Block Copolymer Micellization as a Protection Strategy for DNA Origami.

Science.gov (United States)

Agarwal, Nayan P; Matthies, Michael; Gür, Fatih N; Osada, Kensuke; Schmidt, Thorsten L

2017-05-08

DNA nanotechnology enables the synthesis of nanometer-sized objects that can be site-specifically functionalized with a large variety of materials. For these reasons, DNA-based devices such as DNA origami are being considered for applications in molecular biology and nanomedicine. However, many DNA structures need a higher ionic strength than that of common cell culture buffers or bodily fluids to maintain their integrity and can be degraded quickly by nucleases. To overcome these deficiencies, we coated several different DNA origami structures with a cationic poly(ethylene glycol)-polylysine block copolymer, which electrostatically covered the DNA nanostructures to form DNA origami polyplex micelles (DOPMs). This straightforward, cost-effective, and robust route to protect DNA-based structures could therefore enable applications in biology and nanomedicine where unprotected DNA origami would be degraded. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Star polymer-based unimolecular micelles and their application in bio-imaging and diagnosis.

Science.gov (United States)

Jin, Xin; Sun, Pei; Tong, Gangsheng; Zhu, Xinyuan

2018-02-03

As a novel kind of polymer with covalently linked core-shell structure, star polymers behave in nanostructure in aqueous medium at all concentration range, as unimolecular micelles at high dilution condition and multi-micelle aggregates in other situations. The unique morphologies endow star polymers with excellent stability and functions, making them a promising platform for bio-application. A variety of functions including imaging and therapeutics can be achieved through rational structure design of star polymers, and the existence of plentiful end-groups on shell offers the opportunity for further modification. In the last decades, star polymers have become an attracting platform on fabrication of novel nano-systems for bio-imaging and diagnosis. Focusing on the specific topology and physicochemical properties of star polymers, we have reviewed recent development of star polymer-based unimolecular micelles and their bio-application in imaging and diagnosis. The main content of this review summarizes the synthesis of integrated architecture of star polymers and their self-assembly behavior in aqueous medium, focusing especially on the recent advances on their bio-imaging application and diagnosis use. Finally, we conclude with remarks and give some outlooks for further exploration in this field. Copyright © 2018 Elsevier Ltd. All rights reserved.

Structure of human DNA polymerase iota and the mechanism of DNA synthesis.

Science.gov (United States)

Makarova, A V; Kulbachinskiy, A V

2012-06-01

Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.

Micelle-like nanoassemblies based on polymer-drug conjugates as an emerging platform for drug delivery.

Science.gov (United States)

Liu, Zhihong; Wang, Yutao; Zhang, Na

2012-07-01

During the past decades, polymer-drug conjugates are one of the hottest topics in novel drug development fields. Amphiphilic polymer-drug conjugates in aqueous solution could form micelles or micelle-like nanoassemblies. Compared with polymer-drug conjugates and the micelles into which drugs are physically entrapped, micelles or micelle-like nanoassemblies based on polymer-drug conjugates bring several additional advantages, including increased drug-loading capacity, enhanced intracellular uptake, reduced systemic toxicity, and improved therapeutic efficacy. This review focuses on recent progress achieved in the research field of micelles or micelle-like nanoassemblies based on polymer-drug conjugates. Firstly, properties of polymers, drugs, and linkers which could be used to build polymer-drug conjugate micelles or micelle-like nanoassemblies are summarized. Then, the characterization methods are described. Finally, the drug-targeting mechanisms are discussed. Micelles or micelle-like nanoassemblies based on polymer-drug conjugates as an emerging platform have the potential to achieve medical treatments with enhanced therapeutic effect. The application of micelles or micelle-like nanoassemblies based on polymer-drug conjugates may give new life to old active compounds abandoned due to their low solubility problems. For clinical application, there is a need to further optimize the properties of the polymer, drug, and linker.

Synthesis of CdS nanoparticles based on DNA network templates

International Nuclear Information System (INIS)

Yao Yong; Song Yonghai; Wang Li

2008-01-01

CdS nanoparticles have been successfully synthesized by using DNA networks as templates. The synthesis was carried out by first dropping a mixture of cadmium acetate and DNA on a mica surface for the formation of the DNA network template and then transferring the sample into a heated thiourea solution. The Cd 2+ reacted with thiourea at high temperature and formed CdS nanoparticles on the DNA network template. UV-vis spectroscopy, photoluminescence, x-ray diffraction and atomic force microscopy (AFM) were used to characterize the CdS nanoparticles in detail. AFM results showed that the resulted CdS nanoparticles were directly aligned on the DNA network templates and that the synthesis and assembly of CdS nanoparticles was realized in one step. CdS nanoparticles fabricated with this method were smaller than those directly synthesized in a thiourea solution and were uniformly aligned on the DNA networks. By adjusting the density of the DNA networks and the concentration of Cd 2+ , the size and density of the CdS nanoparticles could be effectively controlled and CdS nanoparticles could grow along the DNA chains into nanowires. The possible growth mechanism has also been discussed in detail

DNA repair synthesis in human fibroblasts requires DNA polymerase delta

International Nuclear Information System (INIS)

Nishida, C.; Reinhard, P.; Linn, S.

1988-01-01

When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone

RAFT Synthesis and Self-Assembly of Free-Base Porphyrin Cored Star Polymers

Directory of Open Access Journals (Sweden)

Lin Wu

2011-01-01

Full Text Available Reversible addition fragmentation chain transfer (RAFT synthesis and self-assembly of free-base porphyrin cored star polymers are reported. The polymerization, in the presence of a free-base porphyrin cored chain transfer agent (CTA-FBP, produced porphyrin star polymers with controlled molecular weights and narrow polydispersities for a number of monomers including N, N-dimethylacrylamide (DMA and styrene (St. Well-defined amphiphilic star block copolymers, P-(PS-PDMA4 and P-(PDMA-PS4 (P: porphyrin, were also prepared and used for self-assembly studies. In methanol, a selective solvent for PDMA, spherical micelles were observed for both block copolymers as characterized by TEM. UV-vis studies suggested star-like micelles were formed from P-(PS-PDMA4, while P-(PDMA-PS4 aggregated into flower-like micelles. Spectrophotometric titrations indicated that the optical response of these two micelles to external ions was a function of micellar structures. These structure-related properties will be used for micelle studies and functional material development in the future.

Micelle swelling agent derived cavities for increasing hydrophobic organic compound removal efficiency by mesoporous micelle@silica hybrid materials

KAUST Repository

Shi, Yifeng

2012-06-01

Mesoporous micelle@silica hybrid materials with 2D hexagonal mesostructures were synthesized as reusable sorbents for hydrophobic organic compounds (HOCs) removal by a facile one-step aqueous solution synthesis using 3-(trimethoxysily)propyl-octadecyldimethyl-ammonium chloride (TPODAC) as a structure directing agent. The mesopores were generated by adding micelle swelling agent, 1,3,5-trimethyl benzene, during the synthesis and removing it afterward, which was demonstrated to greatly increase the HOC removal efficiency. In this material, TPODAC surfactant is directly anchored on the pore surface of mesoporous silica via SiOSi covalent bond after the synthesis due to its reactive Si(OCH 3) 3 head group, and thus makes the synthesized materials can be easily regenerated for reuse. The obtained materials show great potential in water treatment as pollutants sorbents. © 2011 Elsevier Inc. All rights reserved.

Effects of inhibitors of DNA synthesis and protein synthesis on the rate of DNA synthesis after exposure of mammalian cells to ultraviolet light

International Nuclear Information System (INIS)

Griffiths, T.D.; Dahle, D.B.; Meechan, P.J.; Carpenter, J.G.

1981-01-01

Chinese hamster V-79 cells were treated with metabolic inhibitors of DNA or protein synthesis for various intervals of time after exposure of 3.0 or 5.0 J m -2 . After removal of the metabolic block(s) the rate of DNA synthesis was followed by measuring the incorporation of [ 14 C]thymidine into acid-insoluble material. A 2.5 or 5.0h incubation with cycloheximide or hydroxyurea was effective in delaying the onset of the recovery in the rate of DNA synthesis that normally becomes evident several hours after exposure to ultraviolet light. By using concentrations of cycloheximide or hydroxyurea that inhibit DNA synthesis by a similar amount (70%), but protein synthesis by vastly different amounts (95% for cycloheximide; 0% for hydroxyurea), it was apparent that the delay in recovery caused by the treatment of the cells with cycloheximide could be accounted for entirely by its inhibitory effect on DNA synthesis. This suggests that the recovery in DNA synthetic rates following exposure of V-79 cells to ultraviolet light does not appear to require de novo protein synthesis, and therefore does not appear to require the involvement of an inducible DNA repair process. (Auth.)

Highly Dispersed Pseudo-Homogeneous and Heterogeneous Catalysts Synthesized via Inverse Micelle Solutions for the Liquefaction of Coal

Energy Technology Data Exchange (ETDEWEB)

Hampden-Smith, M.; Kawola, J.S.; Martino, A.; Sault, A.G.; Yamanaka, S.A.

1999-01-05

The mission of this project was to use inverse micelle solutions to synthesize nanometer sized metal particles and test the particles as catalysts in the liquefaction of coal and other related reactions. The initial focus of the project was the synthesis of iron based materials in pseudo-homogeneous form. The frost three chapters discuss the synthesis, characterization, and catalyst testing in coal liquefaction and model coal liquefaction reactions of iron based pseudo-homogeneous materials. Later, we became interested in highly dispersed catalysts for coprocessing of coal and plastic waste. Bifunctional catalysts . to hydrogenate the coal and depolymerize the plastic waste are ideal. We began studying, based on our previously devised synthesis strategies, the synthesis of heterogeneous catalysts with a bifunctional nature. In chapter 4, we discuss the fundamental principles in heterogeneous catalysis synthesis with inverse micelle solutions. In chapter 5, we extend the synthesis of chapter 4 to practical systems and use the materials in catalyst testing. Finally in chapter 6, we return to iron and coal liquefaction now studied with the heterogeneous catalysts.

A Novel Solubility-Enhanced Rubusoside-Based Micelles for Increased Cancer Therapy

Science.gov (United States)

Zhang, Meiying; Dai, Tongcheng; Feng, Nianping

2017-04-01

Many anti-cancer drugs have a common problem of poor solubility. Increasing the solubility of the drugs is very important for its clinical applications. In the present study, we revealed that the solubility of insoluble drugs was significantly enhanced by adding rubusoside (RUB). Further, it was demonstrated that RUB could form micelles, which was well characterized by Langmuir monolayer investigation, transmission electron microscopy, atomic-force microscopy, and cryogenic transmission electron microscopy. The RUB micelles were ellipsoid with the horizontal distance of 25 nm and vertical distance of 1.2 nm. Insoluble synergistic anti-cancer drugs including curcumin and resveratrol were loaded in RUB to form anti-cancer micelles RUB/CUR + RES. MTT assay showed that RUB/CUR + RES micelles had more significant toxicity on MCF-7 cells compared to RUB/CUR micelles + RUB/RES micelles. More importantly, it was confirmed that RUB could load other two insoluble drugs together for remarkably enhanced anti-cancer effect compared to that of RUB/one drug + RUB/another drug. Overall, we concluded that RUB-based micelles could efficiently load insoluble drugs for enhanced anti-cancer effect.

Differential sensitivity to aphidicolin of replicative DNA synthesis and ultraviolet-induced unscheduled DNA synthesis in vivo in mammalian cells

International Nuclear Information System (INIS)

Seki, Shuji; Hosogi, Nobuo; Oda, Takuzo

1984-01-01

In vivo in mammalian cells, ultraviolet-induced unscheduled DNA synthesis was less sensitive to aphidicolin than was replicative DNA synthesis. Replicative DNA synthesis in HeLa, HEp-2, WI-38 VA-13 and CV-1 cells was inhibited more than 97 % by aphidicolin at 10 μg/ml, whereas aphidicolin inhibition of DNA synthesis in ultraviolet-irradiated cells varied between 30 % and 90 % depending on cell types and assay conditions. Aphidicolin inhibition of unscheduled DNA synthesis (UDS) in HeLa cells increased gradually with increasing aphidicolin concentration and reached approximately 90 % at 100 μg/ml aphidicolin. A significant fraction of UDS in ultraviolet-irradiated HEp-2 cells was resistant to aphidicolin even at 300 μg/ml. Considered along with related information reported previously, the present results suggest that both aphidicolin-sensitive and insensitive DNA polymerases, DNA polymerase α and a non-α DNA polymerase (possibly DNA polymerase β), are involved in in situ UDS in these ultraviolet-irradiated cells. Comparison of staphylococcal nuclease sensitivity between DNAs repaired in the presence and in the absence of aphidicolin in HEp-2 cells suggested that the involvement of DNA polymerase α in UDS favored DNA synthesis in the intranucleosomal region. (author)

Micelle-Template Synthesis of Nitrogen-Doped Mesoporous Graphene as an Efficient Metal-Free Electrocatalyst for Hydrogen Production

Science.gov (United States)

Huang, Xiaodan; Zhao, Yufei; Ao, Zhimin; Wang, Guoxiu

2014-12-01

Synthesis of mesoporous graphene materials by soft-template methods remains a great challenge, owing to the poor self-assembly capability of precursors and the severe agglomeration of graphene nanosheets. Herein, a micelle-template strategy to prepare porous graphene materials with controllable mesopores, high specific surface areas and large pore volumes is reported. By fine-tuning the synthesis parameters, the pore sizes of mesoporous graphene can be rationally controlled. Nitrogen heteroatom doping is found to remarkably render electrocatalytic properties towards hydrogen evolution reactions as a highly efficient metal-free catalyst. The synthesis strategy and the demonstration of highly efficient catalytic effect provide benchmarks for preparing well-defined mesoporous graphene materials for energy production applications.

Ternary polyplex micelles with PEG shells and intermediate barrier to complexed DNA cores for efficient systemic gene delivery.

Science.gov (United States)

Li, Junjie; Chen, Qixian; Zha, Zengshi; Li, Hui; Toh, Kazuko; Dirisala, Anjaneyulu; Matsumoto, Yu; Osada, Kensuke; Kataoka, Kazunori; Ge, Zhishen

2015-07-10

Simultaneous achievement of prolonged retention in blood circulation and efficient gene transfection activity in target tissues has always been a major challenge hindering in vivo applications of nonviral gene vectors via systemic administration. Herein, we constructed novel rod-shaped ternary polyplex micelles (TPMs) via complexation between the mixed block copolymers of poly(ethylene glycol)-b-poly{N'-[N-(2-aminoethyl)-2-aminoethyl]aspartamide} (PEG-b-PAsp(DET)) and poly(N-isopropylacrylamide)-b-PAsp(DET) (PNIPAM-b-PAsp(DET)) and plasmid DNA (pDNA) at room temperature, exhibiting distinct temperature-responsive formation of a hydrophobic intermediate layer between PEG shells and pDNA cores through facile temperature increase from room temperature to body temperature (~37 °C). As compared with binary polyplex micelles of PEG-b-PAsp(DET) (BPMs), TPMs were confirmed to condense pDNA into a more compact structure, which achieved enhanced tolerability to nuclease digestion and strong counter polyanion exchange. In vitro gene transfection results demonstrated TPMs exhibiting enhanced gene transfection efficiency due to efficient cellular uptake and endosomal escape. Moreover, in vivo performance evaluation after intravenous injection confirmed that TPMs achieved significantly prolonged blood circulation, high tumor accumulation, and promoted gene expression in tumor tissue. Moreover, TPMs loading therapeutic pDNA encoding an anti-angiogenic protein remarkably suppressed tumor growth following intravenous injection into H22 tumor-bearing mice. These results suggest TPMs with PEG shells and facilely engineered intermediate barrier to inner complexed pDNA have great potentials as systemic nonviral gene vectors for cancer gene therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

Viscoelastic wormlike micelles formed by ionic liquid-type surfactant [C16imC8]Br towards template-assisted synthesis of CdS quantum dots.

Science.gov (United States)

Hu, Yimin; Han, Jie; Ge, Lingling; Guo, Rong

2018-01-31

In this paper, viscoelastic wormlike micelles consisting of cationic liquid-type surfactant, 1-hexadecyl-3-octyl imidazolium bromide ([C 16 imC 8 ]Br), water and different additives were utilized for the synthesis of CdS quantum dots. First, the influence of different additives, such as [Cd(NH 3 ) 6 ]Cl 2 and ethanethioamid (precursors for the synthesis of CdS quantum dots), and temperature on the viscoelasticity of the [C 16 imC 8 ]Br aqueous solution was studied by dynamic and steady rheology. Furthermore, the synthesized CdS quantum dots and their photoluminescence properties were characterized by transmission electron microscopy (TEM), UV-Vis absorption spectroscopy, X-ray diffraction (XRD) and energy-dispersive X-ray spectroscopy (EDX). In the end, the mechanism for the synthesis of CdS quantum dots in [C 16 imC 8 ]Br wormlike micelles is proposed.

Use of scintillometric quantitation of unscheduled DNA synthesis in isolated rat hepatocytes for the screening of genotoxic agents

International Nuclear Information System (INIS)

Hsia, M.T.

1987-01-01

The induction of unscheduled DNA synthesis has been considered as a suitable endpoint for the screening of genotoxic agents. Experimentally, unscheduled DNA synthesis is most frequently measured by autoradiography. The purpose of this report was to examine the usefulness of the liquid scintillation counting technique in measuring unscheduled DNA synthesis response in isolated rat hepatocytes. The various liquid scintillation counting-based unscheduled DNA synthesis assay procedures were examined according to the following groupings: (1) procedures based on the acid precipitation of cellular macromolecules, (2) procedures based on isopycnic gradient centrifugation of solubilized cells, (3) procedures based on nuclei isolation in conjunction with other DNA purification methods, and (4) procedures based on the selective retention of hepatocellular DNA. Limited cases in which test chemicals gave positive unscheduled DNA synthesis response in liquid scintillation counting-based assays and negative unscheduled DNA synthesis response in autoradiography-based assays are presented. It is concluded that liquid scintillation counting-based unscheduled DNA synthesis assays represent an appropriate system for inclusion in carcinogenicity and mutagenicity testing programs

The fabrication of nanopatterns with Au nanoparticles-embedded micelles via nanoimprint lithography

Energy Technology Data Exchange (ETDEWEB)

Lee, Jung-Pil; Kim, Eun-Uk; Koh, Haeng-Deog; Kang, Nam-Goo; Jung, Gun-Young; Lee, Jae-Suk, E-mail: gyjung@gist.ac.k, E-mail: jslee@gist.ac.k [Department of Materials Science and Engineering, Gwangju Institute of Science and Technology (GIST), 261 Cheomdan-gwagiro (Oryong-dong), Buk-gu Gwangju 500-712 (Korea, Republic of)

2009-09-09

We fabricated nanopatterns with Au nanoparticles-embedded micelles (Au-micelles) by self-assembly of block copolymers via nanoimprint lithography. The micelle structure prepared by self-assembled block copolymers was used as a template for the synthesis of Au nanoparticles (Au NPs). Au NPs were synthesized in situ inside the micelles of polystyrene-block-poly(2-vinylpyridine) (PS- b-P2VP). Au-micelles were arranged on the trenches of the polymer template, which was imprinted by nanoimprint lithography. The fabrication of line-type and dot-type nanopatterns was carried out by the combined method. In addition, multilayer nanopatterns of the Au-micelles were also proposed.

Micelle swelling agent derived cavities for increasing hydrophobic organic compound removal efficiency by mesoporous micelle@silica hybrid materials

KAUST Repository

Shi, Yifeng; Li, Bin; Wang, Peng; Dua, Rubal; Zhao, Dongyuan

2012-01-01

Mesoporous micelle@silica hybrid materials with 2D hexagonal mesostructures were synthesized as reusable sorbents for hydrophobic organic compounds (HOCs) removal by a facile one-step aqueous solution synthesis using 3-(trimethoxysily)propyl

Design, Synthesis, and Evaluation of Novel Tyrosine-Based DNA Gyrase B Inhibitors.

Science.gov (United States)

Cotman, Andrej E; Trampuž, Marko; Brvar, Matjaž; Kikelj, Danijel; Ilaš, Janez; Peterlin-Mašič, Lucija; Montalvão, Sofia; Tammela, Päivi; Frlan, Rok

2017-08-01

The discovery and synthesis of new tyrosine-based inhibitors of DNA gyrase B (GyrB), which target its ATPase subunit, is reported. Twenty-four compounds were synthesized and evaluated for activity against DNA gyrase and DNA topoisomerase IV. The antibacterial properties of selected GyrB inhibitors were demonstrated by their activity against Staphylococcus aureus and Enterococcus faecalis in the low micromolar range. The most promising compounds, 8a and 13e, inhibited Escherichia coli and S. aureus GyrB with IC 50 values of 40 and 30 µM. The same compound also inhibited the growth of S. aureus and E. faecalis with minimal inhibitory concentrations (MIC 90 ) of 14 and 28 µg/mL, respectively. © 2017 Deutsche Pharmazeutische Gesellschaft.

Synthesis and immobilization of polystyreneb-polyvinyltriethoxysilane micelles

KAUST Repository

Zhu, Saisai; Zhu, Hui; Xia, Ru; Feng, Xiaoshuang; Chen, Peng; Qian, Jiasheng; Cao, Ming; Yang, Bin; Miao, Jibin; Su, Lifen; Song, Changjiang

2018-01-01

Diblock copolymers polystyrene-block-polyvinyltriethoxysilane (PS-b-PVTES) were synthesized via atom transfer radical polymerization (ATRP), which self-assembled into spherical micelles in solvent of THF-methanol mixtures. The self

Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

Science.gov (United States)

Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

2010-05-04

A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

Synthesis of [Fe(Leq(Lax]n coordination polymer nanoparticles using blockcopolymer micelles

Directory of Open Access Journals (Sweden)

Christoph Göbel

2017-06-01

Full Text Available Spin-crossover compounds are a class of materials that can change their spin state from high spin (HS to low spin (LS by external stimuli such as light, pressure or temperature. Applications demand compounds with defined properties concerning the size and switchability that are maintained when the compound is integrated into composite materials. Here, we report the synthesis of [Fe(Leq(Lax]n coordination polymer (CP nanoparticles using self-assembled polystyrene-block-poly(4-vinylpyridine (PS-b-P4VP block copolymer (BCP micelles as template. Variation of the solvent (THF and toluene and the rigidity of the axial ligand Lax (Lax = 1,2-di(pyridin-4-ylethane (bpea, trans-1,2-di(pyridin-4-ylethene (bpee, and 1,2-di(pyridin-4-ylethyne (bpey; Leq = 1,2-phenylenebis(iminomethylidyne-bis(2,4-pentanedionato(2− allowed the determination of the preconditions for the selective formation of nanoparticles. A low solubility of the CP in the used solvent and a high stability of the Fe–L bond with regard to ligand exchange are necessary for the formation of composite nanoparticles where the BCP micelle is filled with the CP, as in the case of the [FeLeq(bpey]n@BCP. Otherwise, in the case of more flexible ligands or ligands that lead to high spin complexes, the formation of microcrystals next to the CP–BCP nanoparticles is observed above a certain concentration of [Fe(Leq(Lax]n. The core of the nanoparticles is about 45 nm in diameter due to the templating effect of the BCP micelle, independent of the used iron complex and [Fe(Leq(Lax]n concentration. The spin-crossover properties of the composite material are similar to those of the bulk for FeLeq(bpea]n@BCP while pronounced differences are observed in the case of [FeLeq(bpey]n@BCP nanoparticles.

Novel hierarchical microparticles super-assembled from nanoparticles with the induction of casein micelles

Energy Technology Data Exchange (ETDEWEB)

Xiong, Xiaopeng, E-mail: xpxiong@xmu.edu.cn; Duan, Jiangjiang; Wang, Yong; Yu, Zhaoju [Xiamen University, Department of Materials Science and Engineering, College of Materials (China)

2013-08-15

We have demonstrated a solution-based synthesis of novel waxberry-like hierarchical ZnO microparticles in the presence casein micelles under mild conditions. The microstructures of the sub-micrometer-sized hierarchical microparticles were characterized, and the synthesis conditions were optimized. The formation mechanism of the hierarchical microparticle was analyzed through control experiments. The hierarchical ZnO microparticles are found to be super-assemblies of 30-70 nm ZnO nanoparticles, which are thought to be based on casein micelle induction followed by Ostwald ripening. In the same manner, copper-based hierarchical microparticles with a similar morphology have also been successfully synthesized. By controlling the synthetic time or temperature, solid or hollow microparticles can be fabricated. The narrowly distributed ZnO microparticles have a high specific surface area, exhibiting great potential application in fields such as photocatalytic and energy conversion. Our findings may meanwhile open a new bottom-up strategy in order to construct structurally sophisticated nanomaterials.

Novel hierarchical microparticles super-assembled from nanoparticles with the induction of casein micelles

Science.gov (United States)

Xiong, Xiaopeng; Duan, Jiangjiang; Wang, Yong; Yu, Zhaoju

2013-08-01

We have demonstrated a solution-based synthesis of novel waxberry-like hierarchical ZnO microparticles in the presence casein micelles under mild conditions. The microstructures of the sub-micrometer-sized hierarchical microparticles were characterized, and the synthesis conditions were optimized. The formation mechanism of the hierarchical microparticle was analyzed through control experiments. The hierarchical ZnO microparticles are found to be super-assemblies of 30-70 nm ZnO nanoparticles, which are thought to be based on casein micelle induction followed by Ostwald ripening. In the same manner, copper-based hierarchical microparticles with a similar morphology have also been successfully synthesized. By controlling the synthetic time or temperature, solid or hollow microparticles can be fabricated. The narrowly distributed ZnO microparticles have a high specific surface area, exhibiting great potential application in fields such as photocatalytic and energy conversion. Our findings may meanwhile open a new bottom-up strategy in order to construct structurally sophisticated nanomaterials.

Novel hierarchical microparticles super-assembled from nanoparticles with the induction of casein micelles

International Nuclear Information System (INIS)

Xiong, Xiaopeng; Duan, Jiangjiang; Wang, Yong; Yu, Zhaoju

2013-01-01

We have demonstrated a solution-based synthesis of novel waxberry-like hierarchical ZnO microparticles in the presence casein micelles under mild conditions. The microstructures of the sub-micrometer-sized hierarchical microparticles were characterized, and the synthesis conditions were optimized. The formation mechanism of the hierarchical microparticle was analyzed through control experiments. The hierarchical ZnO microparticles are found to be super-assemblies of 30–70 nm ZnO nanoparticles, which are thought to be based on casein micelle induction followed by Ostwald ripening. In the same manner, copper-based hierarchical microparticles with a similar morphology have also been successfully synthesized. By controlling the synthetic time or temperature, solid or hollow microparticles can be fabricated. The narrowly distributed ZnO microparticles have a high specific surface area, exhibiting great potential application in fields such as photocatalytic and energy conversion. Our findings may meanwhile open a new bottom-up strategy in order to construct structurally sophisticated nanomaterials

Synthesis and characterization of Fe colloid catalysts in inverse micelle solutions

Energy Technology Data Exchange (ETDEWEB)

Martino, A.; Stoker, M.; Hicks, M. [Sandia National Lab., Alburquerque, NM (United States)] [and others

1995-12-31

Surfactant molecules, possessing a hydrophilic head group and a hydrophobic tail group, aggregate in various solvents to form structured solutions. In two component mixtures of surfactant and organic solvents (e.g., toluene and alkanes), surfactants aggregate to form inverse micelles. Here, the hydrophilic head groups shield themselves by forming a polar core, and the hydrophobic tails groups are free to move about in the surrounding oleic phase. The formation of Fe clusters in inverse miscelles was studied.Iron salts are solubilized within the polar interior of inverse micelles, and the addition of the reducing agent LiBH{sub 4} initiates a chemical reduction to produce monodisperse, nanometer sized Fe based particles. The reaction sequence is sustained by material exchange between inverse micelles. The surfactant interface provides a spatial constraint on the reaction volume, and reactions carried out in these micro-heterogeneous solutions produce colloidal sized particles (10-100{Angstrom}) stabilized in solution against flocculation of surfactant. The clusters were stabilized with respect to size with transmission electron microscopy (TEM) and with respect to chemical composition with Mossbauer spectroscopy, electron diffraction, and x-ray photoelectron spectroscopy (XPS). In addition, these iron based clusters were tested for catalytic activity in a model hydrogenolysis reaction. The hydrogenolysis of naphthyl bibenzyl methane was used as a model for coal pyrolysis.

Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

Science.gov (United States)

Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai

2010-01-01

The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

Diketopyrrolopyrrole Amphiphile-Based Micelle-Like Fluorescent Nanoparticles for Selective and Sensitive Detection of Mercury(II) Ions in Water.

Science.gov (United States)

Nie, Kaixuan; Dong, Bo; Shi, Huanhuan; Liu, Zhengchun; Liang, Bo

2017-03-07

A technique for encapsulating fluorescent organic probes in a micelle system offers an important alternative method to manufacture water-soluble organic nanoparticles (ONPs) for use in sensing Hg 2+ . This article reports on a study of a surfactant-free micelle-like ONPs based on a 3,6-di(2-thienyl)-2,5-dihydropyrrolo[3,4-c]pyrrole-1,4-dione (TDPP) amphiphile, (2-(2-(2-methoxyethoxy)ethyl)-3,6-di(2-thiophyl)-2,5-dihydropyrrolo[3,4-c]pyrrole-1,4-dione (NDPP) fabricated to monitor Hg 2+ in water. NDPP was synthesized through a simple one-step modification of a commercially available dye TDPP with a flexible and hydrophilic alkoxy. This study reports, for the first time, that TDPP dyes can respond reversibly, sensitively, and selectively to Hg 2+ through TDPP-Hg-TDPP complexation, similar to the well-known thymine(T)-Hg-thymine(T) model and the accompanying molecular aggregation. Interestingly, transmission electron microscopy (TEM) and dynamic light scattering (DLS) confirmed that, in water, NDPP forms loose micelle-like fluorescent ONPs with a hydrohobic TDPP portion encapsulated inside. These micelle-like nanoparticles offer an ideal location for TDPP-Hg complexation with a modest molecular aggregation, thereby providing both clear visual and spectroscopic signals for Hg 2+ sensing. An estimated detection limit of 11 nM for Hg 2+ sensing with this NDPP nanoparticle was obtained. In addition, NDPP ONPs show good water solubility and high selectivity to Hg 2+ in neutral or alkalescent water. It was superior to most micelle-based nanosensors, which require a complicated process in the selection or synthesis of suitable surfactants. The determinations in real samples (river water) were made and satisfactory results were achieved. This study provides a low-cost strategy for fabricating small molecule-based fluorescent nanomaterials for use in sensing Hg 2+ . Moreover, the NDPP nanoparticles show potential ability in Hg 2+ ion adsorption and recognization of cysteine

Radiation-induced depression of DNA synthesis in cultured mammalian cells

International Nuclear Information System (INIS)

Povirk, L.F.

1977-01-01

A 313-nm light source was constructed in order to study the mechanisms by which ultraviolet and ionizing radiations inhibit DNA synthesis. It was found that in CHO, MDBK and HeLa cells, grown for one generation in the DNA sensitizer bromodeoxyuridine (BrdUrd), 313-nm light inhibited DNA synthesis with a pattern similar to that of the effect of x-rays on normal cells. A biphasic dose response curve for inhibition of total synthesis was observed, with a sensitive component representing depression of initiation of new replicons and a resistant component representing interference with elongation of replicons already growing at the time of irradiation. Since the BrdUrd plus 313-nm light treatment produces DNA lesions similar to those produced by x-rays (base damage, strand breaks, crosslinks) these results suggest that the effect of x-rays on DNA synthesis is mediated by DNA damage. In experiments with synchronized cells, it was found that in cells in which about half the chromosomes had incorporated BrdUrd, 313-nm light inhibited replication of the BrdUrd-containing DNA, but had no effect on the replication of the unsubstituted DNA in the same cell. Thus the information that DNA is damaged appears to be propagated along the DNA molecule from the sites of damage to the replication initiation sites as some kind of conformational change, possibly a relaxation of superhelical tension. Target theory calculations suggest that a single DNA lesion prevents the initiation of several adjacent replicons

Multi-line split DNA synthesis: a novel combinatorial method to make high quality peptide libraries

Directory of Open Access Journals (Sweden)

Ueno Shingo

2004-09-01

Full Text Available Abstract Background We developed a method to make a various high quality random peptide libraries for evolutionary protein engineering based on a combinatorial DNA synthesis. Results A split synthesis in codon units was performed with mixtures of bases optimally designed by using a Genetic Algorithm program. It required only standard DNA synthetic reagents and standard DNA synthesizers in three lines. This multi-line split DNA synthesis (MLSDS is simply realized by adding a mix-and-split process to normal DNA synthesis protocol. Superiority of MLSDS method over other methods was shown. We demonstrated the synthesis of oligonucleotide libraries with 1016 diversity, and the construction of a library with random sequence coding 120 amino acids containing few stop codons. Conclusions Owing to the flexibility of the MLSDS method, it will be able to design various "rational" libraries by using bioinformatics databases.

Control of DNA synthesis in inhibited and activated Agrostemma githago seeds

Energy Technology Data Exchange (ETDEWEB)

Hecker, M [Sektion Biologie, FG Algemeine Botanik und Pflanzenphysiologie, Universitaet Greifswald (German Democratic Republic)

1975-01-01

The relationships between DNA synthesis and germination capacity of Agrostemma seeds had been studied. Protein synthesis and RNA synthesis were activated at the very beginning of imbibition, whereas DNA synthesis started in the second part of the imbibition phase. Agrostemma seeds inhibited by higher temperature (30 degC), or aged seeds with a low germination capacity were characterized by a significantly reduced protein synthesis. DNA synthesis was also reduced. The inhibition of the protein synthesis of Agrostemma embryos fed with cycloheximide or actinomycin D caused a depression of DNA synthesis. The results indicated that the initiation of DNA synthesis of imbibing Agrostemma seeds depended on the synthesis of special proteins. Abscisic acid inhibited the growth as well as DNA synthesis of isolated Agrostemma embryos. Nitomycin inhibited germination and DNA synthesis to the same extent. Dormant seeds with an undiminished intensity of protein synthesis also showed a reduced incorporation of /sup 3/H-thymidine by DNA. It is suggested that DNA synthesis of imbibed seeds, which is a necessary prerequisite for the radicle protrusion, was involved in the mechanism of ripening of the Agrostemma seeds.

Control of DNA synthesis in inhibited and activated Agrostemma githago seeds

International Nuclear Information System (INIS)

Hecker, M.

1975-01-01

The relationships between DNA synthesis and germination capacity of Agrostemma seeds had been studied. Protein synthesis and RNA synthesis were activated at the very beginning of imbibition, whereas DNA synthesis started in the second part of the imbibition phase. Agrostemma seeds inhibited by higher temperature (30 degC), or aged seeds with a low germination capacity were characterized by a significantly reduced protein synthesis. DNA synthesis was also reduced. The inhibition of the protein synthesis of Agrostemma embryos fed with cycloheximide or actinomycin D caused a depression of DNA synthesis. The results indicated that the initiation of DNA synthesis of imbibing Agrostemma seeds depended on the synthesis of special proteins. Abscisic acid inhibited the growth as well as DNA synthesis of isolated Agrostemma embryos. Nitomycin inhibited germination and DNA synthesis to the same extent. Dormant seeds with an undiminished intensity of protein synthesis also showed a reduced incorporation of 3 H-thymidine by DNA. It is suggested that DNA synthesis of imbibed seeds, which is a necessary prerequisite for the radicle protrusion, was involved in the mechanism of ripening of the Agrostemma seeds. (author)

Synthesis and NMR of {sup 15}N-labeled DNA fragments

Energy Technology Data Exchange (ETDEWEB)

Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

1994-12-01

DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

Radiation metagenesis and inhibition of DNA synthesis

International Nuclear Information System (INIS)

Dubinina, L.G.; Sergievskaya, S.P.; Kurashova, Z.I.; Dubinin, N.P.

1983-01-01

The study of modification of radiation mutagenesis and inhibition of the DNA synthesis by means of 1-β-D arabinofuranosylcytosine (ara-C) is carried out. It is shown that ara-C-acting on chromosomes in the G 1 phase and G 2 phase does not cause mutations in the C capillaris cells. The modification by means of ara-C radiation effect in the G 1 phase and G 2 phase correlates with duration and time of administering ara-C before and after irradiation. A new form of ara-C DNA synthesis inhibitor interaction with mutation processes has been found out. Protective effect of the DNA synthesis inhibitor (ara-C) from mutageneous radiation effect is stressed. Sensibilization of the radiation mutagenesis during cell treafment by the DNA synthesis inhibitor (ara-C) is shown. It is pointed out that emergence of sensibilization or protective effect, i. e. antimutagenesis phenomenon depends on conditions under which the synthesis inhibitor acted in G 1 and G 2 phases

HPMA-based polymeric micelles for curcumin solubilization and inhibition of cancer cell growth.

Science.gov (United States)

Naksuriya, Ornchuma; Shi, Yang; van Nostrum, Cornelus F; Anuchapreeda, Songyot; Hennink, Wim E; Okonogi, Siriporn

2015-08-01

Curcumin (CM) has been reported as a potential anticancer agent. However, its pharmaceutical applications as therapeutic agent are hampered because of its poor aqueous solubility. The present study explores the advantages of polymeric micelles composed of block copolymers of methoxypoly(ethylene glycol) (mPEG) and N-(2-hydroxypropyl) methacrylamide (HPMA) modified with monolactate, dilactate and benzoyl side groups to enhance CM solubility and inhibitory activity against cancer cells. Amphiphilic block copolymers, ω-methoxypoly(ethylene glycol)-b-(N-(2-benzoyloxypropyl) methacrylamide) (PEG-HPMA-Bz) were synthesized and characterized by (1)H NMR and GPC. One polymer with a molecular weight of 28,000Da was used to formulate CM and compared with other aromatic substituted polymers. CM was loaded by a fast heating method (PEG-HPMA-DL and PEG-HPMA-Bz-L) and a nanoprecipitation method (PEG-HPMA-Bz). Physicochemical characteristics and cytotoxicity/cytocompatibility of the CM loaded polymeric micelles were evaluated. It was found that HPMA-based polymeric micelles significantly enhanced the solubility of CM. The PEG-HPMA-Bz micelles showed the best solubilization properties. CM loaded polymeric micelles showed sustained release of the loading CM for more than 20days. All of CM loaded polymeric micelles formulations showed a significantly potent cytotoxic effect against three cancer cell lines. HPMA-based polymeric micelles are therefore promising nanodelivery systems of CM for cancer therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

Role of Synthetic and Dimensional Synthetic Organic Chemistry in Block Copolymer Micelle Nanosensor Engineering

DEFF Research Database (Denmark)

Ek, Pramod Kumar

This thesis investigated the role of amphiphilic triblock copolymer micelle nanomaterials in nanosensors, with emphasis on the synthesis of micelle particle sensors. The thesis is focused on the role of synthetic and dimensional synthetic organic chemistry in amphiphilic triblock core-shellcorona...

Self-Assembly of Calix[4]arene-Based Amphiphiles Bearing Polyethylene Glycols: Another Example of "Platonic Micelles".

Science.gov (United States)

Yoshida, Kenta; Fujii, Shota; Takahashi, Rintaro; Matsumoto, Sakiko; Sakurai, Kazuo

2017-09-12

The aggregation number of classical micelles exhibits a certain distribution, which is a recognizable feature of conventional micelles. However, we recently identified perfectly monodisperse calix[4]arene-based micelles whose aggregation numbers agree with the vertex numbers of regular polyhedra, that is, Platonic solids, and thus they are named "Platonic micelles". Regarding our hypothesis of the formation mechanism of Platonic micelles, both repulsive interactions including steric hindrance and electrostatic repulsions among the headgroups are important for determining their aggregation number; however, neither of these is necessarily needed to consider. In this study, we employed polyethylene glycols (PEGs) as the nonionic headgroup of calix[4]arene-based amphiphiles to study the effects of only repulsive interactions caused by steric hindrance on the formation of Platonic micelles. The amphiphiles containing relatively low-molecular-weight PEGs (550 or 1000 g mol -1 ) form dodecamer or octamer micelles, respectively, with no variation in the aggregation number. However, relatively high-molecular-weight PEGs (2000 g mol -1 ) produce polydispersed micelles with a range of aggregation number. PEG 2000 exhibits a greater affinity for water than PEG 550 and 1000, resulting in fewer hydrophobic interactions in micelle formation, as indicated by the drastic increase of the critical micelle concentration (CMC) value in the PEG 2000 system. The instability of the structure of PEG 2k CaL5 micelles might contribute to the higher mobility of PEG in the micellar shell, resulting in a non-Platonic aggregation number with polydispersity.

The proofreading 3'→5' exonuclease activity of DNA polymerases: a kinetic barrier to translesion DNA synthesis

International Nuclear Information System (INIS)

Khare, Vineeta; Eckert, Kristin A.

2002-01-01

The 3'→5' exonuclease activity intrinsic to several DNA polymerases plays a primary role in genetic stability; it acts as a first line of defense in correcting DNA polymerase errors. A mismatched basepair at the primer terminus is the preferred substrate for the exonuclease activity over a correct basepair. The efficiency of the exonuclease as a proofreading activity for mispairs containing a DNA lesion varies, however, being dependent upon both the DNA polymerase/exonuclease and the type of DNA lesion. The exonuclease activities intrinsic to the T4 polymerase (family B) and DNA polymerase γ (family A) proofread DNA mispairs opposite endogenous DNA lesions, including alkylation, oxidation, and abasic adducts. However, the exonuclease of the Klenow polymerase cannot discriminate between correct and incorrect bases opposite alkylation and oxidative lesions. DNA damage alters the dynamics of the intramolecular partitioning of DNA substrates between the 3'→5' exonuclease and polymerase activities. Enzymatic idling at lesions occurs when an exonuclease activity efficiently removes the same base that is preferentially incorporated by the DNA polymerase activity. Thus, the exonuclease activity can also act as a kinetic barrier to translesion synthesis (TLS) by preventing the stable incorporation of bases opposite DNA lesions. Understanding the downstream consequences of exonuclease activity at DNA lesions is necessary for elucidating the mechanisms of translesion synthesis and damage-induced cytotoxicity

Controlling the Size and Shape of the Elastin-Like Polypeptide based Micelles

Science.gov (United States)

Streletzky, Kiril; Shuman, Hannah; Maraschky, Adam; Holland, Nolan

Elastin-like polypeptide (ELP) trimer constructs make reliable environmentally responsive micellar systems because they exhibit a controllable transition from being water-soluble at low temperatures to aggregating at high temperatures. It has been shown that depending on the specific details of the ELP design (length of the ELP chain, pH and salt concentration) micelles can vary in size and shape between spherical micelles with diameter 30-100 nm to elongated particles with an aspect ratio of about 10. This makes ELP trimers a convenient platform for developing potential drug delivery and bio-sensing applications as well as for understanding micelle formation in ELP systems. Since at a given salt concentration, the headgroup area for each foldon should be constant, the size of the micelles is expected to be proportional to the volume of the linear ELP available per foldon headgroup. Therefore, adding linear ELPs to a system of ELP-foldon should result in changes of the micelle volume allowing to control micelle size and possibly shape. The effects of addition of linear ELPs on size, shape, and molecular weight of micelles at different salt concentrations were studied by a combination of Dynamic Light Scattering and Static Light Scattering. The initial results on 50 µM ELP-foldon samples (at low salt) show that Rh of mixed micelles increases more than 5-fold as the amount of linear ELP raised from 0 to 50 µM. It was also found that a given mixture of linear and trimer constructs has two temperature-based transitions and therefore displays three predominant size regimes.

DNA synthesis in vitro in human fibroblast preparations

Energy Technology Data Exchange (ETDEWEB)

Kaufmann, W.K.

1983-01-01

When confluent cultures of human fibroblasts were ultraviolet irradiated and either permeabilized or lysed, three types of DNA synthesis were subsequently observed during incubation in vitro: (A) a low level of DNA replication, which ceased after 15-30 min incubation at 37/sup 0/C; (B) radiation-dependent reparative gap-filling, which also ceased after 15 min at 37/sup 0/C; and (C) radiation-independent DNA synthesis, which was not semiconservative and proceeded at a linear rate for 1 hr at 37/sup 0/C. Normal and xeroderma pigmentosum fibroblasts displayed different rates of radiation-dependent reparative gap-filling after lysis but similar rates of radiation-independent DNA synthesis. The rates of DNA replication and radiation-independent DNA synthesis were less in the permeable cell system than in the lysed cell system, whereas radiation-dependent reparative gap-filling was the same in both. Preparations of permeable and lysed cells activated radiation-dependent reparative gap-filling at about 15% of the rate estimated for intact cells. No radiation-dependent DNA strand breaks, as assayed by alkaline elution, were observed in the lysed cell preparation. Some radiation-dependent breaks were observed in the permeable cell preparation, but radiation-dependent DNA breakage was less than that seen in intact cells. This inability to incise DNA at damaged sites could account for the low rate of activation of reparative gap-filling in vitro. DNA strand breaks were produced in fibroblast preparations nonspecifically during lysis or permeabilization and incubation in vitro, and this breakage of DNA probably was responsible for the radiation-independent DNA synthesis.

DnaB gene product-independence of DNA polymerase III-directed repair synthesis in Escherichia coli K-12

International Nuclear Information System (INIS)

Billen, D.; Hellermann, G.R.

1977-01-01

An investigation has been carried out into the role of dnaB gene product in X-ray-induced repair synthesis carried out by DNA polymerase III in toluene-treated Escherichia coli K-12. A polAl polBlOO dnaB mutant deficient in both DNA polymerase I and II activities was used, and it was shown that the level of X-ray-induced, ATP-dependent, non-conservative DNA synthesis was, unlike semi-conservative DNA synthesis, unaffected by a temperature shift from 30 0 to 42 0 C. The dnaB gene product was not therefore necessary for DNA polymerase III-directed repair synthesis, which occurred in the absence of replicative synthesis. (U.K.)

DNA-repair synthesis in ataxia telangiectasia lymphoblastoid cells

Energy Technology Data Exchange (ETDEWEB)

Ford, M.D.; Houldsworth, J.; Lavin, M.F. (Queensland Univ., Brisbane (Australia). Dept. of Biochemistry)

1981-12-01

The ability of a number of Epstein-Barr virus-transformed lymphoblastoid cells from ataxia telangiectasia (AT) patients to repair ..gamma..-radiation damage to DNA was determined. All of these AT cells were previously shown to be hypersensitive to ..gamma..-radiation. Two methods were used to determine DNA-repair synthesis: isopycnic gradient analysis and a method employing hydroxyurea to inhibit semiconservative DNA synthesis. Control, AT heterozygote and AT homozygote cells were demonstrated to have similar capacities for repair of radiation damage to DNA. In addition at high radiation doses (10-40 krad) the extent of inhibition of DNA synthesis was similar in the different cell types.

Inhibition of DNA replication, DNA repair synthesis, and DNA polymerases α and δ by butylphenyl deoxyguanosine triphosphate

International Nuclear Information System (INIS)

Dreslor, S.L.; Frattini, M.G.

1987-01-01

Semiconservative DNA replication in growing mammalian cells and ultraviolet (UV)-induced DNA repair synthesis in nongrowing mammalian cells are mediated by one or both of the aphidicolin-sensitive DNA polymerases, α and/or δ. They have studied the inhibition of replication and repair synthesis in permeable human cells by N 2 (p-n-butylphenyl)-2'-deoxyguanosine-5'-triphosphate (BuPh dGTP), an agent which inhibits polymerase α strongly and polymerase δ weakly. Both processes are inhibited by BuPh-dGTP in competition with dGTP. The K/sub i/'s are, for replication, 2-3 μM and, for repair synthesis, 3-4 μM, consistent with the involvement of the same DNA polymerase in both processes. Inhibition of isolated human polymerase α by BuPh-dGTP is also competitive with dGTP, but the K/sub i/ is approximately 10 nM, several hundred-fold lower than the K/sub i/'s of replication and repair synthesis. Isolated polymerase δ is inhibited by BuPh-dGTP at doses similar to those which inhibit replication and repair synthesis, however, attempts to determine the K/sub i/ of polymerase δ were hampered by the finding that the dependence of δ activity on deoxyribunucleotide concentration is parabolic at low doses. This behavior differs from the behavior of polymerase α and of cellular DNA replication and repair synthesis, all of which show a simple, hyperbolic relationship between activity and deoxyribonucleotide concentration. Thus, inhibition of DNA replication and UV induced DNA repair synthesis by BuPh dGTP is quantitatively similar to DNA polymerase δ, but some other characteristics of the cellular processes are more similar to those of polymerase α

Effects of carcinogen treatment on rat liver DNA synthesis in vivo and on nascent DNA synthesis and elongation in cultured hepatocytes

International Nuclear Information System (INIS)

Zurlo, J.; Mignano, J.E.; Eustice, D.C.; Poirier, M.C.; Yager, J.D.

1986-01-01

One objective of this study was to determine the effects of N-hydroxy-2-acetylaminofluorene (N-OH-AAF) treatment on DNA synthesis in regenerating rat liver. It was found that N-OH-AAF caused a dose-dependent inhibition of [ 3 H]thymidine incorporation into liver DNA. This inhibition was followed by a gradual, but incomplete recovery. The second objective of the study was to determine the effects of DNA damage on the size distribution and elongation of nascent hepatocyte DNA. Hepatocytes, which have been shown to demonstrate a pattern of inhibition and subsequent recovery of DNA synthesis following UV irradiation similar to that seen in vivo upon treatment with N-OH-AAF were cultured. The size distribution of nascent DNA after UV irradiation was determined by pH step gradient alkaline elution analysis. The results show that UV irradiation caused a dose-dependent decrease in the size distribution of nascent DNA suggesting an inhibition of elongation. The results show that resumption of DNA synthesis and nascent strand elongation occur on damaged templates. These observations along with previous studies support the idea that DNA damage leading to inhibition of DNA synthesis may induce SOS-type processes which if mutagenic may play a role in the initiation of carcinogenesis. (Auth.)

Green Tea Catechin-Based Complex Micelles Combined with Doxorubicin to Overcome Cardiotoxicity and Multidrug Resistance

Science.gov (United States)

Cheng, Tangjian; Liu, Jinjian; Ren, Jie; Huang, Fan; Ou, Hanlin; Ding, Yuxun; Zhang, Yumin; Ma, Rujiang; An, Yingli; Liu, Jianfeng; Shi, Linqi

2016-01-01

Chemotherapy for cancer treatment has been demonstrated to cause some side effects on healthy tissues and multidrug resistance of the tumor cells, which greatly limits therapeutic efficacy. To address these limitations and achieve better therapeutic efficacy, combination therapy based on nanoparticle platforms provides a promising approach through delivering different agents simultaneously to the same destination with synergistic effect. In this study, a novel green tea catechin-based polyion complex (PIC) micelle loaded with doxorubicin (DOX) and (-)-Epigallocatechin-3-O-gallate (EGCG) was constructed through electrostatic interaction and phenylboronic acid-catechol interaction between poly(ethylene glycol)-block-poly(lysine-co-lysine-phenylboronic acid) (PEG-PLys/PBA) and EGCG. DOX was co-loaded in the PIC micelles through π-π stacking interaction with EGCG. The phenylboronic acid-catechol interaction endowed the PIC micelles with high stability under physiological condition. Moreover, acid cleavability of phenylboronic acid-catechol interaction in the micelle core has significant benefits for delivering EGCG and DOX to same destination with synergistic effects. In addition, benefiting from the oxygen free radicals scavenging activity of EGCG, combination therapy with EGCG and DOX in the micelle core could protect the cardiomyocytes from DOX-mediated cardiotoxicity according to the histopathologic analysis of hearts. Attributed to modulation of EGCG on P-glycoprotein (P-gp) activity, this kind of PIC micelles could effectively reverse multidrug resistance of cancer cells. These results suggested that EGCG based PIC micelles could effectively overcome DOX induced cardiotoxicity and multidrug resistance. PMID:27375779

Direct on-chip DNA synthesis using electrochemically modified gold electrodes as solid support

Science.gov (United States)

Levrie, Karen; Jans, Karolien; Schepers, Guy; Vos, Rita; Van Dorpe, Pol; Lagae, Liesbet; Van Hoof, Chris; Van Aerschot, Arthur; Stakenborg, Tim

2018-04-01

DNA microarrays have propelled important advancements in the field of genomic research by enabling the monitoring of thousands of genes in parallel. The throughput can be increased even further by scaling down the microarray feature size. In this respect, microelectronics-based DNA arrays are promising as they can leverage semiconductor processing techniques with lithographic resolutions. We propose a method that enables the use of metal electrodes for de novo DNA synthesis without the need for an insulating support. By electrochemically functionalizing gold electrodes, these electrodes can act as solid support for phosphoramidite-based synthesis. The proposed method relies on the electrochemical reduction of diazonium salts, enabling site-specific incorporation of hydroxyl groups onto the metal electrodes. An automated DNA synthesizer was used to couple phosphoramidite moieties directly onto the OH-modified electrodes to obtain the desired oligonucleotide sequence. Characterization was done via cyclic voltammetry and fluorescence microscopy. Our results present a valuable proof-of-concept for the integration of solid-phase DNA synthesis with microelectronics.

DNA-synthesis inhibition and repair DNA-synthesis in CHO Ade- C cells: An alternative approach to genotoxicity testing

International Nuclear Information System (INIS)

Slamenova, D.; Papsova, E.; Gabelova, A.; Dusinska, M.; Collins, A.; Wsolova, L.

1997-01-01

We describe an alternative assay to determine genotoxicity. Its main feature is that it combines two measures in a single experiment; the inhibition of replicative DNA synthesis together with the stimulation of DNA repair. We show that, in tests of four different genotoxic agents, the assay gives results that are entirely consistent with what is known about the mode of action of these agents. In addition, we have demonstrated that chemical carcinogens requiring metabolic activation can be examined using a standard procedure of incubation with a microsomal activating fraction. We consider the combined assay for DNA synthesis inhibition and repair synthesis to be a useful way for the rapid pre-screening of chemicals suspected of genotoxic activity on the level of mammalian cells. (author)

Effects of DNA polymerase inhibitors on replicative and repair DNA synthesis in ultraviolet-irradiated HeLa cells

International Nuclear Information System (INIS)

Morita, T.; Nakamura, H.; Tsutsui, Y.; Nishiyama, Y.; Yoshida, S.

1982-01-01

Aphidicolin specifically inhibits eukaryotic DNA polymerase α, while 2',3'-dideoxythymidine 5'-triphosphate (d 2 TTP) inhibits DNA polymerase ν and ν but not α. 1-ν-D-Arabinofuranosylcytosine 5'-triphosphate (araCTP) inhibits both DNA polymerase α and ν although to a different extent. Here we measured the effects of these inhibitors on repair DNA synthesis of U.V.-irradiated HeLa cells by two different methods. Firstly, aphidicolin, 1-ν-D-arabinofuranosylcytosine (araC, a precursor of araCTP) and 2',3'-dideoxythimidine (d 2 Thd, a precursor of d 2 TTP) were added directly to the culture medium. In this case, aphidicolin and araC strongly inhibited replicative DNA synthesis of HeLa cells, and they also inhibited repair synthesis after U.V.-irradiation but to a much lesser extent. In contrast, high concentrations of d 2 Thd inhibited repair DNA synthesis to a higher extent than replicative DNA synthesis. Secondly, the active form of inhibitor, d 2 TTP, was microinjected directly into cytoplasm or nuclei or U.V.-irradiated HeLa cells. Microinjection of d 2 TTP effectively inhibited repair synthesis. The microinjection of d 2 TTP, into either cytoplasm or nucleus, strongly inhibited replicative synthesis. These results might indicate that multiple DNA polymerases are involved in repair synthesis as well as in replicative synthesis

Core-Shell-Corona Micelles with a Responsive Shell.

Science.gov (United States)

Gohy, Jean-François; Willet, Nicolas; Varshney, Sunil; Zhang, Jian-Xin; Jérôme, Robert

2001-09-03

A reactor for the synthesis of gold nanoparticles is one of the uses of a poly(styrene)-block-poly(2-vinylpyridine)-block-poly(ethylene oxide) triblock copolymer (PS-b-P2VP-b-PEO) which forms core-shell-corona micelles in water. Very low polydispersity spherical micelles are observed that consist of a PS core surrounded by a pH-sensitive P2VP shell and a corona of PEO chains end-capped by a hydroxyl group. The corona can act as a site for attaching responsive or sensing molecules. © 2001 WILEY-VCH Verlag GmbH, Weinheim, Fed. Rep. of Germany.

DNA repair synthesis dependent on the uvrA,B gene products

International Nuclear Information System (INIS)

Moses, R.E.; Moody, E.E.M.

1975-01-01

Ultraviolet irradiation of toluene-treated Escherichia coli causes an inhibition of replicative DNA synthesis. This is followed by the appearance of nonconservative DNA repair synthesis which does not require either the polymerase or 5' → 3' exonucleolytic activities of DNA polymerase I. The repair synthesis may be catalyzed by DNA polymerase III activity but does not require a functional DNA polymerase II. The ultraviolet-induced synthesis requires ATP and is dependent on a functional uvrA and uvrB gene product. However, other uvr gene products are not required for the synthesis. The recB function is also not required

Involvement of DNA polymerase δ in DNA repair synthesis in human fibroblasts at late times after ultraviolet irradiation

International Nuclear Information System (INIS)

Dresler, S.L.; Gowans, B.J.; Robinson-Hill, R.M.; Hunting, D.J.

1988-01-01

DNA repair synthesis following UV irradiation of confluent human fibroblasts has a biphasic time course with an early phase of rapid nucleotide incorporation and a late phase of much slower nucleotide incorporation. The biphasic nature of this curve suggests that two distinct DNA repair systems may be operative. Previous studies have specifically implicated DNA polymerase δ as the enzyme involved in DNA repair synthesis occurring immediately after UV damage. In this paper, the authors describe studies of DNA polymerase involvement in DNA repair synthesis in confluent human fibroblasts at late times after UV irradiation. Late UV-induced DNA repair synthesis in both intact and permeable cells was found to be inhibited by aphidicolin, indicating the involvement of one of the aphidicolin-sensitive DNA polymerases, α or δ. In permeable cells, the process was further analyzed by using the nucleotide analogue (butylphenyl)-2'-deoxyguanosine 5'-triphosphate, which inhibits DNA polymerase α several hundred times more strongly than it inhibits DNA polymerase δ. The (butylphenyl)-2'-deoxyguanosine 5'-triphosphate inhibition curve for late UV-induced repair synthesis was very similar to that for polymerase δ. It appears that repair synthesis at late time after UV irradiation, like repair synthesis at early times, is mediated by DNA polymerase δ

Unscheduled synthesis of DNA and poly(ADP-ribose) in human fibroblasts following DNA damage

International Nuclear Information System (INIS)

McCurry, L.S.; Jacobson, M.K.

1981-01-01

Unscheduled DNA synthesis has been measured in human fibroblasts under conditions of reduced rates of conversion of NAD to poly)ADP-ribose). Cells heterozygous for the xeroderma pigmentosum genotype showed normal rates of uv induced unscheduled DNA synthesis under conditions in which the rate of poly(ADP-ribose) synthesis was one-half the rate of normal cells. The addition of theophylline, a potent inhibitor of poly(ADP-ribose) polymerase, to the culture medium of normal cells blocked over 90% of the conversion of NAD to poly(ADP-ribose) following treatment with uv or N-methyl-N'-nitro-N-nitro-soguanidine but did not affect the rate of unscheduled DNA synthesis

Enhanced solubility and targeted delivery of curcumin by lipopeptide micelles.

Science.gov (United States)

Liang, Ju; Wu, Wenlan; Lai, Danyu; Li, Junbo; Fang, Cailin

2015-01-01

A lipopeptide (LP)-containing KKGRGDS as the hydrophilic heads and lauric acid (C12) as the hydrophobic tails has been designed and prepared by standard solid-phase peptide synthesis technique. LP can self-assemble into spherical micelles with the size of ~30 nm in PBS (phosphate buffer saline) (pH 7.4). Curcumin-loaded LP micelles were prepared in order to increase the water solubility, sustain the releasing rate, and improve the tumor targeted delivery of curcumin. Water solubility, cytotoxicity, in vitro release behavior, and intracellular uptake of curcumin-loaded LP micelles were investigated. The results showed that LP micelles can increase the water solubility of curcumin 1.1 × 10(3) times and sustain the release of curcumin in a low rate. Curcumin-loaded LP micelles showed much higher cell inhibition than free curcumin on human cervix carcinoma (HeLa) and HepG2 cells. When incubating these curcumin-loaded micelles with HeLa and COS7 cells, due to the over-expression of integrins on cancer cells, the micelles can efficiently use the tumor-targeting function of RGD (functionalized peptide sequences: Arg-Gly-Asp) sequence to deliver the drug into HeLa cells, and better efficiency of the self-assembled LP micelles for curcumin delivery than crude curcumin was also confirmed by LCSM (laser confocal scanning microscope) assays. Combined with the enhanced solubility and higher cell inhibition, LP micelles reported in this study may be promising in clinical application for targeted curcumin delivery.

Synthesis of furan-based DNA binders and their interaction with DNA

International Nuclear Information System (INIS)

Voege, Andrea; Hoffmann, Sascha; Gabel, Detlef

2006-01-01

In recent years, many substances, based on naturally occurring DNA-binding molecules have been developed for the use in cancer therapy and as virostatica. Most of these substances are binding specifically to A-T rich sequences in the DNA minor groove. Neutral and positively charged DNA-binders are known. BNCT is most effective, which the boron is directly located in the cellular nucleus, so that the intercation with thermal neutrons can directly damage the DNA. To reach this aim, we have connected ammonioundecahydrododecaborate(1-) to DNA-binding structures such as 2,5-bis(4-formylphenyl)furan via a Schiff-Base reaction followed by a reduction of the imine to a secondary amine. In a following step the amine can be alkylated to insert positive charges to prevent repulsion between the compounds and the negatively charged sugar-phosphate-backbone of the DNA. (author)

Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

Science.gov (United States)

Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I

2011-01-31

Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

Directory of Open Access Journals (Sweden)

Alena V Makarova

2011-01-01

Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

Strand-Specific Analysis of DNA Synthesis and Proteins Association with DNA Replication Forks in Budding Yeast.

Science.gov (United States)

Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo

2018-01-01

DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.

Quantum-Dot-Based Theranostic Micelles Conjugated with an Anti-EGFR Nanobody for Triple-Negative Breast Cancer Therapy.

Science.gov (United States)

Wang, Yuyuan; Wang, Yidan; Chen, Guojun; Li, Yitong; Xu, Wei; Gong, Shaoqin

2017-09-13

A quantum-dot (QD)-based micelle conjugated with an anti-epidermal growth factor receptor (EGFR) nanobody (Nb) and loaded with an anticancer drug, aminoflavone (AF), has been engineered for EGFR-overexpressing cancer theranostics. The near-infrared (NIR) fluorescence of the indium phosphate core/zinc sulfide shell QDs (InP/ZnS QDs) allowed for in vivo nanoparticle biodistribution studies. The anti-EGFR nanobody 7D12 conjugation improved the cellular uptake and cytotoxicity of the QD-based micelles in EGFR-overexpressing MDA-MB-468 triple-negative breast cancer (TNBC) cells. In comparison with the AF-encapsulated nontargeted (i.e., without Nb conjugation) micelles, the AF-encapsulated Nb-conjugated (i.e., targeted) micelles accumulated in tumors at higher concentrations, leading to more effective tumor regression in an orthotopic triple-negative breast cancer xenograft mouse model. Furthermore, there was no systemic toxicity observed with the treatments. Thus, this QD-based Nb-conjugated micelle may serve as an effective theranostic nanoplatform for EGFR-overexpressing cancers such as TNBCs.

Stimulation of DNA synthesis in bacterial DNA-membrane complexes after low doses of ionizing radiation

Energy Technology Data Exchange (ETDEWEB)

Watkins, D K [Hammersmith Hospital, London (UK). M.R.C. Experimental Radiopathology Unit

1980-09-01

DNA-membrane complexes from three strains of E. coli were irradiated and changes in the rates of DNA synthesis were observed. Doses from 1-10 krad to complexes from W3110 and pol A1 strains gave up to a 100 per cent increase in DNA synthesis; under the same conditions, no change was observed in Bsub(s-1). The degree of stimulation did not depend on the presence of oxygen during irradiation, and a post-irradiation incubation was necessary to achieve activation. The properties of all three complexes were similar when unirradiated. Irradiation of intact organisms under conditions which produced marked, oxygen-dependent inhibition of the Bsub(s-1) complex had no significant effect on those from W3110 and pol A1. Enhanced DNA synthesis is concluded to be due wholly to repair of pre-existing DNA. It is further postulated that DNA synthesis in untreated complexes (E.coli B's,W3110 and pol A1) is mainly of the repair-type and does not necessarily take place at the site of DNA-membrane attachment.

γ-irradiation induces radioresistant DNA synthesis in HeLa cells

International Nuclear Information System (INIS)

Synzynys, B.I.; Aminev, A.G.; Konstantinova, S.A.; Saenko, A.S.

1987-01-01

Cells of suspension HeLa culture at the logarithmic phase of growth were exposed to 60 Co-γ-rays (5 Gy), incubated in the nutritious medium, and in 4 h subjected to repeated irradiation: the dose-response function and the dynamics of DNA synthesis inhibition were determined. It was shown that DNA synthesis was inhibited to a lesser extent after preirradiation, in other words, DNA synthesis was radioresistant. A correlation between this synthesis and reproductive cell death is discussed

DNA-membrane complex restoration in Micrococcus radiodurans after X-irradiation: relation to repair, DNA synthesis and DNA degradation

Energy Technology Data Exchange (ETDEWEB)

Dardalhon-Samsonoff, M; Averbeck, D [Institut du Radium, 75 - Paris (France). Lab. Curie

1980-07-01

The DNA-membrane complex in Micrococcus radiodurans was shown to be essentially constituted of proteins, lipids and DNA. The complex was dissociated immediately after X-irradiation of cells and restored during post-incubation in complete medium. In X-irradiated protoplasts some DNA remained associated with the complex. Restoration of the complex during post-incubation was only seen in a medium favouring DNA polymerase and ligase activities. Under this condition no DNA synthesis occurred, suggesting that complex restoration may involve ligase activity. The complex restoration in the wild type and the X-ray sensitive mutant UV17 of M. radiodurans was strictly dependent on the X-ray dose. It was correlated with survival and DNA degradation but always preceded the onset of DNA synthesis after X-irradiation. At the same dose the complex restoration was about 2 fold lower in mutant than in wild type cells indicating that the restoration of the complex is related to repair capacity. The results are consistent with the idea that the complex protects X-irradiated DNA of M. radiodurans from further breakdown and, subsequently, permits DNA synthesis and repair to occur.

Polysarcosine-Based Lipids: From Lipopolypeptoid Micelles to Stealth-Like Lipids in Langmuir Blodgett Monolayers

Directory of Open Access Journals (Sweden)

Benjamin Weber

2016-12-01

Full Text Available Amphiphiles and, in particular, PEGylated lipids or alkyl ethers represent an important class of non-ionic surfactants and have become key ingredients for long-circulating (“stealth” liposomes. While poly-(ethylene glycol (PEG can be considered the gold standard for stealth-like materials, it is known to be neither a bio-based nor biodegradable material. In contrast to PEG, polysarcosine (PSar is based on the endogenous amino acid sarcosine (N-methylated glycine, but has also demonstrated stealth-like properties in vitro, as well as in vivo. In this respect, we report on the synthesis and characterization of polysarcosine based lipids with C14 and C18 hydrocarbon chains and their end group functionalization. Size exclusion chromatography (SEC and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS analysis reveals that lipopeptoids with a degree of polymerization between 10 and 100, dispersity indices around 1.1, and the absence of detectable side products are directly accessible by nucleophilic ring opening polymerization (ROP. The values for the critical micelle concentration for these lipopolymers are between 27 and 1181 mg/L for the ones with C18 hydrocarbon chain or even higher for the C14 counterparts. The lipopolypeptoid based micelles have hydrodynamic diameters between 10 and 25 nm, in which the size scales with the length of the PSar block. In addition, C18PSar50 can be incorporated in 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC monolayers up to a polymer content of 3%. Cyclic compression and expansion of the monolayer showed no significant loss of polymer, indicating a stable monolayer. Therefore, lipopolypeptoids can not only be synthesized under living conditions, but my also provide a platform to substitute PEG-based lipopolymers as excipients and/or in lipid formulations.

In situ enzymology of DNA replication and ultraviolet-induced DNA repair synthesis in permeable human cells

International Nuclear Information System (INIS)

Dresler, S.; Frattini, M.G.; Robinson-Hill, R.M.

1988-01-01

Using permeable diploid human fibroblasts, the authors have studied the deoxyribonucleoside triphosphate concentration dependences of ultraviolet- (UV-) induced DNA repair synthesis and semiconservative DNA replication. In both cell types (AG1518 and IMR-90) examined, the apparent K m values for dCTP, dGTP, and dTTP for DNA replication were between 1.2 and 2.9 μM. For UV-induced DNA repair synthesis, the apparent K m values were substantially lower, ranging from 0.11 to 0.44 μM for AG1518 cells and from 0.06 to 0.24 μM for IMR-90 cells. Recent data implicate DNA polymerase δ in UV-induced repair synthesis and suggest that DNA polymerases α and δ are both involved in semiconservative replication. They measured K m values for dGTP and dTTP for polymerases α and δ, for comparison with the values for replication and repair synthesis. The deoxyribonucleotide K m values for DNA polymerase δ are much greater than the K m values for UV-induced repair synthesis, suggesting that when polymerase δ functions in DNA repair, its characteristics are altered substantially either by association with accessory proteins or by direct posttranslational modification. In contrast, the deoxyribonucleotide binding characteristics of the DNA replication machinery differ little from those of the isolated DNA polymerases. The K m values for UV-induced repair synthesis are 5-80-fold lower than deoxyribonucleotide concentrations that have been reported for intact cultured diploid human fibroblasts. For replication, however, the K m for dGTP is only slightly lower than the average cellular dGTP concentration that has been reported for exponentially growing human fibroblasts. This finding is consistent with the concept that nucleotide compartmentation is required for the attainment of high rates of DNA replication in vivo

New self-assembled nanocrystal micelles for biolabels and biosensors.

Energy Technology Data Exchange (ETDEWEB)

Tallant, David Robert; Wilson, Michael C. (University of New Mexico, Albuquerque, NM); Leve, Erik W. (University of New Mexico, Albuquerque, NM); Fan, Hongyou; Brinker, C. Jeffrey; Gabaldon, John (University of New Mexico, Albuquerque, NM); Scullin, Chessa (University of New Mexico, Albuquerque, NM)

2005-12-01

The ability of semiconductor nanocrystals (NCs) to display multiple (size-specific) colors simultaneously during a single, long term excitation holds great promise for their use in fluorescent bio-imaging. The main challenges of using nanocrystals as biolabels are achieving biocompatibility, low non-specific adsorption, and no aggregation. In addition, functional groups that can be used to further couple and conjugate with biospecies (proteins, DNAs, antibodies, etc.) are required. In this project, we invented a new route to the synthesis of water-soluble and biocompatible NCs. Our approach is to encapsulate as-synthesized, monosized, hydrophobic NCs within the hydrophobic cores of micelles composed of a mixture of surfactants and phospholipids containing head groups functionalized with polyethylene glycol (-PEG), -COOH, and NH{sub 2} groups. PEG provided biocompatibility and the other groups were used for further biofunctionalization. The resulting water-soluble metal and semiconductor NC-micelles preserve the optical properties of the original hydrophobic NCs. Semiconductor NCs emit the same color; they exhibit equal photoluminescence (PL) intensity under long-time laser irradiation (one week) ; and they exhibit the same PL lifetime (30-ns). The results from transmission electron microscopy and confocal fluorescent imaging indicate that water-soluble semiconductor NC-micelles are biocompatible and exhibit no aggregation in cells. We have extended the surfactant/lipid encapsulation techniques to synthesize water-soluble magnetic NC-micelles. Transmission electron microscopy results suggest that water-soluble magnetic NC-micelles exhibit no aggregation. The resulting NC-micelles preserve the magnetic properties of the original hydrophobic magnetic NCs. Viability studies conducted using yeast cells suggest that the magnetic nanocrystal-micelles are biocompatible. We have demonstrated, for the first time, that using external oscillating magnetic fields to manipulate

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

Action of some drugs on enzymes involved in DNA-repair and semiconservative DNA-synthesis

International Nuclear Information System (INIS)

Wawra, E.; Klein, W.; Kocsis, F.; Weniger, P.

1975-07-01

Different antirheumatic and cytostatic drugs had been tested by measurement of the thymidine incorporation into DNA of spleen cells under conditions, under which either DNA-synthesis or repair after gamma- or UV-irradiation takes place. There are substances, which inhibit either only the semiconservative DNA-synthesis (vinblastine, isonicotinic acid hydracide) or only DNA-repair after gamma-irradiation (mixture of penicillin-G and procaine-penicillin-G) or both (cyclophosphamide, phenylbutazone, procarbazine, nalidixic acid). Vincristine shows no effect on the thymidine incorporation in DNA, but by density gradient centrifugation it has been found that it influences the ligase reaction. Two DNA polymerases had been isolated from spleen cells, one of the low molecular and one of the high molecular weight type. The influences of the described drugs on these enzymes and on a deoxyribonuclease I from beef pancreas have been tested in ''in vitro'' systems. In all cases, it has been found that there is no effect or only a very small one, compared with the action of well known inhibitors as e.g. ethidium bromide and p-chloromercuribenzoate, and this cannot be responsible for the suppressions found in DNA-repair and semiconservative DNA-synthesis. (author)

Design and synthesis of DNA four-helix bundles

Energy Technology Data Exchange (ETDEWEB)

Rangnekar, Abhijit; Gothelf, Kurt V [Department of Chemistry, Centre for DNA Nanotechnology (CDNA) and Interdisciplinary Nanoscience Center (iNANO), Aarhus University, DK-8000 Aarhus C (Denmark); LaBean, Thomas H, E-mail: kvg@chem.au.dk, E-mail: thl@cs.duke.edu [Department of Chemistry, Duke University, Durham, NC 27708 (United States)

2011-06-10

The field of DNA nanotechnology has evolved significantly in the past decade. Researchers have succeeded in synthesizing tile-based structures and using them to form periodic lattices in one, two and three dimensions. Origami-based structures have also been used to create nanoscale structures in two and three dimensions. Design and construction of DNA bundles with fixed circumference has added a new dimension to the field. Here we report the design and synthesis of a DNA four-helix bundle. It was found to be extremely rigid and stable. When several such bundles were assembled using appropriate sticky-ends, they formed micrometre-long filaments. However, when creation of two-dimensional sheet-like arrays of the four-helix bundles was attempted, nanoscale rings were observed instead. The exact reason behind the nanoring formation is yet to be ascertained, but it provides an exciting prospect for making programmable circular nanostructures using DNA.

Design and synthesis of DNA four-helix bundles

International Nuclear Information System (INIS)

Rangnekar, Abhijit; Gothelf, Kurt V; LaBean, Thomas H

2011-01-01

The field of DNA nanotechnology has evolved significantly in the past decade. Researchers have succeeded in synthesizing tile-based structures and using them to form periodic lattices in one, two and three dimensions. Origami-based structures have also been used to create nanoscale structures in two and three dimensions. Design and construction of DNA bundles with fixed circumference has added a new dimension to the field. Here we report the design and synthesis of a DNA four-helix bundle. It was found to be extremely rigid and stable. When several such bundles were assembled using appropriate sticky-ends, they formed micrometre-long filaments. However, when creation of two-dimensional sheet-like arrays of the four-helix bundles was attempted, nanoscale rings were observed instead. The exact reason behind the nanoring formation is yet to be ascertained, but it provides an exciting prospect for making programmable circular nanostructures using DNA.

DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli

International Nuclear Information System (INIS)

Dorson, J.W.; Moses, R.E.

1978-01-01

DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair

Synthesis of base-modified 2'-deoxyribonucleoside triphosphates and their use in enzymatic synthesis of modified DNA for applications in bioanalysis and chemical biology.

Science.gov (United States)

Hocek, Michal

2014-11-07

The synthesis of 2'-deoxyribonucleoside triphosphates (dNTPs) either by classical triphosphorylation of nucleosides or by aqueous cross-coupling reactions of halogenated dNTPs is discussed. Different enzymatic methods for synthesis of modified oligonucleotides and DNA by polymerase incorporation of modified nucleotides are summarized, and the applications in redox or fluorescent labeling, as well as in bioconjugations and modulation of interactions of DNA with proteins, are outlined.

ATP-independent DNA synthesis in Vaccinia-infected L cells

International Nuclear Information System (INIS)

Berger, N.A.; Kauff, R.A.; Sikorski, G.W.

1978-01-01

Mouse L cells can be made permeable to exogenous nucleotides by a cold shock in 0.01 M Tris . HCl pH 7.8, 0.25 M sucrose, 1 mM EDTA, 30 mM 2-mercaptoethanol and 4 mM MgCl 2 . DNA synthesis in permeabilized L cells requires ATP whereas DNA synthesis in permeabilized L cells that are infected with Vaccinia virus is ATP-independent. Permeabilized L cells that are infected with ultraviolet-irradiated virus show a marked suppression of DNA synthesis which is not corrected by an excess of deoxynucleoside triphosphates and ATP. The ATP-dependent and ATP-independent processes of DNA synthesis are inhibited to the same extent by Mal-Net, pHMB, ara CTP and phosphonoacetate. Concentrations of daunorubicin and cytembena, which cause marked inhibition of the ATP-dependent enzymes, only cause partial inhibition of the ATP-independent enzymes. (Auth.)

Glyco-Nanoparticles Made from Self-Assembly of Maltoheptaose-block-Poly(methyl methacrylate): Micelle, Reverse Micelle, and Encapsulation.

Science.gov (United States)

Zepon, Karine M; Otsuka, Issei; Bouilhac, Cécile; Muniz, Edvani C; Soldi, Valdir; Borsali, Redouane

2015-07-13

The synthesis and the solution-state self-assembly of the "hybrid" diblock copolymers, maltoheptaose-block-poly(methyl methacrylate) (MH-b-PMMA), into large compound micelles (LCMs) and reverve micelle-type nanoparticles, are reported in this paper. The copolymers were self-assembled in water and acetone by direct dissolution method, and the morphologies of the nanoparticles were investigated by dynamic light scattering (DLS), nanoparticle tracking analysis (NTA), transmission electron microscopy (TEM), atomic force microscopy (AFM), proton nuclear magnetic resonance ((1)H NMR), and fluorescence spectroscopy as a function of the volume fraction of the copolymer hydrophobic block, copolymer concentration, stirring speed, and solvent polarity. The DLS measurements and TEM images showed that the hydrodynamic radius (Rh) of the LCMs obtained in water increases with the copolymer concentration. Apart from that, increasing the stirring speed leads to polydispersed aggregations of the LCMs. On the other hand, in acetone, the copolymers self-assembled into reverse micelle-type nanoparticles having Rh values of about 6 nm and micellar aggregates, as revealed the results obtained from DLS, AFM, and (1)H NMR analyses. The variation in micellar structure, that is, conformational inversion from LCMs to reverse micelle-type structures in response to polarity of the solvent, was investigated by apparent water contact angle (WCA) and (1)H NMR analyses. This conformational inversion of the nanoparticles was further confirmed by encapsulation and release of hydrophobic guest molecule, Nile red, characterized by fluorescence spectroscopy.

Termination of DNA synthesis in vitro at apurinic sites but not at ethyl adducts of the template

Energy Technology Data Exchange (ETDEWEB)

Lockhart, M.L.; Deutsch, J.F.; Yamaura, I.; Cavalieri, L.F.; Rosenberg, B.H.

1982-01-01

The effects of DNA lesions produced by the carcinogenic alkylating agents ethylnitrosourea and diethylsulfate on the extent of DNA synthesis have been studied in a system utilizing circular single-stranded phi X174 DNA as template and a 392-base restriction fragment as primer with E. coli polymerase I (Klenow fragment). Apurinic sites produced by loss of unstable ethylated bases from the template terminate DNA synthesis at the first such site encountered, but ethyl adducts at most, if not all, locations permit readthrough. 22 references, 3 figures, 1 table.

Micelle System Based on Molecular Economy Principle for Overcoming Multidrug Resistance and Inhibiting Metastasis.

Science.gov (United States)

Qi, Yan; Qin, Xianya; Yang, Conglian; Wu, Tingting; Qiao, Qi; Song, Qingle; Zhang, Zhiping

2018-03-05

The high mortality of cancer is mainly attributed to multidrug resistance (MDR) and metastasis. A simple micelle system was constructed here to codeliver doxorubicin (DOX), adjudin (ADD), and nitric oxide (NO) for overcoming MDR and inhibiting metastasis. It was devised based on the "molecular economy" principle as the micelle system was easy to fabricate and exhibited high drug loading efficiency, and importantly, each component of the micelles would exert one or more active functions. DOX acted as the main cell killing agent supplemented with ADD, NO, and d-α-tocopheryl polyethylene glycol 1000 succinate (TPGS). MDR was overcome by synergistic effects of mitochondria inhibition agents, TPGS and ADD. A TPGS-based NO donor can be used as a drug carrier, and it can release NO to enhance drug accumulation and penetration in tumor, resulting in a positive cycle of drug delivery. This DOX-ADD conjugate self-assembly system demonstrated controlled drug release, increased cellular uptake and cytotoxicity, enhanced accumulation at tumor site, and improved in vivo metastasis inhibition of breast cancer. The micelles can fully take advantage of the functions of each component, and they provide a potential strategy for nanomedicine design and clinical cancer treatment.

Differential chromosomal and mitochondrial DNA synthesis in temperature-sensitive mutants of Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Unrau, P.

1977-01-01

The amount and type of residual DNA synthesis was determined in eight temperature-sensitive mutants of the smut fungus Ustilago maydis after incubation at the restrictive temperature (32/sup 0/C) for eight hours. Mutants ts-220, ts-207, ts-432 and ts-346 were found to have an overall reduction in the synthesis of both nuclear and mitochondrial DNA in comparison to the wild-type. In mutants ts-20, tsd 1-1, ts-84 and pol 1-1 nuclear DNA synthesis was depressed relative to mitochondrial synthesis. The DNA-polymerase mutant pol 1-1 had persistent nuclear synthesis at about 50% of the rate of synthesis of mitochondrial DNA and similar behavior was observed in a diploid homozygous strain. Mutant ts-84 had an initial burst of DNA synthesis which was reduced for nuclear but not mitochondrial synthesis after three hours preincubation at 32/sup 0/C. tsd 1-1 and ts-20 had nuclear residual synthesis amounting to about 25% of the relative rate of mitochondrial synthesis which correlates to increasing UV sensitivity of these strains on incubation at 32/sup 0/C. A pol 1-1 ts-84 double mutant had an additive loss of nuclear DNA synthesis which indicates that the steps of replication involved may be sequential.

Synthesis and Characterization of Cleavable Core-Cross-Linked Micelles Based on Amphiphilic Block Copolypeptoids as Smart Drug Carriers.

Science.gov (United States)

Li, Ang; Zhang, Donghui

2016-03-14

Amphiphilic block copolypeptoids consisting of a hydrophilic poly(N-ethyl glycine) segment and a hydrophobic poly[(N-propargyl glycine)-r-(N-decyl glycine)] random copolymer segment [PNEG-b-P(NPgG-r-NDG), EPgD] have been synthesized by sequential primary amine-initiated ring-opening polymerization (ROP) of the corresponding N-alkyl N-carboxyanhydride monomers. The block copolypeptoids form micelles in water and the micellar core can be cross-linked with a disulfide-containing diazide cross-linker by copper-mediated alkyne-azide cycloaddition (CuAAC) in aqueous solution. Transmission electron microscopy (TEM) and dynamic light scattering (DLS) analysis revealed the formation of spherical micelles with uniform size for both the core-cross-linked micelles (CCLMs) and non-cross-linked micelles (NCLMs) precursors for selective block copolypeptoid polymers. The CCLMs exhibited increased dimensional stability relative to the NCLMs in DMF, a nonselective solvent for the core and corona segments. Micellar dissociation of CCLMs can be induced upon addition of a reducing agent (e.g., dithiothreitol) in dilute aqueous solutions, as verified by a combination of fluorescence spectroscopy, size exclusion chromatography (SEC), and (1)H NMR spectroscopic measurement. Doxorubicin (DOX), an anticancer drug, can be loaded into the hydrophobic core of CCLMs with a maximal 23% drug loading capacity (DLC) and 37% drug loading efficiency (DLE). In vitro DOX release from the CCLMs can be triggered by DTT (10 mM), in contrast to significantly reduced DOX release in the absence of DTT, attesting to the reductively responsive characteristic of the CCLMs. While the CCLMs exhibited minimal cytotoxicity toward HepG2 cancer cells, DOX-loaded CCLMs inhibited the proliferation of the HepG2 cancer cells in a concentration and time dependent manner, suggesting the controlled release of DOX from the DOX-loaded CCLMS in the cellular environment.

Relationship between structure and reactivity in AOT inverse micelles

International Nuclear Information System (INIS)

Petit, Christophe

1988-01-01

As inverse micelles can be considered as chemical micro-reactors, the objective of this research thesis is to show that reaction rates can be modified, either by varying the size of micro-reactors, or by modifying the location of one of the reactants. After a brief overview of noticeable results obtained on AOT inverse micelles about the structure and reactivity, the author reports the study of structural modifications induced by an addition of small molecules or proteins. Two complementary models are proposed on this purpose: a geometrical model which reports the medium microscopic evolution and a kinetic model which could report the system microscopic evolution as well reactivity changes with respect to probe location. The next part reports the study of in situ synthesis of semi-conductor particles in AOT inverse micelles. The author then reports that a surprising aspect of macromolecule solubilization has been noticed: the solubilization of a polypeptide, gelatine, allows the whole system to be gelled whereas gelatine is essentially polar [fr

Second-strand cDNA synthesis: classical method

International Nuclear Information System (INIS)

Gubler, U.

1987-01-01

The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

Radioresistant DNA synthesis in fibroblasts of a patient with Down's syndrome

International Nuclear Information System (INIS)

Barenfel'd, L.S.; Bil'din, V.N.; Pleskach, N.M.; Prokof'eva, V.V.

1985-01-01

Ionizing radiation effect on DNA replication on fibroblasts of a healthy donor and a patient with Down's syndrome either by direct 3 H-thymidine inclusion into DNA, or by analysis of the sizes of daughter DNA moleculs at the state of stable distribution in acid saccharose, gradients was studied. Gamma-radiation doses (5-10 Gy) suppressing DNA synthesis in normal fibroblasts practically had no effect on DNA synthesisin fibroblasts of a patient with Down's syndrome. Radioresistant DNA synthesis in Down's syndrome is conditioned by a far less supression of replicon initiation as compared with the one in normal cells. So, it is stated that in Down's disease there is no delay in DNA synthesis by ionizing radiation that enables the normal cells to repair DNA damages before replication renewal

[Expression and purification of a novel thermophilic bacterial single-stranded DNA-binding protein and enhancement the synthesis of DNA and cDNA].

Science.gov (United States)

Jia, Xiao-Wei; Zhang, Guo-Hui; Shi, Hai-Yan

2012-12-01

Express a novel species of single-stranded DNA-binding protein (SSB) derived from Thermococcus kodakarensis KOD1, abbreviated kod-ssb. And evaluate the effect of kod-ssb on PCR-based DNA amplification and reverse transcription. We express kod-ssb with the Transrtta (DE3), and kod-ssb was purified by affinity chromatography on a Ni2+ Sepharose column, detected by SDS-PAGE. To evaluate the effect of kod-ssb on PCR-based DNA amplification, the human beta globin gene was used as template to amplify a 5-kb, 9-kb and 13-kb. And to detect the effect of kod-ssb on reverse transcription, we used RNA from flu cell culture supernatant extraction as templates to implement qRT-PCR reaction. The plasmid pET11a-kod was transformed into Transetta (DE3) and the recombinant strain Transetta (pET11 a-kod) was obtained. The kod-ssb was highly expressed when the recombinant strain Transetta(pET11a-kod) was induced by IPTG. The specific protein was detected by SDS-PAGE. To confirm that kod-ssb can enhance target DNA synthesis and reduce PCR by-products, 5-, 9-, and 13-kb human beta globin gene fragments were used as templates for PCR. When PCR reactions did not include SSB proteins, the specific PCR product was contaminated with non-specific products. When kod -ssb was added, kod-ssb significantly enhanced amplification of the 5-, 9-and 13-kb target product and minimised the non-specific PCR products. To confirm that kod-ssb can enhance target cDNA synthesis, RNA from flu cell culture supernatant extraction was used as templates for qRT-PCR reaction. The results was that when kod-ssb was added, kod-ssb significantly enhanced the synthesis of cDNA, average Ct value is 19.42, and the average Ct value without kod-ssb is 22.15. kod-ssb may in future be used to enhance DNA and cDNA amplification.

Patchy micelles based on coassembly of block copolymer chains and block copolymer brushes on silica particles.

Science.gov (United States)

Zhu, Shuzhe; Li, Zhan-Wei; Zhao, Hanying

2015-04-14

Patchy particles are a type of colloidal particles with one or more well-defined patches on the surfaces. The patchy particles with multiple compositions and functionalities have found wide applications from the fundamental studies to practical uses. In this research patchy micelles with thiol groups in the patches were prepared based on coassembly of free block copolymer chains and block copolymer brushes on silica particles. Thiol-terminated and cyanoisopropyl-capped polystyrene-block-poly(N-isopropylacrylamide) block copolymers (PS-b-PNIPAM-SH and PS-b-PNIPAM-CIP) were synthesized by reversible addition-fragmentation chain transfer polymerization and chemical modifications. Pyridyl disulfide-functionalized silica particles (SiO2-SS-Py) were prepared by four-step surface chemical reactions. PS-b-PNIPAM brushes on silica particles were prepared by thiol-disulfide exchange reaction between PS-b-PNIPAM-SH and SiO2-SS-Py. Surface micelles on silica particles were prepared by coassembly of PS-b-PNIPAM-CIP and block copolymer brushes. Upon cleavage of the surface micelles from silica particles, patchy micelles with thiol groups in the patches were obtained. Dynamic light scattering, transmission electron microscopy, and zeta-potential measurements demonstrate the preparation of patchy micelles. Gold nanoparticles can be anchored onto the patchy micelles through S-Au bonds, and asymmetric hybrid structures are formed. The thiol groups can be oxidized to disulfides, which results in directional assembly of the patchy micelles. The self-assembly behavior of the patchy micelles was studied experimentally and by computer simulation.

Sickle erythrocytes inhibit human endothelial cell DNA synthesis

International Nuclear Information System (INIS)

Weinstein, R.; Zhou, M.A.; Bartlett-Pandite, A.; Wenc, K.

1990-01-01

Patients with sickle cell anemia experience severe vascular occlusive phenomena including acute pain crisis and cerebral infarction. Obstruction occurs at both the microvascular and the arterial level, and the clinical presentation of vascular events is heterogeneous, suggesting a complex etiology. Interaction between sickle erythrocytes and the endothelium may contribute to vascular occlusion due to alteration of endothelial function. To investigate this hypothesis, human vascular endothelial cells were overlaid with sickle or normal erythrocytes and stimulated to synthesize DNA. The erythrocytes were sedimented onto replicate monolayers by centrifugation for 10 minutes at 17 g to insure contact with the endothelial cells. Incorporation of 3H-thymidine into endothelial cell DNA was markedly inhibited during contact with sickle erythrocytes. This inhibitory effect was enhanced more than twofold when autologous sickle plasma was present during endothelial cell labeling. Normal erythrocytes, with or without autologous plasma, had a modest effect on endothelial cell DNA synthesis. When sickle erythrocytes in autologous sickle plasma were applied to endothelial monolayers for 1 minute, 10 minutes, or 1 hour and then removed, subsequent DNA synthesis by the endothelial cells was inhibited by 30% to 40%. Although adherence of sickle erythrocytes to the endothelial monolayers was observed under these experimental conditions, the effect of sickle erythrocytes on endothelial DNA synthesis occurred in the absence of significant adherence. Hence, human endothelial cell DNA synthesis is partially inhibited by contact with sickle erythrocytes. The inhibitory effect of sickle erythrocytes occurs during a brief (1 minute) contact with the endothelial monolayers, and persists for at least 6 hours of 3H-thymidine labeling

67Ga-citrate incorporation and DNA synthesis in tumors

International Nuclear Information System (INIS)

Hammersley, P.A.G.; Taylor, D.M.

1975-01-01

The results obtained in these studies suggest that in the tumors studied there is some form of relationship between 67 Ga uptake and the rate of DNA synthesis. However, the observations in the HP melanoma, in which small tumors showed a negative correlation between 67 Ga uptake and rate of DNA synthesis and larger tumors showed a positive correlation, coupled with the virtually constant uptake of 67 Ga over a wide range of rates of DNA synthesis in the drug- and radiation-treated tumors, suggest that the uptake of the radionuclide is not simply related to the rate of DNA synthesis per se. Studies in embryonic mouse tissues suggested that 67 Ga uptake was not related to the rate of DNA synthesis and regenerating liver does not show a greater 67 Ga uptake than normal liver. Phytohemagglutinin-treated human lymphocytes show increased 67 Ga uptake compared to unstimulated lymphocytes, and it has been suggested that this is related to the stimulus to divide rather than to events occurring in a specific phase of the cell cycle. This suggests that proliferating cells may exhibit membrane changes which either result in increased transport of 67 Ga into the cell or permit a greater degree of binding of the radionuclide to the cell membrane than can occur in resting cells. The membrane-binding hypothesis is supported by the observations on phytohemagglutinin-stimulated lymphocytes but not by observations of the subcellular distribution of 67 Ga in these tumors which confirm the suggestion that the radionuclide is concentrated in lysosomes. Thus it appears that although in tumor cells, at least, there is some correlation between 67 Ga uptake and the rate of DNA synthesis and hence by implication of cell proliferation, the nature of this link remains obscure, and more detailed studies are needed to increase our understanding of the relationship

Correspondence: chromosomal localization of uv-induced unscheduled DNA synthesis

International Nuclear Information System (INIS)

Berliner, J.; Mello, R.S.; Norman, A.

1976-01-01

We have measured the grain density - the number of grains per unit length - over the centromere and noncentromere regions of metaphase chromosomes in autoradiographs of human lymphocytes. When the chromosomes were labeled in G 0 by uv-induced unscheduled DNA synthesis, the grain density was two to four times larger over the centromere than over the noncentromere regions. When the labeling was done by scheduled DNA synthesis in S or unscheduled synthesis in M, the grain densities were approximately equal over both regions

Sub-20 nm Stable Micelles Based on a Mixture of Coiled-Coils: A Platform for Controlled Ligand Presentation.

Science.gov (United States)

Ang, JooChuan; Ma, Dan; Jung, Benson T; Keten, Sinan; Xu, Ting

2017-11-13

Ligand-functionalized, multivalent nanoparticles have been extensively studied for biomedical applications from imaging agents to drug delivery vehicles. However, the ligand cluster size is usually heterogeneous and the local valency is ill-defined. Here, we present a mixed micelle platform hierarchically self-assembled from a mixture of two amphiphilic 3-helix and 4-helix peptide-polyethylene glycol (PEG)-lipid hybrid conjugates. We demonstrate that the local multivalent ligand cluster size on the micelle surface can be controlled based on the coiled-coil oligomeric state. The oligomeric states of mixed peptide bundles were found to be in their individual native states. Similarly, mixed micelles indicate the orthogonal self-association of coiled-coil amphiphiles. Using differential scanning calorimetry, fluorescence recovery spectroscopy, and coarse-grained molecular dynamics simulation, we studied the distribution of coiled-coil bundles within the mixed micelles and observed migration of coiled-coils into nanodomains within the sub-20 nm mixed micelle. This report provides important insights into the assembly and formation of nanophase-separated micelles with precise control over the local multivalent state of ligands on the micelle surface.

Coordinated leading and lagging strand DNA synthesis by using the herpes simplex virus 1 replication complex and minicircle DNA templates.

Science.gov (United States)

Stengel, Gudrun; Kuchta, Robert D

2011-01-01

The origin-specific replication of the herpes simplex virus 1 genome requires seven proteins: the helicase-primase (UL5-UL8-UL52), the DNA polymerase (UL30-UL42), the single-strand DNA binding protein (ICP8), and the origin-binding protein (UL9). We reconstituted these proteins, excluding UL9, on synthetic minicircular DNA templates and monitored leading and lagging strand DNA synthesis using the strand-specific incorporation of dTMP and dAMP. Critical features of the assays that led to efficient leading and lagging stand synthesis included high helicase-primase concentrations and a lagging strand template whose sequence resembled that of the viral DNA. Depending on the nature of the minicircle template, the replication complex synthesized leading and lagging strand products at molar ratios varying between 1:1 and 3:1. Lagging strand products (∼0.2 to 0.6 kb) were significantly shorter than leading strand products (∼2 to 10 kb), and conditions that stimulated primer synthesis led to shorter lagging strand products. ICP8 was not essential; however, its presence stimulated DNA synthesis and increased the length of both leading and lagging strand products. Curiously, human DNA polymerase α (p70-p180 or p49-p58-p70-p180), which improves the utilization of RNA primers synthesized by herpesvirus primase on linear DNA templates, had no effect on the replication of the minicircles. The lack of stimulation by polymerase α suggests the existence of a macromolecular assembly that enhances the utilization of RNA primers and may functionally couple leading and lagging strand synthesis. Evidence for functional coupling is further provided by our observations that (i) leading and lagging strand synthesis produce equal amounts of DNA, (ii) leading strand synthesis proceeds faster under conditions that disable primer synthesis on the lagging strand, and (iii) conditions that accelerate helicase-catalyzed DNA unwinding stimulate decoupled leading strand synthesis but not

Understanding thermodynamics of drug partitioning in micelles and delivery to proteins: Studies with naproxen, diclofenac sodium, tetradecyltrimethylammonium bromide, and bovine serum albumin

International Nuclear Information System (INIS)

Talele, Paurnima; Choudhary, Sinjan; Kishore, Nand

2016-01-01

Highlights: • Interactions of non-steroidal anti-inflammatory drugs studied with TTAB micelles, monomers. • Thermodynamics of drug-surfactant interactions and partitioning in micelles addressed. • Mechanism of drug partitioning addressed based on energetics of interactions. • Partitioning in micelles depends on functional groups on drugs. • Such studies are needed for target oriented synthesis and efficient drug delivery. - Abstract: The use of surfactants in drug delivery has offered several advantages. Quantitative knowledge of the interactions of drugs with micellar systems is essential for deriving guidelines to design efficient drug delivery systems. In this work we have quantitatively addressed the mechanism of interaction of naproxen and diclofenac sodium with the micelles and monomers of tetradecyltrimethylammonium bromide (TTAB) based on thermodynamic studies by using isothermal titration calorimetry. The mechanism of interaction of the drugs with TTAB is based on identification of the nature of interactions of the former with the surfactant micelles and monomers. The values of partitioning constant (which is same as equilibrium constant for the reaction of drugs with the surfactant micelles), enthalpy, entropy and stoichiometry of partitioning have been determined and discussed in terms of possible intermolecular interactions. Further, the interaction of the drug naproxen with bovine serum albumin, when delivered from the micellar media has also been addressed in terms of binding constant, enthalpy and entropy of binding. The results are important in developing improved strategies for effective drug delivery systems.

Renewable poly(δ-decalactone based block copolymer micelles as drug delivery vehicle: in vitro and in vivo evaluation

Directory of Open Access Journals (Sweden)

Kuldeep K. Bansal

2018-03-01

Full Text Available Polymers from natural resources are attracting much attention in various fields including drug delivery as green alternatives to fossil fuel based polymers. In this quest, novel block copolymers based on renewable poly(δ-decalactone (PDL were evaluated for their drug delivery capabilities and compared with a fossil fuel based polymer i.e. methoxy-poly(ethylene glycol-b-poly(ε-caprolactone (mPEG-b-PCL. Using curcumin as a hydrophobic drug model, micelles of PDL block copolymers with different orientation i.e. AB (mPEG-b-PDL, ABA (PDL-b-PEG-b-PDL, ABC (mPEG-b-PDL-b-poly(pentadecalactone and (mPEG-b-PCL were prepared by nanoprecipitation method. The size, drug loading and curcumin stability studies results indicated that mPEG-b-PDL micelles was comparable to its counterpart mPEG-b-PCL micelles towards improved delivery of curcumin. Therefore, mixed micelles using these two copolymers were also evaluated to see any change in size, loading and drug release. Drug release studies proposed that sustained release can be obtained using poly(pentadecalactone as crystalline core whereas rapid release can be achieved using amorphous PDL core. Further, mPEG-b-PDL micelles were found to be non-haemolytic, up to the concentration of 40 mg/mL. In vivo toxicity studies on rats advised low-toxic behaviour of these micelles up to 400 mg/kg dose, as evident by histopathological and biochemical analysis. In summary, it is anticipated that mPEG-b-PDL block copolymer micelles could serve as a renewable alternative for mPEG-b-PCL copolymers in drug delivery applications.

Continuous induction of unscheduled DNA synthesis by gamma irradiation

International Nuclear Information System (INIS)

Weniger, P.; Klein, W.; Ott, E.; Kocsis, F.; Altmann, H.

1990-01-01

The induction of DNA-synthesis in non-S-phase cells is a very sensitive measure of a preceding damage of DNA. Usually, in an in vivo - in vitro test (treatment of an animal, incorporation of H3-thymidine in a cell suspension) the damaging of DNA takes place hours to days before the evaluation. In this case, the time course of the UDS-induction after a single dose of 1 Gy gamma irradiation was observed over a long period of time (21 months). C57 black mice served as test animals. In an age of about 80 days they were irradiated and the induction of unscheduled DNA synthesis was measured at ten time intervals during the whole life-span of the animals. Although the repair in this gamma radiation damage in DNA is a very quick process - with centrifugation in alkaline sucrose a half-life of some minutes is found - an induction of unscheduled DNA synthesis could be seen at the irradiated animals until the end of their life (640 days). The reason for this could be permanent disorders in cellular regulation caused by the gamma irradiation. (author) 4 figs

Continuous induction of unscheduled DNA synthesis by gamma irradiation

International Nuclear Information System (INIS)

Weniger, P.; Klein, W.; Ott, E.; Kocsis, F.; Altmann, H.

1988-08-01

The induction of DNA-synthesis in non-S-phase cells is a very sensitive measure of a preceding damage of the DNA. Usually, in an in vivo -in vitro test (treatment of an animal, incorporation of H3-thymidine in a cell suspension) the damaging of DNA takes place hours to days before the evaluation. In this case, the time course of the UDS-induction after a single dose of 1 Gy gamma irradiation should be observed for a long time (21 months). C57 black mice served as test animals. In an age of about 80 days they were irradiated and the induction of unscheduled DNA synthesis was measured at ten points of time during the whole life-span of the animals. Although the repair in this gamma radiation damage in DNA is a very quick process - with centrifugation in alkaline sucrose you find a half time of some minutes - an induction of unscheduled DNA synthesis could be seen at the irradiated animals until the end of their life (640 days). The reason for this could be permanent disorders in cellular regulation caused by the gamma irradiation. 4 figs. (Author)

Preparation of Polymeric Micelles for use as Carriers of ...

African Journals Online (AJOL)

These micelles were characterized by dynamic light scattering, to measure the micelle diameter; by acid-base titration, to determine the percentage of carboxylic groups occupied by the tuberculostatic; by Sudan III solubility tests, to estimate the critical micelle concentration (CMC); and visual control and spectrophotometric ...

Replication stress activates DNA repair synthesis in mitosis

DEFF Research Database (Denmark)

Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A

2015-01-01

Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps...... into mitotic prophase triggers the recruitment of MUS81 to CFSs. The nuclease activity of MUS81 then promotes POLD3-dependent DNA synthesis at CFSs, which serves to minimize chromosome mis-segregation and non-disjunction. We propose that the attempted condensation of incompletely duplicated loci in early...... mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest...

New thiol-responsive mono-cleavable block copolymer micelles labeled with single disulfides.

Science.gov (United States)

Sourkohi, Behnoush Khorsand; Schmidt, Rolf; Oh, Jung Kwon

2011-10-18

Thiol-responsive symmetric triblock copolymers having single disulfide linkages in the middle blocks (called mono-cleavable block copolymers, ss-ABP(2)) were synthesized by atom transfer radical polymerization in the presence of a disulfide-labeled difunctional Br-initiator. These brush-like triblock copolymers consist of a hydrophobic polyacrylate block having pendent oligo(propylene oxide) and a hydrophilic polymethacrylate block having pendent oligo(ethylene oxide). Gel permeation chromatography and (1)H NMR results confirmed the synthesis of well-defined mono-cleavable block copolymers and revealed that polymerizations were well controlled. Because of amphiphilic nature, these copolymers self-assembled to form colloidally stable micelles above critical micellar concentration of 0.032 mg · mL(-1). In response to reductive reactions, disulfides in thiol-responsive micelles were cleaved. Atomic force microscopy and dynamic light scattering analysis suggested that the cleavage of disulfides caused dissociation of micelles to smaller-sized assembled structures in water. Moreover, in a biomedical perspective, the mono-cleavable block copolymer micelles are not cytotoxic and thus biocompatible. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Dissociation of histone and DNA synthesis in x-irradiated HeLa cells

International Nuclear Information System (INIS)

Bases, R.; Mendez, F.

1971-01-01

Although histone synthesis and DNA synthesis are normally very well coordinated in HeLa cells, their histone synthesis proved relatively resistant to inhibition by ionizing radiation. During the first 24 h after 1,000 R the rate of cellular DNA synthesis progressively fell to small fractions of control values while histone synthesis with much less relative reduction. Acrylamide gel electropherograms of the acid soluble nuclear histones synthesized by irradiated HeLa cells were qualitatively normal

Responsive micellar films of amphiphilic block copolymer micelles: control on micelle opening and closing.

Science.gov (United States)

Chen, Zhiquan; He, Changcheng; Li, Fengbin; Tong, Ling; Liao, Xingzhi; Wang, Yong

2010-06-01

We reported the deliberate control on the micelle opening and closing of amphiphilic polystyrene-block-poly(2-vinylpyridine) (PS-b-P2VP) micellar films by exposing them to selective solvents. We first treated the micellar films with polar solvents including ethanol and water (pH = 4, 8, and 12) that have different affinities to P2VP. We observed opening of the micelles in all the cases. Both the size of opened pores and the opening rate are dependent on the solvency of different solvents for P2VP. We then explored the closing behavior of the opened micelles using solvents having different affinities to PS. We found that the opened micelles were recovered to their initial closed micelle forms. The recovery was accompanied by a slow micelle disassociation process which gradually reduced the micelle size. The rates of the micelle closing and disassociation are also dependent on the solvency of different solvents for PS.

Induction of unscheduled DNA synthesis on the nuclear matrix of rat hepatocytes after whole-body γ-irradiation

International Nuclear Information System (INIS)

Bezlepkin, V.G.; Malinovskij, Yu.Yu.; Kuznetsova, E.A.; Namvar, R.A.; Gaziev, A.I.

1986-01-01

DNA synthesis in hepatocytes was studied by incorporation of [ 3 H]thymidine administered of portal vein of γ-irradiated (80 Gy) rats. It was shown that the rate of replicative DNA synthesis decreased in hepatocytes of the regenerating liver and unscheduled DNA synthesis was induced at the nuclear matrix of resting cells of the intact liver. In addition to repair synthesis, DNA synthesis resembling replicative one (''aberrant'' DNA synthesis) accounts for a considerable fraction of γ-radiation-induced synthesis of DNA at the nuclear matrix

Neurotensin enhances estradiol induced DNA synthesis in immature rat uterus

Energy Technology Data Exchange (ETDEWEB)

Mistry, A.; Vijayan, E.

1985-05-27

Systemic administration of Neurotensin, a tridecapeptide, in immature rats treated with estradiol benzoate significantly enhances uterine DNA synthesis as reflected by the incorporation of /sup 3/H-thymidine. The peptide may have a direct action on the uterus. Substance P, a related peptide, had no effect on uterine DNA synthesis. 18 references, 4 tables.

Effect of DNA polymerase inhibitors on DNA repair in intact and permeable human fibroblasts: Evidence that DNA polymerases δ and β are involved in DNA repair synthesis induced by N-methyl-N'-nitro-N-nitrosoguanidine

International Nuclear Information System (INIS)

Hammond, R.A.; Miller, M.R.; McClung, J.K.

1990-01-01

The involvement of DNA polymerases α, β, and δ in DNA repair synthesis induced by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) was investigated in human fibroblasts (HF). The effects of anti-(DNA polymerase α) monoclonal antibody, (p-n-butylphenyl)deoxyguanosine triphosphate (BuPdGTP), dideoxythymidine triphosphate (ddTTP), and aphidicolin on MNNG-induced DNA repair synthesis were investigated to dissect the roles of the different DNA polymerases. A subcellular system (permeable cells), in which DNA repair synthesis and DNA replication were differentiated by CsCl gradient centrifugation of BrdUMP density-labeled DNA, was used to examine the effects of the polymerase inhibitors. Another approach investigated the effects of several of these inhibitors of MNNG-induced DNA repair synthesis in intact cells by measuring the amount of [ 3 H]thymidine incorporated into repair DNA as determined by autoradiography and quantitation with an automated video image analysis system. In permeable cells, MNNG-induced DNA repair synthesis was inhibited 56% by 50 μg of aphidicolin/mL, 6% by 10 μM BuPdGTP, 13% by anti-(DNA polymerse α) monoclonal antibodies, and 29% by ddTTP. In intact cells, MNNG-induced DNA repair synthesis was inhibited 57% by 50 μg of aphidicolin/mL and was not significantly inhibited by microinjecting anti-(DNA polymerase α) antibodies into HF nuclei. These results indicate that both DNA polymerase δ and β are involved in repairing DNA damage caused by MNNG

Stable and biocompatible genipin-inducing interlayer-crosslinked micelles for sustained drug release

Energy Technology Data Exchange (ETDEWEB)

Dai, Yu; Zhang, Xiaojin, E-mail: zhangxj@cug.edu.cn [China University of Geosciences, Faculty of Materials Science and Chemistry (China)

2017-05-15

To develop the sustained drug release system, here we describe genipin-inducing interlayer-crosslinked micelles crosslinked via Schiff bases between the amines of amphiphilic linear-hyperbranched polymer poly(ethylene glycol)-branched polyethylenimine-poly(ε-caprolactone) (PEG-PEI-PCL) and genipin. The generation of Schiff bases was confirmed by the color changes and UV-Vis absorption spectra of polymeric micelles after adding genipin. The particle size, morphology, stability, in vitro cytotoxicity, drug loading capacity, and in vitro drug release behavior of crosslinked micelles as well as non-crosslinked micelles were characterized. The results indicated that genipin-inducing interlayer-crosslinked micelles had better stability and biocompatibility than non-crosslinked micelles and glutaraldehyde-inducing interlayer-crosslinked micelles. In addition, genipin-inducing interlayer-crosslinked micelles were able to improve drug loading capacity, reduce the initial burst release, and achieve sustained drug release.

Synthesis and structural characterization of piperazino-modified DNA that favours hybridization towards DNA over RNA

DEFF Research Database (Denmark)

Skov, Joan; Bryld, Torsten; Lindegaard, Dorthe

2011-01-01

We report the synthesis of two C4'-modified DNA analogues and characterize their structural impact on dsDNA duplexes. The 4'-C-piperazinomethyl modification stabilizes dsDNA by up to 5°C per incorporation. Extension of the modification with a butanoyl-linked pyrene increases the dsDNA stabilizati...

Synthesis and characterization of erbium-doped SiO2 nanoparticles fabricated by using reverse micelle and sol-gel processing

International Nuclear Information System (INIS)

Park, Hoyyul; Bae, Dongsik

2012-01-01

Erbium-doped SiO 2 nanoparticles have been synthesized using a reverse micelle technique combined with metal-alkoxide hydrolysis and condensation. The sizes and the morphologies of the erbium-doped SiO 2 nanoparticles could be changed by varying the molar ratio of water to surfactant. The sizes and the morphologies of the erbium-doped SiO 2 nanoparticles were examined by using a transmission electron microscope. The average size of synthesized erbium-doped SiO 2 nanoparticles was approximately 20 - 25 nm and that of the erbium particles was 3 - 5 nm. The effects of the synthesis parameters, such as the molar ratio of water to surfactant, are discussed.

Stimulatory effect of low dose radionuclide on DNA synthesis and UDS in splenic lymphocytes

International Nuclear Information System (INIS)

Zhu Shoupeng; Yang Zhanshan

1999-12-01

To study the stimulatory effect on DNA synthesis and unscheduled DNA synthesis (UDS) in splenic lymphocytes induced by low dose enriched uranium 235 U. By using 3 H-TdR incorporation assay technique, the DNA replicative synthesis in PHA and LPS stimulated splenic lymphocytes was observed. By using DNA synthesis inhibitor such as hydroxyurea, the UV-induced unscheduled DNA synthesis in splenic lymphocytes occurred. When the injected low dose of enriched uranium 235 u was 0.1 μg/kg body weight, the transformation capacity was elevated for splenic T lymphocytes, simultaneously the stimulative index increased. The UDS of splenic lymphocytes induced by ultra-violate revealed a statistically significant increase by low dose of enriched uranium 235 U at the range of 0.1-20 μg/kg body weight. A stimulatory action of low dose enriched uranium 235 U on DNA replicative synthesis as well as on UV-induced UDS in splenic lymphocytes was detected

Unscheduled DNA synthesis and elimination of DNA damage in liver cells of. gamma. -irradiated senescent mice

Energy Technology Data Exchange (ETDEWEB)

Gaziev, A.I.; Malakhova, L.V. (AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki)

1982-10-01

The level of 'spontaneous' and ..gamma..-radiation-induced DNA synthesis which is not inhibited with hydroxyurea (unscheduled synthesis) is considerably lower in hepatocytes of 18-22-month-old mice than that of 1.5-2-month-old mice. The dose-dependent increase (10-300 Gy) of unscheduled DNA synthesis (UDS) in hepatocytes of senescent mice is higher than in young animals. The elimination of damage in DNA of ..gamma..-irradiated hepatocytes (100 Gy) was examined by using an enzyme system (M. luteus extract and DNA-polymerase I of E. coli). It was found that the rate of elimination of the DNA damage in hepatocytes of 20-month-old mice is lower than that of 2-month-old mice although the activities of DNA-polymerase ..beta.. and apurinic endonuclease remain equal in the liver of both senescent and young mice. However, the nucleoids from ..gamma..-irradiated liver nuclei of 2-month-old mice are relaxed to a greater extent (as judged by the criterion of ethidium-binding capacity) than those of 20-month-old mice. The results suggest that there are limitations in the functioning of repair enzymes and in their access to damaged DNA sites in the chromatin of senescent mouse liver cells.

Radioresistant DNA synthesis in cells of patients showing increased chromosomal sensitivity to ionizing radiation

International Nuclear Information System (INIS)

Barenfeld, L.S.; Pleskach, N.M.; Bildin, V.N.; Prokofjeva, V.V.; Mikhelson, V.M.

1986-01-01

The rate of DNA synthesis after γ-irradiation was studied either by analysis of the steady-state distribution of daughter [ 3 H]DNA in alkaline sucrose gradients or by direct assay of the amount of [ 3 H]thymidine incorporated into DNA of fibroblasts derived from a normal donor (LCH882) and from Down's syndrome (LCH944), Werner's syndrome (WS1LE) and xeroderma pigmentosum (XP2LE) patients with chromosomal sensitivity to ionizing radiation. Doses of γ-irradiation that markedly inhibited the rate of DNA synthesis in normal human cells caused almost no inhibition of DNA synthesis in the cells from the affected individuals. The radioresistant DNA synthesis in Down's syndrome cells was mainly due to a much lower inhibition of replicon initiation than that in normal cells; these cells were also more resistant to damage that inhibited replicon elongation. Our data suggest that radioresistant DNA synthesis may be an intrinsic feature of all genetic disorders showing increased radiosensitivity in terms of chromosome aberrations. (orig.)

Cell-free assay measuring repair DNA synthesis in human fibroblasts

International Nuclear Information System (INIS)

Ciarrocchi, G.; Linn, S.

1978-01-01

Osmotic disruption of confluent cultured human fibroblasts that have been irradiated or exposed to chemical carcinogens allows the specific measurement of repair DNA synthesis using dTTP as a precursor. Fibroblasts similarly prepared from various xeroderma pigmentosum cell lines show the deficiencies of uv-induced DNA synthesis predicted from in vivo studies, while giving normal responses to methylmethanesulfonate. A pyrimidine-dimer-specific enzyme, T4 endonuclease V, stimulated the rate of uv-induced repair synthesis with normal and xeroderma pigmentosum cell lines. This system should prove useful for identifying agents that induce DNA repair, and cells that respond abnormally to such induction. It should also be applicable to an in vitro complementation assay with repair-defective cells and proteins obtained from repair-proficient cells. Finally, by using actively growing fibroblasts and thymidine in the system, DNA replication can be measured and studied in vitro

Design of block-copolymer-based micelles for active and passive targeting

NARCIS (Netherlands)

Lebouille, Jérôme G J L; Leermakers, Frans A M; Cohen Stuart, Martien A.; Tuinier, Remco

2016-01-01

A self-consistent field study is presented on the design of active and passive targeting block-copolymeric micelles. These micelles form in water by self-assembly of triblock copolymers with a hydrophilic middle block and two hydrophobic outer blocks. A minority amount of diblock copolymers with the

Design of block-copolymer-based micelles for active and passive targeting

NARCIS (Netherlands)

Lebouille, Jérôme G.J.L.; Leermakers, Frans A.M.; Cohen Stuart, Martien A.; Tuinier, Remco

2016-01-01

A self-consistent field study is presented on the design of active and passive targeting block-copolymeric micelles. These micelles form in water by self-assembly of triblock copolymers with a hydrophilic middle block and two hydrophobic outer blocks. A minority amount of diblock copolymers with

Escape from X-ray-induced arrest for lens cells stimulated from quiescence: time relationship to RNA, protein, and DNA synthesis

International Nuclear Information System (INIS)

Lindgren, A.L.; Miller, R.C.; Guernsey, D.L.; Riley, E.F.

1988-01-01

Quiescent cells of the central zone region of the rat lens epithelium were stimulated to enter the proliferation cycle by wounding. RNA synthesis and a corresponding increase in poly(A)+/total RNA reached a peak by Hour 4. Cells progressed into the G1B compartment by Hour 10. A rise in protein synthesis began at Hour 8, and onset of DNA synthesis occurred by Hour 14. The timing of cell cycle progression that allowed escape from a dose of X irradiation that completely inhibited DNA synthesis was investigated. A growth-arrest point was identified at Hour 9 where 10 GY of X irradiation given before, but not after, completely inhibited earliest responding cells from entering DNA synthesis on schedule. Increased quantities of cells entered DNA synthesis on schedule as timing of the X irradiation was moved closer to the end of G1. Based on time relationships, the rise in protein synthesis is correlated with the sufficient event for the escape

Immediate effects of grenz rays on epidermal DNA synthesis in the flanks of guinea pigs

International Nuclear Information System (INIS)

Daikeler, G.

1976-01-01

The following findings were obtained by autoradiography: 1) Labelling index (number of labelled cell nuclei per 1,000 based cells): Significant decrease immediately after exposure to grenz rays. 2) Silver grain index (number of silver cells as a function of the labelled basal cells): Significant decrease after irradiation. 3) DNA synthesis index (product of labelling index and silver grain index): Sifnificant decrease of the actual DNA synthesis rate of the reproductive cell cluster after exposure to grenz rays. (orig./AJ) [de

Radiosensitive Down syndrome lymphoblastoid lines have normal ionizing-radiation-induced inhibition of DNA synthesis

International Nuclear Information System (INIS)

Ganges, M.B.; Robbins, J.H.; Jiang, H.; Hauser, C.; Tarone, R.E.

1988-01-01

The extent of X-ray-induced inhibition of DNA synthesis was determined in radiosensitive lymphoblastoid lines from 3 patients with Down syndrome and 3 patients with ataxia telangiectasia (AT). Compared to 6 normal control lines, the 3 AT lines were abnormally resistant to X-ray-induced inhibition of DNA synthesis, while the 3 Down syndrome lines had normal inhibition. These results demonstrate that radiosensitive human cells can have normal X-ray-induced inhibition of DNA synthesis and provide new evidence for the dissociation of radioresistant DNA synthesis. (author). 27 refs.; 1 fig.; 1 tab

Checkpoint Kinase Rad53 Couples Leading- and Lagging-Strand DNA Synthesis under Replication Stress.

Science.gov (United States)

Gan, Haiyun; Yu, Chuanhe; Devbhandari, Sujan; Sharma, Sushma; Han, Junhong; Chabes, Andrei; Remus, Dirk; Zhang, Zhiguo

2017-10-19

The checkpoint kinase Rad53 is activated during replication stress to prevent fork collapse, an essential but poorly understood process. Here we show that Rad53 couples leading- and lagging-strand synthesis under replication stress. In rad53-1 cells stressed by dNTP depletion, the replicative DNA helicase, MCM, and the leading-strand DNA polymerase, Pol ε, move beyond the site of DNA synthesis, likely unwinding template DNA. Remarkably, DNA synthesis progresses further along the lagging strand than the leading strand, resulting in the exposure of long stretches of single-stranded leading-strand template. The asymmetric DNA synthesis in rad53-1 cells is suppressed by elevated levels of dNTPs in vivo, and the activity of Pol ε is compromised more than lagging-strand polymerase Pol δ at low dNTP concentrations in vitro. Therefore, we propose that Rad53 prevents the generation of excessive ssDNA under replication stress by coordinating DNA unwinding with synthesis of both strands. Copyright © 2017 Elsevier Inc. All rights reserved.

DNA synthesis in the imaginal wing discs of the American bollworm ...

Indian Academy of Sciences (India)

Unknown

The effect of two insect growth regulators of plant origin viz. plumbagin and azadirachtin and the ecdysteroids. 20-hydroxyecdysone, makisterone A and a phytoecdysteroid on DNA synthesis in imaginal wing discs of day 4 final instar Helicoverpa armigera larvae was studied. DNA synthesis increased with increase in time of.

pH-Responsive Micelle-Based Cytoplasmic Delivery System for Induction of Cellular Immunity

Directory of Open Access Journals (Sweden)

Eiji Yuba

2017-11-01

Full Text Available (1 Background: Cytoplasmic delivery of antigens is crucial for the induction of cellular immunity, which is an important immune response for the treatment of cancer and infectious diseases. To date, fusogenic protein-incorporated liposomes and pH-responsive polymer-modified liposomes have been used to achieve cytoplasmic delivery of antigen via membrane rupture or fusion with endosomes. However, a more versatile cytoplasmic delivery system is desired for practical use. For this study, we developed pH-responsive micelles composed of dilauroyl phosphatidylcholine (DLPC and deoxycholic acid and investigated their cytoplasmic delivery performance and immunity-inducing capability. (2 Methods: Interaction of micelles with fluorescence dye-loaded liposomes, intracellular distribution of micelles, and antigenic proteins were observed. Finally, antigen-specific cellular immune response was evaluated in vivo using ELIspot assay. (3 Results: Micelles induced leakage of contents from liposomes via lipid mixing at low pH. Micelles were taken up by dendritic cells mainly via macropinocytosis and delivered ovalbumin (OVA into the cytosol. After intradermal injection of micelles and OVA, OVA-specific cellular immunity was induced in the spleen. (4 Conclusions: pH-responsive micelles composed of DLPC and deoxycholic acid are promising as enhancers of cytosol delivery of antigens and the induction capability of cellular immunity for the treatment of cancer immunotherapy and infectious diseases.

Impairment of DNA synthesis in Gunn rat cerebellum.

Science.gov (United States)

Yamada, N; Sawasaki, Y; Nakajima, H

1977-05-06

Brain DNA synthesis was developmentally investigated in Gunn rat with marked cerebellar hypoplasia due to hereditary hyperbilirubinemia. In this mutant rat, the Purkinje cell was nearly selectively affected in the cerebellar cortex by bilirubin. The impaired DNA synthesis was observed in homozygous (jj) Gunn rat cerebellum, in which the DNA content and [3H]thymidine incorporation rate into DNA decreased after 10 days of age compared to those in the heterozygous (Jj)littermate. In contrast, these impairments were not found in the non-cerebellar parts of the brain and liver of jj Gunn rat. The activity of cerebellar thymidine kinase in jj Gunn rat decreased from a very early stae, being 80% of Jj rat at 6 days, and 50% at 10 days of age. The enzyme activity was not affected in the non-cerebellar parts of the brain. Although bilirubin competitively inhibited cerebellar thymidine kinase activity in vitro (15% at 10(-5) M), such bilirubin level was found to be about 1000-fold that in vivo. Moreover, photo-degradation of bilirubin in jj cerebellum exhibited no improvement in thymidine kinase activity, and the presence of an enzyme inactivator was not suggested in jj cerebellum. These results seem to indicate that the induction of thymidine kinase might be affected in jj Gunn rat cerebellum. The possibility that the impaired DNA synthesis in the external granular cells in jj cerebellum may be due to Purkinje cell damage is discussed.

Does trans-lesion synthesis explain the UV-radiation resistance of DNA synthesis in C.elegans embryos?

International Nuclear Information System (INIS)

Hartman, Phil; Reddy, Jennifer; Svendsen, Betty-Ann

1991-01-01

Over 10-fold larger fluences were required to inhibit both DNA synthesis and cell division in wild-type C.elegans embryos as compared with other model systems or C.elegans rad mutants. In addition, unlike in other organisms, the molecular weight of daughter DNA strands was reduced only after large, superlethal fluences. The molecular weight of nascent DNA fragments exceeded the interdimer distance by up to 19-fold, indicating that C.elegans embryos can replicate through non-instructional lesions. This putative trans-lesion synthetic capability may explain the refractory nature of UV-radiation on embryonic DNA synthesis and nuclear division in C.elegans. (author). 42 refs.; 7 figs

Does trans-lesion synthesis explain the UV-radiation resistance of DNA synthesis in C. elegans embryos

Energy Technology Data Exchange (ETDEWEB)

Hartman, Phil; Reddy, Jennifer; Svendsen, Betty-Ann [Texas Christian Univ., Fort Worth, TX (United States). Dept. of Biology

1991-09-01

Over 10-fold larger fluences were required to inhibit both DNA synthesis and cell division in wild-type C.elegans embryos as compared with other model systems or C.elegans rad mutants. In addition, unlike in other organisms, the molecular weight of daughter DNA strands was reduced only after large, superlethal fluences. The molecular weight of nascent DNA fragments exceeded the interdimer distance by up to 19-fold, indicating that C.elegans embryos can replicate through non-instructional lesions. This putative trans-lesion synthetic capability may explain the refractory nature of UV-radiation on embryonic DNA synthesis and nuclear division in C.elegans. (author). 42 refs.; 7 figs.

Potency of carcinogens derived from covalent DNA binding and stimulation of DNA synthesis in rat liver

International Nuclear Information System (INIS)

Lutz, W.K.; Buesser, M.T.; Sagelsdorff, P.

1984-01-01

In order to investigate the role of the stimulation of cell division for the initiation (and possibly promotion) of liver tumors by chemical carcinogens, the incorporation of radiolabelled thymidine into liver DNA was determined in male rats. Single doses of various levels of aflatoxin B1, benzidine and carbon tetrachloride (all known to be genotoxic via DNA binding) did not affect cell division, whereas several hepatocarcinogens known not to bind to DNA (alpha-HCH, clofibrate, and 2,3,7,8-tetrachlorodibenzo-p-dioxin) gave rise to a dose-dependent stimulation of liver DNA synthesis within 24 h. An equation combining the influences of mitotic stimulation, expressed as dose required to double the control level of DNA synthesis, and DNA binding potency, expressed as the Covalent Binding Index, correlated well with the carcinogenic potency for both classes of hepatocarcinogens

Ultrafast dynamics of solvation and charge transfer in a DNA-based biomaterial.

Science.gov (United States)

Choudhury, Susobhan; Batabyal, Subrata; Mondol, Tanumoy; Sao, Dilip; Lemmens, Peter; Pal, Samir Kumar

2014-05-01

Charge migration along DNA molecules is a key factor for DNA-based devices in optoelectronics and biotechnology. The association of a significant amount of water molecules in DNA-based materials for the intactness of the DNA structure and their dynamic role in the charge-transfer (CT) dynamics is less documented in contemporary literature. In the present study, we have used a genomic DNA-cetyltrimethyl ammonium chloride (CTMA) complex, a technological important biomaterial, and Hoechest 33258 (H258), a well-known DNA minor groove binder, as fluorogenic probe for the dynamic solvation studies. The CT dynamics of CdSe/ZnS quantum dots (QDs; 5.2 nm) embedded in the as-prepared and swollen biomaterial have also been studied and correlated with that of the timescale of solvation. We have extended our studies on the temperature-dependent CT dynamics of QDs in a nanoenvironment of an anionic, sodium bis(2-ethylhexyl)sulfosuccinate reverse micelle (AOT RMs), whereby the number of water molecules and their dynamics can be tuned in a controlled manner. A direct correlation of the dynamics of solvation and that of the CT in the nanoenvironments clearly suggests that the hydration barrier within the Arrhenius framework essentially dictates the charge-transfer dynamics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Micelle-templated, poly(lactic-co-glycolic acid nanoparticles for hydrophobic drug delivery

Directory of Open Access Journals (Sweden)

Nabar GM

2018-01-01

functionality, and can be produced at scale using electrospray.Conclusion: Encapsulation of PLGA within micelles provides a bottom-up route for the synthesis of sub-100 nm PLGA-based nanocarriers with enhanced stability and drug-loading capacity, and tunable drug release, suitable for potential clinical applications. Keywords: PLGA, nanoparticles, micelles, drug delivery, hydrophobic drug, block copolymer, glioma, electrospray

Biocompatible Polyhydroxyethylaspartamide-based Micelles with Gadolinium for MRI Contrast Agents

Directory of Open Access Journals (Sweden)

Kim Hyo Jeong

2010-01-01

Full Text Available Abstract Biocompatible poly-[N-(2-hydroxyethyl-d,l-aspartamide]-methoxypoly(ethyleneglycol-hexadecylamine (PHEA-mPEG-C16 conjugated with 1,4,7,10-tetraazacyclododecan-1,4,7,10-tetraacetic acid-gadolinium (DOTA-Gd via ethylenediamine (ED was synthesized as a magnetic resonance imaging (MRI contrast agent. Amphiphilic PHEA-mPEG-C16-ED-DOTA-Gd forms micelle in aqueous solution. All the synthesized materials were characterized by proton nuclear magnetic resonance (1H NMR. Micelle size and shape were examined by dynamic light scattering (DLS and atomic force microscopy (AFM. Micelles with PHEA-mPEG-C16-ED-DOTA-Gd showed higher relaxivities than the commercially available gadolinium contrast agent. Moreover, the signal intensity of a rabbit liver was effectively increased after intravenous injection of PHEA-mPEG-C16-ED-DOTA-Gd.

pH-Responsive Hyaluronic Acid-Based Mixed Micelles for the Hepatoma-Targeting Delivery of Doxorubicin

Directory of Open Access Journals (Sweden)

Jing-Liang Wu

2016-03-01

Full Text Available The tumor targetability and stimulus responsivity of drug delivery systems are crucial in cancer diagnosis and treatment. In this study, hepatoma-targeting mixed micelles composed of a hyaluronic acid–glycyrrhetinic acid conjugate and a hyaluronic acid-l-histidine conjugate (HA–GA/HA–His were prepared through ultrasonic dispersion. The formation and characterization of the mixed micelles were confirmed via 1H-NMR, particle size, and ζ potential measurements. The in vitro cellular uptake of the micelles was evaluated using human liver carcinoma (HepG2 cells. The antitumor effect of doxorubicin (DOX-loaded micelles was investigated in vitro and in vivo. Results indicated that the DOX-loaded HA–GA/HA–His micelles showed a pH-dependent controlled release and were remarkably absorbed by HepG2 cells. Compared with free DOX, the DOX-loaded HA–GA/HA–His micelles showed a higher cytotoxicity to HepG2 cells. Moreover, the micelles effectively inhibited tumor growth in H22 cell-bearing mice. These results suggest that the HA–GA/HA–His mixed micelles are a good candidate for drug delivery in the prevention and treatment of hepatocarcinoma.

Extracellular matrix components influence DNA synthesis of rat hepatocytes in primary culture

International Nuclear Information System (INIS)

Sawada, N.; Tomomura, A.; Sattler, C.A.; Sattler, G.L.; Kleinman, H.K.; Pitot, H.C.

1986-01-01

The effects of several extracellular matrix components (EMCs) - fibronectin (Fn), laminin (Ln), type I (C-I) and type IV (C-IV) collagen - on DNA synthesis in rat hepatocytes in primary culture were examined by both quantitative scintillation spectrometry and autoradiography of [ 3 H]thymidine incorporation. Hepatocytes cultured on Fn showed the most active DNA synthesis initiated by epidermal growth factor (EGF) with decreasing levels of [ 3 H]thymidine uptake exhibited in the cell cultured on C-IV, C-I, and Ln, respectively. The decreasing level of DNA synthesis in hepatocytes cultured on Fn, C-IV, C-I, and Ln respectively was not influenced by cell density. The number of EGF receptors of hepatocytes was also not influenced by EMCs. These data suggest that EMCs modify hepatocyte DNA synthesis by means of post-EGF-receptor mechanisms which are regulated by both growth factors and cell density

Stereocomplex micelle from nonlinear enantiomeric copolymers efficiently transports antineoplastic drug

Science.gov (United States)

Wang, Jixue; Shen, Kexin; Xu, Weiguo; Ding, Jianxun; Wang, Xiaoqing; Liu, Tongjun; Wang, Chunxi; Chen, Xuesi

2015-05-01

Nanoscale polymeric micelles have attracted more and more attention as a promising nanocarrier for controlled delivery of antineoplastic drugs. Herein, the doxorubicin (DOX)-loaded poly(D-lactide)-based micelle (PDM/DOX), poly(L-lactide)-based micelle (PLM/DOX), and stereocomplex micelle (SCM/DOX) from the equimolar mixture of the enantiomeric four-armed poly(ethylene glycol)-polylactide (PEG-PLA) copolymers were successfully fabricated. In phosphate-buffered saline (PBS) at pH 7.4, SCM/DOX exhibited the smallest hydrodynamic diameter ( D h) of 90 ± 4.2 nm and the slowest DOX release compared with PDM/DOX and PLM/DOX. Moreover, PDM/DOX, PLM/DOX, and SCM/DOX exhibited almost stable D hs of around 115, 105, and 90 nm at above normal physiological condition, respectively, which endowed them with great potential in controlled drug delivery. The intracellular DOX fluorescence intensity after the incubation with the laden micelles was different degrees weaker than that incubated with free DOX · HCl within 12 h, probably due to the slow DOX release from micelles. As the incubation time reached to 24 h, all the cells incubated with the laden micelles, especially SCM/DOX, demonstrated a stronger intracellular DOX fluorescence intensity than free DOX · HCl-cultured ones. More importantly, all the DOX-loaded micelles, especially SCM/DOX, exhibited potent antineoplastic efficacy in vitro, excellent serum albumin-tolerance stability, and satisfactory hemocompatibility. These encouraging data indicated that the loading micelles from nonlinear enantiomeric copolymers, especially SCM/DOX, might be promising in clinical systemic chemotherapy through intravenous injection.

Primer-Independent DNA Synthesis by a Family B DNA Polymerase from Self-Replicating Mobile Genetic Elements

Directory of Open Access Journals (Sweden)

Modesto Redrejo-Rodríguez

2017-11-01

Full Text Available Family B DNA polymerases (PolBs play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB, that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance.

Importance of the efficiency of double-stranded DNA formation in cDNA synthesis for the imprecision of microarray expression analysis.

Science.gov (United States)

Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J

2013-04-01

The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry

Enzymatically triggered multifunctional delivery system based on hyaluronic acid micelles

KAUST Repository

Deng, Lin

2012-01-01

Tumor targetability and stimuli responsivity of drug delivery systems (DDS) are key factors in cancer therapy. Implementation of multifunctional DDS can afford targetability and responsivity at the same time. Herein, cholesterol molecules (Ch) were coupled to hyaluronic acid (HA) backbones to afford amphiphilic conjugates that can self-assemble into stable micelles. Doxorubicin (DOX), an anticancer drug, and superparamagnetic iron oxide (SPIO) nanoparticles (NPs), magnetic resonance imaging (MRI) contrast agents, were encapsulated by Ch-HA micelles and were selectively released in the presence of hyaluronidase (Hyals) enzyme. Cytotoxicity and cell uptake studies were done using three cancer cell lines (HeLa, HepG2 and MCF7) and one normal cell line (WI38). Higher Ch-HA micelles uptake was seen in cancer cells versus normal cells. Consequently, DOX release was elevated in cancer cells causing higher cytotoxicity and enhanced cell death. © 2012 The Royal Society of Chemistry.

DNA repair and DNA synthesis in leukemic and virus infected cells

International Nuclear Information System (INIS)

Tuschl, H.; Altmann, H.; Kovac, R.; Topaloglou, A.; Stacher, A.; Fanta, D.

1978-09-01

Autoradiographic determinations of unscheduled DNA synthesis in peripheral lymphocytes of leukemic patients showed strongly different results according to various types of disease of different forms of therapy, respectively. Similar investigations performed with lymphocytes of Herpes simplex infected persons during symptom-free intervals revealed imbalances of the repair system caused by virus infection. BND cellulose chromatography and measurement of 3 H-thymidine incorporation into single- and double stranded DNA fractions showed an increase in velocity of the rejoining process, but a decrease in total incorporation. Because of these results and the demonstration of the supercoiled structure of DNA it is suggested that virusinfections cause a faster rejoining of gaps, but at the same time leave a number of failures within DNA unrecognized. (author)

Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases.

Science.gov (United States)

Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I

2012-03-13

We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases.

Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases

Science.gov (United States)

Pavlov, Andrey R.; Pavlova, Nadejda V.; Kozyavkin, Sergei A.; Slesarev, Alexei I.

2012-01-01

We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases (Pavlov et. al., (2002) Proc. Natl. Acad. Sci. USA 99, 13510–13515). The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various non-specific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting Helix-hairpin-Helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species, but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of TopoV HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105°C by maintaining processivity of DNA synthesis at high temperatures. We also found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. PMID:22320201

Unscheduled DNA synthesis in human hair follicles after in vitro exposure to 11 chemicals: comparison with unscheduled DNA synthesis in rat hepatocytes.

Science.gov (United States)

van Erp, Y H; Koopmans, M J; Heirbaut, P R; van der Hoeven, J C; Weterings, P J

1992-06-01

A new method is described to investigate unscheduled DNA synthesis (UDS) in human tissue after exposure in vitro: the human hair follicle. A histological technique was applied to assess cytotoxicity and UDS in the same hair follicle cells. UDS induction was examined for 11 chemicals and the results were compared with literature findings for UDS in rat hepatocytes. Most chemicals inducing UDS in rat hepatocytes raised DNA repair at comparable concentrations in the hair follicle. However, 1 of 9 chemicals that gave a positive response in the rat hepatocyte UDS test, 2-acetylaminofluorene, failed to induce DNA repair in the hair follicle. Metabolizing potential of hair follicle cells was shown in experiments with indirectly acting compounds, i.e., benzo[a]pyrene, 7,12-dimethylbenz[a]anthracene and dimethylnitrosamine. The results support the conclusion that the test in its present state is valuable as a screening assay for the detection of unscheduled DNA synthesis. Moreover, the use of human tissues may result in a better extrapolation to man.

Mixed micelles of 7,12-dioxolithocholic acid and selected hydrophobic bile acids: interaction parameter, partition coefficient of nitrazepam and mixed micelles haemolytic potential.

Science.gov (United States)

Poša, Mihalj; Tepavčević, Vesna

2011-09-01

The formation of mixed micelles built of 7,12-dioxolithocholic and the following hydrophobic bile acids was examined by conductometric method: cholic (C), deoxycholic (D), chenodeoxycholic (CD), 12-oxolithocholic (12-oxoL), 7-oxolithocholic (7-oxoL), ursodeoxycholic (UD) and hiodeoxycholic (HD). Interaction parameter (β) in the studied binary mixed micelles had negative value, suggesting synergism between micelle building units. Based on β value, the hydrophobic bile acids formed two groups: group I (C, D and CD) and group II (12-oxoL, 7-oxoL, UD and HD). Bile acids from group II had more negative β values than bile acids from group I. Also, bile acids from group II formed intermolecular hydrogen bonds in aggregates with both smaller (2) and higher (4) aggregation numbers, according to the analysis of their stereochemical (conformational) structures and possible structures of mixed micelles built of these bile acids and 7,12-dioxolithocholic acid. Haemolytic potential and partition coefficient of nitrazepam were higher in mixed micelles built of the more hydrophobic bile acids (C, D, CD) and 7,12-dioxolithocholic acid than in micelles built only of 7,12-dioxolithocholic acid. On the other hand, these mixed micelles still had lower values of haemolytic potential than micelles built of C, D or CD. The mixed micelles that included bile acids: 12-oxoL, 7-oxoL, UD or HD did not significantly differ from the micelles of 7,12-dioxolithocholic acid, observing the values of their haemolytic potential. Copyright © 2011 Elsevier B.V. All rights reserved.

Synthesis, self-assembly and lipoplex formulation of two novel cyclic phosphonate lipids

Directory of Open Access Journals (Sweden)

JenniferYeh

2013-05-01

Full Text Available Background: Synthetic cationic lipids hold much potential as gene packaging and delivery agents for the treatment of inherited and acquired life threatening diseases, such as cancer, AIDS, cardiovascular diseases, and certain autoimmune disorders. Methods: We report the synthesis, self-assembly as characterized by critical micelle concentrations and plasmid DNA gel retardation using two novel cyclic, phosphonate cationic lipids 2a and 2b, which were synthesized by derivatizing two diastereomeric macrocyclic phosphonates 1a and 1b with a 2-carbon hydroxylamine linker, N, N-dimethylethanolamine (3. Results: The production of cyclic phosphonate lipids 2a and 2b in 73% and 60% yields, respectively, was achieved using classical synthetic methods involving nucleophilic substitution at the phosphorus centre. Conclusions: The synthesis, aggregation and DNA binding properties of these novel cyclic phosphonate lipids suggest that they may have utility serving as gene packaging and delivery agents.

Survey of current trends in DNA synthesis core facilities.

Science.gov (United States)

Hager, K M; Fox, J W; Gunthorpe, M; Lilley, K S; Yeung, A

1999-12-01

The Nucleic Acids Research Group of the Association of Biomolecular Resource Facilities (ABRF) last surveyed DNA synthesis core facilities in April 1995. Because of the introduction of new technologies and dramatic changes in the market, we sought to update survey information and to determine how academic facilities responded to the challenge presented by commercial counterparts. The online survey was opened in January 1999 by notifying members and subscribers to the ABRF electronic discussion group. The survey consisted of five parts: general facility information, oligonucleotide production profile, oligonucleotide charges, synthesis protocols, and trends in DNA synthesis (including individual comments). All submitted data were anonymously coded. Respondents from DNA synthesis facilities were primarily from the academic category and were established between 1984 and 1991. Typically, a facility provides additional services such as DNA sequencing and has upgraded to electronic ordering. There is stability in staffing profiles for these facilities in that the total number of employees is relatively unchanged, the tenure for staff averages 5.9 years, and experience is extensive. On average, academic facilities annually produce approximately 1/16 the number of oligonucleotides produced by the average commercial facilities, but all facilities report an increase in demand. Charges for standard oligonucleotides from academic facilities are relatively higher than from commercial companies; however, the opposite is true for modified phosphoramidites. Subsidized facilities charge less than nonsubsidized facilities. Synthesis protocols and reagents are standard across the categories. Most facilities offer typical modifications such as biotinylation. Despite the competition by large commercial facilities that have reduced costs dramatically, academic facilities remain a stable entity. Academic facilities enhance the quality of service by focusing on nonstandard

Supercritical fluid reverse micelle separation

Science.gov (United States)

Fulton, J.L.; Smith, R.D.

1993-11-30

A method of separating solute material from a polar fluid in a first polar fluid phase is provided. The method comprises combining a polar fluid, a second fluid that is a gas at standard temperature and pressure and has a critical density, and a surfactant. The solute material is dissolved in the polar fluid to define the first polar fluid phase. The combined polar and second fluids, surfactant, and solute material dissolved in the polar fluid is maintained under near critical or supercritical temperature and pressure conditions such that the density of the second fluid exceeds the critical density thereof. In this way, a reverse micelle system defining a reverse micelle solvent is formed which comprises a continuous phase in the second fluid and a plurality of reverse micelles dispersed in the continuous phase. The solute material is dissolved in the polar fluid and is in chemical equilibrium with the reverse micelles. The first polar fluid phase and the continuous phase are immiscible. The reverse micelles each comprise a dynamic aggregate of surfactant molecules surrounding a core of the polar fluid. The reverse micelle solvent has a polar fluid-to-surfactant molar ratio W, which can vary over a range having a maximum ratio W[sub o] that determines the maximum size of the reverse micelles. The maximum ratio W[sub o] of the reverse micelle solvent is then varied, and the solute material from the first polar fluid phase is transported into the reverse micelles in the continuous phase at an extraction efficiency determined by the critical or supercritical conditions. 27 figures.

Semi-conservative synthesis of DNA in UV-sensitive mutant cells of Chinese hamster after UV-irradiation

International Nuclear Information System (INIS)

Vikhanskaya, F.L.; Khrebtukova, I.A.; Manuilova, E.S.

1985-01-01

A study was made of the rate of semi-conservative DNA synthesis in asynchronous UV-resistant (clone V79) and UV-sensitive clones (VII and XII) of Chinese hamster cells after UV-irradiation. In all 3 clones studied, UV-irradiation (5-30 J/m 2 ) induced a decrease in the rate of DNA synthesis during the subsequent 1-2 h. In the resistant clone (V79) recovery of DNA synthesis rate started after the first 2 h post-irradiation (5 J/m 2 ) and by the 3rd hour reached its maximum value, which constituted 70% of that observed in control, non-irradiated cells. The UV-sensitive mutant clones VII and XII showed no recovery in the rate of DNA synthesis during 6-7 h post-irradiation. The results obtained show that the survival of cells is correlated with the ability of DNA synthesis to recover after UV-irradiation in 3 clones studied. The observed recovery of UV-inhibited DNA synthesis in mutant clones may be due to certain defects in DNA repair. (orig.)

Histone gene expression remains coupled to DNA synthesis during in vitro cellular senescence

International Nuclear Information System (INIS)

Zambetti, G.; Stein, G.; Stein, J.; Dell'Orco, R.

1987-01-01

Despite a decrease in the extent to which confluent monolayers of late compared to early passage CF3 human diploid fibroblasts can be stimulated to proliferate, the time course of DNA synthesis onset is similar regardless of the in vitro age of the cells. A parallel and stoichiometric relationship is maintained between the rate of DNA synthesis and the cellular levels of histone mRNA independent of the age of the cell cultures. Furthermore, DNA synthesis and cellular histone mRNA levels decline in a coordinate manner after inhibition of DNA replication by hydroxyurea treatment. These results indicate that while the proliferative activity of human diploid fibroblasts decreases with passage in culture, those cells that retain the ability to proliferate continue to exhibit a tight coupling of DNA replication and histone gene expression

Stimulation of DNA synthesis in cultured rat alveolar type II cells

International Nuclear Information System (INIS)

Leslie, C.C.; McCormick-Shannon, K.; Robinson, P.C.; Mason, R.J.

1985-01-01

Restoration of the alveolar epithelium after injury is thought to be dependent on the proliferation of alveolar type II cells. To understand the factors that may be involved in promoting type II cell proliferation in vivo, we determined the effect of potential mitogens and culture substrata on DNA synthesis in rat alveolar type II cells in primary culture. Type II cells cultured in basal medium containing 10% fetal bovine serum (FBS) exhibited essentially no DNA synthesis. Factors that stimulated 3 H-thymidine incorporation included cholera toxin, epidermal growth factor, and rat serum. The greatest degree of stimulation was achieved by plating type II cells on an extracellular matrix prepared from bovine corneal endothelial cells and then by culturing the pneumocytes in medium containing rat serum, cholera toxin, insulin, and epidermal growth factor. Under conditions of stimulation of 3 H-thymidine incorporation there was an increased DNA content per culture dish but no increase in cell number. The ability of various culture conditions to promote DNA synthesis in type II cells was verified by autoradiography. Type II cells were identified by the presence of cytoplasmic inclusions, which were visualized by tannic acid staining before autoradiography. These results demonstrate the importance of soluble factors and culture substratum in stimulating DNA synthesis in rat alveolar type II cells in primary culture

Towards an easy access to Annexin-A5 protein binding block copolymer micelles

International Nuclear Information System (INIS)

Schmidt, Vanessa; Giacomelli, Cristiano; Brisson, Alain R.; Borsali, Redouane

2008-01-01

The formation of Annexin-A5 decorated (bio-functionalized) nanoparticles is of particular interest in micelle-mediated target drug delivery, in vivo magnetic resonance imaging, and controlled fabrication of biochips. This work describes an easy access to the synthesis and manipulation of block copolymer nano-objects exhibiting Annexin-A5 protein binding ability. Well-defined spherical micelles containing negatively charged phosphonic diacid groups - which are potential binding sites for Annexin-A5 proteins - at their hydrophilic periphery originate from the self-assembly of polystyrene-b-poly(2-phosphatethyl methacrylate-stat-2-hydroxyethyl methacrylate) (PS-b-P(PEMA-stat-HEMA)) amphiphilic macromolecules in aqueous media. PS-b-P(PEMA-stat-HEMA) can be prepared in a three-step phosphorylation/silylation/methanolysis procedure applied to PS-b-PHEMA precursors synthesized via Atom Transfer Radical Polymerization (ATRP). The herein discussed approach allows precise control over micellar dimensions and properties such as core radius (i.e., loading capacity), corona width, and density of phosphate groups at the micelle periphery

Loss of DNA-membrane interactions and cessation of DNA synthesis in myeloperoxidase-treated Escherichia coli

International Nuclear Information System (INIS)

Rosen, H.; Orman, J.; Rakita, R.M.; Michel, B.R.; VanDevanter, D.R.

1990-01-01

Neutrophils and monocytes employ a diverse array of antimicrobial effector systems to support their host defense functions. The mechanisms of action of most of these systems are incompletely understood. The present report indicates that microbicidal activity by a neutrophil-derived antimicrobial system, consisting of myeloperoxidase, enzymatically generated hydrogen peroxide, and chloride ion, is accompanied by prompt cessation of DNA synthesis in Escherichia coli, as determined by markedly reduced incorporation of [ 3 H]thymidine into trichloracetic acid-precipitable material. Simultaneously, the myeloperoxidase system mediates a decline in the ability of E. coli membranes to bind hemimethylated DNA sequences containing the E. coli chromosomal origin of replication (oriC). Binding of oriC to the E. coli membrane is an essential element of orderly chromosomal DNA replication. Comparable early changes in DNA synthesis and DNA-membrane interactions were not observed with alternative oxidant or antibiotic-mediated microbicidal systems. It is proposed that oxidants generated by the myeloperoxidase system modify the E. coli membrane in such a fashion that oriC binding is markedly impaired. As a consequence chromosomal DNA replication is impaired and organisms can no longer replicate

Stimuli-responsive biodegradable polymeric micelles for targeted cancer therapy

NARCIS (Netherlands)

Talelli, M.A.

2011-01-01

Thermosensitive and biodegradable polymeric micelles based on mPEG-b-pHPMAmLacn have shown very promising results during the past years. The results presented in this thesis illustrate the high potential of these micelles for anticancer therapy and imaging and fully justify further pharmaceutical

Lipoamino acid-based micelles as promising delivery vehicles for monomeric amphotericin B.

Science.gov (United States)

Serafim, Cláudia; Ferreira, Inês; Rijo, Patrícia; Pinheiro, Lídia; Faustino, Célia; Calado, António; Garcia-Rio, Luis

2016-01-30

Lipoamino acid-based micelles have been developed as delivery vehicles for the hydrophobic drug amphotericin B (AmB). The micellar solubilisation of AmB by a gemini lipoamino acid (LAA) derived from cysteine and its equimolar mixtures with the bile salts sodium cholate (NaC) and sodium deoxycholate (NaDC), as well as the aggregation sate of the drug in the micellar systems, was studied under biomimetic conditions (phosphate buffered-saline, pH 7.4) using UV-vis spectroscopy. Pure surfactant systems and equimolar mixtures were characterized by tensiometry and important parameters were determined, such as critical micelle concentration (CMC), surface tension at the CMC (γCMC), maximum surface excess concentration (Γmax), and minimum area occupied per molecule at the water/air interface (Amin). Rheological behaviour from viscosity measurements at different shear rates was also addressed. Solubilisation capacity was quantified in terms of molar solubilisation ratio (χ), micelle-water partition coefficient (KM) and Gibbs energy of solubilisation (ΔGs°). Formulations of AmB in micellar media were compared in terms of drug loading, encapsulation efficiency, aggregation state of AmB and in vitro antifungal activity against Candida albicans. The LAA-containing micellar systems solubilise AmB in its monomeric and less toxic form and exhibit in vitro antifungal activity comparable to that of the commercial formulation Fungizone. Copyright © 2015 Elsevier B.V. All rights reserved.

Relative ultraviolet radiation sensitivity of certain functions of polyoma virus. Stimulation of cell DNA synthesis

International Nuclear Information System (INIS)

Barra, Yves; Imbert, Jean; Planche, Jacqueline; Meyer, Georges.

1977-01-01

Peritoneal Mouse macrophages were used to study the stimulation of cell DNA synthesis by polyoma virus. Using ultraviolet-irradiated polyoma virus, it was possible to show a difference between the inactivation of infectivity and of induction of DNA synthesis. By statistical analysis of these two phenomena it was found that 39% of the viral genome is necessary for the induction of cell DNA synthesis [fr

Translesion synthesis DNA polymerases promote error-free replication through the minor-groove DNA adduct 3-deaza-3-methyladenine.

Science.gov (United States)

Yoon, Jung-Hoon; Roy Choudhury, Jayati; Park, Jeseong; Prakash, Satya; Prakash, Louise

2017-11-10

N3-Methyladenine (3-MeA) is formed in DNA by reaction with S -adenosylmethionine, the reactive methyl donor, and by reaction with alkylating agents. 3-MeA protrudes into the DNA minor groove and strongly blocks synthesis by replicative DNA polymerases (Pols). However, the mechanisms for replicating through this lesion in human cells remain unidentified. Here we analyzed the roles of translesion synthesis (TLS) Pols in the replication of 3-MeA-damaged DNA in human cells. Because 3-MeA has a short half-life in vitro , we used the stable 3-deaza analog, 3-deaza-3-methyladenine (3-dMeA), which blocks the DNA minor groove similarly to 3-MeA. We found that replication through the 3-dMeA adduct is mediated via three different pathways, dependent upon Polι/Polκ, Polθ, and Polζ. As inferred from biochemical studies, in the Polι/Polκ pathway, Polι inserts a nucleotide (nt) opposite 3-dMeA and Polκ extends synthesis from the inserted nt. In the Polθ pathway, Polθ carries out both the insertion and extension steps of TLS opposite 3-dMeA, and in the Polζ pathway, Polζ extends synthesis following nt insertion by an as yet unidentified Pol. Steady-state kinetic analyses indicated that Polι and Polθ insert the correct nt T opposite 3-dMeA with a much reduced catalytic efficiency and that both Pols exhibit a high propensity for inserting a wrong nt opposite this adduct. However, despite their low fidelity of synthesis opposite 3-dMeA, TLS opposite this lesion replicates DNA in a highly error-free manner in human cells. We discuss the implications of these observations for TLS mechanisms in human cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

DNA-Compatible Nitro Reduction and Synthesis of Benzimidazoles.

Science.gov (United States)

Du, Huang-Chi; Huang, Hongbing

2017-10-18

DNA-encoded chemical libraries have emerged as a cost-effective alternative to high-throughput screening (HTS) for hit identification in drug discovery. A key factor for productive DNA-encoded libraries is the chemical diversity of the small molecule moiety attached to an encoding DNA oligomer. The library structure diversity is often limited to DNA-compatible chemical reactions in aqueous media. Herein, we describe a facile process for reducing aryl nitro groups to aryl amines. The new protocol offers simple operation and circumvents the pyrophoric potential of the conventional method (Raney nickel). The reaction is performed in aqueous solution and does not compromise DNA structural integrity. The utility of this method is demonstrated by the versatile synthesis of benzimidazoles on DNA.

Semiconservative and unscheduled DNA-synthesis of rat thymocytes under the influence of some radioprotecting and radiosensitizing agents

Energy Technology Data Exchange (ETDEWEB)

Tempel, K.; Wulffius-Kock, M.; Winkle, J.; Schmerold, I.

1982-02-01

The effects of aminoethylisothiuroniumbromide (AET), cysteamine (CY-A), cysteine (CY-E), glutathione (GLU), mercaptoethanol (MA), mercaptopropionylglycine (MPG), N-ethylmaleimide (NEM), metronidazole (MNA), nitroacetophenone (NAP), nitrofurazone (NFA), arabinofuranosylcytosine (araC), fluorouracil (FU), adriamycin (AM), ethidiumbromide (E), bleomycin (BM), and diethyldithiocarbamate (DDC) on the semiconservative and unscheduled incorporation of /sup 3/H-thymidine into the DNA were tested on rat thymocytes in vitro. DNA damage has been measured using the hydroxylapatite system. Unscheduled DNA synthesis was induced by UV-light and/or X-irradiation. The semiconservative DNA synthesis was inhibited by the above substances-with exception of MA and MPG. Aminothioles, NAP, NFA, and BM enhanced, araC, FU, AM, E, and DDC diminished unscheduled DNA synthesis. After alkaline unwinding, the duplex form of DNA decreased under the influence of CY-A, CY-E, GLU, MPG, NEM, NAP, NFA, araC, FU, AM, E, and BM. It is suggested that stimulation of unscheduled DNA synthesis combined with a transient decrease of semiconservative DNA synthesis will amplify the DNA repair capacity of thymocytes, whereas radiation damage may be intensified by araC, FU, AM,E, and DDC - at least partly, through inhibition of unscheduled DNA synthesis. With respect to the action of NAP, NFA, and BM, DNA repair may be concerned in a more indirect manner.

Semiconservative and unscheduled DNA-synthesis of rat thymocytes under the influence of some radioprotecting and radiosensitizing agents

International Nuclear Information System (INIS)

Tempel, K.; Wulffius-Kock, M.; Winkle, J.; Schmerold, I.

1982-01-01

The effects of aminoethylisothiuroniumbromide (AET), cysteamine (CY-A), cysteine (CY-E), glutathione (GLU), mercaptoethanol (MA), mercaptopropionylglycine (MPG), N-ethylmaleimide (NEM), metronidazole (MNA), nitroacetophenone (NAP), nitrofurazone (NFA), arabinofuranosylcytosine (araC), fluorouracil (FU), adriamycin (AM), ethidiumbromide (E), bleomycin (BM), and diethyldithiocarbamate (DDC) on the semiconservative and unscheduled incorporation of 3 H-thymidine into the DNA were tested on rat thymocytes in vitro. DNA damage has been measured using the hydroxylapatite system. Unscheduled DNA synthesis was induced by UV-light and/or X-irradiation. The semiconservative DNA synthesis was inhibited by the above subtrances-with exception of MA and MPG. Aminothioles, NAP, NFA, and BM enhanced, araC, FU, AM, E, and DDC diminished unscheduled DNA synthesis. After alkaline unwinding, the duplex form of DNA decreased under the influence of CY-A, CY-E, GLU, MPG, NEM, NAP, NFA, araC, FU, AM, E, and BM. It is suggested that stimulation of unscheduled DNA synthesis combined with a transient decrease of semiconservative DNA synthesis will amplify the DNA repair capacity of thymocytes, whereas radiation damage may be intensified by araC, FU, AM,E, and DDC - at least partly, through inhibition of unscheduled DNA synthesis. With respect to the action of NAP, NFA, and BM, DNA repair may be concerned in a more indirect manner. (orig.) [de

Inhibitory effect of benzene metabolites on nuclear DNA synthesis in bone marrow cells

International Nuclear Information System (INIS)

Lee, E.W.; Johnson, J.T.; Garner, C.D.

1989-01-01

Effects of endogenously produced and exogenously added benzene metabolites on the nuclear DNA synthetic activity were investigated using a culture system of mouse bone marrow cells. Effects of the metabolites were evaluated by a 30-min incorporation of [ 3 H]thymidine into DNA following a 30-min interaction with the cells in McCoy's 5a medium with 10% fetal calf serum. Phenol and muconic acid did not inhibit nuclear DNA synthesis. However, catechol, 1,2,4-benzenetriol, hydroquinone, and p-benzoquinone were able to inhibit 52, 64, 79, and 98% of the nuclear DNA synthetic activity, respectively, at 24 μM. In a cell-free DNA synthetic system, catechol and hydroquinone did not inhibit the incorporation of [ 3 H]thymidine triphosphate into DNA up to 24 μM but 1,2,4-benzenetriol and p-benzoquinone did. The effect of the latter two benzene metabolites was completely blocked in the presence of 1,4-dithiothreitol (1 mM) in the cell-free assay system. Furthermore, when DNA polymerase α, which requires a sulfhydryl (SH) group as an active site, was replaced by DNA polymerase 1, which does not require an SH group for its catalytic activity, p-benzoquinone and 1,2,4-benzenetriol were unable to inhibit DNA synthesis. Thus, the data imply the p-benzoquinone and 1,2,4-benzenetriol inhibited DNA polymerase α, consequently resulting in inhibition of DNA synthesis in both cellular and cell-free DNA synthetic systems. The present study identifies catechol, hydroquinone, p-benzoquinone, and 1,2,4-benzenetriol as toxic benzene metabolites in bone marrow cells and also suggests that their inhibitory action on DNA synthesis is mediated by mechanism(s) other than that involving DNA damage as a primary cause

Neutral Polymeric Micelles for RNA Delivery

Science.gov (United States)

Lundy, Brittany B.; Convertine, Anthony; Miteva, Martina; Stayton, Patrick S.

2013-01-01

RNA interference (RNAi) drugs have significant therapeutic potential but delivery systems with appropriate efficacy and toxicity profiles are still needed. Here, we describe a neutral, ampholytic polymeric delivery system based on conjugatable diblock polymer micelles. The diblock copolymer contains a hydrophilic poly[N-(2-hydroxypropyl) methacrylamide-co-N-(2-(pyridin-2- yldisulfanyl)ethyl)methacrylamide) (poly[HPMA-co-PDSMA]) segment to promote aqueous stability and facilitate thiol-disulfide exchange reactions, and a second ampholytic block composed of propyl acrylic acid (PAA), dimethylaminoethyl methacrylate (DMAEMA), and butyl methacrylate (BMA). The poly[(HPMA-co-PDSMA)-b-(PAA-co-DMAEMA-co-BMA)] was synthesized using Reversible Addition-Fragmentation chain Transfer (RAFT) polymerization with an overall molecular weight of 22,000 g/mol and a PDI of 1.88. Dynamic light scattering and fluorescence measurements indicated that the diblock copolymers self-assemble under aqueous conditions to form polymeric micelles with a hydrodynamic radius and critical micelle concentration of 25 nm and 25 μg/mL respectively. Red blood cell hemolysis experiments show that the neutral hydrophilic micelles have potent membrane destabilizing activity at endosomal pH values. Thiolated siRNA targeting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was directly conjugated to the polymeric micelles via thiol exchange reactions with the pyridal disulfide groups present in the micelle corona. Maximum silencing activity in HeLa cells was observed at a 1:10 molar ratio of siRNA to polymer following a 48 h incubation period. Under these conditions 90 % mRNA knockdown and 65 % and protein knockdown of at 48 h was achieved with negligible toxicity. In contrast the polymeric micelles lacking a pH-responsive endosomalytic segment demonstrated negligible mRNA and protein knockdown under these conditions. The potent mRNA knockdown and excellent biocompatibility of the neutral siRNA conjugates

Synthesis of new thermo/pH sensitive drug delivery systems based on tragacanth gum polysaccharide.

Science.gov (United States)

Hemmati, Khadijeh; Ghaemy, Mousa

2016-06-01

In this study, new pH/temperature responsive graft copolymers were synthesized based on natural Tragacanth Gum (TG) carbohydrate and their controlled drug release was investigated. Amphiphilic alkyne terminated terpolymers (mPEG-PCL-PDMAEMA-CCH)s consist of methylated poly(ethyleneglycol) (mPEG), polycaprolactone (PCL), and poly(dimethylaminoethylmethacrylate) (PDMAEMA) were synthesized by using ring opening polymerization (ROP) and atom transfer radical polymerization (ATRP), and then were grafted onto azide-functionalized TG molecules by click chemistry. Different techniques such as FT-IR, (1)H NMR, gel permeation chromatography (GPC), thermo-gravimetrical analysis (TGA) and scanning electron microscopy (SEM) were used to verify the successful synthesis of graft copolymers (TG-g-PDMAEMA-PCL-mPEG)s. The graft copolymers self-assembled to single micelles in aqueous solution and upon pH changes further assembled into micellar aggregates. These micelles were used to prepare quercetin loaded nanocarriers by probe sonication method. Size and morphology of the nanocarriers were studied by dynamic light scattering (DLS) and SEM. The in vitro release behavior of quercetin from these micelles showed pH-dependence. The results showed that release profile of quercetin best followed the first order model. Copyright © 2016 Elsevier B.V. All rights reserved.

DNA nanotubes for NMR structure determination of membrane proteins.

Science.gov (United States)

Bellot, Gaëtan; McClintock, Mark A; Chou, James J; Shih, William M

2013-04-01

Finding a way to determine the structures of integral membrane proteins using solution nuclear magnetic resonance (NMR) spectroscopy has proved to be challenging. A residual-dipolar-coupling-based refinement approach can be used to resolve the structure of membrane proteins up to 40 kDa in size, but to do this you need a weak-alignment medium that is detergent-resistant and it has thus far been difficult to obtain such a medium suitable for weak alignment of membrane proteins. We describe here a protocol for robust, large-scale synthesis of detergent-resistant DNA nanotubes that can be assembled into dilute liquid crystals for application as weak-alignment media in solution NMR structure determination of membrane proteins in detergent micelles. The DNA nanotubes are heterodimers of 400-nm-long six-helix bundles, each self-assembled from a M13-based p7308 scaffold strand and >170 short oligonucleotide staple strands. Compatibility with proteins bearing considerable positive charge as well as modulation of molecular alignment, toward collection of linearly independent restraints, can be introduced by reducing the negative charge of DNA nanotubes using counter ions and small DNA-binding molecules. This detergent-resistant liquid-crystal medium offers a number of properties conducive for membrane protein alignment, including high-yield production, thermal stability, buffer compatibility and structural programmability. Production of sufficient nanotubes for four or five NMR experiments can be completed in 1 week by a single individual.

Synthesis of a Bacillus subtilis small, acid-soluble spore protein in Escherichia coli causes cell DNA to assume some characteristics of spore DNA

International Nuclear Information System (INIS)

Setlow, B.; Hand, A.R.; Setlow, P.

1991-01-01

Small, acid-soluble proteins (SASP) of the alpha/beta-type are associated with DNA in spores of Bacillus subtilis. Induction of synthesis of alpha/beta-type SASP in Escherichia coli resulted in rapid cessation of DNA synthesis, followed by a halt in RNA and then protein accumulation, although significant mRNA and protein synthesis continued. There was a significant loss in viability associated with SASP synthesis in E. coli: recA+ cells became extremely long filaments, whereas recA mutant cells became less filamentous. The nucleoids of cells with alpha/beta-type SASP were extremely condensed, as viewed in both light and electron microscopes, and immunoelectron microscopy showed that the alpha/beta-type SASP were associated with the cell DNA. Induction of alpha/beta-type SASP synthesis in E. coli increased the negative superhelical density of plasmid DNA by approximately 20%; UV irradiation of E. coli with alpha/beta-type SASP gave reduced yields of thymine dimers but significant amounts of the spore photoproduct. These changes in E. coli DNA topology and photochemistry due to alpha/beta-type SASP are similar to the effects of alpha/beta-type SASP on the DNA in Bacillus spores, further suggesting that alpha/beta-type SASP are a major factor determining DNA properties in bacterial spores

Dissociation between insulin secretion and DNA synthesis in cultured pancreatic islets

DEFF Research Database (Denmark)

Nielsen, Jens Høiriis

1985-01-01

-Tdr incorporation. However, long-term exposure to IBMX did not result in increased DNA content of the islets. Inhibition of the DNA synthesis by 5 mM hydroxyurea resulted in a marked reduction in DNA content of the islets but no decrease in either insulin release or insulin content when expressed per ng DNA...

DNA synthesis during development and proliferation of glial cells in organotypic rat cerebellar culture

International Nuclear Information System (INIS)

Renkawek, K.

1977-01-01

DNA synthesis was investigated in glial cells in vitro with 3 H thymidine in concentration 1 μCi/ml medium. Incorporation of isotope into the glial nuclei has been found both in the explant (7-21%) and in the outgrowth (22-56%). DNA synthesis was dependent on the age of culture and due to the contact inhibition in the outgrowth. Results point out that marked DNA synthesis is a characteristic feature of glia differentiation and of reactive character of glial cells in vitro. (author)

DNA synthesis and uv resistance in Escherichia coli K12 cells

Energy Technology Data Exchange (ETDEWEB)

Slezarikova, V [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Vyskumny Ustav Onkologicky

1976-01-01

The influence was studied of preirradiation inhibition of proteosynthesis by amino acids starvation on survival and DNA synthesis in E. coli K 12 cells, which differ by their genetic features with regard to a certain type of repair. The surviving fraction was studied by appropriate dilution of cell suspension and spreading on agar plates. DNA synthesis was investigated by the incorporation of thymine-2-/sup 14/C. In our conditions a correlation was found between cell survival and the resistance of DNA replication to UV radiation in cells proficient in excision and post-replication repair. This correlation was not found in the excision deficient strain. It is concluded that enhanced resistance of DNA replication is not a sufficient condition for enhanced cell resistance.

The rate of DNA synthesis in normal human and ataxia telangiectasia cells after exposure to X-irradiation

International Nuclear Information System (INIS)

Wit, J. de; Bootsma, D.; Jaspers, N.G.J.; Rijksverdedigingsorganisatie TNO, Rijswijk

1981-01-01

The rate of DNA synthesis was studied in normal cell strains and in strains from patients suffering from the inherited disorder ataxia telangiectasia (AT). After exposure to relatively low doses of oxic X-rays (0- 4 krad) DNA synthesis was depressed in AT cell strains to a significantly lesser extent than in normal cells. This response was observed in both an excision-deficient and an excision-proficient strain. In contrast, there was no difference in DNA-synthesis inhibition between AT and normal cells after UV exposure. After X-irradiation of cells from patients with xeroderma pigmentosum, both complementation group A and XP variants, the observed rate of DNA synthesis was equal to that in normal cells. An exception was the strain XP3BR which has been shown to be X-ray-sensitive. This strain exhibited diminished DNA synthesis inhibition after X-ray doses below 1 krad. These data suggest a relationship between hypersensitivity to X-rays and diminished depression of DNA synthesis. (orig.)

Micelle-template synthesis of hollow silica spheres for improving water vapor permeability of waterborne polyurethane membrane

OpenAIRE

Bao, Yan; Wang, Tong; Kang, Qiaoling; Shi, Chunhua; Ma, Jianzhong

2017-01-01

Hollow silica spheres (HSS) with special interior spaces, high specific surface area and excellent adsorption and permeability performance were synthesized via micelle-template method using cetyl trimethyl ammonium bromide (CTAB) micelles as soft template and tetraethoxysilane (TEOS) as silica precursor. SEM, TEM, FT-IR, XRD, DLS and BET-BJH were carried out to characterize the morphology and structure of as-obtained samples. The results demonstrated that the samples were amorphous with a hol...

Synthesis and self-assembly of four-armed star copolymer based on poly(ethylene brassylate) hydrophobic block as potential drug carries

Energy Technology Data Exchange (ETDEWEB)

Chen, Jiucun, E-mail: chenjc@swu.edu.cn; Li, Junzhi; Liu, Jianhua; Weng, Bo; Xu, Liqun [Southwest University, Institute for Clean Energy & Advanced Materials (China)

2016-05-15

A novel well-defined four-armed star poly(ethylene brassylate)-b-poly(poly(ethylene glycol)methyl ether methacrylate) (s-PEB-b-P(PEGMA)) was synthesized and self-assembled via the combination of ring-opening polymerization and reversible addition-fragmentation chain transfer polymerization (RAFT) in this work. It proceeded firstly with the synthesis of hydrophobic four-armed star homopolymer of ethylene brassylate (EB) via ROP with organic catalyst, followed by the esterification reaction of s-PEB with chain transfer agent. Afterward, RAFT polymerization of PEGMA monomer was initialed using PEB-based macro-RAFT agent, resulting in the target amphiphilic four-armed star copolymer. The obtained s-PEB-b-P(PEGMA) can assemble into micelles with PEB segments as core and P(PEGMA) segments as shell in aqueous solution. The self-assembly behavior was studied by dynamic light scattering and transmission electron microscope. The micelles of s-PEB-b-P(PEGMA) exhibited higher loading capacity of the anticancer drug doxorubicin (DOX). The investigation of DOX release from the micelles demonstrated that the release rate of the hydrophobic drug could be effectively controlled.Graphical Abstract.

DNA synthesis in the pituitary gland of the rat: effect of sulpiride and clomiphene.

Science.gov (United States)

Burdman, J A; Szijan, I; Jahn, G A; Machiavelli, G; Kalbermann, L E

1979-09-15

Sulpiride administration to rats releases prolactin and increases DNA replication in the anterior pituitary gland. Clomiphene prevents the stimulation of DNA synthesis produced by sulpiride, but does not affect prolactin release from the gland. These findings suggest that the intracellular prolactin content of the anterior pituitary gland plays a role in the regulation of DNA synthesis through a mechanism mediated by oestrogens.

Age-related variation in the DNA-repair synthesis after UV-C irradiation in unstimulated lymphocytes of healthy blood donors

International Nuclear Information System (INIS)

Kovacs, E.; Weber, W.; Mueller, H.

1984-01-01

UV-C light-induced DNA-repair synthesis was studied in unstimulated lymphocytes of 51 healthy blood donors aged between 17 and 74 years. The evaluation included (1) the spontaneous DNA-synthesis in unirradiated lymphocytes with and without hydroxyurea, (2) the DNA-repair synthesis in lymphocytes irradiated with UV-light. The interindividual variation was significantly higher than the methodological variation ascertained in 24 persons in whom 2 determinations were carried out. In blood donors aged between 17 and 39 years, the spontaneous DNA synthesis, both with and without hydroxyurea, was significantly lower than in older individuals. The DNA-repair synthesis was dependent on the dose of UV-C light between 2 and 16 J/m 2 . There were no significant differences in DNA-repair synthesis in the age range 17-74 years. The variations in rate of DNA-repair synthesis were wider in older (44-74 years), than in younger individuals. (orig.)

Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

International Nuclear Information System (INIS)

Piette, J.; Hearst, J.

1985-01-01

Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

Herpes virus and viral DNA synthesis in ultraviolet light-irradiated cells

Energy Technology Data Exchange (ETDEWEB)

Coppey, J; Nocentini, S [Institut du Radium, 75 - Paris (France). Lab. Curie

1976-07-01

The rate of virus DNA synthesis and the production of infectious virus are impaired in stationary monkey kidney CV-I cells irradiated with u.v. before infection with herpes simplex virus (HSV). The inhibition of HSV multiplication is due to u.v.-induced damage in cell DNA. CV-I cells recover their capacity to support HSV growth during the 40 to 48 h after irradiation, and the final virus yield is enhanced by factor of 10. The time course of the recovery is similar to that of the excision repair process occurring in u.v.-irradiated mammalian cells. Caffeine, hydroxyurea and cycloheximide inhibit the recovery. Fluorodeoxyuridine is without effect. A small but significant amount of labelled dThd coming from irradiated cell DNA is incorporated into virus DNA. HSV specified thymidine kinase seems to be more effective for virus DNA synthesis in irradiated than in control cells.

PEG-lipid micelles enable cholesterol efflux in Niemann-Pick Type C1 disease-based lysosomal storage disorder

Science.gov (United States)

Brown, Anna; Patel, Siddharth; Ward, Carl; Lorenz, Anna; Ortiz, Mauren; Duross, Allison; Wieghardt, Fabian; Esch, Amanda; Otten, Elsje G.; Heiser, Laura M.; Korolchuk, Viktor I.; Sun, Conroy; Sarkar, Sovan; Sahay, Gaurav

2016-08-01

2-Hydroxy-propyl-β-cyclodextrin (HPβCD), a cholesterol scavenger, is currently undergoing Phase 2b/3 clinical trial for treatment of Niemann Pick Type C-1 (NPC1), a fatal neurodegenerative disorder that stems from abnormal cholesterol accumulation in the endo/lysosomes. Unfortunately, the extremely high doses of HPβCD required to prevent progressive neurodegeneration exacerbates ototoxicity, pulmonary toxicity and autophagy-based cellular defects. We present unexpected evidence that a poly (ethylene glycol) (PEG)-lipid conjugate enables cholesterol clearance from endo/lysosomes of Npc1 mutant (Npc1-/-) cells. Herein, we show that distearyl-phosphatidylethanolamine-PEG (DSPE-PEG), which forms 12-nm micelles above the critical micelle concentration, accumulates heavily inside cholesterol-rich late endosomes in Npc1-/- cells. This potentially results in cholesterol solubilization and leakage from lysosomes. High-throughput screening revealed that DSPE-PEG, in combination with HPβCD, acts synergistically to efflux cholesterol without significantly aggravating autophagy defects. These well-known excipients can be used as admixtures to treat NPC1 disorder. Increasing PEG chain lengths from 350 Da-30 kDa in DSPE-PEG micelles, or increasing DSPE-PEG content in an array of liposomes packaged with HPβCD, improved cholesterol egress, while Pluronic block copolymers capable of micelle formation showed slight effects at high concentrations. We postulate that PEG-lipid based nanocarriers can serve as bioactive drug delivery systems for effective treatment of lysosomal storage disorders.

PEG-lipid micelles enable cholesterol efflux in Niemann-Pick Type C1 disease-based lysosomal storage disorder

Science.gov (United States)

Brown, Anna; Patel, Siddharth; Ward, Carl; Lorenz, Anna; Ortiz, Mauren; DuRoss, Allison; Wieghardt, Fabian; Esch, Amanda; Otten, Elsje G.; Heiser, Laura M.; Korolchuk, Viktor I.; Sun, Conroy; Sarkar, Sovan; Sahay, Gaurav

2016-01-01

2-Hydroxy-propyl-β-cyclodextrin (HPβCD), a cholesterol scavenger, is currently undergoing Phase 2b/3 clinical trial for treatment of Niemann Pick Type C-1 (NPC1), a fatal neurodegenerative disorder that stems from abnormal cholesterol accumulation in the endo/lysosomes. Unfortunately, the extremely high doses of HPβCD required to prevent progressive neurodegeneration exacerbates ototoxicity, pulmonary toxicity and autophagy-based cellular defects. We present unexpected evidence that a poly (ethylene glycol) (PEG)-lipid conjugate enables cholesterol clearance from endo/lysosomes of Npc1 mutant (Npc1−/−) cells. Herein, we show that distearyl-phosphatidylethanolamine-PEG (DSPE-PEG), which forms 12-nm micelles above the critical micelle concentration, accumulates heavily inside cholesterol-rich late endosomes in Npc1−/− cells. This potentially results in cholesterol solubilization and leakage from lysosomes. High-throughput screening revealed that DSPE-PEG, in combination with HPβCD, acts synergistically to efflux cholesterol without significantly aggravating autophagy defects. These well-known excipients can be used as admixtures to treat NPC1 disorder. Increasing PEG chain lengths from 350 Da-30 kDa in DSPE-PEG micelles, or increasing DSPE-PEG content in an array of liposomes packaged with HPβCD, improved cholesterol egress, while Pluronic block copolymers capable of micelle formation showed slight effects at high concentrations. We postulate that PEG-lipid based nanocarriers can serve as bioactive drug delivery systems for effective treatment of lysosomal storage disorders. PMID:27572704

Desoxyribonucleic acid (DNA) synthesis in vitro by thymus and spleen cells of the rat after hyperthermia

Energy Technology Data Exchange (ETDEWEB)

Tempel, K.; Spath, A.

1988-03-01

The inhibition of the semiconservative and restorative DNA synthesis caused by hyperthermia (30 to 60 min, 43/sup 0/C) was significantly higher in spleen cells than in thymus cells. The DNA repair synthesis of thymus cells measured at 37/sup 0/C was increased by about two times the initial value after a pre-incubation of 30 to 90 min and 30 to 60 min, respectively, with 37 and 43/sup 0/C, respectively. Under the same conditions, the /sup 3/H-thymidine incorporation into the DNA of spleen cells diminished proportionally to the pre-incubation time after a pre-incubation of 30 and 45 min, respectively, with 43 and 37/sup 0/C, respectively. When hyperthermia and inhibitors of DNA synthesis or DNA repair (hydroxyurea, 1-..beta..-D-arabinofuranosylcytosine, 3', 5'-didesoxythymidine, and 3-aminobenzamide) were combined, overadditive effects - without cellspecific particularities - were seen only in the case of 3-aminobenzamide. Only in thymus cells, the inhibitor of DNA topoisomerase II novobiocin caused an overadditive reinforcement of the inhibition induced by hyperthermia of the semiconservative DNA synthesis. The stimulation of DNA repair synthesis in thymus cells caused by novobiocin with the aid of DNA polymerase ..beta.. could be compensated by hyperthermia. The sedimentation of thymus and spleen cell nucleoids was increased after hyperthermia. The results suggest a special importance of DNA topology and of the DNA polymerase ..beta.. activity for the cellular effect of hyperthermia.

DNA synthesis in permeabilized WI38 and MRC5 cells

International Nuclear Information System (INIS)

Griffiths, T.D.; Carpenter, J.G.

1980-01-01

DNA synthesis was examined in cultures of growing WI38 and MRC5 cells made permeable to deoxyribonucleotides. Cells from late passage cultures showed a reduced rate of deoxythymidine triphosphate (dTTP) uptake as compared to cells from early- to mid-passage cultures. This reduction became evident earlier in WI38 cultures (passage 33) than in MRC5 cultures (passage 41). Although this reduced rate of incorporation appeared to be primarily due to a reduced percentage of replicating (S phase) cells in later passage cultures, some effect on the rate of DNA synthesis in replicating cells was also evident

Stealth properties of poly(ethylene oxide)-based triblock copolymer micelles: a prerequisite for a pH-triggered targeting system.

Science.gov (United States)

Van Butsele, K; Morille, M; Passirani, C; Legras, P; Benoit, J P; Varshney, S K; Jérôme, R; Jérôme, C

2011-10-01

Evaluation of the biocompatibility of pH-triggered targeting micelles was performed with the goal of studying the effect of a poly(ethylene oxide) (PEO) coating on micelle stealth properties. Upon protonation under acidic conditions, pH-sensitive poly(2-vinylpyridine) (P2VP) blocks were stretched, exhibiting positive charges at the periphery of the micelles as well as being a model targeting unit. The polymer micelles were based on two different macromolecular architectures, an ABC miktoarm star terpolymer and an ABC linear triblock copolymer, which combined three different polymer blocks, i.e. hydrophobic poly(ε-caprolactone), PEO and P2VP. Neutral polymer micelles were formed at physiological pH. These systems were tested for their ability to avoid macrophage uptake, their complement activation and their pharmacological behavior after systemic injection in mice, as a function of their conformation (neutral or protonated). After protonation, complement activation and macrophage uptake were up to twofold higher than for neutral systems. By contrast, when P2VP blocks and the targeting unit were buried by the PEO shell at physiological pH, micelle stealth properties were improved, allowing their future systemic injection with an expected long circulation in blood. Smart systems responsive to pH were thus developed which therefore hold great promise for targeted drug delivery to an acidic tumoral environment. Copyright © 2011 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Postirradiation DNA synthesis is inversely related to cell survival

International Nuclear Information System (INIS)

Kapiszewska, M.; Lange, C.S.

1987-01-01

Postirradiation (PI) events which might lead to cellular reproductive death or survival were studied in L5178Y-S (LY-S) cells. PI incubation at 25 0 C protects LY-S cells against the PLD fixation which takes place at 37 0 C. An optimal condition for the repair of PLD is 1h at 37 0 C followed by 4h holding at 25 0 C prior to the second half of a split dose, or 5L holding at 25 0 C without a 37 0 C incubation. Longer incubations at 37 0 C resulted in progressively decreased survivals. Postirradiation inhibition of DNA synthesis at 37 0 C was observed only during the first 30 min; thereafter, /sup 3/H-dThd incorporation was higher than in unirradiated controls. This excess synthesis effect was removed by shifting irradiated cells to 25 0 C holding. The inhibition observed at 25 0 C was reversed by shifting to 37 0 C. Thus the degree of postirradiation DNA synthesis is inversely related to PLD/SLD repair. DNA filter elution shows complete SSB repair by 3h at both temperatures (with faster kinetics at 37 0 C), and DSB repair plateaus at 80% (37 0 C) and 60% (25 0 C) after 90 min

The influence of some prostaglandins on DNA synthesis and DNA excision repair in mouse spleen cells ''in vitro''

International Nuclear Information System (INIS)

Klein, W.; Altmann, H.; Kocsis, F.; Egg, D.; Guenther, R.

1978-03-01

''In vitro'' experiments were performed on mouse spleen cells to establish possible influences of some naturally occurring prostaglandins on DNA synthesis and DNA excision repair. The prostaglandins A 1 , B 1 , E 1 , E 2 and Fsub(2α) were tested in concentrations of 10 pg, 5 ng and 2,5μg per ml cell suspension. DNA synthesis was significantly increased by PgFsub(2α) in all the three concentrations tested, while the other tested prostaglandins were essentially ineffective. DNA excision repair was significantly inhibited by PgE 1 and PgE 2 at 5 ng/ml and at 2,5 μg/ml but increased by PgFsub(2α) in the two lower concentrations. The rejoining of DNA-strand breaks after gamma-irradiation was slightly reduced by PgE 1 , PgE 2 and PgF 2 at 2,5 μg/ml. (author)

Nuclear DNA synthesis rate and labelling index: effects of carcinogenic and non-carcinogenic chemicals on its behaviour in the organism of growing CBA mice

International Nuclear Information System (INIS)

Amlacher, E.; Rudolph, C.

1978-01-01

Well known bioassays have been compared with the author's thymidine incorporation-screening system and other assays based on biochemical quantification of DNA synthesis as a possibility of identification of carcinogens. The partial inhibition of the whole DNA synthesis in a proliferating cell population after treatment with toxic and carcinogenic chemicals is an early common response especially in hepatectomized animal, livers caused by the effects of those substances. However, by quantitative evaluation of the nuclear DNA synthesis rate as a basic parameter, using autoradiographs of kidney and liver of juvenile growing CBA mice, it is possible to differentiate carcinogenic from non-carcinogenic chemicals by means of silver grain counting after 3 H-TdR incorporation. On the contrary, the whole DNA synthesis, expressed by the 3 H-labelling index (in per cent) of kidney and liver, did not permit such a differentiation in the experimental arrangement used. It could be demonstrated that carcinogenic compounds of different chemical classes partially inhibit the nuclear DNA synthesis rate significantly over a period of more than 24 hours. The tested non-carcinogenic compounds did not show this suppressive effect on the nuclear DNA synthesis rate. (author)

Sex determination based on amelogenin DNA by modified electrode with gold nanoparticle.

Science.gov (United States)

Mazloum-Ardakani, Mohammad; Rajabzadeh, Nooshin; Benvidi, Ali; Heidari, Mohammad Mehdi

2013-12-15

We have developed a simple and renewable electrochemical biosensor based on carbon paste electrode (CPE) for the detection of DNA synthesis and hybridization. CPE was modified with gold nanoparticles (AuNPs), which are helpful for immobilization of thiolated bioreceptors. AuNPs were characterized by scanning electron microscopy (SEM). Self-assembled monolayers (SAMs) of thiolated single-stranded DNA (SH-ssDNA) of the amelogenin gene was formed on CPE. The immobilization of the probe and its hybridization with the target DNA was optimized using different experimental conditions. The modified electrode was characterized by electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). The electrochemical response of ssDNA hybridization and DNA synthesis was measured using differential pulse voltammetry (DPV) with methylene blue (MB) as an electroactive indicator. The new biosensor can distinguish between complementary and non-complementary strands of amelogenin ssDNA. Genomic DNA was extracted from blood and was detected based on changes in the MB reduction signal. These results demonstrated that the new biosensor could be used for sex determination. The proposed biosensor in this study could be used for detection and discrimination of polymerase chain reaction (PCR) products of amelogenin DNA. Copyright © 2013 Elsevier Inc. All rights reserved.

The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery.

Science.gov (United States)

O'Reilly, Rachel K; Turberfield, Andrew J; Wilks, Thomas R

2017-10-17

Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify "successful" structures. The largest libraries made by conventional synthesis are currently of the order of 10 8 distinct molecules. To put this in context, there are 10 13 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to engineer a

Glycation Reactions of Casein Micelles.

Science.gov (United States)

Moeckel, Ulrike; Duerasch, Anja; Weiz, Alexander; Ruck, Michael; Henle, Thomas

2016-04-13

After suspensions of micellar casein or nonmicellar sodium caseinate had been heated, respectively, in the presence and absence of glucose for 0-4 h at 100 °C, glycation compounds were quantitated. The formation of Amadori products as indicators for the "early" Maillard reaction were in the same range for both micellar and nonmicellar caseins, indicating that reactive amino acid side chains within the micelles are accessible for glucose in a comparable way as in nonmicellar casein. Significant differences, however, were observed concerning the formation of the advanced glycation end products (AGEs), namely, N(ε)-carboxymethyllysine (CML), pyrraline, pentosidine, and glyoxal-lysine dimer (GOLD). CML could be observerd in higher amounts in nonmicellar casein, whereas in the micelles the pyrraline formation was increased. Pentosidine and GOLD were formed in comparable amounts. Furthermore, the extent of protein cross-linking was significantly higher in the glycated casein micelles than in the nonmicellar casein samples. Dynamic light scattering and scanning electron microscopy showed that glycation has no influence on the size of the casein micelles, indicating that cross-linking occurs only in the interior of the micelles, but altered the surface morphology. Studies on glycation and nonenzymatic cross-linking can contribute to the understanding of the structure of casein micelles.

Yield of DNA strand breaks and their relationship to DNA polymerase I-dependent repair synthesis and ligation following x-ray exposure of toluene-treated Escherichia coli

International Nuclear Information System (INIS)

Billen, D.

1981-01-01

In Escherichia coli made permeable to nucleotides by toluene treatment, a DNA polymerase I-directed repair synthesis is observed. This is an exaggerated repair synthesis which can be abruptly terminated by the addition of the DNA ligase cofactor, nicotinamide adenine dinucleotide. This communication describes experiments which bear on the relationship between measurable strand breaks, DNA polymerase I-directed, exaggerated repair synthesis, and strand-break repair

DNA-based random number generation in security circuitry.

Science.gov (United States)

Gearheart, Christy M; Arazi, Benjamin; Rouchka, Eric C

2010-06-01

DNA-based circuit design is an area of research in which traditional silicon-based technologies are replaced by naturally occurring phenomena taken from biochemistry and molecular biology. This research focuses on further developing DNA-based methodologies to mimic digital data manipulation. While exhibiting fundamental principles, this work was done in conjunction with the vision that DNA-based circuitry, when the technology matures, will form the basis for a tamper-proof security module, revolutionizing the meaning and concept of tamper-proofing and possibly preventing it altogether based on accurate scientific observations. A paramount part of such a solution would be self-generation of random numbers. A novel prototype schema employs solid phase synthesis of oligonucleotides for random construction of DNA sequences; temporary storage and retrieval is achieved through plasmid vectors. A discussion of how to evaluate sequence randomness is included, as well as how these techniques are applied to a simulation of the random number generation circuitry. Simulation results show generated sequences successfully pass three selected NIST random number generation tests specified for security applications.

Feasibility study of molecular memory device based on DNA using methylation to store information

Energy Technology Data Exchange (ETDEWEB)

Jiang, Liming; Al-Dirini, Feras [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); National ICT Australia, The University of Melbourne, Parkville 3010 (Australia); Qiu, Wanzhi; Skafidas, Efstratios, E-mail: sskaf@unimelb.edu.au [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Hossain, Faruque M. [Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Evans, Robin [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia)

2016-07-14

DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

Feasibility study of molecular memory device based on DNA using methylation to store information

International Nuclear Information System (INIS)

Jiang, Liming; Al-Dirini, Feras; Qiu, Wanzhi; Skafidas, Efstratios; Hossain, Faruque M.; Evans, Robin

2016-01-01

DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

Gamma-ray induced inhibition of DNA synthesis in ataxia telangiectasia fibroblasts is a function of excision repair capacity

International Nuclear Information System (INIS)

Smith, P.J.; Paterson, M.C.

1980-01-01

The extent of the deficiency in γ-ray induced DNA repair synthesis in an ataxia telangiectasia (AT) human fibroblast strain was found to show no oxygen enhancement, consistent with a defect in the repair of base damage. Repair deficiency, but not repair proficiency, in AT cells was accompanied by a lack of inhibition of DNA synthesis by either γ-rays or the radiomimetic drug bleomycin. Experiments with 4-nitroquinoline 1-oxide indicated that lack of inhibition was specific for radiogenic-type damage. Thus excision repair, perhaps by DNA strand incision or chromatin modification, appears to halt replicon initiation in irradiated repair proficient cells whereas in repair defective AT strains this putatively important biological function is inoperative

A neutron scattering study of triblock copolymer micelles

Energy Technology Data Exchange (ETDEWEB)

Gerstenberg, M.C.

1997-11-01

The thesis describes the neutron scattering experiments performed on poly(ethylene oxide)/poly(propylene oxide)/poly(ethylene oxide) triblock copolymer micelles in aqueous solution. The studies concern the non-ionic triblock copolymer P85 which consists of two outer segments of 25 monomers of ethylene oxide attached to a central part of 40 monomers of propylene oxide. The amphiphilic character of P85 leads to formation of various structures in aqueous solution such as spherical micelles, rod-like structures, and a BCC liquid-crystal mesophase of spherical micelles. The present investigations are centered around the micellar structures. In the first part of this thesis a model for the micelle is developed for which an analytical scattering form factor can be calculated. The micelle is modeled as a solid sphere with tethered Gaussian chains. Good agreement was found between small-angle neutron scattering experiments and the form factor of the spherical P85 micelles. Above 60 deg. C some discrepancies were found between the model and the data which is possibly due to an elongation of the micelles. The second part focuses on the surface-induced ordering of the various micellar aggregates in the P85 concentration-temperature phase diagram. In the spherical micellar phase, neutron reflection measurements indicated a micellar ordering at the hydrophilic surface of quartz. Extensive modeling was performed based on a hard sphere description of the micellar interaction. By convolution of the distribution of hard spheres at a hard wall, obtained from Monte Carlo simulations, and the projected scattering length density of the micelle, a numerical expression was obtained which made it possible to fit the data. The hard-sphere-hard-wall model gave an excellent agreement in the bulk micellar phase. However, for higher concentrations (25 wt % P85) close to the transition from the micellar liquid into a micellar cubic phase, a discrepancy was found between the model and the

A neutron scattering study of triblock copolymer micelles

International Nuclear Information System (INIS)

Gerstenberg, M.C.

1997-11-01

The thesis describes the neutron scattering experiments performed on poly(ethylene oxide)/poly(propylene oxide)/poly(ethylene oxide) triblock copolymer micelles in aqueous solution. The studies concern the non-ionic triblock copolymer P85 which consists of two outer segments of 25 monomers of ethylene oxide attached to a central part of 40 monomers of propylene oxide. The amphiphilic character of P85 leads to formation of various structures in aqueous solution such as spherical micelles, rod-like structures, and a BCC liquid-crystal mesophase of spherical micelles. The present investigations are centered around the micellar structures. In the first part of this thesis a model for the micelle is developed for which an analytical scattering form factor can be calculated. The micelle is modeled as a solid sphere with tethered Gaussian chains. Good agreement was found between small-angle neutron scattering experiments and the form factor of the spherical P85 micelles. Above 60 deg. C some discrepancies were found between the model and the data which is possibly due to an elongation of the micelles. The second part focuses on the surface-induced ordering of the various micellar aggregates in the P85 concentration-temperature phase diagram. In the spherical micellar phase, neutron reflection measurements indicated a micellar ordering at the hydrophilic surface of quartz. Extensive modeling was performed based on a hard sphere description of the micellar interaction. By convolution of the distribution of hard spheres at a hard wall, obtained from Monte Carlo simulations, and the projected scattering length density of the micelle, a numerical expression was obtained which made it possible to fit the data. The hard-sphere-hard-wall model gave an excellent agreement in the bulk micellar phase. However, for higher concentrations (25 wt % P85) close to the transition from the micellar liquid into a micellar cubic phase, a discrepancy was found between the model and the

Synthesis of Acridine-based DNA Bis-intercalating Agents

Directory of Open Access Journals (Sweden)

P. Mack

2001-02-01

Full Text Available Methods for the synthesis of N1, N8-bis(9-acridinyl-N4-(4-hydroxybenzyl-spermidine and N1, N7-(hydroxybenzyl-bis-(3-aminopropylamine were investigated. Thus monocyanoethylation of 4-methoxybenzylamine followed by treatment with 4-chlorobutyronitrile gave the dinitrile N-(2-cyanoethyl-N-(3-cyanopropyl-4-methoxybenzylamine. Subsequent in situ reduction with lithium aluminium hydride gave the corresponding diamine. Biscyanoethylation of 4-methoxybenzylamine with 2 mole of acrylonitrile followed by reduction yielded the diamine N, N-bis-(3-aminopropyl-4-methoxybenzylamine. Both diamines reacted smoothly with 9-methoxyacridine to give the bis-(9-acridinyl compounds 11 and 15 but with 4,5-dimethyl-9-methoxyacridine, the bis compound 16 was produced in only low yields. Demethylation of the dinitriles by a variety of approaches all failed to give the corresponding hydroxybenzyl derivatives. These studies yielded useful methylated tyrosine derivatives which could also be iodinated. This study has been useful for elucidating chemical methods needed for the synthesis of the desired tyrosine-based bis acridine compound and for alerting us to the need to synthesise a more labile protected tyrosine intermediate which will be easily deprotected to afford the desired tyrosine-based bis acridine compound.

DNA synthesis time in germinating rice and pattern of diethylsulphate induced mutations in pre-soaked seeds

International Nuclear Information System (INIS)

Narahari, P.

1978-01-01

DNA synthesis pattern in germinating rice seeds, pre-soaked in water for varying periods upto 48 hr, was determined by following the pulse incorporation of 3 H-thymidine into the TCA-insoluble nucleoprotein. Synthesis of DNA commenced at 24 hr, progressively increased to a first peak at about 38 hr, thereafter showed a 1/3rd drop and subsequently increased to a 2nd and still higher peak at 46 to 48 hr of pre-soaking. Treatments of diethylsulphate (dES) at a low concentration (0.2%-2hr) administered at various progressing stages of DNA synthesis resulted in decrease in seedling height and survival, and increase in mutation frequency at 45 hr. pre-soaking, maximum mutation frequencies of 20, 10 and 2% on M 1 plants, M 1 spikes and M 2 seedling bases, respectively were observed. Higher dES concentration (0.3%-2hr) given at later periods of pre-soaking showed near lethal effects and consequently decreased mutation frequencies. Treatments of sodium fluoride given singly or in combination with dES did not show any substantially different results as compared to those of the respective controls. Mutation spectra observed after dES treatments to germinating seeds, at different pre-soaking periods, were quite dissimilar. Specific mutations of economic importance like semi-dwarf mutants were isolated from the treatment of germinating seeds pre-soaked for 37.5 hr or more when shoot apex cells were undergoing DNA synthesis. (author)

Inhibition by hyperthermia of repair synthesis and chromatin reassembly of ultraviolet-induced damage to DNA

International Nuclear Information System (INIS)

Bodell, W.J.; Cleaver, J.E.; Roti Roti, J.L.

1984-01-01

The authors have investigated the effects of hyperthermia treatment on sequential steps of the repair of UV-induced DNA damage in HeLa cells. DNA repair synthesis was inhibited by 40% after 15 min of hyperthermia treatment at 45 0 C; greater inhibition of repair synthesis occurred with prolonged incubation at 45 0 C. Enzymatic digestion of repair-labeled DNA with Exonuclease III indicated that once DNA repair was initiated, the DNA repair patch was synthesized to completion and that ligation of the DNA repair patch occurred. Thus, the observed inhibition of UV-induced DNA repair synthesis by hyperthermia treatment may be the result of inhibition of enzymes involved in the initiating steps(s) of DNA repair. DNA repair patches synthesized in UV-irradiated cells labeled at 37 0 C with[ 3 H]Thd were 2.2-fold more sensitive to micrococcal nuclease digestion than was parental DNA; if the length of the labeling period was prolonged, the nuclease sensitivity of the repair patch synthesized approached that of the parental DNA. DNA repair patches synthesized at 45 0 C, however, remained sensitive to micrococcal nuclease digestion even after long labeling periods, indicating that heat treatment inhibits the reassembly of the DNA repair patch into nucleosomal structures. 23 references, 3 figures, 2 tables

Amphipathic dextran-doxorubicin prodrug micelles for solid tumor therapy.

Science.gov (United States)

Jin, Rong; Guo, Xuelian; Dong, Lingli; Xie, Enyuan; Cao, Aoneng

2017-10-01

A group of micelles self-assembled from deoxycholic acid-doxorubicin-conjugated dextran (denoted as Dex-DCA-DOX) prodrugs were designed and prepared for pH-triggered drug release and cancer chemotherapy. These prodrugs could be successfully produced by chemically coupling hydrophobic deoxycholic acid (DCA) to dextran hydrazine (denoted as Dex-NHNH 2 ) and hydrazone linker formation between doxorubicin (DOX) and Dex-NHNH 2 . These Dex-DCA-DOX prodrugs self-assembled to form micelles under physiological conditions with varied particle sizes depending on molecular weight of dextran, degree of substitution (DS) of DCA and DOX. After optimization, Dex10k-DCA9-DOX5.5 conjugate comprising dextran of 10kDa, DCA of DS 9 and DOX loading content of 5.5wt%, formed the micelles with the smallest size (110nm). These prodrug micelles could slowly liberate DOX under physiological conditions but efficiently released the drug at an acidified endosomal pH by the hydrolysis of acid-labile hydrazone linker. In vitro cytotoxicity experiment indicated that Dex10k-DCA9-DOX5.5 micelles exerted marked antitumor activity against MCF-7 and SKOV-3 cancer cells. Besides, intravenous administration of the micelles afforded growth inhibition of SKOV-3 tumor bearing in nude mice at a dosage of 2.5mg per kg with anti-cancer efficacy comparable to free DOX-chemotherapy but low systemic toxicity. This study highlights the feasibility of bio-safe and efficient dextran-based prodrug micelles designed for cancer chemotherapy. Copyright © 2017 Elsevier B.V. All rights reserved.

Overproduction of the poly(ADP-ribose)polymerase DNA-binding domain blocks alkylation-induced DNA repair synthesis in mammalian cells.

NARCIS (Netherlands)

M. Molinete; W. Vermeulen (Wim); A. Bürkle; J. Mé nissier-de Murcia; J.H. Küpper; J.H.J. Hoeijmakers (Jan); G. de Murcia

1993-01-01

textabstractThe zinc-finger DNA-binding domain (DBD) of poly (ADP-ribose) polymerase (PARP, EC 2.4.2.30) specifically recognizes DNA strand breaks induced by various DNA-damaging agents in eukaryotes. This, in turn, triggers the synthesis of polymers of ADP-ribose linked to nuclear proteins during

Pluronic®-bile salt mixed micelles.

Science.gov (United States)

Patel, Vijay; Ray, Debes; Bahadur, Anita; Ma, Junhe; Aswal, V K; Bahadur, Pratap

2018-06-01

The present study was aimed to examine the interaction of two bile salts viz. sodium cholate (NaC) and sodium deoxycholate (NaDC) with three ethylene polyoxide-polypropylene polyoxide (PEO-PPO-PEO) triblock copolymers with similar PPO but varying PEO micelles with a focus on the effect of pH on mixed micelles. Mixed micelles of moderately hydrophobic Pluronic ® P123 were examined in the presence of two bile salts and compared with those from very hydrophobic L121 and very hydrophilic F127. Both the bile salts increase the cloud point (CP) of copolymer solution and decreased apparent micelle hydrodynamic diameter (D h ). SANS study revealed that P123 forms small spherical micelles showing a decrease in size on progressive addition of bile salts. The negatively charged mixed micelles contained fewer P123 molecules but progressively rich in bile salt. NaDC being more hydrophobic displays more pronounced effect than NaC. Interestingly, NaC shows micellar growth in acidic media which has been attributed to the formation of bile acids by protonation of carboxylate ion and subsequent solubilization. In contrast, NaDC showed phase separation at higher concentration. Nuclear Overhauser effect spectroscopy (NOESY) experiments provided information on interaction and location of bile salts in micelles. Results are discussed in terms of hydrophobicity of bile salts and Pluronics ® and the site of bile salt in polymer micelles. Proposed molecular interactions are useful to understand more about bile salts which play important role in physiological processes. Copyright © 2018 Elsevier B.V. All rights reserved.

Synthesis and characterization of novel P(HEMA-LA-MADQUAT) micelles for co-delivery of methotrexate and Chrysin in combination cancer chemotherapy.

Science.gov (United States)

Davaran, Soodabeh; Fazeli, Hamed; Ghamkhari, Aliyeh; Rahimi, Fariborz; Molavi, Ommoleila; Anzabi, Maryam; Salehi, Roya

2018-08-01

A Novel poly [2-hydroxyethyl methacrylate-Lactide-dimethylaminoethyl methacrylate quaternary ammonium alkyl halide] [P(HEMA-LA-MADQUAT)] copolymer was synthesized through combination of ring opening polymerization (ROP) and 'free' radical initiated polymerization methods. This newly developed copolymer was fully characterized by FT-IR, 1 HNMR and 13 CNMR spectroscopy. Micellization of the copolymer was performed by dialysis membrane method and obtained micelles were characterized by FESEM, dynamic light scattering (DLS), zeta potential (ξ), and critical micelle concentration (CMC) measurements. This copolymer was developed with the aim of co-delivering two different anticancer drugs: methotrexate (MTX) and chrysin. In vitro cytotoxicity effect of MTX@Chrysin-loaded P(HEMA-LA-MADQUAT) was also studied through assessing the survival rate of breast cancer cell line (MCF-7) and DAPI staining assays. Cationic micelle (and surface charge of + 7.6) with spherical morphology and an average diameter of 55 nm and CMC of 0.023 gL -1 was successfully obtained. Micelles showed the drug loaded capacity around 87.6 and 86.5% for MTX and Chrysin, respectively. The cytotoxicity assay of a drug-free nanocarrier on MCF-7 cell lines indicated that this developed micelles were suitable nanocarriers for anticancer drugs. Furthermore, the MTX@Chrysin-loaded micelle had more efficient anticancer performance than free dual anticancer drugs (MTX @ chrysin), confirmed by MTT assay and DAPI stainingmethods. Therefore, we envision that this recently developed novel micelle can enhance the efficacy of chemotherapeutic agents, MTX and Chrysin, combination chemotherapy and has the potential to be used as an anticancer drug delivery system for in vivo studies. Therefore, this recently developed novel micelle can enhance the efficacy of chemotherapeutic agents, MTX and Chrysin, combination chemotherapy and has the potential to be used as an anticancer drug delivery system for in vivo studies.

Diclofenac/biodegradable polymer micelles for ocular applications

Science.gov (United States)

Li, Xingyi; Zhang, Zhaoliang; Li, Jie; Sun, Shumao; Weng, Yuhua; Chen, Hao

2012-07-01

In this paper, methoxypoly(ethylene glycol)-poly(ε-caprolactone) (MPEG-PCL) micelle formulations as promising nano-carriers for poorly water soluble drugs were investigated for the delivery of diclofenac to the eye. Diclofenac loaded MPEG-PCL micelles were prepared by a simple solvent-diffusion method and characterized by dynamic light scattering (DLS), atomic force microscopy (AFM), Fourier transform infra-red (FTIR), X-ray diffraction (XRD), differential scanning calorimetery (DSC), etc. With the analysis of XRD and DSC, the diclofenac was present as an amorphous state in the formulation. The in vitro release profile indicated a sustained release manner of diclofenac from the micelles. Meanwhile, in vivo studies on eye irritation were performed with blank MPEG-PCL micelles (200 mg ml-1). The results showed that the developed MPEG-PCL micelles were non-irritants to the eyes of rabbits. In vitro penetration studies across the rabbit cornea demonstrated that the micelle formulations exhibited a 17-fold increase in penetration compared with that of diclofenac phosphate buffered saline (PBS) solution. The in vivo pharmacokinetics profile of the micelle parent drug in the aqueous humor of the rabbit was evaluated and the data showed that the diclofenac loaded MPEG-PCL micelles exhibited a 2-fold increase in AUC0-24 h than that of the diclofenac PBS solution eye drops. These results suggest a great potential of our micelle formulations as a novel ocular drug delivery system to improve the bioavailability of the drugs.

Synthesis and in vitro experiments of carcinoma vascular endothelial targeting polymeric nano-micelles combining small particle size and supermagnetic sensitivity.

Science.gov (United States)

Zhang, Yi; Pan, Jielin; Xu, Qilan; Li, Hao; Wang, Jianhao; Zhang, Chao; Hong, Guobin

2018-01-01

Objective: To construct carcinoma vascular endothelial-targeted polymeric nanomicelles with high magnetic resonance imaging (MRI) sensitivity and to evaluate their biological safety and in vitro tumor-targeting effect, and to monitor their feasibility using clinical MRI scanner. Method: Amphiphilic block copolymer, poly(ethylene glycol)- b -poly(ε-caprolactone) (PEG-PCL) was synthesized via the ring-opening polymerization of ε-caprolactone (CL) initiated by poly(ethylene glycol) (PEG), in which cyclic pentapeptide Arg-Gly-Asp (cRGD) was conjugated with the terminal of hydrophilic PEG block. During the self-assembly of PEG-PCL micelles, superparamagnetic γ-Fe 2 O 3 nanoparticles (11 nm) was loaded into the hydrophobic core. The cRGD-terminated γ-Fe 2 O 3 -loaded polymeric micelles targeting to carcinoma vascular endothelial cells, were characterized in particle size, morphology, loading efficiency and so on, especially high MRI sensitivity in vitro. Normal hepatic vascular endothelial cells (ED25) were incubated with the resulting micelles for assessing their safety. Human hepatic carcinoma vascular endothelial cells (T3A) were cultured with the resulting micelles to assess the micelle uptake using Prussian blue staining and the cell signal intensity using MRI. Results: All the polymeric micelles exhibited ultra-small particle sizes with approximately 50 nm, high relaxation rate, and low toxicity even at high iron concentrations. More blue-stained iron particles were present in the targeting group than the non-targeting and competitive inhibition groups. In vitro MRI showed T 2 WI and T 2 relaxation times were significantly lower in the targeting group than in the other two groups. Conclusion: γ-Fe 2 O 3 -loaded PEG-PCL micelles not only possess ultra-small size and high superparamagnetic sensitivity, also can be actively targeted to carcinoma vascular endothelial cells by tumor-targeted cRGD. It appears to be a promising contrast agent for tumor

Chemical reactions in reverse micelle systems

Science.gov (United States)

Matson, Dean W.; Fulton, John L.; Smith, Richard D.; Consani, Keith A.

1993-08-24

This invention is directed to conducting chemical reactions in reverse micelle or microemulsion systems comprising a substantially discontinuous phase including a polar fluid, typically an aqueous fluid, and a microemulsion promoter, typically a surfactant, for facilitating the formation of reverse micelles in the system. The system further includes a substantially continuous phase including a non-polar or low-polarity fluid material which is a gas under standard temperature and pressure and has a critical density, and which is generally a water-insoluble fluid in a near critical or supercritical state. Thus, the microemulsion system is maintained at a pressure and temperature such that the density of the non-polar or low-polarity fluid exceeds the critical density thereof. The method of carrying out chemical reactions generally comprises forming a first reverse micelle system including an aqueous fluid including reverse micelles in a water-insoluble fluid in the supercritical state. Then, a first reactant is introduced into the first reverse micelle system, and a chemical reaction is carried out with the first reactant to form a reaction product. In general, the first reactant can be incorporated into, and the product formed in, the reverse micelles. A second reactant can also be incorporated in the first reverse micelle system which is capable of reacting with the first reactant to form a product.

Casein Micelle Dispersions under Osmotic Stress

Science.gov (United States)

Bouchoux, Antoine; Cayemitte, Pierre-Emerson; Jardin, Julien; Gésan-Guiziou, Geneviève; Cabane, Bernard

2009-01-01

Abstract Casein micelles dispersions have been concentrated and equilibrated at different osmotic pressures using equilibrium dialysis. This technique measured an equation of state of the dispersions over a wide range of pressures and concentrations and at different ionic strengths. Three regimes were found. i), A dilute regime in which the osmotic pressure is proportional to the casein concentration. In this regime, the casein micelles are well separated and rarely interact, whereas the osmotic pressure is dominated by the contribution from small residual peptides that are dissolved in the aqueous phase. ii), A transition range that starts when the casein micelles begin to interact through their κ-casein brushes and ends when the micelles are forced to get into contact with each other. At the end of this regime, the dispersions behave as coherent solids that do not fully redisperse when osmotic stress is released. iii), A concentrated regime in which compression removes water from within the micelles, and increases the fraction of micelles that are irreversibly linked to each other. In this regime the osmotic pressure profile is a power law of the residual free volume. It is well described by a simple model that considers the micelle to be made of dense regions separated by a continuous phase. The amount of water in the dense regions matches the usual hydration of proteins. PMID:19167314

Surface sulfonamide modification of poly(N-isopropylacrylamide)-based block copolymer micelles to alter pH and temperature responsive properties for controlled intracellular uptake.

Science.gov (United States)

Cyphert, Erika L; von Recum, Horst A; Yamato, Masayuki; Nakayama, Masamichi

2018-06-01

Two different surface sulfonamide-functionalized poly(N-isopropylacrylamide)-based polymeric micelles were designed as pH-/temperature-responsive vehicles. Both sulfadimethoxine- and sulfamethazine-surface functionalized micelles were characterized to determine physicochemical properties, hydrodynamic diameters, zeta potentials, temperature-dependent size changes, and lower critical solution temperatures (LCST) in both pH 7.4 and 6.8 solutions (simulating both physiological and mild low pH conditions), and tested in the incorporation of a proof-of-concept hydrophobic antiproliferative drug, paclitaxel. Cellular uptake studies were conducted using bovine carotid endothelial cells and fluorescently labeled micelles to evaluate if there was enhanced cellular uptake of the micelles in a low pH environment. Both variations of micelles showed enhanced intracellular uptake under mildly acidic (pH 6.8) conditions at temperatures slightly above their LCST and minimal uptake at physiological (pH 7.4) conditions. Due to the less negative zeta potential of the sulfamethazine-surface micelles compared to sulfadimethoxine-surface micelles, and the proximity of their LCST to physiological temperature (37°C), the sulfamethazine variation was deemed more amenable for clinically relevant temperature and pH-stimulated applications. Nevertheless, we believe both polymeric micelle variations have the capacity to be implemented as an intracellular drug or gene delivery system in response to mildly acidic conditions. © 2018 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 106A: 1552-1560, 2018. © 2018 Wiley Periodicals, Inc.

Srs2 mediates PCNA-SUMO-dependent inhibition of DNA repair synthesis

International Nuclear Information System (INIS)

Burkovics, Peter; Sebesta, Marek; Kolesar, Peter; Sisakova, Alexandra; Marini, Victoria; Plault, Nicolas; Szukacsov, Valeria; Pinter, Lajos; Haracska, Lajos; Robert, Thomas; Kolesar, Peter; Gangloff, Serge; Krejci, Lumir

2013-01-01

Completion of DNA replication needs to be ensured even when challenged with fork progression problems or DNA damage. PCNA and its modifications constitute a molecular switch to control distinct repair pathways. In yeast, SUMOylated PCNA (S-PCNA) recruits Srs2 to sites of replication where Srs2 can disrupt Rad51 filaments and prevent homologous recombination (HR). We report here an unexpected additional mechanism by which S-PCNA and Srs2 block the synthesis-dependent extension of a recombination intermediate, thus limiting its potentially hazardous resolution in association with a cross-over. This new Srs2 activity requires the SUMO interaction motif at its C-terminus, but neither its translocase activity nor its interaction with Rad51. Srs2 binding to S-PCNA dissociates Polδ and Polη from the repair synthesis machinery, thus revealing a novel regulatory mechanism controlling spontaneous genome rearrangements. Our results suggest that cycling cells use the Siz1-dependent SUMOylation of PCNA to limit the extension of repair synthesis during template switch or HR and attenuate reciprocal DNA strand exchanges to maintain genome stability. (authors)

On DNA synthesis during C14O2 assimilation by peas seedlings

International Nuclear Information System (INIS)

Karimov, Kh.Kh.; Nikolaeva, M.I.

1976-01-01

In this article authors try to determine how much p articipate t hephotosynthesis in the new formation of DNA seedlings, depends this processfrom the light and realize at this the synthesis DNA in chloroplasts

The influence of polarity of additive molecules on micelle structures of polystyrene-block-poly(4-vinylpyridine) in the fabrication of nano-porous templates.

Science.gov (United States)

Chua, Kee Sze; Koh, Ai Peng; Lam, Yeng Ming

2010-11-01

Block copolymers are useful for in situ synthesis of nanoparticles as well as producing nanoporous templates. As such, the effects of precursors on the block copolymer micelle structure is important. In this study, we investigate the effects of polarity of molecules introduced into block copolymer micelle cores on the micelle structure. The molecular dipole moment of the additive molecules has been evaluated and their effects on the block copolymer micelles investigated using light scattering spectroscopy, small-angle X-ray scattering, transmission electron microscopy and atomic force microscopy. The molecule with the largest dipole moment resulted in spherical structures with a polydispersity of less than 0.06 in a fully translational diffusion system. Surprisingly, the less polar additive molecules produced elongated micelles and the aspect ratio increases with decreasing polarity. The change in structure from spherical to elongated structure was attributed to P4VP chain extension, where compounds with polarity most similar to P4VP induce the most chain extension. The second virial coefficients of the solutions with elongated micelles are lower than that for spherical micelle systems by up to one order in magnitude, indicating a strong tendency for micelles to coalesce. On rinsing the spin-cast films, pores were obtained from spherical micelles and ridges from elongated micelles, suggesting a viable alternative for morphology modification using mild conditions where external annealing treatments to the film are not preferred. The knowledge of polarity effects of additive molecules on micelle structure has wider implications for supramolecular block copolymer systems where, depending on the application requirements, changes to the shape of the micelle structure can be induced or avoided. Copyright 2010 Elsevier Inc. All rights reserved.

Synthesis of anti-aggregation silver nanoparticles based on inositol hexakisphosphoric micelles for a stable surface enhanced Raman scattering substrate

International Nuclear Information System (INIS)

Wang Na; Yang Haifeng; Zhu Xuan; Zhang Rui; Wang Yao; Huang Guanfeng; Zhang Zongrang

2009-01-01

We report a novel method of synthesizing a kind of silver nanoparticles aided by the inositol hexakisphosphoric micelle as a soft template and stabilizer. By controlling the reaction time, UV-vis and TEM observations of the size growth of the nanoparticles are performed. Careful examinations of surface enhanced Raman scattering (SERS) spectra of 2-mercaptopyridine (2-Mpy) on the as-produced silver nanoparticles exhibit very stable and reproducible Raman signals within about 4 months.

Down-regulation of SMT3A gene expression in association with DNA synthesis induction after X-ray irradiation in nevoid basal cell carcinoma syndrome (NBCCS) cells

International Nuclear Information System (INIS)

Sugaya, Shigeru; Nakanishi, Hiroshi; Tanzawa, Hideki; Sugita, Katsuo; Kita, Kazuko; Suzuki, Nobuo

2005-01-01

Fibroblast cells derived from nevoid basal carcinoma syndrome (NBCCS) patients show increased levels of DNA synthesis after X-ray irradiation. Genes, whose expression is modulated in association with the DNA synthesis induction, were searched by using PCR-based mRNA differential display analysis in one of the NBCCS cell lines, NBCCS1 cells. Decreased levels of SMT3A gene expression were found in X-ray-irradiated NBCCS1 cells. This decrease was also shown by RT-PCR analysis in another cell line, NBCCS3 cells. In addition to NBCCS cells, normal fibroblast cells showed the DNA synthesis induction after X-ray irradiation when they were treated with antisense oligonucleotides (AO) for SMT3A. However, treatment of normal fibroblasts with the random oligonucleotides (RO) resulted in decreased levels of DNA synthesis after X-ray irradiation. Thus, down-regulation of SMT3A gene expression may be involved in the DNA synthesis induction after X-ray irradiation in the NBCCS cells at least tested

Down-regulation of SMT3A gene expression in association with DNA synthesis induction after X-ray irradiation in nevoid basal cell carcinoma syndrome (NBCCS) cells

Energy Technology Data Exchange (ETDEWEB)

Sugaya, Shigeru [Department of Environmental Biochemistry, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan); Nakanishi, Hiroshi [Department of Clinical Molecular Biology, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan); Tanzawa, Hideki [Department of Clinical Molecular Biology, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan); Sugita, Katsuo [Department of Clinical Medicine, Faculty of Education, Chiba University, 1-33 Yayoi, Inage-ku, Chiba 263-8522 (Japan); Kita, Kazuko [Department of Environmental Biochemistry, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan); Suzuki, Nobuo [Department of Environmental Biochemistry, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan)]. E-mail: nobuo@faculty.chiba-u.jp

2005-10-15

Fibroblast cells derived from nevoid basal carcinoma syndrome (NBCCS) patients show increased levels of DNA synthesis after X-ray irradiation. Genes, whose expression is modulated in association with the DNA synthesis induction, were searched by using PCR-based mRNA differential display analysis in one of the NBCCS cell lines, NBCCS1 cells. Decreased levels of SMT3A gene expression were found in X-ray-irradiated NBCCS1 cells. This decrease was also shown by RT-PCR analysis in another cell line, NBCCS3 cells. In addition to NBCCS cells, normal fibroblast cells showed the DNA synthesis induction after X-ray irradiation when they were treated with antisense oligonucleotides (AO) for SMT3A. However, treatment of normal fibroblasts with the random oligonucleotides (RO) resulted in decreased levels of DNA synthesis after X-ray irradiation. Thus, down-regulation of SMT3A gene expression may be involved in the DNA synthesis induction after X-ray irradiation in the NBCCS cells at least tested.

DNA hydrogel as a template for synthesis of ultrasmall gold nanoparticles for catalytic applications.

Science.gov (United States)

Zinchenko, Anatoly; Miwa, Yasuyuki; Lopatina, Larisa I; Sergeyev, Vladimir G; Murata, Shizuaki

2014-03-12

DNA cross-linked hydrogel was used as a matrix for synthesis of gold nanoparticles. DNA possesses a strong affinity to transition metals such as gold, which allows for the concentration of Au precursor inside a hydrogel. Further reduction of HAuCl4 inside DNA hydrogel yields well dispersed, non-aggregated spherical Au nanoparticles of 2-3 nm size. The average size of these Au nanoparticles synthesized in DNA hydrogel is the smallest reported so far for in-gel metal nanoparticles synthesis. DNA hybrid hydrogel containing gold nanoparticles showed high catalytic activity in the hydrogenation reaction of nitrophenol to aminophenol. The proposed soft hybrid material is promising as environmentally friendly and sustainable material for catalytic applications.

Casein micelle structure: a concise review

Directory of Open Access Journals (Sweden)

Chanokphat Phadungath

2005-01-01

Full Text Available Milk is a complex biological fluid with high amount of proteins, lipid and minerals. The function of milk is to supply nutrients such as essential amino acids required for the growth of the newborn. In addition, due to the importance of casein and casein micelles for the functional behavior of dairy products, the nature and structure of casein micelles have been studied extensively. However, the exact structure of casein micelles is still under debate. Various models for casein micelle structure have been proposed. Most of the proposedmodels fall into three general categories, which are: coat-core, subunit (sub-micelles, and internal structure models. The coat-core models, proposed by Waugh and Nobel in 1965, Payens in 1966, Parry and Carroll in 1969, and Paquin and co-workers in 1987, describe the micelle as an aggregate of caseins with outer layer differing in composition form the interior, and the structure of the inner part is not accurately identified. The sub-micelle models, proposed by Morr in 1967, Slattery and Evard in 1973, Schmidt in 1980, Walstra in1984, and Ono and Obata in 1989, is considered to be composed of roughly spherical uniform subunits. The last models, the internal structure models, which were proposed by Rose in 1969, Garnier and Ribadeau- Dumas in 1970, Holt in 1992, and Horne in 1998, specify the mode of aggregation of the different caseins.

RBE comparison between rapid electrons of 20 MeV and 45 MeV with survival rate, DNA synthesis, DNA reparation and nucleoid sedimentation

International Nuclear Information System (INIS)

Alth, G.; Weniger, P.; Turtzer, K.; Klein, W.; Kocsis, F.; Krankenhaus der Stadt Wien-Lainz; Oesterreichisches Forschungszentrum Seibersdorf G.m.b.H. Inst. fuer Biologie)

1982-01-01

In order to find out possible differences of the biologic efficacy of rapid electrons of different energies, the authors examined the influence of rapid electrons of 20 MeV and 45 MeV upon the survival rate of Hela cells S3, their cell growth, DNA synthesis, DNA reparation, and sedimentation of nucleoids. The results show a difference only for the nucleoid sedimentation, i.e. there are more fractured DNA cords after 45 MeV irradiation. No significant differences could be demonstrated for the parameters of the survival curve, DNA synthesis and DNA reparation. Four double tests were carried out corresponding to the indicated types of examination. (orig.) [de

DNA synthesis in HeLa cells and isolated nuclei after treatment with an inhibitor of spermidine synthesis, methyl glyoxal bis(guanylhydrazone).

Science.gov (United States)

Krokan, H; Eriksen, A

1977-02-01

Addition of methyl glyoxal bis(guanylhydrazone) to HeLa S3 suspension cultures resulted in increased putrescine levels and decreased spermidine and spermine levels preceding a drop in incorporation of [3H]thymidine, [3H]uridine and [14C]leucine into macromolecules. When putrescine, spermidine, spermine or cadaverine was added simultaneously with methyl glyoxal bis(guanylhydrazone), the drug had no detectable effect on the synthesis of macromolecules. In nuclei isolated from cells treated with methyl glyoxal bis(guanylhydrazone) the reduction in the rate of DNA synthesis was equal to the reduction of [3H]thymidine incorporation in the corresponding whole cells. The capability of the nuclei to synthesize DNA could not be restored by adding spermidine or spermine to the system in vitro. The rate of DNA chain elongation was only reduced slightly by methyl glyoxal bis(guanylhydrazone) indicating that decreased levels of spermidine and spermine lead to a decrease in the number of replication units active in DNA synthesis within each cell.

Bronchoalveolar lavage fluid from normal rats stimulates DNA synthesis in rat alveolar type II cells

International Nuclear Information System (INIS)

Leslie, C.C.; McCormick-Shannon, K.; Mason, R.J.

1989-01-01

Proliferation of alveolar type II cells after lung injury is important for the restoration of the alveolar epithelium. Bronchoalveolar lavage fluid (BALF) may represent an important source of growth factors for alveolar type II cells. To test this possibility, BALF fluid was collected from normal rats, concentrated 10-fold by Amicon filtration, and tested for its ability to stimulate DNA synthesis in rat alveolar type II cells in primary culture. BALF induced a dose-dependent increase in type II cell DNA synthesis resulting in a 6-fold increase in [3H]thymidine incorporation. Similar doses also stimulated [3H]thymidine incorporation into rat lung fibroblasts by 6- to 8-fold. Removal of pulmonary surface active material by centrifugation did not significantly reduce the stimulatory activity of BALF for type II cells. The stimulation of type II cell DNA synthesis by BALF was reduced by 100% after heating at 100 degrees C for 10 min, and by approximately 80% after reduction with dithiothreitol, and after trypsin treatment. Dialysis of BALF against 1 N acetic acid resulted in a 27% reduction in stimulatory activity. The effect of BALF in promoting type II cell DNA synthesis was more pronounced when tested in the presence of serum, although serum itself has very little effect on type II cell DNA synthesis. When BALF was tested in combination with other substances that stimulate type II cell DNA synthesis (cholera toxin, insulin, epidermal growth factor, and acidic fibroblast growth factor), additive effects or greater were observed. When BALF was chromatographed over Sephadex G150, the activity eluted with an apparent molecular weight of 100 kDa

Self-Assembled Polymeric Micelles Based on Hyaluronic Acid-g-Poly(d,l-lactide-co-glycolide) Copolymer for Tumor Targeting

Science.gov (United States)

Son, Gyung Mo; Kim, Hyun Yul; Ryu, Je Ho; Chu, Chong Woo; Kang, Dae Hwan; Park, Su Bum; Jeong, Young-IL

2014-01-01

Graft copolymer composed hyaluronic acid (HA) and poly(d,l-lactide-co-glycolide) (PLGA) (HAgLG) was synthesized for antitumor targeting via CD44 receptor of tumor cells. The carboxylic end of PLGA was conjugated with hexamethylenediamine (HMDA) to have amine end group in the end of chain (PLGA-amine). PLGA-amine was coupled with carboxylic acid of HA. Self-assembled polymeric micelles of HAgLG have spherical morphologies and their sizes were around 50–200 nm. Doxorubicin (DOX)-incorporated polymeric micelles were prepared by dialysis procedure. DOX was released over 4 days and its release rate was accelerated by the tumoric enzyme hyaluronidase. To assess targetability of polymeric micelles, CD44-positive HepG2 cells were employed treated with fluorescein isothiocyanate (FITC)-labeled polymeric micelles. HepG2 cells strongly expressed green fluorescence at the cell membrane and cytosol. However, internalization of polymeric micelles were significantly decreased when free HA was pretreated to block the CD44 receptor. Furthermore, the CD44-specific anticancer activity of HAgLG polymeric micelles was confirmed using CD44-negative CT26 cells and CD44-positive HepG2 cells. These results indicated that polymeric micelles of HaLG polymeric micelles have targetability against CD44 receptor of tumor cells. We suggest HAgLG polymeric micelles as a promising candidate for specific drug targeting. PMID:25216338

Self-Assembled Polymeric Micelles Based on Hyaluronic Acid-g-Poly(d,l-lactide-co-glycolide Copolymer for Tumor Targeting

Directory of Open Access Journals (Sweden)

Gyung Mo Son

2014-09-01

Full Text Available Graft copolymer composed hyaluronic acid (HA and poly(d,l-lactide-co-glycolide (PLGA (HAgLG was synthesized for antitumor targeting via CD44 receptor of tumor cells. The carboxylic end of PLGA was conjugated with hexamethylenediamine (HMDA to have amine end group in the end of chain (PLGA-amine. PLGA-amine was coupled with carboxylic acid of HA. Self-assembled polymeric micelles of HAgLG have spherical morphologies and their sizes were around 50–200 nm. Doxorubicin (DOX-incorporated polymeric micelles were prepared by dialysis procedure. DOX was released over 4 days and its release rate was accelerated by the tumoric enzyme hyaluronidase. To assess targetability of polymeric micelles, CD44-positive HepG2 cells were employed treated with fluorescein isothiocyanate (FITC-labeled polymeric micelles. HepG2 cells strongly expressed green fluorescence at the cell membrane and cytosol. However, internalization of polymeric micelles were significantly decreased when free HA was pretreated to block the CD44 receptor. Furthermore, the CD44-specific anticancer activity of HAgLG polymeric micelles was confirmed using CD44-negative CT26 cells and CD44-positive HepG2 cells. These results indicated that polymeric micelles of HaLG polymeric micelles have targetability against CD44 receptor of tumor cells. We suggest HAgLG polymeric micelles as a promising candidate for specific drug targeting.

Self-assembly of block copolymer micelles: synthesis via reversible addition-fragmentation chain transfer polymerization and aqueous solution properties.

Science.gov (United States)

Mya, Khine Y; Lin, Esther M J; Gudipati, Chakravarthy S; Gose, Halima B A S; He, Chaobin

2010-07-22

Poly(hexafluorobutyl methacrylate) (PHFBMA) homopolymer was synthesized by reversible addition-fragmentation chain transfer (RAFT)-mediated living radical polymerization in the presence of cyano-2-propyl dithiobenzoate (CPDB) RAFT agent. A block copolymer of PHFBMA-poly(propylene glycol acrylate) (PHFBMA-b-PPGA) with dangling poly(propylene glycol) (PPG) side chains was then synthesized by using CPDB-terminated PHFBMA as a macro-RAFT agent. The amphiphilic properties and self-assembly of PHFBMA-b-PPGA block copolymer in aqueous solution were investigated by dynamic and static light scattering (DLS and SLS) studies, in combination with fluorescence spectroscopy and transmission electron microscopy (TEM). Although PPG shows moderately hydrophilic character, the formation of nanosize polymeric micelles was confirmed by fluorescence and TEM studies. The low value of the critical aggregation concentration exhibited that the tendency for the formation of copolymer aggregates in aqueous solution was very high due to the strong hydrophobicity of the PHFBMA(145)-b-PPGA(33) block copolymer. The combination of DLS and SLS measurements revealed the existence of micellar aggregates in aqueous solution with an association number of approximately 40 +/- 7 for block copolymer micelles. It was also found in TEM observation that there are 40-50 micelles accumulated into one aggregate and these micelles are loosely packed inside the aggregate.

CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

Science.gov (United States)

Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

2018-03-01

CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

Inhibition of DNA synthesis by chemical carcinogens in cultures of initiated and normal proliferating rat hepatocytes

International Nuclear Information System (INIS)

Novicki, D.L.; Rosenberg, M.R.; Michalopoulos, G.

1985-01-01

Rat hepatocytes in primary culture can be stimulated to replicate under the influence of rat serum and sparse plating conditions. Higher replication rates are induced by serum from two-thirds partially hepatectomized rats. The effects of carcinogens and noncarcinogens on the ability of hepatocytes to synthesize DNA were examined by measuring the incorporation of [3H]thymidine by liquid scintillation counting and autoradiography. Hepatocyte DNA synthesis was not decreased by ethanol or dimethyl sulfoxide at concentrations less than 0.5%. No effect was observed when 0.1 mM ketamine, Nembutal, hypoxanthine, sucrose, ascorbic acid, or benzo(e)pyrene was added to cultures of replicating hepatocytes. Estrogen, testosterone, tryptophan, and vitamin E inhibited DNA synthesis by approximately 50% at 0.1 mM, a concentration at which toxicity was noticeable. Several carcinogens requiring metabolic activation as well as the direct-acting carcinogen N-methyl-N'-nitro-N-nitrosoguanidine interfered with DNA synthesis. Aflatoxin B1 inhibited DNA synthesis by 50% (ID50) at concentrations between 1 X 10(-8) and 1 X 10(-7) M. The ID50 for 2-acetylaminofluorene was between 1 X 10(-7) and 1 X 10(-6) M. Benzo(a)pyrene and 3'-methyl-4-dimethylaminoazobenzene inhibited DNA synthesis 50% between 1 X 10(-5) and 1 X 10(-4) M. Diethylnitrosamine and dimethylnitrosamine (ID50 between 1 X 10(-4) and 5 X 10(-4) M) and 1- and 2-naphthylamine (ID50 between 1 X 10(-5) and 5 X 10(-4) M) caused inhibition of DNA synthesis at concentrations which overlapped with concentrations that caused measurable toxicity

Sugar-based gemini surfactant with a vesicle-to-micelle transition at acidic pH and a reversible vesicle flocculation near neutral pH

NARCIS (Netherlands)

Johnsson, M; Wagenaar, A; Engberts, JBFN

2003-01-01

A sugar-based (reduced glucose) gemini surfactant forms vesicles in dilute aqueous solution near neutral pH. At lower pH, there is a vesicle-to-micelle transition within a narrow pH region (pH 6.0-5.6). The vesicles are transformed into large cylindrical micelles that in turn are transformed into

Polymeric micelles for potentiated antiulcer and anticancer activities of naringin

Science.gov (United States)

Mohamed, Elham Abdelmonem; Abu Hashim, Irhan Ibrahim; Yusif, Rehab Mohammad; Shaaban, Ahmed Abdel Aziz; El-Sheakh, Ahmed Ramadan; Hamed, Mohammed Fawzy; Badria, Farid Abd Elreheem

2018-01-01

Naringin is one of the most interesting phytopharmaceuticals that has been widely investigated for various biological actions. Yet, its low water solubility, limited permeability, and suboptimal bioavailability limited its use. Therefore, in this study, polymeric micelles of naringin based on pluronic F68 (PF68) were developed, fully characterized, and optimized. The optimized formula was investigated regarding in vitro release, storage stability, and in vitro cytotoxicity vs different cell lines. Also, cytoprotection against ethanol-induced ulcer in rats and antitumor activity against Ehrlich ascites carcinoma in mice were investigated. Nanoscopic and nearly spherical 1:50 micelles with the mean diameter of 74.80±6.56 nm and narrow size distribution were obtained. These micelles showed the highest entrapment efficiency (EE%; 96.14±2.29). The micelles exhibited prolonged release up to 48 vs 10 h for free naringin. The stability of micelles was confirmed by insignificant changes in drug entrapment, particle size, and retention (%) (91.99±3.24). At lower dose than free naringin, effective cytoprotection of 1:50 micelles against ethanol-induced ulcer in rat model has been indicated by significant reduction in mucosal damage, gastric level of malondialdehyde, gastric expression of tumor necrosis factor-alpha, caspase-3, nuclear factor kappa-light-chain-enhancer of activated B cells, and interleukin-6 with the elevation of gastric reduced glutathione and superoxide dismutase when compared with the positive control group. As well, these micelles provoked pronounced antitumor activity assessed by potentiated in vitro cytotoxicity particularly against colorectal carcinoma cells and tumor growth inhibition when compared with free naringin. In conclusion, 1:50 naringin–PF68 micelles can be represented as a potential stable nanodrug delivery system with prolonged release and enhanced antiulcer as well as antitumor activities. PMID:29497294

Enzymatically triggered multifunctional delivery system based on hyaluronic acid micelles

KAUST Repository

Deng, Lin; Wang, Guangchao; Ren, Jian; Zhang, Bei; Yan, Jingjing; Li, Wengang; Khashab, Niveen M.

2012-01-01

(WI38). Higher Ch-HA micelles uptake was seen in cancer cells versus normal cells. Consequently, DOX release was elevated in cancer cells causing higher cytotoxicity and enhanced cell death. © 2012 The Royal Society of Chemistry.

Automation of cDNA Synthesis and Labelling Improves Reproducibility

Directory of Open Access Journals (Sweden)

Daniel Klevebring

2009-01-01

Full Text Available Background. Several technologies, such as in-depth sequencing and microarrays, enable large-scale interrogation of genomes and transcriptomes. In this study, we asses reproducibility and throughput by moving all laboratory procedures to a robotic workstation, capable of handling superparamagnetic beads. Here, we describe a fully automated procedure for cDNA synthesis and labelling for microarrays, where the purification steps prior to and after labelling are based on precipitation of DNA on carboxylic acid-coated paramagnetic beads. Results. The fully automated procedure allows for samples arrayed on a microtiter plate to be processed in parallel without manual intervention and ensuring high reproducibility. We compare our results to a manual sample preparation procedure and, in addition, use a comprehensive reference dataset to show that the protocol described performs better than similar manual procedures. Conclusions. We demonstrate, in an automated gene expression microarray experiment, a reduced variance between replicates, resulting in an increase in the statistical power to detect differentially expressed genes, thus allowing smaller differences between samples to be identified. This protocol can with minor modifications be used to create cDNA libraries for other applications such as in-depth analysis using next-generation sequencing technologies.

The effect of heat and radiation on the initiation and elongation processes of DNA synthesis

International Nuclear Information System (INIS)

Davies, R.C.; Bowden, G.T.; Cress, A.E.

1983-01-01

The pH step alkaline elution and alkaline sucrose gradient techniques were utilized to evaluate alterations in DNA replication (initiation and elongation) induced by heat and low dose X-irradiation in synchronized Chinese hamster ovary cells. The initiation and elongation processes of DNA synthesis were radioresistant at the G 1 /S boundary (4 hours after mitosis) while in mid S phase (9 hours after mitosis) DNA initiation and elongation were sensitive to X-irradiation. The initiation and elongation processes of DNA synthesis which were radiation resistant at the G 1 /S boundary could be inhibited by a hyperthermia treatment (43 0 C for 1 hour beginning at 4 hours after mitosis). The impairment of initiation in the heated cells was maintained through late S phase while that of elongation was reversible as judged by full recovery at 15 hours after mitosis. These data suggest that the known synergistic lethality of heat and radiation may be mediated by an impairment of initiation of DNA synthesis. (author)

Polymeric micelles as a drug carrier for tumor targeting

Directory of Open Access Journals (Sweden)

Neha M Dand

2013-01-01

Full Text Available Polymeric micelle can be targeted to tumor site by passive and active mechanism. Some inherent properties of polymeric micelle such as size in nanorange, stability in plasma, longevity in vivo, and pathological characteristics of tumor make polymeric micelles to be targeted at the tumor site by passive mechanism called enhanced permeability and retention effect. Polymeric micelle formed from the amphiphilic block copolymer is suitable for encapsulation of poorly water soluble, hydrophobic anticancer drugs. Other characteristics of polymeric micelles such as separated functionality at the outer shell are useful for targeting the anticancer drug to tumor by active mechanisms. Polymeric micelles can be conjugated with many ligands such as antibodies fragments, epidermal growth factors, α2 -glycoprotein, transferrine, and folate to target micelles to cancer cells. Application of heat and ultrasound are the alternative methods to enhance drug accumulation in tumoral cells. Targeting using micelles can also be done to tumor angiogenesis which is the potentially promising target for anticancer drugs. This review summarizes about recently available information regarding targeting the anticancer drug to the tumor site using polymeric micelles.

Polymeric micelles for drug targeting.

Science.gov (United States)

Mahmud, Abdullah; Xiong, Xiao-Bing; Aliabadi, Hamidreza Montazeri; Lavasanifar, Afsaneh

2007-11-01

Polymeric micelles are nano-delivery systems formed through self-assembly of amphiphilic block copolymers in an aqueous environment. The nanoscopic dimension, stealth properties induced by the hydrophilic polymeric brush on the micellar surface, capacity for stabilized encapsulation of hydrophobic drugs offered by the hydrophobic and rigid micellar core, and finally a possibility for the chemical manipulation of the core/shell structure have made polymeric micelles one of the most promising carriers for drug targeting. To date, three generations of polymeric micellar delivery systems, i.e. polymeric micelles for passive, active and multifunctional drug targeting, have arisen from research efforts, with each subsequent generation displaying greater specificity for the diseased tissue and/or targeting efficiency. The present manuscript aims to review the research efforts made for the development of each generation and provide an assessment on the overall success of polymeric micellar delivery system in drug targeting. The emphasis is placed on the design and development of ligand modified, stimuli responsive and multifunctional polymeric micelles for drug targeting.

Influence of vinyl chloride monomer and vinyl chloride monomer derivatives on hepatic DNA synthesis

International Nuclear Information System (INIS)

Brenner, E.A.

1982-01-01

Vinyl chloride monomer (VCM) is used extensively in the chemical industry, mainly in the production of polyvinyl chloride. It has recently been found to cause hepatic angiosarcoma. As VCM has also been shown to be mutagenic after metabolic activation the effect of VCM on DNA synthesis was investigated. [ 3 H]Thymidine incorporation into DNA was used to measure the rate of DNA synthesis in regenerating rat liver. A possible direct toxic effect of VCM or its metabolites on liver cell metabolism was examined by two unrelated techniques, viz. the measurement of adenine nucleotide concentrations in regenerating livers and the influence on transmembrane potentials in hepatocytes. The distribution of radioactivity in subcellular fractions following [ 14 C]VCM administration suggested microsomal conversion of VCM to an active form which was selectively retained in the nuclear fraction. Measurement of the activities of thymidine kinase and DNA polymerase in regenerating liver indicated that the induction of these enzymes which normally occurs after partial hepatectomy was not prevented by VCM treatment. Three techniques were used to test the hypothesis that the retardation in DNA synthesis was due to DNA damage: the prophage lambda induction test for DNA damage, autoradiographic detection of unscheduled thymidine incorporation into DNA, and detection of DNA strand breaks in alkaline sucrose gradients. All three provided evidence of DNA damage and led to the development of a novel technique to confirm these findings. This involved centrifugation in neutral sucrose gradients on intact double-stranded DNA contained in hepatocyte nucleoids and showed conclusively that VCM administration causes DNA strand breaks. Subsequent repair of DNA was also assessed by this technique. The site of the VCM/metabolite: DNA reaction was characterized by DNA thermal denaturation and renaturation studies

Typical xeroderma pigmentosum complementation group A fibroblasts have detectable ultraviolet light-induced unscheduled DNA synthesis

International Nuclear Information System (INIS)

Petinga, R.A.; Andrews, A.D.; Robbins, J.H.; Tarone, R.E.

1977-01-01

Ultraviolet-induced nuclear uptake of tritiated thymidine [ 3 H]dThd demonstrable by autoradiography in non-synthesis phases of the cell cycle is known as unscheduled DNA synthesis and reflects repair replication of ultraviolet-damaged DNA. We have reported that the rate of any such unscheduled DNA synthesis in typical group A xeroderma pigmentosum fibroblasts, if present, is less than 2% of the normal rate. We have now performed experiments to determine whether these fibroblasts have any unscheduled DNA synthesis. Fibroblast coverslip cultures of four xeroderma pigmentosum group A strains were prepared. Irradiated (254 nm ultraviolet light) and unirradiated cultures from each strain were incubated with [ 3 H]dThd at 37degC, and autoradiograms were prepared using NTB-3 emulsion. A nuclear grain count was made of 100 consecutive nuclei of non-S-phase irradiated and unirradiated cells. A slide background grain count was simultaneously made from an acellular area adjacent to each cell analyzed. When a strain's irradiated and unirradiated autoradiograms having similar slide background grain count averages were compared, the nuclear grain count average of the irradiated cells was always higher than that of the unirradiated cells. This ultraviolet-induced increase in the mean nuclear grain count ranged from 0.4 to 1.3% of that given by normal non-xeroderma pigmentosum fibroblasts and was not reduced by 10 -2 M hydroxyurea. Planimetric studies showed that the ultraviolet-induced increase in nuclear grain count is not due to an increased nuclear area in irradiated cells. We conclude that these typical group A xeroderma pigmentosum strains perform very low, but detectable, ultraviolet-induced unscheduled DNA synthesis which probably reflects repair replication. We cannot, however, determine if there are significantly different rates of ultraviolet-induced unscheduled DNA synthesis among these ultraviolet strains

Effect of Vaccinia virus infection on poly(ADP-ribose)synthesis and DNA metabolism in different cells

Energy Technology Data Exchange (ETDEWEB)

Topaloglou, A.; Ott, E.; Altmann, H. (Oesterreichisches Forschungszentrum Seibersdorf G.m.b.H. Inst. fuer Biologie); Zashukhina, G.D.; Sinelschikova, T.A. (AN SSSR, Moscow. Inst. Obshchej Genetiki)

1983-07-14

In Chang liver cells and rat spleen cells infected with Vaccinia virus, DNA synthesis, repair replication after UV irradiation and poly(ADP-ribose)(PAR) synthesis were determined. In the time post infection semiconservative DNA synthesis showed only a slight reduction. DNA repair replication was not very different from controls 4 hours p.i. but was enhanced 24 hours after infection compared to noninfected cells. PAR synthesis was also not changed very much 4 hours p.i. but was decreased significantly after 24 hours. The determination of radioactivity resulting from /sup 3/H-NAD, showed a marked reduction of PAR in the spacer region of chromatin 24 hours p.i., but in addition, PAR located in the core region, was reduced, too.

Synthesis and photoluminescence properties of CaSiO3:Eu3+ spheres prepared by the reverse micelles soft template

International Nuclear Information System (INIS)

Yang Liangzhun; Fang Min; Du Lifen; Zhang Zhaojie; Ren Liwen; Yu Xibin

2008-01-01

We report here the successful synthesis of CaSiO 3 :Eu 3+ spheres using the reverse micelles soft template. The influence of the calcination temperature on the shape, crystallization and photoluminescence properties of the prepared spheres was investigated by DTA-TG, XRD, IR, SEM and PL. The results showed that the temperature of crystallization (from amorphous phase to β-CaSiO 3 ) is 668 deg. C. The temperature of phase transition (from β-CaSiO 3 to α-CaSiO 3 ) is 790 deg. C. The average size of CaSiO 3 :Eu 3+ spheres calcined at 700 deg. C was about 350 nm. The radiation was dominated by the red emission peak at 613 nm and the highest emission intensity was observed when the spheres were calcined at 700 deg. C. When calcined at 800 deg. C, the spheres are almost cracked and melted down, due to the high temperature

Effect of hydrostatic pressure on gas solubilization in micelles.

Science.gov (United States)

Meng, Bin; Ashbaugh, Henry S

2015-03-24

Molecular dynamics simulations of anionic sodium decylsulfate and nonionic pentaethylene glycol monodecyl ether micelles in water have been performed to examine the impact of hydrostatic pressure on argon solubilization as a function of pressure. The potential-of-mean force between the micelles and argon demonstrates that nonpolar gases are attracted to the interiors of both micelles. The affinity of argon for micelle interiors, however, decreases with increasing pressure as a result of the comparatively higher molar volume of argon inside assemblies. We evaluate solubility enhancement coefficients, which describe the drop in the solute chemical potential as a function of the micellized surfactant concentration, to quantify the impact of micellization on gas solubilization. While argon is similarly attracted to the hydrophobic cores of both micelles, the gas is more effectively sequestered within nonionic micelles compared with anionic micelles as a result of salting out by charged head groups and accompanying counterions. The solubility enhancement coefficients of both micelles decrease with increasing pressure, reflecting the changing forces observed in the potentials-of-mean force. An analytical liquid drop model is proposed to describe the pressure dependence of argon solubilization within micelles that captures the simulation solubility enhancement coefficients after fitting an effective micelle radius for each surfactant.

Histoautoradiographic and liquid scintillometric studies on DNA synthesis in the liver, kidneys, spleen and tongue after bilateral adrenalectomy in rats

International Nuclear Information System (INIS)

Schneider, A.

1981-01-01

Historadiographies and liquid scintillometries were carried out in 163 male Wistar rats in order to determine the effects of bilateral adrenalectomy on DNA synthesis in the liver, kidneys, spleen, and tongue. Both DNA synthesis and mitotic index are significantly increased from the 1st day p.o. onwards, with broad synthesis peaks between the 2nd and the 4th day. The intensity of DNA synthesis shows a gradual decrease with increasing duration of the experiment. In contrast to the adrenalectonized animals, the synthesis rate and mitotic index in the organs of sham-operated animals were significantly lower, although enhanced proliferation was observed after surgery. The enhanced DNA synthesis after bilateral adrenalectomy is interpreted in terms of a disinhibition; corticosteroids are assumed to play a key role. The effects of bilateral adrenalectromy on untreated organs are not organ-specific. The highest synthesis rate was observed in the tubular epithelia of the convoluted main parts, while the DNA synthesis in the tongue. The findings of autoradiography and liquid scintillometry are well correlated. (orig./MG) [de

Synthesis, X-ray crystal structure, DNA binding and Nuclease activity ...

Indian Academy of Sciences (India)

s12039-016-1125-x. Synthesis, X-ray crystal structure, DNA binding and Nuclease activity of lanthanide(III) complexes of 2-benzoylpyridine acetylhydrazone. KARREDDULA RAJA, AKKILI SUSEELAMMA and KATREDDI HUSSAIN REDDY. ∗.

Near-Infrared Squaraine Dye Encapsulated Micelles for in Vivo Fluorescence and Photoacoustic Bimodal Imaging.

Science.gov (United States)

Sreejith, Sivaramapanicker; Joseph, James; Lin, Manjing; Menon, Nishanth Venugopal; Borah, Parijat; Ng, Hao Jun; Loong, Yun Xian; Kang, Yuejun; Yu, Sidney Wing-Kwong; Zhao, Yanli

2015-06-23

Combined near-infrared (NIR) fluorescence and photoacoustic imaging techniques present promising capabilities for noninvasive visualization of biological structures. Development of bimodal noninvasive optical imaging approaches by combining NIR fluorescence and photoacoustic tomography demands suitable NIR-active exogenous contrast agents. If the aggregation and photobleaching are prevented, squaraine dyes are ideal candidates for fluorescence and photoacoustic imaging. Herein, we report rational selection, preparation, and micelle encapsulation of an NIR-absorbing squaraine dye (D1) for in vivo fluorescence and photoacoustic bimodal imaging. D1 was encapsulated inside micelles constructed from a biocompatible nonionic surfactant (Pluoronic F-127) to obtain D1-encapsulated micelles (D1(micelle)) in aqueous conditions. The micelle encapsulation retains both the photophysical features and chemical stability of D1. D1(micelle) exhibits high photostability and low cytotoxicity in biological conditions. Unique properties of D1(micelle) in the NIR window of 800-900 nm enable the development of a squaraine-based exogenous contrast agent for fluorescence and photoacoustic bimodal imaging above 820 nm. In vivo imaging using D1(micelle), as demonstrated by fluorescence and photoacoustic tomography experiments in live mice, shows contrast-enhanced deep tissue imaging capability. The usage of D1(micelle) proven by preclinical experiments in rodents reveals its excellent applicability for NIR fluorescence and photoacoustic bimodal imaging.

Yolk@Shell Nanoarchitectures with Bimetallic Nanocores-Synthesis and Electrocatalytic Applications.

Science.gov (United States)

Guiet, Amandine; Unmüssig, Tobias; Göbel, Caren; Vainio, Ulla; Wollgarten, Markus; Driess, Matthias; Schlaad, Helmut; Polte, Jörg; Fischer, Anna

2016-10-10

In the present paper, we demonstrate a versatile approach for the one-pot synthesis of metal oxide yolk@shell nanostructures filled with bimetallic nanocores. This novel approach is based on the principles of hydrophobic nanoreactor soft-templating and is exemplified for the synthesis of various AgAu NP @tin-rich ITO (AgAu@ITO TR ) yolk@shell nanomaterials. Hydrophobic nanoreactor soft-templating thereby takes advantage of polystyrene-block-poly(4-vinylpiridine) inverse micelles as two-compartment nanoreactor template, in which the core and the shell of the micelles serve as metal and metal oxide precursor reservoir, respectively. The composition, size and number of AuAg bimetallic nanoparticles incorporated within the ITO TR yolk@shell can easily be tuned. The conductivity of the ITO TR shell and the bimetallic composition of the AuAg nanoparticles, the as-synthesized AuAg NP @ITO TR yolk@shell materials could be used as efficient electrocatalysts for electrochemical glucose oxidation with improved onset potential when compared to their gold counterpart.

Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

OpenAIRE

Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

2012-01-01

8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

Trial watch: Naked and vectored DNA-based anticancer vaccines.

Science.gov (United States)

Bloy, Norma; Buqué, Aitziber; Aranda, Fernando; Castoldi, Francesca; Eggermont, Alexander; Cremer, Isabelle; Sautès-Fridman, Catherine; Fucikova, Jitka; Galon, Jérôme; Spisek, Radek; Tartour, Eric; Zitvogel, Laurence; Kroemer, Guido; Galluzzi, Lorenzo

2015-05-01

One type of anticancer vaccine relies on the administration of DNA constructs encoding one or multiple tumor-associated antigens (TAAs). The ultimate objective of these preparations, which can be naked or vectored by non-pathogenic viruses, bacteria or yeast cells, is to drive the synthesis of TAAs in the context of an immunostimulatory milieu, resulting in the (re-)elicitation of a tumor-targeting immune response. In spite of encouraging preclinical results, the clinical efficacy of DNA-based vaccines employed as standalone immunotherapeutic interventions in cancer patients appears to be limited. Thus, efforts are currently being devoted to the development of combinatorial regimens that allow DNA-based anticancer vaccines to elicit clinically relevant immune responses. Here, we discuss recent advances in the preclinical and clinical development of this therapeutic paradigm.

Radiation effect and response of DNA synthesis in lymphocytes induced by low dose irradiation

International Nuclear Information System (INIS)

Zhao Yujie; Su Liaoyuan; Zou Huawei; Kong Xiangrong

1999-01-01

The ability of DNA synthesis in lymphocytes were measured by using 3 H-TdR incorporation method. This method was used to observe the damage of lymphocytes irradiated by several challenge doses (0.5-0.8 Gy) and adaptive response induced by previous low dose irradiation. The results show that DNA synthesis was inhibited by challenge dose of radiation and was adapted by previous 0.048 Gy irradiation

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

Science.gov (United States)

Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

2013-06-25

A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

On the recovery of the DNA-synthesis after X-irradiation in the spleen of mice and its modification by the NAD-metabolism

International Nuclear Information System (INIS)

Streffer, C.

1974-01-01

The incorporation of tritium-labelled thymidine into the DNA of mice spleen cells after whole body irradiation with X-rays was measured in order to study the decrease of DNA synthesis is decreased for several hours after irradiation with low doses. Recovery effects become operative after six hours. The radiation effect on the NAD metabolism, known to be related to DNA synthesis, was also investigated. The rate of NAD synthesis is influenced via the extremely radiosensitive metabolic process in the nucleus. Conversely, inhibition of DNA synthesis by injection of NAD enhances the recovery of DNA synthesis after irradiaton. (G.G.)

DNA synthesis in toluene-treated bacteriophage-infected minicells of Bacillus subtilis

International Nuclear Information System (INIS)

Amann, E.; Reeve, J.N.

1978-01-01

Bateriophage (phi29, SPP1, or SP01)-infected, toluene-treated minicells of Bacillus subtilis are capable of limited amounts of non-replicative DNA synthesis as measured by incorporation of [ 3 H]dTTP into a trichloroacetic acid-precipitable form. The [ 3 H]dTTP is covalently incorporated into small DNA fragments which result from the degradation of a small percentage of the infecting phage genomes (molecular weights in the range of 2.10 5 ). Short exposure of the DNA molecules containing the incorporated [ 3 H]dTMP to Escherichia coli exonuclease III results in over 90% of the [ 3 H]dTMP being converted to a trichloroacetic acid-soluble form. The synthesis is totally dependent on host-cell enzymes and is not inhibited by the addition of chloramphenicol, rifampicin, nalidixic acid and mitomycin C and only slightly (approx. 20%) inhibited by the addition of 6-(p-hydroxyphenylazo)-uracil. (Auth.)

DNA synthesis and degradation in UV-irradiated toluene treated cells of E. coli K12: the role of polynucleotide ligase

International Nuclear Information System (INIS)

Strike, P.

1977-01-01

Toluene treated cells have been used to study the processes of DNA synthesis and DNA degradation in ultra-violet irradiated Escherichia coli K12. Synthesis and degradation are both shown to occur extensively if polynucleotide ligase is inhibited, and to occur to a much lesser extent if ligase activity is optimal. Extensive UV-induced DNA synthesis in toluene-treated cells requires ATP for the initial incision step, and DNA polymerase I. Extensive degradation also depends on the early ATP-dependent incision step, and the subsequent degradation shows a partial requirement for ATP. Curtailment of degradation by ligase requires DNA polymerase activity, but is not dependent upon DNA polymerase I. Apparently this process can be carried out with equal facility by either DNA polymerase II or polymerase III. These observations suggest that extensive DNA polymerase I-dependent repair synthesis and extensive DNA degradation are facets of two divergent pathways of excision repair, both of which depend upon the early uvrABC determined ATP-dependent incision step. (orig.) [de

Correlation between survival, ability to rejoin DNA and stability of DNA after preirradiation inhibition of protein synthesis in a rec- mutant of Escherichia coli K12

International Nuclear Information System (INIS)

Pirsel, M.; Slezarikova, V.

1977-01-01

A 90 min inhibition of protein synthesis induced by starvation for amino acids (AA - ) or by chloramphenicol (CAP) treatment prior to UV irradiation (2.5 J m -2 ) increased more than tenfold the resistance of the strain Escherichia coli K12 SR19 to UV radiation. Under these conditions, cultures in which protein synthesis was inhibited before the UV irradiation rejoin short regions of DNA synthesized after the irradiation to a normal-size molecule, whereas an exponentially growing culture does not rejoin DNA synthesized after UV irradiation to a molecule of a normal size. In the exponentially growing culture both the parental and the newly synthesized DNA are unstable after the irradiation. In cultures with inhibited protein synthesis only the parental DNA is somewhat unstable. In Escherichia coli K12 SR19 where protein synthesis was inhibited before the irradiation, a correlation between the survival of cells, the ability to rejoin short regions of DNA synthesized after UV irradiation, and a higher stability of both parental and newly synthesized DNAs could be demonstrated. (author)

Multifunctional theranostic Pluronic mixed micelles improve targeted photoactivity of Verteporfin in cancer cells

Energy Technology Data Exchange (ETDEWEB)

Silva Pellosi, Diogo [Laboratory of Phobiology and photomdicine, Department of Chemistry (FFCLRP), University of São Paulo, Av. dos Bandeirantes 3900, 14040-901, Vila Monte Alegre, Ribeirão Preto (Brazil); Calori, Italo Rodrigo [Research Nucleus of Photodynamic Therapy, Department of Chemistry, State University of Maringá, Av. Colombo 5790, 97020-900 Maringá (Brazil); Barcelos de Paula, Leonardo [Laboratory of Phobiology and photomdicine, Department of Chemistry (FFCLRP), University of São Paulo, Av. dos Bandeirantes 3900, 14040-901, Vila Monte Alegre, Ribeirão Preto (Brazil); Hioka, Noboru [Research Nucleus of Photodynamic Therapy, Department of Chemistry, State University of Maringá, Av. Colombo 5790, 97020-900 Maringá (Brazil); Quaglia, Fabiana [Laboratory of Drug Delivery, Department of Pharmacy, University of Napoli Federico II, Via Domenico Montesanto 49, 80131 Napoli (Italy); Tedesco, Antonio Claudio, E-mail: atedesco@usp.br [Laboratory of Phobiology and photomdicine, Department of Chemistry (FFCLRP), University of São Paulo, Av. dos Bandeirantes 3900, 14040-901, Vila Monte Alegre, Ribeirão Preto (Brazil)

2017-02-01

Nanotechnology development provides new strategies to treat cancer by integration of different treatment modalities in a single multifunctional nanoparticle. In this scenario, we applied the multifunctional Pluronic P123/F127 mixed micelles for Verteporfin-mediated photodynamic therapy in PC3 and MCF-7 cancer cells. Micelles functionalization aimed the targeted delivery by the insertion of biotin moiety on micelle surface and fluorescence image-based through rhodamine-B dye conjugation in the polymer chains. Multifunctional Pluronics formed spherical nanoparticulated micelles that efficiently encapsulated the photosensitizer Verteporfin maintaining its favorable photophysical properties. Lyophilized formulations were stable at least for 6 months and readily reconstituted in aqueous media. The multifunctional micelles were stable in protein-rich media due to the dual Pluronic mixed micelles characteristic: high drug loading capacity provided by its micellar core and high kinetic stability due its biocompatible shell. Biotin surface functionalized micelles showed higher internalization rates due biotin-mediated endocytosis, as demonstrated by competitive cellular uptake studies. Rhodamine B-tagged micelles allowed monitoring cellular uptake and intracellular distribution of the formulations. Confocal microscopy studies demonstrated a larger intracellular distribution of the formulation and photosensitizer, which could drive Verteporfin to act on multiple cell sites. Formulations were not toxic in the dark condition, but showed high Verteporfin-induced phototoxicity against both cancer cell lines at low drug and light doses. These results point Verteporfin-loaded multifunctional micelles as a promising tool to further developments in photodynamic therapy of cancer. - Highlights: • We optimized the theranostic mixed micelles – verteporfin formulations. • Multifunctional Pluronic micelles formed nano-sized spherical nanoparticles. • Biotin surface conjugation

Decreased UV-induced DNA repair synthesis in peripheral leukocytes from patients with the nevoid basal cell carcinoma syndrome

International Nuclear Information System (INIS)

Ringborg, U.; Lambert, B.; Landergen, J.; Lewensohn, R.

1981-01-01

The uv-induced DNA repair synthesis in peripheral leukocytes from 7 patients with the nevoid basal cell carcinoma syndrome was compared to that in peripheral leukocytes from 5 patients with basal cell carcinomas and 39 healthy subjects. A dose response curve was established for each individual, and maximum DNA repair synthesis was used as a measure of the capacity for DNA repair. The patients with the nevoid basal cell carcinoma syndrome had about 25% lower level of maximum DNA repair synthesis as compared to the patients with basal cell carcinomas and control individuals. The possibility that DNA repair mechanisms may be involved in the etiology to the nevoid basal cell carcinoma syndrome is discussed

Effects of gamma- and UV-radiation on DNA synthesis in permeable cells of Bacillus stearothermophilus

International Nuclear Information System (INIS)

Trofimenko, A.F.; Vorob'eva, A.M.; Gaziev, A.I.

1981-01-01

It was shown that the most of the DNA synthesis is repaired in permeable cells of Bacillus stearothermophilus not affected by injurious agents. γ-irradiation stimulates the reparative synthesis and degradation of DNA whereas UV-radiation decreases the activity of these processes. The reason for such an unusual response of thermophiles to irradiation lies perhaps in high temperatures at which the cells exist

Programmable autonomous synthesis of single-stranded DNA

Science.gov (United States)

Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

2018-02-01

DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

In vitro evaluation of antioxidant and neuroprotective effects of curcumin loaded in Pluronic micelles

OpenAIRE

Cvetelina Gorinova; Denitsa Aluani; Yordan Yordanov; Magdalena Kondeva-Burdina; Virginia Tzankova; Cvetelina Popova; Krassimira Yoncheva

2016-01-01

Curcumin is a polyphenolic substance with attractive pharmacological activities (e.g. antioxidant, anti-inflammatory, anticancer). Incorporation of curcumin in polymeric micelles could overcome the problems associated with its instability and low aqueous solubility. The aim of this study was to load curcumin in polymeric micelles based on Pluronic® P 123 or Pluronic® F 127 triblock copolymers and evaluate the antioxidant and neuroprotective effects after micellization. The micelles were prepa...

Synergistic effect of pH-responsive folate-functionalized poloxamer 407-TPGS-mixed micelles on targeted delivery of anticancer drugs

Directory of Open Access Journals (Sweden)

Butt AM

2015-02-01

Full Text Available Adeel Masood Butt, Mohd Cairul Iqbal Mohd Amin, Haliza Katas Centre for Drug Delivery Research, Faculty of Pharmacy, Universiti Kebangsaan Malaysia, Kuala Lumpur, Malaysia Background: Doxorubicin (DOX, an anthracycline anticancer antibiotic, is used for treating various types of cancers. However, its use is associated with toxicity to normal cells and development of resistance due to overexpression of drug efflux pumps. Poloxamer 407 (P407 and vitamin E TPGS (d-α-tocopheryl polyethylene glycol succinate, TPGS are widely used polymers as drug delivery carriers and excipients for enhancing the drug retention times and stability. TPGS reduces multidrug resistance, induces apoptosis, and shows selective anticancer activity against tumor cells. Keeping in view the problems, we designed a mixed micelle system encapsulating DOX comprising TPGS for its selective anticancer activity and P407 conjugated with folic acid (FA for folate-mediated receptor targeting to cancer cells. Methods: FA-functionalized P407 was prepared by carbodiimide crosslinker chemistry. P407-TPGS/FA-P407-TPGS-mixed micelles were prepared by thin-film hydration method. Cytotoxicity of blank micelles, DOX, and DOX-loaded micelles was determined by alamarBlue® assay. Results: The size of micelles was less than 200 nm with encapsulation efficiency of 85% and 73% for P407-TPGS and FA-P407-TPGS micelles, respectively. Intracellular trafficking study using nile red-loaded micelles indicated improved drug uptake and perinuclear drug localization. The micelles show minimal toxicity to normal human cell line WRL-68, enhanced cellular uptake of DOX, reduced drug efflux, increased DOX–DNA binding in SKOV3 and DOX-resistant SKOV3 human ovarian carcinoma cell lines, and enhanced in vitro cytotoxicity as compared to free DOX. Conclusion: FA-P407-TPGS-DOX micelles show potential as a targeted nano-drug delivery system for DOX due to their multiple synergistic factors of selective anticancer

Stereocomplex-Reinforced PEGylated Polylactide Micelle for Optimized Drug Delivery

Directory of Open Access Journals (Sweden)

Chunsheng Feng

2016-04-01

Full Text Available The instability of PEGylated polylactide micelles is a challenge for drug delivery. Stereocomplex interaction between racemic polylactide chains with different configurations provides an effective strategy to enhance the stability of micelles as the nanocarriers of drugs. In this work, a stereocomplex micelle (SCM self-assembled from the amphiphilic triblock copolymers comprising poly(ethylene glycol (PEG, and dextrorotatory and levorotatory polylactides (PDLA and PLLA was applied for efficient drug delivery. The spherical SCM showed the smallest scale and the lowest critical micelle concentration (CMC than the micelles with single components attributed to the stereocomplex interaction between PDLA and PLLA. 10-Hydroxycamptothecin (HCPT as a model antitumor drug was loaded into micelles. Compared with the loading micelles from individual PDLA and PLLA, the HCPT-loaded SCM exhibited the highest drug loading efficiency (DLE and the slowest drug release in phosphate-buffered saline (PBS at pH 7.4, indicating its enhanced stability in circulation. More fascinatingly, the laden SCM was demonstrated to have the highest cellular uptake of HCPT and suppress malignant cells most effectively in comparison to the HCPT-loaded micelles from single copolymer. In summary, the stereocomplex-enhanced PLA–PEG–PLA micelle may be promising for optimized drug delivery in the clinic.

Versatile polyion complex micelles for peptide and siRNA vectorization to engineer tolerogenic dendritic cells.

Science.gov (United States)

Mebarek, Naila; Vicente, Rita; Aubert-Pouëssel, Anne; Quentin, Julie; Mausset-Bonnefont, Anne-Laure; Devoisselle, Jean-Marie; Jorgensen, Christian; Bégu, Sylvie; Louis-Plence, Pascale

2015-05-01

Dendritic cells (DCs) are professional antigen-presenting cells that play a critical role in maintaining the balance between immunity and tolerance and, as such are a promising immunotherapy tool to induce immunity or to restore tolerance. The main challenge to harness the tolerogenic properties of DCs is to preserve their immature phenotype. We recently developed polyion complex micelles, formulated with double hydrophilic block copolymers of poly(methacrylic acid) and poly(ethylene oxide) blocks and able to entrap therapeutic molecules, which did not induce DC maturation. In the current study, the intrinsic destabilizing membrane properties of the polymers were used to optimize endosomal escape property of the micelles in order to propose various strategies to restore tolerance. On the first hand, we showed that high molecular weight (Mw) copolymer-based micelles were efficient to favor the release of the micelle-entrapped peptide into the endosomes, and thus to improve peptide presentation by immature (i) DCs. On the second hand, we put in evidence that low Mw copolymer-based micelles were able to favor the cytosolic release of micelle-entrapped small interfering RNAs, dampening the DCs immunogenicity. Therefore, we demonstrate the versatile use of polyionic complex micelles to preserve tolerogenic properties of DCs. Altogether, our results underscored the potential of such micelle-loaded iDCs as a therapeutic tool to restore tolerance in autoimmune diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

Self-assembled catalytic DNA nanostructures for synthesis of para-directed polyaniline.

Science.gov (United States)

Wang, Zhen-Gang; Zhan, Pengfei; Ding, Baoquan

2013-02-26

Templated synthesis has been considered as an efficient approach to produce polyaniline (PANI) nanostructures. The features of DNA molecules enable a DNA template to be an intriguing template for fabrication of emeraldine PANI. In this work, we assembled HRP-mimicking DNAzyme with different artificial DNA nanostructures, aiming to manipulate the molecular structures and morphologies of PANI nanostructures through the controlled DNA self-assembly. UV-vis absorption spectra were used to investigate the molecular structures of PANI and monitor kinetic growth of PANI. It was found that PANI was well-doped at neutral pH and the redox behaviors of the resultant PANI were dependent on the charge density of the template, which was controlled by the template configurations. CD spectra indicated that the PANI threaded tightly around the helical DNA backbone, resulting in the right handedness of PANI. These reveal the formation of the emeraldine form of PANI that was doped by the DNA. The morphologies of the resultant PANI were studied by AFM and SEM. It was concluded from the imaging and spectroscopic kinetic results that PANI grew preferably from the DNAzyme sites and then expanded over the template to form 1D PANI nanostructures. The strategy of the DNAzyme-DNA template assembly brings several advantages in the synthesis of para-coupling PANI, including the region-selective growth of PANI, facilitating the formation of a para-coupling structure and facile regulation. We believe this study contributes significantly to the fabrication of doped PANI nanopatterns with controlled complexity, and the development of DNA nanotechnology.

Synthesis of a large-sized mesoporous phosphosilicate thin film through evaporation-induced polymeric micelle assembly.

Science.gov (United States)

Li, Yunqi; Bastakoti, Bishnu Prasad; Imura, Masataka; Suzuki, Norihiro; Jiang, Xiangfen; Ohki, Shinobu; Deguchi, Kenzo; Suzuki, Madoka; Arai, Satoshi; Yamauchi, Yusuke

2015-01-01

A triblock copolymer, poly(styrene-b-2-vinyl pyridine-b-ethylene oxide) (PS-b-P2VP-b-PEO) was used as a soft template to synthesize large-sized mesoporous phosphosilicate thin films. The kinetically frozen PS core stabilizes the micelles. The strong interaction of the inorganic precursors with the P2VP shell enables the fabrication of highly robust walls of phosphosilicate and the PEO helps orderly packing of the micelles during solvent evaporation. The molar ratio of phosphoric acid and tetraethyl orthosilicate is crucial to achieve the final mesostructure. The insertion of phosphorus species into the siloxane network is studied by (29) Si and (31) P MAS NMR spectra. The mesoporous phosphosilicate films exhibit steady cell adhesion properties and show great promise as excellent materials in bone-growth engineering applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Charged triblock copolymer self-assembly into charged micelles

Science.gov (United States)

Chen, Yingchao; Zhang, Ke; Zhu, Jiahua; Wooley, Karen; Pochan, Darrin; Department of Material Science; Engineering University of Delaware Team; Department of Chemistry Texas A&M University Collaboration

2011-03-01

Micelles were formed through the self-assembly of amphiphlic block copolymer poly(acrylic acid)-block-poly(methyl acrylate)-block-polystyrene (PAA-PMA-PS). ~Importantly, the polymer is complexed with diamine molecules in pure THF solution prior to water titration solvent processing-a critical aspect in the control of final micelle geometry. The addition of diamine triggers acid-base complexation ~between the carboxylic acid PAA side chains and amines. ~Remarkably uniform spheres were found to form close-packed patterns when forced into dried films and thin, solvated films when an excess of amine was used in the polymer assembly process. Surface properties and structural features of these hexagonal-packed spherical micelles with charged corona have been explored by various characterization methods including Transmission Electron Microscopy (TEM), cryogenic TEM, z-potential analysis and Dynamic Light Scattering. The forming mechanism for this pattern and morphology changes against external stimulate such as salt will be discussed.

Action of cytochalasin D on DNA synthesis in cells in culture

International Nuclear Information System (INIS)

Glushankova, N.A.

1986-01-01

To solve the problem of the effect of changes in the actin cytoskeleton on DNA replication during the action of cytochalasins, the effect of long-term incubation of normal cells with cytochalasin D (CCD), which selectively destroys the microfilament system but does not affect transport of sugars, was investigated. Incorporation of labeled thymidine into mononuclear and binuclear cells in the presence of CCD and after its removal by rinsing also was studied separately. To investigate DNA synthesis the method of autoradiography with 3 H-thymidine was used. A culture of mouse fibroblasts of the BALB/3T3 line and a secondary culture of fibroblasts obtained by trypsinization of mouse embryos (MEF) were used. On incubation of MEF and 3T3 cells, gradual inhibition of DNA synthesis is observed. The results obtained indicate that structural changes in the active cytoskeleton can abruptly and reversibly disturb passage of the normal cell through the cycle

Lethality and the depression on DNA synthesis in UV-irradiated normal human and xeroderma pigmentosum cells

Energy Technology Data Exchange (ETDEWEB)

Shinohara, K. (Kobe Univ. (Japan). School of Medicine)

1983-12-01

Ultraviolet radiation suppresses the semiconservative DNA replication in mammalian cells. The rate of DNA synthesis is initially depressed and later recovers after low doses of UV radiation in human cells. Such a response is more sensitive to UV radiation in cells derived from patients with xeroderma pigmentosum (XP) than that in normal human cells. The relative rate of DNA synthesis is not always correlated with cell survival because, unlike cell survival, the dose-response curve of the relative rate of DNA synthesis shows the biphasic nature of the sensitivity. In the experiments reported herein, the total amount (not the rate) of DNA synthesized during a long interval of incubation which covers the period of inhibition and recovery (but not longer than one generation time) after irradiation with various doses of UV radiation was examined in normal human and XP cells, and was found to be well correlated with cell survival in all the cells tested.

Repair of Clustered Damage and DNA Polymerase Iota.

Science.gov (United States)

Belousova, E A; Lavrik, O I

2015-08-01

Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.

Micelles driven magnetite (Fe{sub 3}O{sub 4}) hollow spheres and a study on AC magnetic properties for hyperthermia application

Energy Technology Data Exchange (ETDEWEB)

Goswami, Madhuri Mandal, E-mail: madhuri@bose.res.in [Department of Condensed Matter Physics and Material Science, S. N. Bose National Centre for Basic Sciences, Block JD, Sector III, Salt Lake, Kolkata 700106 (India); Dey, Chaitali [Department of Condensed Matter Physics and Material Science, S. N. Bose National Centre for Basic Sciences, Block JD, Sector III, Salt Lake, Kolkata 700106 (India); CRNN, University of Calcutta, Block JD, Sector III, Salt Lake, Kolkata 700106 (India); Bandyopadhyay, Ayan [CRNN, University of Calcutta, Block JD, Sector III, Salt Lake, Kolkata 700106 (India); Sarkar, Debasish [Department of Condensed Matter Physics and Material Science, S. N. Bose National Centre for Basic Sciences, Block JD, Sector III, Salt Lake, Kolkata 700106 (India); Ahir, Manisha [CRNN, University of Calcutta, Block JD, Sector III, Salt Lake, Kolkata 700106 (India)

2016-11-01

Here we have discussed about designing the magnetic particles for hyperthermia therapy and done some studies in this direction. We have used oleylamine micelles as template to synthesize hollow–nanospheres (HNS) of magnetite by solvo-thermal technique. We have shown that oleylamine plays an important role to generate hollow particles. Structural analysis was done by XRD measurement and morphological measurements like SEM and TEM was performed to confirm the shape and size of hollow sphere particles. The detail magnetic measurements give an idea about the application of these HNS for magnetic heating in hyperthermia therapy. In vitro cytotoxicity studies reveal that tolerable dose rate for these particles can be significantly high and particles are non-toxic in nature. Being hollow in structure and magnetic in nature such materials will also be useful in other application fields like in drug delivery, drug release, arsenic and heavy metal removal by adsorption technique, magnetic separation etc. - Graphical abstract: Oleylamine micelles driven easy synthesis of hollow nanosphere (HNS) magnetite for hyperthermia therapy. - Highlights: • We have reported a new method of synthesis of hollow spheres of magnetite using micelles as model core and removal of micelles evolve the hollow like structure by relocating the core particles to the edge one. • Size can be controlled by varying the micellar concentration. • The detail magnetic measurements give an idea of applicability of these nano hollow spheres (NHS) in hyperthermia therapy. • Cyto-toxicity study reveals that these particles are highly biofriendly and dose rate can be increased upto a significant amount.

Surface induced ordering of micelles at the solid-liquid interface

International Nuclear Information System (INIS)

Gerstenberg, M.C.; Pedersen, J.S.; Smith, G.S.

1998-01-01

The surface induced ordering of triblock copolymer micelles in aqueous solution was measured with neutron reflectivity far above the critical micelle concentration. The scattering length density profiles showed a clear indication of ordered layers of micelles perpendicular to a quartz surface. The structure and interactions of the micelles were modeled in detail. The convolution of the center distribution of the micelles, obtained from Monte Carlo simulations of hard spheres at a hard wall, and the projected density of the micelle showed excellent agreement with the experimental profiles. copyright 1998 The American Physical Society

Surface induced ordering of micelles at the solid-liquid interface

DEFF Research Database (Denmark)

Gerstenberg, M.C.; Pedersen, J.S.; Smith, G.S.

1998-01-01

The surface induced ordering of triblock copolymer micelles in aqueous solution was measured with neutron reflectivity far above the critical micelle concentration. The scattering length density profiles showed a clear indication of ordered layers of micelles perpendicular to a quartz surface....... The structure and interactions of the micelles were modeled in detail. The convolution of the center distribution of the micelles, obtained from Monte Carlo simulations of hard spheres at a hard wall, and the projected density of the micelle showed excellent agreement with the experimental profiles. [S1063-651X...

ATM Protein Physically and Functionally Interacts with Proliferating Cell Nuclear Antigen to Regulate DNA Synthesis*

Science.gov (United States)

Gamper, Armin M.; Choi, Serah; Matsumoto, Yoshihiro; Banerjee, Dibyendu; Tomkinson, Alan E.; Bakkenist, Christopher J.

2012-01-01

Ataxia telangiectasia (A-T) is a pleiotropic disease, with a characteristic hypersensitivity to ionizing radiation that is caused by biallelic mutations in A-T mutated (ATM), a gene encoding a protein kinase critical for the induction of cellular responses to DNA damage, particularly to DNA double strand breaks. A long known characteristic of A-T cells is their ability to synthesize DNA even in the presence of ionizing radiation-induced DNA damage, a phenomenon termed radioresistant DNA synthesis. We previously reported that ATM kinase inhibition, but not ATM protein disruption, blocks sister chromatid exchange following DNA damage. We now show that ATM kinase inhibition, but not ATM protein disruption, also inhibits DNA synthesis. Investigating a potential physical interaction of ATM with the DNA replication machinery, we found that ATM co-precipitates with proliferating cell nuclear antigen (PCNA) from cellular extracts. Using bacterially purified ATM truncation mutants and in vitro translated PCNA, we showed that the interaction is direct and mediated by the C terminus of ATM. Indeed, a 20-amino acid region close to the kinase domain is sufficient for strong binding to PCNA. This binding is specific to ATM, because the homologous regions of other PIKK members, including the closely related kinase A-T and Rad3-related (ATR), did not bind PCNA. ATM was found to bind two regions in PCNA. To examine the functional significance of the interaction between ATM and PCNA, we tested the ability of ATM to stimulate DNA synthesis by DNA polymerase δ, which is implicated in both DNA replication and DNA repair processes. ATM was observed to stimulate DNA polymerase activity in a PCNA-dependent manner. PMID:22362778

Changes in the synthesis of DNA, RNA and protein during somatic embryogenesis in wheat (triticum aestivum L.)

International Nuclear Information System (INIS)

Cui Kairong; Wang Xiaozhe; Chen Xiong; Wang Yafu

1997-01-01

Embryogenic and non-embryogenic callus formed from immature embryo of wheat (Triticum aestivum L.) in N 6 B 5 MS medium I supplemented with 2,4-D 2 mg/L, KT 0.5 mg/L, LH300 mg/L, sucrose 3% were sub-cultured and transferred respectively to N 6 B 5 MS medium II (2,4-D was decreased to 0.5 mg/L and 4 mol/L proline was added). Somatic embryos obtained from embryogenic callus, and plantlet formed from non-embryogenic callus through organogenesis respectively. By incorporation of 3 H-thymidine, 3 H-uridine and 3 H-leucine into DNA, RNA and protein respectively, the rate of synthesis of DNA, RNA and protein during somatic embryogenesis were measured. A large amount of RNA and protein synthesized during the early somatic embryogenesis. The activities of RNA and protein synthesis reached the peak on the 4th and the 8th day respectively, then decreased a little, but kept a high level. The synthesis of DNA increased apparently during the early stage. No apparent change occurred when the embryogenic cell masses formed. The synthesis rate of RNA and protein in non-embryogenic callus were much less than that in embryogenic callus. Actinomycin and cycloheximide inhibited not only the synthesis of nucleic acid and protein, but also the growth of embryogenic callus and somatic embryogenesis. The earlier the inhibitors were added, the greater the influence was caused. The results indicate that the active expression of corresponding genes of wheat is the molecular base of somatic embryogenesis

Recombinant Amphiphilic Protein Micelles for Drug Delivery

OpenAIRE

Kim, Wookhyun; Xiao, Jiantao; Chaikof, Elliot L.

2011-01-01

Amphiphilic block polypeptides can self-assemble into a range of nanostructures in solution, including micelles and vesicles. Our group has recently described the capacity of recombinant amphiphilic diblock copolypeptides to form highly stable micelles. In this report, we demonstrate the utility of protein nanoparticles to serve as a vehicle for controlled drug delivery. Drug-loaded micelles were produced by encapsulating dipyridamole as a model hydrophobic drug with anti-inflammatory activit...

Inhibition and recovery of DNA synthesis in human cells after exposure to ultraviolet light

International Nuclear Information System (INIS)

Painter, R.B.

1985-01-01

The inhibition of DNA synthesis in normal human cells by UV is a complex function of fluence because it has several causes. At low fluences, inhibition of replicon initiation is most important. This is made clear by the fact that it occurs to a lesser degree in cells from patients with ataxia telangiectasia (AT). Assuming that only leading strand synthesis is blocked by UV-induced lesions, single lesions between replicons in parental strands for leading strand synthesis inhibit DNA synthesis by acting as temporary blocks until they are replicated by extension of the lagging strand of the adjacent replicon. A more severe inhibition occurs when two lesions are induced between adjacent growing replicons, because one in four possible configurations may result in a long-lived unreplicated region (LLUR). In the absence of excision repair, these may eventually be replicated by activation of an otherwise unused origin within the LLUR. The frequency of LLURs increases steeply with fluence. Activation of normally unused origins to replicate LLURs may facilitate recovery from inhibition of DNA synthesis, but repair of lesions is probably more important. In excision-repair-defective cells, an LLUR without an origin to initiate its replication may be a lethal lesion. (orig.)

Unexpected Hydration of a Triple Bond During DNA Synthesis

DEFF Research Database (Denmark)

Fatthalla, Maha I.; Pedersen, Erik B.

2016-01-01

acidic conditions, polarizes the triple bond in the intercalator and this makes hydration of the triple bond possible during the DNA synthesis and an oligonucleotide with 1-(indol-3-yl)-2-(pyren-1-yl)ethanone as the intercalator is formed. Insertion of the unhydrated and hydrated linker systems gave...

RAD52 Facilitates Mitotic DNA Synthesis Following Replication Stress

DEFF Research Database (Denmark)

Bhowmick, Rahul; Minocherhomji, Sheroy; Hickson, Ian D

2016-01-01

Homologous recombination (HR) is necessary to counteract DNA replication stress. Common fragile site (CFS) loci are particularly sensitive to replication stress and undergo pathological rearrangements in tumors. At these loci, replication stress frequently activates DNA repair synthesis in mitosis...... replication stress at CFS loci during S-phase. In contrast, MiDAS is RAD52 dependent, and RAD52 is required for the timely recruitment of MUS81 and POLD3 to CFSs in early mitosis. Our results provide further mechanistic insight into MiDAS and define a specific function for human RAD52. Furthermore, selective...

Characterization of Phospholipid Mixed Micelles by Translational Diffusion

International Nuclear Information System (INIS)

Chou, James J.; Baber, James L.; Bax, Ad

2004-01-01

The concentration dependence of the translational self diffusion rate, D s , has been measured for a range of micelle and mixed micelle systems. Use of bipolar gradient pulse pairs in the longitudinal eddy current delay experiment minimizes NOE attenuation and is found critical for optimizing sensitivity of the translational diffusion measurement of macromolecules and aggregates. For low volume fractions Φ (Φ ≤ 15% v/v) of the micelles, experimental measurement of the concentration dependence, combined with use of the D s =D o (1-3.2λΦ) relationship, yields the hydrodynamic volume. For proteins, the hydrodynamic volume, derived from D s at infinitely dilute concentration, is found to be about 2.6 times the unhydrated molecular volume. Using the data collected for hen egg white lysozyme as a reference, diffusion data for dihexanoyl phosphatidylcholine (DHPC) micelles indicate approximately 27 molecules per micelle, and a critical micelle concentration of 14 mM. Differences in translational diffusion rates for detergent and long chain phospholipids in mixed micelles are attributed to rapid exchange between free and micelle-bound detergent. This difference permits determination of the free detergent concentration, which, for a high detergent to long chain phospholipid molar ratio, is found to depend strongly on this ratio. The hydrodynamic volume of DHPC/POPC bicelles, loaded with an M2 channel peptide homolog, derived from translational diffusion, predicts a rotational correlation time that slightly exceeds the value obtained from peptide 15 N relaxation data

Swell Gels to Dumbbell Micelles: Construction of Materials and Nanostructure with Self-assembly

Science.gov (United States)

Pochan, Darrin

2007-03-01

Bionanotechnology, the emerging field of using biomolecular and biotechnological tools for nanostructure or nanotecnology development, provides exceptional opportunity in the design of new materials. Self-assembly of molecules is an attractive materials construction strategy due to its simplicity in application. By considering peptidic or charged synthetic polymer molecules in the bottom-up materials self-assembly design process, one can take advantage of inherently biomolecular attributes; intramolecular folding events, secondary structure, and electrostatic interactions; in addition to more traditional self-assembling molecular attributes such as amphiphilicty, to define hierarchical material structure and consequent properties. Several molecular systems will be discussed. Synthetic block copolymers with charged corona blocks can be assembled in dilute solution containing multivalent organic counterions to produce micelle structures such as toroids. These ring-like micelles are similar to the toroidal bundling of charged semiflexible biopolymers like DNA in the presence of multivalent counterions. Micelle structure can be tuned between toroids, cylinders, and disks simply by using different concentrations or molecular volumes of organic counterion. In addition, these charged blocks can consist of amino acids as monomers producing block copolypeptides. In addition to the above attributes, block copolypeptides provide the control of block secondary structure to further control self-assembly. Design strategies based on small (less than 24 amino acids) beta-hairpin peptides will be discussed. Self-assembly of the peptides is predicated on an intramolecular folding event caused by desired solution properties. Importantly, the intramolecular folding event impart a molecular-level mechanism for environmental responsiveness at the material level (e.g. infinite change in viscosity of a solution to a gel with changes in pH, ionic strength, temperature).

In situ electron-beam polymerization stabilized quantum dot micelles.

Science.gov (United States)

Travert-Branger, Nathalie; Dubois, Fabien; Renault, Jean-Philippe; Pin, Serge; Mahler, Benoit; Gravel, Edmond; Dubertret, Benoit; Doris, Eric

2011-04-19

A polymerizable amphiphile polymer containing PEG was synthesized and used to encapsulate quantum dots in micelles. The quantum dot micelles were then polymerized using a "clean" electron beam process that did not require any post-irradiation purification. Fluorescence spectroscopy revealed that the polymerized micelles provided an organic coating that preserved the quantum dot fluorescence better than nonpolymerized micelles, even under harsh conditions. © 2011 American Chemical Society

Distribution of ultraviolet-induced DNA repair synthesis in nuclease sensitive and resistant regions of human chromatin

International Nuclear Information System (INIS)

Smerdon, M.J.; Tlsty, T.D.; Lieberman, M.W.

1978-01-01

The distribution of ultraviolet radiation (uv) induced DNA repair synthesis within chromatin was examined in cultured human diploid fibroblasts (IMR-90). Measurement of the time course of repair synthesis yielded two distinct phases: An initial rapid phase (fast repair) which occurs during the first 2 to 3 h after damage and a slower phase (slow repair) associated with a tenfold decrease in the rate of nucleotide incorporation, which persists for at least 35 h after damage. Staphylococcal nuclease digests of nuclei from cells damaged with uv and labeled during the fast-repair phase revealed a marked preference of fast-repair synthesis for the nuclease-sensitive regions. A new method was developed to analyze the digestion data and showed that approximately 50% of the nucleotides incorporated during the fast-repair phase are located in staphylococcal nuclease-sensitive regions, which comprise about 30% of the genome. Calculations from these data indicate that in the staphylococcal nuclease-sensitive regions the number of newly inserted nucleotides per unit DNA is about twice that of resistant regions. These results were supported by electrophoresis studies which demonstrated a decreased representation of fast-repair synthesis in core particle DNA. In contrast, the distribution within chromatin of nucleotides incorporated during the slow-repair phase was found to be much more homogeneous with about 30% of the repair sites located in 25% of the genome. Digestion studieswith DNase I indicated a slight preference of repair synthesis for regions sensitive to this enzyme; however, no marked difference between the distributions of fast- and slow-repair synthesis was observed. This study provides evidence that the structural constraints placed upon DNA in chromatin also place constraints upon uv-induced DNA repair synthesis in human cells

Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

Science.gov (United States)

Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

2016-08-02

Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

Chiral halogenated Schiff base compounds: green synthesis, anticancer activity and DNA-binding study

Science.gov (United States)

Ariyaeifar, Mahnaz; Amiri Rudbari, Hadi; Sahihi, Mehdi; Kazemi, Zahra; Kajani, Abolghasem Abbasi; Zali-Boeini, Hassan; Kordestani, Nazanin; Bruno, Giuseppe; Gharaghani, Sajjad

2018-06-01

Eight enantiomerically pure halogenated Schiff base compounds were synthesized by reaction of halogenated salicylaldehydes with 3-Amino-1,2-propanediol (R or S) in water as green solvent at ambient temperature. All compounds were characterized by elemental analyses, NMR (1H and 13C), circular dichroism (CD) and FT-IR spectroscopy. FS-DNA binding studies of these compounds carried out by fluorescence quenching and UV-vis spectroscopy. The obtained results revealed that the ligands bind to DNA as: (Rsbnd ClBr) > (Rsbnd Cl2) > (Rsbnd Br2) > (Rsbnd I2) and (Ssbnd ClBr) > (Ssbnd Cl2) > (Ssbnd Br2) > (Ssbnd I2), indicating the effect of halogen on binding constant. In addition, DNA-binding constant of the Ssbnd and R-enantiomers are different from each other. The ligands can form halogen bonds with DNA that were confirmed by molecular docking. This method was also measured the bond distances and bond angles. The study of obtained data can have concluded that binding affinity of the ligands to DNA depends on strength of halogen bonds. The potential anticancer activity of ligands were also evaluated on MCF-7 and HeLa cancer cell lines by using MTT assay. The results showed that the anticancer activity and FS-DNA interaction is significantly dependent on the stereoisomers of Schiff base compounds as R-enantiomers displayed significantly higher activity than S-enantiomers. The molecular docking was also used to illustrate the specific DNA-binding of synthesized compounds and groove binding mode of DNA interaction was proposed for them. In addition, molecular docking results indicated that there are three types of bonds (Hsbnd and X-bond and hX-bond) between synthesized compounds and base pairs of DNA.

Intestinal DNA concentration and protein synthesis in response to ...

African Journals Online (AJOL)

Performance, protein synthesis and mucosal DNA in small intestine of Leghorn hens may be affected by low quality feedstuff. An experiment was conducted in completely randomized design (CRD) in 2 × 2 factorial arrangement. Main factors included diets containing 20 and 40 % barley and black and blue strains of leghorn ...

Synthesis of modified oligonucleotides that contain purine and pyrimidine radio-induced base lesions

International Nuclear Information System (INIS)

Romieu, Anthony

1999-01-01

Different factors as oxidizing or carcinogenesis agents, UV and ionizing radiations,.... can generate a wide, spectrum of DNA base damages. In order to study the biochemical and structural features of these DNA damages, it is important to prepare short DNA fragments (20 to 50 bases long) bearing a single or several modifications at specific sites in their sequences. The chemical synthesis is a powerful tool to prepare such modified DNA fragments. This work focusses on the chemical incorporation of several modified nucleosides formed in DNA by ionizing radiations or by photo-sensitization. The first part of this study describes the preparation of a phosphoramidite synthon of 5-hydroxy-2'-deoxyuridine and its subsequent incorporation into synthetic oligonucleotides ranging from 14 to 33 bases long. In a second part (chapters Ill and IV), the synthesis and incorporation of original radiation-induced tandem lesions: the carbon-bridged cyclo-nucleosides are presented. Both (5'R)- and (5'S) diastereomers of 5',8-cyclo-2'-deoxyadenosine and 5',8-cyclo-2'-deoxyguanosine have been individually inserted into various different oligonucleotides (3 to 22 bases long) by using the standard phosphoramidite chemistry. The chemical incorporation of a pyrimidine analogue: (5'S, 6S)-5',6-cyclo-5,6-dihydro-thymidine has been also achieved. The loss of aromaticity of this modified nucleoside and its poor reactivity required the development of a synthetic strategy entirely different from that used for the preparation and subsequent incorporation of the phosphoramidite synthons of 5',8-cyclo-purine-2'-deoxyribo-nucleosides. The third part of this study deals with the synthesis of a phosphoramidite synthon of 4-hydroxy-8-oxo-4,8-dihydro-2'-deoxyguanosine. The two (4R)- and (4S)- diastereomers of this oxidized purine have been separated and individually inserted in several synthetic DNA fragments. No epimerization of C-4 position was observed during the solid-phase synthesis and during the

New Strategies for Constructing Polymeric Micelles and Hollow Spheres Via Self-Assembly

Institute of Scientific and Technical Information of China (English)

Ming Jiang

2005-01-01

@@ 1Introduction In recent years, self-assembly of block copolymers leading to micelles in selective solvents, which dissolve only one of the blocks, has developed rapidly because the micelles are very strong candidates for potential applications in advanced technologies. The micelles usually have core-shell structure which are connected by covalent bonds. Based on our long-term research on interpolymer complexation due to hydrogen bonding, where we noticed that the complexation often led to the formation of irregular aggregates, we succeeded recently in developing a series of new approaches to polymeric micelles and hollow spheres via specific intermolecular interactions. As in these approaches, a variety of polymers with interacting groups i.e. homopolymers, random copolymers, graft copolymers as well as low mass compounds (LMC), can be used as building blocks, our research strategies have substantially extended the field of self-assembly.

Structure and reactivity in amphiphile-water micelles

International Nuclear Information System (INIS)

Chevalier, Yves

1985-01-01

Following a review of the general properties of micelles, this report contains two parts: - A structural study of octylphosphate micelles. Important structural changes have been evidenced by mean of small angle neutron scattering as the electrical charge of the interface is varied. The NMR relaxation study of the conformation of the hydrocarbon chains has shown that the micellar core is disordered in contrast with the interface which is rather structured. The diffusion motions in the interface and the segmental motions of the chains are fast. - Studies on the reactivity in micelles have been carried out. A large micellar effect on the complexation of transition ions by amphiphilic ligands is evidenced. The problem of solute localization in micelles is developed with few examples. (author) [fr

Glucose-installed, SPIO-loaded PEG- b-PCL micelles as MR contrast agents to target prostate cancer cells

Science.gov (United States)

Theerasilp, Man; Sunintaboon, Panya; Sungkarat, Witaya; Nasongkla, Norased

2017-11-01

Polymeric micelles of poly(ethylene glycol)- block-poly(ɛ-caprolactone) bearing glucose analog encapsulated with superparamagnetic iron oxide nanoparticles (Glu-SPIO micelles) were synthesized as an MRI contrast agent to target cancer cells based on high-glucose metabolism. Compared to SPIO micelles (non-targeting SPIO micelles), Glu-SPIO micelles demonstrated higher toxicity to human prostate cancer cell lines (PC-3) at high concentration. Atomic absorption spectroscopy was used to determine the amount of iron in cells. It was found that the iron in cancer cells treated by Glu-SPIO micelles were 27-fold higher than cancer cells treated by SPIO micelles at the iron concentration of 25 ppm and fivefold at the iron concentration of 100 ppm. To implement Glu-SPIO micelles as a MR contrast agent, the 3-T clinical MRI was applied to determine transverse relaxivities ( r 2*) and relaxation rate (1/ T 2*) values. In vitro MRI showed different MRI signal from cancer cells after cellular uptake of SPIO micelles and Glu-SPIO micelles. Glu-SPIO micelles was highly sensitive with the r 2* in agarose gel at 155 mM-1 s-1. Moreover, the higher 1/ T 2* value was found for cancer cells treated with Glu-SPIO micelles. These results supported that glucose ligand increased the cellular uptake of micelles by PC-3 cells with over-expressing glucose transporter on the cell membrane. Thus, glucose can be used as a small molecule ligand for targeting prostate cancer cells overexpressing glucose transporter.

The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.

Science.gov (United States)

Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong

2016-05-17

Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

Chromatin Controls DNA Replication Origin Selection, Lagging-Strand Synthesis, and Replication Fork Rates.

Science.gov (United States)

Kurat, Christoph F; Yeeles, Joseph T P; Patel, Harshil; Early, Anne; Diffley, John F X

2017-01-05

The integrity of eukaryotic genomes requires rapid and regulated chromatin replication. How this is accomplished is still poorly understood. Using purified yeast replication proteins and fully chromatinized templates, we have reconstituted this process in vitro. We show that chromatin enforces DNA replication origin specificity by preventing non-specific MCM helicase loading. Helicase activation occurs efficiently in the context of chromatin, but subsequent replisome progression requires the histone chaperone FACT (facilitates chromatin transcription). The FACT-associated Nhp6 protein, the nucleosome remodelers INO80 or ISW1A, and the lysine acetyltransferases Gcn5 and Esa1 each contribute separately to maximum DNA synthesis rates. Chromatin promotes the regular priming of lagging-strand DNA synthesis by facilitating DNA polymerase α function at replication forks. Finally, nucleosomes disrupted during replication are efficiently re-assembled into regular arrays on nascent DNA. Our work defines the minimum requirements for chromatin replication in vitro and shows how multiple chromatin factors might modulate replication fork rates in vivo. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Pluronic-based micelle encapsulation potentiates myricetin-induced cytotoxicity in human glioblastoma cells

Directory of Open Access Journals (Sweden)

Tang XJ

2016-10-01

Full Text Available Xiang-Jun Tang,1,* Kuan-Ming Huang,1,* Hui Gui,1,* Jun-Jie Wang,2 Jun-Ti Lu,1 Long-Jun Dai,1,3 Li Zhang,1 Gang Wang2 1Department of Neurosurgery, TaiHe Hospital, Hubei University of Medicine, Shiyan, 2Department of Pharmaceutics, Shanghai Eighth People’s Hospital, Jiangsu University, Shanghai, People’s Republic of China; 3Department of Surgery, University of British Columbia, Vancouver, BC, Canada *These authors contributed equally to this work Abstract: As one of the natural herbal flavonoids, myricetin has attracted much research interest, mainly owing to its remarkable anticancer properties and negligible side effects. It holds great potential to be developed as an ideal anticancer drug through improving its bioavailability. This study was performed to investigate the effects of Pluronic-based micelle encapsulation on myricetin-induced cytotoxicity and the mechanisms underlying its anticancer properties in human glioblastoma cells. Cell viability was assessed using a methylthiazol tetrazolium assay and a real-time cell analyzer. Immunoblotting and quantitative reverse transcriptase polymerase chain reaction techniques were used for determining the expression levels of related molecules in protein and mRNA. The results indicated that myricetin-induced cytotoxicity was highly potentiated by the encapsulation of myricetin. Mitochondrial apoptotic pathway was demonstrated to be involved in myricetin-induced glioblastoma cell death. The epidermal growth factor receptor (EGFR/PI3K/Akt pathway located in the plasma membrane and cytosol and the RAS-ERK pathway located in mitochondria served as upstream and downstream targets, respectively, in myricetin-induced apoptosis. MiR-21 inhibitors interrupted the expression of EGFR, p-Akt, and K-Ras in the same fashion as myricetin-loaded mixed micelles (MYR-MCs and miR-21 expression were dose-dependently inhibited by MYR-MCs, indicating the interaction of miR-21 with MYR-MCs. This study provided evidence

Action of caffeine on x-irradiated HeLa cells. I. Delayed inhibition of DNA synthesis

International Nuclear Information System (INIS)

Tolmach, L.J.; Jones, R.W.; Busse, P.M.

1977-01-01

Treatment of HeLa S3 cells with 1 mM caffeine delays progression through G1 by 1.5 hours but causes no other detectable inhibition of cell progression; it sometimes results in a large stimulation of thymidine incorporation. When this concentration is applied to cells that have been irradiated with 1-krad doses of 220-kV x rays, there is a marked suppression of both the inhibition of DNA synthesis and G2 arrest induced by the radiation. Larger doses require higher concentrations of caffeine to suppress the inhibition of DNA synthesis. Delaying addition until the rate of synthesis is at its minimum (1.5 hours after irradiation with 1 krad) results in a slightly accelerated recovery of the rate. Treatment before or during irradiation is without effect on the inhibition. Removal of the caffeine as late as 6 hours after its addition at the time of irradiation results in a prompt inhibition in DNA synthesis that mimics that observed immediately after irradiation in the absence of caffeine. These findings raise the possibility that the depression in rate of DNA systhesis might not result from radiation damage introduced into the replicon initiation system, but rather may be an indirect consequence of damage residing elsewhere in the irradiated cell

A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor.

Science.gov (United States)

Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

2015-11-09

A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis.

Titration calorimetry of surfactant–drug interactions: Micelle formation and saturation studies

International Nuclear Information System (INIS)

Waters, Laura J.; Hussain, Talib; Parkes, Gareth M.B.

2012-01-01

Highlights: ► Isothermal titration calorimetry can be used to monitor the saturation of micelles with pharmaceutical compounds. ► The number of drug molecules per micelle varies depending on the drug used and the temperature of the calorimeter. ► The change in enthalpy for the saturation of micelles with drugs can be endothermic or exothermic. ► The critical micellar concentration of an anionic surfactant (SDS) does not appear to vary in the presence of drugs. - Abstract: Isothermal titration calorimetry (ITC) was employed to monitor the addition of five model drugs to anionic surfactant based micelles, composed of sodium dodecyl sulfate (SDS), through to the point at which they were saturated with drug. Analysis of the resultant data using this newly developed method has confirmed the suitability of the technique to acquire such data with saturation limits established in all cases. Values for the point at which saturation occurred ranged from 17 molecules of theophylline per micelle at T = 298 K up to 63 molecules of caffeine per micelle at 310 K. Micellar systems can be disrupted by the presence of additional chemicals, such as the drugs used in this study, therefore a separate investigation was undertaken to determine the critical micellar concentration (CMC) for SDS in the presence of each drug at T = 298 K and 310 K using ITC. In the majority of cases, there was no appreciable alteration to the CMC of SDS with drug present.

Glutathione-responsive core cross-linked micelles for controlled cabazitaxel delivery

Science.gov (United States)

Han, Xiaoxiong; Gong, Feirong; Sun, Jing; Li, Yueqi; Liu, XiaoFei; Chen, Dan; Liu, Jianwen; Shen, Yaling

2018-02-01

Stimulus-responsive polymeric micelles (PMs) have recently received attention due to the controlled delivery of drug or gene for application in cancer diagnosis and treatment. In this work, novel glutathione-responsive PMs were prepared to encapsulate hydrophobic antineoplastic drug, cabazitaxel (CTX), to improve its solubility and toxicity. These CTX-loaded micelles core cross-linked by disulfide bonds (DCL-CTX micelles) were prepared by a novel copolymer, lipoic acid grafted mPEG-PLA. These micelles had regular spherical shape, homogeneous diameter of 18.97 ± 0.23 nm, and a narrow size distribution. The DCL-CTX micelles showed high encapsulation efficiency of 98.65 ± 1.77%, and the aqueous solubility of CTX was improved by a factor of 1:1200. In vitro release investigation showed that DCL-CTX micelles were stable in the medium without glutathione (GSH), whereas the micelles had burst CTX release in the medium with 10 mM GSH. Cell uptake results implied that DCL-CTX micelles were internalized into MCF-7 cells through clathrin-mediated endocytosis and released cargo more effectively than Jevtana (commercially available CTX) owing to GSH-stimulated degradation. In MTT assay against MCF-7 cells, these micelles inhibited tumor cell proliferation more effectively than Jevtana due to their GSH-responsive CTX release. All results revealed the potency of GSH-responsive DCL-CTX micelles for stable delivery in blood circulation and for intracellular GSH-trigged release of CTX. Therefore, DCL-CTX micelles show potential as safe and effective CTX delivery carriers and as a cancer chemotherapy formulation.

DNA synthesis in periportal and perivenous hepatocytes of intact and hepatectomized young mice.

Science.gov (United States)

Fernández-Blanco, A; Inda, A M; Errecalde, A L

2015-01-01

DNA synthesis of hepatocytes in two areas of Intact and Hepatectomized young mice liver along a circadian period was studied. DNA synthesis was significantly different at all analyzed time points in Intact and Hepatectomized animals. Differences between periportal and perivenous hepatocytes were found in hepatectomized animals at 04/42 and 08/46 hr of day/hour post-hepatectomy. DNAs peak in periportal hepatocytes regenerating liver occurs 4 hr earlier than in perivenous hepatocytes, probably reflecting their shorter G1 phase. Besides, daily mean values of regenerating livers were higher than those observed in Intact animals, as a consequence of surgical removal.

Bypass of a 5',8-cyclopurine-2'-deoxynucleoside by DNA polymerase β during DNA replication and base excision repair leads to nucleotide misinsertions and DNA strand breaks.

Science.gov (United States)

Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E; Terzidis, Michael A; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan

2015-09-01

5',8-Cyclopurine-2'-deoxynucleosides including 5',8-cyclo-dA (cdA) and 5',8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5',8-cyclopurine-2'-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5'R-cdA, but inefficiently bypassed a 5'S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5',8-cyclopurine-2'-deoxynucleoside. Moreover, we found that bypass of a 5'S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5',8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion. Copyright © 2015 Elsevier B.V. All rights reserved.

In vitro evaluation of antioxidant and neuroprotective effects of curcumin loaded in Pluronic micelles

Directory of Open Access Journals (Sweden)

Cvetelina Gorinova

2016-09-01

Full Text Available Curcumin is a polyphenolic substance with attractive pharmacological activities (e.g. antioxidant, anti-inflammatory, anticancer. Incorporation of curcumin in polymeric micelles could overcome the problems associated with its instability and low aqueous solubility. The aim of this study was to load curcumin in polymeric micelles based on Pluronic® P 123 or Pluronic® F 127 triblock copolymers and evaluate the antioxidant and neuroprotective effects after micellization. The micelles were prepared and loaded with curcumin by applying the dissolution method. Higher encapsulation efficiency was observed in the micelles formulated with Pluronic® P 123. These micelles were characterized with small size and narrow size distribution. The effects of micellar curcumin were investigated in two in vitro models. First, the capacity of micellar curcumin to inhibit iron/ascorbic acid-induced lipid peroxidation in rat liver microsomes was evaluated. Micellar curcumin and free drug showed similar inhibition of lipid peroxidation. Second, micellar curcumin and free curcumin showed protective potential in a model of 6-hydroxydopamine induced neurotoxicity in rat brain synaptosomes. The results from both methods indicated preservation of antioxidant and neuroprotective activity of curcumin in micelles. The small micellar size, high loading capacity and preservation of antioxidant activity of curcumin into Pluronic micelles, suggested their further evaluation as a curcumin delivery system.

Recovery of DNA synthesis from inhibition by ultraviolet light in mammalian cells

Energy Technology Data Exchange (ETDEWEB)

Ventura, A M; Ortega, J M; Schumacher, R I; Meneghini, R

1987-01-01

In general mammalian cells recover from DNA synthesis inhibition by ultraviolet light (u.v.) before most of the pyrimidine dimers have been removed from the genome. Using metabolic inhibitors, it has been shown that (1) even the low repair rate exhibited by V79 cells is important for recovery; although most of the dimers remain in the V79 genome after recovery of DNA synthesis, either the removal of lesions from some important region of chromatin or the activity of the repair process itself is important for the recovery; (2) the recovery mechanism is induced and depends on RNA synthesis and the production of specific factors. Finally, we have observed that cells previously treated with fluorodeoxyuridine become more resistant to inhibition by u.v. Since it has been shown that this drug activates unused origins of replication in Chinese hamster cells, reducing the average replicon size, we assume that the acquired resistance has to do with the operation of a larger number of small replicons.

Fundamental study of the radiation monitoring system based on evaluation of DNA lesions

International Nuclear Information System (INIS)

Shimizu, K.; Matuo, Y.; Izumi, Y.; Ikeda, T.

2011-01-01

The biological dosemeter that measures biological responses to ionising radiation is useful for radiation protection. This paper presents the development and characterisation of a gamma ray irradiation dosimetry system based on real-time PCR (polymerase chain reaction) methodology. Real-time PCR is used to amplify and simultaneously quantify a targeted DNA molecule. If there are no limitations due to limiting substrates or reagents, at each extension step, the amount of DNA target is doubled, leading to exponential (geometric) amplification of the specific DNA fragment. The essential point of this assay is that DNA lesions caused by ionising radiation block DNA synthesis by DNA polymerase, resulting in a decrease in the amplification of a damaged DNA template compared with that of non-damaged DNA templates. (authors)

Reverse micelle-based water-soluble nanoparticles for simultaneous bioimaging and drug delivery.

Science.gov (United States)

Chen, Ying; Liu, Yong; Yao, Yongchao; Zhang, Shiyong; Gu, Zhongwei

2017-04-11

With special confined water pools, reverse micelles (RMs) have shown potential for a wide range of applications. However, the inherent water-insolubility of RMs hinders their further application prospects, especially for applications related to biology. We recently reported the first successful transfer of RMs from organic media to an aqueous phase without changing the smart water pools by the hydrolysis of an arm-cleavable interfacial cross-linked reverse micelles. Herein, we employed another elaborate amphiphile 1 to construct new acrylamide-based cross-linked water-soluble nanoparticles (ACW-NPs) under much gentler conditions. The special property of the water pools of the ACW-NPs was confirmed by both the Förster resonance energy transfer (FRET) between 5-((2-aminoethyl)amino)naphthalene-1-sulfonic acid (1,5-EDANS) and benzoic acid, 4-[2-[4-(dimethylamino)phenyl]diazenyl] (DABCYL) and satisfactory colloidal stability in 10% fetal bovine serum. Importantly, featured by the gentle synthetic strategy, confined water pool, and carboxylic acid-functionalized surface, the new ACW-NPs are well suitable for biological applications. As an example, the fluorescent reagent 8-hydroxy-1,3,6-pyrenetrisulfonic acid trisodium salt (HPTS) was encapsulated in the core and simultaneously, the anticancer drug gemcitabine (Gem) was covalently conjugated onto the surface exterior. As expected, the resulting multifunctional ACW-NPs@HPTS@Gem exhibits a high imaging effect and anticancer activity for non-small lung cancer cells.

Sister chromatid exchanges in X-ray irradiated blood lymphocytes from patients with hereditary diseases with radioresistant DNA synthesis

International Nuclear Information System (INIS)

Pleskach, N.M.; Andriadze, M.I.; Mikhel'son, V.M.; Zhestyanikov, V.D.

1988-01-01

X-ray irradiation induced sister chromatid exchanges (SCE) in blood lymphocytes from patient with Down's syndrome and adult progeria (in both the cases radioresistant DNA synthesis takes place). In normal lymphocytes (in which ionizing radiation inhibits the replicative synthesis of DNA) the rate of SCE rises with the rise of radiation dose. Thus, the rate of SCE in X-ray irradiated lymphocytes is in reverse dependence with radioresistance of replicative synthesis of DNA. The data obtained are explained in accordance with the replicative hypothesis of the SCE nature (Painter, 1980a): in cells of patients with Down's syndrome, xeroderma pigmentosum from 2 and progeria of adults the time of existence of partly replicated clusters of replicons is decreased due to radioresistant replicative synthesis of DNA, but the presence of partly replicated clusters of replicons in necessary for SCE formation. Therefore the rate of SCF in X-irradiated cells of these patients decreases

A treatise on benzimidazole based Schiff base metal(II) complexes accentuating their biological efficacy: Spectroscopic evaluation of DNA interactions, DNA cleavage and antimicrobial screening

Energy Technology Data Exchange (ETDEWEB)

Kumaravel, Ganesan; Raman, Natarajan, E-mail: ramchem1964@gmail.com

2017-01-01

Two novel imidazole derived Schiff bases, (Z)-1-(1H-benzo[d]imidazol-2-yl)-N-benzylidenemethanamine (L{sup 1}) and 1-(1H-benzo[d]imidazol-2-yl)-N-(4-nitrobenzylidene) methanamine, and a series of their transition metal complexes of the types [M(L{sup 1}){sub 2}]Cl{sub 2} and [M(L{sup 2}){sub 2}]Cl{sub 2} where, M = Cu(II), Ni(II), Co(II) and Zn(II) have been designed and synthesized. These compounds were characterized by various spectral and physicochemical data. UV–Vis, magnetic susceptibility and molar conductivity data indicate that all the complexes adopt square planar geometry. The EPR spectral data of the Cu(II) complexes have provided supportive evidence to the conclusion derived on the basis of electronic absorption and magnetic moment values. Moreover, the interaction of complexes with DNA via intercalation has been explored by absorption, fluorescence spectroscopy, cyclic voltammetry, viscosity and circular dichroism. Agarose gel electrophoresis technique reveals that the complexes are good metallonucleases. All the compounds have relatively high antibacterial and antifungal potencies. Among the metal complexes, Cu(II) complexes exhibit higher efficacy against all the pathogens. - Highlights: • Synthesis of new and efficient benzimidazole based DNA targeting complexes • Synthesis of efficient metallointercalators • Excellent DNA exploiting ability of Cu(II) complexes • Efficient antimicrobial agents against various pathogens.

Influence of metronidazole on the survival rate of whole-body irradiated mice and on the DNA repair synthesis of lymphocytes

International Nuclear Information System (INIS)

Magdon, E.; Schroeder, E.

1978-01-01

With reference to literature reports the effect of Metronidazole [1-(hydroxyethyl)-5-nitro-2-methyl-imidazole] on the survival rate of C 3 H inbred mice following whole-body doses ranging from 5 to 15 Gy was determined under oxic and hypoxic conditions. Ehrlich ascites tumor cells were used to study the influence of Metronidazole on radiation-induced alterations of the DNA sedimentation behavior in the alkaline sucrose gradient under oxic conditions in vitro. The effect of Metronidazole on the semiconservative DNA synthesis was investigated under oxic and hypoxic conditions in Ehrlich ascites carcinoma cells and L5178Y lymphoma cells. Furthermore, it was examined whether the radiation-induced inhibition of semiconservative DNA synthesis in L5178Y lymphoma cells and the radiation-induced repair synthesis in lymphocytes is influenced by Metronidazole. From the values of the LDsub(50/30) after whole-body irradiation a sensitilization factor of 1.3 was derived for Metronidazole under hypoxic conditions. Under atmospheric conditions an increase of the radiation effect by a factor of 1.1 was obtained. The protective factor of hypoxia was 1.6 and thus greater than the radiosensibilization caused by Metronidazole. The DNA synthesis was slightly inhibited by Metronidazole under both hypoxic and euoxic conditions. The studies revealed no significant influence of Metronidazole on radiation-induced changes of the DNA sedimentation behavior and of the DNA repair synthesis as well as on the radiation induced inhibition of semiconservative DNA synthesis. (author)

Reduction-sensitive micelles self-assembled from amphiphilic chondroitin sulfate A-deoxycholic acid conjugate for triggered release of doxorubicin.

Science.gov (United States)

Liu, Hongxia; Wu, Shuqin; Yu, Jingmou; Fan, Dun; Ren, Jin; Zhang, Lei; Zhao, Jianguo

2017-06-01

Reduction-sensitive chondroitin sulfate A (CSA)-based micelles were developed. CSA was conjugated with deoxycholic acid (DOCA) via a disulfide linkage. The bioreducible conjugate (CSA-ss-DOCA) can form self-assembled micelles in aqueous medium. The critical micelle concentration (CMC) of CSA-ss-DOCA conjugate is 0.047mg/mL, and its mean diameter is 387nm. The anticancer drug doxorubicin (DOX) was chosen as a model drug, and was effectively encapsulated into the micelles with high loading efficiency. Reduction-sensitive micelles and reduction-insensitive control micelles displayed similar DOX release behavior in phosphate buffered saline (PBS, pH7.4). Notably, DOX release from the reduction-sensitive micelles in vitro was accelerated in the presence of 20mM glutathione-containing PBS environment. Moreover, DOX-loaded CSA-ss-DOCA (CSA-ss-DOCA/DOX) micelles exhibited intracellular reduction-responsive characteristics in human gastric cancer HGC-27 cells determined by confocal laser scanning microscopy (CLSM). Furthermore, CSA-ss-DOCA/DOX micelles demonstrated higher antitumor efficacy than reduction-insensitive control micelles in HGC-27 cells. These results suggested that reduction-sensitive CSA-ss-DOCA micelles had the potential as intracellular targeted carriers of anticancer drugs. Copyright © 2017 Elsevier B.V. All rights reserved.

Recovery from DNA synthesis in V 79 chinese hamster cells irradiated with UV light

International Nuclear Information System (INIS)

Ventura, A.M.

1987-01-01

Mammalian cells recover from DNA synthesis inhibition by UV light before most of the pyrimidine dimers have been removed from the genome. Most of the rodent cells show a deficient dimer excision repair compared with normal human fibroblasts. Despite this fact they recover efficiently from DNA synthesis inhibition after UV. In Chinese hamster V 79 cells was found that this recovery takes place in the absence of a significant excision repair, and it seems to be directly coupled to a recovery in the rate of movement of the replication fork. 120 refs, 31 figs. (author)

Micelles As Delivery System for Cancer Treatment.

Science.gov (United States)

Keskin, Dilek; Tezcaner, Aysen

2017-01-01

Micelles are nanoparticles formed by the self-assembly of amphiphilic block copolymers in certain solvents above concentrations called critical micelle concentration (CMC). Micelles are used in different fields like food, cosmetics, medicine, etc. These nanosized delivery systems are under spotlight in the recent years with new achievements in terms of their in vivo stability, ability to protect entrapped drug, release kinetics, ease of cellular penetration and thereby increased therapeutic efficacy. Drug loaded micelles can be prepared by dialysis, oil-in-water method, solid dispersion, freezing, spray drying, etc. The aim of this review is to give an overview of the research on micelles (in vitro, in vivo and clinical) as delivery system for cancer treatment. Passive targeting is one route for accumulation of nanosized micellar drug formulations. Many research groups from both academia and industry focus on developing new strategies for improving the therapeutic efficacy of micellar systems (active targeting to the tumor site, designing multidrug delivery systems for overcoming multidrug resistance or micelles formed by prodrug conjugates, etc). There is only one micellar drug formulation in South Korea that has reached clinical practice. However, there are many untargeted anticancer drug loaded micellar formulations in clinical trials, which have potential for use in clinics. Many more products are expected to be on the market in the near future. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Structural properties of self-assembled polymeric micelles

DEFF Research Database (Denmark)

Mortensen, K.

1998-01-01

At present, the thermodynamic understanding of complex copolymer systems is undergoing important developments. Block copolymers aggregate in selective solvents into micelles of various form and size depending on molecular architecture and interaction parameters. The micelles constitute the basis ...

Inhibition and recovery of the rate of DNA synthesis in V79 Chinese hamster cells following ultraviolet light irradiation

International Nuclear Information System (INIS)

Ventura, A.M.; Meneghini, R.

1984-01-01

Chinese hamster fibroblasts (V79 cell line) exhibit the phenomenon of recovery of DNA synthesis from the initial inhibition observed after ultraviolet light irradiation, in the absence of significant excision of pyrimidine dimers. In an attempt to determine whether the initial inhibition and subsequent recovery can be accounted for by parallel variations in the rate of movement of the replication fork, the cells were pulse-labeled with radioactive bromodeoxyuridine at different times following irradiation and their DNA centrifuged in neutral CsCl density gradients. When DNA synthesis inhibition was at a maximum, an accumulation of DNA, of density intermediate between hybrid and nonsubstituted DNA, was noticed in the density-distribution profiles. The density distribution of DNA along the gradient can provide an estimate of the rate of movement of the replication fork, and the results indicate that most of the variation in the overall rate of DNA synthesis can be accounted for by a parallel variation in the rate of fork movement. (Auth.)

Hydrolytic Degradation of Poly (ethylene oxide)-block-Polycaprolactone Worm Micelles

OpenAIRE

Geng, Yan; Discher, Dennis E.

2005-01-01

Spherical micelles and nanoparticles made with degradable polymers have been of great interest for therapeutic application, but degradation induced changes in a spherical morphology can be subtle and mechanism/kinetics appears poorly understood. Here, we report the first preparation of giant and flexible worm micelles self-assembled from degradable copolymer poly (ethylene oxide)-block-polycaprolactone. Such worm micelles spontaneously shorten to generate spherical micelles, triggered by poly...

Photophysical properties of pyronin dyes in reverse micelles of AOT

Energy Technology Data Exchange (ETDEWEB)

Bayraktutan, Tuğba; Meral, Kadem; Onganer, Yavuz, E-mail: yonganer@atauni.edu.tr

2014-01-15

The photophysical properties of pyronin B (PyB) and pyronin Y (PyY) in reverse micelles formed with water/sodium bis (2-ethyl-1-hexyl) sulfosuccinate (AOT)/n-heptane were investigated by UV–vis absorption, steady-state and time-resolved fluorescence spectroscopy techniques. This study was carried out a wide range of reverse micelle sizes, with hydrodynamic radii ranging from 1.85 to 9.38 nm. Significant photophysical parameters as band shifts, fluorescence quantum yields and fluorescence lifetimes were determined to understand how photophysical and spectroscopic features of the dye compounds were affected by the variation of reverse micelle sizes. In this regard, control of reverse micelle size by changing W{sub 0}, the molar ratio of water to surfactant, allowed tuning the photophysical properties of the dyes in organic solvent via reverse micelle. Non-fluorescent H-aggregates of pyronin dyes were observed for the smaller reverse micelles whereas an increase in the reverse micelle size induced an increment in the amount of dye monomers instead of dye aggregates. Thus, the fluorescence intensities of the dyes were improved by increasing W{sub 0} due to the predomination of the fluorescent dye monomers. As a result, the fluorescence quantum yields also increased. The fluorescence lifetimes of the dyes in the reverse micelles were determined by the time-resolved fluorescence decay studies. Evaluation of the fluorescence lifetimes calculated for pyronin dyes in the reverse micelles showed that the size of reverse micelle affected the fluorescence lifetimes of pyronin dyes. -- Highlights: • The photophysical properties of pyronin dyes were examined by spectroscopic techniques. • Optical properties of the dyes were tuned by changing of W{sub 0} values. • The fluorescence lifetime and quantum yield values of the dyes in reverse micelles were discussed.

Photoenhanced gene transfection by a curcumin loaded CS-g-PZLL micelle.

Science.gov (United States)

Lin, Jian-Tao; Pan, Wen-Jia; Zhang, Jun-Ai; Wang, Wei; Zhong, Jia; Su, Jia-Min; Li, Tong; Zou, Ying; Wang, Guan-Hai

2017-09-01

The codelivery of drug and gene is a promising method for cancer treatment. In our previous works, we prepared a cationic micelles based on chitosan and poly-(N-3-carbobenzyloxylysine) (CS-g-PZLL), but transfection ratio of CS-g-PZLL to Hela cell was low. Herein, to improve the transfection efficiency of CS-g-PZLL, curcumin was loaded in the CS-g-PZLL micelle. After irradiation, the obtained curcumin loaded micelle showed a better transfection, and the p53 protein expression in Hela cells was higher. The apoptosis assay showed that the complex could induce a more significant apoptosis to Hela cells than that of curcumin or p53 used alone, and the curcumin loaded micelle inducing apoptosis was best after irradiation. Therefore, CS-g-PZLL is a safe and effective carrier for the codelivery of drug/gene, and curcumin could be used as a photosensitizer to induce a photoenhanced gene transfection, which should be encouraged in improving transfection and tumor therapy. Copyright © 2017. Published by Elsevier B.V.

Dynamic changes of peripheral blood T-lymphocyte DNA-Synthesis in rabbits after fractionated and single exposure to 60Co-γ rays

International Nuclear Information System (INIS)

Wang Zongwu; Chen Tiehe; Yu Zhijie; Han Ling; Pan Yusha; Su Fuqiang

1988-01-01

The experiments in 59 rabbits γ-irradiated with doses of 0, 0.5, 1.0, 2.0, and 3.0 Gy in fractional and single exposure to 60 Co-γ rays were reported, respectively · Dynamics of the changes of DNA-Synthesis in T-lymphocytes of peripheral blood was obserced during 29 days after γ-irradiation. Marked inhibition in DNA-synthesis was found on 1st day after irradiation. Recovery was observed in 3rd day after irradiation. The levels of DNA-synthesis before irradiation was recovered on 7th day after exposure for all groups. For fractionated irradiation, however, an increase, rather than a decrese, of DNA-synthesis was in the group of 1.0 Gy

Two distinct modes of RecA action are required for DNA polymerase V-catalyzed translesion synthesis.

Science.gov (United States)

Pham, Phuong; Seitz, Erica M; Saveliev, Sergei; Shen, Xuan; Woodgate, Roger; Cox, Michael M; Goodman, Myron F

2002-08-20

SOS mutagenesis in Escherichia coli requires DNA polymerase V (pol V) and RecA protein to copy damaged DNA templates. Here we show that two distinct biochemical modes for RecA protein are necessary for pol V-catalyzed translesion synthesis. One RecA mode is characterized by a strong stimulation in nucleotide incorporation either directly opposite a lesion or at undamaged template sites, but by the absence of lesion bypass. A separate RecA mode is necessary for translesion synthesis. The RecA1730 mutant protein, which was identified on the basis of its inability to promote pol V (UmuD'(2)C)-dependent UV-mutagenesis, appears proficient for the first mode of RecA action but is deficient in the second mode. Data are presented suggesting that the two RecA modes are "nonfilamentous". That is, contrary to current models for SOS mutagenesis, formation of a RecA nucleoprotein filament may not be required for copying damaged DNA templates. Instead, SOS mutagenesis occurs when pol V interacts with two RecA molecules, first at a 3' primer end, upstream of a template lesion, where RecA mode 1 stimulates pol V activity, and subsequently at a site immediately downstream of the lesion, where RecA mode 2 cocatalyzes lesion bypass. We posit that in vivo assembly of a RecA nucleoprotein filament may be required principally to target pol V to a site of DNA damage and to stabilize the pol V-RecA interaction at the lesion. However, it is only a RecA molecule located at the 3' filament tip, proximal to a damaged template base, that is directly responsible for translesion synthesis.

Solvation dynamics in triton-X-100 and triton-X-165 micelles: Effect of micellar size and hydration

Science.gov (United States)

Kumbhakar, Manoj; Nath, Sukhendu; Mukherjee, Tulsi; Pal, Haridas

2004-09-01

Dynamic Stokes' shift measurements using coumarin 153 as the fluorescence probe have been carried out to study solvation dynamics in two nonionic micelles, viz., triton-X-100 (TX-100) and triton-X-165 (TX-165). In both the micelles, the solvent relaxation dynamics is biexponential in nature. While the fast solvation time τs1 is seen to be almost similar for both the micelles, the slow solvation time τs2 is found to be appreciably smaller in TX-165 than in TX-100 micelle. Dynamic light scattering measurements indicate that the TX-165 micelles are substantially smaller in size than that of TX-100. Assuming similar core size for both the micelles, as expected from the similar chemical structures of the nonpolar ends for both the surfactants, the Palisade layer is also indicated to be substantially thinner for TX-165 micelles than that of TX-100. The aggregation number of TX-165 micelles is also found to be substantially smaller than that of TX-100 micelles. Fluorescence spectral studies of C153 dye in the two micelles indicate that the Palisade layer of TX-165 micelles is more polar than that of TX-100 micelles. Fluorescence anisotropy measurements indicate that the microviscosity in the Palisade layer of TX-165 micelles is also lower than that of TX-100 micelles. Based on these results it is inferred that the structure of the Palisade layer of TX-165 micelles is quite loose and have higher degree hydration in comparison to that of TX-100 micelles. Due to these structural differences in the Palisade layers of TX-165 and TX-100 micelles the solvation dynamics is faster in the former micelles than in the latter. It has been further inferred that in the present systems the collective response of the water molecules at somewhat away from the probes is responsible for the faster component of the solvation time, which does not reflect much of the structural changes of the micellar Palisade layer. On the contrary, the slower solvation time component, which is mainly due to

Preparation of Polymeric Micelles for Use as Carriers of ...

African Journals Online (AJOL)

Erah

Tropical Journal of Pharmaceutical Research, December 2007; 6 (4): 815-824 ... by the tuberculostatic; by Sudan III solubility tests, to estimate the critical micelle concentration (CMC); ... Furthermore, the micelles were stable in vitro, exhibiting a low level of CMC and stronger anti- ... that take the form of micelles 5, 6, 7, 8.

Synthesis of in-situ luminescent ZnS nanoparticles facile with CTAB micelles and their properties study

Energy Technology Data Exchange (ETDEWEB)

Shukla, Vaishali [Centre for Nanoscience, Central University of Gujarat, Gandhinagar (India); Singh, Man [School of Chemical Sciences, Central University of Gujarat, Gandhinagar, India Telephone: 079-23260210, fax: 079-23260076 (India)

2016-04-13

Currently, the development of micelles route is thrust area of research in nanoscience for the control particle size and remarkable properties through chemical co-precipitation method. A 0.9 mM aqueous CTAB micellar solution plays a role as capping agent in the homogeneous solution of 0.5 M ZnSO{sub 4} and 0.5 M Na{sub 2}S for synthesis, further precipitates purified with centrifugation in cold ethanol and millipore water to remove unreacted reagents and ionic salt particles. A resultant, white colored luminescent ZnS nanoparticle out with ∼95% yield is reported. The ZnS nanoparticles have been examined by their luminescence properties, optical properties and crystal structure. The mean particle size of ZnS nanoparticles is found to be ∼10 nm in various technical results and UV-absorption was 80 nm blue shifts moved from 345 nm (bulk material) to 265 nm, showing a quantum size impact. The X-ray diffraction (XRD) pattern shows the immaculate cubic phase. Photoluminescence (PL) investigates the recombination mechanism with blue emission from shallow electron traps at 490 nm in ZnS nanoparticles. An FTIR spectrum and Thermal gravimetric analysis (TGA) gives confirmation of CTAB – cationic surfactant on surface of ZnS nanoparticle as capping agent as well thermal stability of CTAB capped ZnS nanoparticles with respect to temperature.

NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

Science.gov (United States)

Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

2015-01-01

Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues.

Analysis of translesion DNA synthesis activity of the human REV1 protein, which is a key player in radiation-induced mutagenesis

International Nuclear Information System (INIS)

Masuda, Yuji; Kamiya, Kenji

2003-01-01

Ionizing radiation frequently causes oxidative DNA damage in cells. It has been suggested that functions of the REV1 gene are induction of mutations and prevention of cell death caused by ionizing radiation through the damage bypass DNA replication. The gene product possesses a deoxycytidyl transferase activity, which is required for translesion DNA synthesis of a variety of damaged bases and an abasic site. To elucidate molecular mechanisms of the mutagenesis and translesion DNA synthesis, it is important to characterize the enzymatic properties of the REV1 protein. Here, we describe a novel method for purifying the recombinant human REV1 protein and the anzymatic properties of the protein. We established an efficient system for induction of the recombinant human REV1 protein in Escherichia coli cells. The REV1 protein was purified to homogeneity using nickel-chelating sepharose, heparin sepharose and superdex 200 chromatography. When purified by this method, REV1 protein is free of endo-, exonuclease and DNA polymerase activities. The purified REV1 protein is suitable for enzymological studies, and we used this to biochemical characterization. The REV1 protein inserts dCMP opposite templates G, A, T, C and an abasic site and inserts dGMP and dTMP opposite template G. Kinetic analysis provided evidence for high efficiency for dCMP insertion opposite template G and an abasic site, suggesting that the REV1 protein play a role in translesion DNA synthesis of an abasic site. (author)

The impact of cofactors and inhibitors on DNA repair synthesis after γ-irradiation in semi-permeable Escherichia coli cells

International Nuclear Information System (INIS)

Gaertner, C.

1981-01-01

The DNA-repair synthesis in tuluol-permeable E. coli cells after γ-irradiation has been investigated in dependence on the co-facotrs. ATB and NAD by means of enzyme kinetics. A partly repair-deficient mutants were taken into consideration which are well characterized in view of molecular biology; they showed which enzyme functions participate in the γ-induced DNA repair synthesis. The inhibition of the DNA-repair synthesis by the intercalary substances Adriamycin and Proflavin has been described and compared with the survival rates after irradiation and after combined treatment by irradiation and intercalary agents. (orig./AJ) [de

Engineering single-polymer micelle shape using nonuniform spontaneous surface curvature

Science.gov (United States)

Moths, Brian; Witten, T. A.

2018-03-01

Conventional micelles, composed of simple amphiphiles, exhibit only a few standard morphologies, each characterized by its mean surface curvature set by the amphiphiles. Here we demonstrate a rational design scheme to construct micelles of more general shape from polymeric amphiphiles. We replace the many amphiphiles of a conventional micelle by a single flexible, linear, block copolymer chain containing two incompatible species arranged in multiple alternating segments. With suitable segment lengths, the chain exhibits a condensed spherical configuration in solution, similar to conventional micelles. Our design scheme posits that further shapes are attained by altering the segment lengths. As a first study of the power of this scheme, we demonstrate the capacity to produce long-lived micelles of horseshoe form using conventional bead-spring simulations in two dimensions. Modest changes in the segment lengths produce smooth changes in the micelle's shape and stability.

Self-assembly of micelles into designed networks

Directory of Open Access Journals (Sweden)

Pyatenko Alexander

2007-01-01

Full Text Available AbstractThe EO20PO70EO20(molecular weight 5800 amphiphile as a template is to form dispersed micelle structures. Silver nanoparticles, as inorganic precursors synthesized by a laser ablation method in pure water, are able to produce the highly ordered vesicles detected by TEM micrography. The thickness of the outer layer of a micelle, formed by the silver nanoparticles interacting preferentially with the more hydrophilic EO20block, was around 3.5 nm. The vesicular structure ensembled from micelles is due to proceeding to the mixture of cubic and hexagonal phases.

Scheduled and unscheduled DNA synthesis in chick embryo liver following X-irradiation and treatment with DNA repair inhibitors in vivo

Energy Technology Data Exchange (ETDEWEB)

Stammberger, I.; Tempel, K. (Muenchen Univ. (Germany, F.R.). Inst. fuer Pharmakologie und Toxikologie); Schmahl, W. (Gesellschaft fuer Strahlen- und Umweltforschung m.b.H. Muenchen, Neuherberg (Germany, F.R.). Inst. fuer Pathologie)

1989-09-01

Three hours following X-irradiation of chick embryos with doses of 4 and 8 Gy the in vitro incorporation of tritiated thymidine (({sup 3}H)dT) into DNA (scheduled DNA synthesis, ss) of hepatocytes was reduced to about one-third. Within 24 h after the exposure, ss returned to control values. The return of ss to a normal rate could be strongly inhibited by 2', 3'-dideoxythymidine (ddT), and to a lesser extent by 1-beta-D-arabinofuranosylcytosine (araC). In strong contrast to ss, the hydroxyurea (hu)-resistant ({sup 3)H}dT incorporation (unscheduled DNA synthesis, us) showed a highly significant increase 24 h after treatment of the embryos with araC and/or X-irradiation. Autoradiographic studies revealed no change of total ({sup 3}H)dT labelling frequency in the whole chick embryo liver 24 h after treatment with araC and/or X-irradiation, but a persistent depression of ss and a simultaneous increase of us. (author).

Self-assembled micelles based on pH-sensitive PAE-g-MPEG-cholesterol block copolymer for anticancer drug delivery

Directory of Open Access Journals (Sweden)

Zhang CY

2014-10-01

Full Text Available Can Yang Zhang, Di Xiong, Yao Sun, Bin Zhao, Wen Jing Lin, Li Juan Zhang School of Chemistry and Chemical Engineering, South China University of Technology, Guangzhou, Guangdong Province, People’s Republic of China Abstract: A novel amphiphilic triblock pH-sensitive poly(ß-amino ester-g-poly(ethylene glycol methyl ether-cholesterol (PAE-g-MPEG-Chol was designed and synthesized via the Michael-type step polymerization and esterification condensation method. The synthesized copolymer was determined with proton nuclear magnetic resonance and gel permeation chromatography. The grafting percentages of MPEG and cholesterol were determined as 10.93% and 62.02%, calculated from the area of the characteristic peaks, respectively. The amphiphilic copolymer was confirmed to self-assemble into core/shell micelles in aqueous solution at low concentrations. The critical micelle concentrations were 6.92 and 15.14 mg/L at pH of 7.4 and 6.0, respectively, obviously influenced by the changes of pH values. The solubility of pH-responsive PAE segment could be transformed depending on the different values of pH because of protonation–deprotonation of the amino groups, resulting in pH sensitivity of the copolymer. The average particle size of micelles increased from 125 nm to 165 nm with the pH decreasing, and the zeta potential was also significantly changed. Doxorubicin (DOX was entrapped into the polymeric micelles with a high drug loading level. The in vitro DOX release from the micelles was distinctly enhanced with the pH decreasing from 7.4 to 6.0. Toxicity testing proved that the DOX-loaded micelles exhibited high cytotoxicity in HepG2 cells, whereas the copolymer showed low toxicity. The results demonstrated how pH-sensitive PAE-g-MPEG-Chol micelles were proved to be a potential vector in hydrophobic drug delivery for tumor therapy. Keywords: micelle, pH-sensitive, cholesterol, poly(ß-amino ester, drug delivery

Effects of gamma-irradiation on some properties of bovine casein micelles

International Nuclear Information System (INIS)

Saito, Zenichi

1974-01-01

Sedimentation studies and electron microscopic observations revealed that an association between casein micelles dispersed in water or milk serum was not induced significantly by gamma-irradiation of exposure up to 3 x 10 6 R, whereas a release of nonprotein nitrogen was observed to a certain extent. It was concluded from the results of turbidi-metry and gel filtration using 3 size groups of casein micelles, namely large, medium and small, that an irradiation-induced polymerization or association occurred within individual casein micelles, and strengthend the micelle structure. Thus the irradiated casein micelles resisted, more or less, to the solubilizing effect of NaCl, EDTA, pyrophosphate and urea. Stabilities of casein micelles for ethanol and for acidification to an isoelectric point were decreased and increased, respectively, after irradiation. Gamma irradiation also caused the decrease of glycomacropeptide released from casein micelles by the action of rennin, and this resulted in the delay of rennin-coagulation of casein. There were no essential differences among the 3 size groups of casein micelles concerning the above described tendencies. (auth.)

Vibrational dynamics of ice in reverse micelles

NARCIS (Netherlands)

Dokter, A.M.; Petersen, C.; Woutersen, S.; Bakker, H.J.

2008-01-01

he ultrafast vibrational dynamics of HDO:D2O ice at 180 K in anionic reverse micelles is studied by midinfrared femtosecond pump-probe spectroscopy. Solutions containing reverse micelles are cooled to low temperatures by a fast-freezing procedure. The heating dynamics of the micellar solutions is

Casein polymorphism heterogeneity influences casein micelle size in milk of individual cows.

Science.gov (United States)

Day, L; Williams, R P W; Otter, D; Augustin, M A

2015-06-01

Milk samples from individual cows producing small (148-155 nm) or large (177-222 nm) casein micelles were selected to investigate the relationship between the individual casein proteins, specifically κ- and β-casein phenotypes, and casein micelle size. Only κ-casein AA and β-casein A1A1, A1A2 and A2A2 phenotypes were found in the large casein micelle group. Among the small micelle group, both κ-casein and β-casein phenotypes were more diverse. κ-Casein AB was the dominant phenotype, and 3 combinations (AA, AB, and BB) were present in the small casein micelle group. A considerable mix of β-casein phenotypes was found, including B and I variants, which were only found in the small casein micelle group. The relative amount of κ-casein to total casein was significantly higher in the small micelle group, and the nonglycosylated and glycosylated κ-casein contents were higher in the milks with small casein micelles (primarily with κ-casein AB and BB variants) compared with the large micelle group. The ratio of glycosylated to nonglycosylated κ-casein was higher in the milks with small casein micelles compared with the milks with large casein micelles. This suggests that although the amount of κ-casein (both glycosylated and nonglycosylated) is associated with micelle size, an increased proportion of glycosylated κ-casein could be a more important and favorable factor for small micelle size. This suggests that the increased spatial requirement due to addition of the glycosyl group with increasing extent of glycosylation of κ-casein is one mechanism that controls casein micelle assembly and growth. In addition, increased electrostatic repulsion due to the sialyl residues on the glycosyl group could be a contributory factor. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Sensitization of human cells by inhibitors of DNA synthesis following the action of DNA-damaging agents

Energy Technology Data Exchange (ETDEWEB)

Filatov, M.V.; Noskin, L.A. (Leningrad Inst. of Nuclear Physics, Gatchina (USSR))

1983-08-01

Inhibitors of DNA synthesis 1-..beta..-arabinofuranosylcytosine (Ac) and hydroxyurea (Hu) taken together drastically sensitized human cells to the killing effect of DNA-damaging agents. For UV-irradiation this sensitization depended on the cells' ability for excision repair. By using viscoelastometric methods of measurement of double-strand breaks (DSB) in the genome, it was established that the first DSB were generated after incubation of the damaged cells in the mixture of inhibitors at about the same dose when sensitization appeared. A scheme is proposed to describe molecular events associated with the phenomenon studied. 35 refs.

Soluplus/TPGS mixed micelles for dioscin delivery in cancer therapy.

Science.gov (United States)

Zhao, Jing; Xu, Youwei; Wang, Changyuan; Ding, Yanfang; Chen, Manyu; Wang, Yifei; Peng, Jinyong; Li, Lei; Lv, Li

2017-07-01

Dioscin has shown cytotoxicity against cancer cells, but its poor solubility and stability have limited its clinical application. In this study, we designed mixed micelles composed of TPGS and Soluplus ® copolymers entrapping the poorly soluble anticancer drug dioscin. In order to improve the aqueous solubility and bioactivity of dioscin, TPGS/Soluplus ® mixed micelles with an optimal ratio were prepared using a thin-film hydration method, and their physicochemical properties were characterized. Cellular cytotoxicity and uptake of the dioscin-loaded TPGS/Soluplus ® mixed micelles were studied in MCF-7 breast cancer cells and A2780s ovarian cancer cells. The pharmacokinetics of free dioscin and dioscin-loaded TPGS/Soluplus ® mixed micelles was studied in vivo in male Sprague-Dawley rats via a single intravenous injection in the tail vein. The average size of the optimized mixed micelle was 67.15 nm, with 92.59% drug encapsulation efficiency and 4.63% drug loading efficiency. The in vitro release profile showed that the mixed micelles presented sustained release behavior compared to the anhydrous ethanol solution of dioscin. In vitro cytotoxicity assays were conducted on human cancer cell lines including A2780s ovarian cancer cells and MCF-7 breast cancer cells. The mixed micelles exhibited better antitumor activity compared to free dioscin against all cell lines, which may benefit from the significant increase in the cellular uptake of dioscin from mixed micelles compared to free dioscin. The pharmacokinetic study showed that the mixed micelle formulation achieved a 1.3 times longer mean residual time (MRT) in circulation and a 2.16 times larger area under the plasma concentration-time curve (AUC) than the free dioscin solution. Our results suggest that the dioscin-loaded mixed micelles developed in this study might be a potential nano drug-delivery system for cancer chemotherapy.

Polyplex micelle installing intracellular self-processing functionalities without free catiomers for safe and efficient systemic gene therapy through tumor vasculature targeting.

Science.gov (United States)

Chen, Qixian; Osada, Kensuke; Ge, Zhishen; Uchida, Satoshi; Tockary, Theofilus A; Dirisala, Anjaneyulu; Matsui, Akitsugu; Toh, Kazuko; Takeda, Kaori M; Liu, Xueying; Nomoto, Takahiro; Ishii, Tekihiko; Oba, Makoto; Matsumoto, Yu; Kataoka, Kazunori

2017-01-01

Both efficiency and safety profiles are crucial for promotion of gene delivery systems towards practical applications. A promising template system was previously developed based on block catiomer of poly(ethylene glycol) (PEG)-b-poly{N'-[N-(2-aminoethyl)-2-aminoehtyl]aspartamide}-cholesteryl [PEG-PAsp(DET)-cholesteryl] with strategies of ligand conjugation at the α-terminus for specific affinity to the targeted cells and cholesteryl conjugation at the ω-terminus for structural stabilization to obtain systemic retention. Aiming for advocating this formulation towards practical applications, in the current study, the binding profile of this polymer to plasmid DNA (pDNA) was carefully studied to address an issue of toxicity origin. Quantification of free polymer composition confirmed that the toxicity mainly results from unbound polymer and polyplex micelle itself has negligible toxicity. This evaluation allowed for identifying an optimal condition to prepare safe polyplex micelles for systemic application that possess maximal polymer-binding but exclude free polymers. The identified polyplex micelles then faced a drawback of limited transfection efficiency due to the absence of free polymer, which is an acknowledged tendency found in various synthetic gene carriers. Thus, series of functional components was strategically compiled to improve the transfection efficiency such as attachment of cyclic (Arg-Gly-Asp) (cRGD) peptide as a ligand onto the polyplex micelles to facilitate cellular uptake, use of endosome membrane disruptive catiomer of PAsp(DET) for facilitating endosome escape along with use of the conjugated cholesteryl group to amplify the effect of PAsp(DET) on membrane disruption, so as to obtain efficient transfection. The mechanistic investigation respecting the appreciated pH dependent protonation behavior of PAsp(DET) permitted to depict an intriguing scenario how the block catiomers manage to escape from the endosome entrapment in response to the p

Self-assembly of star micelle into vesicle in solvents of variable quality: the star micelle retains its core-shell nanostructure in the vesicle.

Science.gov (United States)

Liu, Nijuan; He, Qun; Bu, Weifeng

2015-03-03

Intra- and intermolecular interactions of star polymers in dilute solutions are of fundamental importance for both theoretical interest and hierarchical self-assembly into functional nanostructures. Here, star micelles with a polystyrene corona and a small ionic core bearing platinum(II) complexes have been regarded as a model of star polymers to mimic their intra- and interstar interactions and self-assembled behaviors in solvents of weakening quality. In the chloroform/methanol mixture solvents, the star micelles can self-assemble to form vesicles, in which the star micelles shrink significantly and are homogeneously distributed on the vesicle surface. Unlike the morphological evolution of conventional amphiphiles from micellar to vesicular, during which the amphiphilic molecules are commonly reorganized, the star micelles still retain their core-shell nanostructures in the vesicles and the coronal chains of the star micelle between the ionic cores are fully interpenetrated.

Method and apparatus for synthesis of arrays of DNA probes

Science.gov (United States)

Cerrina, Francesco; Sussman, Michael R.; Blattner, Frederick R.; Singh-Gasson, Sangeet; Green, Roland

2002-04-23

The synthesis of arrays of DNA probes sequences, polypeptides, and the like is carried out using a patterning process on an active surface of a substrate. An image is projected onto the active surface of the substrate utilizing an image former that includes a light source that provides light to a micromirror device comprising an array of electronically addressable micromirrors, each of which can be selectively tilted between one of at least two positions. Projection optics receives the light reflected from the micromirrors along an optical axis and precisely images the micromirrors onto the active surface of the substrate, which may be used to activate the surface of the substrate. The first level of bases may then be applied to the substrate, followed by development steps, and subsequent exposure of the substrate utilizing a different pattern of micromirrors, with further repeats until the elements of a two dimensional array on the substrate surface have an appropriate base bound thereto. The micromirror array can be controlled in conjunction with a DNA synthesizer supplying appropriate reagents to a flow cell containing the active substrate to control the sequencing of images presented by the micromirror array in coordination of the reagents provided to the substrate.

Inhibition and recovery of semiconservative DNA synthesis in normal and solar UV sensitive ICR 2A frog cell lines following the induction of non-dimer DNA damage by sunlamp UV > 315 nm

Energy Technology Data Exchange (ETDEWEB)

Rosenstein, B.S. (Brown Univ., Providence, RI (USA). Dept. of Radiation Medicine)

1989-08-01

Cultures of solar UV-sensitive cell lines DRP 36 and DRP 153, and of the parental ICR 2A cell line, were exposed to 150 kJ/m{sup 2} of sunlamp UV>315nm plus photoreactivating light, resulting in the induction primarily of non-dimer DNA damage. Following either 0, 3, 6, 12 or 24 h incubation, cultures were pulse-labelled with ({sup 3}H) thymidine, and the synthesis of different size classes of replicon intermediates measured using alkaline step elution assay. For all three cell lines tested, an immediate depression of low molecular weight DNA synthesis was observed, followed by inhibition of all size classes of replicon intermediates. Within 12 h following irradiation, recovery of DNA synthesis was observed, generally most apparent for low molecular weight DNA. The ICR 2A cells exhibited a nearly full recovery in all size classes of DNA synthesized by 24 h. A much smaller recovery of continued inhibition was primarily in the synthesis of full replicon size DNA, and most pronounced for DRP 36 cells. (author).

Glycopolymer micelles with reducible ionic cores for hepatocytes-targeting delivery of DOX.

Science.gov (United States)

Wang, Yanxia; Zhang, Xinge; Yu, Peien; Li, Chaoxing

2013-01-30

A novel galactose-decorated cross-linked micelles (cl-micelles) with ionic cores using cystamine (Cys) as a biodegradable cross-linker was prepared by using block ionomer complexes of poly(ethylene glycol)-b-poly(2-acryloxyethyl-galactose)-b-poly(acrylic acid) (PEG-b-PAEG-b-PAA) and Ca(2+) (PEG-b-PAEG-b-PAA cl-micelles/Cys). Doxorubicin (DOX) was successfully incorporated into the ionic cores of such micelles via electrostatic interactions. Proton nuclear magnetic resonance spectrum and Fourier transform infrared spectrometer indicated galactose ligands were exposed at the micellar surface. The micelles were spherical in shape, with an average size of 100nm. The in vitro release studies confirmed that DOX-loaded PEG-b-PAEG-b-PAA cl-micelles/Cys accomplished rapid drug release under reducing condition. Remarkably, PEG-b-PAEG-b-PAA cl-micelles/Cys efficiently delivered and released DOX into the cell nucleus of HepG2 cells, and the intensity of fluorescence observed in HepG2 cells was stronger than that incubated with the micelles without galactose ligands. In contrast, little fluorescence was observed in NIH3T3 cells after incubation with PEG-b-PAEG-b-PAA cl-micelles/Cys. Interestingly, cytotoxicity assays showed that DOX-loaded PEG-b-PAEG-b-PAA cl-micelles/Cys retained higher cell inhibition efficiency in HepG2 cells as compared with NIH3T3 cells, and were more potent than the micelles without galactose ligands and the micelles with non degradable cross-links. These results indicate that PEG-b-PAEG-b-PAA cl-micelles/Cys have great potential in liver tumor-targeted chemotherapy. Copyright © 2012 Elsevier B.V. All rights reserved.

Effects of low doses of gamma radiation on DNA synthesis in the developing rat brain

International Nuclear Information System (INIS)

Cerda, H.

1983-01-01

Rats of one or ten days of age were irradiated with low doses of gamma radiation, and synthesis of DNA was examined by the incorporation of 3 H-thymidine in the cerebellum and the rest of the brain in vivo. DNA synthesis was depressed in both parts of the brain but the effects were larger in cerebellum. A minimum was found about 10 hours after irradiation in the older rats and later (18 h) in the younger ones. The dose response in 10 day-old rats, was biphasic and showed that cerebellum was more affected. Autoradiographs showed that fewer cells entered the cycle and those synthesizing showed a depressed rate of synthesis. These findings are discussed in relation to induction of cell death. (Auth.)

DNA-Conjugated Organic Chromophores in DNA Stacking Interactions

DEFF Research Database (Denmark)

Filichev, Vyacheslav V.; Pedersen, Erik Bjerregaard

2009-01-01

Since the discovery of the intercalation of acridine derivatives into DNA (1961), chemists have synthesized many intercalators tethered to DNA. Advances in the chemical synthesis of modified nucleosides along with progress in oligonucleotide synthesis have made it possible to introduce organic ch...... review presents those efforts in the design of intercalators/organic chromophores as oligonucleotide conjugates that form a foundation for the generation of novel nucleic acid architectures......Since the discovery of the intercalation of acridine derivatives into DNA (1961), chemists have synthesized many intercalators tethered to DNA. Advances in the chemical synthesis of modified nucleosides along with progress in oligonucleotide synthesis have made it possible to introduce organic...

Synthesis and DNA cleavage activity of Bis-3-chloropiperidines as alkylating agents.

Science.gov (United States)

Zuravka, Ivonne; Roesmann, Rolf; Sosic, Alice; Wende, Wolfgang; Pingoud, Alfred; Gatto, Barbara; Göttlich, Richard

2014-09-01

Nitrogen mustards are an important class of bifunctional alkylating agents routinely used in chemotherapy. They react with DNA as electrophiles through the formation of highly reactive aziridinium ion intermediates. The antibiotic 593A, with potential antitumor activity, can be considered a naturally occurring piperidine mustard containing a unique 3-chloropiperidine ring. However, the total synthesis of this antibiotic proved to be rather challenging. With the aim of designing simplified analogues of this natural product, we developed an efficient bidirectional synthetic route to bis-3-chloropiperidines joined by flexible, conformationally restricted, or rigid diamine linkers. The key step involves an iodide-catalyzed double cyclization of unsaturated bis-N-chloroamines to simultaneously generate both piperidine rings. Herein we describe the synthesis and subsequent evaluation of a series of novel nitrogen-bridged bis-3-chloropiperidines, enabling the study of the impact of the linker structure on DNA alkylation properties. Our studies reveal that the synthesized compounds possess DNA alkylating abilities and induce strand cleavage, with a strong preference for guanine residues. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Reverse micelles as a tool for probing solvent modulation of protein dynamics: Reverse micelle encapsulated hemoglobin☆

OpenAIRE

Roche, Camille J.; Dantsker, David; Heller, Elizabeth R.; Sabat, Joseph E.; Friedman, Joel M.

2013-01-01

Hydration waters impact protein dynamics. Dissecting the interplay between hydration waters and dynamics requires a protein that manifests a broad range of dynamics. Proteins in reverse micelles (RMs) have promise as tools to achieve this objective because the water content can be manipulated. Hemoglobin is an appropriate tool with which to probe hydration effects. We describe both a protocol for hemoglobin encapsulation in reverse micelles and a facile method using PEG and cosolvents to mani...

Nanoscale elastic modulus variation in loaded polymeric micelle reactors.

Science.gov (United States)

Solmaz, Alim; Aytun, Taner; Deuschle, Julia K; Ow-Yang, Cleva W

2012-07-17

Tapping mode atomic force microscopy (TM-AFM) enables mapping of chemical composition at the nanoscale by taking advantage of the variation in phase angle shift arising from an embedded second phase. We demonstrate that phase contrast can be attributed to the variation in elastic modulus during the imaging of zinc acetate (ZnAc)-loaded reverse polystyrene-block-poly(2-vinylpyridine) (PS-b-P2VP) diblock co-polymer micelles less than 100 nm in diameter. Three sample configurations were characterized: (i) a 31.6 μm thick polystyrene (PS) support film for eliminating the substrate contribution, (ii) an unfilled PS-b-P2VP micelle supported by the same PS film, and (iii) a ZnAc-loaded PS-b-P2VP micelle supported by the same PS film. Force-indentation (F-I) curves were measured over unloaded micelles on the PS film and over loaded micelles on the PS film, using standard tapping mode probes of three different spring constants, the same cantilevers used for imaging of the samples before and after loading. For calibration of the tip geometry, nanoindentation was performed on the bare PS film. The resulting elastic modulus values extracted by applying the Hertz model were 8.26 ± 3.43 GPa over the loaded micelles and 4.17 ± 1.65 GPa over the unloaded micelles, confirming that phase contrast images of a monolayer of loaded micelles represent maps of the nanoscale chemical and mechanical variation. By calibrating the tip geometry indirectly using a known soft material, we are able to use the same standard tapping mode cantilevers for both imaging and indentation.

H3-THYMIDINE DERIVATIVE POOLS IN RELATION TO MACRONUCLEAR DNA SYNTHESIS IN TETRAHYMENA PYRIFORMIS

Science.gov (United States)

Stone, G. E.; Miller, O. L.; Prescott, D. M.

1965-01-01

The formation of a soluble H3-thymidine derivative pool has been examined in Tetrahymena pyriformis as a function of macronuclear DNA synthesis during the cell life cycle. An autoradiographic technique which allows the detection of water-soluble materials within a cell has shown that these cells do not take up and retain exogenous H3-thymidine during G1 or G2. Uptake of H3-thymidine is restricted to the S period of the cell cycle. Additional autoradiographic experiments show, however, that a soluble pool of H3-thymidine derivatives persists from the end of one DNA synthesis period to the beginning of the next synthesis period in the subsequent cell cycle. Since this persisting pool cannot be labeled with H3-thymidine, the pool does not turn over during non-S periods. PMID:19866660

Hydrolytic degradation of poly(ethylene oxide)-block-polycaprolactone worm micelles.

Science.gov (United States)

Geng, Yan; Discher, Dennis E

2005-09-21

Spherical micelles and nanoparticles made with degradable polymers have been of great interest for therapeutic application, but degradation-induced changes in a spherical morphology can be subtle and mechanism/kinetics appears poorly understood. Here, we report the first preparation of giant and flexible worm micelles self-assembled from degradable copolymer poly(ethylene oxide)-block-polycaprolactone. Such worm micelles spontaneously shorten to generate spherical micelles, triggered by polycaprolactone hydrolysis, with distinct mechanism and kinetics from that which occurs in bulk material.

Inhibition of the synthesis of polyamines and DNA in activated lymphocytes by a combination of alpha-methylornithine and methylglyoxal bis(guanylhydrazone).

Science.gov (United States)

Morris, D R; Jorstad, C M; Seyfried, C E

1977-09-01

The cancer chemotherapeutic drug, methylglyoxal bis(guanylhydrazone), inhibits the synthesis of spermidine and spermine, but allows continued putrescine production in small lymphocytes stimulated by concanavalin A. DNA replication in these cells is inhibited 50% while the synthesis of protein and RNA continues normally. When excess putrescine accumulation in the presence of methylglyoxal bis(guanylhydrazone) was inhibited with alpha-methylornithine, a competitive inhibitor of ornithine decarboxylase, the inhibition of DNA replication was accentuated, with still no effect on protein or RNA synthesis. No inhibition of DNA synthesis by the combination of alpha-methylornithine and methylglyoxal bis(guanylhydrazone) was observed when the inhibitors were added after accumulation of cellular polyamines. In addition, inhibition was reversed by exogenous putrescine, spermidine, or spermine. We conclude that putrescine can fulfill in part the role normally played by spermidine and spermine in DNA replication, and that blocking putrescine synthesis in the presence of methylglyoxal bis(guanylhydrazone) amplifies the polyamine requirement. The implications of this with regard to polyamine synthesis as a site of chemotherapy are discussed.

Detection of short repeated genomic sequences on metaphase chromosomes using padlock probes and target primed rolling circle DNA synthesis

Directory of Open Access Journals (Sweden)

Stougaard Magnus

2007-11-01

Full Text Available Abstract Background In situ detection of short sequence elements in genomic DNA requires short probes with high molecular resolution and powerful specific signal amplification. Padlock probes can differentiate single base variations. Ligated padlock probes can be amplified in situ by rolling circle DNA synthesis and detected by fluorescence microscopy, thus enhancing PRINS type reactions, where localized DNA synthesis reports on the position of hybridization targets, to potentially reveal the binding of single oligonucleotide-size probe molecules. Such a system has been presented for the detection of mitochondrial DNA in fixed cells, whereas attempts to apply rolling circle detection to metaphase chromosomes have previously failed, according to the literature. Methods Synchronized cultured cells were fixed with methanol/acetic acid to prepare chromosome spreads in teflon-coated diagnostic well-slides. Apart from the slide format and the chromosome spreading everything was done essentially according to standard protocols. Hybridization targets were detected in situ with padlock probes, which were ligated and amplified using target primed rolling circle DNA synthesis, and detected by fluorescence labeling. Results An optimized protocol for the spreading of condensed metaphase chromosomes in teflon-coated diagnostic well-slides was developed. Applying this protocol we generated specimens for target primed rolling circle DNA synthesis of padlock probes recognizing a 40 nucleotide sequence in the male specific repetitive satellite I sequence (DYZ1 on the Y-chromosome and a 32 nucleotide sequence in the repetitive kringle IV domain in the apolipoprotein(a gene positioned on the long arm of chromosome 6. These targets were detected with good efficiency, but the efficiency on other target sites was unsatisfactory. Conclusion Our aim was to test the applicability of the method used on mitochondrial DNA to the analysis of nuclear genomes, in particular as

Opportunities for measuring DNA synthesis time by quantitative autoradiography

International Nuclear Information System (INIS)

Vasileva, D.

1980-01-01

DNA sysntesis time (Tsub(s)) in cells of the canine erythropoiesis and myelopoiesis pools was determined by quantitative autoradiography according to Doermer. In contrast to mitosis labelling for Tsub(s) estimation as so far applied, this technique uses well-differentiated cells. After blocking endogeneous DNA synthesis with 5-fluorodeoxyuridine, its further course becomes dependent on exogeneous supply of thymidine, in the form of 14 C-thymidine. From incroporation of the latter into the individual cell within a definite time span (3-7 min) and taking into account its total amount, Tsub(s) may be calculated. The data thus obtained were found to agree with Tsub(s) values as estimated from the labelled mitosis curve

Cytometry of DNA Replication and RNA Synthesis: Historical Perspective and Recent Advances Based on “Click Chemistry”

OpenAIRE

Darzynkiewicz, Zbigniew; Traganos, Frank; Zhao, Hong; Halicka, H. Dorota; Li, Jiangwei

2011-01-01

This review covers progress in the development of cytometric methodologies designed to assess DNA replication and RNA synthesis. The early approaches utilizing autoradiography to detect incorporation of 3H- or 14C-labeled thymidine were able to identify the four fundamental phases of the cell cycle G1, S, G2, and M, and by analysis of the fraction of labeled mitosis (FLM), to precisely define the kinetics of cell progression through these phases. Analysis of 3H-uridine incorporation and RNA c...

Synthesis of sol–gel silica particles in reverse micelles with mixed-solvent polar cores: tailoring nanoreactor structure and properties

Energy Technology Data Exchange (ETDEWEB)

Bürglová, Kristýna; Hlaváč, Jan [Institute of Molecular and Translational Medicine, Faculty of Medicine and Dentistry (Czech Republic); Bartlett, John R., E-mail: jbartlett@usc.edu.au [University of the Sunshine Coast, Faculty of Science, Health, Education and Engineering (Australia)

2015-07-15

In this paper, we describe a new approach for producing metal oxide nano- and microparticles via sol–gel processing in confined media (sodium bis(2-ethylhexyl)sulfosuccinate reverse micelles), in which the chemical and physical properties of the polar aqueous core of the reverse micelles are modulated by the inclusion of a second polar co-solvent. The co-solvents were selected for their capacity to solubilise compounds with low water solubility and included dimethylsulfoxide, dimethylformamide, ethylene glycol, n-propanol, dimethylacetamide and N-methylpyrrolidone. A broad range of processing conditions across the sodium bis(2-ethylhexyl)sulfosuccinate/cyclohexane/water phase diagram were identified that are suitable for preparing particles with dimensions <50 to >500 nm. In contrast, only a relatively narrow range of processing conditions were suitable for preparing such particles in the absence of the co-solvents, highlighting the role of the co-solvent in modulating the properties of the polar core of the reverse micelles. A mechanism is proposed that links the interactions between the various reactive sites on the polar head group of the surfactant and the co-solvent to the nucleation and growth of the particles.

Enhanced unscheduled DNA synthesis in UV-irradiated human skin explants treated with T4N5 liposomes

International Nuclear Information System (INIS)

Yarosh, D.B.; Kibitel, J.T.; Green, L.A.; Spinowitz, A.

1991-01-01

Epidermal keratinocytes cultured from explants of skin cancer patients, including biopsies from xeroderma pigmentosum patients, were ultraviolet light-irradiated and DNA repair synthesis was measured. Repair capacity was much lower in xeroderma pigmentosum patients than in normal patients. The extent of DNA repair replication did not decline with the age of the normal patient. Treatment with T4N5 liposomes containing a DNA repair enzyme enhanced repair synthesis in both normal and xeroderma pigmentosum keratinocytes in an irradiation- and liposome-dose dependent manner. These results provide no evidence that aging people or skin cancer patients are predisposed to cutaneous malignancy by a DNA repair deficiency, but do demonstrate that T4N5 liposomes enhance DNA repair in the keratinocytes of the susceptible xeroderma pigmentosum and skin cancer population

Preparation of mono-dispersed silver nanoparticles assisted by chitosan-g-poly(ε-caprolactone) micelles and their antimicrobial application

Energy Technology Data Exchange (ETDEWEB)

Gu, Chunhua [Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai 200237 (China); Zhang, Huan [State Key Laboratory of Bioreactor Engineering, New World Biotechnology Institute, East China University of Science and Technology, Shanghai 200237 (China); Lang, Meidong, E-mail: mdlang@ecust.edu.cn [Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai 200237 (China)

2014-05-01

Graphical abstract: - Highlights: • Chemical modification of chitosan were conducted after phthaloyl protection of amino groups. • Silver nanoparticles were prepared in the presence of chitosan-based copolymer micelles. • The optimal time scale and weight ratios of silver to micelles were monitored by UV–vis spectrometer. - Abstract: Amphiphilic chitosan-graft-poly(ε-caprolactone) (CS-g-PCLs) copolymers were synthesized by a homogeneous coupling method and characterized by {sup 1}H NMR, FTIR and ninhydrin assay. The graft copolymers were subsequently self-assembled into micelles, which were measured by DLS and TEM. The particle size of the micelles decreased as the segment grafting fraction was increased. Thereafter, silver nanoparticles were prepared in the presence of chitosan-based micelles under UV irradiation. The molar ratio and radiation time of silver to micelles were optimized with process monitored via UV–vis spectrophotometer. DLS and TEM were used to illustrate the particle structure and size while XRD patterns were applied to characterize the crystal structures of polymer-assisted silver nanoparticles. Films impregnated with silver nanoparticles were conducted with results of strong antimicrobial activities against Escherichia coli and Staphylococcus aureus as model Gram-negative and positive bacteria.

Preparation of mono-dispersed silver nanoparticles assisted by chitosan-g-poly(ε-caprolactone) micelles and their antimicrobial application

International Nuclear Information System (INIS)

Gu, Chunhua; Zhang, Huan; Lang, Meidong

2014-01-01

Graphical abstract: - Highlights: • Chemical modification of chitosan were conducted after phthaloyl protection of amino groups. • Silver nanoparticles were prepared in the presence of chitosan-based copolymer micelles. • The optimal time scale and weight ratios of silver to micelles were monitored by UV–vis spectrometer. - Abstract: Amphiphilic chitosan-graft-poly(ε-caprolactone) (CS-g-PCLs) copolymers were synthesized by a homogeneous coupling method and characterized by 1 H NMR, FTIR and ninhydrin assay. The graft copolymers were subsequently self-assembled into micelles, which were measured by DLS and TEM. The particle size of the micelles decreased as the segment grafting fraction was increased. Thereafter, silver nanoparticles were prepared in the presence of chitosan-based micelles under UV irradiation. The molar ratio and radiation time of silver to micelles were optimized with process monitored via UV–vis spectrophotometer. DLS and TEM were used to illustrate the particle structure and size while XRD patterns were applied to characterize the crystal structures of polymer-assisted silver nanoparticles. Films impregnated with silver nanoparticles were conducted with results of strong antimicrobial activities against Escherichia coli and Staphylococcus aureus as model Gram-negative and positive bacteria

Functional roles of DNA polymerases β and γ

International Nuclear Information System (INIS)

Huebscher, U.; Kuenzle, C.C.; Spadari, S.

1979-01-01

The physiological functions of DNA polymerases (deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC2.7.7.7)β and γ were investigated by using neuronal nuclei and synaptosomes isolated from rat brain. uv irradiation of neuronal nuclei from 60-day-old rats resulted in a 7- to 10-fold stimulation of DNA repair synthesis attributable to DNA polymerase β which, at this developmental stage, is virtually the only DNA polymerase present in the nuclei. No repair synthesis could be elicited by treating the nuclei with N-methyl-N-nitrosourea, but this was probably due to the inability of brain tissue to excise alkylated bases from DNA. The role of DNA polymerase γ was studied in synaptosomes by using a system mimicking in vivo mitochondrial DNA synthesis. By showing that under these conditions, DNA replication occurs in miatochondria, and exploiting the fact that DNA polymerase γ is the only DNA polymerase present in mitochondria, evidence was obtained for a role of DNA polymerase γ in mitochondrial DNA replication. Based on these results and on the wealth of literature on DNA polymerase α, we conclude that DNA polymerase α is mainly responsible for DNA replication in nuclei, DNA polymerase β is involved in nuclear DNA repair, and DNA polymerase γ is the mitochondrial replicating enzyme. However, minor roles for DNA polymerase α in DNA repair or for DNA polymerase β in DNA replication cannot be excluded

Effect of haloperidol on the synthesis of DNA in the pituitary gland of the rat.

Science.gov (United States)

Machiavelli, G A; Jahn, G A; Kalbermann, L E; Szijan, I; Alonso, G E; Burdman, J A

1982-03-01

The administration of haloperidol increased serum prolactin and decreased the pituitary concentration of prolactin 15 min after its administration. Concomitantly there was a stimulation in the synthesis of DNA and the activity of DNA polymerase alpha in the anterior pituitary gland that was greater in oestrogenized than in non-oestrogenized male rats. Both these effects were greatly reduced by clomiphene in the oestrogenized male rats, although it did not affect the release of prolactin produced by haloperidol. In non-oestrogenized animals clomiphene abolished the stimulatory effect of haloperidol on the synthesis of DNA. These results suggest that the reduction in the intracellular levels of prolactin are a primary event in the oestrogen mediated stimulation of cell proliferation by prolactin releasing agents.

Normal inhibition of DNA synthesis following γ-irradiation of radiosensitive cell lines from patients with Down's syndrome and Alzheimer's disease

International Nuclear Information System (INIS)

Lavin, M.F.; Le poidevin, P.; Chen, P.C.; Bates, P.

1989-01-01

Inhibition of DNA synthesis was studied in γ-iradiated lymphoblastoid cells from patients with Alzheimer's disease and Down's syndrome. A normal biphasic pattern of inhibition was observed over a dose range of 0-4 krad of γ-rays in all of the cell lines 3 out of 4 Down's and all the Alzheimer's cell lines were shown to be hypersensitive to ionizing radiation based on induced chromosomal aberrations. Increased G2 phase delay, comparable to that occurring in ataxia-telangiectasia cells, was observed for some of the cell lines, after exposure to γ-rays. Contrary to other data in the literature these results demonstrate that radioresistand DNA synthesis is not an intrinsic feature of all disorders characterized by radiosensitivitey. (author).; 25 refs.; 2 figs.; 1 tab

2D and 3D organisation of nano-particles: synthesis and specific properties

International Nuclear Information System (INIS)

Taleb, Abdelhafed

1998-01-01

The first part of this research thesis addresses the synthesis of nano-particles of silver and cobalt in the inverse micellar system, and highlights the feasibility of two- and three-dimensional structures of these particles. The author first presents the micellar system (micro-emulsions, surfactant, properties of inverse micelles, functionalized inverse micelles, application to the synthesis of nano-particles), and then reports the study of the synthesis and organisation of colloids in 2D and 3D. He also reports the study of optical properties of metallic colloids: free electron approximation, optical properties of electron gases, optical properties of colloids, optical response of two-dimensional and three-dimensional nano-structures. The magnetic properties of colloids are then studied: magnetism of the massive metallic state, magnetic properties of nano-particles (influence of size, interactions and field, notions of magnetic order and disorder), effect of organisation. The second part of this thesis is made of a set of published articles: Synthesis of highly mono-disperse silver nano-particles from AOT reverse micelles (a way to 2D and 3D self-organisation), Optical properties of self-assembled 2D and 3D super-lattices of silver nano-particles, Collective optical properties of silver nano-particles organised in 2D super-lattices, Self assembled in 2D cobalt nano-sized particles, Self organisation of magnetic nano-sized cobalt particles, Organisation in 2D cobalt nano-particles (synthesis, characterization and magnetic properties) [fr

DNA repair genes RAD52 and SRS2, a cell wall synthesis regulator gene SMI1, and the membrane sterol synthesis scaffold gene ERG28 are important in efficient Agrobacterium-mediated yeast transformation with chromosomal T-DNA.

Science.gov (United States)

Ohmine, Yuta; Satoh, Yukari; Kiyokawa, Kazuya; Yamamoto, Shinji; Moriguchi, Kazuki; Suzuki, Katsunori

2016-04-02

Plant pathogenic Agrobacterium strains can transfer T-DNA regions of their Ti plasmids to a broad range of eukaryotic hosts, including fungi, in vitro. In the recent decade, the yeast Saccharomyces cerevisiae is used as a model host to reveal important host proteins for the Agrobacterium-mediated transformation (AMT). Further investigation is required to understand the fundamental mechanism of AMT, including interaction at the cell surface, to expand the host range, and to develop new tools. In this study, we screened a yeast mutant library for low AMT mutant strains by advantage of a chromosome type T-DNA, which transfer is efficient and independent on integration into host chromosome. By the mutant screening, we identified four mutant strains (srs2Δ, rad52Δ, smi1Δ and erg28Δ), which showed considerably low AMT efficiency. Structural analysis of T-DNA product replicons in AMT colonies of mutants lacking each of the two DNA repair genes, SRS2 and RAD52, suggested that the genes act soon after T-DNA entry for modification of the chromosomal T-DNA to stably maintain them as linear replicons and to circularize certain T-DNA simultaneously. The cell wall synthesis regulator SMI1 might have a role in the cell surface interaction between the donor and recipient cells, but the smi1Δ mutant exhibited pleiotropic effect, i.e. low effector protein transport as well as low AMT for the chromosomal T-DNA, but relatively high AMT for integrative T-DNAs. The ergosterol synthesis regulator/enzyme-scaffold gene ERG28 probably contributes by sensing a congested environment, because growth of erg28Δ strain was unaffected by the presence of donor bacterial cells, while the growth of the wild-type and other mutant yeast strains was suppressed by their presence. RAD52 and the DNA helicase/anti-recombinase gene SRS2 are necessary to form and maintain artificial chromosomes through the AMT of chromosomal T-DNA. A sterol synthesis scaffold gene ERG28 is important in the high

Block and Gradient Copoly(2-oxazoline) Micelles: Strikingly Different on the Inside.

Science.gov (United States)

Filippov, Sergey K; Verbraeken, Bart; Konarev, Petr V; Svergun, Dmitri I; Angelov, Borislav; Vishnevetskaya, Natalya S; Papadakis, Christine M; Rogers, Sarah; Radulescu, Aurel; Courtin, Tim; Martins, José C; Starovoytova, Larisa; Hruby, Martin; Stepanek, Petr; Kravchenko, Vitaly S; Potemkin, Igor I; Hoogenboom, Richard

2017-08-17

Herein, we provide a direct proof for differences in the micellar structure of amphiphilic diblock and gradient copolymers, thereby unambiguously demonstrating the influence of monomer distribution along the polymer chains on the micellization behavior. The internal structure of amphiphilic block and gradient co poly(2-oxazolines) based on the hydrophilic poly(2-methyl-2-oxazoline) (PMeOx) and the hydrophobic poly(2-phenyl-2-oxazoline) (PPhOx) was studied in water and water-ethanol mixtures by small-angle X-ray scattering (SAXS), small-angle neutron scattering (SANS), static and dynamic light scattering (SLS/DLS), and 1 H NMR spectroscopy. Contrast matching SANS experiments revealed that block copolymers form micelles with a uniform density profile of the core. In contrast to popular assumption, the outer part of the core of the gradient copolymer micelles has a distinctly higher density than the middle of the core. We attribute the latter finding to back-folding of chains resulting from hydrophilic-hydrophobic interactions, leading to a new type of micelles that we refer to as micelles with a "bitterball-core" structure.

Regulation of chloroplast number and DNA synthesis in higher plants. Final report

Energy Technology Data Exchange (ETDEWEB)

Mullet, J.E.

1995-11-10

The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailed description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

In vivo effects of T-2 mycotoxin on synthesis of proteins and DNA in rat tissues

International Nuclear Information System (INIS)

Thompson, W.L.; Wannemacher, R.W. Jr.

1990-01-01

Rats were given an ip injection of T-2 mycotoxin (T-2), the T-2 metabolite, T-2 tetraol (tetraol), or cycloheximide. Serum, liver, heart, kidney, spleen, muscle, and intestine were collected at 3, 6, and 9 hr postinjection after a 2-hr pulse at each time with [14C]leucine and [3H]thymidine. Protein and DNA synthesis levels in rats were determined by dual-label counting of the acid-precipitable fraction of tissue homogenates. Rats given a lethal dose of T-2, tetraol, or cycloheximide died between 14 and 20 hr. Maximum inhibition of protein synthesis at the earliest time period was observed in additional rats given the same lethal dose of the three treatments and continued for the duration of the study (9 hr). With sublethal doses of T-2 or tetraol, the same early decrease in protein synthesis was observed but, in most of the tissues, recovery was seen with time. In the T-2-treated rats. DNA synthesis in the six tissues studied was also suppressed, although to a lesser degree. With sublethal doses, complete recovery of DNA synthesis took place in four of the six tissues by 9 hr after toxin exposure. The appearance of newly translated serum proteins did not occur in the animals treated with T-2 mycotoxin or cycloheximide, as evidenced by total and PCA-soluble serum levels of labeled leucine. An increase in tissue-pool levels of free leucine and thymidine in response to T-2 mycotoxin was also noted. T-2 mycotoxin, its metabolite, T-2 tetraol, and cycloheximide cause a rapid inhibition of protein and DNA synthesis in all tissue types studied. These results are compared with the responses seen in in vitro studies

Photophysical study of a charge transfer oxazole dye in micelles: Role of surfactant headgroups

Energy Technology Data Exchange (ETDEWEB)

Maiti, Jyotirmay [Department of Chemistry, West Bengal State University, Barasat, Kolkata 700126 (India); Sarkar, Yeasmin; Parui, Partha Pratim [Department of Chemistry, Jadavpur University, Kolkata 700032 (India); Chakraborty, Sandipan [Department of Microbiology, University of Calcutta, Kolkata 700019 (India); Biswas, Suman [Department of Chemistry, West Bengal State University, Barasat, Kolkata 700126 (India); Das, Ranjan, E-mail: ranjan.das68@gmail.com [Department of Chemistry, West Bengal State University, Barasat, Kolkata 700126 (India)

2015-07-15

Photophysics of 5-(4′′-dimethylaminophenyl)-2-(4′-sulfophenyl)oxazole, sodium salt (DMO) which undergoes intramolecular charge transfer in the excited state was studied in micelles. In the cationic and the nonionic micelles, significantly higher fluorescence quantum yield is observed in comparison to the anionic micelles, due to much lower accessibility of DMO to the water molecules in the former micelles than the latter. Time-resolved fluorescence decays were characterized by a fast (τ{sub 1}) and a slow (τ{sub 2}) component of decay in all the micelles. The fast decay component (τ{sub 1}) increases significantly in going from the anionic micelles to the cationic micelles, because of the poorly hydrated headgroup region of the latter micelles compared to the former. Furthermore, much higher value of the slow component of decay (τ{sub 2}) is observed for the cationic and the neutral micelles than the anionic micelles. This is attributed to the increased penetration of water molecules into the micellar core of the anionic micelles compared to the cationic and the neutral micelles. - Highlights: • Photophysics of the fluorophore are remarkably different in the cationic and the anionic micelles. • Differential hydration of the surfactant headgroups gives rise to significantly different fluorescence quantum yield and lifetime in oppositely charged micelles. • Electrostatic interactions fine tune location of the fluorophore in the micelle–water interface of ionic micelles.

Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: Evidence for differential gene expression

International Nuclear Information System (INIS)

Kim, Sunyoung; Baltimore, D.; Byrn, R.; Groopman, J.

1989-01-01

The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. The authors have established a single-cycle growth condition for HIV in H9 cells, a human CD4 + lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes

Unscheduled DNA synthesis in human skin after in vitro ultraviolet-excimer laser ablation

International Nuclear Information System (INIS)

Green, H.A.; Margolis, R.; Boll, J.; Kochevar, I.E.; Parrish, J.A.; Oseroff, A.R.

1987-01-01

DNA damage repaired by the excision repair system and measured as unscheduled DNA synthesis (UDS) was assessed in freshly excised human skin after 193 and 248 nm ultraviolet (UV)-excimer laser ablative incisions. Laser irradiation at 248 nm induced DNA damage throughout a zone of cells surrounding the ablated and heat-damaged area. In contrast, with 193 nm irradiation UDS was not detected in cells adjacent to the ablated area, even though DNA strongly absorbs this wavelength. Our results suggest that the lack of UDS after 193 nm irradiation is due to: ''shielding'' of DNA by the cellular interstitium, membrane, and cytoplasm, DNA damage that is not repaired by excision repair, or thermal effects that either temporarily or permanently inhibit the excision repair processes

The acute effects of ionizing radiation on DNA synthesis and the development of antibody-producing cells

International Nuclear Information System (INIS)

Harris, G.; Olsen, I.; Cramp, W.A.

1981-01-01

Ionizing radiation inhibited the development of specific haemolysin-producing cells (PFC) and depressed the incorporation of ( 3 H) thymidine by rabbit spleen explants responding to SRC in the culture medium. In contrast to these effects, the rates of incorporation of precursors for protein and RNA synthesis were much less affected. The depression of ( 3 H) thymidine incorporation was found to result from a quantitative reduction of new DNA synthesis, without any change in the proportion of labelled cells, at any time after irradiation. The DNA synthesis occurring in these cells preparing to develop antibody-producing capacity was thus radio-sensitive, but the exact nature of the defect resulting from exposure to radiation requires further study. (orig.)

Novel pattern of post-γ ray de novo DNA synthesis in a radioresistant human strain

International Nuclear Information System (INIS)

Mirzayans, R.; Gentner, N.E.; Paterson, M.C.

1985-01-01

Enhanced resistance to radiation cytotoxicity in a fibroblast strain from an afflicted member of a Li-Fraumeni syndrome family may be largely ascribable to a change in the pattern of DNA replicative synthesis following γ ray exposure. That is, the extent of the initial radiogenic inhibition of replicative synthesis and the time interval before its subsequent recovery were both found to be greater in radioresistant (RR) compared to normal cells. In addition, the post-recovery replication rates in the RR cells were both higher and longer lasting than those in the control cells. A similar differential pattern was also seen following treatment with 4NQO, another DNA-damaging agent to which this RR strain displays enhanced resistance. Moreover, several conventional DNA repair assays indicated that the RR cells repair radiogenic damage at normal rates. The authors therefore suggest that the increased inhibition and prolonged lag in resumption of replicative synthesis seen in the RR strain upon exposure to certain genotoxic agents may enhance cellular recovery by ''buying additional time'' for processing of potentially lethal lesions

Bacillus subtilis DNA polymerases, PolC and DnaE, are required for both leading and lagging strand synthesis in SPP1 origin-dependent DNA replication

Science.gov (United States)

Seco, Elena M.

2017-01-01

Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448

Effects of the Nd:YAG laser on DNA synthesis and collagen production in human skin fibroblast cultures

Energy Technology Data Exchange (ETDEWEB)

Castro, D.J.; Abergel, R.P.; Meeker, C.; Dwyer, R.M.; Lesavoy, M.A.; Uitto, J.

1983-09-01

Human skin fibroblasts were subjected to treatment with a Neodymium:YAG laser at 1060 nm with varying levels of energy determined by a reproducible method of dosimetry. DNA synthesis in the cells was measured by the incorporation of (3H)thymidine, and collagen production was monitored by the synthesis of nondialyzable (3H)hydroxyproline after incubation of cells with (3H)proline. Using energy levels equal to 1.7 X 10(3) J/cm2, a significant reduction in DNA synthesis was noted, while the cells remained viable as tested by the trypan blue exclusion test. With energy levels higher or equal to 2.3 X 10(3) J/cm2, the suppression of DNA synthesis was accompanied by cell nonviability. The collagen production, when measured immediately following the treatment with 1.7 X 10(3) J/cm2, was markedly reduced, and similar effects were observed with higher energy levels. However, when the cells were tested for collagen production at 20 hours following laser treatment, there was a significant decrease in collagen production at energy levels as low as 1.1 X 10(3) J/cm2, a dose that did not affect DNA synthesis or cell viability. Thus, the results indicate that the Nd:YAG laser can selectively suppress collagen production without affecting cell proliferation. These observations suggest that laser treatment could potentially be used to reduce collagen deposition in conditions such as keloids and hypertrophic scars.

Slow elimination of injured liver DNA bases of γ-irradiated old mice

International Nuclear Information System (INIS)

Gaziev, A.I.; Malakhov, L.V.; Fomenko, L.A.

1982-01-01

The paper presents a study of the elimination of injured bases from the liver DNA of old and young mice after their exposure to γ rays. The presented data show that if DNA from the liver of irradiated mice is treated with incision enzymes, its priming activity is increased. In the case of enzymatic treatment of DNA isolated 5 h after irradiation we find a great difference between the priming activity of the liver DNA of old and young mice. The reason for this difference is that the liver DNA of 20-month old mice 5 h after irradiation still has many unrepaired injured bases. These data indicated that the rate of incision of γ-injured DNA bases in the liver of old mice is lower than in the liver of young mice. In the liver of mice of different age the rate of restitution of DNA, single-strand breaks induced by γ rays in doses up to 100 Gy is the same. At the same time, the level of induced reparative synthesis of DNA in cells of an old organism is lower than in cells of a young organism. The obtained data suggest that reduction of the rate of elimination of modified bases from the cell DNA of 20-month old mice is due to reduction of the activity of the DNA repair enzymes or to restrictions in the chromatin in the access of these enzymes to the injured regions of DNA in the cells of old animals

PSMA ligand conjugated PCL-PEG polymeric micelles targeted to prostate cancer cells.

Directory of Open Access Journals (Sweden)

Jian Jin

Full Text Available In this content, a small molecular ligand of prostate specific membrane antigen (SMLP conjugated poly (caprolactone (PCL-b-poly (ethylene glycol (PEG copolymers with different block lengths were synthesized to construct a satisfactory drug delivery system. Four different docetaxel-loaded polymeric micelles (DTX-PMs were prepared by dialysis with particle sizes less than 60 nm as characterized by dynamic light scattering (DLS and transmission electron microscope (TEM. Optimization of the prepared micelles was conducted based on short-term stability and drug-loading content. The results showed that optimized systems were able to remain stable over 7 days. Compared with Taxotere, DTX-PMs with the same ratio of hydrophilic/hydrophobic chain length displayed similar sustained release behaviors. The cytotoxicity of the optimized targeted DTX-PCL12K-PEG5K-SMLP micelles (DTX-PMs2 and non-targeted DTX-PCL12K-mPEG5K micelles (DTX-PMs1 were evaluated by MTT assays using prostate specific membrane antigen (PSMA positive prostate adenocarcinoma cells (LNCaP. The results showed that the targeted micelles had a much lower IC50 than their non-targeted counterparts (48 h: 0.87 ± 0.27 vs 13.48 ± 1.03 µg/ml; 72 h: 0.02 ± 0.008 vs 1.35 ± 0.54 µg/ml. In vitro cellular uptake of PMs2 showed 5-fold higher fluorescence intensity than that of PMs1 after 4 h incubation. According to these results, the novel nano-sized drug delivery system based on DTX-PCL-PEG-SMLP offers great promise for the treatment of prostatic cancer.

Micelle-encapsulated fullerenes in aqueous electrolytes

Energy Technology Data Exchange (ETDEWEB)

Ala-Kleme, T., E-mail: timo.ala-kleme@utu.fi [Department of Chemistry, University of Turku, 20014 Turku (Finland); Maeki, A.; Maeki, R.; Kopperoinen, A.; Heikkinen, M.; Haapakka, K. [Department of Chemistry, University of Turku, 20014 Turku (Finland)

2013-03-15

Different micellar particles Mi(M{sup +}) (Mi=Triton X-100, Triton N-101 R, Triton CF-10, Brij-35, M{sup +}=Na{sup +}, K{sup +}, Cs{sup +}) have been prepared in different aqueous H{sub 3}BO{sub 3}/MOH background electrolytes. It has been observed that these particles can be used to disperse the highly hydrophobic spherical [60]fullerene (1) and ellipsoidal [70]fullerene (2). This dispersion is realised as either micelle-encapsulated monomers Mi(M{sup +})1{sub m} and Mi(M{sup +})2{sub m} or water-soluble micelle-bound aggregates Mi(M{sup +})1{sub agg} and Mi(M{sup +})2{sub agg}, where especially the hydration degree and polyoxyethylene (POE) thickness of the micellar particle seems to play a role of vital importance. Further, the encapsulation microenvironment of 1{sub m} was found to depend strongly on the selected monovalent electrolyte cation, i.e., the encapsulated 1{sub m} is accommodated in the more hydrophobic microenvironment the higher the cationic solvation number is. - Highlights: Black-Right-Pointing-Pointer Different micellar particles is used to disperse [60]fullerene and [70]fullerene. Black-Right-Pointing-Pointer Fullerene monomers or aggregates are dispersed encaging or bounding by micelles. Black-Right-Pointing-Pointer Effective facts are hydration degree and polyoxyethylene thickness of micelle.

Synthesis and DNA interaction of a Sm(III) complex of a Schiff base ...

African Journals Online (AJOL)

The interaction between the Sm(III) complex of an ionic Schiff base [HL]-, derived from vanillin and L-tryptophan, and herring sperm DNA at physiological pH (7.40) has been studied by UV-Vis absorption, fluorescence and viscosity methods. The binding ratios nSm(III) : nK[HL] = 1:1 and nSm(III)L: nDNA =5:1 were confirmed ...

Synthesis of DNA

Science.gov (United States)

Mariella, Jr., Raymond P.

2008-11-18

A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

Selective inhibition of influenza virus protein synthesis by inhibitors of DNA function

International Nuclear Information System (INIS)

Minor, P.D.; Dimmock, N.J.

1977-01-01

Various known inhibitors of cellular DNA function were shown to inhibit cellular RNA synthesis and influenza (fowl plague) virus multiplication. The drugs were investigated for their effect upon the synthesis of influenza virus proteins. According to this effect they could be classified with previously studied compounds as follows: Group I (ethidium bromide, proflavine, and N-nitroquinoline-N-oxide) inhibited both viral and cellular protein synthesis; Group II (nogalomycin, daunomycin and α-amanitin) inhibited viral but not cellular protein synthesis, and all viral proteins were inhibited coordinately; Group III (mithramycin, echinomycin, and actinomycin D) inhibited all viral but not cellular protein synthesis at high concentrations, but at a lower critical concentration inhibited the synthesis of viral haemagglutinin, neuraminidase, and M protein preferentially; Group IV(uv irradiation and camptothecin) inhibited the synthesis of viral haemagglutinin, neuraminidase, and M protein, but not other viral proteins, even at high doses. The mode of action of these inhibitors is discussed in relation to the mechanism of the nuclear events upon which influenza virus multiplication is dependent

Synthesis of schiff bases of pyridine-4-carbaldehyde and their antioxidant and DNA binding studies

International Nuclear Information System (INIS)

Shamim, S.; Murtaza, S.; Nazar, M.F.

2016-01-01

A series of Schiff bases of pyridine-4-carbaldehyde with 3-aminobenzoic acid, 2-aminobenzoic acid, 4-aminobenzoic acid, 1,3-phenylenediamine, 1,2-phenylenediamine, 2-aminothiophenol, 4-aminoantipyrene, 2-aminophenol and naphthalene-1-amine was synthesized and compounds were characterized by FTIR, NMR and mass spectrometry. The synthesized compounds were evaluated for their antioxidant and DNA binding interaction studies. DPPH scavenging method was used to evaluate the antioxidant activities of synthesized Schiff bases at six gradually increasing concentrations of 0.5-5mg/ml. 2-((pyridin-4-ylmethylidene)amino)phenol came out to be the most efficient antioxidant at a concentration of 4mg/ml with 74% inhibition of free radicals generated by DPPH. The DNA binding interaction of the synthesized Schiff bases was determined using UV-Vis absorption titration method. Both the hypochromic and hyperchromic effects were observed along the series. The values for the binding constant (K) and free energy change (G) were calculated and most of the Schiff bases have high positive K values which indicate the efficient binding of Schiff bases with DNA. Molecular docking studies as carried out using PatchDock molecular algorithm software also indicated the high values for geometrical shape complementarity score suggesting the stabilities of Schiff bases/DNA complex. Docking studies also suggested the minor groove binding of the Schiff bases with DNA. Drug-likeness of the synthesized compounds was also tested in silico and the results are accordingly discussed. (author)

Simple Laboratory methods to measure cell proliferation using DNA synthesis property

Directory of Open Access Journals (Sweden)

Madhavan H N

2007-01-01

Full Text Available This is a mini-review on the techniques to measure proliferation of cells by estimation of DNA synthesis. This is not an exhaustive review of literature, but a bird’s eye view of a few selected articles which may provide the technical details to the readers.The nucleus of a cell occupies about 10-30% of the cells space, depends on the type of genetic material (DNA -DeoxyriboNucleic Acid. DNA is a long, double-stranded, helical molecule which carries the genetic information. Duplication of the DNA takes place by the phenomena of replication. One copy of double-stranded DNA molecule forms two double-stranded DNA molecules. DNA replication is the fundamental process used in all living organisms as it is the basis for biological inheritance. This process is known also as Mitosis in somatic cells. In Mitosis, the duplication process results in two genetically identical "daughter" cells from a single "parent" cell. The resulting double-stranded DNA molecules are identical; proof reading and error-checking mechanisms exist to ensure near perfect pair. Mitosis is divided into six phases: prophase, prometaphase, metaphase, anaphase, telophase, and cytokinesis.

Investigation of a new thermosensitive block copolymer micelle: hydrolysis, disruption, and release.

Science.gov (United States)

Pelletier, Maxime; Babin, Jérôme; Tremblay, Luc; Zhao, Yue

2008-11-04

Thermosensitive polymer micelles are generally obtained with block copolymers in which one block exhibits a lower critical solution temperature in aqueous solution. We investigate a different design that is based on the use of one block bearing a thermally labile side group, whose hydrolysis upon heating shifts the hydrophilic-hydrophobic balance toward the destabilization of block copolymer micelles. Atom transfer radical polymerization was utilized to synthesize a series of diblock copolymers composed of hydrophilic poly(ethylene oxide) (PEO) and hydrophobic poly(2-tetrahydropyranyl methacrylate) (PTHPMA). We show that micelles of PEO-b-PTHPMA in aqueous solution can be destabilized as a result of the thermosensitive hydrolytic cleavage of tetrahydropyranyl (THP) groups that transforms PTHPMA into hydrophilic poly(methacrylic acid). The three related processes occurring in aqueous solution, namely, hydrolytic cleavage of THP, destabilization of micelles, and release of loaded Nile Red (NR), were investigated simultaneously using 1H NMR, dynamic light scattering, and fluorescence spectroscopy, respectively. At 80 degrees C, the results suggest that the three events proceed with a similar kinetics. Although slower than at elevated temperatures, the disruption of PEO-b-PTHPMA micelles can take place at the body temperature (approximately 37 degrees C), and the release kinetics of NR can be adjusted by changing the relative lengths of the two blocks or the pH of the solution.

The effect of caffeine and adenine on radiation induced suppression of DNA synthesis, and cell survival

International Nuclear Information System (INIS)

Wilcoxson, L.T.; Griffiths, T.D.

1984-01-01

Exposure of cultured mammalian cells to ionizing radiation or UV light results in a transient decrease in the rate of DNA synthesis. This depression in synthetic rate may be attenuated or deferred via a post-irradiation treatment with caffeine or adenine. It has been suggested that this attenuation may increase the fixation of damage and, therefore, increase radiation sensitivity. However, it has been previously reported that, for V79 cells treated with caffeine or adenine, no correlation exists between the extent of depression and cell survival. The present investigation expands upon these findings by examining the effect of caffeine or adenine post-irradiation treatment on two cell lines with normal UV sensitivity, mouse 3T3 and CHO AA8 cells, and one UV sensitive cell line, CHO UV5 cells. Both caffeine and adenine have been found to reduce, or delay, the suppression in DNA synthesis in all three cell lines. Surprisingly, caffeine appeared to induced even the UV5 cells to recover DNA synthetic ability. The amount of reduction in suppression of DNA synthesis, however, varies between the different cell lines and no consistent relationship with cell survival has emerged

Estrogen-induced DNA synthesis in vascular endothelial cells is mediated by ROS signaling

Directory of Open Access Journals (Sweden)

Felty Quentin

2006-04-01

Full Text Available Abstract Background Since estrogen is known to increase vascular endothelial cell growth, elevated estrogen exposure from hormone replacement therapy or oral contraceptives has the potential to contribute in the development of abnormal proliferative vascular lesions and subsequent thickening of the vasculature. How estrogen may support or promote vascular lesions is not clear. We have examined in this study whether estrogen exposure to vascular endothelial cells increase the formation of reactive oxygen species (ROS, and estrogen-induced ROS is involved in the growth of endothelial cells. Methods The effect of estrogen on the production of intracellular oxidants and the role of estrogen-induced ROS on cell growth was studied in human umbilical vein endothelial cells. ROS were measured by monitoring the oxidation of 2'7'-dichlorofluorescin by spectrofluorometry. Endothelial cell growth was measured by a colorimetric immunoassay based on BrdU incorporation into DNA. Results Physiological concentrations of estrogen (367 fmol and 3.67 pmol triggered a rapid 2-fold increase in intracellular oxidants in endothelial cells. E2-induced ROS formation was inhibited to basal levels by cotreatment with the mitochondrial inhibitor rotenone (2 μM and xanthine oxidase inhibitor allopurinol (50 μM. Inhibitors of NAD(PH oxidase, apocynin and DPI, did not block E2-induced ROS formation. Furthermore, the NOS inhibitor, L-NAME, did not prevent the increase in E2-induced ROS. These findings indicate both mitochondria and xanthine oxidase are the source of ROS in estrogen treated vascular endothelial cells. E2 treated cells showed a 2-fold induction of BrdU incorporation at 18 h which was not observed in cells exposed to vehicle alone. Cotreatment with ebselen (20 μM and NAC (1 mM inhibited E2-induced BrdU incorporation without affecting the basal levels of DNA synthesis. The observed inhibitory effect of NAC and ebselen on E2-induced DNA synthesis was also shown

5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

Science.gov (United States)

Frank, Natia L.; Meade, Thomas J.

2003-01-01

Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

Backbone-hydrazone-containing biodegradable copolymeric micelles for anticancer drug delivery

Energy Technology Data Exchange (ETDEWEB)

Xu, Jing; Luan, Shujuan; Qin, Benkai; Wang, Yingying; Wang, Kai; Qi, Peilan; Song, Shiyong, E-mail: pharmsong@henu.edu.cn [Henan University, Institute of Pharmacy (China)

2016-11-15

Well-defined biodegradable, pH-sensitive amphiphilic block polymers, poly(ethylene glycol)-Hyd-poly(lactic acid) (mPEG-Hyd-PLA) which have acid-cleavable linkages in their backbones, were synthesized via ring-opening polymerization initiated from hydrazone-containing macroinitiators. Introducing a hydrazone bond onto the backbone of an amphiphilic copolymer will find a broad-spectrum encapsulation of hydrophobic drugs. Dynamic light scattering (DLS) and transmission electron microscopy showed that the diblock copolymers self-assembled into stable micelles with average diameters of 100 nm. The mean diameters and size distribution of the hydrazone-containing micelles changed obviously in mildly acidic pH (multiple peaks from 1 to 202 nm appeared under a pH 4.0 condition) than in neutral, while there were no changes in the case of non-sensitive ones. Doxorubicin (DOX) and paclitaxel (PTX) were loaded with drug loading content ranging from 2.4 to 3.5 %, respectively. Interestingly, the anticancer drugs released from mPEG-Hyd-PLA micelles could also be promoted by the increased acidity. An in vitro cytotoxicity study showed that the DOX-loaded mPEG-Hyd-PLA micelles have significantly enhanced cytotoxicity against HepG2 cells compared with the non-sensitive poly(ethylene glycol)-block-poly(lactic acid) (mPEG-PLA) micelles. Confocal microscopy observation indicated that more DOX were delivered into the nuclei of cells following 6 or 12 h incubation with DOX-loaded mPEG-Hyd-PLA micelles. In vivo studies on H22-bearing Swiss mice demonstrated the superior anticancer activity of DOX-loaded mPEG-Hyd-PLA micelles over free DOX and DOX-loaded mPEG-PLA micelles. These hydrazone-containing pH-responsive degradable micelles provide a useful strategy for antitumor drug delivery.

Backbone-hydrazone-containing biodegradable copolymeric micelles for anticancer drug delivery

International Nuclear Information System (INIS)

Xu, Jing; Luan, Shujuan; Qin, Benkai; Wang, Yingying; Wang, Kai; Qi, Peilan; Song, Shiyong

2016-01-01

Well-defined biodegradable, pH-sensitive amphiphilic block polymers, poly(ethylene glycol)-Hyd-poly(lactic acid) (mPEG-Hyd-PLA) which have acid-cleavable linkages in their backbones, were synthesized via ring-opening polymerization initiated from hydrazone-containing macroinitiators. Introducing a hydrazone bond onto the backbone of an amphiphilic copolymer will find a broad-spectrum encapsulation of hydrophobic drugs. Dynamic light scattering (DLS) and transmission electron microscopy showed that the diblock copolymers self-assembled into stable micelles with average diameters of 100 nm. The mean diameters and size distribution of the hydrazone-containing micelles changed obviously in mildly acidic pH (multiple peaks from 1 to 202 nm appeared under a pH 4.0 condition) than in neutral, while there were no changes in the case of non-sensitive ones. Doxorubicin (DOX) and paclitaxel (PTX) were loaded with drug loading content ranging from 2.4 to 3.5 %, respectively. Interestingly, the anticancer drugs released from mPEG-Hyd-PLA micelles could also be promoted by the increased acidity. An in vitro cytotoxicity study showed that the DOX-loaded mPEG-Hyd-PLA micelles have significantly enhanced cytotoxicity against HepG2 cells compared with the non-sensitive poly(ethylene glycol)-block-poly(lactic acid) (mPEG-PLA) micelles. Confocal microscopy observation indicated that more DOX were delivered into the nuclei of cells following 6 or 12 h incubation with DOX-loaded mPEG-Hyd-PLA micelles. In vivo studies on H22-bearing Swiss mice demonstrated the superior anticancer activity of DOX-loaded mPEG-Hyd-PLA micelles over free DOX and DOX-loaded mPEG-PLA micelles. These hydrazone-containing pH-responsive degradable micelles provide a useful strategy for antitumor drug delivery.

The essential component in DNA-based information storage system: robust error-tolerating module

Directory of Open Access Journals (Sweden)

Aldrin Kay-Yuen eYim

2014-11-01

Full Text Available The size of digital data is ever increasing and is expected to grow to 40,000EB by 2020, yet the estimated global information storage capacity in 2011 is less than 300EB, indicating that most of the data are transient. DNA, as a very stable nano-molecule, is an ideal massive storage device for long-term data archive. The two most notable illustrations are from Church et al. and Goldman et al., whose approaches are well-optimized for most sequencing platforms – short synthesized DNA fragments without homopolymer. Here we suggested improvements on error handling methodology that could enable the integration of DNA-based computational process, e.g. algorithms based on self-assembly of DNA. As a proof of concept, a picture of size 438 bytes was encoded to DNA with Low-Density Parity-Check error-correction code. We salvaged a significant portion of sequencing reads with mutations generated during DNA synthesis and sequencing and successfully reconstructed the entire picture. A modular-based programming framework - DNAcodec with a XML-based data format was also introduced. Our experiments demonstrated the practicability of long DNA message recovery with high error-tolerance, which opens the field to biocomputing and synthetic biology.

Polarizability of DNA Block Copolymer Nanoparticles Observed by Electrostatic Force Microscopy

NARCIS (Netherlands)

Sowwan, Mukhles; Faroun, Maryam; Mentovich, Elad; Ibrahim, Imad; Haboush, Shayma; Alemdaroglu, Fikri Emrah; Kwak, Minseok; Richter, Shachar; Herrmann, Andreas

2010-01-01

In this study, DNA block copolymer (DBC) micelles with a polystyrene (PS) core and a single-stranded (ss) DNA shell were doped with ferrocene (Fc) molecules. Tapping mode atomic force microscopy (AFM) was used to study the morphology of the doped and undoped block copolymer aggregates. We show that