conserved arginines (R122, R131, and R135) to glycine in DmHsp27 results in only one population of higher molecular weight form. In vitro, the chaperone-like activity of wild-type DmHsp27 was comparable with that of its two isolated populations and to the single population of the R122G, R131G, and R135G using luciferase as substrate. However, using insulin, the chaperone-like activity of wild-type DmHsp27 was lower than that of R122G and R131G mutants. Altogether, the results characterize wild-type DmHsp27 and its alpha-crystallin domain (ACD) arginine mutants and may give insight into protection mechanism of sHsps.

Anatomy of RISC: how do small RNAs and chaperones activate Argonaute proteins?

Science.gov (United States)

Nakanishi, Kotaro

2016-09-01

RNA silencing is a eukaryote-specific phenomenon in which microRNAs and small interfering RNAs degrade messenger RNAs containing a complementary sequence. To this end, these small RNAs need to be loaded onto an Argonaute protein (AGO protein) to form the effector complex referred to as RNA-induced silencing complex (RISC). RISC assembly undergoes multiple and sequential steps with the aid of Hsc70/Hsp90 chaperone machinery. The molecular mechanisms for this assembly process remain unclear, despite their significance for the development of gene silencing techniques and RNA interference-based therapeutics. This review dissects the currently available structures of AGO proteins and proposes models and hypotheses for RISC assembly, covering the conformation of unloaded AGO proteins, the chaperone-assisted duplex loading, and the slicer-dependent and slicer-independent duplex separation. The differences in the properties of RISC between prokaryotes and eukaryotes will also be clarified. WIREs RNA 2016, 7:637-660. doi: 10.1002/wrna.1356 For further resources related to this article, please visit the WIREs website. © 2016 The Authors. WIREs RNA published by Wiley Periodicals, Inc.

Between the Unbearable Weight and Lightness of the Past. Banal Silence in Spain's Post-Dictatorship Memory Politics.

Science.gov (United States)

Brescó de Luna, Ignacio

2018-05-04

This paper explores the role of silence in Spain's post-dictatorship memory politics. More specifically, the paper examines the forgotten Spanish colonial past in North Africa vis-à-vis the so-called pact of silence that accompanied Spain's transition to democracy after the Franco dictatorship. Drawing on various theoretical approaches in relation to collective memory, traditionally assumed associations between silence and forgetting are questioned. As is argued, silence may nurture and preserve memory just as it may also feed into forgetting. In the former case, silence typically enshrouds a living memory of a past that still weighs on the present, as the pact of silence in Spain clearly illustrates. In the latter case, silence signals a past perceived as already left behind and alien to society's current problems, as is the case of the Spanish colonial past in North Africa. In order to further explore the latter case, the notion of banal silence is introduced. Such notion points to cases where silence over certain contentious historical issues goes unnoticed by society, thus becoming naturalized. The paper concludes with some final reflexions on memory, banal silence and political change.

Characterization of the activity of β-galactosidase from Escherichia coli and Drosophila melanogaster in fixed and non-fixed Drosophila tissues

Directory of Open Access Journals (Sweden)

Mizuki Tomizawa

2016-12-01

Full Text Available β-Galactosidase encoded by the Escherichia coli lacZ gene, is widely used as a reporter molecule in molecular biology in a wide variety of animals. β-Galactosidase retains its enzymatic activity in cells or tissues even after fixation and can degrade X-Gal, a frequently used colormetric substrate, producing a blue color. Therefore, it can be used for the activity staining of fixed tissues. However, the enzymatic activity of the β-galactosidase that is ectopically expressed in the non-fixed tissues of animals has not been extensively studied. Here, we report the characterization of β-galactosidase activity in Drosophila tissues with and without fixation in various experimental conditions comparing the activity of two evolutionarily orthologous β-galactosidases derived from the E. coli lacZ and Drosophila melanogaster DmelGal genes. We performed quantitative analysis of the activity staining of larval imaginal discs and an in vitro assay using larval lysates. Our data showed that both E. coli and Drosophila β-galactosidase can be used for cell-type-specific activity staining, but they have their own preferences in regard to conditions. E. coli β-galactosidase showed a preference for neutral pH but not for acidic pH compared with Drosophila β-galactosidase. Our data suggested that both E. coli and Drosophila β-galactosidase show enzymatic activity in the physiological conditions of living animals when they are ectopically expressed in a desired specific spatial and temporal pattern. This may enable their future application to studies of chemical biology using model animals.

Silence in liturgy as the space for the Holy Ghost’s activity

Directory of Open Access Journals (Sweden)

Adelajda Sielepin

2006-06-01

Full Text Available The aim of this article is to clarify the essential and often neglected function of liturgical silence. In practice silence is usually intended to prepare the participants for listening or reflecting upon the word, especially when proclaimed by the minister. Whereas it is vital to know that silence constitutes a creative element of the liturgy, because the involvement of the Holy Spirit. In His action and cooperation with the participants He enables them to get into communion with Christ the Word and the Person and eventually to join effectively His mission. In that sense silence helps the Holy Ghost to fulfill His function in continuing the dialogue between God and man as well as in enhancing one’s spiritual skills for the fruitful participation in the Mystery of Christ and the Church.

Regulation of the Drosophila Enhancer of split and invected-engrailed gene complexes by sister chromatid cohesion proteins.

Directory of Open Access Journals (Sweden)

Cheri A Schaaf

2009-07-01

Full Text Available The cohesin protein complex was first recognized for holding sister chromatids together and ensuring proper chromosome segregation. Cohesin also regulates gene expression, but the mechanisms are unknown. Cohesin associates preferentially with active genes, and is generally absent from regions in which histone H3 is methylated by the Enhancer of zeste [E(z] Polycomb group silencing protein. Here we show that transcription is hypersensitive to cohesin levels in two exceptional cases where cohesin and the E(z-mediated histone methylation simultaneously coat the entire Enhancer of split and invected-engrailed gene complexes in cells derived from Drosophila central nervous system. These gene complexes are modestly transcribed, and produce seven of the twelve transcripts that increase the most with cohesin knockdown genome-wide. Cohesin mutations alter eye development in the same manner as increased Enhancer of split activity, suggesting that similar regulation occurs in vivo. We propose that cohesin helps restrain transcription of these gene complexes, and that deregulation of similarly cohesin-hypersensitive genes may underlie developmental deficits in Cornelia de Lange syndrome.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

Directory of Open Access Journals (Sweden)

Jiangyu Wu

2013-01-01

Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

Science.gov (United States)

Huang, Weizhe; He, Ziying

2013-01-01

RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

NARCIS (Netherlands)

Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

2017-01-01

Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

Mutants dissecting development and behaviour in drosophila

International Nuclear Information System (INIS)

Joshi, Adita; Chandrashekaran, Shanti; Sharma, R.P.

2005-01-01

We have traced in this paper the progress in Drosophila genetics research from the 1960s, at the IARI, spearheaded by the visionary insight of M. S. Swaminathan. The work started with the study of indirect effect of radiation and the synergistic interaction of physical and chemical mutagens on chromosomal and genetic changes. This paved the way for the study of single gene mutants in dissecting developmental and behavioural processes. New genes discovered by us have been shown to encode conserved cell signalling molecules controlling developmental and behavioural pathways. With the complete sequencing of the Drosophila genome, in the year 2000, mounting evidence for the homology between Drosophila and human genes controlling genetic disorders became available. This has led to the fly becoming an indispensable tool for studying human diseases as well as a model to test for drugs and pharmaceuticals against human diseases and complex behavioural processes. For example wingless in Drosophila belongs to the conserved Wnt gene family and aberrant WNT signalling is linked to a range of human diseases, most notably cancer. Inhibition as well as activation of WNT signalling form the basis of an effective therapy for some cancers as well as several other clinical conditions. Recent experiments have shown that WNTs might also normally participate in self-renewal, proliferation or differentiation of stem cells and altering WNT signalling might be beneficial to the use of stem cells for therapeutic means. Likewise, the stambhA mutant of Drosophila which was discovered for its temperature-dependent paralytic behaviour is the fly homologue of Phospholipase Cβ. Phospholipase C mediated G protein signalling plays a central role in vital processes controlling epilepsy, vision, taste, and olfaction in animals. Proteins of the G-signalling pathway are of intense research interest since many human diseases involve defects in G-protein signalling pathways. In fact, approximately 50

An Empirical Study to Determine The Relationship between Occupational Self-Efficacy and Organizational Silence

Directory of Open Access Journals (Sweden)

Cem KAHYA

2015-06-01

Full Text Available The concept of occupational self-efficacy means the efficacy perceptions of employees in their occupational fields, and the concept of organizational silence means the employees avoid to voice their ideas and suggestions about organizational issues. The main aim of this study is to examine the relationship between the concepts of occupational self-efficacy and organizational silence by revealing employees’ perceptions of occupational self-efficacy and organizational silence level. With this aim, the survey study was conducted on total 114 academicians who work in University of Bayburt. As a result of research, while the significant relationship was found between employees’ perceptions of occupational self-efficacy and organizational silence level, there was reached a result that this relationship incurred the negatively relationship between perceptions of occupational self-efficacy and negative silence.

Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

Directory of Open Access Journals (Sweden)

Zeenia Jagga

Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

Silencing VDAC1 Expression by siRNA Inhibits Cancer Cell Proliferation and Tumor Growth In Vivo

Directory of Open Access Journals (Sweden)

Tasleem Arif

2014-01-01

Full Text Available Alterations in cellular metabolism and bioenergetics are vital for cancer cell growth and motility. Here, the role of the mitochondrial protein voltage-dependent anion channel (VDAC1, a master gatekeeper regulating the flux of metabolites and ions between mitochondria and the cytoplasm, in regulating the growth of several cancer cell lines was investigated by silencing VDAC1 expression using small interfering RNA (siRNA. A single siRNA specific to the human VDAC1 sequence at nanomolar concentrations led to some 90% decrease in VDAC1 levels in the lung A549 and H358, prostate PC-3, colon HCT116, glioblastoma U87, liver HepG2, and pancreas Panc-1 cancer cell lines. VDAC1 silencing persisted 144 hours post-transfection and resulted in profound inhibition of cell growth in cancer but not in noncancerous cells, with up to 90% inhibition being observed over 5 days that was prolonged by a second transfection. Cells expressing low VDAC1 levels showed decreased mitochondrial membrane potential and adenoside triphosphate (ATP levels, suggesting limited metabolite exchange between mitochondria and cytosol. Moreover, cells silenced for VDAC1 expression showed decreased migration, even in the presence of the wound healing accelerator basic fibroblast growth factor (bFGF. VDAC1-siRNA inhibited cancer cell growth in a Matrigel-based assay in host nude mice. Finally, in a xenograft lung cancer mouse model, chemically modified VDAC1-siRNA not only inhibited tumor growth but also resulted in tumor regression. This study thus shows that VDAC1 silencing by means of RNA interference (RNAi dramatically inhibits cancer cell growth and tumor development by disabling the abnormal metabolic behavior of cancer cells, potentially paving the way for a more effective pipeline of anticancer drugs.

Spontaneous alternation: A potential gateway to spatial working memory in Drosophila.

Science.gov (United States)

Lewis, Sara A; Negelspach, David C; Kaladchibachi, Sevag; Cowen, Stephen L; Fernandez, Fabian

2017-07-01

Despite their ubiquity in biomedical research, Drosophila have yet to be widely employed as model organisms in psychology. Many complex human-like behaviors are observed in Drosophila, which exhibit elaborate displays of inter-male aggression and female courtship, self-medication with alcohol in response to stress, and even cultural transmission of social information. Here, we asked whether Drosophila can demonstrate behavioral indices of spatial working memory in a Y-maze, a classic test of memory function and novelty-seeking in rodents. Our data show that Drosophila, like rodents, alternate their visits among the three arms of a Y-maze and spontaneously favor entry into arms they have explored less recently versus ones they have just seen. These findings suggest that Drosophila possess some of the information-seeking and working memory facilities mammals depend on to navigate through space and might be relevant models for understanding human psychological phenomena such as curiosity. Copyright © 2017 Elsevier Inc. All rights reserved.

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions.

Science.gov (United States)

Koyle, Melinda L; Veloz, Madeline; Judd, Alec M; Wong, Adam C-N; Newell, Peter D; Douglas, Angela E; Chaston, John M

2016-07-30

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is a model for understanding microbial interactions with animal hosts, facilitated by approaches to rear large sample sizes of Drosophila under microorganism-free (axenic) conditions, or with defined microbial communities (gnotobiotic). This work outlines a method for collection of Drosophila embryos, hypochlorite dechorionation and sterilization, and transfer to sterile diet. Sterilized embryos are transferred to sterile diet in 50 ml centrifuge tubes, and developing larvae and adults remain free of any exogenous microbes until the vials are opened. Alternatively, flies with a defined microbiota can be reared by inoculating sterile diet and embryos with microbial species of interest. We describe the introduction of 4 bacterial species to establish a representative gnotobiotic microbiota in Drosophila. Finally, we describe approaches for confirming bacterial community composition, including testing if axenic Drosophila remain bacteria-free into adulthood.

Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

Directory of Open Access Journals (Sweden)

Dacheng Liang

2014-12-01

Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

Neuronal Cbl Controls Biosynthesis of Insulin-Like Peptides in Drosophila melanogaster

OpenAIRE

Yu, Yue; Sun, Ying; He, Shengqi; Yan, Cheng; Rui, Liangyou; Li, Wenjun; Liu, Yong

2012-01-01

The Cbl family proteins function as both E3 ubiquitin ligases and adaptor proteins to regulate various cellular signaling events, including the insulin/insulin-like growth factor 1 (IGF1) and epidermal growth factor (EGF) pathways. These pathways play essential roles in growth, development, metabolism, and survival. Here we show that in Drosophila melanogaster, Drosophila Cbl (dCbl) regulates longevity and carbohydrate metabolism through downregulating the production of Drosophila insulin-lik...

Intratracheal Administration of Small Interfering RNA Targeting Fas Reduces Lung Ischemia-Reperfusion Injury.

Science.gov (United States)

Del Sorbo, Lorenzo; Costamagna, Andrea; Muraca, Giuseppe; Rotondo, Giuseppe; Civiletti, Federica; Vizio, Barbara; Bosco, Ornella; Martin Conte, Erica L; Frati, Giacomo; Delsedime, Luisa; Lupia, Enrico; Fanelli, Vito; Ranieri, V Marco

2016-08-01

Lung ischemia-reperfusion injury is the main cause of primary graft dysfunction after lung transplantation and results in increased morbidity and mortality. Fas-mediated apoptosis is one of the pathologic mechanisms involved in the development of ischemia-reperfusion injury. We hypothesized that the inhibition of Fas gene expression in lungs by intratracheal administration of small interfering RNA could reduce lung ischemia-reperfusion injury in an ex vivo model reproducing the procedural sequence of lung transplantation. Prospective, randomized, controlled experimental study. University research laboratory. C57/BL6 mice weighing 28-30 g. Ischemia-reperfusion injury was induced in lungs isolated from mice, 48 hours after treatment with intratracheal small interfering RNA targeting Fas, control small interfering RNA, or vehicle. Isolated lungs were exposed to 6 hours of cold ischemia (4°C), followed by 2 hours of warm (37°C) reperfusion with a solution containing 10% of fresh whole blood and mechanical ventilation with constant low driving pressure. Fas gene expression was significantly silenced at the level of messenger RNA and protein after ischemia-reperfusion in lungs treated with small interfering RNA targeting Fas compared with lungs treated with control small interfering RNA or vehicle. Silencing of Fas gene expression resulted in reduced edema formation (bronchoalveolar lavage protein concentration and lung histology) and improvement in lung compliance. These effects were associated with a significant reduction of pulmonary cell apoptosis of lungs treated with small interfering RNA targeting Fas, which did not affect cytokine release and neutrophil infiltration. Fas expression silencing in the lung by small interfering RNA is effective against ischemia-reperfusion injury. This approach represents a potential innovative strategy of organ preservation before lung transplantation.

Optogenetic pacing in Drosophila melanogaster

Science.gov (United States)

Alex, Aneesh; Li, Airong; Tanzi, Rudolph E.; Zhou, Chao

2015-01-01

Electrical stimulation is currently the gold standard for cardiac pacing. However, it is invasive and nonspecific for cardiac tissues. We recently developed a noninvasive cardiac pacing technique using optogenetic tools, which are widely used in neuroscience. Optogenetic pacing of the heart provides high spatial and temporal precisions, is specific for cardiac tissues, avoids artifacts associated with electrical stimulation, and therefore promises to be a powerful tool in basic cardiac research. We demonstrated optogenetic control of heart rhythm in a well-established model organism, Drosophila melanogaster. We developed transgenic flies expressing a light-gated cation channel, channelrhodopsin-2 (ChR2), specifically in their hearts and demonstrated successful optogenetic pacing of ChR2-expressing Drosophila at different developmental stages, including the larva, pupa, and adult stages. A high-speed and ultrahigh-resolution optical coherence microscopy imaging system that is capable of providing images at a rate of 130 frames/s with axial and transverse resolutions of 1.5 and 3.9 μm, respectively, was used to noninvasively monitor Drosophila cardiac function and its response to pacing stimulation. The development of a noninvasive integrated optical pacing and imaging system provides a novel platform for performing research studies in developmental cardiology. PMID:26601299

Drosophila: Retrotransposons Making up Telomeres.

Science.gov (United States)

Casacuberta, Elena

2017-07-19

Drosophila and extant species are the best-studied telomerase exception. In this organism, telomere elongation is coupled with targeted retrotransposition of Healing Transposon (HeT-A) and Telomere Associated Retrotransposon (TART) with sporadic additions of Telomere Associated and HeT-A Related (TAHRE), all three specialized non-Long Terminal Repeat (non-LTR) retrotransposons. These three very special retroelements transpose in head to tail arrays, always in the same orientation at the end of the chromosomes but never in interior locations. Apparently, retrotransposon and telomerase telomeres might seem very different, but a detailed view of their mechanisms reveals similarities explaining how the loss of telomerase in a Drosophila ancestor could successfully have been replaced by the telomere retrotransposons. In this review, we will discover that although HeT-A, TART, and TAHRE are still the only examples to date where their targeted transposition is perfectly tamed into the telomere biology of Drosophila, there are other examples of retrotransposons that manage to successfully integrate inside and at the end of telomeres. Because the aim of this special issue is viral integration at telomeres, understanding the base of the telomerase exceptions will help to obtain clues on similar strategies that mobile elements and viruses could have acquired in order to ensure their survival in the host genome.

From early lessons to new frontiers: The worm as a treasure trove of small RNA biology

Directory of Open Access Journals (Sweden)

Elaine M. Youngman

2014-11-01

Full Text Available In the past twenty years, the tiny soil nematode C. elegans has provided critical insights into our understanding of the breadth of small RNA-mediated gene regulatory activities. The first microRNA was identified in C. elegans in 1993, and the understanding that dsRNA was the driving force behind RNA-mediated gene silencing came from experiments performed in C. elegans in 1998. Likewise, early genetic screens in C. elegans for factors involved in RNAi pointed to conserved mechanisms for small RNA-mediated gene silencing pathways, placing the worm squarely among the founding fathers of a now extensive field of molecular biology. Today, the worm continues to be at the forefront of ground-breaking insight into small RNA-mediated biology. Recent studies have revealed with increasing mechanistic clarity that C. elegans possesses an extensive nuclear small RNA regulatory network that encompasses not only gene silencing but also gene activating roles. Further, a portrait is emerging whereby small RNA pathways play key roles in integrating responses to environmental stimuli and transmitting epigenetic information about such responses from one generation to the next. Here we discuss endogenous small RNA pathways in C. elegans and the insight worm biology has provided into the mechanisms employed by these pathways. We touch on the increasingly spectacular diversity of small RNA biogenesis and function, and discuss the relevance of lessons learned in the worm for human biology.

From early lessons to new frontiers: the worm as a treasure trove of small RNA biology.

Science.gov (United States)

Youngman, Elaine M; Claycomb, Julie M

2014-01-01

In the past 20 years, the tiny soil nematode Caenorhabditis elegans has provided critical insights into our understanding of the breadth of small RNA-mediated gene regulatory activities. The first microRNA was identified in C. elegans in 1993, and the understanding that dsRNA was the driving force behind RNA-mediated gene silencing came from experiments performed in C. elegans in 1998. Likewise, early genetic screens in C. elegans for factors involved in RNA interference pointed to conserved mechanisms for small RNA-mediated gene silencing pathways, placing the worm squarely among the founding fathers of a now extensive field of molecular biology. Today, the worm continues to be at the forefront of ground-breaking insight into small RNA-mediated biology. Recent studies have revealed with increasing mechanistic clarity that C. elegans possesses an extensive nuclear small RNA regulatory network that encompasses not only gene silencing but also gene activating roles. Further, a portrait is emerging whereby small RNA pathways play key roles in integrating responses to environmental stimuli and transmitting epigenetic information about such responses from one generation to the next. Here we discuss endogenous small RNA pathways in C. elegans and the insight worm biology has provided into the mechanisms employed by these pathways. We touch on the increasingly spectacular diversity of small RNA biogenesis and function, and discuss the relevance of lessons learned in the worm for human biology.

TOR signaling pathway and autophagy are involved in the regulation of circadian rhythms in behavior and plasticity of L2 interneurons in the brain of Drosophila melanogaster.

Science.gov (United States)

Kijak, Ewelina; Pyza, Elżbieta

2017-01-01

Drosophila melanogaster is a common model used to study circadian rhythms in behavior and circadian clocks. However, numerous circadian rhythms have also been detected in non-clock neurons, especially in the first optic neuropil (lamina) of the fly's visual system. Such rhythms have been observed in the number of synapses and in the structure of interneurons, which exhibit changes in size and shape in a circadian manner. Although the patterns of these changes are known, the mechanism remains unclear. In the present study, we investigated the role of the TOR signaling pathway and autophagy in regulating circadian rhythms based on the behavior and structural plasticity of the lamina L2 monopolar cell dendritic trees. In addition, we examined the cyclic expression of the TOR signaling pathway (Tor, Pi3K class 1, Akt1) and autophagy (Atg5 and Atg7) genes in the fly's brain. We observed that Tor, Atg5 and Atg7 exhibit rhythmic expressions in the brain of wild-type flies in day/night conditions (LD 12:12) that are abolished in per01 clock mutants. The silencing of Tor in per expressing cells shortens a period of the locomotor activity rhythm of flies. In addition, silencing of the Tor and Atg5 genes in L2 cells disrupts the circadian plasticity of the L2 cell dendritic trees measured in the distal lamina. In turn, silencing of the Atg7 gene in L2 cells changes the pattern of this rhythm. Our results indicate that the TOR signaling pathway and autophagy are involved in the regulation of circadian rhythms in the behavior and plasticity of neurons in the brain of adult flies.

Origin and specification of type II neuroblasts in the Drosophila embryo.

Science.gov (United States)

Álvarez, José-Andrés; Díaz-Benjumea, Fernando J

2018-04-05

In Drosophila , neural stem cells or neuroblasts (NBs) acquire different identities according to their site of origin in the embryonic neuroectoderm. Their identity determines the number of times they will divide and the types of daughter cells they will generate. All NBs divide asymmetrically, with type I NBs undergoing self-renewal and generating another cell that will divide only once more. By contrast, a small set of NBs in the larval brain, type II NBs, divides differently, undergoing self-renewal and generating an intermediate neural progenitor (INP) that continues to divide asymmetrically several more times, generating larger lineages. In this study, we have analysed the origin of type II NBs and how they are specified. Our results indicate that these cells originate in three distinct clusters in the dorsal protocerebrum during stage 12 of embryonic development. Moreover, it appears that their specification requires the combined action of EGFR signalling and the activity of the related genes buttonhead and Drosophila Sp1 In addition, we also show that the INPs generated in the embryo enter quiescence at the end of embryogenesis, resuming proliferation during the larval stage. © 2018. Published by The Company of Biologists Ltd.

Super resolution imaging of genetically labelled synapses in Drosophila brain tissue

Directory of Open Access Journals (Sweden)

Isabelle Ayumi Spühler

2016-05-01

Full Text Available Understanding synaptic connectivity and plasticity within brain circuits and their relationship to learning and behavior is a fundamental quest in neuroscience. Visualizing the fine details of synapses using optical microscopy remains however a major technical challenge. Super resolution microscopy opens the possibility to reveal molecular features of synapses beyond the diffraction limit. With direct stochastic optical reconstruction microscopy, dSTORM, we image synaptic proteins in the brain tissue of the fruit fly, Drosophila melanogaster. Super resolution imaging of brain tissue harbors difficulties due to light scattering and the density of signals. In order to reduce out of focus signal, we take advantage of the genetic tools available in the Drosophila and have fluorescently tagged synaptic proteins expressed in only a small number of neurons. These neurons form synapses within the calyx of the mushroom body, a distinct brain region involved in associative memory formation. Our results show that super resolution microscopy, in combination with genetically labelled synaptic proteins, is a powerful tool to investigate synapses in a quantitative fashion providing an entry point for studies on synaptic plasticity during learning and memory formation

Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

Directory of Open Access Journals (Sweden)

Mustafa Emre Civelek

2015-10-01

Full Text Available Dynamic competition conditions in present day, bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

Directory of Open Access Journals (Sweden)

Mustafa Emre Civelek

2015-12-01

Full Text Available Dynamic competition conditions in present day bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

The cytoskeleton of Drosophila-derived Schneider line-1 and Kc23 cells undergoes significant changes during long-term culture

Science.gov (United States)

Schatten, H.; Hedrick, J.; Chakrabarti, A.

1998-01-01

Insect cell cultures derived from Drosophila melanogaster are increasingly being used as an alternative system to mammalian cell cultures, as they are amenable to genetic manipulation. Although Drosophila cells are an excellent tool for the study of genes and expression of proteins, culture conditions have to be considered in the interpretation of biochemical results. Our studies indicate that significant differences occur in cytoskeletal structure during the long-term culture of the Drosophila-derived cell lines Schneider Line-1 (S1) and Kc23. Scanning, transmission-electron, and immunofluorescence microscopy studies reveal that microfilaments, microtubules, and centrosomes become increasingly different during the culture of these cells from 24 h to 7-14 days. Significant cytoskeletal changes are observed at the cell surface where actin polymerizes into microfilaments, during the elongation of long microvilli. Additionally, long protrusions develop from the cell surface; these protrusions are microtubule-based and establish contact with neighboring cells. In contrast, the microtubule network in the interior of the cells becomes disrupted after four days of culture, resulting in altered transport of mitochondria. Microtubules and centrosomes are also affected in a small percent of cells during cell division, indicating an instability of centrosomes. Thus, the cytoskeletal network of microfilaments, microtubules, and centrosomes is affected in Drosophila cells during long-term culture. This implies that gene regulation and post-translational modifications are probably different under different culture conditions.

Genetic human prion disease modelled in PrP transgenic Drosophila.

Science.gov (United States)

Thackray, Alana M; Cardova, Alzbeta; Wolf, Hanna; Pradl, Lydia; Vorberg, Ina; Jackson, Walker S; Bujdoso, Raymond

2017-09-20

Inherited human prion diseases, such as fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD), are associated with autosomal dominant mutations in the human prion protein gene PRNP and accumulation of PrP Sc , an abnormal isomer of the normal host protein PrP C , in the brain of affected individuals. PrP Sc is the principal component of the transmissible neurotoxic prion agent. It is important to identify molecular pathways and cellular processes that regulate prion formation and prion-induced neurotoxicity. This will allow identification of possible therapeutic interventions for individuals with, or at risk from, genetic human prion disease. Increasingly, Drosophila has been used to model human neurodegenerative disease. An important unanswered question is whether genetic prion disease with concomitant spontaneous prion formation can be modelled in Drosophila We have used pUAST/PhiC31-mediated site-directed mutagenesis to generate Drosophila transgenic for murine or hamster PrP (prion protein) that carry single-codon mutations associated with genetic human prion disease. Mouse or hamster PrP harbouring an FFI (D178N) or fCJD (E200K) mutation showed mild Proteinase K resistance when expressed in Drosophila Adult Drosophila transgenic for FFI or fCJD variants of mouse or hamster PrP displayed a spontaneous decline in locomotor ability that increased in severity as the flies aged. Significantly, this mutant PrP-mediated neurotoxic fly phenotype was transferable to recipient Drosophila that expressed the wild-type form of the transgene. Collectively, our novel data are indicative of the spontaneous formation of a PrP-dependent neurotoxic phenotype in FFI- or CJD-PrP transgenic Drosophila and show that inherited human prion disease can be modelled in this invertebrate host. © 2017 The Author(s).

A genomic investigation of ecological differentiation between free-living and Drosophila-associated bacteria.

Science.gov (United States)

Winans, Nathan J; Walter, Alec; Chouaia, Bessem; Chaston, John M; Douglas, Angela E; Newell, Peter D