WorldWideScience

Sample records for dna vector encoding

  1. Cationic lipid-formulated DNA vaccine against hepatitis B virus: immunogenicity of MIDGE-Th1 vectors encoding small and large surface antigen in comparison to a licensed protein vaccine.

    Directory of Open Access Journals (Sweden)

    Anne Endmann

    Full Text Available Currently marketed vaccines against hepatitis B virus (HBV based on the small (S hepatitis B surface antigen (HBsAg fail to induce a protective immune response in about 10% of vaccinees. DNA vaccination and the inclusion of PreS1 and PreS2 domains of HBsAg have been reported to represent feasible strategies to improve the efficacy of HBV vaccines. Here, we evaluated the immunogenicity of SAINT-18-formulated MIDGE-Th1 vectors encoding the S or the large (L protein of HBsAg in mice and pigs. In both animal models, vectors encoding the secretion-competent S protein induced stronger humoral responses than vectors encoding the L protein, which was shown to be retained mainly intracellularly despite the presence of a heterologous secretion signal. In pigs, SAINT-18-formulated MIDGE-Th1 vectors encoding the S protein elicited an immune response of the same magnitude as the licensed protein vaccine Engerix-B, with S protein-specific antibody levels significantly higher than those considered protective in humans, and lasting for at least six months after the third immunization. Thus, our results provide not only the proof of concept for the SAINT-18-formulated MIDGE-Th1 vector approach but also confirm that with a cationic-lipid formulation, a DNA vaccine at a relatively low dose can elicit an immune response similar to a human dose of an aluminum hydroxide-adjuvanted protein vaccine in large animals.

  2. Local Patch Vectors Encoded by Fisher Vectors for Image Classification

    Directory of Open Access Journals (Sweden)

    Shuangshuang Chen

    2018-02-01

    Full Text Available The objective of this work is image classification, whose purpose is to group images into corresponding semantic categories. Four contributions are made as follows: (i For computational simplicity and efficiency, we directly adopt raw image patch vectors as local descriptors encoded by Fisher vector (FV subsequently; (ii For obtaining representative local features within the FV encoding framework, we compare and analyze three typical sampling strategies: random sampling, saliency-based sampling and dense sampling; (iii In order to embed both global and local spatial information into local features, we construct an improved spatial geometry structure which shows good performance; (iv For reducing the storage and CPU costs of high dimensional vectors, we adopt a new feature selection method based on supervised mutual information (MI, which chooses features by an importance sorting algorithm. We report experimental results on dataset STL-10. It shows very promising performance with this simple and efficient framework compared to conventional methods.

  3. Assessment of a DNA Vaccine Encoding Burkholderia pseudomallei Bacterioferritin

    Science.gov (United States)

    2007-08-01

    excised by restriction enzyme digestion with Xba I and subcloned into the mammalian expression vector pcDNA3.1start, to create the DNA vaccine...Lewis, J. T. August, and E. T. Marques. 2006. DNA Encoding an HIV -1 Gag/Human Lysosome-Associated Membrane Protein-1 Chimera Elicits a Broad

  4. A Plasmodium vivax Plasmid DNA- and Adenovirus-Vectored Malaria Vaccine Encoding Blood-Stage Antigens AMA1 and MSP142in a Prime/Boost Heterologous Immunization Regimen Partially Protects Aotus Monkeys against Blood-Stage Challenge.

    Science.gov (United States)

    Obaldia, Nicanor; Stockelman, Michael G; Otero, William; Cockrill, Jennifer A; Ganeshan, Harini; Abot, Esteban N; Zhang, Jianfeng; Limbach, Keith; Charoenvit, Yupin; Doolan, Denise L; Tang, De-Chu C; Richie, Thomas L

    2017-04-01

    Malaria is caused by parasites of the genus Plasmodium , which are transmitted to humans by the bites of Anopheles mosquitoes. After the elimination of Plasmodium falciparum , it is predicted that Plasmodium vivax will remain an important cause of morbidity and mortality outside Africa, stressing the importance of developing a vaccine against P. vivax malaria. In this study, we assessed the immunogenicity and protective efficacy of two P. vivax antigens, apical membrane antigen 1 (AMA1) and the 42-kDa C-terminal fragment of merozoite surface protein 1 (MSP1 42 ) in a plasmid recombinant DNA prime/adenoviral (Ad) vector boost regimen in Aotus monkeys. Groups of 4 to 5 monkeys were immunized with plasmid DNA alone, Ad alone, prime/boost regimens with each antigen, prime/boost regimens with both antigens, and empty vector controls and then subjected to blood-stage challenge. The heterologous immunization regimen with the antigen pair was more protective than either antigen alone or both antigens delivered with a single vaccine platform, on the basis of their ability to induce the longest prepatent period and the longest time to the peak level of parasitemia, the lowest peak and mean levels of parasitemia, the smallest area under the parasitemia curve, and the highest self-cure rate. Overall, prechallenge MSP1 42 antibody titers strongly correlated with a decreased parasite burden. Nevertheless, a significant proportion of immunized animals developed anemia. In conclusion, the P. vivax plasmid DNA/Ad serotype 5 vaccine encoding blood-stage parasite antigens AMA1 and MSP1 42 in a heterologous prime/boost immunization regimen provided significant protection against blood-stage challenge in Aotus monkeys, indicating the suitability of these antigens and this regimen for further development. Copyright © 2017 American Society for Microbiology.

  5. Storing data encoded DNA in living organisms

    Science.gov (United States)

    Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA

    2006-06-06

    Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

  6. Dendritic Cells Genetically Modified with an Adenovirus Vector Encoding the cDNA for a Model Antigen Induce Protective and Therapeutic Antitumor Immunity

    Science.gov (United States)

    Song, Wenru; Kong, Hwai-Loong; Carpenter, Heather; Torii, Hideshi; Granstein, Richard; Rafii, Shahin; Moore, Malcolm A.S.; Crystal, Ronald G.

    1997-01-01

    Dendritic cells (DCs) are potent antigen-presenting cells that play a critical role in the initiation of antitumor immune responses. In this study, we show that genetic modifications of a murine epidermis-derived DC line and primary bone marrow–derived DCs to express a model antigen β-galactosidase (βgal) can be achieved through the use of a replication-deficient, recombinant adenovirus vector, and that the modified DCs are capable of eliciting antigen-specific, MHC-restricted CTL responses. Importantly, using a murine metastatic lung tumor model with syngeneic colon carcinoma cells expressing βgal, we show that immunization of mice with the genetically modified DC line or bone marrow DCs confers potent protection against a lethal tumor challenge, as well as suppression of preestablished tumors, resulting in a significant survival advantage. We conclude that genetic modification of DCs to express antigens that are also expressed in tumors can lead to antigen-specific, antitumor killer cells, with a concomitant resistance to tumor challenge and a decrease in the size of existing tumors. PMID:9334364

  7. An encyclopedia of mouse DNA elements (Mouse ENCODE).

    Science.gov (United States)

    Stamatoyannopoulos, John A; Snyder, Michael; Hardison, Ross; Ren, Bing; Gingeras, Thomas; Gilbert, David M; Groudine, Mark; Bender, Michael; Kaul, Rajinder; Canfield, Theresa; Giste, Erica; Johnson, Audra; Zhang, Mia; Balasundaram, Gayathri; Byron, Rachel; Roach, Vaughan; Sabo, Peter J; Sandstrom, Richard; Stehling, A Sandra; Thurman, Robert E; Weissman, Sherman M; Cayting, Philip; Hariharan, Manoj; Lian, Jin; Cheng, Yong; Landt, Stephen G; Ma, Zhihai; Wold, Barbara J; Dekker, Job; Crawford, Gregory E; Keller, Cheryl A; Wu, Weisheng; Morrissey, Christopher; Kumar, Swathi A; Mishra, Tejaswini; Jain, Deepti; Byrska-Bishop, Marta; Blankenberg, Daniel; Lajoie, Bryan R; Jain, Gaurav; Sanyal, Amartya; Chen, Kaun-Bei; Denas, Olgert; Taylor, James; Blobel, Gerd A; Weiss, Mitchell J; Pimkin, Max; Deng, Wulan; Marinov, Georgi K; Williams, Brian A; Fisher-Aylor, Katherine I; Desalvo, Gilberto; Kiralusha, Anthony; Trout, Diane; Amrhein, Henry; Mortazavi, Ali; Edsall, Lee; McCleary, David; Kuan, Samantha; Shen, Yin; Yue, Feng; Ye, Zhen; Davis, Carrie A; Zaleski, Chris; Jha, Sonali; Xue, Chenghai; Dobin, Alex; Lin, Wei; Fastuca, Meagan; Wang, Huaien; Guigo, Roderic; Djebali, Sarah; Lagarde, Julien; Ryba, Tyrone; Sasaki, Takayo; Malladi, Venkat S; Cline, Melissa S; Kirkup, Vanessa M; Learned, Katrina; Rosenbloom, Kate R; Kent, W James; Feingold, Elise A; Good, Peter J; Pazin, Michael; Lowdon, Rebecca F; Adams, Leslie B

    2012-08-13

    To complement the human Encyclopedia of DNA Elements (ENCODE) project and to enable a broad range of mouse genomics efforts, the Mouse ENCODE Consortium is applying the same experimental pipelines developed for human ENCODE to annotate the mouse genome.

  8. The ENCODE (ENCyclopedia Of DNA Elements) Project.

    Science.gov (United States)

    2004-10-22

    The ENCyclopedia Of DNA Elements (ENCODE) Project aims to identify all functional elements in the human genome sequence. The pilot phase of the Project is focused on a specified 30 megabases (approximately 1%) of the human genome sequence and is organized as an international consortium of computational and laboratory-based scientists working to develop and apply high-throughput approaches for detecting all sequence elements that confer biological function. The results of this pilot phase will guide future efforts to analyze the entire human genome.

  9. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Directory of Open Access Journals (Sweden)

    Hamada F Rady

    Full Text Available Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC. DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route.

  10. Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair

    International Nuclear Information System (INIS)

    Thomas, S.M.; Sedgwick, S.G.

    1989-01-01

    Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli

  11. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  12. Solving traveling salesman problems with DNA molecules encoding numerical values.

    Science.gov (United States)

    Lee, Ji Youn; Shin, Soo-Yong; Park, Tai Hyun; Zhang, Byoung-Tak

    2004-12-01

    We introduce a DNA encoding method to represent numerical values and a biased molecular algorithm based on the thermodynamic properties of DNA. DNA strands are designed to encode real values by variation of their melting temperatures. The thermodynamic properties of DNA are used for effective local search of optimal solutions using biochemical techniques, such as denaturation temperature gradient polymerase chain reaction and temperature gradient gel electrophoresis. The proposed method was successfully applied to the traveling salesman problem, an instance of optimization problems on weighted graphs. This work extends the capability of DNA computing to solving numerical optimization problems, which is contrasted with other DNA computing methods focusing on logical problem solving.

  13. Enhanced immunogenicity of DNA fusion vaccine encoding secreted hepatitis B surface antigen and chemokine RANTES

    International Nuclear Information System (INIS)

    Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung

    2003-01-01

    To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES

  14. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  15. Multiplexed Sequence Encoding: A Framework for DNA Communication

    Science.gov (United States)

    Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.

    2016-01-01

    Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646

  16. Multi-modulus algorithm based on global artificial fish swarm intelligent optimization of DNA encoding sequences.

    Science.gov (United States)

    Guo, Y C; Wang, H; Wu, H P; Zhang, M Q

    2015-12-21

    Aimed to address the defects of the large mean square error (MSE), and the slow convergence speed in equalizing the multi-modulus signals of the constant modulus algorithm (CMA), a multi-modulus algorithm (MMA) based on global artificial fish swarm (GAFS) intelligent optimization of DNA encoding sequences (GAFS-DNA-MMA) was proposed. To improve the convergence rate and reduce the MSE, this proposed algorithm adopted an encoding method based on DNA nucleotide chains to provide a possible solution to the problem. Furthermore, the GAFS algorithm, with its fast convergence and global search ability, was used to find the best sequence. The real and imaginary parts of the initial optimal weight vector of MMA were obtained through DNA coding of the best sequence. The simulation results show that the proposed algorithm has a faster convergence speed and smaller MSE in comparison with the CMA, the MMA, and the AFS-DNA-MMA.

  17. Main features of DNA-based immunization vectors

    Directory of Open Access Journals (Sweden)

    V. Azevedo

    1999-02-01

    Full Text Available DNA-based immunization has initiated a new era of vaccine research. One of the main goals of gene vaccine development is the control of the levels of expression in vivo for efficient immunization. Modifying the vector to modulate expression or immunogenicity is of critical importance for the improvement of DNA vaccines. The most frequently used vectors for genetic immunization are plasmids. In this article, we review some of the main elements relevant to their design such as strong promoter/enhancer region, introns, genes encoding antigens of interest from the pathogen (how to choose and modify them, polyadenylation termination sequence, origin of replication for plasmid production in Escherichia coli, antibiotic resistance gene as selectable marker, convenient cloning sites, and the presence of immunostimulatory sequences (ISS that can be added to the plasmid to enhance adjuvanticity and to activate the immune system. In this review, the specific modifications that can increase overall expression as well as the potential of DNA-based vaccination are also discussed.

  18. A user's guide to the encyclopedia of DNA elements (ENCODE).

    Science.gov (United States)

    2011-04-01

    The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome.

  19. Amsacta moorei entomopoxvirus encodes a functional DNA photolyase (AMV025)

    NARCIS (Netherlands)

    Nalcacioglu, R.; Dizman, Y.A.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.

    2010-01-01

    The major damage induced in DNA by ultraviolet light is the induction of cyclobutane pyrimidine dimers (CPDs). Amsacta moorei entomopoxvirus (AMEV) encodes a CPD photolyase (AMV025) with a putative role in converting these dimers back into monomers. In infected Lymantria dispar cells transcription

  20. Memorizing binary vector sequences by a sparsely encoded network.

    Science.gov (United States)

    Baram, Y

    1994-01-01

    We present a neural network employing Hebbian storage and sparse internal coding, which is capable of memorizing and correcting sequences of binary vectors by association. A ternary version of the Kanerva memory, folded into a feedback configuration, is shown to perform the basic sequence memorization and regeneration function. The inclusion of lateral connections between the internal cells increases the network capacity considerably and facilitates the correction of individual input patterns and the detection of large errors. The introduction of higher delays in the transmission lines between the external input-output layer and the internal memory layer is shown to further improve the network's error correction capability.

  1. Cationic Lipid-Formulated DNA Vaccine against Hepatitis B Virus : Immunogenicity of MIDGE-Th1 Vectors Encoding Small and Large Surface Antigen in Comparison to a Licensed Protein Vaccine

    NARCIS (Netherlands)

    Endmann, Anne; Klunder, Katharina; Kapp, Kerstin; Riede, Oliver; Oswald, Detlef; Talman, Eduard G.; Schroff, Matthias; Kleuss, Christiane; Ruiters, Marcel H. J.; Juhls, Christiane

    2014-01-01

    Currently marketed vaccines against hepatitis B virus (HBV) based on the small (S) hepatitis B surface antigen (HBsAg) fail to induce a protective immune response in about 10% of vaccinees. DNA vaccination and the inclusion of PreS1 and PreS2 domains of HBsAg have been reported to represent feasible

  2. The Encyclopedia of DNA elements (ENCODE): data portal update.

    Science.gov (United States)

    Davis, Carrie A; Hitz, Benjamin C; Sloan, Cricket A; Chan, Esther T; Davidson, Jean M; Gabdank, Idan; Hilton, Jason A; Jain, Kriti; Baymuradov, Ulugbek K; Narayanan, Aditi K; Onate, Kathrina C; Graham, Keenan; Miyasato, Stuart R; Dreszer, Timothy R; Strattan, J Seth; Jolanki, Otto; Tanaka, Forrest Y; Cherry, J Michael

    2018-01-04

    The Encyclopedia of DNA Elements (ENCODE) Data Coordinating Center has developed the ENCODE Portal database and website as the source for the data and metadata generated by the ENCODE Consortium. Two principles have motivated the design. First, experimental protocols, analytical procedures and the data themselves should be made publicly accessible through a coherent, web-based search and download interface. Second, the same interface should serve carefully curated metadata that record the provenance of the data and justify its interpretation in biological terms. Since its initial release in 2013 and in response to recommendations from consortium members and the wider community of scientists who use the Portal to access ENCODE data, the Portal has been regularly updated to better reflect these design principles. Here we report on these updates, including results from new experiments, uniformly-processed data from other projects, new visualization tools and more comprehensive metadata to describe experiments and analyses. Additionally, the Portal is now home to meta(data) from related projects including Genomics of Gene Regulation, Roadmap Epigenome Project, Model organism ENCODE (modENCODE) and modERN. The Portal now makes available over 13000 datasets and their accompanying metadata and can be accessed at: https://www.encodeproject.org/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Multi-Probe Based Artificial DNA Encoding and Matching Classifier for Hyperspectral Remote Sensing Imagery

    Directory of Open Access Journals (Sweden)

    Ke Wu

    2016-08-01

    Full Text Available In recent years, a novel matching classification strategy inspired by the artificial deoxyribonucleic acid (DNA technology has been proposed for hyperspectral remote sensing imagery. Such a method can describe brightness and shape information of a spectrum by encoding the spectral curve into a DNA strand, providing a more comprehensive way for spectral similarity comparison. However, it suffers from two problems: data volume is amplified when all of the bands participate in the encoding procedure and full-band comparison degrades the importance of bands carrying key information. In this paper, a new multi-probe based artificial DNA encoding and matching (MADEM method is proposed. In this method, spectral signatures are first transformed into DNA code words with a spectral feature encoding operation. After that, multiple probes for interesting classes are extracted to represent the specific fragments of DNA strands. During the course of spectral matching, the different probes are compared to obtain the similarity of different types of land covers. By computing the absolute vector distance (AVD between different probes of an unclassified spectrum and the typical DNA code words from the database, the class property of each pixel is set as the minimum distance class. The main benefit of this strategy is that the risk of redundant bands can be deeply reduced and critical spectral discrepancies can be enlarged. Two hyperspectral image datasets were tested. Comparing with the other classification methods, the overall accuracy can be improved from 1.22% to 10.09% and 1.19% to 15.87%, respectively. Furthermore, the kappa coefficient can be improved from 2.05% to 15.29% and 1.35% to 19.59%, respectively. This demonstrated that the proposed algorithm outperformed other traditional classification methods.

  4. DyNAvectors: dynamic constitutional vectors for adaptive DNA transfection.

    Science.gov (United States)

    Clima, Lilia; Peptanariu, Dragos; Pinteala, Mariana; Salic, Adrian; Barboiu, Mihail

    2015-12-25

    Dynamic constitutional frameworks, based on squalene, PEG and PEI components, reversibly connected to core centers, allow the efficient identification of adaptive vectors for good DNA transfection efficiency and are well tolerated by mammalian cells.

  5. A Novel Audio Cryptosystem Using Chaotic Maps and DNA Encoding

    Directory of Open Access Journals (Sweden)

    S. J. Sheela

    2017-01-01

    Full Text Available Chaotic maps have good potential in security applications due to their inherent characteristics relevant to cryptography. This paper introduces a new audio cryptosystem based on chaotic maps, hybrid chaotic shift transform (HCST, and deoxyribonucleic acid (DNA encoding rules. The scheme uses chaotic maps such as two-dimensional modified Henon map (2D-MHM and standard map. The 2D-MHM which has sophisticated chaotic behavior for an extensive range of control parameters is used to perform HCST. DNA encoding technology is used as an auxiliary tool which enhances the security of the cryptosystem. The performance of the algorithm is evaluated for various speech signals using different encryption/decryption quality metrics. The simulation and comparison results show that the algorithm can achieve good encryption results and is able to resist several cryptographic attacks. The various types of analysis revealed that the algorithm is suitable for narrow band radio communication and real-time speech encryption applications.

  6. Encoding Sequential Information in Vector Space Models of Semantics: Comparing Holographic Reduced Representation and Random Permutation

    OpenAIRE

    Recchia, Gabriel; Jones, Michael; Sahlgren, Magnus; Kanerva, Pentti

    2010-01-01

    Encoding information about the order in which words typically appear has been shown to improve the performance of high-dimensional semantic space models. This requires an encoding operation capable of binding together vectors in an order-sensitive way, and efficient enough to scale to large text corpora. Although both circular convolution and random permutations have been enlisted for this purpose in semantic models, these operations have never been systematically compared. In Experiment 1 we...

  7. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  8. Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

    International Nuclear Information System (INIS)

    Szopa, J.

    1995-01-01

    The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

  9. Multicistronic lentiviral vectors containing the FMDV 2A cleavage factor demonstrate robust expression of encoded genes at limiting MOI

    Directory of Open Access Journals (Sweden)

    Margison Geoffrey P

    2006-03-01

    Full Text Available Abstract Background A number of gene therapy applications would benefit from vectors capable of expressing multiple genes. In this study we explored the feasibility and efficiency of expressing two or three transgenes in HIV-1 based lentiviral vector. Bicistronic and tricistronic self-inactivating lentiviral vectors were constructed employing the internal ribosomal entry site (IRES sequence of encephalomyocarditis virus (EMCV and/or foot-and-mouth disease virus (FMDV cleavage factor 2A. We employed enhanced green fluorescent protein (eGFP, O6-methylguanine-DNA-methyltransferase (MGMT, and homeobox transcription factor HOXB4 as model genes and their expression was detected by appropriate methods including fluorescence microscopy, flow cytometry, immunocytochemistry, biochemical assay, and western blotting. Results All the multigene vectors produced high titer virus and were able to simultaneously express two or three transgenes in transduced cells. However, the level of expression of individual transgenes varied depending on: the transgene itself; its position within the construct; the total number of transgenes expressed; the strategy used for multigene expression and the average copy number of pro-viral insertions. Notably, at limiting MOI, the expression of eGFP in a bicistronic vector based on 2A was ~4 times greater than that of an IRES based vector. Conclusion The small and efficient 2A sequence can be used alone or in combination with an IRES for the construction of multicistronic lentiviral vectors which can express encoded transgenes at functionally relevant levels in cells containing an average of one pro-viral insert.

  10. Interleukin-Encoding Adenoviral Vectors as Genetic Adjuvant for Vaccination against Retroviral Infection

    Science.gov (United States)

    Ohs, Inga; Windmann, Sonja; Wildner, Oliver; Dittmer, Ulf; Bayer, Wibke

    2013-01-01

    Interleukins (IL) are cytokines with stimulatory and modulatory functions in the immune system. In this study, we have chosen interleukins which are involved in the enhancement of TH2 responses and B cell functions to analyze their potential to improve a prophylactic adenovirus-based anti-retroviral vaccine with regard to antibody and virus-specific CD4+ T cell responses. Mice were vaccinated with an adenoviral vector which encodes and displays the Friend Virus (FV) surface envelope protein gp70 (Ad.pIXgp70) in combination with adenoviral vectors encoding the interleukins IL4, IL5, IL6, IL7 or IL23. Co-application of Ad.pIXgp70 with Ad.IL5, Ad.IL6 or Ad.IL23 resulted in improved protection with high control over FV-induced splenomegaly and reduced viral loads. Mice co-immunized with adenoviral vectors encoding IL5 or IL23 showed increased neutralizing antibody responses while mice co-immunized with Ad.IL6 or Ad.IL23 showed improved FV-specific CD4+ T cell responses compared to mice immunized with Ad.pIXgp70 alone. We show that the co-application of adenoviral vectors encoding specific interleukins is suitable to improve the vaccination efficacy of an anti-retroviral vaccine. Improved protection correlated with improved CD4+ T cell responses and especially with higher neutralizing antibody titers. The co-application of selected interleukin-encoding adenoviral vectors is a valuable tool for vaccination with regard to enhancement of antibody mediated immunity. PMID:24349306

  11. Cryptanalysis of an image encryption algorithm based on DNA encoding

    Science.gov (United States)

    Akhavan, A.; Samsudin, A.; Akhshani, A.

    2017-10-01

    Recently an image encryption algorithm based on DNA encoding and the Elliptic Curve Cryptography (ECC) is proposed. This paper aims to investigate the security the DNA-based image encryption algorithm and its resistance against chosen plaintext attack. The results of the analysis demonstrate that security of the algorithm mainly relies on one static shuffling step, with a simple confusion operation. In this study, a practical plain image recovery method is proposed, and it is shown that the images encrypted with the same key could easily be recovered using the suggested cryptanalysis method with as low as two chosen plain images. Also, a strategy to improve the security of the algorithm is presented in this paper.

  12. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  13. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  14. Construction of adenovirus vectors encoding the lumican gene by gateway recombinant cloning technology.

    Science.gov (United States)

    Wang, Gui-Fang; Qi, Bing; Tu, Lei-Lei; Liu, Lian; Yu, Guo-Cheng; Zhong, Jing-Xiang

    2016-01-01

    To construct adenovirus vectors of lumican gene by gateway recombinant cloning technology to further understand the role of lumican gene in myopia. Gateway recombinant cloning technology was used to construct adenovirus vectors. The wild-type (wt) and mutant (mut) forms of the lumican gene were synthesized and amplified by polymerase chain reaction (PCR). The lumican cDNA fragments were purified and ligated into the adenovirus shuttle vector pDown-multiple cloning site (MCS)-/internal ribozyme entry site (IRES)/enhanced green fluorescent protein (EGFP). Then the desired DNA fragments were integrated into the destination vector pAV.Des1d yielding the final expression constructs pAV.Ex1d-cytomegalovirus (CMV)>wt-lumican/IRES/EGFP and pAV.Ex1d-CMV>mut-lumican/IRES /EGFP, respectively. The adenovirus plasmids pAV.Ex1d-CMV>wt-lumican/IRES/EGFP and pAV.Ex1d-CMV>mut-lumican/IRES/EGFP were successfully constructed by gateway recombinant cloning technology. Positive clones identified by PCR and sequencing were selected and packaged into recombinant adenovirus in HEK293 cells. We construct adenovirus vectors containing the lumican gene by gateway recombinant cloning technology, which provides a basis for investigating the role of lumican gene in the pathogenesis of high myopia.

  15. Characterization of a cDNA encoding cottonseed catalase.

    Science.gov (United States)

    Ni, W; Turley, R B; Trelease, R N

    1990-06-21

    A 1.7 kb cDNA clone was isolated from our lambda gt11 library constructed from poly(A) RNA of 24-h-old cotyledons. The cDNA encodes a full-length catalase peptide (492 amino acid residues). The calculated molecular mass is 56,800, similar to that determined for purified enzyme (57,000 SDS-PAGE). Among higher plant catalases, this cotton catalase shows the highest amino acid sequence identity (85%) to the subunit of homotetrameric maize CAT 1, a developmental counterpart to the homotetrameric CAT A isoform of cotton seeds. Comparison of sequences from cotton, sweet potato, maize CAT 1, and yeast with bovine catalase revealed that the amino acid residues and regions that are involved in catalytic activity and/or required to maintain basic catalase structure, are highly conserved. The C-terminus region, which has the lowest nucleotide sequence identity between plant and mammalian catalases, does not terminate with a tripeptide, S-K/R/H-L, a putative targeting signal for peroxisomal proteins.

  16. Immunogenicity in African Green Monkeys of M Protein Mutant Vesicular Stomatitis Virus Vectors and Contribution of Vector-Encoded Flagellin

    Directory of Open Access Journals (Sweden)

    Marlena M. Westcott

    2018-03-01

    Full Text Available Recombinant vesicular stomatitis virus (VSV is a promising platform for vaccine development. M51R VSV, an attenuated, M protein mutant strain, is an effective inducer of Type I interferon and dendritic cell (DC maturation, which are desirable properties to exploit for vaccine design. We have previously evaluated M51R VSV (M51R and M51R VSV that produces flagellin (M51R-F as vaccine vectors using murine models, and found that flagellin enhanced DC activation and VSV-specific antibody production after low-dose vaccination. In this report, the immunogenicity of M51R vectors and the adjuvant effect of virus-produced flagellin were evaluated in nonhuman primates following high-dose (108 pfu and low-dose (105 pfu vaccination. A single intramuscular vaccination of African green monkeys with M51R or M51R-F induced VSV-specific, dose-dependent humoral immune responses. Flagellin induced a significant increase in antibody production (IgM, IgG and neutralizing antibody at the low vaccination dose. A VSV-specific cellular response was detected at 6 weeks post-vaccination, but was neither dose-dependent nor enhanced by flagellin; similar numbers of VSV-specific, IFNγ-producing cells were detected in lymph node and spleen of all animals. These results indicate that virus-directed, intracellular flagellin production may improve VSV-based vaccines encoding heterologous antigens by lowering the dose required to achieve humoral immunity.

  17. Characterization of a cDNA encoding metallothionein 3 from cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Jordan, Robin H; Turley, Rickie B; Defauw, Sherri L; Steele, Mark

    2005-04-01

    A cDNA encoding metallothionein (MT) was isolated from a library constructed with poly A(+) RNA purified from 48 h etiolated cotton (Gossypium hirsutum L.) cotyledons. This cDNA encodes a deduced protein with 63 residues and a molecular weight of 6.3 kDa. The protein has 10 cysteines of which 4 are within the CXXCXCXXXXXC amino-terminus motif and six are within the CXCXXXCXCXXCXC carboxyl-terminus motif characteristic of the type III MT (MT3). The cotton MT3 protein sequence is 76.2, 69.8, 66.7, 60.3 and 33.5% identical to MT3 from Carica papaya, Rubus idaeus, Ribes nigrum, Citrus unshiu, and Gossypium hirsutum type I MT, respectively. A fusion protein was constructed by producing PCR primers for the 5' and 3' ends of the cotton MT3 cDNA and ligating the PCR product inframe at the 3' end of a bacterial glutathione S-transferase (GST) gene in the pGEX3 vector. The 5' PCR primer incorporated a segment of the cotton MT3 noncoding region, resulting in an addition of 9 residues to the MT3 (after Factor Xa digestion site) which increased the size of the expressed protein to 72 residues and 7.6 kDa. Expression of the 7.6 kDa protein in bacteria was confirmed by SDS-PAGE. Induction and accumulation of the GST-MT3 protein began inhibiting bacterial growth after 1 h. Addition of Cu (1 muM to 1 mM), 1 mM cysteine, or 1 mM cystine to the media did not rescue growth. Additionally, this protein was evaluated for its ability to bind Cd, Cu, Ni and Zn in the bacterial expression system. We found that cotton MT3 preferentially binds Cu.

  18. Implementation of digital image encryption algorithm using logistic function and DNA encoding

    Science.gov (United States)

    Suryadi, MT; Satria, Yudi; Fauzi, Muhammad

    2018-03-01

    Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.

  19. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    317. 2.4 cDNA sequencing and analysis. The nucleotide sequence of the cloned H. fossilis GH. cDNA was determined by Sanger's dideoxy chain termi- nation method, using Perkin Elmer bigdye terminator kit in an ABI Prism 377 automated DNA sequencer. All other computational analysis of the GH cDNA was done using.

  20. DNA transformations of Candida tropicalis with replicating and integrative vectors.

    Science.gov (United States)

    Sanglard, D; Fiechter, A

    1992-12-01

    The alkane-assimilating yeast Candida tropicalis was used as a host for DNA transformations. A stable ade2 mutant (Ha900) obtained by UV-mutagenesis was used as a recipient for different vectors carrying selectable markers. A first vector, pMK16, that was developed for the transformation of C. albicans and carries an ADE2 gene marker and a Candida autonomously replicating sequence (CARS) element promoting autonomous replication, was compatible for transforming Ha900. Two transformant types were observed: (i) pink transformants which easily lose pMK16 under non-selective growth conditions; (ii) white transformants, in which the same plasmid exhibited a higher mitotic stability. In both cases pMK16 could be rescued from these cells in Escherichia coli. A second vector, pADE2, containing the isolated C. tropicalis ADE2, gene, was used to transform Ha900. This vector integrated in the yeast genome at homologous sites of the ade2 locus. Different integration types were observed at one or both ade2 alleles in single or in tandem repeats.

  1. Molecular cloning of growth hormone encoding cDNA of Indian ...

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  2. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  3. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Using polymerase chain reaction (PCR) primers representing the conserved regions of fish GH sequences the 3′ region of catfish GH cDNA (540 bp) was cloned by random amplification of cDNA ends and the clone was used as a probe to isolate recombinant phages carrying the full-length cDNA sequence. The full-length ...

  4. pENCODE: a plant encyclopedia of DNA elements.

    Science.gov (United States)

    Lane, Amanda K; Niederhuth, Chad E; Ji, Lexiang; Schmitz, Robert J

    2014-01-01

    ENCODE projects exist for many eukaryotes, including humans, but as of yet no defined project exists for plants. A plant ENCODE would be invaluable to the research community and could be more readily produced than its metazoan equivalents by capitalizing on the preexisting infrastructure provided from similar projects. Collecting and normalizing plant epigenomic data for a range of species will facilitate hypothesis generation, cross-species comparisons, annotation of genomes, and an understanding of epigenomic functions throughout plant evolution. Here, we discuss the need for such a project, outline the challenges it faces, and suggest ways forward to build a plant ENCODE.

  5. Chemical ligation methods for the tagging of DNA-encoded chemical libraries.

    Science.gov (United States)

    Keefe, Anthony D; Clark, Matthew A; Hupp, Christopher D; Litovchick, Alexander; Zhang, Ying

    2015-06-01

    The generation of DNA-encoded chemical libraries requires the unimolecular association of multiple encoding oligonucleotides with encoded chemical entities during combinatorial synthesis processes. This has traditionally been achieved using enzymatic ligation. We discuss a range of chemical ligation methods that provide alternatives to enzymatic ligation. These chemical ligation methods include the generation of modified internucleotide linkages that support polymerase translocation and other modified linkages that while not supporting the translocation of polymerases can also be used to generate individual cDNA molecules containing encoded chemical information specifying individual library members. We also describe which of these approaches have been successfully utilized for the preparation of DNA-encoded chemical libraries and those that were subsequently used for the discovery of inhibitors. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. A DNA Vaccine Encoding Cu,Zn Superoxide Dismutase of Brucella abortus Induces Protective Immunity in BALB/c Mice

    Science.gov (United States)

    Oñate, Angel A.; Céspedes, Sandra; Cabrera, Alex; Rivers, Rodolfo; González, Andrés; Muñoz, Carola; Folch, Hugo; Andrews, Edilia

    2003-01-01

    This study was conducted to evaluate the immunogenicity and protective efficacy of a DNA vaccine encoding Brucella abortus Cu,Zn superoxide dismutase (SOD). Intramuscular injection of plasmid DNA carrying the SOD gene (pcDNA-SOD) into BALB/c mice elicited both humoral and cellular immune responses. Animals injected with pcDNA-SOD developed SOD-specific antibodies which exhibited a dominance of immunoglobulin G2a (IgG2a) over IgG1. In addition, the DNA vaccine elicited a T-cell-proliferative response and also induced the production of gamma interferon, but not interleukin-10 (IL-10) or IL-4, upon restimulation with either recombinant SOD or crude Brucella protein, suggesting the induction of a typical T-helper-1-dominated immune response in mice. The pcDNA-SOD (but not the control vector) induced a strong, significant level of protection in BALB/c mice against challenge with B. abortus virulent strain 2308; the level of protection was similar to the one induced by B. abortus vaccine strain RB51. Altogether, these data suggest that pcDNA-SOD is a good candidate for use in future studies of vaccination against brucellosis. PMID:12933826

  7. Blocking Blood Supply to Breast Carcinoma with a DNA Vaccine Encoding VEGF Receptor-2

    National Research Council Canada - National Science Library

    Xiang, Rong

    2003-01-01

    Proof of concept was established for the hypothesis driving this project indicating that effective suppression of tumor angiogenesis can be achieved with a DNA vaccine encoding murine VEGF receptor-2 (FLK-l...

  8. Blocking Blood Supply to Breast Carcinoma with a DNA Vaccine Encoding VEGF Receptor-2

    National Research Council Canada - National Science Library

    Xiang, Rong

    2004-01-01

    .... In our second fiscal year, we demonstrated proof of concept indicating that effective suppression of tumor angiogenesis can be achieved with a DNA vaccine encoding either muring VEGF receptor-2 (Flk-1...

  9. Combination of MIDGE-Th1 DNA vaccines with the cationic lipid SAINT-18 : Studies on formulation, biodistribution and vector clearance

    NARCIS (Netherlands)

    Endmann, Anne; Oswald, Detlef; Riede, Oliver; Talman, Eduard G.; Vos, Roelien E.; Schroff, Matthias; Kleuss, Christiane; Ruiters, Marcel H. J.; Juhls, Christiane

    2014-01-01

    We have previously shown that the combination of MIDGE-Th1 DNA vectors with the cationic lipid SAINT-18 increases the immune response to the encoded antigen in mice. Here, we report on experiments to further optimize and characterize this approach. We evaluated different formulations of MIDGE-Th1

  10. Translating the ENCyclopedia Of DNA Elements Project findings to the clinic: ENCODE's implications for eye disease.

    Science.gov (United States)

    Sanfilippo, Paul G; Hewitt, Alex W

    2014-01-01

    Approximately 10 years after the Human Genome Project unravelled the sequence of our DNA, the ENCyclopedia Of DNA Elements (ENCODE) Project sought to interpret it. Data from the recently completed project have shed new light on the proportion of biologically active human DNA, assigning a biochemical role to much of the sequence previously considered to be 'junk'. Many of these newly catalogued functional elements represent epigenetic mechanisms involved in regulation of gene expression. Analogous to an Ishihara plate, a gene-coding region of DNA (target dots) only comes into context when the non-coding DNA (surrounding dots) is appreciated. In this review we provide an overview of the ENCODE project, discussing the significance of these data for ophthalmic research and eye disease. The novel insights afforded by the ENCODE project will in time allow for the development of new therapeutic strategies in the management of common blinding disorders. © 2013 Royal Australian and New Zealand College of Ophthalmologists.

  11. Cloning of the mouse cDNA encoding DNA topoisomerase I and chromosomal location of the gene.

    Science.gov (United States)

    Koiwai, O; Yasui, Y; Sakai, Y; Watanabe, T; Ishii, K; Yanagihara, S; Andoh, T

    1993-03-30

    The mouse cDNA encoding DNA topoisomerase I (TopoI) was cloned and the nucleotide sequence of 3512 bp was determined. The cDNA clone contained an open reading frame encoding a protein of 767 amino acids (aa), which is 2 aa longer than its human counterpart. Overall aa sequence homology between the mouse and human, and between the mouse and yeast (Saccharomyces cerevisiae) sequences was 96% and 42%, respectively. The mouse TopI gene was mapped at position 54.5 on chromosome 2 from linkage analyses of a three-point cross test with Geg, Ada, and a as marker genes.

  12. Joint capsule treatment with enkephalin-encoding HSV-1 recombinant vector reduces inflammatory damage and behavioural sequelae in rat CFA monoarthritis.

    Science.gov (United States)

    Lu, Ying; McNearney, Terry A; Wilson, Steven P; Yeomans, David C; Westlund, Karin N

    2008-03-01

    This study assessed enkephalin expression induced by intra-articular application of recombinant, enkephalin-encoding herpes virus (HSV-1) and the impact of expression on nociceptive behaviours and synovial lining inflammation in arthritic rats. Replication-conditional HSV-1 recombinant vectors with cDNA encoding preproenkephalin (HSV-ENK), or control transgene beta-galactosidase cDNA (HSV-beta-gal; control) were injected into knee joints with complete Freund's adjuvant (CFA). Joint temperatures, circumferences and nociceptive behaviours were monitored on days 0, 7, 14 and 21 post CFA and vector treatments. Lumbar (L4-6) dorsal root ganglia (DRG) and spinal cords were immunostained for met-enkephalin (met-ENK), beta-gal, HSV-1 proteins and Fos. Joint tissues were immunostained for met-ENK, HSV-1 proteins, and inflammatory mediators Regulated on Activation, Normal T-cell Expressed and Secreted (RANTES) and cyclo-oxygenase-2, or stained with haematoxylin and eosin for histopathology. Compared to exuberant synovial hypertrophy and inflammatory cell infiltration seen in arthritic rats treated with CFA only or CFA and HSV-beta-gal, the CFA- and HSV-ENK-treated arthritic rats had: (i) striking preservation of synovial membrane cytoarchitecture with minimal inflammatory cell infiltrates; (ii) significantly improved nociceptive behavioural responses to mechanical and thermal stimuli; (iii) normalized Fos staining in lumbar dorsal horn; and (iv) significantly increased met-ENK staining in ipsilateral synovial tissue, lumbar DRG and spinal cord. The HSV-1 and transgene product expression were confined to ipsilateral lumbar DRG (HSV-1, met-ENK, beta-gal). Only transgene product (met-ENK and beta-gal) was seen in lumbar spinal cord sections. Targeted delivery of enkephalin-encoding HSV-1 vector generated safe, sustained opioid-induced analgesia with protective anti-inflammatory blunting in rat inflammatory arthritis.

  13. Reduction of nuclear encoded enzymes of mitochondrial energy metabolism in cells devoid of mitochondrial DNA

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, Edith E., E-mail: ed.mueller@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Mayr, Johannes A., E-mail: h.mayr@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Zimmermann, Franz A., E-mail: f.zimmermann@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Feichtinger, Rene G., E-mail: r.feichtinger@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Stanger, Olaf, E-mail: o.stanger@rbht.nhs.uk [Department of Cardiac Surgery, Paracelsus Medical University, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Sperl, Wolfgang, E-mail: w.sperl@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Kofler, Barbara, E-mail: b.kofler@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria)

    2012-01-20

    Highlights: Black-Right-Pointing-Pointer We examined OXPHOS and citrate synthase enzyme activities in HEK293 cells devoid of mtDNA. Black-Right-Pointing-Pointer Enzymes partially encoded by mtDNA show reduced activities. Black-Right-Pointing-Pointer Also the entirely nuclear encoded complex II and citrate synthase exhibit reduced activities. Black-Right-Pointing-Pointer Loss of mtDNA induces a feedback mechanism that downregulates complex II and citrate synthase. -- Abstract: Mitochondrial DNA (mtDNA) depletion syndromes are generally associated with reduced activities of oxidative phosphorylation (OXPHOS) enzymes that contain subunits encoded by mtDNA. Conversely, entirely nuclear encoded mitochondrial enzymes in these syndromes, such as the tricarboxylic acid cycle enzyme citrate synthase (CS) and OXPHOS complex II, usually exhibit normal or compensatory enhanced activities. Here we report that a human cell line devoid of mtDNA (HEK293 {rho}{sup 0} cells) has diminished activities of both complex II and CS. This finding indicates the existence of a feedback mechanism in {rho}{sup 0} cells that downregulates the expression of entirely nuclear encoded components of mitochondrial energy metabolism.

  14. Molecular cloning and characterization of a cDNA encoding ...

    African Journals Online (AJOL)

    enoh

    2012-03-29

    Nanjing) co., Ltd. The nucleotide sequences of these primers are as follows: ..... Ebizuka Y (2000). Molecular cloning and characterization of a cDNA for Glycyrrhiza glabra cycloartenol synthase. Biol. Pharm. Bull. 23(2):231-234.

  15. Searching for avidity by chemical ligation of combinatorially self-assembled DNA-encoded ligand libraries.

    Science.gov (United States)

    Matysiak, Stefan; Hellmuth, Klaus; El-Sagheer, Afaf H; Shivalingam, Arun; Ariyurek, Yavuz; de Jong, Marco; Hollestelle, Martine J; Out, Ruud; Brown, Tom

    2017-12-19

    DNA encoded ligands are self-assembled into bivalent complexes and chemically ligated to link their identities. To demonstrate their potential as a combinatorial screening platform for avidity interactions, the optimal bivalent aptamer design (examplar ligands) for human alpha-thrombin is determined in a single round of selection and the DNA scaffold replaced with minimal impact on the final design.

  16. Enhancement of the priming efficacy of DNA vaccines encoding dendritic cell-targeted antigens by synergistic toll-like receptor ligands

    Directory of Open Access Journals (Sweden)

    Kornbluth Richard S

    2009-08-01

    Full Text Available Abstract Background Targeting of protein antigens to dendritic cells (DC via the DEC205 receptor enhances presentation of antigen-derived peptides on MHC-I and MHC-II molecules and, in the presence of costimulatory signals, antigen-specific immune responses. The immunogenicity and efficacy of DNA vaccination can also be enhanced by fusing the encoded antigen to single chain antibodies directed against DEC205. To further improve this strategy, we evaluated different toll-like receptor ligands (TLR and CD40 ligands (CD40L as adjuvants for DNA vaccines encoding a DEC205-single-chain antibody fused to the ovalbumin model antigen or HIV-1 Gag and assessed the priming efficacy of DNA in a DNA prime adenoviral vector boost immunization regimen. Results Mice were primed with the adjuvanted DEC-205 targeted DNA vaccines and boosted with adenoviral vectors encoding the same antigens. CD8+ T cell responses were determined after the adenoviral booster immunization, to determine how well the different DNA immunization regimens prime for the adenoviral boost. In the absence of adjuvants, targeting of DNA-encoded ovalbumin to DCs suppressed CD8+ T-cell responses after the adenoviral booster immunization. CD8+ T-cell responses to the DEC205 targeted DNA vaccines increased only slightly by adding either the TLR-9 ligand CpG, the TLR-3 ligand Poly I:C, or CD40 ligand expression plasmids. However, the combination of both TLR-ligands led to a strong enhancement of CD8+ T-cell responses compared to a non-targeted DNA vaccine. This finding was confirmed using HIV Gag as antigen. Conclusion Although DNA prime adenoviral vector boost immunizations belong to the strongest inducers of cytotoxic T cell responses in different animal models and humans, the CD8+ T cell responses can be further improved by targeting the DNA encoded antigen to DEC205 in the presence of synergistic TLR ligands CpG and Poly I:C.

  17. A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

    Directory of Open Access Journals (Sweden)

    Chunyan Song

    2015-10-01

    Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

  18. Phage lambda cDNA cloning vectors for subtractive hybridization, fusion-protein synthesis and Cre-loxP automatic plasmid subcloning.

    Science.gov (United States)

    Palazzolo, M J; Hamilton, B A; Ding, D L; Martin, C H; Mead, D A; Mierendorf, R C; Raghavan, K V; Meyerowitz, E M; Lipshitz, H D

    1990-03-30

    We describe the construction and use of two classes of cDNA cloning vectors. The first class comprises the lambda EXLX(+) and lambda EXLX(-) vectors that can be used for the expression in Escherichia coli of proteins encoded by cDNA inserts. This is achieved by the fusion of cDNA open reading frames to the T7 gene 10 promoter and protein-coding sequences. The second class, the lambda SHLX vectors, allows the generation of large amounts of single-stranded DNA or synthetic cRNA that can be used in subtractive hybridization procedures. Both classes of vectors are designed to allow directional cDNA cloning with non-enzymatic protection of internal restriction sites. In addition, they are designed to facilitate conversion from phage lambda to plasmid clones using a genetic method based on the bacteriophage P1 site-specific recombination system; we refer to this as automatic Cre-loxP plasmid subcloning. The phage lambda arms, lambda LOX, used in the construction of these vectors have unique restriction sites positioned between the two loxP sites. Insertion of a specialized plasmid between these sites will convert it into a phage lambda cDNA cloning vector with automatic plasmid subcloning capability.

  19. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    cell embryo and the expression was monitored continuously. The expression shown here is in developing embryo and freshly hatched fish. The intensity of green colour indicate the strong expression of EGFP in all the tissues of the embryo/fry. The expression of EGPF indicates the co-expression of catfish GH cDNA and the ...

  20. Cloning and characterization of cDNA encoding xyloglucan ...

    African Journals Online (AJOL)

    Jane

    2011-08-22

    Aug 22, 2011 ... construction and restructuring of xyloglucan cross-links, thereby controlling the mechanical properties of cell wall. We cloned complete cDNA of an ..... are marked by horizontal lines. The conserved cysteine residues (amino acids 220, 229, 274 and 288 in P. glaucum) are marked by vertical blue arrows.

  1. Increased T cell breadth and antibody response elicited in prime-boost regimen by viral vector encoded homologous SIV Gag/Env in outbred CD1 mice

    DEFF Research Database (Denmark)

    Andersson, Anne Marie Carola; Holst, Peter Johannes

    2016-01-01

    ) or homologous (SIVmac239) gag sequences using adenovirus (Ad5) and MVA vectors. Env (SIVmac239) was co-encoded in the vectors to study the induction of antibodies, which is a primary target of current HIV vaccine designs. All three vaccines were designed as virus-encoded virus-like particle vaccines. Antibody...

  2. DNA-Encoded Chemical Libraries: A Selection System Based On Endowing Organic Compounds with Amplifiable Information.

    Science.gov (United States)

    Neri, Dario; Lerner, Richard A

    2018-01-12

    The discovery of organic ligands that bind specifically to proteins is a central problem in chemistry, biology, and the biomedical sciences. The encoding of individual organic molecules with distinctive DNA tags, serving as amplifiable identification bar codes, allows the construction and screening of combinatorial libraries of unprecedented size, thus facilitating the discovery of ligands to many different protein targets. Fundamentally, one links powers of genetics and chemical synthesis. After the initial description of DNA-encoded chemical libraries in 1992, several experimental embodiments of the technology have been reduced to practice. This review provides a historical account of important milestones in the development of DNA-encoded chemical libraries, a survey of relevant ongoing research activities, and a glimpse into the future. Expected final online publication date for the Annual Review of Biochemistry Volume 87 is June 20, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.

  3. [A novel vector for construction of a cDNA library].

    Science.gov (United States)

    Fedchenko, V I; Kaloshin, A A; Medvedev, A E

    2010-01-01

    A new original vector pEM-(dT)40(f+) has been prepared. It can be used for cDNA library construction from polyadenylated mRNA, isolated from various sources. The pGEM-(dT)40f(+) is initially transformed into single stranded and then into a linear form and its (dT)40 tail at 3'-end is used as the vector-primer for synthesis of the first strand cDNA. The use of a synthetic oligonucleotide complementary to the vector and recombinant DNA results in vector cyclization and synthesis of the second strand cDNA. This approach significantly simplifies cDNA library construction, it does not require PCR reaction (which can induce artifact mutations in cDNA sequences) and restrictase treatment.

  4. The transduction pattern of IL-12-encoding lentiviral vectors shapes the immunological outcome.

    Science.gov (United States)

    Goyvaerts, Cleo; Broos, Katrijn; Escors, David; Heirman, Carlo; Raes, Geert; De Baetselier, Patrick; Thielemans, Kris; Breckpot, Karine

    2015-12-01

    In situ modification of antigen-presenting cells garnered interest in cancer immunotherapy. Therefore, we developed APC-targeted lentiviral vectors (LVs). Unexpectedly, these LVs were inferior vaccines to broad tropism LVs. Since IL-12 is a potent mediator of antitumor immunity, we evaluated whether this proinflammatory cytokine could enhance antitumor immunity of an APC-targeted LV-based vaccine. Therefore, we compared subcutaneous administration of broad tropism LVs (VSV-G-LV) with APC-targeted LVs (DC2.1-LV)-encoding enhanced GFP and ovalbumin, or IL-12 and ovalbumin in mice. We show that codelivery of IL-12 by VSV-G-LVs or DC2.1-LVs augments CD4(+) or CD8(+) T-cell proliferation, respectively. Furthermore, we demonstrate that codelivery of IL-12 enhances the CD4(+) TH 1 profile irrespective of its delivery mode, while an increase in cytotoxic and therapeutic CD8(+) T cells was only induced upon VSV-G-LV injection. While codelivery of IL-12 by DC2.1-LVs did not enhance CD8(+) T-cell performance, it increased expression of inhibitory checkpoint markers Lag3, Tim3, and PD-1. Finally, the discrepancy between CD4(+) T-cell stimulation with and without functional CD8(+) T-cell stimulation by VSV-G- and DC2.1-LVs is partly explained by the observation that IL-12 relieves CD8(+) T cells from CD4(+) T-cell help, implying that a T(H)1 profile is of minor importance for antitumor immunotherapy if IL-12 is exogenously delivered. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. DNA Encoding Training Using 3D Gesture Interaction.

    Science.gov (United States)

    Nicola, Stelian; Handrea, Flavia-Laura; Crişan-Vida, Mihaela; Stoicu-Tivadar, Lăcrămioara

    2017-01-01

    The work described in this paper summarizes the development process and presents the results of a human genetics training application, studying the 20 amino acids formed by the combination of the 3 nucleotides of DNA targeting mainly medical and bioinformatics students. Currently, the domain applications using recognized human gestures of the Leap Motion sensor are used in molecules controlling and learning from Mendeleev table or in visualizing the animated reactions of specific molecules with water. The novelty in the current application consists in using the Leap Motion sensor creating new gestures for the application control and creating a tag based algorithm corresponding to each amino acid, depending on the position in the 3D virtual space of the 4 nucleotides of DNA and their type. The team proposes a 3D application based on Unity editor and on Leap Motion sensor where the user has the liberty of forming different combinations of the 20 amino acids. The results confirm that this new type of study of medicine/biochemistry using the Leap Motion sensor for handling amino acids is suitable for students. The application is original and interactive and the users can create their own amino acid structures in a 3D-like environment which they could not do otherwise using traditional pen-and-paper.

  6. DNA encoding individual mycobacterial antigens protects mice against tuberculosis

    Directory of Open Access Journals (Sweden)

    C.L. Silva

    1999-02-01

    Full Text Available Over the last few years, some of our experiments in which mycobacterial antigens were presented to the immune system as if they were viral antigens have had a significant impact on our understanding of protective immunity against tuberculosis. They have also markedly enhanced the prospects for new vaccines. We now know that individual mycobacterial protein antigens can confer protection equal to that from live BCG vaccine in mice. A critical determinant of the outcome of immunization appears to be the degree to which antigen-specific cytotoxic T cells are generated by the immune response. Our most recent studies indicate that DNA vaccination is an effective way to establish long-lasting cytotoxic T cell memory and protection against tuberculosis.

  7. A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector.

    Science.gov (United States)

    Buj, Raquel; Iglesias, Noa; Planas, Anna M; Santalucía, Tomàs

    2013-08-20

    Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit's component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior

  8. Molecular cloning of growth hormone encoding cDNA of Indian ...

    Indian Academy of Sciences (India)

    Unknown

    Evans and Long 1921) and the human growth hormone (GH) encoding cDNA was per- haps the first to be isolated and characterized (Li and. Evans 1944). GH, chorionic somatomamotropin (placental lactogen) and prolactin (PRL) are all a family of ...

  9. Molecular cloning and characterization of cDNA encoding fibrinolytic enzyme-3 from earthworm Eisenia foetida.

    Science.gov (United States)

    Dong, Guo-Qing; Yuan, Xiao-Ling; Shan, Ya-Jun; Zhao, Zhen-Hu; Chen, Jia-Pei; Cong, Yu-Wen

    2004-04-01

    The earthworm fibrinolytic enzyme-3 (EFE-3, GenBank accession No: AY438622), from the earthworm Eisenia foetida, is a component of earthworm fibrinolytic enzymes. In this study, cDNA encoding the EFE-3 was cloned by RT-PCR. The cDNA contained an open reading frame of 741 nucleotides, which encoded a deduced protein of 247 amino acid residues, including signal sequences. EFE-3 showed a high degree of homology to earthworm (Lumbricus rebullus) proteases F-III-1, F-III-2, and bovine trypsin. The recombinant EFE-3 was expressed in E. coli as inclusion bodies, and the gene encoding the native form of EFE-3 was expressed in COS-7 cells in the medium. Both the refolding product of inclusion bodies and the secreted protease could dissolve the artificial fibrin plate.

  10. Cloning and sequencing of dolphinfish (Coryphaena hippurus, Coryphaenidae) growth hormone-encoding cDNA.

    Science.gov (United States)

    Peduel, A D; Elizur, A; Knibb, W

    1994-01-01

    The cDNA encoding the preprotein growth hormone from the dolphinfish (Coryphaena hippurus) has been cloned and sequenced. The cDNA was derived by reverse transcription of RNA from the pituitary of a young fish using the method known as Rapid Amplification of cDNA Ends (RACE). An oligonucleotide primer corresponding to the 5' region of Pagrus major and the universal RACE primer enabled amplification using the Polymerase Chain Reaction (PCR). The dolphinfish and yellow-tail, Seriola quineqeradiata, are both members of the sub-order Percoidei (Perciforme) and their GH sequences show a high level of homology.

  11. DNA methylation status of nuclear-encoded mitochondrial genes underlies the tissue-dependent mitochondrial functions

    Directory of Open Access Journals (Sweden)

    Takasugi Masaki

    2010-08-01

    Full Text Available Abstract Background Mitochondria are semi-autonomous, semi-self-replicating organelles harboring their own DNA (mitochondrial DNA, mtDNA, and their dysregulation is involved in the development of various diseases. While mtDNA does not generally undergo epigenetic modifications, almost all mitochondrial proteins are encoded by nuclear DNA. However, the epigenetic regulation of nuclear-encoded mitochondrial genes (nuclear mt genes has not been comprehensively analyzed. Results We analyzed the DNA methylation status of 899 nuclear mt genes in the liver, brain, and heart tissues of mouse, and identified 636 nuclear mt genes carrying tissue-dependent and differentially methylated regions (T-DMRs. These nuclar mt genes are involved in various mitochondrial functions and they also include genes related to human diseases. T-DMRs regulate the expression of nuclear mt genes. Nuclear mt genes with tissue-specific hypomethylated T-DMRs were characterized by enrichment of the target genes of specific transcription factors such as FOXA2 in the liver, and CEBPA and STAT1 in the brain. Conclusions A substantial proportion of nuclear mt genes contained T-DMRs, and the DNA methylation status of numerous T-DMRs should underlie tissue-dependent mitochondrial functions.

  12. Nonviral DNA vectors for immunization and therapy: design and methods for their obtention.

    Science.gov (United States)

    Rodríguez, Ernesto G

    2004-08-01

    The use of plasmid DNA for vaccination and therapy is a relatively novel technology, with advantages and limitations as with other gene transfer techniques. The technology is based on DNA vectors designed for administering genes coding for relevant proteins into a given organism, fulfilling requirements of the regulatory agencies that once properly formulated and delivered the desired vaccine/therapeutic effect can be achieved. Starting from conventional plasmid DNA vectors currently tested in clinical trials, improvement resulted in bacterial element-less vectors, increasing the complexity of the developmental process. The present review focuses on systems described for generating these nonviral DNA vectors for immunization and therapy from bacterial hosts (conventional and conditionally replicating plasmids, nonreplicating minicircles, and linear dumbbell-shaped expression cassettes) in vivo or in vitro. Additionally, nontherapeutic genetic sequences with a negative or positive effect according to the specific application are described, bringing a better comprehension of the technology's state of the art.

  13. Characterization of the Single Stranded DNA Binding Protein SsbB Encoded in the Gonoccocal Genetic Island

    NARCIS (Netherlands)

    Jain, Samta; Zweig, Maria; Peeters, Eveline; Siewering, Katja; Hackett, Kathleen T.; Dillard, Joseph P.; van der Does, Chris

    2012-01-01

    Background: Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in

  14. Quantification of residual host cell DNA in adenoviral vectors produced on PER.C6 cells

    NARCIS (Netherlands)

    Gijsbers, Linda; Koel, Björn; Weggeman, Miranda; Goudsmit, Jaap; Havenga, Menzo; Marzio, Giuseppe

    2005-01-01

    Recombinant adenoviral vectors for gene therapy and vaccination are routinely prepared on cultures of immortalized cells, allowing the production of vector batches of high titer and consistent quality. Quantification of residual DNA from the producing cell line is part of the purity tests for

  15. Adenoviral vectors encoding CRISPR/Cas9 multiplexes rescue dystrophin synthesis in unselected populations of DMD muscle cells.

    Science.gov (United States)

    Maggio, Ignazio; Liu, Jin; Janssen, Josephine M; Chen, Xiaoyu; Gonçalves, Manuel A F V

    2016-11-15

    Mutations disrupting the reading frame of the ~2.4 Mb dystrophin-encoding DMD gene cause a fatal X-linked muscle-wasting disorder called Duchenne muscular dystrophy (DMD). Genome editing based on paired RNA-guided nucleases (RGNs) from CRISPR/Cas9 systems has been proposed for permanently repairing faulty DMD loci. However, such multiplexing strategies require the development and testing of delivery systems capable of introducing the various gene editing tools into target cells. Here, we investigated the suitability of adenoviral vectors (AdVs) for multiplexed DMD editing by packaging in single vector particles expression units encoding the Streptococcus pyogenes Cas9 nuclease and sequence-specific gRNA pairs. These RGN components were customized to trigger short- and long-range intragenic DMD excisions encompassing reading frame-disrupting exons in patient-derived muscle progenitor cells. By allowing synchronous and stoichiometric expression of the various RGN components, we demonstrate that dual RGN-encoding AdVs can correct over 10% of target DMD alleles, readily leading to the detection of Becker-like dystrophin proteins in unselected muscle cell populations. Moreover, we report that AdV-based gene editing can be tailored for removing mutations located within the over 500-kb major DMD mutational hotspot. Hence, this single DMD editing strategy can in principle tackle a broad spectrum of mutations present in more than 60% of patients with DMD.

  16. Immune response induced by candidate Sarcoptes scabiei var. cuniculi DNA vaccine encoding paramyosin in mice.

    Science.gov (United States)

    Gu, Xiaobin; Xie, Yue; Wang, Shuxian; Peng, Xuerong; Lai, Songjia; Yang, Guangyou

    2014-07-01

    Sarcoptes scabiei is the causal agent of the highly contagious disease sarcoptic mange (scabies) that affects animals and humans worldwide. An increasing number of cases of treatment failure is being reported because of drug resistance. The development of a specific vaccine would be a sustainable option for control of this disease. In this study, we cloned and expressed a S. scabiei gene encoding paramyosin (PAR) and investigated the immune response elicited by DNA encoding PAR in mice. The ability of the DNA vaccine to express antigen in COS-7 cells was confirmed by RT-PCR and IFA. The immune response induced by DNA vaccine was investigated by ELISA, splenocyte proliferation assay, and cytokine production assay. Compared to the pVAX1 control group, the PAR DNA vaccination group showed the higher levels of IgG, IgG1, IgG2a, IgE, IgM, stronger lymphocyte proliferation in mouse spleen, and larger production of IL-2, IL-4, IL-5, and IFN-γ in the supernatant of cultures from splenocytes. These results indicated that the PAR DNA vaccine induced a mixed Th1/Th2 response in mice. In conclusion, our results revealed that the S. scabiei PAR DNA vaccine induced both a humoral and cellular immune response, which would provide basic data for the further study to develop an effective vaccine against sarcoptic mange.

  17. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  18. Protective effect of the DNA vaccine encoding the major house dust mite allergens on allergic inflammation in the murine model of house dust mite allergy

    Directory of Open Access Journals (Sweden)

    Lee Jaechun

    2006-02-01

    Full Text Available Abstract Background Vaccination with naked DNA encoding antigen induces cellular and humoral immunity characterized by the activation of specific Th1 cells. Objective To evaluate the effects of vaccination with mixed naked DNA plasmids encoding Der p 1, Der p 2, Der p 3, Der f 1, Der f 2, and Der f 3, the major house dust mite allergens on the allergic inflammation to the whole house dust mites (HDM crude extract. Methods Three hundred micrograms of these gene mixtures were injected into muscle of BALB/c mice. Control mice were injected with the pcDNA 3.1 blank vector. After 3 weeks, the mice were actively sensitized and inhaled with the whole house dust mite extract intranasally. Results The vaccinated mice showed a significantly decreased synthesis of total and HDM-specific IgE compared with controls. Analysis of the cytokine profile of lymphocytes after challenge with HDM crude extract revealed that mRNA expression of interferon-γ was higher in the vaccinated mice than in the controls. Reduced infiltration of inflammatory cells and the prominent infiltration of CD8+ T cells were observed in histology of lung tissue from the vaccinated mice. Conclusion Vaccination with DNA encoding the major house dust mite allergens provides a promising approach for treating allergic responses to whole house dust mite allergens.

  19. A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector

    Science.gov (United States)

    2013-01-01

    Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome

  20. Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT).

    Science.gov (United States)

    Ding, Yun; O'Keefe, Heather; DeLorey, Jennifer L; Israel, David I; Messer, Jeffrey A; Chiu, Cynthia H; Skinner, Steven R; Matico, Rosalie E; Murray-Thompson, Monique F; Li, Fan; Clark, Matthew A; Cuozzo, John W; Arico-Muendel, Christopher; Morgan, Barry A

    2015-08-13

    The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure-activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality.

  1. Numerical encoding of DNA sequences by chaos game representation with application in similarity comparison.

    Science.gov (United States)

    Hoang, Tung; Yin, Changchuan; Yau, Stephen S-T

    2016-10-01

    Numerical encoding plays an important role in DNA sequence analysis via computational methods, in which numerical values are associated with corresponding symbolic characters. After numerical representation, digital signal processing methods can be exploited to analyze DNA sequences. To reflect the biological properties of the original sequence, it is vital that the representation is one-to-one. Chaos Game Representation (CGR) is an iterative mapping technique that assigns each nucleotide in a DNA sequence to a respective position on the plane that allows the depiction of the DNA sequence in the form of image. Using CGR, a biological sequence can be transformed one-to-one to a numerical sequence that preserves the main features of the original sequence. In this research, we propose to encode DNA sequences by considering 2D CGR coordinates as complex numbers, and apply digital signal processing methods to analyze their evolutionary relationship. Computational experiments indicate that this approach gives comparable results to the state-of-the-art multiple sequence alignment method, Clustal Omega, and is significantly faster. The MATLAB code for our method can be accessed from: www.mathworks.com/matlabcentral/fileexchange/57152. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. A platform for high-throughput screening of DNA-encoded catalyst libraries in organic solvents.

    Science.gov (United States)

    Hook, K Delaney; Chambers, John T; Hili, Ryan

    2017-10-01

    We have developed a novel high-throughput screening platform for the discovery of small-molecules catalysts for bond-forming reactions. The method employs an in vitro selection for bond-formation using amphiphilic DNA-encoded small molecules charged with reaction substrate, which enables selections to be conducted in a variety of organic or aqueous solvents. Using the amine-catalysed aldol reaction as a catalytic model and high-throughput DNA sequencing as a selection read-out, we demonstrate the 1200-fold enrichment of a known aldol catalyst from a library of 16.7-million uncompetitive library members.

  3. [Effects of UV-induced DNA damage on vector ligation and transformation into bacterial cells].

    Science.gov (United States)

    Huang, Wan-ling; Li, Chang-zheng; Chen, Zhen-rui; He, Wei; Zhou, Ye; Zhou, Zhi-gang; Liu, Shu-wen; Zhou, Chen

    2010-01-01

    To study the effects of UV irradiation on DNA ligation and transformation efficiency of the expression vector into competent bacterial cells. The expression vector was digested with the restriction enzyme SfiI, and the purified target DNA fragments were exposed to UV light at different wavelengths. Ligation and transformation experiments with the exposed fragments were carried out and the colony number and transformation efficiency were assessed. The transformation efficiency of the DNA with a 5-min exposure to 302 nm UV was 60 colonies per nanogram of the DNA, as compared with 20400 for the DNA exposed to 365 nm UV. The time course experiment showed that prolonged DNA exposure to 365 nm UV light was associated with lowered transformation efficiency. DNA exposure for 30 min caused a reduction of the transformation efficiency to lower than 50% compared to that of DNA without UV exposure. But with a 15 min exposure, the DNA maintained a transformation efficiency more than 70%, which was sufficient for most molecular biology experiments. In construction of the expression vector, it is advisable to prevent the target DNA from UV exposure. When UV exposure is essential, we suggest that 365 nm UV be used and the exposure time controlled within 15 min.

  4. Frequency and persistency of DNA vaccine encoding GP25 by oral on common carp

    Directory of Open Access Journals (Sweden)

    Sri Nuryati

    2015-05-01

    Full Text Available ABSTRACT Koi herpesvirus (KHV is a major viral pathogen that infects common carp and koi. KHV disease outbreak is happened in almost all centre of common carp culture in Indonesia and caused mass mortality. Deoxyribonucleic acid (DNA vaccination method is one of ways to cope with KHV infection. Vaccines were commonly given by injection. The aim of this research was to get frequency and persistency of DNA vaccine encoding GP25 given by oral delivery method in common carp. This research would like to determine dose, frequency of vaccination, persistency of DNA vaccine and culture medium for the bacterial host. DNA vaccine persistency test was done by using polymerase chain reaction (PCR method with the specific primer for GP25 gene. The results showed that level of DNA vaccine that could be detected in feed was 7.56 ng (equal to 1.598×1010 copies. Efficient culture medium for Escherichia coli DH5α carrying DNA vaccine was LB triptone. Feeding fish with diet supplemented with 1 mL E. coli DH5α containing DNA vaccine for each fish and two times a week allowed persistence of DNA vaccine in kindney and spleen. Keywords: common carp, KHV, DNA vaccine, GP25, persistance  ABSTRAK Koi herpesvirus (KHV adalah virus patogen utama yang menginfeksi ikan mas dan ikan koi. Wabah penyakit KHV terjadi di hampir semua sentra budidaya ikan mas di Indonesia dan menyebabkan kematian massal ikan. Metode vaksinasi DNA merupakan salah satu cara yang dapat dilakukan untuk menanggulangi serangan KHV. Pemberian vaksin umumnya dilakukan dengan cara injeksi. Tujuan penelitian ini adalah untuk menguji frekuensi dan persistensi vaksin DNA GP25 antivirus KHV yang diberikan melalui oral pada ikan mas. Pada penelitian ini dilakukan uji dosis, frekuensi pemberian vaksin, persistensi vaksin DNA, dan media kultur bakteri inang. Persistensi vaksin DNA dianalisis menggunakan metode PCR dengan primer spesifik gen GP25. Hasil penelitian menunjukkan bahwa dosis vaksin DNA yang

  5. Two-label peak-height encoded DNA sequencing by capillary gel electrophoresis: three examples.

    OpenAIRE

    Chen, D; Harke, H R; Dovichi, N J

    1992-01-01

    We report a modification to the peak-height encoded DNA sequencing technique of Tabor and Richardson. As in the original protocol, the sequencing reaction uses modified T7 polymerase with manganese rather than magnesium to produce very uniform incorporation of each dideoxynucleoside. To improve sequencing accuracy, two fluorescently labeled primers are employed in separate sequencing reactions. As an example, one sequencing reaction uses a FAM-labeled primer with dideoxyadenosine triphosphate...

  6. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  7. A Vector Printing Method for High-Speed Electrohydrodynamic (EHD Jet Printing Based on Encoder Position Sensors

    Directory of Open Access Journals (Sweden)

    Thanh Huy Phung

    2018-02-01

    Full Text Available Electrohyrodynamic (EHD jet printing has been widely used in the field of direct micro-nano patterning applications, due to its high resolution printing capability. So far, vector line printing using a single nozzle has been widely used for most EHD printing applications. However, the application has been limited to low-speed printing, to avoid non-uniform line width near the end points where line printing starts and ends. At end points of line vector printing, the deposited drop amount is likely to be significantly large compared to the rest of the printed lines, due to unavoidable acceleration and deceleration. In this study, we proposed a method to solve the printing quality problems by producing droplets at an equally spaced distance, irrespective of the printing speed. For this purpose, an encoder processing unit (EPU was developed, so that the jetting trigger could be generated according to user-defined spacing by using encoder position signals, which are used for the positioning control of the two linear stages.

  8. Hit-Validation Methodologies for Ligands Isolated from DNA-Encoded Chemical Libraries.

    Science.gov (United States)

    Zimmermann, Gunther; Li, Yizhou; Rieder, Ulrike; Mattarella, Martin; Neri, Dario; Scheuermann, Jörg

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are large collections of compounds linked to DNA fragments, serving as amplifiable barcodes, which can be screened on target proteins of interest. In typical DECL selections, preferential binders are identified by high-throughput DNA sequencing, by comparing their frequency before and after the affinity capture step. Hits identified in this procedure need to be confirmed, by resynthesis and by performing affinity measurements. In this article we present new methods based on hybridization of oligonucleotide conjugates with fluorescently labeled complementary oligonucleotides; these facilitate the determination of affinity constants and kinetic dissociation constants. The experimental procedures were demonstrated with acetazolamide, a binder to carbonic anhydrase IX with a dissociation constant in the nanomolar range. The detection of binding events was compatible not only with fluorescence polarization methodologies, but also with Alphascreen technology and with microscale thermophoresis. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Cloning and expression of full-length cDNA encoding human vitamin D receptor

    Energy Technology Data Exchange (ETDEWEB)

    Baker, A.R.; McDonnell, D.P.; Hughes, M.; Crisp, T.M.; Mangelsdorf, D.J.; Haussler, M.R.; Pike, J.W.; Shine, J.; O' Malley, B.W. (California Biotechnology Inc., Mountain View (USA))

    1988-05-01

    Complementary DNA clones encoding the human vitamin D receptor have been isolated from human intestine and T47D cell cDNA libraries. The nucleotide sequence of the 4605-base pair (bp) cDNA includes a noncoding leader sequence of 115 bp, a 1281-bp open reading frame, and 3209 bp of 3{prime} noncoding sequence. Two polyadenylylation signals, AATAAA, are present 25 and 70 bp upstream of the poly(A) tail, respectively. RNA blot hybridization indicates a single mRNA species of {approx} 4600 bp. Transfection of the cloned sequences into COS-1 cells results in the production of a single receptor species indistinguishable from the native receptor. Sequence comparisons demonstrate that the vitamin D receptor belongs to the steroid-receptor gene family and is closest in size and sequence to another member of this family, the thyroid hormone receptor.

  10. Chaotic Image Encryption Algorithm Based on Bit Permutation and Dynamic DNA Encoding

    Directory of Open Access Journals (Sweden)

    Xuncai Zhang

    2017-01-01

    Full Text Available With the help of the fact that chaos is sensitive to initial conditions and pseudorandomness, combined with the spatial configurations in the DNA molecule’s inherent and unique information processing ability, a novel image encryption algorithm based on bit permutation and dynamic DNA encoding is proposed here. The algorithm first uses Keccak to calculate the hash value for a given DNA sequence as the initial value of a chaotic map; second, it uses a chaotic sequence to scramble the image pixel locations, and the butterfly network is used to implement the bit permutation. Then, the image is coded into a DNA matrix dynamic, and an algebraic operation is performed with the DNA sequence to realize the substitution of the pixels, which further improves the security of the encryption. Finally, the confusion and diffusion properties of the algorithm are further enhanced by the operation of the DNA sequence and the ciphertext feedback. The results of the experiment and security analysis show that the algorithm not only has a large key space and strong sensitivity to the key but can also effectively resist attack operations such as statistical analysis and exhaustive analysis.

  11. The Cloning of the Human Tumor Supressor Gene INGI: DNA Cloning into Plasmid Vector and DNA Analysis by Restriction Enzymes

    Directory of Open Access Journals (Sweden)

    Elza Ibrahim Auerkari

    2015-11-01

    Full Text Available DNA cloning is one of the most important techniques In the field of molecular biology, with a critical role in analyzing the structure and function of genes and their adjacent regulatory regions. DNA cloning is helpful in learning fundamental molecular biological techniques, since DNA cloning involves a series of them, such as polymerase chain reaction (PCR, DNA ligation, bacterial transformation, bacterial culture, plasmid DNA extraction, DNA digestion with restriction enzymes and agarose gel electrophoresis. In this paper the cloning of the human tumor suppressor gene INGI has been used to illustrate the methodology. The gene was amplified by PCR, cloned into a TA-cloning vectore, and restriction enzyme mapping was used to distinguish the sense INGI construct from the antisense INGI construct.

  12. Automated seamless DNA co-transformation cloning with direct expression vectors applying positive or negative insert selection

    Directory of Open Access Journals (Sweden)

    Frey Daniel

    2010-08-01

    Full Text Available Abstract Background Molecular DNA cloning is crucial to many experiments and with the trend to higher throughput of modern approaches automated techniques are urgently required. We have established an automated, fast and flexible low-cost expression cloning approach requiring only vector and insert amplification by PCR and co-transformation of the products. Results Our vectors apply positive selection for the insert or negative selection against empty vector molecules and drive strong expression of target proteins in E.coli cells. Variable tags are available both in N-terminal or C-terminal position. A newly developed β-lactamase (ΔW290 selection cassette contains a segment inside the β-lactamase open reading frame encoding a stretch of hydrophilic amino acids that result in a T7 promoter when back-translated. This position of the promoter permits positive selection and attenuated expression of fusion proteins with C-terminal tags. We have tested eight vectors by inserting six target sequences of variable length, provenience and function. The target proteins were cloned, expressed and detected using an automated Tecan Freedom Evo II liquid handling work station. Only two colonies had to be picked to score with 85% correct inserts while 80% of those were positive in expression tests. Conclusions Our results establish co-transformation and positive/negative selection cloning in conjunction with the provided vectors and selection cassettes as an automatable alternative to commercialized high-throughput cloning systems like Gateway® or ligase-independent cloning (LIC .

  13. Bacillus subtilis genome vector-based complete manipulation and reconstruction of genomic DNA for mouse transgenesis.

    Science.gov (United States)

    Iwata, Tetsuo; Kaneko, Shinya; Shiwa, Yuh; Enomoto, Takayuki; Yoshikawa, Hirofumi; Hirota, Junji

    2013-05-03

    The Bacillus subtilis genome (BGM) vector is a novel cloning system for large DNA fragments, in which the entire 4.2 Mb genome of B. subtilis functions as a vector. The BGM vector system has several attractive properties, such as a large cloning capacity of over 3 Mb, stable propagation of cloned DNA and various modification strategies using RecA-mediated homologous recombination. However, genetic modifications using the BGM vector system have not been fully established, and this system has not been applied to transgenesis. In this study, we developed important additions to the genetic modification methods of the BGM vector system. To explore the potential of the BGM vector, we focused on the fish-like odorant receptor (class I OR) gene family, which consists of 158 genes and forms a single gene cluster. Although a cis-acting locus control region is expected to regulate transcription, this has not yet been determined experimentally. Using two contiguous bacterial artificial chromosome clones containing several class I OR genes, we constructed two transgenes in the BGM vector by inserting a reporter gene cassette into one class I OR gene. Because they were oriented in opposite directions, we performed an inversion modification to align their orientation and then fused them to enlarge the genomic structure. DNA sequencing revealed that no mutations occurred during gene manipulations with the BGM vector. We further demonstrated that the modified, reconstructed genomic DNA fragments could be used to generate transgenic mice. Transgenic mice carrying the enlarged transgene recapitulated the expression and axonal projection patterns of the target class I OR gene in the main olfactory system. We offer a complete genetic modification method for the BGM vector system, including insertion, deletion, inversion and fusion, to engineer genomic DNA fragments without any trace of modifications. In addition, we demonstrate that this system can be used for mouse transgenesis. Thus

  14. Vaccination with DNA Encoding an Immunodominant Myelin Basic Protein Peptide Targeted to Fc of Immunoglobulin G Suppresses Experimental Autoimmune Encephalomyelitis

    OpenAIRE

    Lobell, Anna; Weissert, Robert; Storch, Maria K.; Svanholm, Cecilia; de Graaf, Katrien L.; Lassmann, Hans; Andersson, Roland; Olsson, Tomas; Wigzell, Hans

    1998-01-01

    We explore here if vaccination with DNA encoding an autoantigenic peptide can suppress autoimmune disease. For this purpose we used experimental autoimmune encephalomyelitis (EAE), which is an autoaggressive disease in the central nervous system and an animal model for multiple sclerosis. Lewis rats were vaccinated with DNA encoding an encephalitogenic T cell epitope, guinea pig myelin basic protein peptide 68–85 (MBP68–85), before induction of EAE with MBP68–85 in complete Freund's adjuvant....

  15. Dendritic cell-targeted lentiviral vector immunization uses pseudotransduction and DNA-mediated STING and cGAS activation.

    Science.gov (United States)

    Kim, Jocelyn T; Liu, Yarong; Kulkarni, Rajan P; Lee, Kevin K; Dai, Bingbing; Lovely, Geoffrey; Ouyang, Yong; Wang, Pin; Yang, Lili; Baltimore, David

    2017-07-21

    Dendritic cell (DC) activation and antigen presentation are critical for efficient priming of T cell responses. Here, we study how lentiviral vectors (LVs) deliver antigen and activate DCs to generate T cell immunization in vivo. We report that antigenic proteins delivered in vector particles via pseudotransduction were sufficient to stimulate an antigen-specific immune response. The delivery of the viral genome encoding the antigen increased the magnitude of this response in vivo but was irrelevant in vitro. Activation of DCs by LVs was independent of MyD88, TRIF, and MAVS, ruling out an involvement of Toll-like receptor or RIG-I-like receptor signaling. Cellular DNA packaged in LV preparations induced DC activation by the host STING (stimulator of interferon genes) and cGAS (cyclic guanosine monophosphate-adenosine monophosphate synthase) pathway. Envelope-mediated viral fusion also activated DCs in a phosphoinositide 3-kinase-dependent but STING-independent process. Pseudotransduction, transduction, viral fusion, and delivery of cellular DNA collaborate to make the DC-targeted LV preparation an effective immunogen. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  16. Cloning and characterization of human liver cDNA encoding a protein S precursor

    International Nuclear Information System (INIS)

    Hoskins, J.; Norman, D.K.; Beckmann, R.J.; Long, G.L.

    1987-01-01

    Human liver cDNA encoding a protein S precursor was isolated from two cDNA libraries by two different techniques. Based upon the frequency of positive clones, the abundance of mRNA for protein S is ≅ 0.01%. Blot hybridization of electrophoretically fractionated poly(A) + RNA revealed a major mRNA ≅ 4 kilobases long and two minor forms of ≅ 3.1 and ≅ 2.6 kilobases. One of the cDNA clones contains a segment encoding a 676 amino acid protein S precursor, as well as 108 and 1132 nucleotides of 5' and 3' noncoding sequence, respectively, plus a poly(A) region at the 3' end. The cDNAs are adenosine plus thymidine-rich (60%) except for the 5' noncoding region, where 78% of the nucleotides are guanosine or cytosine. The protein precursor consists of a 41 amino acid leader peptide followed by 635 amino acids corresponding to mature protein S. Comparison of the mature protein region with homologous vitamin K-dependent plasma proteins shows that it is composed of the following domains: an amino-terminal γ-carboxyglutamic acid-rich region of 37 amino acids; a 36 amino acid linker region rich in hydroxy amino acids; four epidermal growth factor-like segments, each ≅ 45 amino acids long; and a 387 amino acid carboxyl-terminal domain of unrecognized structure and unknown function

  17. Agrobacterium T-DNA-encoded protein Atu6002 interferes with the host auxin response

    Science.gov (United States)

    Lacroix, Benoît; Gizatullina, Diana I.; Babst, Benjamin A.; Gifford, Andrew N.; Citovsky, Vitaly

    2013-01-01

    Summary Several genes in the Agrobacterium tumefaciens transferred (T) DNA encode proteins that are involved in developmental alterations leading to the formation of tumors in infected plants. We investigated the role of the protein encoded by the Atu6002 gene, the function of which is completely unknown. The Atu6002 expression occurs in Agrobacterium-induced tumors, and is also activated upon activation of plant cell division by growth hormones. Within the expressing plant cells, the Atu6002 protein is targeted to the plasma membrane. Interestingly, constitutive ectopic expression of Atu6002 in transgenic tobacco plants lead to a severe developmental phenotype characterized by stunted growth, shorter internodes, lanceolate leaves, increased branching, and modified flower morphology. These Atu6002-expressing plants also displayed impaired response to auxin. However, auxin cellular uptake and polar transport were not significantly inhibited in these plants, suggesting that Atu6002 interferes with auxin perception or signaling pathways. PMID:24128370

  18. DNA regulatory motif selection based on support vector machine ...

    African Journals Online (AJOL)

    Conserved DNA sequences are essential to investigate the regulation and expression of nearby genes. The conserved regions can interact with certain proteins and can potentially determine the transcription speed and amount of the corresponding mRNA in gene replication process. In this paper, motifs of coexpressed ...

  19. Gammaretroviral vector encoding a fluorescent marker to facilitate detection of reprogrammed human fibroblasts during iPSC generation

    Directory of Open Access Journals (Sweden)

    Narasimhachar Srinivasakumar

    2013-12-01

    Full Text Available Induced pluripotent stem cells (iPSCs are becoming mainstream tools to study mechanisms of development and disease. They have a broad range of applications in understanding disease processes, in vitro testing of novel therapies, and potential utility in regenerative medicine. Although the techniques for generating iPSCs are becoming more straightforward, scientists can expend considerable resources and time to establish this technology. A major hurdle is the accurate determination of valid iPSC-like colonies that can be selected for further cloning and characterization. In this study, we describe the use of a gammaretroviral vector encoding a fluorescent marker, mRFP1, to not only monitor the efficiency of initial transduction but also to identify putative iPSC colonies through silencing of mRFP1 gene as a consequence of successful reprogramming.

  20. Vectors

    DEFF Research Database (Denmark)

    Boeriis, Morten; van Leeuwen, Theo

    2017-01-01

    This article revisits the concept of vectors, which, in Kress and van Leeuwen’s Reading Images (2006), plays a crucial role in distinguishing between ‘narrative’, action-oriented processes and ‘conceptual’, state-oriented processes. The use of this concept in image analysis has usually focused...... on the most salient vectors, and this works well, but many images contain a plethora of vectors, which makes their structure quite different from the linguistic transitivity structures with which Kress and van Leeuwen have compared ‘narrative’ images. It can also be asked whether facial expression vectors...... should be taken into account in discussing ‘reactions’, which Kress and van Leeuwen link only to eyeline vectors. Finally, the question can be raised as to whether actions are always realized by vectors. Drawing on a re-reading of Rudolf Arnheim’s account of vectors, these issues are outlined...

  1. Cloning and Characterization of a cDNA Encoding a Novel Extracellular Peroxidase from Trametes versicolor

    Science.gov (United States)

    Collins, Patrick J.; O’Brien, Margaret M.; Dobson, Alan D. W.

    1999-01-01

    The white rot basidiomycete Trametes versicolor secretes a large number of peroxidases which are believed to be involved in the degradation of polymeric lignin. These peroxidases have been classified previously as lignin peroxidases or manganese peroxidases (MnP). We have isolated a novel extracellular peroxidase-encoding cDNA sequence from T. versicolor CU1, the transcript levels of which are repressed by low concentrations of Mn2+ and induced by nitrogen and carbon but not induced in response to a range of stresses which have been reported to induce MnP expression. PMID:10049906

  2. Chitosan-Graft-Polyethylenimine/DNA Nanoparticles as Novel Non-Viral Gene Delivery Vectors Targeting Osteoarthritis

    Science.gov (United States)

    Lv, Lulu; Zhao, Huiqing

    2014-01-01

    The development of safe and efficient gene carriers is the key to the clinical success of gene therapy. The present study was designed to develop and evaluate the chitosan-graft-polyethylenimine (CP)/DNA nanoparticles as novel non-viral gene vectors for gene therapy of osteoarthritis. The CP/DNA nanoparticles were produced through a complex coacervation of the cationic polymers with pEGFP after grafting chitosan (CS) with a low molecular weight (Mw) PEI (Mw = 1.8 kDa). Particle size and zeta potential were related to the weight ratio of CP:DNA, where decreases in nanoparticle size and increases in surface charge were observed as CP content increased. The buffering capacity of CP was significantly greater than that of CS. The transfection efficiency of CP/DNA nanoparticles was similar with that of the Lipofectamine™ 2000, and significantly higher than that of CS/DNA and PEI (25 kDa)/DNA nanoparticles. The transfection efficiency of the CP/DNA nanoparticles was dependent on the weight ratio of CP:DNA (w/w). The average cell viability after the treatment with CP/DNA nanoparticles was over 90% in both chondrocytes and synoviocytes, which was much higher than that of PEI (25 kDa)/DNA nanoparticles. The CP copolymers efficiently carried the pDNA inside chondrocytes and synoviocytes, and the pDNA was detected entering into nucleus. These results suggest that CP/DNA nanoparticles with improved transfection efficiency and low cytotoxicity might be a safe and efficient non-viral vector for gene delivery to both chondrocytes and synoviocytes. PMID:24392152

  3. Achievements, Challenges, and Opportunities in DNA-Encoded Library Research: An Academic Point of View.

    Science.gov (United States)

    Yuen, Lik Hang; Franzini, Raphael M

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are pools of DNA-tagged small molecules that enable facile screening and identification of bio-macromolecule binders. The successful development of DECLs has led to their increasingly important role in drug development, and screening hits have entered clinical trials. In this review, we summarize the development and currently active research areas of DECLs with a focus on contributions from groups at academic institutes. We further look at opportunities and future directions of DECL research in medicinal chemistry and chemical biology based on the symbiotic relationship between academia and industry. Challenges associated with the application of DECLs in academic drug discovery are further discussed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Identification and characterization of a novel Cut family cDNA that encodes human copper transporter protein CutC

    International Nuclear Information System (INIS)

    Li Jixi; Ji Chaoneng; Chen Jinzhong; Yang Zhenxing; Wang Yijing; Fei, Xiangwei; Zheng Mei; Gu Xing; Wen Ge; Xie Yi; Mao Yumin

    2005-01-01

    Copper is an essential heavy metal trace element that plays important roles in cell physiology. The Cut family was associated with the copper homeostasis and involved in several important metabolisms, such as uptake, storage, delivery, and efflux of copper. In this study, a novel Cut family cDNA was isolated from the human fetal brain library, which encodes a 273 amino acid protein with a molecular mass of about 29.3 kDa and a calculated pI of 8.17. It was named hCutC (human copper transporter protein CutC). The ORF of hCutC gene was cloned into pQE30 vector and expressed in Escherichia coli M15. The secreted hCutC protein was purified to a homogenicity of 95% by using the Ni-NTA affinity chromatography. RT-PCR analysis showed that the hCutC gene expressed extensively in human tissues. Subcellular location analysis of hCutC-EGFP fusion protein revealed that hCutC was distributed to cytoplasm of COS-7 cells, and both cytoplasm and nucleus of AD293 cells. The results suggest that hCutC may be one shuttle protein and play important roles in intracellular copper trafficking

  5. Self-entanglement of long linear DNA vectors using transient non-B-DNA attachment points: a new concept for improvement of non-viral therapeutic gene delivery.

    Science.gov (United States)

    Tolmachov, Oleg E

    2012-05-01

    The cell-specific and long-term expression of therapeutic transgenes often requires a full array of native gene control elements including distal enhancers, regulatory introns and chromatin organisation sequences. The delivery of such extended gene expression modules to human cells can be accomplished with non-viral high-molecular-weight DNA vectors, in particular with several classes of linear DNA vectors. All high-molecular-weight DNA vectors are susceptible to damage by shear stress, and while for some of the vectors the harmful impact of shear stress can be minimised through the transformation of the vectors to compact topological configurations by supercoiling and/or knotting, linear DNA vectors with terminal loops or covalently attached terminal proteins cannot be self-compacted in this way. In this case, the only available self-compacting option is self-entangling, which can be defined as the folding of single DNA molecules into a configuration with mutual restriction of molecular motion by the individual segments of bent DNA. A negatively charged phosphate backbone makes DNA self-repulsive, so it is reasonable to assume that a certain number of 'sticky points' dispersed within DNA could facilitate the entangling by bringing DNA segments into proximity and by interfering with the DNA slipping away from the entanglement. I propose that the spontaneous entanglement of vector DNA can be enhanced by the interlacing of the DNA with sites capable of mutual transient attachment through the formation of non-B-DNA forms, such as interacting cruciform structures, inter-segment triplexes, slipped-strand DNA, left-handed duplexes (Z-forms) or G-quadruplexes. It is expected that the non-B-DNA based entanglement of the linear DNA vectors would consist of the initial transient and co-operative non-B-DNA mediated binding events followed by tight self-ensnarement of the vector DNA. Once in the nucleoplasm of the target human cells, the DNA can be disentangled by type II

  6. DNA Vaccines Encoding Toxoplasma gondii Cathepsin C 1 Induce Protection against Toxoplasmosis in Mice.

    Science.gov (United States)

    Han, Yali; Zhou, Aihua; Lu, Gang; Zhao, Guanghui; Sha, Wenchao; Wang, Lin; Guo, Jingjing; Zhou, Jian; Zhou, Huaiyu; Cong, Hua; He, Shenyi

    2017-10-01

    Toxoplasma gondii cathepsin C proteases (TgCPC1, 2, and 3) are important for the growth and survival of T. gondii. In the present study, B-cell and T-cell epitopes of TgCPC1 were predicted using DNAstar and the Immune Epitope Database. A TgCPC1 DNA vaccine was constructed, and its ability to induce protective immune responses against toxoplasmosis in BALB/c mice was evaluated in the presence or absence of the adjuvant α-GalCer. As results, TgCPC1 DNA vaccine with or without adjuvant α-GalCer showed higher levels of IgG and IgG2a in the serum, as well as IL-2 and IFN-γ in the spleen compared to controls (PBS, pEGFP-C1, and α-Galcer). Upon challenge infection with tachyzoites of T. gondii (RH), pCPC1/α-Galcer immunized mice showed the longest survival among all the groups. Mice vaccinated with DNA vaccine without adjuvant (pCPC1) showed better protective immunity compared to other controls (PBS, pEGFP-C1, and α-Galcer). These results indicate that a DNA vaccine encoding TgCPC1 is a potential vaccine candidate against toxoplasmosis.

  7. Vectors

    DEFF Research Database (Denmark)

    Boeriis, Morten; van Leeuwen, Theo

    2017-01-01

    This article revisits the concept of vectors, which, in Kress and van Leeuwen’s Reading Images (2006), plays a crucial role in distinguishing between ‘narrative’, action-oriented processes and ‘conceptual’, state-oriented processes. The use of this concept in image analysis has usually focused...... should be taken into account in discussing ‘reactions’, which Kress and van Leeuwen link only to eyeline vectors. Finally, the question can be raised as to whether actions are always realized by vectors. Drawing on a re-reading of Rudolf Arnheim’s account of vectors, these issues are outlined...

  8. Vaccination with DNA encoding an immunodominant myelin basic protein peptide targeted to Fc of immunoglobulin G suppresses experimental autoimmune encephalomyelitis.

    Science.gov (United States)

    Lobell, A; Weissert, R; Storch, M K; Svanholm, C; de Graaf, K L; Lassmann, H; Andersson, R; Olsson, T; Wigzell, H

    1998-05-04

    We explore here if vaccination with DNA encoding an autoantigenic peptide can suppress autoimmune disease. For this purpose we used experimental autoimmune encephalomyelitis (EAE), which is an autoaggressive disease in the central nervous system and an animal model for multiple sclerosis. Lewis rats were vaccinated with DNA encoding an encephalitogenic T cell epitope, guinea pig myelin basic protein peptide 68-85 (MBP68-85), before induction of EAE with MBP68-85 in complete Freund's adjuvant. Compared to vaccination with a control DNA construct, the vaccination suppressed clinical and histopathological signs of EAE, and reduced the interferon gamma production after challenge with MBP68-85. Targeting of the gene product to Fc of IgG was essential for this effect. There were no signs of a Th2 cytokine bias. Our data suggest that DNA vaccines encoding autoantigenic peptides may be useful tools in controlling autoimmune disease.

  9. The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.

  10. Design of a titering assay for lentiviral vectors utilizing direct extraction of DNA from transduced cells in microtiter plates

    Directory of Open Access Journals (Sweden)

    Michele E Murphy

    2016-01-01

    Full Text Available Using lentiviral vector products in clinical applications requires an accurate method for measuring transduction titer. For vectors lacking a marker gene, quantitative polymerase chain reaction is used to evaluate the number of vector DNA copies in transduced target cells, from which a transduction titer is calculated. Immune Design previously described an integration-deficient lentiviral vector pseudotyped with a modified Sindbis virus envelope for use in cancer immunotherapy (VP02, of the ZVex platform. Standard protocols for titering integration-competent lentiviral vectors employ commercial spin columns to purify vector DNA from transduced cells, but such columns are not optimized for isolation of extrachromosomal (nonintegrated DNA. Here, we describe a 96-well transduction titer assay in which DNA extraction is performed in situ in the transduction plate, yielding quantitative recovery of extrachromosomal DNA. Vector titers measured by this method were higher than when commercial spin columns were used for DNA isolation. Evaluation of the method's specificity, linear range, and precision demonstrate that it is suitable for use as a lot release assay to support clinical trials with VP02. Finally, the method is compatible with titering both integrating and nonintegrating lentiviral vectors, suggesting that it may be used to evaluate the transduction titer for any lentiviral vector.

  11. Arabidopsis thaliana GYRB3 does not encode a DNA gyrase subunit.

    Directory of Open Access Journals (Sweden)

    Katherine M Evans-Roberts

    2010-03-01

    Full Text Available DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3.We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer.These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen.

  12. Intranasal Vaccination against Cutaneous Leishmaniasis with a Particulated Leishmanial Antigen or DNA Encoding LACK

    Science.gov (United States)

    Pinto, Eduardo Fonseca; Pinheiro, Roberta Olmo; Rayol, Alice; Larraga, Vicente; Rossi-Bergmann, Bartira

    2004-01-01

    We have previously demonstrated that oral delivery of a disease-promoting particulated antigen of Leishmania amazonensis (LaAg) partially protects mice against cutaneous leishmaniasis. In the present work, we sought to optimize a mucosal vaccine by using the intranasal route for delivery of different antigen preparations, including (i) LaAg, (ii) soluble recombinant p36/LACK leishmanial antigen (LACK), and (iii) plasmid DNA encoding LACK (LACK DNA). BALB/c mice that received two intranasal doses of 10 μg of LaAg and were challenged 1 week postvaccination with L. amazonensis developed delayed but effective control of lesion growth. A diminished parasite burden was accompanied by enhancement of both gamma interferon (IFN-γ) and interleukin-10 levels in the lesion-draining lymph nodes. The vaccine efficacy improved with time. At 4 months postvaccination, when a strong parasite-specific TH1-type response was present in vivo, the infection was controlled for at least 5 months after challenge. In contrast to the particulated LaAg, soluble LACK (10 μg/dose) had no effect. Interestingly, LACK DNA (30 μg/dose), but not empty DNA, promoted rapid and durable protective immunity. Parasite growth was effectively controlled, and at 5 months after challenge LACK-reactive cells in both the mucosal and lesion-draining lymph nodes produced high levels of IFN-γ. These results demonstrate for the first time the feasibility of using the intranasal route for long-lived memory vaccination against cutaneous leishmaniasis with adjuvant-free crude antigens or DNA. PMID:15271911

  13. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  14. Replication-defective recombinant Semliki Forest virus encoding GM-CSF as a vector system for rapid and facile generation of autologous human tumor cell vaccines

    NARCIS (Netherlands)

    Withoff, S; Glazenburg, KL; van Veen, ML; Kraak, MMJ; Hospers, GAP; Storkel, S; de Vries, EGE; Wischut, J; Daemen, T

    2001-01-01

    This paper describes the production of recombinant Semliki Forest virus encoding murine or human granulocyte-macrophage colony-stimulating factor (GM-CSF) and the capacity of these vectors to transduce murine and human tumor cells ex vivo. High-titer stocks (up to 3 x 10(9) particles/ml) of

  15. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  16. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  17. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Jandova, Jana; Janda, Jaroslav [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States); Sligh, James E, E-mail: jsligh@azcc.arizona.edu [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States)

    2012-10-15

    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  18. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    International Nuclear Information System (INIS)

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

    1987-01-01

    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  19. A brief review on the Human Encyclopedia of DNA Elements (ENCODE) project.

    Science.gov (United States)

    Qu, Hongzhu; Fang, Xiangdong

    2013-06-01

    The ENCyclopedia Of DNA Elements (ENCODE) project is an international research consortium that aims to identify all functional elements in the human genome sequence. The second phase of the project comprised 1640 datasets from 147 different cell types, yielding a set of 30 publications across several journals. These data revealed that 80.4% of the human genome displays some functionality in at least one cell type. Many of these regulatory elements are physically associated with one another and further form a network or three-dimensional conformation to affect gene expression. These elements are also related to sequence variants associated with diseases or traits. All these findings provide us new insights into the organization and regulation of genes and genome, and serve as an expansive resource for understanding human health and disease. Copyright © 2013. Production and hosting by Elsevier Ltd.

  20. Prioritizing multiple therapeutic targets in parallel using automated DNA-encoded library screening

    Science.gov (United States)

    Machutta, Carl A.; Kollmann, Christopher S.; Lind, Kenneth E.; Bai, Xiaopeng; Chan, Pan F.; Huang, Jianzhong; Ballell, Lluis; Belyanskaya, Svetlana; Besra, Gurdyal S.; Barros-Aguirre, David; Bates, Robert H.; Centrella, Paolo A.; Chang, Sandy S.; Chai, Jing; Choudhry, Anthony E.; Coffin, Aaron; Davie, Christopher P.; Deng, Hongfeng; Deng, Jianghe; Ding, Yun; Dodson, Jason W.; Fosbenner, David T.; Gao, Enoch N.; Graham, Taylor L.; Graybill, Todd L.; Ingraham, Karen; Johnson, Walter P.; King, Bryan W.; Kwiatkowski, Christopher R.; Lelièvre, Joël; Li, Yue; Liu, Xiaorong; Lu, Quinn; Lehr, Ruth; Mendoza-Losana, Alfonso; Martin, John; McCloskey, Lynn; McCormick, Patti; O'Keefe, Heather P.; O'Keeffe, Thomas; Pao, Christina; Phelps, Christopher B.; Qi, Hongwei; Rafferty, Keith; Scavello, Genaro S.; Steiginga, Matt S.; Sundersingh, Flora S.; Sweitzer, Sharon M.; Szewczuk, Lawrence M.; Taylor, Amy; Toh, May Fern; Wang, Juan; Wang, Minghui; Wilkins, Devan J.; Xia, Bing; Yao, Gang; Zhang, Jean; Zhou, Jingye; Donahue, Christine P.; Messer, Jeffrey A.; Holmes, David; Arico-Muendel, Christopher C.; Pope, Andrew J.; Gross, Jeffrey W.; Evindar, Ghotas

    2017-07-01

    The identification and prioritization of chemically tractable therapeutic targets is a significant challenge in the discovery of new medicines. We have developed a novel method that rapidly screens multiple proteins in parallel using DNA-encoded library technology (ELT). Initial efforts were focused on the efficient discovery of antibacterial leads against 119 targets from Acinetobacter baumannii and Staphylococcus aureus. The success of this effort led to the hypothesis that the relative number of ELT binders alone could be used to assess the ligandability of large sets of proteins. This concept was further explored by screening 42 targets from Mycobacterium tuberculosis. Active chemical series for six targets from our initial effort as well as three chemotypes for DHFR from M. tuberculosis are reported. The findings demonstrate that parallel ELT selections can be used to assess ligandability and highlight opportunities for successful lead and tool discovery.

  1. Successful transfer of plasmid DNA into in vitro cells transfected with an inorganic plasmid-Mg/Al-LDH nanobiocomposite material as a vector for gene expression

    Science.gov (United States)

    Jaffri Masarudin, Mas; Yusoff, Khatijah; Rahim, Raha Abdul; Zobir Hussein, Mohd

    2009-01-01

    The delivery of a full plasmid, encoding the green fluorescent protein gene into African monkey kidney (Vero3) cells, was successfully achieved using nanobiocomposites based on layered double hydroxides. This demonstrated the potential of using the system as an alternative DNA delivery vector. Intercalation of the circular plasmid DNA, pEGFP-N2, into Mg/Al-NO3- layered double hydroxides (LDH) was accomplished through anion exchange routes to form the nanobiocomposite material. The host was previously synthesized at the Mg2+ to Al3+ molar ratio Ri = 2 and subsequently intercalated with plasmid DNA. Size expansion of the interlamellae host from 8.8 Å in LDH to 42 Å was observed in the resulting nanobiocomposite, indicating stable hybridization of the plasmid DNA. The powder x-ray diffraction (PXRD) results, supplemented with Fourier-transform infrared (FTIR) spectroscopy, compositional and electrophoresis studies confirmed the encapsulation episode of the biomaterial. In order to elucidate the use of this resulting nanobiocomposite as a delivery vector, an MTT assay was performed to determine any cytotoxic effects of the host towards cells. The intercalated pEGFP-N2 anion was later successfully recovered through acidification with HNO3 after treatment with DNA-degrading enzymes, thus also showing the ability of the LDH host to protect the intercalated biomaterial from degradation. Cell transfection studies on Vero3 cells were then performed, where cells transfected with the nanobiocomposite exhibited fluorescence as early as 12 h post-treatment compared to naked delivery of the plasmid itself.

  2. A combined approach of hollow microneedles and nanocarriers for skin immunization with plasmid DNA encoding ovalbumin

    Directory of Open Access Journals (Sweden)

    Pamornpathomkul B

    2017-01-01

    Full Text Available Boonnada Pamornpathomkul,1 Adisak Wongkajornsilp,2 Wanida Laiwattanapaisal,3 Theerasak Rojanarata,1 Praneet Opanasopit,1 Tanasait Ngawhirunpat1 1Department of Pharmaceutical Technology, Faculty of Pharmacy, Pharmaceutical Development of Green Innovations Group, Silpakorn University, Nakhon Pathom, 2Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 3Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, Thailand Abstract: The aim of this study was to investigate the use of different types of microneedles (MNs and nanocarriers for in vitro skin permeation and in vivo immunization of plasmid DNA encoding ovalbumin (pOVA. In vitro skin permeation studies indicated that hollow MNs had a superior enhancing effect on skin permeation compared with solid MN patches, electroporation (EP patches, the combination of MN and EP patches, and untreated skin. Upon using hollow MNs combined with nanocarriers for pOVA delivery, the skin permeation was higher than for the delivery of naked pOVA, as evidenced by the increased amount of pOVA in Franz diffusion cells and immunoglobulin G (IgG antibody responses. When the hollow MNs were used for the delivery of nanocarrier:pOVA complexes into the skin of mice, they induced a stronger IgG immune response than conventional subcutaneous (SC injections. In addition, immunization of mice with the hollow MNs did not induce signs of skin infection or pinpoint bleeding. Accordingly, the hollow MNs combined with a nanocarrier delivery system is a promising approach for delivering pOVA complexes to the skin for promoting successful immunization. Keywords: hollow microneedle, solid microneedle, electroporation, plasmid DNA encoding ovalbumin, skin immunization, nanocarrier

  3. Begomovirus-Associated Satellite DNA Diversity Captured Through Vector-Enabled Metagenomic (VEM) Surveys Using Whiteflies (Aleyrodidae).

    Science.gov (United States)

    Rosario, Karyna; Marr, Christian; Varsani, Arvind; Kraberger, Simona; Stainton, Daisy; Moriones, Enrique; Polston, Jane E; Breitbart, Mya

    2016-02-02

    Monopartite begomoviruses (Geminiviridae), which are whitefly-transmitted single-stranded DNA viruses known for causing devastating crop diseases, are often associated with satellite DNAs. Since begomovirus acquisition or exchange of satellite DNAs may lead to adaptation to new plant hosts and emergence of new disease complexes, it is important to investigate the diversity and distribution of these molecules. This study reports begomovirus-associated satellite DNAs identified during a vector-enabled metagenomic (VEM) survey of begomoviruses using whiteflies collected in various locations (California (USA), Guatemala, Israel, Puerto Rico, and Spain). Protein-encoding satellite DNAs, including alphasatellites and betasatellites, were identified in Israel, Puerto Rico, and Guatemala. Novel alphasatellites were detected in samples from Guatemala and Puerto Rico, resulting in the description of a phylogenetic clade (DNA-3-type alphasatellites) dominated by New World sequences. In addition, a diversity of small (~640-750 nucleotides) satellite DNAs similar to satellites associated with begomoviruses infecting Ipomoea spp. were detected in Puerto Rico and Spain. A third class of satellite molecules, named gammasatellites, is proposed to encompass the increasing number of reported small (satellite DNAs. This VEM-based survey indicates that, although recently recovered begomovirus genomes are variations of known genetic themes, satellite DNAs hold unexplored genetic diversity.

  4. Glycoprotein is enough for sindbis virus-derived DNA vector to express heterogenous genes

    Directory of Open Access Journals (Sweden)

    Fu Juanjuan

    2011-07-01

    Full Text Available Abstract To investigate the necessity and potential application of structural genes for expressing heterogenous genes from Sindbis virus-derived vector, the DNA-based expression vector pVaXJ was constructed by placing the recombinant genome of sindbis-like virus XJ-160 under the control of the human cytomegalovirus (CMV promoter of the plasmid pVAX1, in which viral structural genes were replaced by a polylinker cassette to allow for insertion of heterologous genes. The defect helper plasmids pVaE or pVaC were developed by cloning the gene of glycoprotein E3E26KE1 or capsid protein of XJ-160 virus into pVAX1, respectively. The report gene cassette pVaXJ-EGFP or pV-Gluc expressing enhanced green fluorescence protein (EGFP or Gaussia luciferase (G.luc were constructed by cloning EGFP or G.luc gene into pVaXJ. EGFP or G.luc was expressed in the BHK-21 cells co-transfected with report gene cassettes and pVaE at levels that were comparable to those produced by report gene cassettes, pVaC and pVaE and were much higher than the levels produced by report gene cassette and pVaC, suggesting that glycoprotein is enough for Sindbis virus-derived DNA vector to express heterogenous genes in host cells. The method of gene expression from Sindbis virus-based DNA vector only co-transfected with envelop E gene increase the conveniency and the utility of alphavirus-based vector systems in general.

  5. Skin vaccination using microneedles coated with a plasmid DNA cocktail encoding nucleosomal histones of Leishmania spp.

    Science.gov (United States)

    Moreno, Esther; Schwartz, Juana; Calvo, Alba; Blanco, Laura; Larrea, Esther; Irache, Juan M; Sanmartín, Carmen; Coulman, Sion A; Soto, Manuel; Birchall, James C; Espuelas, Socorro

    2017-11-25

    Vaccine delivery using microneedles (MNs) represents a safe, easily disposable and painless alternative to traditional needle immunizations. The MN delivery of DNA vaccines to the dermis may result in a superior immune response and/or an equivalent immune response at a lower vaccine dose (dose-sparing). This could be of special interest for immunization programs against neglected tropical diseases such as leishmaniasis. In this work, we loaded a MN device with 60μg of a plasmid DNA cocktail encoding the Leishmania infantum nucleosomal histones H2A, H2B, H3 and H4 and compared its immunogenicity and protective capacity against conventional s.c. or i.d. injection of the plasmid. Mice immunized with MNs showed increased ratios of IFN-γ/IL-10, IFN-γ/IL-13, IFN-γ/IL-4, and IFN-γ/TGF-β in the spleens and lymph nodes compared with mice immunized by s.c. and i.d. routes. Furthermore, CCXCL9, CXCL10 and CCL2 levels were also higher. These data suggest that the nucleic acid immunization using MNs produced a better bias towards a Th1 response. However, none of the immunizations strategies were able to control Leishmania major infection in BALB/c mice, as illustrated by an increase in lesion size and parasite burden. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Design and Development of a Technology Platform for DNA-Encoded Library Production and Affinity Selection.

    Science.gov (United States)

    Castañón, Jesús; Román, José Pablo; Jessop, Theodore C; de Blas, Jesús; Haro, Rubén

    2018-01-01

    DNA-encoded libraries (DELs) have emerged as an efficient and cost-effective drug discovery tool for the exploration and screening of very large chemical space using small-molecule collections of unprecedented size. Herein, we report an integrated automation and informatics system designed to enhance the quality, efficiency, and throughput of the production and affinity selection of these libraries. The platform is governed by software developed according to a database-centric architecture to ensure data consistency, integrity, and availability. Through its versatile protocol management functionalities, this application captures the wide diversity of experimental processes involved with DEL technology, keeps track of working protocols in the database, and uses them to command robotic liquid handlers for the synthesis of libraries. This approach provides full traceability of building-blocks and DNA tags in each split-and-pool cycle. Affinity selection experiments and high-throughput sequencing reads are also captured in the database, and the results are automatically deconvoluted and visualized in customizable representations. Researchers can compare results of different experiments and use machine learning methods to discover patterns in data. As of this writing, the platform has been validated through the generation and affinity selection of various libraries, and it has become the cornerstone of the DEL production effort at Lilly.

  7. Efficient production of superior dumbbell-shaped DNA minimal vectors for small hairpin RNA expression.

    Science.gov (United States)

    Yu, Han; Jiang, Xiaoou; Tan, Kar Tong; Hang, Liting; Patzel, Volker

    2015-10-15

    Genetic therapy holds great promise for the treatment of inherited or acquired genetic diseases; however, its breakthrough is hampered by the lack of suitable gene delivery systems. Dumbbell-shaped DNA minimal vectors represent an attractive, safe alternative to the commonly used viral vectors which are fraught with risk, but dumbbell generation appears to be costly and time-consuming. We developed a new PCR-based method for dumbbell production which comprises only two steps. First, PCR amplification of the therapeutic expression cassette using chemically modified primers to form a ready-to-ligate DNA structure; and second, a highly efficient intramolecular ligation reaction. Compared with conventional strategies, the new method produces dumbbell vector/span>s more rapidly, with higher yields and purity, and at lower costs. In addition, such produced small hairpin RNA expressing dumbbells triggered superior target gene knockdown compared with conventionally produced dumbbells or plasmids. Our novel method is suitable for large-scale dumbbell production and can facilitate clinical applications of this vector system. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Efficient production of superior dumbbell-shaped DNA minimal vectors for small hairpin RNA expression

    Science.gov (United States)

    Yu, Han; Jiang, Xiaoou; Tan, Kar Tong; Hang, Liting; Patzel, Volker

    2015-01-01

    Genetic therapy holds great promise for the treatment of inherited or acquired genetic diseases; however, its breakthrough is hampered by the lack of suitable gene delivery systems. Dumbbell-shaped DNA minimal vectors represent an attractive, safe alternative to the commonly used viral vectors which are fraught with risk, but dumbbell generation appears to be costly and time-consuming. We developed a new PCR-based method for dumbbell production which comprises only two steps. First, PCR amplification of the therapeutic expression cassette using chemically modified primers to form a ready-to-ligate DNA structure; and second, a highly efficient intramolecular ligation reaction. Compared with conventional strategies, the new method produces dumbbell vectors more rapidly, with higher yields and purity, and at lower costs. In addition, such produced small hairpin RNA expressing dumbbells triggered superior target gene knockdown compared with conventionally produced dumbbells or plasmids. Our novel method is suitable for large-scale dumbbell production and can facilitate clinical applications of this vector system. PMID:26068470

  9. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

    Science.gov (United States)

    Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

    2011-06-10

    The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Protamine/DNA/Niosome Ternary Nonviral Vectors for Gene Delivery to the Retina: The Role of Protamine.

    Science.gov (United States)

    Puras, G; Martínez-Navarrete, G; Mashal, M; Zárate, J; Agirre, M; Ojeda, E; Grijalvo, S; Eritja, R; Diaz-Tahoces, A; Avilés-Trigueros, M; Fernández, E; Pedraz, J L

    2015-10-05

    The present study aimed to evaluate the incorporation of protamine into niosome/DNA vectors to analyze the potential application of this novel ternary formulation to deliver the pCMS-EGFP plasmid into the rat retina. Binary vectors based on niosome/DNA and ternary vectors based on protamine/DNA/niosomes were prepared and physicochemically characterized. In vitro experiments were performed in ARPE-19 cells. At 1:1:5 protamine/DNA/niosome mass ratio, the resulted ternary vectors had 150 nm size, positive charge, spherical morphology, and condensed, released, and protected the DNA against enzymatic digestion. The presence of protamine in the ternary vectors improved transfection efficiency, cell viability, and DNA condensation. After ocular administration, the EGFP expression was detected in different cell layers of the retina depending on the administration route without any sign of toxicity associated with the formulations. While subretinal administration transfected mainly photoreceptors and retinal pigment epithelial cells at the site of injection, intravitreal administration produced a more uniform distribution of the protein expression through the inner layers of the retina. The protein expression in the retina persisted for at least one month after both administrations. Our study highlights the flattering properties of protamine/DNA/niosome ternary vectors for efficient and safe gene delivery to the rat retina.

  11. A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F

    DEFF Research Database (Denmark)

    Helin, K; Lees, J A; Vidal, M

    1992-01-01

    The retinoblastoma protein (pRB) plays an important role in the control of cell proliferation, apparently by binding to and regulating cellular transcription factors such as E2F. Here we describe the characterization of a cDNA clone that encodes a protein with properties of E2F. This clone, RBP3...

  12. Genetic modification of dividing cells using episomally maintained S/MAR DNA vectors

    Directory of Open Access Journals (Sweden)

    Suet-Ping Wong

    2013-01-01

    Full Text Available The development of episomally maintained DNA vectors to genetically modify dividing cells efficiently and stably, without the risk of integration-mediated genotoxicity, should prove to be a valuable tool in genetic research. In this study, we demonstrate the utility of Scaffold/Matrix Attachment Region (S/MAR DNA vectors to model the restoration of a functional wild-type copy of the gene folliculin (FLCN implicated in the renal cancer Birt-Hogg-Dubé (BHD. Inactivation of FLCN has been shown to be involved in the development of sporadic renal neoplasia in BHD. S/MAR-modified BHD tumor cells (named UOK257-FS show restored stable FLCN expression and have normalized downstream TGFβ signals. We demonstrate that UOK257-FS cells show a reduced growth rate in vitro and suppression of xenograft tumor development in vivo, compared with the original FLCN-null UOK257 cell line. In addition, we demonstrate that mTOR signaling in serum-starved FLCN-restored cells is differentially regulated compared with the FLCN-deficient cell. The novel UOK257-FS cell line will be useful for studying the signaling pathways affected in BHD pathogenesis. Significantly, this study demonstrates the suitability of S/MAR vectors to successfully model the functional expression of a therapeutic gene in a cancer cell line and will aid the identification of novel cancer markers for diagnosis and therapy.

  13. An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply

    National Research Council Canada - National Science Library

    Reisfeld, Ralph A

    2006-01-01

    .... We attained our goals for the second fiscal year, first, by constructing unique expression plasmids encoding endoglin and co-expressing IL-15 or encoding IL-7, the latter to be co-expressed with endoglin...

  14. Isolation of genomic DNA encoding transcription factor TFIID from Acanthamoeba castellanii: characterization of the promoter.

    Science.gov (United States)

    Wong, J M; Liu, F; Bateman, E

    1992-01-01

    We have isolated a genomic clone encoding Acanthamoeba castellanii TFIID. The clone contains the entire TFIID gene, 300 bp of 5' promoter sequences and several hundred base pairs of 3' non-coding sequence. The coding region is interrupted by two short introns, but is otherwise identical to Acanthamoeba TFIID cDNA. Comparisons between forty four Acanthamoeba intron 5' and 3' boundaries suggest a 5' splice site consensus of GTACG(T/C) and a 3' consensus of CAG. We determined the position of the transcription initiation site used in vivo, and show that the same site is used in vitro by homologous nuclear extracts. Deletion analysis of the promoter region shows that the minimal promoter required for efficient expression in vitro is located between -97 and +4 relative to the transcription start site. Three regions within the promoter are important for transcription in vitro; sequences between -97 and -35, the TATAAA box and the initiation region. The initiation region is dispensable but appears to position the transcription start site relative to the TATAAA box. The TATAAA box is absolutely required for transcription initiation whereas the upstream region stimulates transcription approximately five-fold. Images PMID:1408796

  15. Saccharomyces cerevisiae gene ISW2 encodes a microtubule-interacting protein required for premeiotic DNA replication.

    Science.gov (United States)

    Trachtulcová, P; Janatová, I; Kohlwein, S D; Hasek, J

    2000-01-15

    A molecular genetic characterization of the ORF YOR304W (ISW2), identified in a screen of a yeast lambdagt11 library using a monoclonal antibody that reacts with a 210 kDa mammalian microtubule-interacting protein, is presented in this paper. The protein encoded by the ORF YOR304W is 50% identical to the Drosophila nucleosome remodelling factor ISWI and is therefore a new member of the SNF2 protein family and has been recently entered into SDG as ISW2. Although not essential for vegetative growth, we found that the ISW2 gene is required for early stages in sporulation. The isw2 homozygous deletant diploid strain was blocked in the G(1) phase of the cell cycle, unable to execute the premeiotic DNA replication and progress through the nuclear meiotic division cycle. ISW2 expression from a multicopy plasmid had the same effect as deletion, but ISW2 expression from a centromeric plasmid rescued the deletion phenotype. In vegetatively growing diploid cells, the Isw2 protein was preferentially found in the cytoplasm, co-localizing with microtubules. An accumulation of the Isw2 protein within the nucleus was observed in cells entering sporulation. Together with data published very recently by Tsukiyama et al. (1999), we propose a role for the Isw2 protein in facilitating chromatin accessibility for transcriptional factor(s) that positively regulate meiosis/sporulation-specific genes. Copyright 2000 John Wiley & Sons, Ltd.

  16. A prophage-encoded actin-like protein required for efficient viral DNA replication in bacteria.

    Science.gov (United States)

    Donovan, Catriona; Heyer, Antonia; Pfeifer, Eugen; Polen, Tino; Wittmann, Anja; Krämer, Reinhard; Frunzke, Julia; Bramkamp, Marc

    2015-05-26

    In host cells, viral replication is localized at specific subcellular sites. Viruses that infect eukaryotic and prokaryotic cells often use host-derived cytoskeletal structures, such as the actin skeleton, for intracellular positioning. Here, we describe that a prophage, CGP3, integrated into the genome of Corynebacterium glutamicum encodes an actin-like protein, AlpC. Biochemical characterization confirms that AlpC is a bona fide actin-like protein and cell biological analysis shows that AlpC forms filamentous structures upon prophage induction. The co-transcribed adaptor protein, AlpA, binds to a consensus sequence in the upstream promoter region of the alpAC operon and also interacts with AlpC, thus connecting circular phage DNA to the actin-like filaments. Transcriptome analysis revealed that alpA and alpC are among the early induced genes upon excision of the CGP3 prophage. Furthermore, qPCR analysis of mutant strains revealed that both AlpA and AlpC are required for efficient phage replication. Altogether, these data emphasize that AlpAC are crucial for the spatio-temporal organization of efficient viral replication. This is remarkably similar to actin-assisted membrane localization of eukaryotic viruses that use the actin cytoskeleton to concentrate virus particles at the egress sites and provides a link of evolutionary conserved interactions between intracellular virus transport and actin. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Discovering Drugs with DNA-Encoded Library Technology: From Concept to Clinic with an Inhibitor of Soluble Epoxide Hydrolase.

    Science.gov (United States)

    Belyanskaya, Svetlana L; Ding, Yun; Callahan, James F; Lazaar, Aili L; Israel, David I

    2017-05-04

    DNA-encoded chemical library technology was developed with the vision of its becoming a transformational platform for drug discovery. The hope was that a new paradigm for the discovery of low-molecular-weight drugs would be enabled by combining the vast molecular diversity achievable with combinatorial chemistry, the information-encoding attributes of DNA, the power of molecular biology, and a streamlined selection-based discovery process. Here, we describe the discovery and early clinical development of GSK2256294, an inhibitor of soluble epoxide hydrolase (sEH, EPHX2), by using encoded-library technology (ELT). GSK2256294 is an orally bioavailable, potent and selective inhibitor of sEH that has a long half life and produced no serious adverse events in a first-time-in-human clinical study. To our knowledge, GSK2256294 is the first molecule discovered from this technology to enter human clinical testing and represents a realization of the vision that DNA-encoded chemical library technology can efficiently yield molecules with favorable properties that can be readily progressed into high-quality drugs. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Evaluation of Immunogenicity of Divalent DNA Vaccine Encoding Brucella melitensis Omp31 and P39 Genes in Balb/c Mice

    Directory of Open Access Journals (Sweden)

    A Doosti

    2007-10-01

    Full Text Available Introduction & Objective: Brucella is a facultative intracellular pathogen and one of the etiologic agents of brucellosis that can infect humans and domestic animals. Attenuated strains such as B. melitensis Rve1 and B. abortus S19 and Rb51 are being used to control brucellosis in domestic animals. However, no safe and effective vaccine is available for human use. This study was designed to evaluate the immunogenicity and the protective efficacy of a divalent fusion DNA vaccine encoding both the B. melitensis Omp31 protein and P39 protein, designated pCDNA3 recombinant vector. Materials & Methods: This experimental study was performed in Biotechnology Research Center of Islamic Azad University, Shahrekord branch in summer, 1386. Construction of pCDNA3 recombinant vector containing Omp31 and P39 genes of B. melitensis was completed. Then, 12 Balb/c mice were immunized intramuscularly with 100 mg per 50 micro liters of this DNA vaccine. Control mice, 12 Balb/c mice, were simultaneously injected with PBS. During the 1st, 7th, 15th and 30th days the mice received the injections. Afterwards, the ELISA cytokine assay was performed and data were analyzed by SPSS software. Results: Intramuscular injection of the divalent DNA vaccine elicited cellular immune responses in Balb/c mice. The ELISA cytokine assay with serum of vaccinated mice showed high level of IFN-γ and low changes of IL-4 in compare with control mice. Conclusion: Use of divalent genetic vaccine based on the Omp31 and P39 genes can elicit a strong cellular immune response against Brucellosis.

  19. Thermus thermophilis dnaX homolog encoding gamma- and tau-like proteins of the chromosomal replicase.

    Science.gov (United States)

    Yurieva, O; Skangalis, M; Kuriyan, J; O'Donnell, M

    1997-10-24

    This report identifies the dnaX homolog from Thermus thermophilis. Replicases from bacteria to humans contain subunits that are homologous to one another. These homologs are subunits of a clamp loading apparatus that loads sliding clamps onto DNA, which in turn act as mobile tethers for the replication machinery. In Escherichia coli, two of these subunits (gamma and tau) are encoded by one gene (dnaX) in nearly equal amounts by way of an efficient translational frameshift. The gamma and tau subunits form the central touchpoint that holds together two DNA polymerases with one clamp loading apparatus to form the E. coli chromosomal replicase, DNA polymerase III holoenzyme. The E. coli holoenzyme is an efficient replication machine that simultaneously replicates both strands of duplex DNA. The T. thermophilis dnaX homolog also contains a frameshift signature and produces both tau- and gamma-like proteins. Recombinant T. thermophilis tau- and gamma-like proteins, expressed in E. coli, have an oligomeric state similar to that of their E. coli counterparts and display ATPase activity that is stimulated by DNA. These results imply that T. thermophilis utilizes a DNA polymerase III holoenzyme replication machinery similar to that of E. coli.

  20. Perlecan and vascular endothelial growth factor-encoding DNA-loaded chitosan scaffolds promote angiogenesis and wound healing.

    Science.gov (United States)

    Lord, Megan S; Ellis, April L; Farrugia, Brooke L; Whitelock, John M; Grenett, Hernan; Li, Chuanyu; O'Grady, Robert L; DeCarlo, Arthur A

    2017-03-28

    The repair of dermal wounds, particularly in the diabetic population, poses a significant healthcare burden. The impaired wound healing of diabetic wounds is attributed to low levels of endogenous growth factors, including vascular endothelial growth factor (VEGF), that normally stimulate multiple phases of wound healing. In this study, chitosan scaffolds were prepared via freeze drying and loaded with plasmid DNA encoding perlecan domain I and VEGF189 and analyzed in vivo for their ability to promote dermal wound healing. The plasmid DNA encoding perlecan domain I and VEGF189 loaded scaffolds promoted dermal wound healing in normal and diabetic rats. This treatment resulted in an increase in the number of blood vessels and sub-epithelial connective tissue matrix components within the wound beds compared to wounds treated with chitosan scaffolds containing control DNA or wounded controls. These results suggest that chitosan scaffolds containing plasmid DNA encoding VEGF189 and perlecan domain I have the potential to induce angiogenesis and wound healing. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. ORF 2 from the Bacillus cereus linear plasmid pBClin15 encodes a DNA binding protein.

    Science.gov (United States)

    Stabell, F B; Egge-Jacobsen, W; Risøen, P A; Kolstø, A-B; Økstad, O A

    2009-01-01

    To isolate and identify DNA-binding protein(s) with affinity for the mobile chromosomal repeat element bcr1 in Bacillus cereus group bacteria. A biotinylated bcr1 element was immobilized to streptavidin-coated magnetic beads and used to pull out a 20 kDa DNA-binding protein from a whole cell protein extract of B. cereus ATCC 14579. The protein was identified as the product of ORF 2 encoded by the bacteriophage-related autonomously replicating linear genetic element pBClin15 carried by the strain. DNA binding was not bcr1-specific. By Northern blotting ORF 2 was co-transcribed with ORF 1, and also in certain instances with ORF 3 by transcriptional readthrough of the terminator located between ORF 2 and ORF 3. ORF 2 from pBClin15 encodes a DNA-binding protein. ORF 2 is co-transcribed with its upstream gene ORF 1, and in a subset of the transcripts also with the downstream gene ORF 3 through alternative transcription termination. The B. cereus group contains bacterial species of medical and economic importance. Bacteriophages or phage-encoded proteins from these bacteria have been suggested as potential therapeutic agents. Understanding the biology of bacteriophage-related genetic elements through functional characterization of their genes is of high relevance.

  2. The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase

    Directory of Open Access Journals (Sweden)

    Santos Diógenes S

    2008-04-01

    Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and

  3. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  4. Exploring genetic variation in haplotypes of the filariasis vector Culex quinquefasciatus (Diptera: Culicidae) through DNA barcoding.

    Science.gov (United States)

    Vadivalagan, Chithravel; Karthika, Pushparaj; Murugan, Kadarkarai; Panneerselvam, Chellasamy; Del Serrone, Paola; Benelli, Giovanni

    2017-05-01

    Culex quinquefasciatus (Diptera: Culicidae) is a vector of many pathogens and parasites of humans, as well as domestic and wild animals. In urban and semi-urban Asian countries, Cx. quinquefasciatus is a main vector of nematodes causing lymphatic filariasis. In the African region, it vectors the Rift Valley fever virus, while in the USA it transmits West Nile, St. Louis encephalitis and Western equine encephalitis virus. In this study, DNA barcoding was used to explore the genetic variation of Cx. quinquefasciatus populations from 88 geographical regions. We presented a comprehensive approach analyzing the effectiveness of two gene markers, i.e. CO1 and 16S rRNA. The high threshold genetic divergence of CO1 (0.47%) gene was reported as an ideal marker for molecular identification of this mosquito vector. Furthermore, null substitutions were lower in CO1 if compared to 16S rRNA, which influenced its differentiating potential among Indian haplotypes. NJ tree was well supported with high branch values for CO1 gene than 16S rRNA, indicating ideal genetic differentiation among haplotypes. TCS haplotype network revealed 14 distinct clusters. The intra- and inter-population polymorphism were calculated among the global and Indian Cx. quinquefasciatus lineages. The genetic diversity index Tajima' D showed negative values for all the 4 intra-population clusters (G2-4, G10). Fu's FS showed negative value for G10 cluster, which was significant and indicated recent population expansion. However, the G2-G4 (i.e. Indian lineages) had positive values, suggesting a bottleneck effect. Overall, our research firstly shed light on the genetic differences among the haplotypes of Cx. quinquefasciatus species complex, adding basic knowledge to the molecular ecology of this important mosquito vector. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

    Science.gov (United States)

    Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.

    2017-02-01

    The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber

  6. Low-Dose Gene Therapy for Murine PKU Using Episomal Naked DNA Vectors Expressing PAH from Its Endogenous Liver Promoter

    Directory of Open Access Journals (Sweden)

    Hiu Man Grisch-Chan

    2017-06-01

    Full Text Available Limited duration of transgene expression, insertional mutagenesis, and size limitations for transgene cassettes pose challenges and risk factors for many gene therapy vectors. Here, we report on physiological expression of liver phenylalanine hydroxylase (PAH by delivery of naked DNA/minicircle (MC-based vectors for correction of homozygous enu2 mice, a model of human phenylketonuria (PKU. Because MC vectors lack a defined size limit, we constructed a MC vector expressing a codon-optimized murine Pah cDNA that includes a truncated intron and is under the transcriptional control of a 3.6-kb native Pah promoter/enhancer sequence. This vector, delivered via hydrodynamic injection, yielded therapeutic liver PAH activity and sustained correction of blood phenylalanine comparable to viral or synthetic liver promoters. Therapeutic efficacy was seen with vector copy numbers of 95% loss of vector genomes and PAH activity in liver, demonstrating that MC vectors had not integrated into the liver genome. In conclusion, MC vectors, which do not have a defined size-limitation, offer a favorable safety profile for hepatic gene therapy due to their non-integration in combination with native promoters.

  7. Low-Dose Gene Therapy for Murine PKU Using Episomal Naked DNA Vectors Expressing PAH from Its Endogenous Liver Promoter.

    Science.gov (United States)

    Grisch-Chan, Hiu Man; Schlegel, Andrea; Scherer, Tanja; Allegri, Gabriella; Heidelberger, Raphael; Tsikrika, Panagiota; Schmeer, Marco; Schleef, Martin; Harding, Cary O; Häberle, Johannes; Thöny, Beat

    2017-06-16

    Limited duration of transgene expression, insertional mutagenesis, and size limitations for transgene cassettes pose challenges and risk factors for many gene therapy vectors. Here, we report on physiological expression of liver phenylalanine hydroxylase (PAH) by delivery of naked DNA/minicircle (MC)-based vectors for correction of homozygous enu2 mice, a model of human phenylketonuria (PKU). Because MC vectors lack a defined size limit, we constructed a MC vector expressing a codon-optimized murine Pah cDNA that includes a truncated intron and is under the transcriptional control of a 3.6-kb native Pah promoter/enhancer sequence. This vector, delivered via hydrodynamic injection, yielded therapeutic liver PAH activity and sustained correction of blood phenylalanine comparable to viral or synthetic liver promoters. Therapeutic efficacy was seen with vector copy numbers of 95% loss of vector genomes and PAH activity in liver, demonstrating that MC vectors had not integrated into the liver genome. In conclusion, MC vectors, which do not have a defined size-limitation, offer a favorable safety profile for hepatic gene therapy due to their non-integration in combination with native promoters. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Efficacy of chimeric DNA vaccines encoding Eimeria tenella 5401 and chicken IFN-γ or IL-2 against coccidiosis in chickens.

    Science.gov (United States)

    Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

    2015-09-01

    Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier

  9. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells.

    Science.gov (United States)

    Sui, Guangchao; Soohoo, Christina; Affar, El Bachir; Gay, Frédérique; Shi, Yujiang; Forrester, William C; Shi, Yang

    2002-04-16

    Double-stranded RNA-mediated interference (RNAi) has recently emerged as a powerful reverse genetic tool to silence gene expression in multiple organisms including plants, Caenorhabditis elegans, and Drosophila. The discovery that synthetic double-stranded, 21-nt small interfering RNA triggers gene-specific silencing in mammalian cells has further expanded the utility of RNAi into mammalian systems. Here we report a technology that allows synthesis of small interfering RNAs from DNA templates in vivo to efficiently inhibit endogenous gene expression. Significantly, we were able to use this approach to demonstrate, in multiple cell lines, robust inhibition of several endogenous genes of diverse functions. These findings highlight the general utility of this DNA vector-based RNAi technology in suppressing gene expression in mammalian cells.

  10. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  11. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

    Directory of Open Access Journals (Sweden)

    Dongsheng Li

    Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

  12. Spontaneous silencing of humanized green fluorescent protein (hGFP) gene expression from a retroviral vector by DNA methylation

    DEFF Research Database (Denmark)

    Gram, G J; Nielsen, S D; Hansen, J E

    1998-01-01

    We have constructed a functional murine leukemia virus (MLV)-derived retroviral vector transducing two genes encoding the autofluorescent humanized green fluorescent protein (hGFP) and neomycin phosphotransferase (Neo). This was done to determine whether hGFP could function as a marker gene...

  13. Generation of human induced pluripotent stem cells by simple transient transfection of plasmid DNA encoding reprogramming factors

    Directory of Open Access Journals (Sweden)

    Lough John W

    2010-08-01

    Full Text Available Abstract Background The use of lentiviruses to reprogram human somatic cells into induced pluripotent stem (iPS cells could limit their therapeutic usefulness due to the integration of viral DNA sequences into the genome of the recipient cell. Recent work has demonstrated that human iPS cells can be generated using episomal plasmids, excisable transposons, adeno or sendai viruses, mRNA, or recombinant proteins. While these approaches offer an advance, the protocols have some drawbacks. Commonly the procedures require either subcloning to identify human iPS cells that are free of exogenous DNA, a knowledge of virology and safe handling procedures, or a detailed understanding of protein biochemistry. Results Here we report a simple approach that facilitates the reprogramming of human somatic cells using standard techniques to transfect expression plasmids that encode OCT4, NANOG, SOX2, and LIN28 without the need for episomal stability or selection. The resulting human iPS cells are free of DNA integration, express pluripotent markers, and form teratomas in immunodeficient animals. These iPS cells were also able to undergo directed differentiation into hepatocyte-like and cardiac myocyte-like cells in culture. Conclusions Simple transient transfection of plasmid DNA encoding reprogramming factors is sufficient to generate human iPS cells from primary fibroblasts that are free of exogenous DNA integrations. This approach is highly accessible and could expand the use of iPS cells in the study of human disease and development.

  14. Smart DNA vectors based on cyclodextrin polymers: compaction and endosomal release.

    Science.gov (United States)

    Wintgens, Véronique; Leborgne, Christian; Baconnais, Sonia; Burckbuchler, Virginie; Le Cam, Eric; Scherman, Daniel; Kichler, Antoine; Amiel, Catherine

    2012-02-01

    Neutral β-cyclodextrin polymers (polyβCD) associated with cationic adamantyl derivatives (Ada) can be used to deliver plasmid DNA into cells. In absence of an endosomolytic agent, transfection efficiency remains low because most complexes are trapped in the endosomal compartment. We asked whether addition of an imidazole-modified Ada can increase efficiency of polyβCD/cationic Ada-based delivery system. We synthesized two adamantyl derivatives: Ada5, which has a spacer arm between the Ada moiety and a bi-cationic polar head group, and Ada6, which presents an imidazole group. Strength of association between polyβCD and Ada derivatives was evaluated by fluorimetric titration. Gel mobility shift assay, zeta potential, and dark field transmission electron microscopy experiments demonstrated the system allowed for efficient DNA compaction. In vitro transfection experiments performed on HepG2 and HEK293 cells revealed the quaternary system polyβCD/Ada5/Ada6/DNA has efficiency comparable to cationic lipid DOTAP. We successfully designed fine-tuned DNA vectors based on cyclodextrin polymers combined with two new adamantyl derivatives, leading to significant transfection associated with low toxicity.

  15. Hybrid DNA and Enzyme Based Computing for Address Encoding, Link Switching and Error Correction in Molecular Communication

    Science.gov (United States)

    Walsh, Frank; Balasubramaniam, Sasitharan; Botvich, Dmitri; Suda, Tatsuya; Nakano, Tadashi; Bush, Stephen F.; Foghlú, Mícheál Ó.

    This paper proposes a biological cell-based communication protocol to enable communication between biological nanodevices. Inspired by existing communication network protocols, our solution combines two molecular computing techniques (DNA and enzyme computing), to design a protocol stack for molecular communication networks. Based on computational requirements of each layer of the stack, our solution specifies biomolecule address encoding/decoding, error correction and link switching mechanisms for molecular communication networks.

  16. DNA Immunization with the Gene Encoding P4 Nuclease of Leishmania amazonensis Protects Mice against Cutaneous Leishmaniasis

    Science.gov (United States)

    Campbell, Kimberly; Diao, Hong; Ji, Jiaxiang; Soong, Lynn

    2003-01-01

    Infection with the protozoan parasite Leishmania amazonensis can cause diverse clinical forms of leishmaniasis. Immunization with purified P4 nuclease protein has been shown to elicit a protective response in mice challenged with L. amazonensis and L. pifanoi. To explore the potential of a DNA-based vaccine, we tested the L. amazonensis gene encoding P4 nuclease as well as adjuvant constructs encoding murine interleukin-12 (IL-12) and L. amazonensis HSP70. Susceptible BALB/c mice were immunized with the DNA encoding P4 alone, P4/IL-12, or P4/HSP70 prior to challenge with L. amazonensis promastigotes. Mice given P4/IL-12 exhibited no lesion development and had a 3- to 4-log reduction in tissue parasite burdens compared to controls. This protection corresponded to significant increases in gamma interferon and tumor necrosis factor alpha production and a reduction in parasite-specific immunoglobulin G1, suggesting an enhancement in Th1 responses. Moreover, we immunized mice with the L. amazonensis vaccines to determine if this vaccine regimen could provide cross-protection against a genetically diverse species, L. major. While the P4/HSP70 vaccine led to self-healing lesions, the P4/IL-12 vaccine provided negligible protection against L. major infection. This is the first report of successful use of a DNA vaccine to induce protection against L. amazonensis infection. Additionally, our results indicate that different vaccine combinations, including DNA encoding P4, HSP70, or IL-12, can provide significant protection against both Old World and New World cutaneous leishmaniasis. PMID:14573646

  17. Immune protection duration and efficacy stability of DNA vaccine encoding Eimeria tenella TA4 and chicken IL-2 against coccidiosis.

    Science.gov (United States)

    Song, Xiaokai; Zhao, Xiaofang; Xu, Lixin; Yan, Ruofeng; Li, Xiangrui

    2017-04-01

    In our previous study, an effective DNA vaccine encoding Eimeria tenella TA4 and chicken IL-2 was constructed. In the present study, the immunization dose of the DNA vaccine pVAX1.0-TA4-IL-2 was further optimized. With the optimized dose, the dynamics of antibodies induced by the DNA vaccine was determined using indirect ELISA. To evaluate the immune protection duration of the DNA vaccine, two-week-old chickens were intramuscularly immunized twice and the induced efficacy was evaluated by challenging with E. tenella at 5, 9, 13, 17 and 21weeks post the last immunization (PLI) separately. To evaluate the efficacy stability of the DNA vaccine, two-week-old chickens were immunized with 3 batches of the DNA vaccine, and the induced efficacy was evaluated by challenging with E. tenella. The results showed that the optimal dose was 25μg. The induced antibody level persisted until 10weeks PPI. For the challenge time of 5 and 9weeks PLI, the immunization resulted in ACIs of 182.28 and 162.23 beyond 160, showing effective protection. However, for the challenge time of 13, 17 and 21weeks PLI, the immunization resulted in ACIs below 160 which means poor protection. Therefore, the immune protection duration of the DNA vaccination was at least 9weeks PLI. DNA immunization with three batches DNA vaccine resulted in ACIs of 187.52, 191.57 and 185.22, which demonstrated that efficacies of the three batches DNA vaccine were effective and stable. Overall, our results indicate that DNA vaccine pVAX1.0-TA4-IL-2 has the potential to be developed as effective vaccine against coccidiosis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Essential roles for imuA′- and imuB-encoded accessory factors in DnaE2-dependent mutagenesis in Mycobacterium tuberculosis

    OpenAIRE

    Warner, Digby F.; Ndwandwe, Duduzile E.; Abrahams, Garth L.; Kana, Bavesh D.; Machowski, Edith E.; Venclovas, Česlovas; Mizrahi, Valerie

    2010-01-01

    In Mycobacterium tuberculosis (Mtb), damage-induced mutagenesis is dependent on the C-family DNA polymerase, DnaE2. Included with dnaE2 in the Mtb SOS regulon is a putative operon comprising Rv3395c, which encodes a protein of unknown function restricted primarily to actinomycetes, and Rv3394c, which is predicted to encode a Y-family DNA polymerase. These genes were previously identified as components of an imuA-imuB-dnaE2–type mutagenic cassette widespread among bacterial genomes. Here, we c...

  19. RNase-L regulates the stability of mitochondrial DNA-encoded mRNAs in mouse embryo fibroblasts

    International Nuclear Information System (INIS)

    Chandrasekaran, Krish; Mehrabian, Zara; Li Xiaoling; Hassel, Bret

    2004-01-01

    Accelerated decrease in the levels of mitochondrial DNA-encoded mRNA (mt-mRNA) occurs in neuronal cells exposed either to the excitatory amino acid, glutamate or to the sodium ionophore, monensin, suggesting a role of mitochondrial RNase(s) on the stability of mt-mRNAs. Here we report that in mouse embryo fibroblasts that are devoid of the interferon-regulated RNase, RNase-L, the monensin-induced decrease in the half-life of mt-mRNA was reduced. In monensin (250 nM)-treated RNase-L +/+ cells the average half-life of mt-mRNA, determined after termination of transcription with actinomycin D, was found to be 3 h, whereas in monensin-treated RNase-L -/- cells the half-life of mt-mRNA was >6 h. In contrast, the stability of nuclear DNA-encoded β-actin mRNA was unaffected. Induction of RNase-L expression in mouse 3T3 fibroblasts further decreased the monensin-induced reduction in mt-mRNA half-life to 1.5 h. The results indicate that the RNase-L-dependent decrease in mtDNA-encoded mRNA transcript levels occurs through a decrease in the half-life of mt-mRNA, and that RNase-L may play a role in the stability of mt-mRNA

  20. The protein encoded by the proto-oncogene DEK changes the topology of chromatin and reduces the efficiency of DNA replication in a chromatin-specific manner

    DEFF Research Database (Denmark)

    Alexiadis, V; Waldmann, T; Andersen, Jens S.

    2000-01-01

    The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...... protein substantially reduces the replication efficiency of chromatin but not of naked DNA templates....

  1. VIP Barcoding: composition vector-based software for rapid species identification based on DNA barcoding.

    Science.gov (United States)

    Fan, Long; Hui, Jerome H L; Yu, Zu Guo; Chu, Ka Hou

    2014-07-01

    Species identification based on short sequences of DNA markers, that is, DNA barcoding, has emerged as an integral part of modern taxonomy. However, software for the analysis of large and multilocus barcoding data sets is scarce. The Basic Local Alignment Search Tool (BLAST) is currently the fastest tool capable of handling large databases (e.g. >5000 sequences), but its accuracy is a concern and has been criticized for its local optimization. However, current more accurate software requires sequence alignment or complex calculations, which are time-consuming when dealing with large data sets during data preprocessing or during the search stage. Therefore, it is imperative to develop a practical program for both accurate and scalable species identification for DNA barcoding. In this context, we present VIP Barcoding: a user-friendly software in graphical user interface for rapid DNA barcoding. It adopts a hybrid, two-stage algorithm. First, an alignment-free composition vector (CV) method is utilized to reduce searching space by screening a reference database. The alignment-based K2P distance nearest-neighbour method is then employed to analyse the smaller data set generated in the first stage. In comparison with other software, we demonstrate that VIP Barcoding has (i) higher accuracy than Blastn and several alignment-free methods and (ii) higher scalability than alignment-based distance methods and character-based methods. These results suggest that this platform is able to deal with both large-scale and multilocus barcoding data with accuracy and can contribute to DNA barcoding for modern taxonomy. VIP Barcoding is free and available at http://msl.sls.cuhk.edu.hk/vipbarcoding/. © 2014 John Wiley & Sons Ltd.

  2. Integration-free reprogramming of human somatic cells to induced pluripotent stem cells (iPSCs) without viral vectors, recombinant DNA, and genetic modification.

    Science.gov (United States)

    Heng, Boon Chin; Fussenegger, Martin

    2014-01-01

    Stem cells are envisaged to be integral components of multicellular systems engineered for therapeutic applications. The reprogramming of somatic cells to induced pluripotent stem cells (iPSCs) via recombinant expression of a limited number of transcription factors, which was first achieved by Yamanaka and colleagues in 2007, heralded a major breakthrough in the stem cell field. Since then, there has been rapid progress in the field of iPSC generation, including the identification of various small molecules that can enhance reprogramming efficiency and reduce the number of different transcription factors required for reprogramming. Nevertheless, the major obstacles facing clinical applications of iPSCs are safety concerns associated with the use of viral vectors and recombinant DNA for expressing the appropriate transcription factors during reprogramming. In particular, permanent genetic modifications to newly reprogrammed iPSCs have to be avoided in order to meet stringent safety requirements for clinical therapy. These safety challenges can be overcome by new technology platforms that enable cellular reprogramming to iPSCs without the need to utilize either recombinant DNA or viral vectors. The use of recombinant cell-penetrating peptides and direct transfection of synthetic mRNA encoding appropriate transcription factors have both been shown to successfully reprogram somatic cells to iPSCs. It has also been shown more recently that the direct transfection of certain miRNA species can reprogram somatic cells to pluripotency without the need for any of the transcription factors commonly utilized for iPSC generation. This chapter describes protocols for iPSC generation with these new techniques, which would obviate the use of recombinant DNA and viral vectors in cellular reprogramming, thus avoiding permanent genetic modification to the reprogrammed cells.

  3. rad-Dependent response of the chk1-encoded protein kinase at the DNA damage checkpoint

    NARCIS (Netherlands)

    Walworth, N.C.; Bernards, R.A.

    1996-01-01

    Exposure of eukaryotic cells to agents that generate DNA damage results in transient arrest of progression through the cell cycle. In fission yeast, the DNA damage checkpoint associated with cell cycle arrest before mitosis requires the protein kinase p56chk1. DNA damage induced by ultraviolet

  4. Spontaneous silencing of humanized green fluorescent protein (hGFP) gene expression from a retroviral vector by DNA methylation

    DEFF Research Database (Denmark)

    Gram, G J; Nielsen, S D; Hansen, J E

    1998-01-01

    packaging cells returned to untreated control levels within 2 weeks. Using flow cytometric analysis, hGFP expression was detected in up to 15% of transduced MT4 cells (a CD4+ lymphocytic cell line) after coculturing with packaging cells for 4 days. A 3-day postcoculture treatment with 5-azacytidine......We have constructed a functional murine leukemia virus (MLV)-derived retroviral vector transducing two genes encoding the autofluorescent humanized green fluorescent protein (hGFP) and neomycin phosphotransferase (Neo). This was done to determine whether hGFP could function as a marker gene...... in a retroviral vector and to investigate the expression of genes in a retroviral vector. Surprisingly, clonal vector packaging cell lines showed variable levels of hGFP expression, and expression was detected in as few as 49% of the cells in a clonally derived culture. This indicated that hGFP expression...

  5. Adeno-associated virus Rep-mediated targeting of integrase-defective retroviral vector DNA circles into human chromosome 19

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shuohao [Graduate School of Systems Life Sciences, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan); Kawabe, Yoshinori; Ito, Akira [Department of Chemical Engineering, Faculty of Engineering, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan); Kamihira, Masamichi, E-mail: kamihira@chem-eng.kyushu-u.ac.jp [Graduate School of Systems Life Sciences, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan); Department of Chemical Engineering, Faculty of Engineering, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan)

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Adeno-associated virus (AAV) is capable of targeted integration in human cells. Black-Right-Pointing-Pointer Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. Black-Right-Pointing-Pointer A targeted integration system of IDRV DNA using the AAV integration mechanism. Black-Right-Pointing-Pointer Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors, therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.

  6. Safety and immunogenicity of a novel therapeutic DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Juan, Long; Xiao, Zhao; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    Current clinically available treatments for rheumatoid arthritis (RA) fail to cure the disease or unsatisfactorily halt disease progression. To overcome these limitations, the development of therapeutic DNA vaccines and boosters may offer new promising strategies. Because type II collagen (CII) as a critical autoantigen in RA and native chicken type II collagen (nCCII) has been used to effectively treat RA, we previously developed a novel therapeutic DNA vaccine encoding CCII (pcDNA-CCOL2A1) with efficacy comparable to that of the current "gold standard", methotrexate(MTX). Here, we systemically evaluated the safety and immunogenicity of the pcDNA-CCOL2A1 vaccine in normal Wistar rats. Group 1 received only a single intramuscular injection into the hind leg with pcDNA-CCOL2A1 at the maximum dosage of 3 mg/kg on day 0; Group 2 was injected with normal saline (NS) as a negative control. All rats were monitored daily for any systemic adverse events, reactions at the injection site, and changes in body weights. Plasma and tissues from all experimental rats were collected on day 14 for routine examinations of hematology and biochemistry parameters, anti-CII IgG antibody reactivity, and histopathology. Our results indicated clearly that at the maximum dosage of 3 mg/kg, the pcDNA-CCOL2A1 vaccine was safe and well-tolerated. No abnormal clinical signs or deaths occurred in the pcDNA-CCOL2A1 group compared with the NS group. Furthermore, no major alterations were observed in hematology, biochemistry, and histopathology, even at the maximum dose. In particularly, no anti-CII IgG antibodies were detected in vaccinated normal rats at 14 d after vaccination; this was relevant because we previously demonstrated that the pcDNA-CCOL2A1 vaccine, when administered at the therapeutic dosage of 300 μg/kg alone, did not induce anti-CII IgG antibody production and significantly reduced levels of anti-CII IgG antibodies in the plasma of rats with established collagen-induced arthritis

  7. DNA prime/Adenovirus boost malaria vaccine encoding P. falciparum CSP and AMA1 induces sterile protection associated with cell-mediated immunity.

    Directory of Open Access Journals (Sweden)

    Ilin Chuang

    Full Text Available BACKGROUND: Gene-based vaccination using prime/boost regimens protects animals and humans against malaria, inducing cell-mediated responses that in animal models target liver stage malaria parasites. We tested a DNA prime/adenovirus boost malaria vaccine in a Phase 1 clinical trial with controlled human malaria infection. METHODOLOGY/PRINCIPAL FINDINGS: The vaccine regimen was three monthly doses of two DNA plasmids (DNA followed four months later by a single boost with two non-replicating human serotype 5 adenovirus vectors (Ad. The constructs encoded genes expressing P. falciparum circumsporozoite protein (CSP and apical membrane antigen-1 (AMA1. The regimen was safe and well-tolerated, with mostly mild adverse events that occurred at the site of injection. Only one AE (diarrhea, possibly related to immunization, was severe (Grade 3, preventing daily activities. Four weeks after the Ad boost, 15 study subjects were challenged with P. falciparum sporozoites by mosquito bite, and four (27% were sterilely protected. Antibody responses by ELISA rose after Ad boost but were low (CSP geometric mean titer 210, range 44-817; AMA1 geometric mean micrograms/milliliter 11.9, range 1.5-102 and were not associated with protection. Ex vivo IFN-γ ELISpot responses after Ad boost were modest (CSP geometric mean spot forming cells/million peripheral blood mononuclear cells 86, range 13-408; AMA1 348, range 88-1270 and were highest in three protected subjects. ELISpot responses to AMA1 were significantly associated with protection (p = 0.019. Flow cytometry identified predominant IFN-γ mono-secreting CD8+ T cell responses in three protected subjects. No subjects with high pre-existing anti-Ad5 neutralizing antibodies were protected but the association was not statistically significant. SIGNIFICANCE: The DNA/Ad regimen provided the highest sterile immunity achieved against malaria following immunization with a gene-based subunit vaccine (27%. Protection

  8. Comprehensive phylogenetic analysis of bacterial group II intron-encoded ORFs lacking the DNA endonuclease domain reveals new varieties.

    Directory of Open Access Journals (Sweden)

    Nicolás Toro

    Full Text Available Group II introns are self-splicing RNAs that act as mobile retroelements in the organelles of plants, fungi and protists. They are also widely distributed in bacteria, and are generally assumed to be the ancestors of nuclear spliceosomal introns. Most bacterial group II introns have a multifunctional intron-encoded protein (IEP ORF within the ribozyme domain IV (DIV. This ORF encodes an N-terminal reverse transcriptase (RT domain, followed by a putative RNA-binding domain with RNA splicing or maturase activity and, in some cases, a C-terminal DNA-binding (D region followed by a DNA endonuclease (En domain. In this study, we focused on bacterial group II intron ORF phylogenetic classes containing only reverse transcriptase/maturase open reading frames, with no recognizable D/En region (classes A, C, D, E, F and unclassified introns. On the basis of phylogenetic analyses of the maturase domain and its C-terminal extension, which appears to be a signature characteristic of ORF phylogenetic class, with support from the phylogeny inferred from the RT domain, we have revised the proposed new class F, defining new intron ORF varieties. Our results increase knowledge of the lineage of group II introns encoding proteins lacking the En-domain.

  9. Plasmid-Chromosome Recombination of Irradiated Shuttle Vector DNA in African Green Monkey Kidney Cells.

    Science.gov (United States)

    Mudgett, John Stuart

    1987-09-01

    An autonomously replicating shuttle vector was used to investigate the enhancement of plasmid-chromosome recombination in mammalian host cells by ultraviolet light and gamma radiation. Sequences homologous to the shuttle vector were stably inserted into the genome of African Green Monkey kidney cells to act as the target substrate for these recombination events. The SV40- and pBR322-derived plasmid DNA was irradiated with various doses of radiation before transfection into the transformed mammalian host cells. The successful homologous transfer of the bacterial ampicillin resistance (amp^{rm r}) gene from the inserted sequences to replace a mutant amp^->=ne on the shuttle vector was identified by plasmid extraction and transformation into E. coli host cells. Ultraviolet light (UV) was found not to induce homologous plasmid-chromosome recombination, while gamma radiation increased the frequency of recombinant plasmids detected. The introduction of specific double -strand breaks in the plasmid or prolonging the time of plasmid residence in the mammalian host cells also enhanced plasmid-chromosome recombination. In contrast, plasmid mutagenesis was found to be increased by plasmid UV irradiation, but not to change with time. Plasmid survival, recombination, and mutagenesis were not affected by treating the mammalian host cells with UV light prior to plasmid transfection. The amp^{rm r} recombinant plasmid molecules analyzed were found to be mostly the result of nonconservative exchanges which appeared to involve both homologous and possibly nonhomologous interactions with the host chromosome. The observation that these recombinant structures were obtained from all of the plasmid alterations investigated suggests a common mechanistic origin for plasmid -chromosome recombination in these mammalian cells.

  10. Machine learning classifier for identification of damaging missense mutations exclusive to human mitochondrial DNA-encoded polypeptides.

    Science.gov (United States)

    Martín-Navarro, Antonio; Gaudioso-Simón, Andrés; Álvarez-Jarreta, Jorge; Montoya, Julio; Mayordomo, Elvira; Ruiz-Pesini, Eduardo

    2017-03-07

    Several methods have been developed to predict the pathogenicity of missense mutations but none has been specifically designed for classification of variants in mtDNA-encoded polypeptides. Moreover, there is not available curated dataset of neutral and damaging mtDNA missense variants to test the accuracy of predictors. Because mtDNA sequencing of patients suffering mitochondrial diseases is revealing many missense mutations, it is needed to prioritize candidate substitutions for further confirmation. Predictors can be useful as screening tools but their performance must be improved. We have developed a SVM classifier (Mitoclass.1) specific for mtDNA missense variants. Training and validation of the model was executed with 2,835 mtDNA damaging and neutral amino acid substitutions, previously curated by a set of rigorous pathogenicity criteria with high specificity. Each instance is described by a set of three attributes based on evolutionary conservation in Eukaryota of wildtype and mutant amino acids as well as coevolution and a novel evolutionary analysis of specific substitutions belonging to the same domain of mitochondrial polypeptides. Our classifier has performed better than other web-available tested predictors. We checked performance of three broadly used predictors with the total mutations of our curated dataset. PolyPhen-2 showed the best results for a screening proposal with a good sensitivity. Nevertheless, the number of false positive predictions was too high. Our method has an improved sensitivity and better specificity in relation to PolyPhen-2. We also publish predictions for the complete set of 24,201 possible missense variants in the 13 human mtDNA-encoded polypeptides. Mitoclass.1 allows a better selection of candidate damaging missense variants from mtDNA. A careful search of discriminatory attributes and a training step based on a curated dataset of amino acid substitutions belonging exclusively to human mtDNA genes allows an improved

  11. Kaposi's sarcoma-associated herpesvirus-encoded LANA recruits topoisomerase IIβ for latent DNA replication of the terminal repeats.

    Science.gov (United States)

    Purushothaman, Pravinkumar; McDowell, Maria E; McGuinness, James; Salas, Ruth; Rumjahn, Sharif M; Verma, Subhash C

    2012-09-01

    The latency-associated nuclear antigen (LANA) encoded by Kaposi's sarcoma-associated herpesvirus (KSHV) plays a major role in maintaining latency and is critical for the perpetual segregation of viral episomes to the progeny nuclei of newly divided cells. LANA binds to KSHV terminal repeat (TR) DNA and tethers the viral episomes to host chromosomes through the association of chromatin-bound cellular proteins. TR elements serve as potential origin sites of KSHV replication and have been shown to play important roles in latent DNA replication and transcription of adjacent genes. Affinity chromatography and proteomics analysis using KSHV TR DNA and the LANA binding site as the affinity column identified topoisomerase IIβ (TopoIIβ) as a LANA-interacting protein. Here, we show that TopoIIβ forms complexes with LANA that colocalize as punctuate bodies in the nucleus of KSHV-infected cells. The specific TopoIIβ binding region of LANA has been identified to its N terminus and the first 32 amino acid residues containing the nucleosome-binding region crucial for binding. Moreover, this region could also act as a dominant negative to disrupt association of TopoIIβ with LANA. TopoIIβ plays an important role in LANA-dependent latent DNA replication, as addition of ellipticine, a selective inhibitor of TopoII, negatively regulated replication mediated by the TR. DNA break labeling and chromatin immunoprecipitation assay using biotin-16-dUTP and terminal deoxynucleotide transferase showed that TopoIIβ mediates a transient DNA break on viral DNA. These studies confirm that LANA recruits TopoIIβ at the origins of latent replication to unwind the DNA for replication.

  12. Toxicity and biodistribution of the serotype 2 recombinant adeno-associated viral vector, encoding Aquaporin-1, after retroductal delivery to a single mouse parotid gland.

    Directory of Open Access Journals (Sweden)

    Dariya Momot

    Full Text Available In preparation for testing the safety of using serotype 2 recombinant adeno-associated vector, encoding Aquaporin-1 to treat radiation-induced salivary gland damage in a phase 1 clinical trial, we conducted a 13 week GLP biodistribution and toxicology study using Balb/c mice. To best assess the safety of rAAV2hAQP1 as well as resemble clinical delivery, vector (10(8, 10(9, 10(10, or 4.4 × 10(10 vector particles/gland or saline was delivered to the right parotid gland of mice via retroductal cannulation. Very mild surgically induced inflammation was caused by this procedure, seen in 3.6% of animals for the right parotid gland, and 5.3% for the left parotid gland. Long term distribution of vector appeared to be localized to the site of cannulation as well as the right and left draining submandibular lymph nodes at levels >50 copies/μg in some animals. As expected, there was a dose-related increase in neutralizing antibodies produced by day 29. Overall, animals appeared to thrive, with no differences in mean body weight, food or water consumption between groups. There were no significant adverse effects due to treatment noted by clinical chemistry and pathology evaluations. Hematology assessment of serum demonstrated very limited changes to the white blood cell, segmented neutrophils, and hematocrit levels and were concluded to not be vector-associated. Indicators for liver, kidney, cardiac functions and general tissue damage showed no changes due to treatment. All of these indicators suggest the treatment is clinically safe.

  13. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  14. DNA inversion within the apolipoproteins AI/CIII/AIV-encoding gene cluster of certain patients with premature atherosclerosis

    International Nuclear Information System (INIS)

    Karathanasis, S.K.; Ferris, E.; Haddad, I.A.

    1987-01-01

    The genes coding for apolipoproteins (apo) AI, CIII, and AIV, designated APOA1, APOC3, and APOA4, respectively, are closely linked and tandemly organized in the long arm of the human chromosome 11. A DNA rearrangement involving the genes encoding apoAI and apoCIII in certain patients with premature atherosclerosis has been associated with deficiency of both apoAI and apoCIII in the plasma of these patients. Structural characterization of the genes for apoAI and apoCIII in one of these patients indicates that this rearrangement consists of a DNA inversion containing portions of the 3' ends of the apoAI and apoCIII genes, including the DNA region between these genes. The breakpoints of this DNA inversion are located within the fourth exon of the apoAI gene and the first intron of the apoCIII gene. Thus, this DNA inversion results in reciprocal fusion of the apoAI and apoCIII gene transcriptional units. Expression of these gene fusions in cultured mammalian cells results in stable mRNA transcripts with sequences representing fusions of the apoAI and apoCIII mRNAs. These results indicate that absence of transcripts with correct apoAI and apoCIII mRNA sequences causes apoAI and apoCIII deficiency in the plasma of these patients and suggest that these apolipoproteins are involved in cholesterol homeostasis and protection against premature atherosclerosis

  15. DNA vaccine encoding peptide P10 against experimental paracoccidioidomycosis induces long-term protection in presence of regulatory T cells.

    Science.gov (United States)

    de Amorim, Juliana; Magalhães, Adriana; Muñoz, Julián Esteban; Rittner, Glauce M G; Nosanchuk, Joshua D; Travassos, Luiz R; Taborda, Carlos P

    2013-03-01

    Paracoccidioidomycosis is a granulomatous systemic mycosis endemic in Brazil and other Latin America countries. A DNA vaccine encoding the immunoprotective peptide 10 (P10) significantly reduced the fungal burden in mice when given prior to or after intratracheal challenge with Paracoccidioides brasiliensis. Presently, the generation/expansion of CD4+ CD44hi memory T cells as well as Foxp3+ Treg cells in mice immunized with the DNA vaccine (pcDNA3-P10) before and after infection with P. brasiliensis was investigated. Memory CD4+ CD44hi T cells simultaneously with Foxp3+ Treg cells increased in the spleens and lungs of pcDNA3-P10 immunized mice on day 0, 30, 60 and 120 postinfection. Histopathology of the lung tissue showed minimal inflammation in immunized mice compared with the unimmunized group, suggesting a role for regulatory T cells in controlling the immunopathology. The DNA vaccine shows that the repeated immunization generates memory cells and regulatory T cells that replace the initially protective pro-inflammatory T cells conferring a long term protection while preserving the integrity of the infected tissue. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  16. Characterization of cDNA clones encoding rabbit and human serum paraoxonase: The mature protein retains its signal sequence

    Energy Technology Data Exchange (ETDEWEB)

    Hassett, C.; Richter, R.J.; Humbert, R.; Omiecinski, C.J.; Furlong, C.E. (Univ. of Washington, Seattle (United States)); Chapline, C.; Crabb, J.W. (W.Alton Jones Cell Science Center, Lake Placid, NY (United States))

    1991-10-22

    Serum paraoxonase hydrolyzes the toxic metabolites of a variety of organophosphorus insecticides. High serum paraoxonase levels appear to protect against the neurotoxic effects of organophosphorus substrates of this enzyme. The amino acid sequence accounting for 42% of rabbit paraoxonase was determined. From these data, two oligonucleotide probes were synthesized and used to screen a rabbit liver cDNA library. Human paraoxonase clones were isolated from a liver cDNA library by using the rabbit cDNA as a hybridization probe. Inserts from three of the longest clones were sequenced, and one full-length clone contained an open reading frame encoding 355 amino acids, four less than the rabbit paraoxonase protein. Amino-terminal sequences derived from purified rabbit and human paraoxonase proteins suggested that the signal sequence is retained, with the exception of the initiator methionine residue. Characterization of the rabbit and human paraoxonase cDNA clones confirms that the signal sequences are not processed, except for the N-terminal methionine residue. The rabbit and human cDNA clones demonstrate striking nucleotide and deduced amino acid similarities (greater than 85%), suggesting an important metabolic role and constraints on the evolution of this protein.

  17. Modulation-frequency encoded multi-color fluorescent DNA analysis in an optofluidic chip

    NARCIS (Netherlands)

    Dongre, C.; van Weerd, J.; Besselink, G.A.J.; Osellame, R.; Martínez Vázquez, R.; Cerullo, G.; van Weeghel, R.; van den Vlekkert, H.H.; Hoekstra, Hugo; Pollnau, Markus

    By capillary electrophoresis (CE) in miniaturized lab-on-a-chip devices, integrated DNA sequencing and genetic diagnostics have become feasible. We introduce a principle of parallel optical processing to significantly enhance analysis capabilities. In a commercial microfluidic chip, a plug of DNA

  18. Self-assembly of genetically encoded DNA-protein hybrid nanoscale shapes.

    Science.gov (United States)

    Praetorius, Florian; Dietz, Hendrik

    2017-03-24

    We describe an approach to bottom-up fabrication that allows integration of the functional diversity of proteins into designed three-dimensional structural frameworks. A set of custom staple proteins based on transcription activator-like effector proteins folds a double-stranded DNA template into a user-defined shape. Each staple protein is designed to recognize and closely link two distinct double-helical DNA sequences at separate positions on the template. We present design rules for constructing megadalton-scale DNA-protein hybrid shapes; introduce various structural motifs, such as custom curvature, corners, and vertices; and describe principles for creating multilayer DNA-protein objects with enhanced rigidity. We demonstrate self-assembly of our hybrid nanostructures in one-pot mixtures that include the genetic information for the designed proteins, the template DNA, RNA polymerase, ribosomes, and cofactors for transcription and translation. Copyright © 2017, American Association for the Advancement of Science.

  19. Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1994-01-01

    We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa......-134]. The protein contains a nuclear targeting signal (KKKGK), and fractionation of transformed human amnion cells (AMA) in karyoplasts and cytoplasts confirmed that it is predominantly localized in the nucleus. Database searching indicated that IEF SSP 9502 is a putative human homologue of the Saccharomyces...

  20. An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply

    National Research Council Canada - National Science Library

    Reisfeld, Ralph A

    2005-01-01

    .... These cells overexpress a glycoprotein called endoglin which stimulates such vessels. We successfully constructed and evaluated an oral endoglin-based DNA vaccine and demonstrated its capability to induce a robust CD8...

  1. An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply

    National Research Council Canada - National Science Library

    Reisfeld, Ralph A

    2007-01-01

    In an effort to meet the urgent need for the development of novel and effective treatments for metastatic breast cancer, we developed and evaluated a novel, oral DNA vaccine targeting endoglin (CD105...

  2. Ability of herpes simplex virus vectors to boost immune responses to DNA vectors and to protect against challenge by simian immunodeficiency virus

    International Nuclear Information System (INIS)

    Kaur, Amitinder; Sanford, Hannah B.; Garry, Deirdre; Lang, Sabine; Klumpp, Sherry A.; Watanabe, Daisuke; Bronson, Roderick T.; Lifson, Jeffrey D.; Rosati, Margherita; Pavlakis, George N.; Felber, Barbara K.; Knipe, David M.; Desrosiers, Ronald C.

    2007-01-01

    The immunogenicity and protective capacity of replication-defective herpes simplex virus (HSV) vector-based vaccines were examined in rhesus macaques. Three macaques were inoculated with recombinant HSV vectors expressing Gag, Env, and a Tat-Rev-Nef fusion protein of simian immunodeficiency virus (SIV). Three other macaques were primed with recombinant DNA vectors expressing Gag, Env, and a Pol-Tat-Nef-Vif fusion protein prior to boosting with the HSV vectors. Robust anti-Gag and anti-Env cellular responses were detected in all six macaques. Following intravenous challenge with wild-type, cloned SIV239, peak and 12-week plasma viremia levels were significantly lower in vaccinated compared to control macaques. Plasma SIV RNA in vaccinated macaques was inversely correlated with anti-Rev ELISPOT responses on the day of challenge (P value < 0.05), anti-Tat ELISPOT responses at 2 weeks post challenge (P value < 0.05) and peak neutralizing antibody titers pre-challenge (P value 0.06). These findings support continued study of recombinant herpesviruses as a vaccine approach for AIDS

  3. The protein encoded by the proto-oncogene DEK changes the topology of chromatin and reduces the efficiency of DNA replication in a chromatin-specific manner

    DEFF Research Database (Denmark)

    Alexiadis, V; Waldmann, T; Andersen, Jens S.

    2000-01-01

    The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...

  4. Immune protection of nonhuman primates against Ebola virus with single low-dose adenovirus vectors encoding modified GPs

    NARCIS (Netherlands)

    Sullivan, Nancy J.; Geisbert, Thomas W.; Geisbert, Joan B.; Shedlock, Devon J.; Xu, Ling; Lamoreaux, Laurie; Custers, Jerome H. H. V.; Popernack, Paul M.; Yang, Zhi-Yong; Pau, Maria G.; Roederer, Mario; Koup, Richard A.; Goudsmit, Jaap; Jahrling, Peter B.; Nabel, Gary J.

    2006-01-01

    BACKGROUND: Ebola virus causes a hemorrhagic fever syndrome that is associated with high mortality in humans. In the absence of effective therapies for Ebola virus infection, the development of a vaccine becomes an important strategy to contain outbreaks. Immunization with DNA and/or

  5. Analysis of Current DNA Encoded Library Screening Data Indicates Higher False Negative Rates for Numerically Larger Libraries.

    Science.gov (United States)

    Satz, Alexander L; Hochstrasser, Remo; Petersen, Ann C

    2017-04-10

    To optimize future DNA-encoded library design, we have attempted to quantify the library size at which the signal becomes undetectable. To accomplish this we (i) have calculated that percent yields of individual library members following a screen range from 0.002 to 1%, (ii) extrapolated that ∼1 million copies per library member are required at the outset of a screen, and (iii) from this extrapolation predict that false negative rates will begin to outweigh the benefit of increased diversity at library sizes >10 8 . The above analysis is based upon a large internal data set comprising multiple screens, targets, and libraries; we also augmented our internal data with all currently available literature data. In theory, high false negative rates may be overcome by employing larger amounts of library; however, we argue that using more than currently reported amounts of library (≫10 nmoles) is impractical. The above conclusions may be generally applicable to other DNA encoded library platforms, particularly those platforms that do not allow for library amplification.

  6. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

    Science.gov (United States)

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

    2010-01-01

    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  7. Modeling DNA affinity landscape through two-round support vector regression with weighted degree kernels

    KAUST Repository

    Wang, Xiaolei

    2014-12-12

    Background: A quantitative understanding of interactions between transcription factors (TFs) and their DNA binding sites is key to the rational design of gene regulatory networks. Recent advances in high-throughput technologies have enabled high-resolution measurements of protein-DNA binding affinity. Importantly, such experiments revealed the complex nature of TF-DNA interactions, whereby the effects of nucleotide changes on the binding affinity were observed to be context dependent. A systematic method to give high-quality estimates of such complex affinity landscapes is, thus, essential to the control of gene expression and the advance of synthetic biology. Results: Here, we propose a two-round prediction method that is based on support vector regression (SVR) with weighted degree (WD) kernels. In the first round, a WD kernel with shifts and mismatches is used with SVR to detect the importance of subsequences with different lengths at different positions. The subsequences identified as important in the first round are then fed into a second WD kernel to fit the experimentally measured affinities. To our knowledge, this is the first attempt to increase the accuracy of the affinity prediction by applying two rounds of string kernels and by identifying a small number of crucial k-mers. The proposed method was tested by predicting the binding affinity landscape of Gcn4p in Saccharomyces cerevisiae using datasets from HiTS-FLIP. Our method explicitly identified important subsequences and showed significant performance improvements when compared with other state-of-the-art methods. Based on the identified important subsequences, we discovered two surprisingly stable 10-mers and one sensitive 10-mer which were not reported before. Further test on four other TFs in S. cerevisiae demonstrated the generality of our method. Conclusion: We proposed in this paper a two-round method to quantitatively model the DNA binding affinity landscape. Since the ability to modify

  8. An amphioxus RAG1-like DNA fragment encodes a functional central domain of vertebrate core RAG1.

    Science.gov (United States)

    Zhang, Yanni; Xu, Ke; Deng, Anqi; Fu, Xing; Xu, Anlong; Liu, Xiaolong

    2014-01-07

    The highly diversified repertoire of antigen receptors in the vertebrate immune system is generated via proteins encoded by the recombination activating genes (RAGs) RAG1 and RAG2 by a process known as variable, diversity, and joining [V(D)J] gene recombination. Based on the study of vertebrate RAG proteins, many hypotheses have been proposed regarding the origin and evolution of RAG. This issue remains unresolved, leaving a significant gap in our understanding of the evolution of adaptive immunity. Here, we show that the amphioxus genome contains an ancient RAG1-like DNA fragment (bfRAG1L) that encodes a virus-related protein that is much shorter than vertebrate RAG1 and harbors a region homologous to the central domain of core RAG1 (cRAG1). bfRAG1L also contains an unexpected retroviral type II nuclease active site motif, DXN(D/E)XK, and is capable of degrading both DNA and RNA. Moreover, bfRAG1L shares important functional properties with the central domain of cRAG1, including interaction with RAG2 and localization to the nucleus. Remarkably, the reconstitution of bfRAG1L into a cRAG1-like protein yielded an enzyme capable of recognizing recombination signal sequences and performing V(D)J recombination in the presence of mouse RAG2. Moreover, this reconstituted cRAG1-like protein could mediate the assembly of antigen receptor genes in RAG1-deficient mice. Together, our results demonstrate that amphioxus bfRAG1L encodes a protein that is functionally equivalent to the central domain of cRAG1 and is well prepared for further evolution to mediate V(D)J recombination. Thus, our findings provide unique insights into the evolutionary origin of RAG1.

  9. Gene therapy for bladder pain with gene gun particle encoding pro-opiomelanocortin cDNA.

    Science.gov (United States)

    Chuang, Yao-Chi; Chou, A-K; Wu, P-C; Chiang, Po-Hui; Yu, T-J; Yang, L-C; Yoshimura, Naoki; Chancellor, Michael B

    2003-11-01

    Interstitial cystitis is a bladder hypersensitivity disease associated with bladder pain that has been a major challenge to understand and treat. We hypothesized that targeted and localized expression of endogenous opioid peptide in the bladder could be useful for the treatment of bladder pain. Pro-opiomelanocortin (POMC) is one of such precursor molecules. In this study we developed a gene gun method for the transfer of POMC cDNA in vivo and investigated its therapeutic effect on acetic acid induced bladder hyperactivity in rats. Human POMC cDNA was cloned into a modified pCMV plasmid and delivered into the bladder wall of adult female rats by direct injection or the gene gun. Three days after gene therapy continuous cystometrograms were performed using urethane anesthesia by filling the bladder (0.08 ml per minute) with saline, followed by 0.3% acetic acid. Bladder immunohistochemical testing was used to detect endorphin after POMC cDNA transfer. The intercontraction interval was decreased after intravesical instillation of acetic acid (73.1% or 68.1% decrease) in 2 control groups treated with saline or the gene gun without POMC cDNA, respectively. However, rats that received POMC cDNA via the gene gun showed a significantly decreased response (intercontraction interval 35% decreased) to acetic acid instillation, whereas this antinociceptive effect was not detected in the plasmid POMC cDNA direct injection group. This effect induced by POMC gene gun treatment was reversed by intramuscular naloxone (1 mg/kg), an opioid antagonist. Increased endorphin immunoreactivity with anti-endorphin antibodies was observed in the bladder of gene gun treated animals. The POMC gene can be transferred in the bladder using the gene gun and increased bladder expression of endorphin can suppress nociceptive responses induced by bladder irritation. Thus, POMC gene gun delivery may be useful for the treatment of interstitial cystitis and other types of visceral pain.

  10. Strategies to enhance immunogenicity of cDNA vaccine encoded antigens by modulation of antigen processing

    NARCIS (Netherlands)

    Platteel, Anouk C M; Marit de Groot, A; Andersen, Peter; Ovaa, Huib; Kloetzel, Peter M; Mishto, Michele; Sijts, Alice J A M

    2016-01-01

    Most vaccines are based on protective humoral responses while for intracellular pathogens CD8(+) T cells are regularly needed to provide protection. However, poor processing efficiency of antigens is often a limiting factor in CD8(+) T cell priming, hampering vaccine efficacy. The multistage cDNA

  11. Lack of dependence on p53 for DNA double strand break repair of episomal vectors in human lymphoblasts

    Science.gov (United States)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.

  12. Characterization of Recombinant Thermococcus kodakaraensis (KOD) DNA Polymerases Produced Using Silkworm-Baculovirus Expression Vector System

    KAUST Repository

    Yamashita, Mami

    2017-05-08

    The KOD DNA polymerase from Thermococcus kodakarensis (Tkod-Pol) has been preferred for PCR due to its rapid elongation rate, extreme thermostability and outstanding fidelity. Here in this study, we utilized silkworm-baculovirus expression vector system (silkworm-BEVS) to express the recombinant Tkod-Pol (rKOD) with N-terminal (rKOD-N) or C-terminal (rKOD-C) tandem fusion tags. By using BEVS, we produced functional rKODs with satisfactory yields, about 1.1 mg/larva for rKOD-N and 0.25 mg/larva for rKOD-C, respectively. Interestingly, we found that rKOD-C shows higher thermostability at 95 °C than that of rKOD-N, while that rKOD-N is significantly unstable after exposing to long period of heat-shock. We also assessed the polymerase activity as well as the fidelity of purified rKODs under various conditions. Compared with commercially available rKOD, which is expressed in E. coli expression system, rKOD-C exhibited almost the same PCR performance as the commercial rKOD did, while rKOD-N did lower performance. Taken together, our results suggested that silkworm-BEVS can be used to express and purify efficient rKOD in a commercial way.

  13. Quantitative PCR is a Valuable Tool to Monitor the Performance of DNA-Encoded Chemical Library Selections.

    Science.gov (United States)

    Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario

    2017-05-04

    Phage-display libraries and DNA-encoded chemical libraries (DECLs) represent useful tools for the isolation of specific binding molecules from large combinatorial sets of compounds. With both methods, specific binders are recovered at the end of affinity capture procedures by using target proteins of interest immobilized on a solid support. However, although the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DECL selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency by using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provided rapid information about the performance of selections, thus facilitating the optimization of experimental conditions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. DNA-Encoded Antibody Libraries: A Unified Platform for Multiplexed Cell Sorting and Detection of Genes and Proteins

    Science.gov (United States)

    Bailey, Ryan C.; Kwong, Gabriel A.; Radu, Caius G.; Witte, Owen N.; Heath, James R.

    2013-01-01

    Whether for pathological examination or for fundamental biology studies, different classes of biomaterials and biomolecules are each measured from a different region of a typically heterogeneous tissue sample, thus introducing unavoidable sources of noise that are hard to quantitate. We describe the method of DNA-encoded antibody libraries (DEAL) for spatially multiplexed detection of ssDNAs and proteins as well as for cell sorting, all on the same diagnostic platform. DEAL is based upon the coupling of ssDNA oligomers onto antibodies which are then combined with the biological sample of interest. Spotted DNA arrays, which are found to inhibit biofouling, are utilized to spatially stratify the biomolecules or cells of interest. We demonstrate the DEAL technique for: (1) the rapid detection of multiple proteins within a single microfluidic channel, and, with the additional step of electroless amplification of gold-nanoparticle labeled secondary antibodies, we establish a detection limit of 10 femtoMolar for the protein IL-2, 150 times more sensitive than the analog ELISA; (2) the multiplexed, on-chip sorting of both immortalized cell lines and primary immune cells with an efficiency that exceeds surface confined panning approaches; and (3) the co-detection of ssDNAs, proteins and cell populations on the same platform. PMID:17260987

  15. Construction of a genomic DNA library with a TA vector and its application in cloning of the phytoene synthase gene from the cyanobacterium Spirulina platensis M-135

    Science.gov (United States)

    Yoshikazu, Kawata; Shin-Ichi, Yano; Hiroyuki, Kojima

    1998-03-01

    An efficient and simple method for constructing a genomic DNA library using a TA cloning vector is presented. It is based on the sonicative cleavage of genomic DNA and modification of fragment ends with Taq DNA polymerase, followed by ligation using a TA vector. This method was applied for cloning of the phytoene synthase gene crt B from Spirulina platensis. This method is useful when genomic DNA cannot be efficiently digested with restriction enzymes, a problem often encountered during the construction of a genomic DNA library of cyanobacteria.

  16. Metalloregulatory DNA-Binding Protein Encoded by the merR Gene: Isolation and Characterization

    Science.gov (United States)

    O'Halloran, Thomas; Walsh, Christopher

    1987-01-01

    The MerR protein mediates the induction of the mercury resistance phenotype in bacteria; it has been isolated in order to study the effects of metal-ion induced changes in the metabolism of prokaryotic cells at the molecular level. After DNA sequences responsible for negative autoregulation were removed, the 16-kilodalton protein was overproduced and purified to more than 90 percent homogeneity by a salt extraction procedure that yields about 5 milligrams of protein per gram of cells. Complementation data, amino terminal analysis, gel filtration, and deoxyribonuclease I protection studies demonstrate that the purified merR gene product is a dimer under nondenaturing conditions and that it binds specifically to DNA, in the presence and absence of mercury, at a palindromic site which is directly between the -10 and -35 regions of the structural genes and adjacent to its own promoter. These initial results indicate that MerR is a DNA-binding metalloregulatory protein that plays a central role in this heavy metal responsive system and they delineate an operator site in the mer operon.

  17. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......We have used available protein sequence data for the anaphylatoxin (C5a) portion of the fifth component of human complement (residues 19-25) to synthesize a mixed-sequence oligonucleotide probe. The labeled oligonucleotide was then used to screen a human liver cDNA library, and a single candidate cDNA...... obtained further predicted an arginine-rich sequence (RPRR) immediately upstream of the N-terminal threonine of C5a, indicating that the promolecule form of C5 is synthesized with a beta alpha-chain orientation as previously shown for pro-C3 and pro-C4. The C5 cDNA clone was sheared randomly by sonication...

  18. Molecular characterization of a cDNA encoding copper/zinc superoxide dismutase from cultured cells of Manihot esculenta.

    Science.gov (United States)

    Shin, Seung-Yong; Lee, Haeng-Soon; Kwon, Suk-Yoon; Kwon, Soon-Tae; Kwak, Sang-Soo

    2005-01-01

    Superoxide dismutase (SOD) cDNA, mSOD2, encoding cytosolic copper/zinc SOD (CuZnSOD) cDNA was isolated from suspension-cultured cells of cassava (Manihot esculenta Crantz) by cDNA library screening, and its expression was investigated in relation to environmental stress. mSOD2 is 774 bp in length with an open reading frame (ORF) of 152 amino acids, corresponding to a protein of predicted molecular mass 15 kDa and a pI of 5.22. One copy of the mSOD2 gene was found to be present in the cassava genome by Southern analysis using an mSOD2 cDNA-specific probe. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis revealed diverse expression patterns for the mSOD2 gene in various tissues of intact cassava plants, at various stages of the growth in suspension cultures, and in the leaf tissues exposed to different stresses. The mSOD2 gene was highly expressed in suspension-cultured cells and in the stems of intact plants. However, it was expressed at low levels in leaves and roots. During suspension cell growth, the mSOD2 transcript progressively increased during culture. Moreover, the mSOD2 gene in excised cassava leaves responded to various stresses in different ways. In particular, it was highly induced in leaf tissue by several abiotic stresses, including high temperature (37 degrees C), chilling (4 degrees C), methyl viologen (MV) exposure, and wounding treatment. These results indicate that the mSOD2 gene is involved in the antioxidative process triggered by oxidative stress induced by environmental change.

  19. Isolation of a cDNA encoding a CHH-family peptide from the silkworm Bombyx mori.

    Science.gov (United States)

    Endo, H; Nagasawa, H; Watanabe, T

    2000-05-01

    The crustacean hyperglycemic hormone (CHH) peptide family includes four types of neuropeptide in decapod and isopod crustaceans, and the ion-transport peptide in orthopteran insects. To identify a new member of this family in Insecta, a PCR-based search for cDNAs encoding CHH-family peptides was carried out in the silkworm Bombyx mori. A cDNA, named BmCHHL (Bombyx mori CHH-like protein), with an open reading frame of 110 amino acids was isolated. Sequence analyses suggested that the conceptual protein was a precursor of a peptide of 72 amino acids which was amidated at the carboxy terminus. The BmCHHL sequence exhibited significant similarities to members of the CHH family including the orthopteran ion-transport peptide. BmCHHL expression was detected in five or six cells (per hemisphere) in the frontal area of the brain in day 4 fifth instar larvae.

  20. Blocking Blood Supply to Breast Carcinoma With a DNA Vaccine Encoding VEGF Receptor-2

    Science.gov (United States)

    2006-03-01

    vaccination: an update. Methods Mol Med 2003;87:377–90. 14. Ambrosini G, Adida C, Altieri DC. A novel anti- apoptosis gene, survivin, expressed in cancer...endothelial cells. Biochem Biophys Res Commun 1999;264:781–8. 26. O’Connor DS, Schechner JS, Adida C, et al. Control of apoptosis during angiogenesis by...minigene DNA vaccine protects mice from tumors of different origins by inducing a T cell-mediated suppression of tumor angiogenesis. From the Department of

  1. [Cloning and functional characterization of a cDNA encoding isopentenyl diphosphate isomerase involved in taxol biosynthesis in Taxus media].

    Science.gov (United States)

    Shen, Tian; Qiu, Fei; Chen, Min; Lan, Xiao-zhong; Liao, Zhi-hua

    2015-05-01

    Taxol is one of the most potent anti-cancer agents, which is extracted from the plants of Taxus species. Isopentenyl diphosphate isomerase (IPI) catalyzes the reversible transformation between IPP and DMAPP, both of which are the general 5-carbon precursors for taxol biosynthesis. In the present study, a new gene encoding IPI was cloned from Taxus media (namely TmIPI with the GenBank Accession Number KP970677) for the first time. The full-length cDNA of TmIPI was 1 232 bps encoding a polypeptide with 233 amino acids, in which the conserved domain Nudix was found. Bioinformatic analysis indicated that the sequence of TmIPI was highly similar to those of other plant IPI proteins, and the phylogenetic analysis showed that there were two clades of plant IPI proteins, including IPIs of angiosperm plants and IPIs of gymnosperm plants. TmIPI belonged to the clade of gymnosperm plant IPIs, and this was consistent with the fact that Taxus media is a plant species of gymnosperm. Southern blotting analysis demonstrated that there was a gene family of IPI in Taxus media. Finally, functional verification was applied to identify the function of TmIPI. The results showed that biosynthesis of β-carotenoid was enhanced by overexpressing TmIPI in the engineered E. coli strain, and this suggested that TmIPI might be a key gene involved in isoprenoid/terpenoid biosynthesis.

  2. [Construction and transfection of eucaryotic expression recombinant vector containing truncated region of UL83 gene of human cytomegalovirus and it's sheltered effect as DNA vaccine].

    Science.gov (United States)

    Gao, Rong-Bao; Li, Yan-Qiu; Wang, Ming-Li

    2006-06-01

    To construct eucaryotic expression recombinant vector containing vivo truncated region of UL83 gene of human cytomegalovirus, realize its steady expression in Hep-2 cell, and study sheltered effect of the eucaryotic expression recombinant vector as DNA vaccine. A vivo truncated UL83 gene fragment encoding for truncated HCMV pp65 was obtained by PCR from human cytomegalovirus AD169 stock genome. By gene recombinant ways, the truncated UL83 gene fragment was cloned into eucaryotic expression vector pEGFP-C1 with reported gene coding GFP to construct recombinant vector pEGFP-C1-UL83. The recombinant vector pEGFP-C1-UL83 was tested by different methods including PCR, restriction digestion and gene sequencing. Test results showed the recombinant vector was constructed successfully. After pEGFP-C1-UL83 was transfected into Hep-2 cell by lipofectin mediation, expression of GFP and truncated pp65 fusion protein in Hep-2 cell was observed at different time points by fluorescence microscope. Results showed that quantity of fusion protein expression was the highest at 36h point. Then, Hep-2 cell was cultured selectively by RPMI-1640 containing G418 (200 microg/mL) to obtain a new cell stock of expressing truncated UL83 Gene fragment steadily. RT-PCR and Western blot results showed the truncated fragment of UL83 gene could be expressed steadily in Hep-2 cell. The result showed a new cell stock of expressing Tpp65 was established. This cell stock could be useful in some HCMV research fields, for example, it could be a tool in study of pp65 and HCMV infection, and it could provide a platform for the research into the therapy of HCMV infection. Immune sheltered effect of pEGFP-C1-UL83 as DNA vaccine was studied in vivo of HCMV congenital infection mouse model. The mouse model was immunized solely by pEGFP-C1-UL83, and was immunized jointly by pEGFP-C1-UL83 and its expression product. When the mouse was pregnant and brought to bed, differential antibody of anti-HCMV pp65 was

  3. Immunogenicity and protective efficacy of Semliki forest virus replicon-based DNA vaccines encoding goatpox virus structural proteins

    International Nuclear Information System (INIS)

    Zheng Min; Jin Ningyi; Liu Qi; Huo Xiaowei; Li Yang; Hu Bo; Ma Haili; Zhu Zhanbo; Cong Yanzhao; Li Xiao; Jin Minglan; Zhu Guangze

    2009-01-01

    Goatpox, caused by goatpox virus (GTPV), is an acute feverish and contagious disease in goats often associated with high morbidity and high mortality. To resolve potential safety risks and vaccination side effects of existing live attenuated goatpox vaccine (AV41), two Semliki forest virus (SFV) replicon-based bicistronic expression DNA vaccines (pCSm-AAL and pCSm-BAA) which encode GTPV structural proteins corresponding to the Vaccinia virus proteins A27, L1, A33, and B5, respectively, were constructed. Then, theirs ability to induce humoral and cellular response in mice and goats, and protect goats against virulent virus challenge were evaluated. The results showed that, vaccination with pCSm-AAL and pCSm-BAA in combination could elicit strong humoral and cellular responses in mice and goats, provide partial protection against viral challenge in goats, and reduce disease symptoms. Additionally, priming vaccination with the above-mentioned DNA vaccines could significantly reduce the goats' side reactions from boosting vaccinations with current live vaccine (AV41), which include skin lesions at the inoculation site and fevers. Data obtained in this study could not only facilitate improvement of the current goatpox vaccination strategy, but also provide valuable guidance to suitable candidates for evaluation and development of orthopoxvirus vaccines.

  4. Isolation and Expression of a cDNA Encoding Methylmalonic Aciduria Type A Protein from Euglena gracilis Z

    Directory of Open Access Journals (Sweden)

    Fumio Watanabe

    2013-02-01

    Full Text Available In animals, cobalamin (Cbl is a cofactor for methionine synthase and methylmalonyl-CoA mutase (MCM, which utilizes methylcobalamin and 5′-deoxyadenosylcobalamin (AdoCbl, respectively. The cblA complementation class of inborn errors of Cbl metabolism in humans is one of three known disorders that affect AdoCbl synthesis. The gene responsible for cblA has been identified in humans (MMAA as well as its homolog (meaB in Methylobacterium extorquens. Recently, it has been reported that human MMAA plays an important role in the protection and reactivation of MCM in vitro. However, the physiological function of MMAA is largely unknown. In the present study, we isolated the cDNA encoding MMAA from Euglena gracilis Z, a photosynthetic flagellate. The deduced amino acid sequence of the cDNA shows 79%, 79%, 79% and 80% similarity to human, mouse, Danio rerio MMAAs and M. extorquens MeaB, respectively. The level of the MCM transcript was higher in Cbl-deficient cultures of E. gracilis than in those supplemented with Cbl. In contrast, no significant differences were observed in the levels of the MMAA transcript under the same two conditions. No significant difference in MCM activity was observed between Escherichia coli that expressed either MCM together with MMAA or expressed MCM alone.

  5. Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

    Science.gov (United States)

    de Bellocq, J Goüy; Leirs, H

    2009-09-01

    Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

  6. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

    Science.gov (United States)

    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

    2014-08-20

    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  7. Complementary DNA sequences encoding the multimammate rat MHC class II DQ α and β chains and cross-species sequence comparison in rodents

    DEFF Research Database (Denmark)

    Goüy de Bellocq, J; Leirs, H

    2009-01-01

    DNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide...... of Mana-DQB, which is unique among known rodents....

  8. Mitochondrial DNA polymorphism in genes encoding ND1, COI and CYTB in canine malignant cancers.

    Science.gov (United States)

    Slaska, Brygida; Grzybowska-Szatkowska, Ludmila; Nisztuk, Sylwia; Surdyka, Magdalena; Rozanska, Dorota

    2015-06-01

    The aim of the study was to identify DNA changes in mitochondrial gene fragments: NADH dehydrogenase subunit 1 (ND1), cytochrome c oxidase subunit I (COI) and cytochrome b (CYTB) in tumor tissue, normal tissue and blood, and to define their association with the tumor type in dogs. Molecular analysis included 144 tests in total. A functional effect of the non-synonymous protein coding SNP was predicted. The presence of polymorphisms in all tested gene fragments in individual tissues of dogs was observed. Heteroplasmic changes were found in ND1 and CYTB in epithelioma glandulae sebacei and in CYTB in lymphoma centroblasticum. The results of in silico analysis show the impact of these alleles (COI: 507, ND1: 450, 216, CYTB: 748) on the functioning of proteins and thus their potential role in carcinogenesis. The possible harmful effects of changes in polypeptides in positions T193N, V98M, V118M and H196P were evaluated. It seems that polymorphisms occurring in cells can have a negative impact on functioning of proteins. This promotes disorders of the energy level in cells.

  9. Immunogenicity of bivalent human papillomavirus DNA vaccine using human endogenous retrovirus envelope-coated baculoviral vectors in mice and pigs.

    Directory of Open Access Journals (Sweden)

    Hee-Jung Lee

    Full Text Available Human papillomavirus is known to be the major pathogen of cervical cancer. Here, we report the efficacy of a bivalent human papillomavirus type 16 and 18 DNA vaccine system following repeated dosing in mice and pigs using a recombinant baculovirus bearing human endogenous retrovirus envelope protein (AcHERV as a vector. The intramuscular administration of AcHERV-based HPV16L1 and HPV18L1 DNA vaccines induced antigen-specific serum IgG, vaginal IgA, and neutralizing antibodies to levels comparable to those achieved using the commercially marketed vaccine Cervarix. Similar to Cervarix, AcHERV-based bivalent vaccinations completely blocked subsequent vaginal challenge with HPV type-specific pseudovirions. However, AcHERV-based bivalent vaccinations induced significantly higher cell-mediated immune responses than Cervarix, promoting 4.5- (HPV16L1 and 3.9-(HPV18L1 fold higher interferon-γ production in splenocytes upon stimulation with antigen type-specific pseudovirions. Repeated dosing did not affect the immunogenicity of AcHERV DNA vaccines. Three sequential immunizations with AcHERV-HP18L1 DNA vaccine followed by three repeated dosing with AcHERV-HP16L1 over 11 weeks induced an initial production of anti-HPV18L1 antibody followed by subsequent induction of anti-HPV16L1 antibody. Finally, AcHERV-based bivalent DNA vaccination induced antigen-specific serum IgG immune responses in pigs. These results support the further development of AcHERV as a bivalent human papillomavirus DNA vaccine system for use in preventing the viral infection as well as treating the infected women by inducing both humoral and cell-mediated immune responses. Moreover, the possibility of repeated dosing indicates the utility of AcHERV system for reusable vectors of other viral pathogen vaccines.

  10. Induction of cell-mediated immunity against mycobacterium tuberculosis using DNA vaccines encoding cytotoxic and helper T-cell epitopes of the 38-kilodalton protein

    NARCIS (Netherlands)

    Fonseca, DPAJ; Benaissa-Trouw, B; Kraaijeveld, CA; Snippe, H; Verheul, AFM

    Cell-mediated immune responses are crucial in the protection against tuberculosis. In this study, we constructed DNA vaccines encoding cytotoxic T lymphocytes (CTL) and T helper cell (Th) epitopes of the 38-kDa lipoglycoprotein of Mycobacterium tuberculosis and analyzed and compared their

  11. The roles of adenoviral vectors and donor DNA structures on genome editing

    NARCIS (Netherlands)

    Holkers, Maarten

    2016-01-01

    Accurate and efficient genome editing is primarily dependent on the generation of a sequence-specific, genomic double-stranded DNA break (DSB) combined with the introduction of an exogenous DNA template into target cells. The exogenous template, called donor DNA, normally contains the foreign

  12. Stimulation of IgY responses in gene gun immunized laying hens by combined administration of vector DNA coding for the target antigen Botulinum toxin A1 and for avian cytokine adjuvants.

    Science.gov (United States)

    Niederstadt, Lars; Hohn, Oliver; Dorner, Brigitte G; Schade, Rüdiger; Bannert, Norbert

    2012-08-31

    DNA immunization is a convenient and effective way of inducing a specific antibody response. In mammals, co-administration of vectors encoding immunostimulatory cytokines can enhance the humoral response resulting in elevated antibody titers. We therefore set out to investigate the effect using avian interleukin 1β (IL-1β) and avian interleukin 6 (IL-6) as genetic adjuvants when immunizing laying hens. A BoNT A1 holotoxoid DNA immunogen carrying two inactivating mutations was evaluated for its ability to induce a specific and sustained IgY antibody response. Both the holotoxoid and the cytokine sequences were codon-optimized. In vitro, the proteins were efficiently expressed in transfected HEK 293T cells and the cytokines were secreted into the culture supernatants. Whereas eggs from hens immunized via gene gun using a prime boost strategy showed no differences in their total IgY content, the specific αBoNT A1 response was slightly elevated up to 1.4× by the IL-1β adjuvant vector and increased by 3.8× by the IL-6 vector. Finally, although hens receiving the IL-1β adjuvant had laying capacities above the average, hens receiving the IL-6 adjuvant experienced laying problems. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Constructing of DNA vectors with controlled nanosize and single dispersion by block copolymer coating gold nanoparticles as template assembly

    Energy Technology Data Exchange (ETDEWEB)

    Li, Junbo, E-mail: Lijunbo@haust.edu.cn [Henan University of Science and Technology, School of Chemical Engineering and Pharmaceutics (China); Wu, Wenlan [Henan University of Science and Technology, School of Medicine (China); Gao, Jiayu; Liang, Ju; Zhou, Huiyun; Liang, Lijuan [Henan University of Science and Technology, School of Chemical Engineering and Pharmaceutics (China)

    2017-03-15

    Synthesized vectors with nanoscale size and stable colloid dispersion are highly desirable for improving gene delivery efficiency. Here, a core-shell template particle was constructed with polyethylene glycol-b-poly1-(3-aminopropyl)-3-(2-methacryloyloxy propylimidazolium bromine) (PEG-b-PAMPImB) coating gold nanoparticles (PEG-b-PAMPImB-@-Au NPs) for loading DNA and delivering in vitro. Data from transmission electron microscopy (TEM) and dynamic light scattering (DLS) suggest that these nanoplexes, by forming an electrostatic complex with DNA at the inner PAMPImB shell, offer steric protection for the outer PEG corona leading to single dispersion and small size. Notably, higher colloid stability and lower cytotoxicity were achieved with these nanoplexes when compared with PAMPImB monolayer-coated gold nanoparticles (Au NPs). Confocal laser scanning microscopy and intracellular trafficking TEM further indicate that the nanoplexes can translocate across the cell membrane and partly enter the nucleus for high efficient expression. Thus, template assembly represents a promising approach to control the size and colloid stability of gene vectors and ensure safety and efficiency of DNA delivery.

  14. Covalently bound DNA on naked iron oxide nanoparticles: Intelligent colloidal nano-vector for cell transfection.

    Science.gov (United States)

    Magro, Massimiliano; Martinello, Tiziana; Bonaiuto, Emanuela; Gomiero, Chiara; Baratella, Davide; Zoppellaro, Giorgio; Cozza, Giorgio; Patruno, Marco; Zboril, Radek; Vianello, Fabio

    2017-11-01

    Conversely to common coated iron oxide nanoparticles, novel naked surface active maghemite nanoparticles (SAMNs) can covalently bind DNA. Plasmid (pDNA) harboring the coding gene for GFP was directly chemisorbed onto SAMNs, leading to a novel DNA nanovector (SAMN@pDNA). The spontaneous internalization of SAMN@pDNA into cells was compared with an extensively studied fluorescent SAMN derivative (SAMN@RITC). Moreover, the transfection efficiency of SAMN@pDNA was evaluated and explained by computational model. SAMN@pDNA was prepared and characterized by spectroscopic and computational methods, and molecular dynamic simulation. The size and hydrodynamic properties of SAMN@pDNA and SAMN@RITC were studied by electron transmission microscopy, light scattering and zeta-potential. The two nanomaterials were tested by confocal scanning microscopy on equine peripheral blood-derived mesenchymal stem cells (ePB-MSCs) and GFP expression by SAMN@pDNA was determined. Nanomaterials characterized by similar hydrodynamic properties were successfully internalized and stored into mesenchymal stem cells. Transfection by SAMN@pDNA occurred and GFP expression was higher than lipofectamine procedure, even in the absence of an external magnetic field. A computational model clarified that transfection efficiency can be ascribed to DNA availability inside cells. Direct covalent binding of DNA on naked magnetic nanoparticles led to an extremely robust gene delivery tool. Hydrodynamic and chemical-physical properties of SAMN@pDNA were responsible of the successful uptake by cells and of the efficiency of GFP gene transfection. SAMNs are characterized by colloidal stability, excellent cell uptake, persistence in the host cells, low toxicity and are proposed as novel intelligent DNA nanovectors for efficient cell transfection. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Vaccination with a plasmid DNA cocktail encoding the nucleosomal histones of Leishmania confers protection against murine cutaneous leishmaniosis.

    Science.gov (United States)

    Iborra, Salvador; Soto, Manuel; Carrión, Javier; Alonso, Carlos; Requena, Jose M

    2004-09-28

    Leishmania histones are relevant immunogens for the host immune system during both Leishmania infection and disease. In the present paper we have evaluated the prophylactic value of the four Leishmania infantum histones forming the nucleosomal core in the murine model of cutaneous leishmaniasis. In a first stage, the immune response elicited by the intramuscular injection of a mixture of four plasmid DNAs, encoding the L. infantum histones H2A, H2B, H3 and H4, was determined in BALB/c mice. It was found that the immunized animals developed a specific Th1 immune response, which was associated with an antigen-specific production of interferon (IFN-gamma) and a limited humoral response against histones (dominated by antibodies of the IgG2a isotype). According to the pure Th1-type immune response elicited by the DNA vaccination with Leishmania histones, vaccinated mice showed a solid immunity that efficiently controlled the Leishmania major infection. The protection in mice vaccinated with histone-DNAs was associated with a low humoral response against leishmanial antigens, an enhanced IFN-gamma production and little, if any, IL-4 production. The relative contribution of both CD8(+) and CD4(+) T cells to the IFN-gamma production, and the IL-12 dependence were also evaluated. All these data indicated that DNA vaccination with Leishmania histones genes results in a specific Th1-like response during L. major infection, and that both CD4(+) and CD8(+) T cells contribute to the resistance of vaccinated mice to cutaneous leishmaniasis.

  16. "Direct cloning in Lactobacillus plantarum: electroporation with non-methylated plasmid DNA enhances transformation efficiency and makes shuttle vectors obsolete".

    Science.gov (United States)

    Spath, Katharina; Heinl, Stefan; Grabherr, Reingard

    2012-10-25

    Lactic acid bacteria (LAB) play an important role in agricultural as well as industrial biotechnology. Development of improved LAB strains using e.g. library approaches is often limited by low transformation efficiencies wherefore one reason could be differences in the DNA methylation patterns between the Escherichia coli intermediate host for plasmid amplification and the final LAB host. In the present study, we examined the influence of DNA methylation on transformation efficiency in LAB and developed a direct cloning approach for Lactobacillus plantarum CD033. Therefore, we propagated plasmid pCD256 in E. coli strains with different dam/dcm-methylation properties. The obtained plasmid DNA was purified and transformed into three different L. plantarum strains and a selection of other LAB species. Best transformation efficiencies were obtained using the strain L. plantarum CD033 and non-methylated plasmid DNA. Thereby we achieved transformation efficiencies of ~ 10(9) colony forming units/μg DNA in L. plantarum CD033 which is in the range of transformation efficiencies reached with E. coli. Based on these results, we directly transformed recombinant expression vectors received from PCR/ligation reactions into L. plantarum CD033, omitting plasmid amplification in E. coli. Also this approach was successful and yielded a sufficient number of recombinant clones. Transformation efficiency of L. plantarum CD033 was drastically increased when non-methylated plasmid DNA was used, providing the possibility to generate expression libraries in this organism. A direct cloning approach, whereby ligated PCR-products where successfully transformed directly into L. plantarum CD033, obviates the construction of shuttle vectors containing E. coli-specific sequences, as e.g. a ColEI origin of replication, and makes amplification of these vectors in E. coli obsolete. Thus, plasmid constructs become much smaller and occasional structural instability or mutagenesis during E. coli

  17. ARG1 (altered response to gravity) encodes a DnaJ-like protein that potentially interacts with the cytoskeleton

    Science.gov (United States)

    Sedbrook, J. C.; Chen, R.; Masson, P. H.

    1999-01-01

    Gravitropism allows plant organs to direct their growth at a specific angle from the gravity vector, promoting upward growth for shoots and downward growth for roots. Little is known about the mechanisms underlying gravitropic signal transduction. We found that mutations in the ARG1 locus of Arabidopsis thaliana alter root and hypocotyl gravitropism without affecting phototropism, root growth responses to phytohormones or inhibitors of auxin transport, or starch accumulation. The positional cloning of ARG1 revealed a DnaJ-like protein containing a coiled-coil region homologous to coiled coils found in cytoskeleton-interacting proteins. These data suggest that ARG1 participates in a gravity-signaling process involving the cytoskeleton. A combination of Northern blot studies and analysis of ARG1-GUS fusion-reporter expression in transgenic plants demonstrated that ARG1 is expressed in all organs. Ubiquitous ARG1 expression in Arabidopsis and the identification of an ortholog in Caenorhabditis elegans suggest that ARG1 is involved in other essential processes.

  18. Molecular cloning and expression of a cDNA encoding a hybrid histidine kinase receptor in tropical periwinkle Catharanthus roseus.

    Science.gov (United States)

    Papon, N; Bremer, J; Vansiri, A; Glévarec, G; Rideau, M; Creche, J

    2006-09-01

    Signalling pathways involving histidine kinase receptors (HKRs) are widely used by prokaryotes and fungi to regulate a large palette of biological processes. In plants, HKRs are known to be implicated in cytokinin, ethylene, and osmosensing transduction pathways. In this work, a full length cDNA named CRCIK was isolated from the tropical species CATHARANTHUS ROSEUS (L.) G. Don. It encodes a 1205 amino acid protein that belongs to the hybrid HKR family. The deduced amino acid sequence shows the highest homology with AtHK1, an osmosensing HKR in ARABIDOPSIS THALIANA. In return, CrCIK protein shares very low identity with the other 10 ARABIDOPSIS HKRs. Southern blot analysis indicates that the CRCIK corresponding gene is either present in multiple copies or has very close homologues in the genome of the tropical periwinkle. The gene is widely expressed in the plant. In C. ROSEUS C20D cell suspension, it is slightly induced after exposure to low temperature, pointing to a putative role in cold-shock signal transduction.

  19. Effect of IL-22 on DNA vaccine encoding LACK gene of Leishmania major in BALB/c mice.

    Science.gov (United States)

    Hezarjaribi, Hajar Ziaee; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh; Jorjani, Ogholniaz

    2013-07-01

    In the present study, the effect of IL-22 together with the plasmid encoding LACK (Leishmania homolog of receptors for activated C-kinase) gene of Leishmania major on the trend of leishmaniasis in BALB/c mice was evaluated. Evaluation of the cellular and humoral immunity was performed by measurement of IL-4 and IFN-γ, culture of splenocytes and MTT assay, and measurement of total IgG, IgG1, and IgG2a in the control and immunized groups. Clinical evaluations were also carried out by measurement of the lesion size, survival rate, and body weight of mice. Comparison of the mean size of lesions in the LACK and LACK+IL-22 groups demonstrated that the mean size of lesions of the two groups was significantly different from week four (pLACK gene), and pcLACK+IL-22 groups were 20%, 40%, 60%, and 80%, respectively. According to the results of IFN-γ, IL-4, total IgG, IgG1, and IgG2a measurement and the MTT assay, IL-22 obviously caused an increase in IFN-γ production and a decrease in IL-4 production before and after the challenge (p<0.05). The results showed the effectiveness of IL-22 in DNA vaccine. It showed that IL-22 brought about Th1 cytokine responses and high survival rate of mice. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Development of a gene silencing DNA vector derived from a broad host range geminivirus

    Directory of Open Access Journals (Sweden)

    Hancock Leandria C

    2009-07-01

    Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

  1. A bovine cDNA and a yeast gene (VMA8) encoding the subunit D of the vacuolar H(+)-ATPase.

    OpenAIRE

    Nelson, H; Mandiyan, S; Nelson, N

    1995-01-01

    Subunit D of vacuolar H(+)-ATPase (V-ATPase) from bovine chromaffin granules was subjected to partial proteolysis and amino acid sequencing. A cDNA encoding this subunit was isolated and sequenced. The predicted open reading frame encodes a protein of 247 amino acids with a calculated molecular weight of 28,336. Northern blot analysis revealed an mRNA distribution with higher transcript amounts in tissues that are active in secretion. A homologous gene was identified as open reading frame 11 ...

  2. Construction of a new shuttle vector for DNA delivery into mammalian cells using non-invasive Lactococcus lactis.

    Science.gov (United States)

    Yagnik, Bhrugu; Padh, Harish; Desai, Priti

    2016-04-01

    Use of food grade Lactococcus lactis (L. lactis) is fast emerging as a safe alternative for delivery of DNA vaccine. To attain efficient DNA delivery, L. lactis, a non-invasive bacterium is converted to invasive strain either by expressing proteins like Internalin A (InlA) or Fibronectin binding protein A (FnBPA) or through chemical treatments. However the safety status of invasive L. lactis is questionable. In the present report, we have shown that non-invasive L. lactis efficiently delivered the newly constructed reporter plasmid pPERDBY to mammalian cells without any chemical enhancers. The salient features of the vector are; I) Ability to replicate in two different hosts; Escherichia coli (E. coli) and Lactic Acid Bacteria (LAB), II) One of the smallest reporter plasmid for DNA vaccine, III) Enhanced Green Fluorescence Protein (EGFP) linked to Multiple Cloning Site (MCS), IV) Immunostimulatory CpG motifs functioning as an adjuvant. Expression of EGFP in pPERDBY transfected CHO-K1 and Caco-2 cells demonstrates its functionality. Non-invasive r-L. lactis was found efficient in delivering pPERDBY to Caco-2 cells. The in vitro data presented in this article supports the hypothesis that in the absence of invasive proteins or relevant chemical treatment, L. lactis was found efficient in delivering DNA to mammalian cells. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  3. Construction and characterization of three yeast-Escherichia coli shuttle vectors designed for rapid subcloning of yeast genes on small DNA fragments.

    Science.gov (United States)

    Ferguson, J; Groppe, J C; Reed, S I

    1981-12-01

    We have constructed three new subcloning plasmid vectors, pRC1, pRC2, and pRC3, derived from pKC7, which allow the rapid, single-step subcloning of yeast genes. Subcloning with these vectors utilizes a partial digestion with Sau3A to generate a quasi-random set of DNA fragments from the original plasmid. All three vectors contain a kanamycin resistance gene. Therefore, if the original cloned yeast DNA fragment is present in a vector that does not specify kanamycin resistance, the subclone pool can be propagated in Escherichia coli in the presence of kanamycin to select against parent plasmids that escaped restriction by Sau3A. Selection by complementation in yeast yields a collection of plasmids with smaller yeast DNA inserts containing the gene of interest. In the vectors pRC2 and pRC3, constructed from pRC1, the unique BamHI site is located within an intact tetracycline resistance gene, thus making it possible to screen bacterial transformants for those containing recombinant plasmid molecules. Vectors pRC2 and pRC3 also contain the yeast 2 micrometers DNA replication origin, and thus are more stable than plasmids carrying only the TRP1-associated replicator (ars1).

  4. DNA barcoding reveals both known and novel taxa in the Albitarsis Group (Anopheles: Nyssorhynchus) of Neotropical malaria vectors.

    Science.gov (United States)

    Ruiz-Lopez, Freddy; Wilkerson, Richard C; Conn, Jan E; McKeon, Sascha N; Levin, David M; Quiñones, Martha L; Póvoa, Marinete M; Linton, Yvonne-Marie

    2012-02-21

    Mosquitoes belonging to the Albitarsis Group (Anopheles: Nyssorhynchus) are of importance as malaria vectors across the Neotropics. The Group currently comprises six known species, and recent studies have indicated further hidden biodiversity within the Group. DNA barcoding has been proposed as a highly useful tool for species recognition, although its discriminatory utility has not been verified in closely related taxa across a wide geographic distribution. DNA barcodes (658 bp of the mtDNA Cytochrome c Oxidase--COI) were generated for 565 An. albitarsis s.l. collected in Argentina, Brazil, Colombia, Paraguay, Trinidad and Venezuela over the past twenty years, including specimens from type series and type localities. Here we test the utility of currently advocated barcoding methodologies, including the Kimura-two-parameter distance model (K2P) and Neighbor-joining analysis (NJ), for determining species delineation within mosquitoes of the Neotropical Albitarsis Group of malaria vectors (Anopheles: Nyssorhynchus), and compare results with Bayesian analysis. Species delineation through barcoding analysis and Bayesian phylogenetic analysis, fully concur. Analysis of 565 sequences (302 unique haplotypes) resolved nine NJ tree clusters, with less than 2% intra-node variation. Mean intra-specific variation (K2P) was 0.009 (range 0.002-0.014), whereas mean inter-specific divergence were several-fold higher at 0.041 (0.020-0.056), supporting the reported "barcoding gap". These results show full support for separate species status of the six known species in the Albitarsis Group (An. albitarsis s.s., An. albitarsis F, An. deaneorum, An. janconnae, An. marajoara and An. oryzalimnetes), and also support species level status for two previously detected lineages--An. albitarsis G &An. albitarsis I (designated herein). In addition, we highlight the presence of a unique mitochondrial lineage close to An. deaneorum and An. marajoara (An. albitarsis H) from Rondônia and Mato

  5. DNA barcoding reveals both known and novel taxa in the Albitarsis Group (Anopheles: Nyssorhynchus of Neotropical malaria vectors

    Directory of Open Access Journals (Sweden)

    Ruiz-Lopez Freddy

    2012-02-01

    Full Text Available Abstract Background Mosquitoes belonging to the Albitarsis Group (Anopheles: Nyssorhynchus are of importance as malaria vectors across the Neotropics. The Group currently comprises six known species, and recent studies have indicated further hidden biodiversity within the Group. DNA barcoding has been proposed as a highly useful tool for species recognition, although its discriminatory utility has not been verified in closely related taxa across a wide geographic distribution. Methods DNA barcodes (658 bp of the mtDNA Cytochrome c Oxidase - COI were generated for 565 An. albitarsis s.l. collected in Argentina, Brazil, Colombia, Paraguay, Trinidad and Venezuela over the past twenty years, including specimens from type series and type localities. Here we test the utility of currently advocated barcoding methodologies, including the Kimura-two-parameter distance model (K2P and Neighbor-joining analysis (NJ, for determining species delineation within mosquitoes of the Neotropical Albitarsis Group of malaria vectors (Anopheles: Nyssorhynchus, and compare results with Bayesian analysis. Results Species delineation through barcoding analysis and Bayesian phylogenetic analysis, fully concur. Analysis of 565 sequences (302 unique haplotypes resolved nine NJ tree clusters, with less than 2% intra-node variation. Mean intra-specific variation (K2P was 0.009 (range 0.002 - 0.014, whereas mean inter-specific divergence were several-fold higher at 0.041 (0.020 - 0.056, supporting the reported "barcoding gap". These results show full support for separate species status of the six known species in the Albitarsis Group (An. albitarsis s.s., An. albitarsis F, An. deaneorum, An. janconnae, An. marajoara and An. oryzalimnetes, and also support species level status for two previously detected lineages - An. albitarsis G &An. albitarsis I (designated herein. In addition, we highlight the presence of a unique mitochondrial lineage close to An. deaneorum and An

  6. Characterization of the cDNA encoding bullfrog, Rana catesbeiana, osteocalcin and two forms of the protein isolated from bone.

    Science.gov (United States)

    Dohi, Yoshiko; Tabata, Shiro; Yamaguchi, Minoru; Ohgushi, Hajime; Yonemasu, Kunio

    2004-07-01

    A full-length cDNA clone encoding osteocalcin from the bullfrog, Rana catesbeiana (bone Gla-protein, BGP) has been isolated, and the complete coding sequence for the 100-amino-acid pre-pro-osteocalcin protein was determined. The amino acid sequence of Rana catesbeiana osteocalcin, especially the mature 49-amino acid sequence, is closer to the mammalian than to the fish, Sparus osteocalcin. Rana mature osteocalcin has a similarity of 67% with human or 59% with rat osteocalcin, and only 42% with fish mature osteocalcin. The 51-amino-acid pre-pro-peptide contains the expected hydrophobic leader sequence and the dibasic Arg-Arg sequence preceding the NH2-terminal Ser of the mature 49-amino-acid Rana osteocalcin. The pro-peptide sequence also contains the expected motif of polar and hydrophobic residues, which targets vitamin K-dependent gamma-carboxylation of three specific Glu residues at positions 17, 21, and 24 in the mature protein. At the native protein expression levels, extraction from Rana cortical bone in the presence of protease inhibitor cocktail resulted in the isolation of two distinct forms of osteocalcin, P-1 and P-2, with a 3:2 distribution. Using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and amino acid sequence analysis of the N-terminal domain, we confirmed that P-1 is the intact 49-residue osteocalcin with N-terminal SNLRNAVFG., and that P-2 lacks four amino acids from the N-terminus, (NAVFG.). These results demonstrate the existence of a form of osteocalcin lacking four N-terminal amino acids in Rana bone, and that mature Rana osteocalcins remained highly conserved in their molecular evolution, especially with respect to the conservation of the C-terminal domain (residues 14-49).

  7. Assessment of a DNA vaccine encoding an anchored-glycosylphosphatidylinositol tegumental antigen complexed to protamine sulphate on immunoprotection against murine schistosomiasis

    Directory of Open Access Journals (Sweden)

    Eduardo JM Nascimento

    2007-02-01

    Full Text Available Protamine sulphate/DNA complexes have been shown to protect DNA from DNase digestion in a lipid system for gene transfer. A DNA-based vaccine complexed to protamine sulphate was used to induce an immune response against Schistosoma mansoni anchored-glycosylphosphatidylinositol tegumental antigen in BALB/c mice. The protection elicited ranged from 33 to 44%. The spectrum of the elicited immune response induced by the vaccine formulation without protamine was characterized by a high level of IgG (IgG1> IgG2a. Protamine sulphate added to the DNA vaccine formulation retained the green fluorescent protein encoding-plasmid longer in muscle and spleen. The experiments in vivo showed that under protamine sulphate effect, the scope of protection remained unchanged, but a modulation in antibody production (IgG1= IgG2a was observed.

  8. A Viral Satellite DNA Vector (TYLCCNV) for Functional Analysis of miRNAs and siRNAs in Plants.

    Science.gov (United States)

    Ju, Zheng; Cao, Dongyan; Gao, Chao; Zuo, Jinhua; Zhai, Baiqiang; Li, Shan; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong

    2017-04-01

    With experimental and bioinformatical methods, numerous small RNAs, including microRNAs (miRNAs) and short interfering RNAs (siRNAs), have been found in plants, and they play vital roles in various biological regulation processes. However, most of these small RNAs remain to be functionally characterized. Until now, only several viral vectors were developed to overexpress miRNAs with limited application in plants. In this study, we report a new small RNA overexpression system via viral satellite DNA associated with Tomato yellow leaf curl China virus (TYLCCNV) vector, which could highly overexpress not only artificial and endogenous miRNAs but also endogenous siRNAs in Nicotiana benthamiana First, we constructed basic TYLCCNV-amiRPDS(319L) vector with widely used AtMIR319a backbone, but the expected photobleaching phenotype was very weak. Second, through comparing the effect of backbones ( AtMIR319a , AtMIR390a , and SlMIR159 ) on specificity and significance of generating small RNAs, the AtMIR390a backbone was optimally selected to construct the small RNA overexpression system. Third, through sRNA-Seq and Degradome-Seq, the small RNAs from AtMIR390a backbone in TYLCCNV-amiRPDS(390) vector were confirmed to highly overexpress amiRPDS and specifically silence targeted PDS gene. Using this system, rapid functional analysis of endogenous miRNAs and siRNAs was carried out, including miR156 and athTAS3a 5'D8(+). Meanwhile, through designing corresponding artificial miRNAs, this system could also significantly silence targeted endogenous genes and show specific phenotypes, including PDS , Su , and PCNA These results demonstrated that this small RNA overexpression system could contribute to investigating not only the function of endogenous small RNAs, but also the functional genes in plants. © 2017 American Society of Plant Biologists. All Rights Reserved.

  9. Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

    International Nuclear Information System (INIS)

    Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

    1988-01-01

    A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

  10. Molecular cloning and characterization of the full-length cDNA encoding the tree shrew (tupaia belangeri) CD28

    Science.gov (United States)

    Huang, Xiaoyan; Yan, Yan; Wang, Sha; Wang, Qinying; Shi, Jian; Shao, Zhanshe; Dai, Jiejie

    2017-11-01

    CD28 is one of the most important co-stimulatory molecules expressed by naive and primed T cells. The tree shrews (Tupaia belangeri), as an ideal animal model for analyzing mechanism of human diseases receiving extensive attentions, demands essential research tools, in particular in the study of cellular markers and monoclonal antibodies for immunological studies. However, little is known about tree shrew CD28 (tsCD28) until now. In this study, a 663 bp of the full-length CD28 cDNA, encoding a polypeptide of 220 amino acids was cloned from tree shrew spleen lymphocytes. The nucleotide sequence of the tsCD28 showed 85%, 76%, and 75% similarities with human, rat, and mouse, respectively, which showed the affinity relationship between tree shrew and human is much closer than between human and rodents. The open reading frame (ORF) sequence of tsCD28 gene was predicted to be in correspondence with the signal sequence, immunoglobulin variable-like (IgV) domain, transmembrane domain and cytoplasmic tail, respectively.We also analyzed its molecular characteristics with other mammals by using biology software such as Clustal W 2.0 and so forth. Our results showed that tsCD28 contained many features conserved in CD28 genes from other mammals, including conserved signal peptide and glycosylation sites, and several residues responsible for binding to the CD28R, and the tsCD28 amino acid sequence were found a close genetic relationship with human and monkey. The crystal structure and surface charge revealed most regions of tree shrew CD28 molecule surface charges are similar as human. However, compared with human CD28 (hCD28) regions, in some areas, the surface positive charge of tsCD28 was less than hCD28, which may affect antibody binding. The present study is the first report of cloning and characterization of CD28 in tree shrew. This study provides a theoretical basis for the further study the structure and function of tree shrew CD28 and utilize tree shrew as an effective

  11. Exploring the Diversity of Plant DNA Viruses and Their Satellites Using Vector-Enabled Metagenomics on Whiteflies

    Science.gov (United States)

    Ng, Terry Fei Fan; Duffy, Siobain; Polston, Jane E.; Bixby, Elise; Vallad, Gary E.; Breitbart, Mya

    2011-01-01

    Current knowledge of plant virus diversity is biased towards agents of visible and economically important diseases. Less is known about viruses that have not caused major diseases in crops, or viruses from native vegetation, which are a reservoir of biodiversity that can contribute to viral emergence. Discovery of these plant viruses is hindered by the traditional approach of sampling individual symptomatic plants. Since many damaging plant viruses are transmitted by insect vectors, we have developed “vector-enabled metagenomics” (VEM) to investigate the diversity of plant viruses. VEM involves sampling of insect vectors (in this case, whiteflies) from plants, followed by purification of viral particles and metagenomic sequencing. The VEM approach exploits the natural ability of highly mobile adult whiteflies to integrate viruses from many plants over time and space, and leverages the capability of metagenomics for discovering novel viruses. This study utilized VEM to describe the DNA viral community from whiteflies (Bemisia tabaci) collected from two important agricultural regions in Florida, USA. VEM successfully characterized the active and abundant viruses that produce disease symptoms in crops, as well as the less abundant viruses infecting adjacent native vegetation. PCR assays designed from the metagenomic sequences enabled the complete sequencing of four novel begomovirus genome components, as well as the first discovery of plant virus satellites in North America. One of the novel begomoviruses was subsequently identified in symptomatic Chenopodium ambrosiodes from the same field site, validating VEM as an effective method for proactive monitoring of plant viruses without a priori knowledge of the pathogens. This study demonstrates the power of VEM for describing the circulating viral community in a given region, which will enhance our understanding of plant viral diversity, and facilitate emerging plant virus surveillance and management of viral

  12. Seasonality of sand flies (Diptera: Psychodidae) and Leishmania DNA detection in vector species in an area with endemic visceral leishmaniasis

    Science.gov (United States)

    Saraiva, Lara; Leite, Camila Gonçalves; Lima, Ana Cristina Vianna Mariano da Rocha; de Carvalho, Luiz Otávio Alves; Pereira, Agnes Antônia Sampaio; Rugani, Jerônimo Marteleto Nunes; Rego, Felipe Dutra; Gontijo, Célia Maria Ferreira; Andrade, José Dilermando

    2017-01-01

    BACKGROUND Leishmaniases are a serious health problem in southeast Brazil, including the city of Belo Horizonte (BH), Minas Gerais state (MG), where there are high rates of incidence and mortality due to visceral leishmaniases. BH is divided into nine sanitary districts (SD) of which one, the Venda Nova SD, was selected for this study because it has high rates of positivity for canine leishmaniasis and high incidence of human leishmaniasis. OBJECTIVES This study aimed to survey the sand fly fauna in Venda Nova SD from August 2011 to July 2013 and perform a descriptive analysis of the vector population. METHODS The sampling was carried out using automatic HP light traps at all covered areas of the Venda Nova SD, in a total of eighteen light traps. Sampled specimens were identified following Galati (2003), and females were submitted to molecular techniques for the detection and identification of Leishmania DNA. A simple environmental description was done for it area and Kernel estimation was used to infer vector density for each study site. FINDINGS A total of 2,427 sand fly specimens belonging to eight species and five genera were collected of which 95.3% were Lutzomyia longipalpis. The seasonal variation curve was delineated by this species. Lu. longipalpis was the most abundant at all collection points and in all months of the study, and exhibited a natural infection rate of 1.01% for Leishmania infantum and 1.77% for Leishmania braziliensis. MAIN CONCLUSIONS The results show the presence and adaptation of Lu. longipalpis to the anthropic environment of BH and reinforces its role as the main vector of L. infantum in the region. PMID:28327794

  13. Seasonality of sand flies (Diptera: Psychodidae) and Leishmania DNA detection in vector species in an area with endemic visceral leishmaniasis.

    Science.gov (United States)

    Saraiva, Lara; Leite, Camila Gonçalves; Lima, Ana Cristina Vianna Mariano da Rocha; Carvalho, Luiz Otávio Alves de; Pereira, Agnes Antônia Sampaio; Rugani, Jerônimo Marteleto Nunes; Rego, Felipe Dutra; Gontijo, Célia Maria Ferreira; Andrade, José Dilermando

    2017-04-01

    Leishmaniases are a serious health problem in southeast Brazil, including the city of Belo Horizonte (BH), Minas Gerais state (MG), where there are high rates of incidence and mortality due to visceral leishmaniases. BH is divided into nine sanitary districts (SD) of which one, the Venda Nova SD, was selected for this study because it has high rates of positivity for canine leishmaniasis and high incidence of human leishmaniasis. This study aimed to survey the sand fly fauna in Venda Nova SD from August 2011 to July 2013 and perform a descriptive analysis of the vector population. The sampling was carried out using automatic HP light traps at all covered areas of the Venda Nova SD, in a total of eighteen light traps. Sampled specimens were identified following Galati (2003), and females were submitted to molecular techniques for the detection and identification of Leishmania DNA. A simple environmental description was done for it area and Kernel estimation was used to infer vector density for each study site. A total of 2,427 sand fly specimens belonging to eight species and five genera were collected of which 95.3% were Lutzomyia longipalpis. The seasonal variation curve was delineated by this species. Lu. longipalpis was the most abundant at all collection points and in all months of the study, and exhibited a natural infection rate of 1.01% for Leishmania infantum and 1.77% for Leishmania braziliensis. The results show the presence and adaptation of Lu. longipalpis to the anthropic environment of BH and reinforces its role as the main vector of L. infantum in the region.

  14. Is passive transmission of non-viral vectors through artificial insemination of sperm-DNA mixtures sufficient for chicken transgenesis?

    Science.gov (United States)

    Chaparian, Shahram; Abdulahnejad, Ahad; Rashidi, Farzad; Toghyani, Majid; Gheisari, Abbasali; Eghbalsaied, Shahin

    2016-06-17

    DNA uptake in the post-acrosomal region of the spermatozoa takes place exclusively in immotile spermatozoa that are naturally unable to fertilize eggs. The present study aimed to assess whether passive transmission of non-viral vectors to the surrounding areas of chicken embryos could be an alternate mechanism in chicken sperm-mediated gene transfer. First, the presence of nucleases in rooster seminal plasma was evaluated. Semen ejaculates from five roosters were centrifuged and the supernatant was incubated with pBL2 for 1 h. A robust nuclease cocktail was detected in the rooster semen. To overcome these nucleases, plasmid-TransIT combinations were incubated with semen for 1 h. Incubation of exogenous DNA in the lipoplex structure could considerably bypass the semen nuclease effect. Then, intravaginal insemination of 1 × 10(9) sperm mixed with lipoplexes (40 µg pBL2:40 µl TransIT) was carried out in 15 virgin hens. Neither the epithelial tissue from the inseminated female reproductive tracts nor the produced embryos following artificial insemination showed the transgene. To remove any bias in the transgene transmission possibility, the plasmid-TransIT admixture was directly injected in close vicinity of the embryos in newly laid eggs. Nonetheless, none of the produced fetuses or chicks carried the transgene. In conclusion, the results of the present study revealed a nuclease admixture in rooster seminal plasma, and passive/active transmission of the non-viral vector into close vicinity of the chicken embryo was inefficient for producing transgenic chicks.

  15. Is passive transmission of non-viral vectors through artificial insemination of sperm-DNA mixtures sufficient for chicken transgenesis?

    Science.gov (United States)

    CHAPARIAN, Shahram; ABDULAHNEJAD, Ahad; RASHIDI, Farzad; TOGHYANI, Majid; GHEISARI, Abbasali; EGHBALSAIED, Shahin

    2016-01-01

    DNA uptake in the post-acrosomal region of the spermatozoa takes place exclusively in immotile spermatozoa that are naturally unable to fertilize eggs. The present study aimed to assess whether passive transmission of non-viral vectors to the surrounding areas of chicken embryos could be an alternate mechanism in chicken sperm-mediated gene transfer. First, the presence of nucleases in rooster seminal plasma was evaluated. Semen ejaculates from five roosters were centrifuged and the supernatant was incubated with pBL2 for 1 h. A robust nuclease cocktail was detected in the rooster semen. To overcome these nucleases, plasmid-TransIT combinations were incubated with semen for 1 h. Incubation of exogenous DNA in the lipoplex structure could considerably bypass the semen nuclease effect. Then, intravaginal insemination of 1 × 109 sperm mixed with lipoplexes (40 µg pBL2:40 µl TransIT) was carried out in 15 virgin hens. Neither the epithelial tissue from the inseminated female reproductive tracts nor the produced embryos following artificial insemination showed the transgene. To remove any bias in the transgene transmission possibility, the plasmid-TransIT admixture was directly injected in close vicinity of the embryos in newly laid eggs. Nonetheless, none of the produced fetuses or chicks carried the transgene. In conclusion, the results of the present study revealed a nuclease admixture in rooster seminal plasma, and passive/active transmission of the non-viral vector into close vicinity of the chicken embryo was inefficient for producing transgenic chicks. PMID:26935324

  16. The Alterations in Mitochondrial DNA Copy Number and Nuclear-Encoded Mitochondrial Genes in Rat Brain Structures after Cocaine Self-Administration.

    Science.gov (United States)

    Sadakierska-Chudy, Anna; Kotarska, Agnieszka; Frankowska, Małgorzata; Jastrzębska, Joanna; Wydra, Karolina; Miszkiel, Joanna; Przegaliński, Edmund; Filip, Małgorzata

    2017-11-01

    The repeated intake of cocaine evokes oxidative stress that is present even during drug withdrawal. Recent studies demonstrate that cocaine-induced oxidative and/or endoplasmic reticulum stress can affect mitochondrial function and dynamics as well as the expression of mitochondrial and nuclear genes. These alterations in mitochondrial function may determine synaptic and behavioral plasticity. Mitochondria and mitochondrial DNA (mtDNA) seem to play an important role in the initiation of drug addiction. We used a microarray approach to investigate the expression patterns of nuclear-encoded genes relevant for mitochondrial functions and quantitative real-time PCR assays to determine the numbers of copies of mtDNA and of mRNAs corresponding to two mitochondrial proteins in the prefrontal cortex and hippocampus of rats during early cocaine abstinence. We found a significant elevation in the copy number of mtDNA and concomitant increased expression of mitochondrial genes. Moreover, microarray analysis revealed changes in the transcription of nuclear genes engaged in mtDNA replication, nucleoid formation, the oxidative phosphorylation pathway, and mitochondrial fission and fusion. Finally, we observed the upregulation of endoplasmic reticulum stress-induced genes. Cocaine self-administration influences the expression of both nuclear and mitochondrial genes as well as mtDNA replication. To determine whether these alterations serve as compensatory mechanisms to help maintain normal level of ATP production, further studies are necessary.

  17. Increasing versatility of the DNA vaccines through modification of the subcellular location of plasmid-encoded antigen expression in the in vivo transfected cells.

    Directory of Open Access Journals (Sweden)

    Alicia Martinez-Lopez

    Full Text Available The route of administration of DNA vaccines can play a key role in the magnitude and quality of the immune response triggered after their administration. DNA vaccines containing the gene of the membrane-anchored glycoprotein (gpG of the fish rhabdoviruses infectious haematopoietic necrosis virus (IHNV or viral haematopoietic septicaemia virus (VHSV, perhaps the most effective DNA vaccines generated so far, confer maximum protection when injected intramuscularly in contrast to their low efficacy when injected intraperitoneally. In this work, taking as a model the DNA vaccine against VHSV, we focused on developing a more versatile DNA vaccine capable of inducing protective immunity regardless of the administration route used. For that, we designed two alternative constructs to gpG₁₋₅₀₇ (the wild type membrane-anchored gpG of VHSV encoding either a soluble (gpG₁₋₄₆₂ or a secreted soluble (gpG(LmPle20-462 form of the VHSV-gpG. In vivo immunisation/challenge assays showed that only gpG(LmPle20-462 (the secreted soluble form conferred protective immunity against VHSV lethal challenge via both intramuscular and intraperitoneal injection, being this the first description of a fish viral DNA vaccine that confers protection when administered intraperitoneally. Moreover, this new DNA vaccine construct also conferred protection when administered in the presence of an oil adjuvant suggesting that DNA vaccines against rhabdoviruses could be included in the formulation of current multicomponent-intaperitoneally injectable fish vaccines formulated with an oil adjuvant. On the other hand, a strong recruitment of membrane immunoglobulin expressing B cells, mainly membrane IgT, as well as t-bet expressing T cells, at early times post-immunisation, was specifically observed in the fish immunised with the secreted soluble form of the VHSV-gpG protein; this may indicate that the subcellular location of plasmid-encoded antigen expression in the in

  18. Construction and Immunogenicity of DNA Vaccines Encoding Fusion Protein of Porcine IFN-λ1 and GP5 Gene of Porcine Reproductive and Respiratory Syndrome Virus

    Directory of Open Access Journals (Sweden)

    Luping Du

    2013-01-01

    Full Text Available Porcine reproductive and respiratory syndrome virus (PRRSV has been mainly responsible for the catastrophic economic losses in pig industry worldwide. The commercial vaccines only provide a limited protection against PRRSV infection. Thus, the focus and direction is to develop safer and more effective vaccines in the research field of PRRS. The immune modulators are being considered to enhance the effectiveness of PRRSV vaccines. IFN-λ1 belongs to type III interferon, a new interferon family. IFN-λ1 is an important cytokine with multiple functions in innate and acquired immunity. In this study, porcine IFN-λ1 (PoIFN-λ1 was evaluated for its adjuvant effects on the immunity of a DNA vaccine carrying the GP5 gene of PRRSV. Groups of mice were immunized twice at 2-week interval with 100 μg of the plasmid DNA vaccine pcDNA3.1-SynORF5, pcDNA3.1-PoIFN-λ1-SynORF5, and the blank vector pcDNA3.1, respectively. The results showed that pcDNA3.1-PoIFN-λ1-SynORF5 can significantly enhance GP5-specific ELISA antibody, PRRSV-specific neutralizing antibody, IFN-γ level, and lymphocyte proliferation ratherthan the responses induced by pcDNA3.1-SynORF5. Therefore, type III interferon PoIFN-λ1 could enhance the immune responses of DNA vaccine of PRRSV, highlighting the potential value of PoIFN-λ1 as a molecular adjuvant in the prevention of PRRSV infection.

  19. Cloning vector

    Science.gov (United States)

    Guilfoyle, R.A.; Smith, L.M.

    1994-12-27

    A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site. 2 figures.

  20. Cloning vector

    Science.gov (United States)

    Guilfoyle, Richard A.; Smith, Lloyd M.

    1994-01-01

    A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site.

  1. Enhanced anti-tumor effect of a gene gun-delivered DNA vaccine encoding the human papillomavirus type 16 oncoproteins genetically fused to the herpes simplex virus glycoprotein D

    Directory of Open Access Journals (Sweden)

    M.O. Diniz

    2011-05-01

    Full Text Available Anti-cancer DNA vaccines have attracted growing interest as a simple and non-invasive method for both the treatment and prevention of tumors induced by human papillomaviruses. Nonetheless, the low immunogenicity of parenterally administered vaccines, particularly regarding the activation of cytotoxic CD8+ T cell responses, suggests that further improvements in both vaccine composition and administration routes are still required. In the present study, we report the immune responses and anti-tumor effects of a DNA vaccine (pgD-E7E6E5 expressing three proteins (E7, E6, and E5 of the human papillomavirus type 16 genetically fused to the glycoprotein D of the human herpes simplex virus type 1, which was administered to mice by the intradermal (id route using a gene gun. A single id dose of pgD-E7E6E5 (2 µg/dose induced a strong activation of E7-specific interferon-γ (INF-γ-producing CD8+ T cells and full prophylactic anti-tumor effects in the vaccinated mice. Three vaccine doses inhibited tumor growth in 70% of the mice with established tumors. In addition, a single vaccine dose consisting of the co-administration of pgD-E7E6E5 and the vector encoding interleukin-12 or granulocyte-macrophage colony-stimulating factor further enhanced the therapeutic anti-tumor effects and conferred protection to 60 and 50% of the vaccinated mice, respectively. In conclusion, id administration of pgD-E7E6E5 significantly enhanced the immunogenicity and anti-tumor effects of the DNA vaccine, representing a promising administration route for future clinical trials.

  2. Molecular cloning of the cDNA encoding aspartate aminotransferase from bean root nodules and determination of its role in nodule nitrogen metabolism.

    Science.gov (United States)

    Silvente, Sonia; Camas, Alberto; Lara, Miguel

    2003-06-01

    A cDNA clone encoding aspartate aminotransferase (PVAAT-2) (EC 2.6.1.1) was isolated from the common bean Phaseolus vulgaris nodule cDNA library. The nucleotide sequence analysis of the full-length cDNA allowed its identification by comparison with sequence databases. The amino acid sequence of the bean PvAAT-2 showed high similarity with the AAT-2 isoforms described in other leguminous plants. The amino-terminal region of the PvAAT-2 contains a sequence, which shares common features of plastid transit peptides. Southern blot analysis showed that the PvAAT-2 clone is encoded by a single gene in the P. vulgaris genome. Analysis of the PvAAT-2 mRNA levels suggests that the expression of this gene is nodule enhanced. The PvAAT-2 transcript is more abundant in nodules with increased synthesis of amides and is down-regulated in conditions where ureides accumulate. When plants were supplemented with ureides or with amides, PvAAT-2 expression was reduced, while it was not affected when plants were treated with allopurinol, an inhibitor of ureide synthesis. On the other hand, the expression of asparagine synthetase (another enzyme involved in the synthesis of amides) is not affected either by ureides or amides. These data suggest a role for AAT-2 in the mechanism involved in the synthesis of nitrogen compounds in bean nodules.

  3. Transfection of Infectious RNA and DNA/RNA Layered Vectors of Semliki Forest Virus by the Cell-Penetrating Peptide Based Reagent PepFect6

    Science.gov (United States)

    Pärn, Kalle; Viru, Liane; Lehto, Taavi; Oskolkov, Nikita; Langel, Ülo; Merits, Andres

    2013-01-01

    Viral vectors have a wide variety of applications ranging from fundamental studies of viruses to therapeutics. Recombinant viral vectors are usually constructed using methods of reverse genetics to obtain the genetic material of the viral vector. The physicochemical properties of DNA and RNA make them unable to access cells by themselves, and they require assistance to achieve intracellular delivery. Non-viral delivery vectors can be used for this purpose if they enable efficient intracellular delivery without interfering with the viral life cycle. In this report, we utilize Semliki Forest virus (genus alphavirus) based RNA and DNA vectors to study the transfection efficiency of the non-viral cell-penetrating peptide-based delivery vector PepFect6 in comparison with that of the cationic liposome-based Lipofectamine 2000, and assess their impact on viral replication. The optimal conditions for transfection were determined for both reagents. These results demonstrate, for the first time, the ability of PepFect6 to transport large (13-19 kbp) constructs across the cell membrane. Curiously, DNA molecules delivered using the PepFect6 reagent were found to be transported to the cell nucleus approximately 1.5 hours later than DNA molecules delivered using the Lipofectamine 2000 reagent. Finally, although both PepFect6 and Lipofectamine 2000 reagents can be used for alphavirus research, PepFect6 is preferred because it does not induce changes in the normal cellular phenotype and it does not affect the normal replication-infection cycle of viruses in previously transfected cells. PMID:23861978

  4. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  5. A genetic determinant in Streptococcus gordonii Challis encodes a peptide with activity similar to that of enterococcal sex pheromone cAM373, which facilitates intergeneric DNA transfer.

    Science.gov (United States)

    Vickerman, M M; Flannagan, S E; Jesionowski, A M; Brossard, K A; Clewell, D B; Sedgley, C M

    2010-05-01

    Enterococcus faecalis strains secrete multiple peptides representing different sex pheromones that induce mating responses by bacteria carrying specific conjugative plasmids. The pheromone cAM373, which induces a response by the enterococcal plasmid pAM373, has been of interest because a similar activity is also secreted by Streptococcus gordonii and Staphylococcus aureus. The potential to facilitate intergeneric DNA transfer from E. faecalis is of concern because of extensive multiple antibiotic resistance, including vancomycin resistance, that has emerged among enterococci in recent years. Here, we characterize the related pheromone determinant in S. gordonii and show that the peptide it encodes, gordonii-cAM373, does indeed induce transfer of plasmid DNA from E. faecalis into S. gordonii. The streptococcal determinant camG encodes a lipoprotein with a leader sequence, the last 7 residues of which represent the gordonii-cAM373 heptapeptide SVFILAA. Synthetic forms of the peptide had activity similar to that of the enterococcal cAM373 AIFILAS. The lipoprotein moiety bore no resemblance to the lipoprotein encoded by E. faecalis. We also identified determinants in S. gordonii encoding a signal peptidase and an Eep-like zinc metalloprotease (lspA and eep, respectively) similar to those involved in processing certain pheromone precursors in E. faecalis. Mutations generated in camG, lspA, and eep each resulted in the ablation of gordonii-cAM373 activity in culture supernatants. This is the first genetic analysis of a potential sex pheromone system in a commensal oral streptococcal species, which may have implications for intergeneric gene acquisition in oral biofilms.

  6. Immunization strategies against visceral leishmaniosis with the nucleosomal histones of Leishmania infantum encoded in DNA vaccine or pulsed in dendritic cells.

    Science.gov (United States)

    Carrión, Javier; Folgueira, Cristina; Alonso, Carlos

    2008-05-12

    Immunization of BALB/c mice with a DNA vaccine encoding the nucleosomal histones from Leishmania infantum resulted in a complete failure of protection against visceral leishmaniosis (VL), whereas the adoptive transfer of bone marrow-derived dendritic cells pulsed with the same pathoantigens plays an essential role in controlling parasite growth in half of the cases. Reduction of the visceral parasite burden seems to be related to low persistence of regulatory T-cells in the spleen from vaccinated mice. These results provide clues for the optimization of this vaccine strategy with the four Leishmania nucleosomal histones against L. infantum infection.

  7. Isolation of cDNA encoding a newly identified major allergenic protein of rye-grass pollen: intracellular targeting to the amyloplast.

    OpenAIRE

    Singh, M B; Hough, T; Theerakulpisut, P; Avjioglu, A; Davies, S; Smith, P M; Taylor, P; Simpson, R J; Ward, L D; McCluskey, J

    1991-01-01

    We have identified a major allergenic protein from rye-grass pollen, tentatively designated Lol pIb of 31kDa and with pI 9.0. A cDNA clone encoding Lol pIb has been isolated, sequenced, and characterized. Lol pIb is located mainly in the starch granules. This is a distinct allergen from Lol pI, which is located in the cytosol. Lol pIb is synthesized in pollen as a pre-allergen with a transit peptide targeting the allergen to amyloplasts. Epitope mapping of the fusion protein localized the IgE...

  8. Safety profile, efficacy, and biodistribution of a bicistronic high-capacity adenovirus vector encoding a combined immunostimulation and cytotoxic gene therapy as a prelude to a phase I clinical trial for glioblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Puntel, Mariana [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Ghulam, Muhammad A.K.M. [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Farrokhi, Catherine [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); VanderVeen, Nathan; Paran, Christopher; Appelhans, Ashley [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Kroeger, Kurt M.; Salem, Alireza [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Lacayo, Liliana [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Pechnick, Robert N. [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Department of Psychiatry and Behavioral Neurosciences, David Geffen School of Medicine, University of California, Los Angeles, CA (United States); Kelson, Kyle R.; Kaur, Sukhpreet; Kennedy, Sean [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Palmer, Donna; Ng, Philip [Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030 (United States); and others

    2013-05-01

    Adenoviral vectors (Ads) are promising gene delivery vehicles due to their high transduction efficiency; however, their clinical usefulness has been hampered by their immunogenicity and the presence of anti-Ad immunity in humans. We reported the efficacy of a gene therapy approach for glioma consisting of intratumoral injection of Ads encoding conditionally cytotoxic herpes simplex type 1 thymidine kinase (Ad-TK) and the immunostimulatory cytokine fms-like tyrosine kinase ligand 3 (Ad-Flt3L). Herein, we report the biodistribution, efficacy, and neurological and systemic effects of a bicistronic high-capacity Ad, i.e., HC-Ad-TK/TetOn-Flt3L. HC-Ads elicit sustained transgene expression, even in the presence of anti-Ad immunity, and can encode large therapeutic cassettes, including regulatory elements to enable turning gene expression “on” or “off” according to clinical need. The inclusion of two therapeutic transgenes within a single vector enables a reduction of the total vector load without adversely impacting efficacy. Because clinically the vectors will be delivered into the surgical cavity, normal regions of the brain parenchyma are likely to be transduced. Thus, we assessed any potential toxicities elicited by escalating doses of HC-Ad-TK/TetOn-Flt3L (1 × 10{sup 8}, 1 × 10{sup 9}, or 1 × 10{sup 10} viral particles [vp]) delivered into the rat brain parenchyma. We assessed neuropathology, biodistribution, transgene expression, systemic toxicity, and behavioral impact at acute and chronic time points. The results indicate that doses up to 1 × 10{sup 9} vp of HC-Ad-TK/TetOn-Flt3L can be safely delivered into the normal rat brain and underpin further developments for its implementation in a phase I clinical trial for glioma. - Highlights: ► High capacity Ad vectors elicit sustained therapeutic gene expression in the brain. ► HC-Ad-TK/TetOn-Flt3L encodes two therapeutic genes and a transcriptional switch. ► We performed a dose escalation study at

  9. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  10. Transformation of the Methylotrophic Actinomycete Amycolatopis methanolica with Plasmid DNA : Stimulatory Effect of a pMEA300-Encoded Gene

    NARCIS (Netherlands)

    Vrijbloed, J.W.; Madoń, J.; Dijkhuizen, L.

    Amycolatopsis methanolica contains a 13.29-kb plasmid (pMEA300) present both in the free state and integrated at a unique genomic location. A pMEA300-free derivative (strain WV1) was selected, allowing further analysis of pMEA300-encoded functions. Whole cells of strain WV1 could be transformed at

  11. Full-length transcriptome analysis using a bias-free cDNA library prepared with the vector-capping method.

    Science.gov (United States)

    Kato, Seishi; Oshikawa, Mio; Ohtoko, Kuniyo

    2011-01-01

    Full-length complementary DNAs (cDNAs) are an essential resource for functional genomics. Recently, we have developed a simple and efficient method for preparing a full-length cDNA library from a small amount of total RNA, named the "vector-capping" method. The biggest advantage of this method is that the intactness of the cDNA can be assured by the presence of dG at the 5' end of the full-length cDNA. Furthermore, the cDNA library represents the mRNA population in the cell owing to a bias-free procedure. In this chapter, we describe not only the protocol for preparing the library but also the points for analyzing the 5'-end sequence of the obtained cDNA.

  12. Induction of cytotoxic T-cell responses by gene gun DNA vaccination with minigenes encoding influenza A virus HA and NP CTL-epitopes

    DEFF Research Database (Denmark)

    Fomsgaard, A; Nielsen, H V; Kirkby, N

    1999-01-01

    Cytotoxic T-lymphocyte (CTL) response is an important component of anti-viral immunity. CTLs are specific to short peptides presented by MHC-I molecules and immunisation with the exact peptide sequence introduced in the cytosol is therefore a minimal approach, which potentially affords a high...... degree of controllability. We have examined the induction of murine CTL's by this approach using DNA plasmid minigene vaccines encoding known mouse K(k) minimal CTL epitopes (8 amino acids) from the influenza A virus hemagglutinin and nucleoprotein. We here report that such an approach is feasible......'. This did not improve CTL induction. In another version, one CTL epitope was inserted into a known T-helper protein (HBsAg). This did significantly augment the response probably due to immunological help from HBsAg Th epitopes. Finally, the CTL inducing minigene DNA vaccines were compared with Flu...

  13. Cloning of a cDNA that encodes farnesyl diphosphate synthase and the blue-light-induced expression of the corresponding gene in the leaves of rice plants.

    Science.gov (United States)

    Sanmiya, K; Iwasaki, T; Matsuoka, M; Miyao, M; Yamamoto, N

    1997-02-28

    A cDNA encoding farnesyl diphosphate synthase (FPPS), a key enzyme in isoprenoid biosynthesis, was isolated from a cDNA library constructed from mRNA that had been prepared from etiolated rice (Oriza sativa L. variety Nipponbare) seedlings after three hours of illumination by a subtraction method. The putative polypeptide deduced from the 1289 bp nucleotide sequence consisted of 353 amino acids and had a molecular mass of 40 676 Da. The predicted amino acid sequence exhibited high homology to those of FPPS from Arabidopsis (73% to type 1, 72% to type 2) and white lupin (74%). Southern blot analysis showed that the rice genome might contain only one gene for FPPS. The highest level of expression of the gene was demonstrated in leaves by RNA blot analysis. Moreover, light, in particular blue light, effectively enhanced expression of the gene.

  14. Methods for rapid and effective PCR-based detection of 'Candidatus Liberibacter solanacearum' from the insect vector Bactericera cockerelli: streamlining the DNA extraction/purification process.

    Science.gov (United States)

    Lévy, Julien; Hancock, Joseph; Ravindran, Aravind; Gross, Dennis; Tamborindeguy, Cecilia; Pierson, Elizabeth

    2013-06-01

    This study provides a protocol for rapid DNA isolation from psyllid vectors (Bactericera cockerelli and Diaphorina citri) that can be used directly with DNA-based methods for the detection of 'Candidatus (Ca.) Liberibacter solanacearum,' the bacterial causal agent of potato zebra chip disease and eventually for 'Ca. Liberibacter asiaticus' the causal agent of huanglongbing disease in citrus. The fast DNA extraction protocol was designed to work with conventional polymerase chain reaction (cPCR) DNA amplification as well as Loop mediated PCR DNA amplification. Direct cPCR of the psyllid 28S rDNA gene from samples prepared using the fast DNA extraction method was as reliable as from samples prepared using standard DNA purification (> 97% from live insects) as tested in B. cockerelli. However, samples prepared using the fast DNA extraction method had to be diluted 1:100 in sterile water for reliable amplification, presumably to dilute PCR inhibitors in the crude extract. Similarly, both cPCR and loop mediated PCR DNA amplification detected 'Ca. Liberibacter' in psyllids infected with either the zebra chip or huanglongbing pathogen equally well from diluted samples prepared using the fast DNA extraction method or from samples prepared using a DNA purification step. In addition to being reliable, the time required to complete the fast DNA extraction for 10 samples was on average approximately 5 min and required no special reagents or laboratory equipment. Thus, the fast DNA extraction method shows strong promise as a rapid, reliable, and expedient method when coupled with PCR-based analyses for detection of 'Ca. Liberibacter' pathogens in psyllids.

  15. Immunization with a DNA vaccine encoding Toxoplasma gondii Superoxide dismutase (TgSOD) induces partial immune protection against acute toxoplasmosis in BALB/c mice.

    Science.gov (United States)

    Liu, Yuan; Cao, Aiping; Li, Yawen; Li, Xun; Cong, Hua; He, Shenyi; Zhou, Huaiyu

    2017-06-07

    Toxoplasma gondii (T. gondii) is an obligate intracellular protozoan parasite that infects all warm-blooded animals including humans and causes toxoplasmosis. An effective vaccine could be an ideal choice for preventing and controlling toxoplasmosis. T. gondii Superoxide dismutase (TgSOD) might participate in affecting the intracellular growth of both bradyzoite and tachyzoite forms. In the present study, the TgSOD gene was used to construct a DNA vaccine (pEGFP-SOD). TgSOD gene was amplified and inserted into eukaryotic vector pEGFP-C1 and formed the DNA vaccine pEGFP-SOD. Then the BALB/c mice were immunized intramuscularly with the DNA vaccine and those injected with pEGFP-C1, PBS or nothing were treated as controls. Four weeks after the last immunization, all mouse groups followed by challenging intraperitoneally with tachyzoites of T. gondii ME49 strain. Results showed higher levels of total IgG, IgG2α in the sera and interferon gamma (IFN-γ) in the splenocytes from pEGFP-SOD inoculated mice than those unvaccinated, or inoculated with either empty plasmid vector or PBS. The proportions of CD4 + T cells and CD8 + T cells in the spleen from pEGFP-SOD inoculated mice were significantly (p < 0.05) increased compared to control groups. In addition, the survival time of mice immunized with pEGFP-SOD was significantly prolonged as compared to the controls (p < 0.05) although all the mice died. The present study revealed that the DNA vaccine triggered strong humoral and cellular immune responses, and aroused partial protective immunity against acute T. gondii infection in BALB/c mice. The collective data suggests the SOD may be a potential vaccine candidate for further development.

  16. Molecular cloning of the cDNA encoding follicle-stimulating hormone beta subunit of the Chinese soft-shell turtle Pelodiscus sinensis, and its gene expression.

    Science.gov (United States)

    Chien, Jung-Tsun; Shen, San-Tai; Lin, Yao-Sung; Yu, John Yuh-Lin

    2005-04-01

    Follicle-stimulating hormone (FSH) is a member of the pituitary glycoprotein hormone family. These hormones are composed of two dissimilar subunits, alpha and beta. Very little information is available regarding the nucleotide and amino acid sequence of FSHbeta in reptilian species. For better understanding of the phylogenetic diversity and evolution of FSH molecule, we have isolated and sequenced the complementary DNA (cDNA) encoding the Chinese soft-shell turtle (Pelodiscus sinensis, Family of Trionychidae) FSHbeta precursor molecule by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end (RACE) methods. The cloned Chinese soft-shell turtle FSHbeta cDNA consists of 602-bp nucleotides, including 34-bp nucleotides of the 5'-untranslated region (UTR), 396-bp of the open reading frame, and 3'-UTR of 206-bp nucleotides. It encodes a 131-amino acid precursor molecule of FSHbeta subunit with a signal peptide of 20 amino acids followed by a mature protein of 111 amino acids. Twelve cysteine residues, forming six disulfide bonds within beta-subunit and two putative asparagine-linked glycosylation sites, are also conserved in the Chinese soft-shell turtle FSHbeta subunit. The deduced amino acid sequence of the Chinese soft-shell turtle FSHbeta shares identities of 97% with Reeves's turtle (Family of Bataguridae), 83-89% with birds, 61-70% with mammals, 63-66% with amphibians and 40-58% with fish. By contrast, when comparing the FSHbeta with the beta-subunits of the Chinese soft-shell turtle luteinizing hormone and thyroid stimulating hormone, the homologies are as low as 38 and 39%, respectively. A phylogenetic tree including reptilian species of FSHbeta subunits, is presented for the first time. Out of various tissues examined, FSHbeta mRNA was only expressed in the pituitary gland and can be up-regulated by gonadotropin-releasing hormone in pituitary tissue culture as estimated by fluorescence real-time PCR analysis.

  17. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Energy Technology Data Exchange (ETDEWEB)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  18. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    International Nuclear Information System (INIS)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-01-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  19. Safety and efficacy of a xenogeneic DNA vaccine encoding for human tyrosinase as adjunctive treatment for oral malignant melanoma in dogs following surgical excision of the primary tumor.

    Science.gov (United States)

    Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D

    2011-12-01

    To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.

  20. Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

    International Nuclear Information System (INIS)

    Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo

    1988-01-01

    Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged

  1. Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy

    International Nuclear Information System (INIS)

    Mangin, M.; Webb, A.C.; Dreyer, B.E.

    1988-01-01

    Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12

  2. Nucleotide sequence of the cDNA encoding the precursor of the beta subunit of rat lutropin.

    OpenAIRE

    Chin, W W; Godine, J E; Klein, D R; Chang, A S; Tan, L K; Habener, J F

    1983-01-01

    We have determined the nucleotide sequences of cDNAs encoding the precursor of the beta subunit of rat lutropin, a polypeptide hormone that regulates gonadal function, including the development of gametes and the production of steroid sex hormones. The cDNAs were prepared from poly(A)+ RNA derived from the pituitary glands of rats 4 weeks after ovariectomy and were cloned in bacterial plasmids. Bacterial colonies containing transfected plasmids were screened by hybridization with a 32P-labele...

  3. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen

    2009-10-01

    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  4. α/sub i/-3 cDNA encodes the α subunit of G/sub k/, the stimulatory G protein of receptor-regulated K+ channels

    International Nuclear Information System (INIS)

    Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

    1988-01-01

    cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed

  5. Rapid Construction of Complex Plant RNA Virus Infectious cDNA Clones for Agroinfection Using a Yeast-E. coli-Agrobacterium Shuttle Vector.

    Science.gov (United States)

    Sun, Kai; Zhao, Danyang; Liu, Yong; Huang, Changjun; Zhang, Wei; Li, Zhenghe

    2017-11-07

    The availability of infectious full-length clone is indispensable for reverse genetics studies of virus biology, pathology and construction of viral vectors. However, for RNA viruses with large genome sizes or those exhibiting inherent cloning difficulties, procedure to generate biologically active circular DNA (cDNA) clones can be time-consuming or technically challenging. Here we have constructed a yeast- Escherichia coli - Agrobacterium shuttle vector that enables highly efficient homologous recombination in yeast for assembly of Agrobacterium compatible plant virus clones. Using this vector, we show that infectious cDNA clones of a plant negative-stranded RNA virus, sonchus yellow net rhabdovirus, can be rapidly assembled. In addition, one-step assembly of infectious clones of potato virus Y in yeast, either with or without intron, was readily achieved from as many as eight overlapping DNA fragments. More importantly, the recovered yeast plasmids can be transformed directly into Agrobacterium for inoculation, thereby obviating the E. coli cloning steps and associated toxicity issues. This method is rapid, highly efficient and cost-effective and should be readily applicable to a broad range of plant viruses.

  6. Validation of the use of an artificial mitochondrial reporter DNA vector containing a Cytomegalovirus promoter for mitochondrial transgene expression.

    Science.gov (United States)

    Yamada, Yuma; Ishikawa, Takuya; Harashima, Hideyoshi

    2017-08-01

    Mitochondria have their own gene expression system that is independent of the nuclear system, and control cellular functions in cooperation with the nucleus. While a number of useful technologies for achieving nuclear transgene expression have been reported, only a few have focused on mitochondria. In this study, we validated the utility of an artificial mitochondrial DNA vector with a virus promoter on mitochondrial transgene expression. We designed and constructed pCMV-mtLuc (CGG) that contains a CMV promotor derived from Cytomegalovirus and an artificial mitochondrial genome with a NanoLuc (Nluc) luciferase gene that records adjustments to the mitochondrial codon system. Nluc luciferase activity measurements showed that the pCMV-mtLuc (CGG) efficiently produced the Nluc luciferase protein in human HeLa cells. Moreover, we optimized the mitochondrial transfection of pCMV-mtLuc (CGG) using a MITO-Porter system, a liposome-based carrier for mitochondrial delivery via membrane fusion. As a result, we found that transfection of pCMV-mtLuc (CGG) by MITO-Porter modified with the KALA peptide (cationic amphipathic cell-penetrating peptide) showed a high mitochondrial transgene expression. The developed mitochondrial transgene expression system represents a potentially useful tool for the fields of nanoscience and nanotechnology for controlling the intracellular microenvironment via the regulation of mitochondrial function and promises to open additional innovative research fields of study. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Molecular characterization of a cDNA encoding vitellogenin in the banana shrimp, Penaeus (Litopenaeus) merguiensis and sites of vitellogenin mRNA expression.

    Science.gov (United States)

    Phiriyangkul, Pharima; Utarabhand, Prapaporn

    2006-04-01

    In order to determine the primary structure of banana shrimp, Penaeus merguiensis, vitellogenin (Vg), we previously purified vitellin (Vt) from the ovaries of vitellogenic females, and chemically analyzed the N-terminal amino acid sequence of its 78 kDa subunit. In this study, a cDNA from this species encoding Vg was cloned based on the N-terminal amino acid sequence of the major 78 kDa subunit of Vt and conserved sequences of Vg/Vt from other crustacean species. The complete nucleotide sequence of Vg cDNA was achieved by RT-PCR and 5' and 3' rapid amplification of cDNA ends (RACE) approaches. The full-length Vg cDNA consisted of 7,961 nucleotides. The open reading frame of this cDNA encoding a precursor peptide was comprised of 2,586 amino acid residues, with a putative processing site, R-X-K/R-R, recognized by subtilisin-like endoproteases. The deduced amino acid sequence was obtained from the Vg cDNA and its amino acid composition showed a high similarity to that of purified Vt. The deduced primary structure, of P. merguiensis Vg was 91.4% identical to the Vg of Penaeus semisulcatus and was also related to the Vg sequences of six other crustacean species with identities that ranged from 86.9% to 36.6%. In addition, the amino acid sequences corresponding to the signal peptide, N-terminal region and C-terminal region of P. merguiensis Vg were almost identical to the same sequences of the seven other reported crustacean species. Results from RT-PCR analysis showed that Vg mRNA expression was present in both the ovary and hepatopancreas of vitellogenic females but was not detected in other tissues including muscle, heart, and intestine of females or in the hepatopancreas of mature males. These results indicate that the Vg gene may be expressed only by mature P. merguiensis females and that both the ovary and hepatopancreas are possible sites for Vg synthesis in this species of shrimp. Copyright 2006 Wiley-Liss, Inc.

  8. Protective immunity against acute toxoplasmosis in BALB/c mice induced by a DNA vaccine encoding Toxoplasma gondii elongation factor 1-alpha.

    Science.gov (United States)

    Wang, Shuai; Wang, YuJian; Sun, XiaoNi; Zhang, ZhenChao; Liu, TingQi; Gadahi, Javaid Ali; Hassan, Ibrahim Adam; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai; Li, XiangRui

    2015-10-24

    Toxoplasma gondii can infect almost all warm-blood animals including human beings. The high incidence and severe damage that can be caused by T. gondii infection clearly indicates the need for the development of a vaccine. T. gondii elongation factor 1-alpha (TgEF-1α) plays an important role in pathogenesis and host cell invasion for this parasite. The aim of this study was to evaluate the immune protective efficacy of a DNA vaccine encoding TgEF-1α gene against acute T. gondii infection in mice. A DNA vaccine (pVAX-EF-1α) encoding T. gondii EF-1a (TgEF-1α) gene was constructed and its immune response and protective efficacy against lethal challenge in BALB/c mice were evaluated. Mice inoculated with the pVAX-EF-1α vaccine had a high level of specific anti-T. gondii antibodies and produced high levels of IFN-gamma, interleukin (IL)-4, and IL-17. The expression levels of MHC-I and MHC-II molecules as well as the percentages of both CD4(+) and CD8(+) T cells in mice vaccinated with pVAX-EF-1α were significantly increased (p control groups (blank control, PBS, and pVAXI). Immunization with pVAX-EF-1α significantly (p control groups which died within 8 days. DNA vaccination with pVAX-EF-1α triggered strong humoral and cellular responses and induced effective protection in mice against acute T. gondii infection, indicating that TgEF-1α is a promising vaccine candidate against acute toxoplasmosis.

  9. Characterization of Sinorhizobium sp. LM21 Prophages and Virus-Encoded DNA Methyltransferases in the Light of Comparative Genomic Analyses of the Sinorhizobial Virome

    Directory of Open Access Journals (Sweden)

    Przemyslaw Decewicz

    2017-06-01

    Full Text Available The genus Sinorhizobium/Ensifer mostly groups nitrogen-fixing bacteria that create root or stem nodules on leguminous plants and transform atmospheric nitrogen into ammonia, which improves the productivity of the plants. Although these biotechnologically-important bacteria are commonly found in various soil environments, little is known about their phages. In this study, the genome of Sinorhizobium sp. LM21 isolated from a heavy-metal-contaminated copper mine in Poland was investigated for the presence of prophages and DNA methyltransferase-encoding genes. In addition to the previously identified temperate phage, ΦLM21, and the phage-plasmid, pLM21S1, the analysis revealed the presence of three prophage regions. Moreover, four novel phage-encoded DNA methyltransferase (MTase genes were identified and the enzymes were characterized. It was shown that two of the identified viral MTases methylated the same target sequence (GANTC as cell cycle-regulated methyltransferase (CcrM of the bacterial host strain, LM21. This discovery was recognized as an example of the evolutionary convergence between enzymes of sinorhizobial viruses and their host, which may play an important role in virus cycle. In the last part of the study, thorough comparative analyses of 31 sinorhizobial (prophages (including active sinorhizobial phages and novel putative prophages retrieved and manually re-annotated from Sinorhizobium spp. genomes were performed. The networking analysis revealed the presence of highly conserved proteins (e.g., holins and endolysins and a high diversity of viral integrases. The analysis also revealed a large number of viral DNA MTases, whose genes were frequently located within the predicted replication modules of analyzed prophages, which may suggest their important regulatory role. Summarizing, complex analysis of the phage protein similarity network enabled a new insight into overall sinorhizobial virome diversity.

  10. Increased generation of HIV-1 gp120-reactive CD8+ T cells by a DNA vaccine construct encoding the chemokine CCL3.

    Directory of Open Access Journals (Sweden)

    Inger Øynebråten

    Full Text Available DNA vaccines based on subunits from pathogens have several advantages over other vaccine strategies. DNA vaccines can easily be modified, they show good safety profiles, are stable and inexpensive to produce, and the immune response can be focused to the antigen of interest. However, the immunogenicity of DNA vaccines which is generally quite low needs to be improved. Electroporation and co-delivery of genetically encoded immune adjuvants are two strategies aiming at increasing the efficacy of DNA vaccines. Here, we have examined whether targeting to antigen-presenting cells (APC could increase the immune response to surface envelope glycoprotein (Env gp120 from Human Immunodeficiency Virus type 1 (HIV-1. To target APC, we utilized a homodimeric vaccine format denoted vaccibody, which enables covalent fusion of gp120 to molecules that can target APC. Two molecules were tested for their efficiency as targeting units: the antibody-derived single chain Fragment variable (scFv specific for the major histocompatibility complex (MHC class II I-E molecules, and the CC chemokine ligand 3 (CCL3. The vaccines were delivered as DNA into muscle of mice with or without electroporation. Targeting of gp120 to MHC class II molecules induced antibodies that neutralized HIV-1 and that persisted for more than a year after one single immunization with electroporation. Targeting by CCL3 significantly increased the number of HIV-1 gp120-reactive CD8+ T cells compared to non-targeted vaccines and gp120 delivered alone in the absence of electroporation. The data suggest that chemokines are promising molecular adjuvants because small amounts can attract immune cells and promote immune responses without advanced equipment such as electroporation.

  11. A carboxy-terminally truncated human CPSF6 lacking residues encoded by exon 6 inhibits HIV-1 cDNA synthesis and promotes capsid disassembly.

    Science.gov (United States)

    Hori, Takanori; Takeuchi, Hiroaki; Saito, Hideki; Sakuma, Ryuta; Inagaki, Yoshio; Yamaoka, Shoji

    2013-07-01

    Since HIV-1 replication is modulated at multiple stages by host cell factors, identification and characterization of those host cell factors are expected to contribute to the development of novel anti-HIV therapeutics. Previous studies showed that a C-terminally truncated cytosolic form of cleavage and polyadenylation-specific factor 6 (CPSF6-358) inhibits HIV-1 infection through interference with HIV-1 trafficking to the nucleus. Here we identified and characterized a different configuration of C-terminally truncated human CPSF6 (hCPSF6-375) through cDNA expression cloning coupled with ganciclovir-mediated lethal selection. Notably, hCPSF6-375, but not mouse CPSF6-358 (mCPSF6-358) as previously reported, remarkably interfered with viral cDNA synthesis after HIV-1 infection. Moreover, we found that hCPSF6-375 aberrantly accelerated the disassembly of the viral capsid in target cells, while CPSF6-358 did not. Sequence comparison of CPSF6-375 and CPSF6-358 cDNAs showed a lack of exon 6 and additional coding sequence for 54 amino acid residues in the C terminus of hCPSF6-375. Mutational analyses revealed that the residues encoded by exon 6, but not the C-terminal 54 residues in hCPSF6-375, is responsible for impaired viral cDNA synthesis by hCPSF6-375. This is the first report demonstrating a novel mode of HIV-1 inhibition by truncated forms of CPSF6 that involves rapid capsid disassembly and inhibition of viral cDNA synthesis. These findings could facilitate an increased understanding of viral cDNA synthesis in light of the viral capsid disassembly.

  12. The natriuretic peptide/helokinestatin precursor from Mexican beaded lizard (Heloderma horridum) venom: Amino acid sequence deduced from cloned cDNA and identification of two novel encoded helokinestatins.

    Science.gov (United States)

    Ma, Chengbang; Yang, Mu; Zhou, Mei; Wu, Yuxin; Wang, Lei; Chen, Tianbao; Ding, Anwei; Shaw, Chris

    2011-06-01

    Natriuretic peptides are common components of reptile venoms and molecular cloning of their biosynthetic precursors has revealed that in snakes, they co-encode bradykinin-potentiating peptides and in venomous lizards, some co-encode bradykinin inhibitory peptides such as the helokinestatins. The common natriuretic peptide/helokinestatin precursor of the Gila Monster, Heloderma suspectum, encodes five helokinestatins of differing primary structures. Here we report the molecular cloning of a natriuretic peptide/helokinestatin precursor cDNA from a venom-derived cDNA library of the Mexican beaded lizard (Heloderma horridum). Deduction of the primary structure of the encoded precursor protein from this cloned cDNA template revealed that it consisted of 196 amino acid residues encoding a single natriuretic peptide and five helokinestatins. While the natriuretic peptide was of identical primary structure to its Gila Monster (H. suspectum) homolog, the encoded helokinestatins were not, with this region of the common precursor displaying some significant differences to its H. suspectum homolog. The helokinestatin-encoding region contained a single copy of helokinestatin-1, 2 copies of helokinestatin-3 and single copies of 2 novel peptides, (Phe)(5)-helokinestatin-2 (VPPAFVPLVPR) and helokinestatin-6 (GPPFNPPPFVDYEPR). All predicted peptides were found in reverse phase HPLC fractions of the same venom. Synthetic replicates of both novel helokinestatins were found to antagonize the relaxing effect of bradykinin on rat tail artery smooth muscle. Thus lizard venom continues to provide a source of novel biologically active peptides. Copyright © 2011. Published by Elsevier Inc.

  13. Genetic population structure of the malaria vector Anopheles baimaii in north-east India using mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Sarma Devojit K

    2012-03-01

    Full Text Available Abstract Background Anopheles baimaii is a primary vector of human malaria in the forest settings of Southeast Asia including the north-eastern region of India. Here, the genetic population structure and the basic population genetic parameters of An. baimaii in north-east India were estimated using DNA sequences of the mitochondrial cytochrome oxidase sub unit II (COII gene. Methods Anopheles baimaii were collected from 26 geo-referenced locations across the seven north-east Indian states and the COII gene was sequenced from 176 individuals across these sites. Fifty-seven COII sequences of An. baimaii from six locations in Bangladesh, Myanmar and Thailand from a previous study were added to this dataset. Altogether, 233 sequences were grouped into eight population groups, to facilitate analyses of genetic diversity, population structure and population history. Results A star-shaped median joining haplotype network, unimodal mismatch distribution and significantly negative neutrality tests indicated population expansion in An. baimaii with the start of expansion estimated to be ~0.243 million years before present (MYBP in north-east India. The populations of An. baimaii from north-east India had the highest haplotype and nucleotide diversity with all other populations having a subset of this diversity, likely as the result of range expansion from north-east India. The north-east Indian populations were genetically distinct from those in Bangladesh, Myanmar and Thailand, indicating that mountains, such as the Arakan mountain range between north-east India and Myanmar, are a significant barrier to gene flow. Within north-east India, there was no genetic differentiation among populations with the exception of the Central 2 population in the Barail hills area that was significantly differentiated from other populations. Conclusions The high genetic distinctiveness of the Central 2 population in the Barail hills area of the north-east India should be

  14. Genetic population structure of the malaria vector Anopheles baimaii in north-east India using mitochondrial DNA.

    Science.gov (United States)

    Sarma, Devojit K; Prakash, Anil; O'Loughlin, Samantha M; Bhattacharyya, Dibya R; Mohapatra, Pradumnya K; Bhattacharjee, Kanta; Das, Kanika; Singh, Sweta; Sarma, Nilanju P; Ahmed, Gias U; Walton, Catherine; Mahanta, Jagadish

    2012-03-20

    Anopheles baimaii is a primary vector of human malaria in the forest settings of Southeast Asia including the north-eastern region of India. Here, the genetic population structure and the basic population genetic parameters of An. baimaii in north-east India were estimated using DNA sequences of the mitochondrial cytochrome oxidase sub unit II (COII) gene. Anopheles baimaii were collected from 26 geo-referenced locations across the seven north-east Indian states and the COII gene was sequenced from 176 individuals across these sites. Fifty-seven COII sequences of An. baimaii from six locations in Bangladesh, Myanmar and Thailand from a previous study were added to this dataset. Altogether, 233 sequences were grouped into eight population groups, to facilitate analyses of genetic diversity, population structure and population history. A star-shaped median joining haplotype network, unimodal mismatch distribution and significantly negative neutrality tests indicated population expansion in An. baimaii with the start of expansion estimated to be ~0.243 million years before present (MYBP) in north-east India. The populations of An. baimaii from north-east India had the highest haplotype and nucleotide diversity with all other populations having a subset of this diversity, likely as the result of range expansion from north-east India. The north-east Indian populations were genetically distinct from those in Bangladesh, Myanmar and Thailand, indicating that mountains, such as the Arakan mountain range between north-east India and Myanmar, are a significant barrier to gene flow. Within north-east India, there was no genetic differentiation among populations with the exception of the Central 2 population in the Barail hills area that was significantly differentiated from other populations. The high genetic distinctiveness of the Central 2 population in the Barail hills area of the north-east India should be confirmed and its epidemiological significance further

  15. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Verónica Loera-Castañeda

    2014-01-01

    Full Text Available Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS. Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12% harbored the A8027G polymorphism and three of them were early onset (EO AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn’t been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

  16. Emergence of a daptomycin-non-susceptible Enterococcus faecium strain that encodes mutations in DNA repair genes after high-dose daptomycin therapy.

    Science.gov (United States)

    Matono, Takashi; Hayakawa, Kayoko; Hirai, Risen; Tanimura, Akira; Yamamoto, Kei; Fujiya, Yoshihiro; Mawatari, Momoko; Kutsuna, Satoshi; Takeshita, Nozomi; Mezaki, Kazuhisa; Ohmagari, Norio; Miyoshi-Akiyama, Tohru

    2016-04-01

    An increasing number of reports have documented the emergence of daptomycin-nonsusceptible Enterococcus in patients during daptomycin therapy. Even though several mechanisms for daptomycin-nonsusceptibility have been suggested, the potential genetic mutations which might contribute to the daptomycin-nonsusceptibility are not fully understood. We isolated a vancomycin-susceptible, daptomycin nonsusceptible Enterococcus faecium strain from a patient with acute lymphocytic leukemia who received high-dose daptomycin therapy for E. faecium endocarditis. Whole-genome sequencing analysis revealed mutations within genes encoding DNA repair proteins MutL and RecJ of the daptomycin-nonsusceptible Enterococcus strain which might have facilitated its emergence. We identified the mutations of DNA mismatch repair genes in a clinical isolate of daptomycin nonsusceptible E. faecium which emerged in spite of high-dose daptomycin therapy. The finding implicates the possible association of DNA repair mechanism and daptomycin resistance. Careful monitoring is necessary to avoid the emergence of daptomycin non-susceptible isolates of E. faecium and particularly in cases of long-term daptomycin use or in immunocompromised patients.

  17. Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer's disease: Identification as the microtubule-associated protein tau

    International Nuclear Information System (INIS)

    Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.

    1988-01-01

    Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease

  18. Identification and Molecular Characterization of the cDNA Encoding Cucumis melo Allergen, Cuc m 3, a Plant Pathogenesis-Related Protein

    Directory of Open Access Journals (Sweden)

    Mojtaba Sankian

    2014-05-01

    Full Text Available Background: Melon (Cucumis melo allergy is one of the most common food allergies, characterized by oral allergy syndrome. To date, two allergen molecules, Cuc m 1 and Cuc m 2, have been fully characterized in melon pulp, but there are few reports about the molecular characteristics of Cuc m 3. Methods:The Cuc m 3 cDNA has been characterized by rapid amplification of cDNA ends (RACE, which revealed a 456 base-pair (bp fragment encoding a 151-amino acid polypeptide with a predicted molecular mass of 16.97 kDa, and identified 79 and 178 bp untranslated sequences at the 5′ and 3´ ends, respectively. Results: In silico analysis showed strong similarities between Cuc m 3 and other plant pathogen-related protein 1s from cucumber, grape, bell pepper, and tomato. Conclusion: Here we report the identification and characterization of the Cuc m 3 cDNA, which will be utilized for further analyses of structural and allergenic features of this allergen

  19. Site-specific integration of CAR gene into Jurkat T cells with a linear close-ended AAV-based DNA vector for CAR-T engineering.

    Science.gov (United States)

    Zhang, Yun; Liu, Xiaomei; Zhang, Jinju; Zhang, Chun

    2016-09-01

    To develop a site-specific integration strategy for CAR-T engineering by using a non-viral vector dependent on adeno-associated viral (AAV) genome, which tends to be integrated into AAVS1 site with the help of its Rep proteins. AAV-dependent vectors were produced in Sf9 cells. Structural analyses revealed the vector as covalently close-ended, linear duplex molecules, which was termed "CELiD" DNA. A plasmid CMV-Rep was constructed to express the integrases Rep78 and Rep68. Jurkat cells were co-electroporated with "CELiD" DNA and plasmid CMV-Rep in order to specifically integrate CAR gene into AAVS1 site. We examined 71 stably transfected Jurkat clones by nested PCR, sequencing and southern blotting, of which 30 clones bore CAR gene within AAVS1 site. The site-specific integration efficiency was nearly 42.2 %. The AAV-dependent vector preferentially integrated CAR into AAVS1 site, which could be further used in human T cell modification and enhance the security of CAR-T therapy.

  20. Hybrid lentivirus-phiC31-int-NLS vector allows site-specific recombination in murine and human cells but induces DNA damage.

    Directory of Open Access Journals (Sweden)

    Nicolas Grandchamp

    Full Text Available Gene transfer allows transient or permanent genetic modifications of cells for experimental or therapeutic purposes. Gene delivery by HIV-derived lentiviral vector (LV is highly effective but the risk of insertional mutagenesis is important and the random/uncontrollable integration of the DNA vector can deregulate the cell transcriptional activity. Non Integrative Lentiviral Vectors (NILVs solve this issue in non-dividing cells, but they do not allow long term expression in dividing cells. In this context, obtaining stable expression while avoiding the problems inherent to unpredictable DNA vector integration requires the ability to control the integration site. One possibility is to use the integrase of phage phiC31 (phiC31-int which catalyzes efficient site-specific recombination between the attP site in the phage genome and the chromosomal attB site of its Streptomyces host. Previous studies showed that phiC31-int is active in many eukaryotic cells, such as murine or human cells, and directs the integration of a DNA substrate into pseudo attP sites (pattP which are homologous to the native attP site. In this study, we combined the efficiency of NILV for gene delivery and the specificity of phiC31-int for DNA substrate integration to engineer a hybrid tool for gene transfer with the aim of allowing long term expression in dividing and non-dividing cells preventing genotoxicity. We demonstrated the feasibility to target NILV integration in human and murine pattP sites with a dual NILV vectors system: one which delivers phiC31-int, the other which constitute the substrate containing an attB site in its DNA sequence. These promising results are however alleviated by the occurrence of significant DNA damages. Further improvements are thus required to prevent chromosomal rearrangements for a therapeutic use of the system. However, its use as a tool for experimental applications such as transgenesis is already applicable.

  1. The Mycoplasma pneumoniae MPN229 gene encodes a protein that selectively binds single-stranded DNA and stimulates Recombinase A-mediated DNA strand exchange

    NARCIS (Netherlands)

    M. Sluijter (Marcel); T.A. Hoogenboezem (Thomas); N.G. Hartwig (Nico); C. Vink (Cornelis)

    2008-01-01

    textabstractBackground. Mycoplasma pneumoniae has previously been characterized as a micro-organism that is genetically highly stable. In spite of this genetic stability, homologous DNA recombination has been hypothesized to lie at the basis of antigenic variation of the major surface protein, P1,

  2. Development of pGEMINI, a Plant Gateway Destination Vector Allowing the Simultaneous Integration of Two cDNA via a Single LR-Clonase Reaction.

    Science.gov (United States)

    Exposito-Rodriguez, Marino; Laissue, Philippe P; López-Calcagno, Patricia E; Mullineaux, Philip M; Raines, Christine A; Simkin, Andrew J

    2017-11-12

    Gateway technology has been used to facilitate the generation of a large number of constructs for the modification of plants for research purposes. However, many of the currently available vectors only allow the integration of a single cDNA of interest into an expression clone. The ability to over-express multiple genes in combination is essential for the study of plant development where several transcripts have a role to play in one or more metabolic processes. The tools to carry out such studies are limited, and in many cases rely on the incorporation of cDNA into expression systems via conventional cloning, which can be both time consuming and laborious. To our knowledge, this study reports on the first development of a vector allowing the simultaneous integration of two independent cDNAs via a single LR-clonase reaction. This vector " pGEMINI " represents a powerful molecular tool offering the ability to study the role of multi-cDNA constructs on plant development, and opens up the process of gene stacking and the study of gene combinations through transient or stable transformation procedures.

  3. A DNA Vaccine-Encoded Nucleoprotein of Influenza Virus Fails To Induce Cellular Immune Responses in a Diabetic Mouse Model▿

    OpenAIRE

    Jamali, Abbas; Sabahi, Farzaneh; Bamdad, Taravat; Hashemi, Hamidreza; Mahboudi, Fereidoun; Kheiri, Masume Tavasoti

    2010-01-01

    International audience; Influenza virus infections cause yearly epidemics and are a major cause of lower respiratory tract illnesses in humans worldwide. Influenza virus has long been recognized to be associated with higher morbidity and mortality in diabetic patients. Vaccination is an effective tool to prevent influenza virus infection in this group of patients. Vaccines employing recombinant-DNA technologies are an alternative to inactivated virus and live attenuated virus vaccines. Intern...

  4. A single cDNA encodes two isoforms of stathmin, a developmentally regulated neuron-enriched phosphoprotein.

    Science.gov (United States)

    Doye, V; Soubrier, F; Bauw, G; Boutterin, M C; Beretta, L; Koppel, J; Vandekerckhove, J; Sobel, A

    1989-07-25

    Stathmin, a 19-kDa neuron-enriched soluble phosphoprotein, has been recently proposed as an ubiquitous intracellular relay for the diverse extracellular signals regulating cell proliferation, differentiation, and functions through various second messenger pathways (Sobel, A., Boutterin, M.C., Beretta, L., Chneiweiss, H., Doye, V., and peyro-Saint-Paul, H. (1989) J. Biol. Chem. 264, 3765-3772). Internal sequences of the protein from rat brain were determined after purification by two-dimensional polyacrylamide gel electrophoresis, electrotransfer onto Immobilon, and in situ proteolysis. Oligonucleotide mixtures based on these sequences were used to clone a cDNA for stathmin from a rat PC12 cell lambda gt 10 library. The deduced amino acid sequence reveals partial homologies with the coiled coil structural regions of several intracellular matrix phosphoproteins. Using this cDNA as a probe, we show that the expression of stathmin mRNA parallels that of the protein during brain ontogenesis, reaching a maximum at the neonatal stage. In vitro translation of the derived cRNA yielded all the known molecular forms of stathmin, namely its alpha and beta isoforms in their unphosphorylated and phosphorylated states. Thus, a single cDNA codes for both biologically relevant isoforms of the protein, indicating that they differ by co- or post-translational modifications.

  5. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  6. Staphylococcal pathogenicity island DNA packaging system involving cos-site packaging and phage-encoded HNH endonucleases.

    Science.gov (United States)

    Quiles-Puchalt, Nuria; Carpena, Nuria; Alonso, Juan C; Novick, Richard P; Marina, Alberto; Penadés, José R

    2014-04-22

    Staphylococcal pathogenicity islands (SaPIs) are the prototypical members of a widespread family of chromosomally located mobile genetic elements that contribute substantially to intra- and interspecies gene transfer, host adaptation, and virulence. The key feature of their mobility is the induction of SaPI excision and replication by certain helper phages and their efficient encapsidation into phage-like infectious particles. Most SaPIs use the headful packaging mechanism and encode small terminase subunit (TerS) homologs that recognize the SaPI-specific pac site and determine SaPI packaging specificity. Several of the known SaPIs do not encode a recognizable TerS homolog but are nevertheless packaged efficiently by helper phages and transferred at high frequencies. In this report, we have characterized one of the non-terS-coding SaPIs, SaPIbov5, and found that it uses two different, undescribed packaging strategies. SaPIbov5 is packaged in full-sized phage-like particles either by typical pac-type helper phages, or by cos-type phages--i.e., it has both pac and cos sites--a configuration that has not hitherto been described for any mobile element, phages included--and uses the two different phage-coded TerSs. To our knowledge, this is the first example of SaPI packaging by a cos phage, and in this, it resembles the P4 plasmid of Escherichia coli. Cos-site packaging in Staphylococcus aureus is additionally unique in that it requires the HNH nuclease, carried only by cos phages, in addition to the large terminase subunit, for cos-site cleavage and melting.

  7. Organometallic DNA-B12 Conjugates as Potential Oligonucleotide Vectors: Synthesis and Structural and Binding Studies with Human Cobalamin-Transport Proteins.

    Science.gov (United States)

    Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard

    2017-11-16

    The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Immunogenicity of a Multi-Epitope DNA Vaccine Encoding Epitopes from Cu–Zn Superoxide Dismutase and Open Reading Frames of Brucella abortus in Mice

    Science.gov (United States)

    Escalona, Emilia; Sáez, Darwin; Oñate, Angel

    2017-01-01

    Brucellosis is a bacterial zoonotic disease affecting several mammalian species that is transmitted to humans by direct or indirect contact with infected animals or their products. In cattle, brucellosis is almost invariably caused by Brucella abortus. Live, attenuated Brucella vaccines are commonly used to prevent illness in cattle, but can cause abortions in pregnant animals. It is, therefore, desirable to design an effective and safer vaccine against Brucella. We have used specific Brucella antigens that induce immunity and protection against B. abortus. A novel recombinant multi-epitope DNA vaccine specific for brucellosis was developed. To design the vaccine construct, we employed bioinformatics tools to predict epitopes present in Cu–Zn superoxide dismutase and in the open reading frames of the genomic island-3 (BAB1_0260, BAB1_0270, BAB1_0273, and BAB1_0278) of Brucella. We successfully designed a multi-epitope DNA plasmid vaccine chimera that encodes and expresses 21 epitopes. This DNA vaccine induced a specific humoral and cellular immune response in BALB/c mice. It induced a typical T-helper 1 response, eliciting production of immunoglobulin G2a and IFN-γ particularly associated with the Th1 cell subset of CD4+ T cells. The production of IL-4, an indicator of Th2 activation, was not detected in splenocytes. Therefore, it is reasonable to suggest that the vaccine induced a predominantly Th1 response. The vaccine induced a statistically significant level of protection in BALB/c mice when challenged with B. abortus 2308. This is the first use of an in silico strategy to a design a multi-epitope DNA vaccine against B. abortus. PMID:28232837

  9. From Plant Extract to a cDNA Encoding a Glucosyltransferase Candidate: Proteomics and Transcriptomics as Tools to Help Elucidate Saponin Biosynthesis in Centella asiatica.

    Science.gov (United States)

    de Costa, Fernanda; Barber, Carla J S; Reed, Darwin W; Covello, Patrick S

    2016-01-01

    Centella asiatica (L.) Urban (Apiaceae), a small annual plant that grows in India, Sri Lanka, Malaysia, and other parts of Asia, is well-known as a medicinal herb with a long history of therapeutic uses. The bioactive compounds present in C. asiatica leaves include ursane-type triterpene sapogenins and saponins-asiatic acid, madecassic acid, asiaticoside, and madecassoside. Various bioactivities have been shown for these compounds, although most of the steps in the biosynthesis of triterpene saponins, including glycosylation, remain uncharacterized at the molecular level. This chapter describes an approach that integrates partial enzyme purification, proteomics methods, and transcriptomics, with the aim of reducing the number of cDNA candidates encoding for a glucosyltransferase involved in saponin biosynthesis and facilitating the elucidation of the pathway in this medicinal plant.

  10. Isolation of cDNA encoding a newly identified major allergenic protein of rye-grass pollen: intracellular targeting to the amyloplast.

    Science.gov (United States)

    Singh, M B; Hough, T; Theerakulpisut, P; Avjioglu, A; Davies, S; Smith, P M; Taylor, P; Simpson, R J; Ward, L D; McCluskey, J

    1991-01-01

    We have identified a major allergenic protein from rye-grass pollen, tentatively designated Lol pIb of 31kDa and with pI 9.0. A cDNA clone encoding Lol pIb has been isolated, sequenced, and characterized. Lol pIb is located mainly in the starch granules. This is a distinct allergen from Lol pI, which is located in the cytosol. Lol pIb is synthesized in pollen as a pre-allergen with a transit peptide targeting the allergen to amyloplasts. Epitope mapping of the fusion protein localized the IgE binding determinant in the C-terminal domain. Images PMID:1671715

  11. Characterization of a cDNA encoding a 34-kDa Purkinje neuron protein recognized by sera from patients with paraneoplastic cerebellar degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Furneaux, H.M.; Dropcho, E.J.; Barbut, D.; Chen, Yaotseng; Rosenblum, M.K.; Old, L.J.; Posner, J.B. (Memorial Sloan-Kettering Cancer Center, New York, NY (USA))

    1989-04-01

    Paraneoplastic cerebellar degeneration is a neurological disorder of unknown cause occurring in patients with an identified or occult cancer. An autoimmune etiology is likely since autoantibodies directed against the Purkinje cells of the cerebellum have been found in the serum and cerebrospinal fluid of some patients. Two Purkinje cell-specific antigens are recognized by these autoantibodies, a major antigen of 62 kDa (CDR 62, cerebellar degeneration-related 62-kDa protein) and a minor antigen of 34 kDa (CDR 34). Previous studies have described the isolation and characterization of a human cerebellar cDNA that encodes an epitope recognized by sera from patients with paraneoplastic cerebellar degeneration. The authors have now established by two independent methods that this gene is uniquely expressed in Purkinje cells of the cerebellum and corresponds to the minor antigen CDR 34. This antigen is also expressed in tumor tissue from a patient with paraneoplastic cerebellar degeneration.

  12. MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

    DEFF Research Database (Denmark)

    Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

    particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...... during infection and vaccination in order to understand the complex web of interactions involved in the underlying host immune response. Micro ribonucleic acids (miRNAs) are a diverse class of small (18-22 nucleotides) endogenous RNAs that potently mediate post-transcriptional silencing of a wide range...... of genes and are emerging as critical regulators of cellular processes, including immune responses. A microarray experiment in our lab revealed that miR-155, miR-462, and miR-731 were upregulated in fish liver following VHSV infection. Therefore, we analysed the expression of these miRNAs together...

  13. Identification, characterization, and cloning of a complementary DNA encoding a 60-kd house dust mite allergen (Der f 18) for human beings and dogs.

    Science.gov (United States)

    Weber, Eric; Hunter, Shirley; Stedman, Kim; Dreitz, Steve; Olivry, Thierry; Hillier, Andrew; McCall, Catherine

    2003-07-01

    House dust mites of the Dermatophagoides genus are the most important cause of perennial allergic disease in both humans and companion animals. Although the major mite allergens for humans are proteins of relatively low molecular weight, this is not the case for dogs. Western blotting shows that canine anti-mite IgE responses are directed primarily toward proteins in the molecular weight range of 50 to 120 kd. The objectives of this study were to characterize a D farinae allergen with a molecular weight of approximately 60 kd and to isolate the cDNA coding for this allergen. A protein of apparent molecular weight of 60 kd was identified by Western blotting by using canine serum IgE from house dust mite-sensitized atopic dogs. The protein was purified from homogenized D farinae mite bodies by ammonium sulfate precipitation, followed by gel filtration and cation exchange HPLC. The presence of IgE directed to the 60-kd protein in sera from humans and dogs with dust mite allergy was measured by FcepsilonRIalpha-based ELISA. A cDNA encoding a full-length 60-kd protein was isolated from a D farinae cDNA library by a combination of both PCR amplification and hybridization screening. A panel of mAbs specific for the 60-kd protein was generated and used to localize the protein in whole body sections of D farinae mites. ELISA showed that the purified protein bound IgE in 54% of the sera from patients with D farinae allergy. In addition, the 60-kd protein was able to bind IgE in 57% to 77% of D farinae -sensitized dogs. A cDNA was isolated that encoded a protein of 462 amino acids, consisting of a 25 amino acid signal sequence and a 437 amino acid mature protein. The calculated molecular weight of the mature protein is 50 kd, and the amino acid sequence contains a single N-glycosylation site. A protein database search showed homology with multiple chitinases. A mAb specific for the 60-kd chitinase recognized the allergen in the mite digestive system, but fecal pellets did not

  14. DNA vaccine encoding myristoylated membrane protein (MMP) of rock bream iridovirus (RBIV) induces protective immunity in rock bream (Oplegnathus fasciatus).

    Science.gov (United States)

    Jung, Myung-Hwa; Nikapitiya, Chamilani; Jung, Sung-Ju

    2018-02-01

    Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream (Oplegnathus fasciatus) in Korea. In this study, we investigated the potential of viral membrane protein to induce antiviral status protecting rock bream against RBIV infection. We found that fish administered with ORF008L (myristoylated membrane protein, MMP) vaccine exhibited significantly higher levels of survival compared to ORF007L (major capsid protein, MCP). Moreover, ORF008L-based DNA vaccinated fish showed significant protection at 4 and 8 weeks post vaccination (wpv) than non-vaccinated fish after infected with RBIV (6.7 × 10 5 ) at 23 °C, with relative percent survival (RPS) of 73.36% and 46.72%, respectively. All of the survivors from the first RBIV infection were strongly protected (100% RPS) from re-infected with RBIV (1.1 × 10 7 ) at 100 dpi. In addition, the MMP (ORF008L)-based DNA vaccine significantly induced the gene expression of TLR3 (14.2-fold), MyD88 (11.6-fold), Mx (84.7-fold), ISG15 (8.7-fold), PKR (25.6-fold), MHC class I (13.3-fold), Fas (6.7-fold), Fas ligand (6.7-fold), caspase9 (17.0-fold) and caspase3 (15.3-fold) at 7 days post vaccination in the muscle (vaccine injection site). Our results showed the induction of immune responses and suggest the possibility of developing preventive measures against RBIV using myristoylated membrane protein-based DNA vaccine. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Cloning of a cDNA encoding a cystatin from grain amaranth (Amaranthus hypochondriacus) showing a tissue-specific expression that is modified by germination and abiotic stress.

    Science.gov (United States)

    Valdés-Rodríguez, Silvia; Guerrero-Rangel, Armando; Melgoza-Villagómez, Claudia; Chagolla-López, Alicia; Delgado-Vargas, Francisco; Martínez-Gallardo, Norma; Sánchez-Hernández, Carla; Délano-Frier, John

    2007-01-01

    A cDNA, encoding a cysteine protease inhibitor (AhCPI), was isolated from an immature seed cDNA library of grain amaranth (Amaranthus hypochondriacus L.) and characterized. It encoded a polypeptide of 247 amino acids (aa), including a putative N-terminal signal peptide. Other relevant regions found in its sequence included the G and PW conserved aa motifs, the consensus LARFAV sequence for phytocystatins and the reactive site QVVAG. The predicted aa sequence for AhCPI showed a significant homology to other plant cystatins. Gene expression analyses indicated that AhCPI was constitutively expressed in mature seeds, and gradually decreased during germination. In vegetative tissues, AhCPI was expressed in the radicle and hypocotyls of seedlings and in the stems and roots of young plantlets. Its expression in roots and stems increased substantially in response to water deficit, salinity-, cold- and heat-stress, whereas heat-stress induced a rapid and transient accumulation of AhCPI transcripts in leaves. The results obtained were suggestive of multiple roles for AhCPI in grain amaranth, acting as a regulator of seed germination and as a protective agent against diverse types of abiotic stress, which induced this gene in a tissue- and stress-specific manner. The work herewith described reports a novel, and apparently, single cystatin protein in which, in agreement with other plant model systems, could have a regulatory role in germination, and further expands previous findings linking the accumulation of protease inhibitors, mostly of the serine proteinase type, with protection against (a)biotic stress in A. hypochondriacus.

  16. Cloning of partial cDNA encoding differentiation and tumor-associated mucin glycoproteins expressed by human mammary epithelium

    Energy Technology Data Exchange (ETDEWEB)

    Gender, S.J.; Burchell, J.M.; Duhig, T.; Lamport, D.; White, R.; Parker, M.; Taylor-Papadimitriou, J.

    1987-09-01

    Human mammary epithelial cells secrete and express on their cell surfaces complex mucin glycoproteins that are developmentally regulated, tumor-associated, and highly immunogenic. Studies using monoclonal antibodies directed to these glycoproteins suggest that their molecular structures can vary with differentiation stages in the normal gland and in malignancy. To analyze the molecular nature of these glycoproteins, milk mucin was affinity-purifed and deglycosylated with hydrogen fluoride, yielding bands at 68 and 72 kDa on silver-stained gels. Polyclonal and monoclonal antibodies to the stripped core protein were developed and used to screen a lambdagt11 expression library of cDNA made from mRNA of the mammary tumor cell line MCF-7. Seven crossreacting clones were isolated, with inserts 0.1-1.8 kilobases long. RNA blot analysis, using as a probe the 1.8-kilobase insert subcloned in plasmid pUC8 (pMUC10), revealed transcripts of 4.7 and 6.4 kilobases in MCF-7 and T47D mammary tumor cells, whereas normal mammary epithelial cells from pooled milks have additional transcripts. The expression of mRNA correlates with antigen expression as determined by binding of two previously characterized anti-mucin monoclonal antibodies (HMFG-1 and HMFG-2) to seven cell lines. Restriction enzyme analysis detected a restriction fragment length polymorphism when human genomic DNA was digested with EcoRI or HinfI.

  17. Cloning of a cDNA encoding the human cation-dependent mannose 6-phosphate-specific receptor

    International Nuclear Information System (INIS)

    Pohlmann, R.; Nagel, G.; Schmidt, B.

    1987-01-01

    Complementary DNA clones for the human cation-dependent mannose 6-phosphate-specific receptor have been isolated from a human placenta library in λgt11. The nucleotide sequence of the 2463-base-pair cDNA insert includes a 145-base-pair 5' untranslated region, an open reading frame of 831 base pairs corresponding to 277 amino acids, and a 1487-base-pair 3' untranslated region. The deduced amino acid sequence is colinear with that determined by amino acid sequencing of the N-terminus peptide (41 residues) and nine tryptic peptides (93 additional residues). The receptor is synthesized as a precursor with a signal peptide of 20 amino acids. The hydrophobicity profile of the receptor indicates a single membrane-spanning domain, which separates an N-terminal region containing five potential N-glycosylation sites from a C-terminal region lacking N-glycosylation sites. Thus the N-terminal (M/sub r/ = 18,299) and C-terminal (M/sub r/ ≤ 7648) segments of the mature receptor are assumed to be exposed to the extracytosolic and cytosolic sides of the membrane, respectively. Analysis of a panel of somatic cell (mouse-human) hybrids shows that the gene for the receptor is located on human chromosome 12

  18. Protective efficacy of cationic-PLGA microspheres loaded with DNA vaccine encoding the sip gene of Streptococcus agalactiae in tilapia.

    Science.gov (United States)

    Ma, Yan-Ping; Ke, Hao; Liang, Zhi-Ling; Ma, Jiang-Yao; Hao, Le; Liu, Zhen-Xing

    2017-07-01

    Streptococcus agalactiae (S. agalactiae) is an important fish pathogen, which has received more attention in the past decade due to the increasing economic losses in the tilapia industry worldwide. As existing effective vaccines of S. agalactiae in fish have obvious disadvantage, to select immunoprotective antigens and package materials would undoubtedly contribute to the development of novel oral vaccines. In the present study, surface immunogenic protein (sip) was selected from the S. agalactiae serovar I a genomes as immunogenic protein in DNA vaccine form with cationic chitosan and biodegradable and biocompatible PLGA. The pcSip plasmid in cationic-PLGA was successfully expressed in tissues of immunized tilapia and the immunogenicity was assessed in tilapia challenge model. A significant increase was observed in the cytokine levels of IL-1β, TNF-α, CC1, CC2 in spleen and kidney tissues. Furthermore, immunized tilapia conferred different levels of protection against challenge with a lethal dose of highly virulent serovar I a S. agalactiae. Our results indicated that the pcSip plasmid in cationic-PLGA induced high level of antibodies and protection against S. agalactiae infection, could be effective oral DNA vaccine candidates. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. The effects of gamma irradiation on growth and expression of genes encoding DNA repair-related proteins in Lombardy poplar (Populus nigra var. italica)

    International Nuclear Information System (INIS)

    Nishiguchi, Mitsuru; Nanjo, Tokihiko; Yoshida, Kazumasa

    2012-01-01

    In this study, to elucidate the mechanisms of adaptation and tolerance to ionizing radiation in woody plants, we investigated the various biological effects of γ-rays on the Lombardy poplar (Populus nigra L. var. italica Du Roi). We detected abnormal leaf shape and color, fusion, distorted venation, shortened internode, fasciation and increased axillary shoots in γ-irradiated poplar plants. Acute γ-irradiation with a dose of 100 Gy greatly reduced the height, stem diameter and biomass of poplar plantlets. After receiving doses of 200 and 300 Gy, all the plantlets stopped growing, and then most of them withered after 4–10 weeks of γ-irradiation. Comet assays showed that nuclear DNA in suspension-cultured poplar cells had been damaged by γ-rays. To determine whether DNA repair-related proteins are involved in the response to γ-rays in Lombardy poplars, we cloned the PnRAD51, PnLIG4, PnKU70, PnXRCC4, PnPCNA and PnOGG1 cDNAs and investigated their mRNA expression. The PnRAD51, PnLIG4, PnKU70, PnXRCC4 and PnPCNA mRNAs were increased by γ-rays, but the PnOGG1 mRNA was decreased. Moreover, the expression of PnLIG4, PnKU70 and PnRAD51 was also up-regulated by Zeocin known as a DNA cleavage agent. These observations suggest that the morphogenesis, growth and protective gene expression in Lombardy poplars are severely affected by the DNA damage and unknown cellular events caused by γ-irradiation. - Highlights: ► Gamma rays caused morphological change and growth inhibition to Lombardy poplar. ► The nuclear DNA of Lombardy poplar was broken by γ-rays or Zeocin. ► Six cDNAs encoding DNA repair-related proteins were cloned from the Lombardy poplar. ► The expression level of those genes was increased or decreased by γ-rays. ► Some genes having been increased by γ-rays were also up-regulated by Zeocin.

  20. Immortalization and Characterization of Porcine Macrophages That Had Been Transduced with Lentiviral Vectors Encoding the SV40 Large T Antigen and Porcine Telomerase Reverse Transcriptase

    Directory of Open Access Journals (Sweden)

    Takato Takenouchi

    2017-08-01

    Full Text Available The domestic pig is an important agricultural animal, and thus, infectious diseases that affect pigs can cause severe economic losses in the global swine industry. Various porcine pathogens target macrophages, which are classical innate immune cells. Although macrophages basically protect the host from pathogens, they also seem to contribute to infectious processes. Therefore, cultured macrophages can be used to develop in vitro models for studying not only genes associated with porcine innate immunity but also the infectious processes of porcine pathogens. However, the availability of porcine macrophage cell lines is limited. In this study, we describe a novel immortalized porcine kidney-derived macrophage (IPKM cell line, which was generated by transferring the SV40 large T antigen (SV40LT and porcine telomerase reverse transcriptase (pTERT genes into primary porcine kidney-derived macrophages using lentiviral vectors. The IPKM displayed a typical macrophage morphology and was routinely passaged (doubling time: about 4 days. These cells were immunostained for macrophage markers. In addition, they exhibited substantial phagocytosis of polystyrene microbeads and released inflammatory cytokines upon lipopolysaccharide (LPS stimulation. Furthermore, the maturation and secretion of interleukin-1β were observed after nigericin-induced inflammasome activation in LPS-primed IPKM. These findings suggest that IPKM exhibit the typical inflammatory characteristics of macrophages. By transferring the SV40LT and pTERT genes using lentiviral vectors, we also successfully immortalized macrophages derived from the peripheral blood of a low-density lipoprotein receptor-deficient pig. These results suggest that the co-expression of SV40LT and pTERT is an effective way of immortalizing porcine macrophages.

  1. Generation of neutralizing monoclonal antibodies against a conformational epitope of human adenovirus type 7 (HAdv-7 incorporated in capsid encoded in a HAdv-3-based vector.

    Directory of Open Access Journals (Sweden)

    Minglong Liu

    Full Text Available The generation of monoclonal antibodies (MAbs by epitope-based immunization is difficult because the immunogenicity of simple peptides is poor and T cells must be potently stimulated and immunological memory elicited. A strategy in which antigen is incorporated into the adenoviral capsid protein has been used previously to develop antibody responses against several vaccine targets and may offer a solution to this problem. In this study, we used a similar strategy to develop HAdv-7-neutralizing MAbs using rAdMHE3 virions into which hexon hypervariable region 5 (HVR5 of adenovirus type 7 (HAdv-7 was incorporated. The epitope mutant rAdMHE3 was generated by replacing HVR5 of Ad3EGFP, a recombinant HAdv-3-based vector expressing enhanced green fluorescence protein, with HVR5 of HAdv-7. We immunized BALB/c mice with rAdMHE3 virions and produced 22 different MAbs against them, four of which showed neutralizing activity against HAdv-7 in vitro. Using an indirect enzyme-linked immunosorbent assay (ELISA analysis and an antibody-binding-competition ELISA with Ad3EGFP, HAdv-7, and a series of chimeric adenoviral particles containing epitope mutants, we demonstrated that the four MAbs recognize the neutralization site within HVR5 of the HAdv-7 virion. Using an immunoblotting analysis and ELISA with HAdv-7, recombinant peptides, and a synthetic peptide, we also showed that the neutralizing epitope within HVR5 of the HAdv-7 virion is a conformational epitope. These findings suggest that it is feasible to use a strategy in which antigen is incorporated into the adenoviral capsid protein to generate neutralizing MAbs. This strategy may also be useful for developing therapeutic neutralizing MAbs and designing recombinant vector vaccines against HAdv-7, and in structural analysis of adenoviruses.

  2. Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers

    Directory of Open Access Journals (Sweden)

    Pattana Srifah Huehne

    2013-08-01

    Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.

  3. Vector-mediated chromosomal integration of the glutamate decarboxylase gene in streptococcus thermophilus

    Science.gov (United States)

    The integrative vector pINTRS was used to transfer glutamate decarboxylase (GAD) activity to Streptococcus thermophilus ST128, thus allowing for the production of '-aminobutyric acid (GABA). In pINTRS, the gene encoding glutamate decarboxylase, gadB, was flanked by DNA fragments homologous to a S. ...

  4. Transcript level characterization of a cDNA encoding stress regulated NAC transcription factor in the mangrove plant Avicennia marina.

    Science.gov (United States)

    Ganesan, G; Sankararamasubramanian, H M; Narayanan, Jithesh M; Sivaprakash, K R; Parida, Ajay

    2008-10-01

    NAC transcription factors are a family of functionally diverse proteins responsive to biotic and abiotic stresses. A full-length cDNA isolated from the salt stressed mangrove plant Avicennia marina showed high sequence identity to NAC proteins induced upon biotic stress in tomato and potato. The predicted protein sequence had all the highly conserved sub domains characteristic of NAC domain containing proteins. Northern analysis for AmNAC1 expression under tolerable (250 mM) concentration of NaCl revealed up regulation of the transcript after 48 h and higher transcript level after 10 days of treatment. Induction of AmNAC1 after 12h of ABA treatment was similar to the treatment with stressful (500 mM) concentration of NaCl. The results suggest the involvement of AmNAC1 in early salt stress response and long-term adjustment to salt, besides a role for ABA in its expression under salt stress conditions.

  5. Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata.

    Science.gov (United States)

    Templeton, M D; Rikkerink, E H; Solon, S L; Crowhurst, R N

    1992-12-01

    The glyceraldehyde-3-phosphate dehydrogenase gene (gpdA) has been identified from a genomic DNA library prepared from the plant pathogenic fungus Glomerella cingulata. Nucleotide sequence data revealed that this gene codes for a putative 338-amino-acid protein encoded by two exons of 129 and 885 bp, separated by an intron 216 bp long. The 5' leader sequence is also spliced by an intron of 156 bp. A cDNA clone was prepared using the polymerase chain reaction, the sequence of which was used to confirm the presence of the intron in the coding sequence and the splicing of the 5' leader sequence. The transcriptional start point (tsp) was mapped at -253 nt from the site of the initiation of translation by primer extension and is adjacent to a 42-bp pyrimidine-rich region. The general structure of the 5' flanking region shows similarities to gpdA from Aspergillus nidulans. The putative protein product is 71-86% identical at the aa level to GPDs from Aspergillus nidulans, Cryphonectria parasitica, Curvularia lunata, Podospora anserina and Ustilago maydis.

  6. High-level rapid production of full-size monoclonal antibodies in plants by a single-vector DNA replicon system

    Science.gov (United States)

    Huang, Zhong; Phoolcharoen, Waranyoo; Lai, Huafang; Piensook, Khanrat; Cardineau, Guy; Zeitlin, Larry; Whaley, Kevin J.; Arntzen, Charles J.

    2010-01-01

    Plant viral vectors have great potential in rapid production of important pharmaceutical proteins. However, high-yield production of heterooligomeric proteins that require the expression and assembly of two or more protein subunits often suffers problems due to the “competing” nature of viral vectors derived from the same virus. Previously we reported that a bean yellow dwarf virus (BeYDV)-derived, three-component DNA replicon system allows rapid production of single recombinant proteins in plants (Huang et al. 2009). In this article, we report further development of this expression system for its application in high-yield production of oligomeric protein complexes including monoclonal antibodies (mAbs) in plants. We showed that the BeYDV replicon system permits simultaneous efficient replication of two DNA replicons and thus, high-level accumulation of two recombinant proteins in the same plant cell. We also demonstrated that a single vector that contains multiple replicon cassettes was as efficient as the three-component system in driving the expression of two distinct proteins. Using either the non-competing, three-vector system or the multi-replicon single vector, we produced both the heavy and light chain subunits of a protective IgG mAb 6D8 against Ebola virus GP1 (Wilson et al. 2000) at 0.5 mg of mAb per gram leaf fresh weight within 4 days post infiltration of Nicotiana benthamiana leaves. We further demonstrated that full-size tetrameric IgG complex containing two heavy and two light chains was efficiently assembled and readily purified, and retained its functionality in specific binding to inactivated Ebola virus. Thus, our single-vector replicon system provides high-yield production capacity for heterooligomeric proteins, yet eliminates the difficult task of identifying non-competing virus and the need for co-infection of multiple expression modules. The multi-replicon vector represents a significant advance in transient expression technology for

  7. Safety and immunogenicity of an oral DNA vaccine encoding Sip of Streptococcus agalactiae from Nile tilapia Oreochromis niloticus delivered by live attenuated Salmonella typhimurium.

    Science.gov (United States)

    Huang, L Y; Wang, K Y; Xiao, D; Chen, D F; Geng, Y; Wang, J; He, Y; Wang, E L; Huang, J L; Xiao, G Y

    2014-05-01

    Attenuated Salmonella typhimurium SL7207 was used as a carrier for a reconstructed DNA vaccine against Streptococcus agalactiae. A 1.02 kb DNA fragment, encoding for a portion of the surface immunogenic protein (Sip) of S. agalactiae was inserted into pVAX1. The recombinant plasmid pVAX1-sip was transfected in EPC cells to detect the transient expression by an indirect immunofluorescence assay, together with Western blot analysis. The pVAX1-sip was transformed by electroporation into SL7207. The stability of pVAX1-sip into Salmonella was over 90% after 50 generations with antibiotic selection in vitro while remained stable over 80% during 35 generations under antibiotic-free conditions. The LD50 of SL/pVAX1-sip was 1.7 × 10(11) CFU/fish by intragastric administration which indicated a quite low virulence. Tilapias were inoculated orally at 10(8) CFU/fish, the recombinant bacteria were found present in intestinal tract, spleens and livers and eventually eliminated from the tissues 4 weeks after immunization. Fish immunized at 10(7), 10(8) and 10(9) CFU/fish with different immunization times caused various levels of serum antibody and an effective protection against lethal challenge with the wild-type strain S. agalactiae. Integration studies showed that the pVAX1-sip did not integrate with tilapia chromosomes. The DNA vaccine SL/pVAX1-sip was proved to be safe and effective in protecting tilapias against S. agalactiae infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Comparative analysis and molecular characterization of a gene BANF1 encoded a DNA-binding protein during mitosis from the Giant Panda and Black Bear.

    Science.gov (United States)

    Zeng, Yichun; Hou, Yi-Ling; Ding, Xiang; Hou, Wan-Ru; Li, Jian

    2014-01-01

    Barrier to autointegration factor 1 (BANF1) is a DNA-binding protein found in the nucleus and cytoplasm of eukaryotic cells that functions to establish nuclear architecture during mitosis. The cDNA and the genomic sequence of BANF1 were cloned from the Giant Panda (Ailuropoda melanoleuca) and Black Bear (Ursus thibetanus mupinensis) using RT-PCR technology and Touchdown-PCR, respectively. The cDNA of the BANF1 cloned from Giant Panda and Black Bear is 297 bp in size, containing an open reading frame of 270 bp encoding 89 amino acids. The length of the genomic sequence from Giant Panda is 521 bp, from Black Bear is 536 bp, which were found both to possess 2 exons. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to some mammalian species studied. Topology prediction showed there is one Protein kinase C phosphorylation site, one Casein kinase II phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Giant Panda, and there is one Protein kinase C phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Black Bear. The BANF1 gene can be readily expressed in E. coli. Results showed that the protein BANF1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 14 kD polypeptide that formed inclusion bodies. The expression products obtained could be used to purify the proteins and study their function further.

  9. DNA vaccines encoding antigen targeted to MHC class II induce influenza specific CD8+ T cell responses, enabling faster resolution of influenza disease.

    Directory of Open Access Journals (Sweden)

    Laura Lambert

    2016-08-01

    Full Text Available Current influenza vaccines are effective but imperfect, failing to cover against emerging strains of virus and requiring seasonal administration to protect against new strains. A key step to improving influenza vaccines is to improve our understanding of vaccine induced protection. Whilst it is clear that antibodies play a protective role, vaccine induced CD8+ T cells can improve protection. To further explore the role of CD8+ T cells we used a DNA vaccine that encodes antigen dimerised to an immune cell targeting module. Immunising CB6F1 mice with the DNA vaccine in a heterologous prime boost regime with the seasonal protein vaccine improved the resolution of influenza disease compared to protein alone. This improved disease resolution was dependent on CD8+ T cells. However, DNA vaccine regimes that induced CD8+ T cells alone were not protective and did not boost the protection provided by protein. The MHC targeting module used was an anti-I-Ed single chain antibody specific to the BALB/c strain of mice. To test the role of MHC targeting we compared the response between BALB/c, C57BL/6 mice and an F1 cross of the two strains (CB6F1. BALB/c mice were protected, C57BL/6 were not and the F1 had an intermediate phenotype; showing that the targeting of antigen is important in the response. Based on these findings, and in agreement with other studies using different vaccines, we conclude that in addition to antibody, inducing a protective CD8 response is important in future influenza vaccines.

  10. DNA Vaccines Encoding Antigen Targeted to MHC Class II Induce Influenza-Specific CD8+ T Cell Responses, Enabling Faster Resolution of Influenza Disease

    Science.gov (United States)

    Lambert, Laura; Kinnear, Ekaterina; McDonald, Jacqueline U.; Grodeland, Gunnveig; Bogen, Bjarne; Stubsrud, Elisabeth; Lindeberg, Mona M.; Fredriksen, Agnete Brunsvik; Tregoning, John S.

    2016-01-01

    Current influenza vaccines are effective but imperfect, failing to cover against emerging strains of virus and requiring seasonal administration to protect against new strains. A key step to improving influenza vaccines is to improve our understanding of vaccine-induced protection. While it is clear that antibodies play a protective role, vaccine-induced CD8+ T cells can improve protection. To further explore the role of CD8+ T cells, we used a DNA vaccine that encodes antigen dimerized to an immune cell targeting module. Immunizing CB6F1 mice with the DNA vaccine in a heterologous prime-boost regime with the seasonal protein vaccine improved the resolution of influenza disease compared with protein alone. This improved disease resolution was dependent on CD8+ T cells. However, DNA vaccine regimes that induced CD8+ T cells alone were not protective and did not boost the protection provided by protein. The MHC-targeting module used was an anti-I-Ed single chain antibody specific to the BALB/c strain of mice. To test the role of MHC targeting, we compared the response between BALB/c, C57BL/6 mice, and an F1 cross of the two strains (CB6F1). BALB/c mice were protected, C57BL/6 were not, and the F1 had an intermediate phenotype; showing that the targeting of antigen is important in the response. Based on these findings, and in agreement with other studies using different vaccines, we conclude that, in addition to antibody, inducing a protective CD8 response is important in future influenza vaccines. PMID:27602032

  11. Cloning and functional expression of a cDNA encoding stearoyl-ACP Δ9-desaturase from the endosperm of coconut (Cocos nucifera L.).

    Science.gov (United States)

    Gao, Lingchao; Sun, Ruhao; Liang, Yuanxue; Zhang, Mengdan; Zheng, Yusheng; Li, Dongdong

    2014-10-01

    Coconut (Cocos nucifera L.) is an economically tropical fruit tree with special fatty acid compositions. The stearoyl-acyl carrier protein (ACP) desaturase (SAD) plays a key role in the properties of the majority of cellular glycerolipids. In this paper, a full-length cDNA of a stearoyl-acyl carrier protein desaturase, designated CocoFAD, was isolated from cDNA library prepared from the endosperm of coconut (C. nucifera L.). An 1176 bp cDNA from overlapped PCR products containing ORF encoding a 391-amino acid (aa) protein was obtained. The coded protein was virtually identical and shared the homology to other Δ9-desaturase plant sequences (greater than 80% as similarity to that of Elaeis guineensis Jacq). The real-time fluorescent quantitative PCR result indicated that the yield of CocoFAD was the highest in the endosperm of 8-month-old coconut and leaf, and the yield was reduced to 50% of the highest level in the endosperm of 15-month-old coconut. The coding region showed heterologous expression in strain INVSc1 of yeast (Saccharomyces cerevisiae). GC-MS analysis showed that the levels of palmitoleic acid (16:1) and oleic acid (18:1) were improved significantly; meanwhile stearic acid (18:0) was reduced. These results indicated that the plastidial Δ9 desaturase from the endosperm of coconut was involved in the biosynthesis of hexadecenoic acid and octadecenoic acid, which was similar with other plants. These results may be valuable for understanding the mechanism of fatty acid metabolism and the genetic improvement of CocoFAD gene in palm plants in the future. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. DNA Vaccines Encoding Antigen Targeted to MHC Class II Induce Influenza-Specific CD8(+) T Cell Responses, Enabling Faster Resolution of Influenza Disease.

    Science.gov (United States)

    Lambert, Laura; Kinnear, Ekaterina; McDonald, Jacqueline U; Grodeland, Gunnveig; Bogen, Bjarne; Stubsrud, Elisabeth; Lindeberg, Mona M; Fredriksen, Agnete Brunsvik; Tregoning, John S

    2016-01-01

    Current influenza vaccines are effective but imperfect, failing to cover against emerging strains of virus and requiring seasonal administration to protect against new strains. A key step to improving influenza vaccines is to improve our understanding of vaccine-induced protection. While it is clear that antibodies play a protective role, vaccine-induced CD8(+) T cells can improve protection. To further explore the role of CD8(+) T cells, we used a DNA vaccine that encodes antigen dimerized to an immune cell targeting module. Immunizing CB6F1 mice with the DNA vaccine in a heterologous prime-boost regime with the seasonal protein vaccine improved the resolution of influenza disease compared with protein alone. This improved disease resolution was dependent on CD8(+) T cells. However, DNA vaccine regimes that induced CD8(+) T cells alone were not protective and did not boost the protection provided by protein. The MHC-targeting module used was an anti-I-E(d) single chain antibody specific to the BALB/c strain of mice. To test the role of MHC targeting, we compared the response between BALB/c, C57BL/6 mice, and an F1 cross of the two strains (CB6F1). BALB/c mice were protected, C57BL/6 were not, and the F1 had an intermediate phenotype; showing that the targeting of antigen is important in the response. Based on these findings, and in agreement with other studies using different vaccines, we conclude that, in addition to antibody, inducing a protective CD8 response is important in future influenza vaccines.

  13. DNA Vaccine Encoding the Chimeric Form of Schistosoma mansoni Sm-TSP2 and Sm29 Confers Partial Protection against Challenge Infection.

    Science.gov (United States)

    Gonçalves de Assis, Natan Raimundo; Batistoni de Morais, Suellen; Figueiredo, Bárbara Castro Pimentel; Ricci, Natasha Delaqua; de Almeida, Leonardo Augusto; da Silva Pinheiro, Carina; Martins, Vicente de Paulo; Oliveira, Sergio Costa

    2015-01-01

    Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2) are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed.

  14. DNA Vaccine Encoding the Chimeric Form of Schistosoma mansoni Sm-TSP2 and Sm29 Confers Partial Protection against Challenge Infection.

    Directory of Open Access Journals (Sweden)

    Natan Raimundo Gonçalves de Assis

    Full Text Available Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2 are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed.

  15. LV305, a dendritic cell-targeting integration-deficient ZVex(TM)-based lentiviral vector encoding NY-ESO-1, induces potent anti-tumor immune response.

    Science.gov (United States)

    Albershardt, Tina Chang; Campbell, David James; Parsons, Andrea Jean; Slough, Megan Merrill; Ter Meulen, Jan; Berglund, Peter

    2016-01-01

    We have engineered an integration-deficient lentiviral vector, LV305, to deliver the tumor antigen NY-ESO-1 to human dendritic cells in vivo through pseudotyping with a modified Sindbis virus envelop protein. Mice immunized once with LV305 developed strong, dose-dependent, multifunctional, and cytotoxic NY-ESO-1-specific cluster of differentiation 8 (CD8) T cells within 14 days post-immunization and could be boosted with LV305 at least twice to recall peak-level CD8 T-cell responses. Immunization with LV305 protected mice against tumor growth in an NY-ESO-1-expressing CT26 lung metastasis model, with the protective effect abrogated upon depletion of CD8 T cells. Adoptive transfer of CD8 T cells, alone or together with CD4 T cells or natural killer cells, from LV305-immunized donor mice to tumor-bearing recipient mice conferred significant protection against metastatic tumor growth. Biodistribution of injected LV305 in mice was limited to the site of injection and the draining lymph node, and injected LV305 exhibited minimal excretion. Mice injected with LV305 developed little to no adverse effects, as evaluated by toxicology studies adherent to good laboratory practices. Taken together, these data support the development of LV305 as a clinical candidate for treatment against tumors expressing NY-ESO-1.

  16. LV305, a dendritic cell-targeting integration-deficient ZVexTM-based lentiviral vector encoding NY-ESO-1, induces potent anti-tumor immune response

    Science.gov (United States)

    Albershardt, Tina Chang; Campbell, David James; Parsons, Andrea Jean; Slough, Megan Merrill; ter Meulen, Jan; Berglund, Peter

    2016-01-01

    We have engineered an integration-deficient lentiviral vector, LV305, to deliver the tumor antigen NY-ESO-1 to human dendritic cells in vivo through pseudotyping with a modified Sindbis virus envelop protein. Mice immunized once with LV305 developed strong, dose-dependent, multifunctional, and cytotoxic NY-ESO-1-specific cluster of differentiation 8 (CD8) T cells within 14 days post-immunization and could be boosted with LV305 at least twice to recall peak-level CD8 T-cell responses. Immunization with LV305 protected mice against tumor growth in an NY-ESO-1-expressing CT26 lung metastasis model, with the protective effect abrogated upon depletion of CD8 T cells. Adoptive transfer of CD8 T cells, alone or together with CD4 T cells or natural killer cells, from LV305-immunized donor mice to tumor-bearing recipient mice conferred significant protection against metastatic tumor growth. Biodistribution of injected LV305 in mice was limited to the site of injection and the draining lymph node, and injected LV305 exhibited minimal excretion. Mice injected with LV305 developed little to no adverse effects, as evaluated by toxicology studies adherent to good laboratory practices. Taken together, these data support the development of LV305 as a clinical candidate for treatment against tumors expressing NY-ESO-1. PMID:27626061

  17. Enhancement of protective efficacy through adenoviral vectored vaccine priming and protein boosting strategy encoding triosephosphate isomerase (SjTPI) against Schistosoma japonicum in mice.

    Science.gov (United States)

    Dai, Yang; Wang, Xiaoting; Tang, Jianxia; Zhao, Song; Xing, Yuntian; Dai, Jianrong; Jin, Xiaolin; Zhu, Yinchang

    2015-01-01

    Schistosomiasis japonica is a zoonotic parasitic disease; developing transmission blocking veterinary vaccines are urgently needed for the prevention and control of schistosomiasis in China. Heterologous prime-boost strategy, a novel vaccination approach, is more effective in enhancing vaccine efficacy against multiple pathogens. In the present study, we established a novel heterologous prime-boost vaccination strategy, the rAdV-SjTPI.opt intramuscular priming and rSjTPI subcutaneous boosting strategy, and evaluated its protective efficacy against Schistosoma japonicum in mice. Adenoviral vectored vaccine (rAdV-SjTPI.opt) and recombinant protein vaccine (rSjTPI) were prepared and used in different combinations as vaccines in a mouse model. The specific immune responses and protective efficacies were evaluated. Furthermore, the longevity of protective efficacy was also determined. Results showed that the rAdV-SjTPI.opt priming-rSjTPI boosting strategy elicited higher levels of specific IgG responses and broad-spectrum specific cellular immune responses. The protective efficacy could reach up to nearly 70% and 50% of protection could be observed at 10 weeks after the last immunization in mice. The rAdV-SjTPI.opt intramuscular priming-rSjTPI subcutaneous boosting vaccination strategy is a novel, highly efficient, and stable approach to developing vaccines against Schistosoma japonicum infections in China.

  18. Enhancement of protective efficacy through adenoviral vectored vaccine priming and protein boosting strategy encoding triosephosphate isomerase (SjTPI against Schistosoma japonicum in mice.

    Directory of Open Access Journals (Sweden)

    Yang Dai

    Full Text Available Schistosomiasis japonica is a zoonotic parasitic disease; developing transmission blocking veterinary vaccines are urgently needed for the prevention and control of schistosomiasis in China. Heterologous prime-boost strategy, a novel vaccination approach, is more effective in enhancing vaccine efficacy against multiple pathogens. In the present study, we established a novel heterologous prime-boost vaccination strategy, the rAdV-SjTPI.opt intramuscular priming and rSjTPI subcutaneous boosting strategy, and evaluated its protective efficacy against Schistosoma japonicum in mice.Adenoviral vectored vaccine (rAdV-SjTPI.opt and recombinant protein vaccine (rSjTPI were prepared and used in different combinations as vaccines in a mouse model. The specific immune responses and protective efficacies were evaluated. Furthermore, the longevity of protective efficacy was also determined. Results showed that the rAdV-SjTPI.opt priming-rSjTPI boosting strategy elicited higher levels of specific IgG responses and broad-spectrum specific cellular immune responses. The protective efficacy could reach up to nearly 70% and 50% of protection could be observed at 10 weeks after the last immunization in mice.The rAdV-SjTPI.opt intramuscular priming-rSjTPI subcutaneous boosting vaccination strategy is a novel, highly efficient, and stable approach to developing vaccines against Schistosoma japonicum infections in China.

  19. Cloning of a cDNA encoding a surface antigen of Schistosoma mansoni schistosomula recognized by sera of vassinated mice

    International Nuclear Information System (INIS)

    Dalton, J.P.; Tom, T.D.; Strand, M.

    1987-01-01

    Spleen cells of mice vaccinated with radiation-attenuated Schistosoma mansoni cercariae were used to produce monoclonal antibodies directed against newly transformed schistosomular surface antigens. One of these monoclonal antibodies recognized a polypeptide of 18 kDa. Binding was measured by radioimmunoassay. This glycoprotein was purified by monoclonal antibody immunoaffinity chromatography and a polyclonal antiserum was prepared against it. Immunofluorescence assays showed that the polyclonal antiserum bound to the surface of newly transformed schistosomula and lung-stage organisms but not to the surface of liver-stage and adult worms. Using this polyclonal antiserum we isolated recombinant clones from an adult worm cDNA expression library constructed in λgt11. Clone 654.2 contained an insert of 0.52 kilobase and hybridized to a 1.2-kilobase mRNA species from adult worms. Most importantly, clone 654.2 produced a fusion protein of 125 kDa that was reactive with sera of vaccinated mice that are capable of transferring resistance. This result encourages future vaccination trials with the fusion protein

  20. Identification and expression analysis of cDNA encoding chitinase-like protein (CLP) gene in Japanese scallop Mizuhopecten yessoensis.

    Science.gov (United States)

    Gao, L; Xu, G J; Su, H; Gao, X G; Li, Y F; Bao, X B; Liu, W D; He, C B

    2014-12-18

    Chitinase-like proteins (CLP) are important members of the glycoside hydrolase family 18 (GH18) and are involved in growth control and remodeling processes. In this study, a CLP transcript was isolated and sequenced from the Japanese scallop (Mizuhopecten yessoensis) after screening expressed sequence tags. The full-length complementary DNA of M. yessoensis CLP (My-Clp1) was 1555 bp in length, consisting of a 75-bp 5'-untranslated region (UTR), a 160-bp 3'-UTR, and a 1320-bp open reading frame bearing characteristics of the GH18 family. The My-Clp1 protein was well conserved, with similar domain structures and architecture across species (e.g., from mollusks to mammals). Expression analysis in healthy tissues and across developmental stages revealed a strong preference for expression; My-Clp1 was abundantly expressed in the mantle and throughout metamorphosis, which suggests the involvement of My-Clp1 in the synthesis of extracellular components, and tissue degeneration and remodeling. My-Clp1 expression was induced after infection with a bacterial pathogen, Vibrio anguillarum, suggesting its involvement in immunity against this intracellular pathogen.

  1. DNA vaccination with a plasmid encoding LACK-TSA fusion against Leishmania major infection in BALB/c mice.

    Science.gov (United States)

    Maspi, N; Ghaffarifar, F; Sharifi, Z; Dalimi, A; Khademi, S Z

    2017-12-01

    Vaccination would be the most important strategy for the prevention and elimination of leishmaniasis. The aim of the present study was to compare the immune responses induced following DNA vaccination with LACK (Leishmania analogue of the receptor kinase C), TSA (Thiol-specific-antioxidant) genes alone or LACK-TSA fusion against cutaneous leishmaniasis (CL). Cellular and humoral immune responses were evaluated before and after challenge with Leishmania major (L. major). In addition, the mean lesion size was also measured from 3th week post-infection. All immunized mice showed a partial immunity characterized by higher interferon (IFN)-γ and Immunoglobulin G (IgG2a) levels compared to control groups (pLACK-TSA fusion. Mean lesion sizes reduced significantly in all immunized mice compared with control groups at 7th week post-infection (pLACK-TSA and TSA groups than LACK group after challenge (pLACK and TSA antigens against CL. Furthermore, this study demonstrated that a bivalent vaccine can induce stronger immune responses and protection against infectious challenge with L. major.

  2. [Creation of DNA vaccine vector based on codon-optimized gene of rabies virus glycoprotein (G protein) with consensus amino acid sequence].

    Science.gov (United States)

    Starodubova, E S; Kuzmenko, Y V; Latanova, A A; Preobrazhenskaya, O V; Karpov, V L

    2016-01-01

    An optimized design of the rabies virus glycoprotein (G protein) for use within DNA vaccines has been suggested. The design represents a territorially adapted antigen constructed taking into account glycoprotein amino acid sequences of the rabies viruses registered in the Russian Federation and the vaccine Vnukovo-32 strain. Based on the created consensus amino acid sequence, the nucleotide codon-optimized sequence of this modified glycoprotein was obtained and cloned into the pVAX1 plasmid (a vector of the last generation used in the creation of DNA vaccines). A twofold increase in this gene expression compared to the expression of the Vnukovo-32 strain viral glycoprotein gene in a similar vector was registered in the transfected cell culture. It has been demonstrated that the accumulation of modified G protein exceeds the number of the control protein synthesized using the plasmid with the Vnukovo-32 strain viral glycoprotein gene by 20 times. Thus, the obtained modified rabies virus glycoprotein can be considered to be a promising DNA vaccine antigen.

  3. Production of glycosylated physiologically normal human α1-antitrypsin by mouse fibroblasts modified by insertion of a human α1-antitrypsin cDNA using a retroviral vector

    International Nuclear Information System (INIS)

    Garver, R.I. Jr.; Chytil, A.; Karlsson, S.

    1987-01-01

    α 2 -Antitrypsin (α 1 AT) deficiency is a hereditary disorder characterized by reduced serum levels of α 1 AT, resulting in destruction of the lower respiratory tract by neutrophil elastase. As an approach to augment α 1 AT levels in this disorder with physiologically normal human α 1 AT, the authors have integrated a full-length normal human α 1 AT cDNA into the genome of mouse fibroblasts. To accomplish this, the retroviral vector N2 was modified by inserting the simian virus 40 early promoter followed by the α 1 AT cDNA. Southern analysis demonstrated that the intact cDNA was present in the genome of selected clones of the transfected murine fibroblasts psi2 and infected NIH 3T3. The clones produced three mRNA transcripts containing human α 1 AT sequences, secreted an α 1 AT molecule recognized by an anti-human α 1 AT antibody, with the same molecular mass as normal human α 1 AT and that complexed with and inhibited human neutrophil elastase. The psi2 produced α 1 AT was glycosylated, and when infused intravenously into mice, it had a serum half-life similar to normal α 1 AT purified from human plasma and markedly longer than that of nonglycosylated human α 1 AT cDNA-directed yeast-produced α 1 AT. These studies demonstrate the feasibility of using a retroviral vector to insert the normal human α 1 AT cDNA into non-α 1 AT-producing cells, resulting in the synthesis and secretion of physiologically normal α 1 AT

  4. Vector optimization and needle-free intradermal application of a broadly protective polyvalent influenza A DNA vaccine for pigs and humans

    DEFF Research Database (Denmark)

    Borggren, Marie; Nielsen, Jens; Bragstad, Karoline

    2015-01-01

    expressed by next-generation vectors. These new vectors can improve gene expression, but they are also efficiently produced on large scales and comply with regulatory guidelines by avoiding antibiotic resistance genes. In addition, a new needle-free delivery of the vaccine, convenient for mass vaccinations......The threat posed by the 2009 pandemic H1N1 virus emphasized the need for new influenza A virus vaccines inducing a broad cross-protective immune response for use in both humans and pigs. An effective and broad influenza vaccine for pigs would greatly benefit the pork industry and contribute...... to public health by diminishing the risk of emerging highly pathogenic reassortants. Current inactivated protein vaccines against swine influenza produce only short-lived immunity and have no efficacy against heterologous strains. DNA vaccines are a potential alternative with advantages...

  5. Lineage analysis of the late otocyst stage mouse inner ear by transuterine microinjection of a retroviral vector encoding alkaline phosphatase and an oligonucleotide library.

    Directory of Open Access Journals (Sweden)

    Han Jiang

    Full Text Available The mammalian inner ear subserves the special senses of hearing and balance. The auditory and vestibular sensory epithelia consist of mechanically sensitive hair cells and associated supporting cells. Hearing loss and balance dysfunction are most frequently caused by compromise of hair cells and/or their innervating neurons. The development of gene- and cell-based therapeutics will benefit from a thorough understanding of the molecular basis of patterning and cell fate specification in the mammalian inner ear. This includes analyses of cell lineages and cell dispersals across anatomical boundaries (such as sensory versus nonsensory territories. The goal of this study was to conduct retroviral lineage analysis of the embryonic day 11.5(E11.5 mouse otic vesicle. A replication-defective retrovirus encoding human placental alkaline phosphatase (PLAP and a variable 24-bp oligonucleotide tag was microinjected into the E11.5 mouse otocyst. PLAP-positive cells were microdissected from cryostat sections of the postnatal inner ear and subjected to nested PCR. PLAP-positive cells sharing the same sequence tag were assumed to have arisen from a common progenitor and are clonally related. Thirty five multicellular clones consisting of an average of 3.4 cells per clone were identified in the auditory and vestibular sensory epithelia, ganglia, spiral limbus, and stria vascularis. Vestibular hair cells in the posterior crista were related to one another, their supporting cells, and nonsensory epithelial cells lining the ampulla. In the organ of Corti, outer hair cells were related to a supporting cell type and were tightly clustered. By contrast, spiral ganglion neurons, interdental cells, and Claudius' cells were related to cells of the same type and could be dispersed over hundreds of microns. These data contribute new information about the developmental potential of mammalian otic precursors in vivo.

  6. “Direct cloning in Lactobacillus plantarum: Electroporation with non-methylated plasmid DNA enhances transformation efficiency and makes shuttle vectors obsolete”

    Directory of Open Access Journals (Sweden)

    Spath Katharina

    2012-10-01

    Full Text Available Abstract Background Lactic acid bacteria (LAB play an important role in agricultural as well as industrial biotechnology. Development of improved LAB strains using e.g. library approaches is often limited by low transformation efficiencies wherefore one reason could be differences in the DNA methylation patterns between the Escherichia coli intermediate host for plasmid amplification and the final LAB host. In the present study, we examined the influence of DNA methylation on transformation efficiency in LAB and developed a direct cloning approach for Lactobacillus plantarum CD033. Therefore, we propagated plasmid pCD256 in E. coli strains with different dam/dcm-methylation properties. The obtained plasmid DNA was purified and transformed into three different L. plantarum strains and a selection of other LAB species. Results Best transformation efficiencies were obtained using the strain L. plantarum CD033 and non-methylated plasmid DNA. Thereby we achieved transformation efficiencies of ~ 109 colony forming units/μg DNA in L. plantarum CD033 which is in the range of transformation efficiencies reached with E. coli. Based on these results, we directly transformed recombinant expression vectors received from PCR/ligation reactions into L. plantarum CD033, omitting plasmid amplification in E. coli. Also this approach was successful and yielded a sufficient number of recombinant clones. Conclusions Transformation efficiency of L. plantarum CD033 was drastically increased when non-methylated plasmid DNA was used, providing the possibility to generate expression libraries in this organism. A direct cloning approach, whereby ligated PCR-products where successfully transformed directly into L. plantarum CD033, obviates the construction of shuttle vectors containing E. coli-specific sequences, as e.g. a ColEI origin of replication, and makes amplification of these vectors in E. coli obsolete. Thus, plasmid constructs become much smaller and occasional

  7. Improved humoral and cellular immune responses against the gp120 V3 loop of HIV-1 following genetic immunization with a chimeric DNA vaccine encoding the V3 inserted into the hepatitis B surface antigen

    DEFF Research Database (Denmark)

    Fomsgaard, A; Nielsen, H V; Bryder, K

    1998-01-01

    by gene gun was used for genetic immunization in a mouse model. Antibody and CTL responses to MN V3 and HBsAg were measured and compared with the immune responses obtained after vaccination with plasmids encoding the complete HIV-1 MN gp160 and HBsAg (pre-S2 + S), respectively. DNA vaccination...

  8. A DNA vaccine encoding multiple HIV CD4 epitopes elicits vigorous polyfunctional, long-lived CD4+ and CD8+ T cell responses.

    Directory of Open Access Journals (Sweden)

    Daniela Santoro Rosa

    Full Text Available T-cell based vaccines against HIV have the goal of limiting both transmission and disease progression by inducing broad and functionally relevant T cell responses. Moreover, polyfunctional and long-lived specific memory T cells have been associated to vaccine-induced protection. CD4(+ T cells are important for the generation and maintenance of functional CD8(+ cytotoxic T cells. We have recently developed a DNA vaccine encoding 18 conserved multiple HLA-DR-binding HIV-1 CD4 epitopes (HIVBr18, capable of eliciting broad CD4(+ T cell responses in multiple HLA class II transgenic mice. Here, we evaluated the breadth and functional profile of HIVBr18-induced immune responses in BALB/c mice. Immunized mice displayed high-magnitude, broad CD4(+/CD8(+ T cell responses, and 8/18 vaccine-encoded peptides were recognized. In addition, HIVBr18 immunization was able to induce polyfunctional CD4(+ and CD8(+ T cells that proliferate and produce any two cytokines (IFNγ/TNFα, IFNγ/IL-2 or TNFα/IL-2 simultaneously in response to HIV-1 peptides. For CD4(+ T cells exclusively, we also detected cells that proliferate and produce all three tested cytokines simultaneously (IFNγ/TNFα/IL-2. The vaccine also generated long-lived central and effector memory CD4(+ T cells, a desirable feature for T-cell based vaccines. By virtue of inducing broad, polyfunctional and long-lived T cell responses against conserved CD4(+ T cell epitopes, combined administration of this vaccine concept may provide sustained help for CD8(+ T cells and antibody responses- elicited by other HIV immunogens.

  9. Acquisition of apparent DNA slippage structures during extensive evolutionary divergence of pcaD and catD genes encoding identical catalytic activities in Acinetobacter calcoaceticus.

    Science.gov (United States)

    Hartnett, G B; Ornston, L N

    1994-05-03

    The pca operon from the Gram- bacterium Acinetobacter calcoaceticus encodes all of the enzymes required for catabolism of protocatechuate to common intermediary metabolites. This report presents the 2754-nucleotide (nt) sequence of a HindIII restriction fragment containing pcaD, the 801-bp gene encoding beta-ketoadipate enol-lactone hydrolase I. The deduced primary structure of A. calcoaceticus PcaD shares 44% amino acid (aa) sequence identity with the aligned primary structure of CatD (beta-ketoadipate enol-lactone hydrolase II) from the same organism, and the overall nt sequence identity of the two genes is 51.8%. In the 56% of the genes where selection for identical aa residues was not imposed, pcaD and catD have diverged so extensively that nt sequence identity of the aligned segments is only 28.2%; the G+C contents of these segments from the respective genes differ by 8%. Conserved within the aligned PcaD and CatD aa sequences is a Ser residue corresponding to the nucleophile within the alpha/beta-fold of many hydrolytic enzymes. In this region of primary structure, PcaD and CatD appear to have maintained some different aa sequences derived from a common ancestor. Conservation of the different aa sequences during extreme evolutionary divergence suggests that separate segments of primary structure, conserved within either PcaD or CatD, may be functionally incompatible within recombinant enzymes. Consequently, selection for avoidance of genetic exchange between pcaD and catD could account for the thorough nt substitution in regions where identical aa were not selected. Sequence repetitions within pcaD suggest that the multiple mutations required for its extensive divergence from catD were achieved in part by acquisition of a complex DNA slippage structure.

  10. High-efficiency system for the construction of adenovirus vectors and its application to the generation of representative adenovirus-based cDNA expression libraries.

    Science.gov (United States)

    Hillgenberg, Moritz; Hofmann, Christian; Stadler, Herbert; Löser, Peter

    2006-06-01

    We here describe a convenient system for the production of recombinant adenovirus vectors and its use for the construction of a representative adenovirus-based cDNA expression library. The system is based on direct site-specific insertion of transgene cassettes into a replicating donor virus. The transgene is inserted into a donor plasmid containing the viral 5' inverted terminal repeat, the complete viral packaging signal, and a single loxP site. The plasmid is then transfected into a Cre recombinase-expressing packaging cell line that has been infected with a donor virus containing a partially deleted packaging signal flanked by loxP sites. Cre recombinase, by two steps of action, sequentially catalyzes the generation of a nonpackageable donor virus acceptor substrate and the generation of the desired recombinant adenovirus vector. Due to its growth impairment, residual donor virus can efficiently be counterselected during amplification of the recombinant adenovirus vector. By using this adenovirus construction system, a plasmid-based human liver cDNA library was converted by a single step into an adenovirus-based cDNA expression library with about 10(6) independent adenovirus clones. The high-titer purified library was shown to contain about 44% of full-length cDNAs with an average insert size of 1.3 kb. cDNAs of a gene expressed at a high level (human alpha(1)-antitrypsin) and a gene expressed at a relatively low level (human coagulation factor IX) in human liver were isolated from the adenovirus-based library using an enzyme-linked immunosorbent assay-based screening procedure.

  11. Retroviral DNA Integration

    Science.gov (United States)

    2016-01-01

    The integration of a DNA copy of the viral RNA genome into host chromatin is the defining step of retroviral replication. This enzymatic process is catalyzed by the virus-encoded integrase protein, which is conserved among retroviruses and LTR-retrotransposons. Retroviral integration proceeds via two integrase activities: 3′-processing of the viral DNA ends, followed by the strand transfer of the processed ends into host cell chromosomal DNA. Herein we review the molecular mechanism of retroviral DNA integration, with an emphasis on reaction chemistries and architectures of the nucleoprotein complexes involved. We additionally discuss the latest advances on anti-integrase drug development for the treatment of AIDS and the utility of integrating retroviral vectors in gene therapy applications. PMID:27198982

  12. Efficient cDNA cloning by direct phenotypic correction of a mutant human cell line (HPRT-) using an Epstein-Barr virus derived cDNA expression vector.

    NARCIS (Netherlands)

    P.B.G.M. Belt; W. Jongmans; J. de Wit (Jan); J.H.J. Hoeijmakers (Jan); C.M.P. Backendorf (Claude); P. van de Putte (Pieter)

    1991-01-01

    textabstractHuman cells are, in general, poor recipients of foreign DNA, which has severely hampered the cloning of genes by direct phenotypic correction of deficient human cell lines after DNA mediated gene transfer. In this communication a methodology is presented which largely circumvents this

  13. A Bacteriophage-Encoded J-Domain Protein Interacts with the DnaK/Hsp70 Chaperone and Stabilizes the Heat-Shock Factor σ32 of Escherichia coli

    Science.gov (United States)

    Perrody, Elsa; Cirinesi, Anne-Marie; Desplats, Carine; Keppel, France; Schwager, Françoise; Tranier, Samuel; Georgopoulos, Costa; Genevaux, Pierre

    2012-01-01

    The universally conserved J-domain proteins (JDPs) are obligate cochaperone partners of the Hsp70 (DnaK) chaperone. They stimulate Hsp70's ATPase activity, facilitate substrate delivery, and confer specific cellular localization to Hsp70. In this work, we have identified and characterized the first functional JDP protein encoded by a bacteriophage. Specifically, we show that the ORFan gene 057w of the T4-related enterobacteriophage RB43 encodes a bona fide JDP protein, named Rki, which specifically interacts with the Escherichia coli host multifunctional DnaK chaperone. However, in sharp contrast with the three known host JDP cochaperones of DnaK encoded by E. coli, Rki does not act as a generic cochaperone in vivo or in vitro. Expression of Rki alone is highly toxic for wild-type E. coli, but toxicity is abolished in the absence of endogenous DnaK or when the conserved J-domain of Rki is mutated. Further in vivo analyses revealed that Rki is expressed early after infection by RB43 and that deletion of the rki gene significantly impairs RB43 proliferation. Furthermore, we show that mutations in the host dnaK gene efficiently suppress the growth phenotype of the RB43 rki deletion mutant, thus indicating that Rki specifically interferes with DnaK cellular function. Finally, we show that the interaction of Rki with the host DnaK chaperone rapidly results in the stabilization of the heat-shock factor σ32, which is normally targeted for degradation by DnaK. The mechanism by which the Rki-dependent stabilization of σ32 facilitates RB43 bacteriophage proliferation is discussed. PMID:23133404

  14. Molecular cloning and expression of mouse and human cDNA encoding AES and ESG proteins with strong similarity to Drosophila enhancer of split groucho protein.

    Science.gov (United States)

    Miyasaka, H; Choudhury, B K; Hou, E W; Li, S S

    1993-08-15

    Mouse and human cDNA encoding AES (amino-terminal enhancer of split) and ESG (enhancer of split groucho) proteins with strong similarity to Drosophila enhancer of split groucho protein were isolated and sequenced. Mouse AES-1 and AES-2 proteins, probably resulting from alternative splicing, contain 202 and 196 amino acids, respectively, while mouse ESG protein consists of 771 amino acids. The amino acid sequences of mouse and human AES proteins were found to exhibit approximately 50% identity to the amino-terminal region of Drosophila groucho, mouse ESG and human transducin-like enhancer of split (TLE) proteins. Mouse AES transcripts of 1.5 kb and 1.2 kb were abundantly expressed in muscle, heart and brain. Human AES transcripts of 1.6 kb and 1.4 kb were predominantly present in muscle, heart and placenta. Mouse ESG (homolog of human TLE 3) transcripts of 3.3 kb and 4.0 kb were found only in testis, while human TLE 1 transcripts of 4.5 kb was more abundant in muscle and placenta compared to heart, brain, lung, liver, kidney and pancreas. Human AES, TLE 1 and TLE 3 genes were mapped to chromosomes 19, 9 and 15, respectively, using human and Chinese hamster hybrid cell lines.

  15. Isolation and characterization of a cDNA encoding phytochrome A in the non-photosynthetic parasitic plant, Orobanche minor Sm.

    Science.gov (United States)

    Trakulnaleamsai, Chitra; Okazawa, Atsushi; An, Chung-Il; Kajiyama, Shin'ichiro; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio

    2005-01-01

    In this study, the isolation and characterization of a phytochrome A (PHYA) homologous cDNA (OmPHYA) in the non-photosynthetic holoparasitic plant Orobanche minor are described. The present findings provide the first report of the presence of a PHYA homolog in the holoparasite. This study found that OmPHYA is of similar size to the other PHYAs of green plants and shows 72, 77, and 77% amino acid sequence identity with PHYA in Arabidopsis, potato, and tobacco respectively. The OmPHYA contains a conserved chromophore attachment cysteine at position 323. Although OmPHYA shows high sequence identity with other PHYAs in green plants, 13 amino acid substitutions located in both the N and C-terminal domains are observed (a total of 26 amino acids). OmPHYA is encoded by a single gene within the O. minor genome. The abundance of the OmPHYA transcript as well as nuclear translocation of OmphyA occurs in a light-dependent manner.

  16. A Recombinant DNA Plasmid Encoding the sIL-4R-NAP Fusion Protein Suppress Airway Inflammation in an OVA-Induced Mouse Model of Asthma.

    Science.gov (United States)

    Liu, Xin; Fu, Guo; Ji, Zhenyu; Huang, Xiabing; Ding, Cong; Jiang, Hui; Wang, Xiaolong; Du, Mingxuan; Wang, Ting; Kang, Qiaozhen

    2016-08-01

    Asthma is a chronic inflammatory airway disease. It was prevalently perceived that Th2 cells played the crucial role in asthma pathogenesis, which has been identified as the important target for anti-asthma therapy. The soluble IL-4 receptor (sIL-4R), which is the decoy receptor for Th2 cytokine IL-4, has been reported to be effective in treating asthma in phase I/II clinical trail. To develop more efficacious anti-asthma agent, we attempt to test whether the Helicobacter pylori neutrophil-activating protein (HP-NAP), a novel TLR2 agonist, would enhance the efficacy of sIL-4R in anti-asthma therapy. In our work, we constructed a pcDNA3.1-sIL-4R-NAP plasmid, named PSN, encoding fusion protein of murine sIL-4R and HP-NAP. PSN significantly inhibited airway inflammation, decreased the serum OVA-specific IgE levels and remodeled the Th1/Th2 balance. Notably, PSN is more effective on anti-asthma therapy comparing with plasmid only expressing sIL-4R.

  17. Combined virus-like particle and fusion protein-encoding DNA vaccination of cotton rats induces protection against respiratory syncytial virus without causing vaccine-enhanced disease

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Jong Seok [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); National Institute of Biological Resources, Incheon (Korea, Republic of); Kim, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Yu-Na; Kim, Min-Chul [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Animal and Plant Quarantine Agency, Gyeonggi-do, Gimcheon, Gyeongsangbukdo (Korea, Republic of); Cho, Minkyoung [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Kang, Sang-Moo, E-mail: skang24@gsu.edu [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States)

    2016-07-15

    A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.

  18. Complementation of a yeast cell cycle mutant by an alfalfa cDNA encoding a protein kinase homologous to p34cdc2.

    Science.gov (United States)

    Hirt, H; Páy, A; Györgyey, J; Bakó, L; Németh, K; Bögre, L; Schweyen, R J; Heberle-Bors, E; Dudits, D

    1991-03-01

    The cdc2 protein kinase plays a central role in control of the eukaryotic cell cycle of animals and yeasts. We have isolated a cDNA clone (cdc2Ms) from alfalfa (Medicago sativa L.) that is homologous to the yeast cdc2/CDC28 genes. The encoded protein is 64% identical to the yeast and mammalian counterparts and shows all the prominent structural features known from these organisms. Antibody raised against a 16-amino acid synthetic peptide with crossreactivity against p34 proteins recognized a 34-kilodalton protein in extracts of alfalfa cells. When transferred into a fission yeast, the plant cdc2 homolog can complement a temperature-sensitive cdc2 mutant. Northern analysis revealed higher transcript levels in shoots and suspension cultures than in roots. In addition to the dominant transcript of 1.4 kilobases detected in the poly(A)+fraction, 2.5- and 1.2-kilobase transcripts were detected in total RNA preparations from shoots or somatic embryos. Suspension cultures that were induced to form somatic embryos by an auxin (2,4-dichlorophenoxyacetic acid) showed fluctuations in transcription pattern during the induction period and embryogenesis.

  19. Combined virus-like particle and fusion protein-encoding DNA vaccination of cotton rats induces protection against respiratory syncytial virus without causing vaccine-enhanced disease

    International Nuclear Information System (INIS)

    Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin; Lee, Jong Seok; Kim, Yu-Jin; Lee, Yu-Na; Kim, Min-Chul; Cho, Minkyoung; Kang, Sang-Moo

    2016-01-01

    A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.

  20. Arginine-rich cross-linking peptides with different SV40 nuclear localization signal content as vectors for intranuclear DNA delivery.

    Science.gov (United States)

    Bogacheva, Mariia; Egorova, Anna; Slita, Anna; Maretina, Marianna; Baranov, Vladislav; Kiselev, Anton

    2017-11-01

    The major barriers for intracellular DNA transportation by cationic polymers are their toxicity, poor endosomal escape and inefficient nuclear uptake. Therefore, we designed novel modular peptide-based carriers modified with SV40 nuclear localization signal (NLS). Core peptide consists of arginine, histidine and cysteine residues for DNA condensation, endosomal escape promotion and interpeptide cross-linking, respectively. We investigated three polyplexes with different NLS content (10 mol%, 50 mol% and 90 mol% of SV40 NLS) as vectors for intranuclear DNA delivery. All carriers tested were able to condense DNA, to protect it from DNAase I and were not toxic to the cells. We observed that cell cycle arrest by hydroxyurea did not affect transfection efficacy of NLS-modified carriers which we confirmed using quantitative confocal microscopy analysis. Overall, peptide carrier modified with 90 mol% of SV40 NLS provided efficient transfection and nuclear uptake in non-dividing cells. Thus, incorporation of NLS into arginine-rich cross-linking peptides is an adequate approach to the development of efficient intranuclear gene delivery vehicles. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Sequential priming with simian immunodeficiency virus (SIV) DNA vaccines, with or without encoded cytokines, and a replicating adenovirus-SIV recombinant followed by protein boosting does not control a pathogenic SIVmac251 mucosal challenge.

    Science.gov (United States)

    Demberg, Thorsten; Boyer, Jean D; Malkevich, Nina; Patterson, L Jean; Venzon, David; Summers, Ebonita L; Kalisz, Irene; Kalyanaraman, V S; Lee, Eun Mi; Weiner, David B; Robert-Guroff, Marjorie

    2008-11-01

    Previously, combination DNA/nonreplicating adenovirus (Ad)- or poxvirus-vectored vaccines have strongly protected against SHIV(89.6P), DNAs expressing cytokines have modulated immunity elicited by DNA vaccines, and replication-competent Ad-recombinant priming and protein boosting has strongly protected against simian immunodeficiency virus (SIV) challenge. Here we evaluated a vaccine strategy composed of these promising components. Seven rhesus macaques per group were primed twice with multigenic SIV plasmid DNA with or without interleukin-12 (IL-12) DNA or IL-15 DNA. After a multigenic replicating Ad-SIV immunization, all groups received two booster immunizations with SIV gp140 and SIV Nef protein. Four control macaques received control DNA plasmids, empty Ad vector, and adjuvant. All vaccine components were immunogenic, but the cytokine DNAs had little effect. Macaques that received IL-15-DNA exhibited higher peak anti-Nef titers, a more rapid anti-Nef anamnestic response postchallenge, and expanded CD8(CM) T cells 2 weeks postchallenge compared to the DNA-only group. Other immune responses were indistinguishable between groups. Overall, no protection against intrarectal challenge with SIV(mac251) was observed, although immunized non-Mamu-A*01 macaques as a group exhibited a statistically significant 1-log decline in acute viremia compared to non-Mamu-A*01 controls. Possible factors contributing to the poor outcome include administration of cytokine DNAs to sites different from the Ad recombinants (intramuscular and intratracheal, respectively), too few DNA priming immunizations, a suboptimal DNA delivery method, failure to ensure delivery of SIV and cytokine plasmids to the same cell, and instability and short half-life of the IL-15 component. Future experiments should address these issues to determine if this combination approach is able to control a virulent SIV challenge.

  2. DNA sequence characterisation and phylogeography of Lymnaea cousini and related species, vectors of fascioliasis in northern Andean countries, with description of L. meridensis n. sp. (Gastropoda: Lymnaeidae

    Directory of Open Access Journals (Sweden)

    Bargues M Dolores

    2011-07-01

    Full Text Available Abstract Background Livestock fascioliasis is a problem throughout Ecuador, Colombia and Venezuela, mainly in Andean areas where the disease also appears to affect humans. Transmission patterns and epidemiological scenarios of liver fluke infection have shown to differ according to the lymnaeid vector snail species involved. These Andean countries present the vectors Lymnaea cousini, L. bogotensis and L. ubaquensis, unknown in the rest of Latin America. An exhaustive combined haplotype study of these species is performed by means of DNA sequencing of the nuclear ribosomal 18S RNA gene, ITS-2 and ITS-1, and mitochondrial DNA cox1 gene. Results The conserved 5.8S rDNA sequence corroborated that no pseudogenes are involved in the numerous non-microsatellite/minisatellite-related indels appearing between the ITS-2 and ITS-1 sequences when comparing different L. cousini - L. bogotensis populations. Sequence analyses and phylogenetic reconstruction methods including other lymnaeid vector species show that (i L. bogotensis is a synonym of L. cousini, (ii L. ubaquensis is a synonym of Pseudosuccinea columella, and (iii populations of L. cousini hitherto known from Venezuelan highlands indeed belong to a new species for which the name L. meridensis n. sp. is proposed. This new species is described and a complete phenotypic differentiation provided. Conclusions ITS-2, ITS-1 and cox1 prove to be good markers for specimen classification and haplotype characterisation of these morphologically similar lymnaeids in endemic areas. Analysis of the 18S gene and phylogenetic reconstructions indicate that L. cousini and L. meridensis n. sp. cluster in an evolutionary line different from the one of P. columella, despite their external resemblance. This suggests an evolutionary phenotypic convergence related to similar environments and which has given rise to frequent specimen misclassification. Body size and phylogenetic relationships of L. meridensis n. sp. with

  3. Heterologous prime-boost-boost immunisation of Chinese cynomolgus macaques using DNA and recombinant poxvirus vectors expressing HIV-1 virus-like particles

    Directory of Open Access Journals (Sweden)

    Anson Donald S

    2011-09-01

    Full Text Available Abstract Background There is renewed interest in the development of poxvirus vector-based HIV vaccines due to the protective effect observed with repeated recombinant canarypox priming with gp120 boosting in the recent Thai placebo-controlled trial. This study sought to investigate whether a heterologous prime-boost-boost vaccine regimen in Chinese cynomolgus macaques with a DNA vaccine and recombinant poxviral vectors expressing HIV virus-like particles bearing envelopes derived from the most prevalent clades circulating in sub-Saharan Africa, focused the antibody response to shared neutralising epitopes. Methods Three Chinese cynomolgus macaques were immunised via intramuscular injections using a regimen composed of a prime with two DNA vaccines expressing clade A Env/clade B Gag followed by boosting with recombinant fowlpox virus expressing HIV-1 clade D Gag, Env and cholera toxin B subunit followed by the final boost with recombinant modified vaccinia virus Ankara expressing HIV-1 clade C Env, Gag and human complement protein C3d. We measured the macaque serum antibody responses by ELISA, enumerated T cell responses by IFN-γ ELISpot and assessed seroneutralisation of HIV-1 using the TZM-bl β-galactosidase assay with primary isolates of HIV-1. Results This study shows that large and complex synthetic DNA sequences can be successfully cloned in a single step into two poxvirus vectors: MVA and FPV and the recombinant poxviruses could be grown to high titres. The vaccine candidates showed appropriate expression of recombinant proteins with the formation of authentic HIV virus-like particles seen on transmission electron microscopy. In addition the b12 epitope was shown to be held in common by the vaccine candidates using confocal immunofluorescent microscopy. The vaccine candidates were safely administered to Chinese cynomolgus macaques which elicited modest T cell responses at the end of the study but only one out of the three macaques

  4. A DNA vaccine encoding mutated HPV58 mE6E7-Fc-GPI fusion antigen and GM-CSF and B7.1.

    Science.gov (United States)

    Wang, He; Yu, Jiyun; Li, Li

    2015-01-01

    Persistent infection with high-risk human papillomavirus (HPV) is a predominant cause of cervical cancer, and HPV58 is the third most common virus detected in the patients with cervical cancer in Asia. E6 and E7 are the viral oncogenes which are constitutively expressed in HPV-associated tumor cells and can be used as target antigens for related immunotherapy. In this study, we modified the HPV58 E6 and E7 oncogenes to eliminate their oncogenic potential and constructed a recombinant DNA vaccine that coexpresses the sig-HPV58 mE6E7-Fc-GPI fusion antigen in addition to granulocyte-macrophage colony-stimulating factor (GM-CSF) and B7.1 as molecular adjuvants (PVAX1-HPV58 mE6E7FcGB) for the treatment of HPV58 (+) cancer. PVAX1-HPV58 mE6E7FcGB recombinant DNA vaccine was constructed to express a fusion protein containing a signal peptide, a modified HPV58 mE6E7 gene, and human IgG Fc and glycosylphosphatidylinositol (GPI)-anchoring sequences using the modified DNA vaccine vector PVAX1-IRES-GM/B7.1 that coexpresses GM-CSF, and B7.1. C57BL/6 mice were challenged by HPV58 E6E7-expressing B16-HPV58 E6E7 cells, followed by immunization by PVAX1-HPV58 mE6E7FcGB vaccine on days 7, 14, 21 after tumor challenge. The cellular immune responses in immunized mice were assessed by measuring IFN-γ production in splenocytes upon stimulation by HPV58 E6E7-GST protein and the lysis of B16-HPV58 E6E7 target cells by splenocytes after restimulation with HPV58 E6E7-GST protein. The antitumor efficacy was evaluated by monitoring the growth of the tumor. PVAX1-HPV58 mE6E7FcGB elicited varying levels of IFN-lsgdB58onn T-cell immune responses and lysis of target cell in mice in response to the recombinant antigen HPV58 E6E7-GST. Furthermore, the vaccine also induced antitumor responses in the HPV58 (+) B16-HPV58 E6E7 tumor challenge model as evidenced by delayed tumor development. The recombinant DNA vaccine PVAX1-HPV58 mE6E7FcGB efficiently generates cellular immunity and antitumor efficacy

  5. Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of Streptococcus pneumontae

    Science.gov (United States)

    Lacks, S.A.

    1990-10-02

    Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252. 9 figs.

  6. Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of streptococcus pneumontae

    Science.gov (United States)

    Lacks, Sanford A.

    1990-01-01

    Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252.

  7. Evaluation of protective immune responses induced by DNA vaccines encoding Toxoplasma gondii surface antigen 1 (SAG1) and 14-3-3 protein in BALB/c mice.

    Science.gov (United States)

    Meng, Min; He, Shenyi; Zhao, Guanghui; Bai, Yang; Zhou, Huaiyu; Cong, Hua; Lu, Gang; Zhao, Qunli; Zhu, Xing-Quan

    2012-11-26

    Toxoplasmosis, caused by an obligate intracellular protozoan parasite Toxoplasma gondii, has been a serious clinical and veterinary problem. Effective DNA vaccines against T. gondii can prevent and control the spread of toxoplasmosis, which is important for both human health and the farming industry. The T. gondii 14-3-3 protein has been proved to be antigenic and immunogenic and was a potential vaccine candidate against toxoplasmosis. In this study, we evaluated the immune responses induced by recombinant plasmids encoding T. gondii surface antigen 1 (SAG1) and 14-3-3 protein by immunizing BALB/c mice intramuscularly. In the present study, BALB/c mice were randomly divided into five groups, including three experimental groups (pSAG1, p14-3-3 and pSAG1/14-3-3) and two control groups (PBS and pBudCE4.1), and were immunized intramuscularly three times. The levels of IgG antibodies and cytokine production in mouse sera were determined by enzyme-linked immunosorbent assays (ELISA). Two weeks after the last immunization, all mice were challenged intraperitoneally (i.p.) with 1×10(4) tachyzoites of T. gondii and the survival time of mice was observed and recorded every day. Mice vaccinated with pSAG1, p14-3-3 or pSAG1/14-3-3 developed high levels of IgG2a and gamma interferon (IFN-γ) and low levels of interleukin-4 (IL-4) and interleukin-10 (IL-10) compared to control groups (PBS or pBudCE4.1), which suggested a modulated Th1 type immune response (Pmice in experimental groups was longer than control groups (Pmice and was a novel DNA vaccine candidate against toxoplasmosis, and the immune protective efficacy elicited by SAG1 gene was also demonstrated. Our results also showed multi-gene vaccine significantly enhanced immune responses and protective efficacy and was superior to the single-gene vaccine.

  8. Nuclear rDNA-based molecular clock of the evolution of triatominae (Hemiptera: Reduviidae, vectors of Chagas disease

    Directory of Open Access Journals (Sweden)

    Bargues MD

    2000-01-01

    Full Text Available The evolutionary history and times of divergence of triatomine bug lineages are estimated from molecular clocks inferred from nucleotide sequences of the small subunit SSU (18S and the second internal transcribed spacer (ITS-2 of the nuclear ribosomal DNA of these reduviids. The 18S rDNA molecular clock rate in Triatominae, and Prosorrhynchan Hemiptera in general, appears to be of 1.8% per 100 million years (my. The ITS-2 molecular clock rate in Triatominae is estimated to be around 0.4-1% per 1 my, indicating that ITS-2 evolves 23-55 times faster than 18S rDNA. Inferred chronological data about the evolution of Triatominae fit well with current hypotheses on their evolutionary histories, but suggest reconsideration of the current taxonomy of North American species complexes.

  9. A new baseline for fascioliasis in Venezuela: lymnaeid vectors ascertained by DNA sequencing and analysis of their relationships with human and animal infection

    Science.gov (United States)

    2011-01-01

    Background Human and animal fascioliasis poses serious public health problems in South America. In Venezuela, livestock infection represents an important veterinary problem whereas there appear to be few human cases reported, most of which are passively detected in health centres. However, results of recent surveys suggest that the situation may be underestimated in particular areas. To obtain a baseline for future fascioliasis assessment, studies were undertaken by means of rDNA ITS-2 and ITS-1 and mtDNA cox1 sequencing to clarify the specific status of Venezuelan lymnaeids, their geographical distribution and fascioliasis transmission capacity, by comparison with other American countries and other continents. Results Results obtained completely change the lymnaeid scenario known so far. The relatively rich lymnaeid fauna of Venezuela has been proven to include (i) Lymnaea meridensis and L. neotropica as the only native members, (ii) L. cubensis and Pseudosuccinea columella introduced from the Caribbean area, and (iii) Galba truncatula and L. schirazensis introduced from the Old World. The absence of representatives of the stagnicoline and Radix groups is remarkable. Four species are fascioliasis vectors: G. truncatula, L. cubensis and L. neotropica, which have the capacity to give rise to human endemic areas, and P. columella, which is a source of animal infection and is responsible for the spread of disease. Vector capacity in the apparently highland endemic L. meridensis is to be confimed, although may be expected given its phylogenetic relationships. Similarly as elsewhere, the non-transmitting L. schirazensis has been confused with L. cubensis, also with G. truncatula and possibly with L. neotropica. Conclusions The new scenario leads to the re-opening of many disease aspects. In Venezuela, altitude appears to be the main factor influencing fascioliasis distribution. Human infection shows an altitude pattern similar to other Andean countries, although a

  10. [Cloning and characterization of a novel mouse short-chain dehydrogenase/reductases cDNA mHsdl2#, encoding a protein with a SDR domaid and a SCP2 domain].

    Science.gov (United States)

    Dai, J; Li, P; Ji, Ch; Feng, C; Gui, M; Sun, Y; Zhang, J; Zhu, J; Dou, Ch; Gu, Sh

    2005-01-01

    The short-chain dehydrogenases/reductases (SDRs) play important roles in body's metabolism. We cloned a novel mouse SDR cDNA which encodes a deduced HSD-like protein with a conserved SDR domain and a SCP2 domain. The 1.8 kb cDNA consists of 11 exons and is mapped to mouse chromosome 4B3. The corresponding gene is widely expressed in normal mouse tissues and its expression level in liver increases after inducement with cholesterol food. The predicted mouse HSDL2 protein, which has a peroxisomal target signal, is localized in the cytoplasm of NIH 3T3 cells.

  11. Immunization with a Recombinant Expression Vector Encoding NS3/NS4A of Hepatitis C Virus Genotype 3a Elicits Cell-Mediated Immune Responses in C57BL/6 Mice.

    Science.gov (United States)

    Behzadi, Mohammad Amin; Alborzi, Abdolvahab; Kalani, Mehdi; Pouladfar, Gholamreza; Dianatpour, Mehdi; Ziyaeyan, Mazyar

    2016-04-01

    Today, hepatitis C virus (HCV) infection is considered as one of the most significant international health concerns. Although novel therapeutic regimens against the infection have shown satisfactory results, no approved vaccine exists yet. This study aimed to evaluate the immunogenicity of a DNA vaccine candidate for HCV-3a, based on nonstructural proteins NS3/NS4A, in C57BL/6 mice. Immunogenicity effect of pDisplay-NS3/NS4A was analyzed through immunization with 100 and 200 μg concentrations of the construct with complete Freund's adjuvant, monophosphoryl lipid A (MPL), or without adjuvant. The frequencies of different splenic mononuclear cells were measured using the Mouse Th1/Th2/Th17 Phenotyping Kit. Moreover, the number of T-CD8(+) cells was determined using conjugated anti-CD8a and anti-CD3e antibodies by flow cytometry. As observed, the frequencies of Th1, T-CD8(+), and Th2 cells increased in all the experimental groups, compared with the controls. The highest levels of the respective cells were seen in the group immunized with 200 μg of the construct with MPL. Also, there were positive correlations between the frequency of Th1 cells and those of Th2 and T-CD8(+) cells in all the immunized groups, but were significant in those receiving adjuvants. The frequency of Th17 cells did not statistically change among the groups. Taken together, our findings revealed that the constructed DNA vaccine encoding HCV-3a NS3/NS4A gene induces the cell-mediated immune responses significantly. However, its coadministration with adjuvants exhibits more efficient results than the recombinant plasmid alone. Further study is currently underway to evaluate the specific immune responses and recognize the responsible antigenic epitopes.

  12. Genetic variations of ND5 gene of mtDNA in populations of Anopheles sinensis (Diptera: Culicidae) malaria vector in China

    Science.gov (United States)

    2013-01-01

    Background Anopheles sinensis is a principal vector for Plasmodium vivax malaria in most parts of China. Understanding of genetic structure and genetic differentiation of the mosquito should contribute to the vector control and malaria elimination in China. Methods The present study investigated the genetic structure of An. sinensis populations using a 729 bp fragment of mtDNA ND5 among 10 populations collected from seven provinces in China. Results ND5 was polymorphic by single mutations within three groups of An. sinensis that were collected from 10 different geographic populations in China. Out of 140 specimens collected from 10 representative sites, 84 haplotypes and 71 variable positions were determined. The overall level of genetic differentiation of An. sinensis varied from low to moderate across China and with a FST range of 0.00065 – 0.341. Genealogy analysis clustered the populations of An. sinensis into three main clusters. Each cluster shared one main haplotype. Pairwise variations within populations were higher (68.68%) than among populations (31.32%) and with high fixation index (FST = 0.313). The results of the present study support population growth and expansion in the An. sinensis populations from China. Three clusters of An. sinensis populations were detected in this study with each displaying different proportion patterns over seven Chinese provinces. No correlation between genetic and geographic distance was detected in overall populations of An. sinensis (R2 = 0.058; P = 0.301). Conclusions The results indicate that the ND5 gene of mtDNA is highly polymorphic in An. sinensis and has moderate genetic variability in the populations of this mosquito in China. Demographic and spatial results support evidence of expansion in An. sinensis populations. PMID:24192424

  13. Physical properties and in vitro transfection efficiency of gene delivery vectors based on complexes of DNA with synthetic polycations

    Czech Academy of Sciences Publication Activity Database

    Reschel, Tomáš; Koňák, Čestmír; Oupický, D.; Seymour, L. W.; Ulbrich, Karel

    2002-01-01

    Roč. 81, 1-2 (2002), s. 201-217 ISSN 0168-3659 R&D Projects: GA ČR GV307/96/K226; GA AV ČR IAA1050101 Institutional research plan: CEZ:AV0Z4050913 Keywords : gene delivery * self assembly * polycation/DNA complexes Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.131, year: 2002

  14. Use of S-[2,3-bispalmitoyiloxy-(2R)-propyl]-R-cysteinyl-amido-monomethoxy polyethylene glycol as an adjuvant improved protective immunity associated with a DNA vaccine encoding Cu,Zn superoxide dismutase of Brucella abortus in mice.

    Science.gov (United States)

    Retamal-Díaz, Angello; Riquelme-Neira, Roberto; Sáez, Darwin; Rivera, Alejandra; Fernández, Pablo; Cabrera, Alex; Guzmán, Carlos A; Oñate, Angel

    2014-11-01

    This study was conducted to evaluate the immunogenicity and protective efficacy of a DNA vaccine encoding Brucella abortus Cu,Zn superoxide dismutase (SOD) using the Toll-like receptor 2/6 agonist S-[2,3-bispalmitoyiloxy-(2R)-propyl]-R-cysteinyl-amido-monomethoxy polyethylene glycol (BPPcysMPEG) as an adjuvant. Intranasal coadministration of BPPcysMPEG with a plasmid carrying the SOD-encoding gene (pcDNA-SOD) into BALB/c mice elicited antigen-specific humoral and cellular immune responses. Humoral responses were characterized by the stimulation of IgG2a and IgG1 and by the presence of SOD-specific secretory IgA in nasal and bronchoalveolar lavage fluids. Furthermore, T-cell proliferative responses and increased production of gamma interferon were also observed upon splenocyte restimulation with recombinant SOD. Cytotoxic responses were also stimulated, as demonstrated by the lysis of RB51-SOD-infected J774.A1 macrophages by cells recovered from immunized mice. The pcDNA-SOD/BPPcysMPEG formulation induced improved protection against challenge with the virulent strain B. abortus 2308 in BALB/c mice over that provided by pcDNA-SOD, suggesting the potential of this vaccination strategy against Brucella infection. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  15. DNA multigene sequencing of topotypic specimens of the fascioliasis vector Lymnaea diaphana and phylogenetic analysis of the genus Pectinidens (Gastropoda

    Directory of Open Access Journals (Sweden)

    Maria Dolores Bargues

    2012-02-01

    Full Text Available Freshwater lymnaeid snails are crucial in defining transmission and epidemiology of fascioliasis. In South America, human endemic areas are related to high altitudes in Andean regions. The species Lymnaea diaphana has, however, been involved in low altitude areas of Chile, Argentina and Peru where human infection also occurs. Complete nuclear ribosomal DNA 18S, internal transcribed spacer (ITS-2 and ITS-1 and fragments of mitochondrial DNA 16S and cytochrome c oxidase (cox1 genes of L. diaphana specimens from its type locality offered 1,848, 495, 520, 424 and 672 bp long sequences. Comparisons with New and Old World Galba/Fossaria, Palaearctic stagnicolines, Nearctic stagnicolines, Old World Radix and Pseudosuccinea allowed to conclude that (i L. diaphana shows sequences very different from all other lymnaeids, (ii each marker allows its differentiation, except cox1 amino acid sequence, and (iii L. diaphana is not a fossarine lymnaeid, but rather an archaic relict form derived from the oldest North American stagnicoline ancestors. Phylogeny and large genetic distances support the genus Pectinidens as the first stagnicoline representative in the southern hemisphere, including colonization of extreme world regions, as most southern Patagonia, long time ago. The phylogenetic link of L. diaphana with the stagnicoline group may give light to the aforementioned peculiar low altitude epidemiological scenario of fascioliasis.

  16. Radiation-induced upregulation of gene expression from adenoviral vectors mediated by DNA damage repair and regulation.

    Science.gov (United States)

    Nokisalmi, Petri; Rajecki, Maria; Pesonen, Sari; Escutenaire, Sophie; Soliymani, Rabah; Tenhunen, Mikko; Ahtiainen, Laura; Hemminki, Akseli

    2012-05-01

    In the present study, we evaluated the combination of replication-deficient adenoviruses and radiotherapy in vitro. The purpose of the present study was to analyze the mechanism of radiation-mediated upregulation of adenoviral transgene expression. Adenoviral transgene expression (luciferase or green fluorescent protein) was studied with and without radiation in three cell lines: breast cancer M4A4-LM3, prostate cancer PC-3MM2, and lung cancer LNM35/enhanced green fluorescent protein. The effect of the radiation dose, modification of the viral capsid, and five different transgene promoters were studied. The cellular responses were studied using mass spectrometry and immunofluorescence analysis. Double strand break repair was modulated by inhibitors of heat shock protein 90, topoisomerase-I, and DNA protein kinase, and transgene expression was measured. We found that a wide range of radiation doses increased adenoviral transgene expression regardless of the cell line, transgene, promoter, or viral capsid modification. Treatment with adenovirus, radiation, and double strand break repair inhibitors resulted in persistence of double strand breaks and subsequent increases in adenovirus transgene expression. Radiation-induced enhancement of adenoviral transgene expression is linked to DNA damage recognition and repair. Radiation induces a global cellular response that results in increased production of RNA and proteins, including adenoviral transgene products. This study provides a mechanistic rationale for combining radiation with adenoviral gene delivery. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Radiation-Induced Upregulation of Gene Expression From Adenoviral Vectors Mediated by DNA Damage Repair and Regulation

    Energy Technology Data Exchange (ETDEWEB)

    Nokisalmi, Petri; Rajecki, Maria; Pesonen, Sari; Escutenaire, Sophie [Cancer Gene Therapy Group, Molecular Cancer Biology Program, Transplantation Laboratory, Haartman Institute, and Finnish Institute for Molecular Medicine, University of Helsinki, Helsinki (Finland); Helsinki and Uusimaa Hospital District Laboratory, Helsinki University Central Hospital, Helsinki (Finland); Soliymani, Rabah [Protein Chemistry Unit, Department of Anatomy, Institute of Biomedicine, Biomedicum Helsinki (Finland); Tenhunen, Mikko [Department of Radiation and Oncology, Helsinki University Central Hospital, Helsinki (Finland); Ahtiainen, Laura [Cancer Gene Therapy Group, Molecular Cancer Biology Program, Transplantation Laboratory, Haartman Institute, and Finnish Institute for Molecular Medicine, University of Helsinki, Helsinki (Finland); Helsinki and Uusimaa Hospital District Laboratory, Helsinki University Central Hospital, Helsinki (Finland); Hemminki, Akseli, E-mail: akseli.hemminki@helsinki.fi [Cancer Gene Therapy Group, Molecular Cancer Biology Program, Transplantation Laboratory, Haartman Institute, and Finnish Institute for Molecular Medicine, University of Helsinki, Helsinki (Finland); Helsinki and Uusimaa Hospital District Laboratory, Helsinki University Central Hospital, Helsinki (Finland)

    2012-05-01

    Purpose: In the present study, we evaluated the combination of replication-deficient adenoviruses and radiotherapy in vitro. The purpose of the present study was to analyze the mechanism of radiation-mediated upregulation of adenoviral transgene expression. Methods and Materials: Adenoviral transgene expression (luciferase or green fluorescent protein) was studied with and without radiation in three cell lines: breast cancer M4A4-LM3, prostate cancer PC-3MM2, and lung cancer LNM35/enhanced green fluorescent protein. The effect of the radiation dose, modification of the viral capsid, and five different transgene promoters were studied. The cellular responses were studied using mass spectrometry and immunofluorescence analysis. Double strand break repair was modulated by inhibitors of heat shock protein 90, topoisomerase-I, and DNA protein kinase, and transgene expression was measured. Results: We found that a wide range of radiation doses increased adenoviral transgene expression regardless of the cell line, transgene, promoter, or viral capsid modification. Treatment with adenovirus, radiation, and double strand break repair inhibitors resulted in persistence of double strand breaks and subsequent increases in adenovirus transgene expression. Conclusions: Radiation-induced enhancement of adenoviral transgene expression is linked to DNA damage recognition and repair. Radiation induces a global cellular response that results in increased production of RNA and proteins, including adenoviral transgene products. This study provides a mechanistic rationale for combining radiation with adenoviral gene delivery.

  18. Phylogeographic Pattern and Extensive Mitochondrial DNA Divergence Disclose a Species Complex within the Chagas Disease Vector Triatoma dimidiata

    Science.gov (United States)

    Monteiro, Fernando A.; Peretolchina, Tatiana; Lazoski, Cristiano; Harris, Kecia; Dotson, Ellen M.; Abad-Franch, Fernando; Tamayo, Elsa; Pennington, Pamela M.; Monroy, Carlota; Cordon-Rosales, Celia; Salazar-Schettino, Paz Maria; Gómez-Palacio, Andrés; Grijalva, Mario J.; Beard, Charles B.; Marcet, Paula L.

    2013-01-01

    Background Triatoma dimidiata is among the main vectors of Chagas disease in Latin America. However, and despite important advances, there is no consensus about the taxonomic status of phenotypically divergent T. dimidiata populations, which in most recent papers are regarded as subspecies. Methodology and Findings A total of 126 cyt b sequences (621 bp long) were produced for specimens from across the species range. Forty-seven selected specimens representing the main cyt b clades observed (after a preliminary phylogenetic analysis) were also sequenced for an ND4 fragment (554 bp long) and concatenated with their respective cyt b sequences to produce a combined data set totalling 1175 bp/individual. Bayesian and Maximum-Likelihood phylogenetic analyses of both data sets (cyt b, and cyt b+ND4) disclosed four strongly divergent (all pairwise Kimura 2-parameter distances >0.08), monophyletic groups: Group I occurs from Southern Mexico through Central America into Colombia, with Ecuadorian specimens resembling Nicaraguan material; Group II includes samples from Western-Southwestern Mexico; Group III comprises specimens from the Yucatán peninsula; and Group IV consists of sylvatic samples from Belize. The closely-related, yet formally recognized species T. hegneri from the island of Cozumel falls within the divergence range of the T. dimidiata populations studied. Conclusions We propose that Groups I–IV, as well as T. hegneri, should be regarded as separate species. In the Petén of Guatemala, representatives of Groups I, II, and III occur in sympatry; the absence of haplotypes with intermediate genetic distances, as shown by multimodal mismatch distribution plots, clearly indicates that reproductive barriers actively promote within-group cohesion. Some sylvatic specimens from Belize belong to a different species – likely the basal lineage of the T. dimidiata complex, originated ∼8.25 Mya. The evidence presented here strongly supports the proposition that T

  19. Phylogeographic pattern and extensive mitochondrial DNA divergence disclose a species complex within the Chagas disease vector Triatoma dimidiata.

    Directory of Open Access Journals (Sweden)

    Fernando A Monteiro

    Full Text Available BACKGROUND: Triatoma dimidiata is among the main vectors of Chagas disease in Latin America. However, and despite important advances, there is no consensus about the taxonomic status of phenotypically divergent T. dimidiata populations, which in most recent papers are regarded as subspecies. METHODOLOGY AND FINDINGS: A total of 126 cyt b sequences (621 bp long were produced for specimens from across the species range. Forty-seven selected specimens representing the main cyt b clades observed (after a preliminary phylogenetic analysis were also sequenced for an ND4 fragment (554 bp long and concatenated with their respective cyt b sequences to produce a combined data set totalling 1175 bp/individual. Bayesian and Maximum-Likelihood phylogenetic analyses of both data sets (cyt b, and cyt b+ND4 disclosed four strongly divergent (all pairwise Kimura 2-parameter distances >0.08, monophyletic groups: Group I occurs from Southern Mexico through Central America into Colombia, with Ecuadorian specimens resembling Nicaraguan material; Group II includes samples from Western-Southwestern Mexico; Group III comprises specimens from the Yucatán peninsula; and Group IV consists of sylvatic samples from Belize. The closely-related, yet formally recognized species T. hegneri from the island of Cozumel falls within the divergence range of the T. dimidiata populations studied. CONCLUSIONS: We propose that Groups I-IV, as well as T. hegneri, should be regarded as separate species. In the Petén of Guatemala, representatives of Groups I, II, and III occur in sympatry; the absence of haplotypes with intermediate genetic distances, as shown by multimodal mismatch distribution plots, clearly indicates that reproductive barriers actively promote within-group cohesion. Some sylvatic specimens from Belize belong to a different species - likely the basal lineage of the T. dimidiata complex, originated ~8.25 Mya. The evidence presented here strongly supports the proposition

  20. Introduction of optical reporter gene into cancer and immune cells using lentiviral vector

    Energy Technology Data Exchange (ETDEWEB)

    Min, Jung Joon; Le, Uyenchi N.; Moon, Sung Min; Heo, Young Jun; Song, Ho Chun; Bom, Hee Seung [School of Medicine, Chonnam National University, Gwangju (Korea, Republic of); Kim, Yeon Soo [Schoole of Medicine, Inje University, Seoul (Korea, Republic of)

    2004-07-01

    For some applications such as gene therapy or reporter gene imaging, a gene has to be introduced into the organism of interest. Adenoviral vectors are capable of transducing both replicating and non-dividing cells. The adenoviral vectors do not integrate their DNA into host DNA, but do lead to an immune response. Lentiviruses belong to the retrovirus family and are capable of infecting both dividing and non-dividing cells. The human immunodeficiency virus (HIV) is an example of a lentavirus. A disabled HIV virus has been developed and could be used for in vivo gene delivery. A portion of the viral genome which encodes for accessory proteins canbe deleted without affecting production of the vector and efficiency of infection. Lentiviral delivery into various rodent tissues shows sustained expression of the transgene of up to six months. Furthermore, there seems to be little or no immune response with these vectors. These lentiviral vectors hold significant promise for in vivo gene delivery. We constructed lentiviral vector encoding firefly luciferase (Fluc) and eGFP. Fluc-eGFP fusion gene was inserted into multiple cloning sites of pLentiM1.3 vector. Reporter gene (Fluc-eGFP) was designed to be driven by murine CMV promoter with enhanced efficacy of transgene expression as compared to human CMV promoter. We transfected pLenti1.3-Fluc into human cervix cancer cell line (HeLa) and murine T lymphocytes. We also constructed adenovirus encoding Fluc and transfected to HeLa and T cells. This LentiM1.3-Fluc was transfected into HeLa cells and murine T lymphocytes in vitro, showing consistent expression of eGFP under the fluorescence microscopy from the 2nd day of transfection. Firefly luciferase reporter gene was not expressed in immune cells when it is mediated by adenovirus. Lentivirus was validated as a useful vector for both immune and cancer cells.

  1. Viral Vectors for Use in the Development of Biodefense Vaccines

    National Research Council Canada - National Science Library

    Lee, John S; Hadjipanayis, Angela G; Parker, Michael D

    2005-01-01

    .... DNA vectors, live-attenuated viruses and bacteria, recombinant proteins combined with adjuvant, and viral- or bacterial-vectored vaccines have been developed as countermeasures against many potential...

  2. Subcloning of a DNA fragment encoding a single cohesin domain of the Clostridium thermocellum cellulosome-integrating protein CipA: purification, crystallization, and preliminary diffraction analysis of the encoded polypeptide.

    Science.gov (United States)

    Béguin, P; Raynaud, O; Chaveroche, M K; Dridi, A; Alzari, P M

    1996-06-01

    An Escherichia coli clone encoding a single cohesin domain of the cellulosome-integrating protein CipA from Clostridium thermocellum was constructed, and the corresponding polypeptide was purified, treated with papain, and crystallized from a PEG 8000 solution. Crystals exhibit orthorhombic symmetry, space group P2(1)2(1)2(1), with cell dimensions a = 37.7 A, b = 80.7 A, c = 93.3 A, and four or eight molecules in the unit cell. The crystals diffract X-rays to beyond 2 A resolution and are suitable for further crystallographic studies.

  3. Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.

    Science.gov (United States)

    Kant, Ravi; Dasgupta, Indranil

    2017-07-01

    Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.

  4. Vaccination with DNA Encoding Truncated Enterohemorrhagic Escherichia coli (EHEC) Factor for Adherence-1 Gene (efa-1′) Confers Protective Immunity to Mice Infected with E. coli O157:H7

    Science.gov (United States)

    Riquelme-Neira, Roberto; Rivera, Alejandra; Sáez, Darwin; Fernández, Pablo; Osorio, Gonzalo; del Canto, Felipe; Salazar, Juan C.; Vidal, Roberto M.; Oñate, Angel

    2016-01-01

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is the predominant causative agent of hemorrhagic colitis in humans and is the cause of haemolytic uraemic syndrome and other illnesses. Cattle have been implicated as the main reservoir of this organism. Here, we evaluated the immunogenicity and protective efficacy of a DNA vaccine encoding conserved sequences of truncated EHEC factor for adherence-1 (efa-1′) in a mouse model. Intranasal administration of plasmid DNA carrying the efa-1′ gene (pVAXefa-1′) into C57BL/6 mice elicited both humoral and cellular immune responses. In animals immunized with pVAXefa-1′, EHEC-secreted protein-specific IgM and IgG antibodies were detected in sera at day 45. Anti-EHEC-secreted protein sIgA was also detected in nasal and bronchoalveolar lavages. In addition, antigen-specific T-cell-proliferation, IL-10, and IFN-γ were observed upon re-stimulation with either heat-killed bacteria or EHEC-secreted proteins. Vaccinated animals were also protected against challenge with E. coli O157:H7 strain EDL933. These results suggest that DNA vaccine encoding efa-1′ have therapeutic potential in interventions against EHEC infections. This approach could lead to a new strategy in the production of vaccines that prevent infections in cattle. PMID:26835434

  5. Vaccination with DNA encoding truncated enterohemorrhagic Escherichia coli (EHEC factor for adherence-1 gene (efa-1’ confers protective immunity to mice infected with E. coli O157:H7

    Directory of Open Access Journals (Sweden)

    Roberto eRiquelme-Neira

    2016-01-01

    Full Text Available Enterohemorrhagic Escherichia coli (EHEC O157:H7 is the predominant causative agent of hemorrhagic colitis in humans and is the cause of haemolytic uraemic syndrome and other illnesses. Cattle have been implicated as the main reservoir of this organism. Here, we evaluated the immunogenicity and protective efficacy of a DNA vaccine encoding conserved sequences of truncated EHEC factor for adherence-1 (efa-1’ in a mouse model. Intranasal administration of plasmid DNA carrying the efa-1’ gene (pVAXefa-1’ into C57BL/6 mice elicited both humoral and cellular immune responses. In animals immunized with pVAXefa-1`, EHEC-secreted protein-specific IgM and IgG antibodies were detected in sera at day 45. Anti-EHEC-secreted protein sIgA was also detected in nasal and bronchoalveolar lavages. In addition, antigen-specific T-cell-proliferation, IL-10 and IFN-γ were observed upon re-stimulation with either heat-killed bacteria or EHEC-secreted proteins. Vaccinated animals were also protected against challenge with E. coli O157:H7 strain EDL933. These results suggest that DNA vaccine encoding efa-1´ have therapeutic potential in interventions against EHEC infections. This approach could lead to a new strategy in the production of vaccines that prevent infections in cattle.

  6. Vaccination with DNA Encoding Truncated Enterohemorrhagic Escherichia coli (EHEC) Factor for Adherence-1 Gene (efa-1') Confers Protective Immunity to Mice Infected with E. coli O157:H7.

    Science.gov (United States)

    Riquelme-Neira, Roberto; Rivera, Alejandra; Sáez, Darwin; Fernández, Pablo; Osorio, Gonzalo; del Canto, Felipe; Salazar, Juan C; Vidal, Roberto M; Oñate, Angel

    2015-01-01

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is the predominant causative agent of hemorrhagic colitis in humans and is the cause of haemolytic uraemic syndrome and other illnesses. Cattle have been implicated as the main reservoir of this organism. Here, we evaluated the immunogenicity and protective efficacy of a DNA vaccine encoding conserved sequences of truncated EHEC factor for adherence-1 (efa-1') in a mouse model. Intranasal administration of plasmid DNA carrying the efa-1' gene (pVAXefa-1') into C57BL/6 mice elicited both humoral and cellular immune responses. In animals immunized with pVAXefa-1', EHEC-secreted protein-specific IgM and IgG antibodies were detected in sera at day 45. Anti-EHEC-secreted protein sIgA was also detected in nasal and bronchoalveolar lavages. In addition, antigen-specific T-cell-proliferation, IL-10, and IFN-γ were observed upon re-stimulation with either heat-killed bacteria or EHEC-secreted proteins. Vaccinated animals were also protected against challenge with E. coli O157:H7 strain EDL933. These results suggest that DNA vaccine encoding efa-1' have therapeutic potential in interventions against EHEC infections. This approach could lead to a new strategy in the production of vaccines that prevent infections in cattle.

  7. Improved humoral and cellular immune response against the gp120 V3 loop of HIV-1 following genetic immunization with a chimeric DNA vaccine encoding the V3 inserted into the hepatites B surface antigen

    DEFF Research Database (Denmark)

    Fomsgaard, A.; Nielsen, H.V.; Bryder, K.

    1998-01-01

    -2d-restricted cytotoxic T lymphocyte (CTL) epitope. In an attempt to improve the immunogenicity of V3 in DNA vaccines, a plasmid expressing MN V3 as a fusion protein with the highly immunogenic middle (pre-S2+S) surface antigen of hepatitis B virus (HBsAg) was constructed. Epidermal inoculation...... by gene gun was used for genetic immunization in a mouse model. Antibody and CTL responses to MN V3 and HBsAg were measured and compared with the immune responses obtained after vaccination with plasmids encoding the complete HIV-1 MN gp160 and HBsAg (pre-S2+S), respectively. DNA vaccination with the HIV...... MN gp160 envelope plasmid induced a slow and low titred anti-MN V3 antibody response at 12 weeks post-inoculation (p.i.) and a late appearing (7 weeks), weak and variable CTL response. In contrast, DNA vaccination with the HBsAg-encoding plasmid induced a rapid and high titred anti-HBsAg antibody...

  8. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα-encoding (GNAS genomic imprinting domain are associated with performance traits

    Directory of Open Access Journals (Sweden)

    Mullen Michael P

    2011-01-01

    Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs

  9. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα)-encoding (GNAS) genomic imprinting domain are associated with performance traits

    Science.gov (United States)

    2011-01-01

    Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs) spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS) domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486) were located upstream of the GNAS gene, while one SNP (rs41694646) was located in the second intron of the GNAS gene. The final SNP (rs41694656) was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646) is associated (P ≤ 0.05) with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf) and gestation length. Association (P ≤ 0.01) with direct calving difficulty (i.e. due to calf size) and maternal calving difficulty (i.e. due to the maternal pelvic width size) was also observed at the rs43101491 SNP. Following

  10. Plasimids containing the gene for DNA polymerase I from Streptococcus pneumoniae

    Science.gov (United States)

    Lacks, Sanford A.; Martinez, Susana; Lopez, Paloma; Espinosa, Manuel

    1991-01-01

    A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme.

  11. Protective immunity to VHS in rainbow trout (Oncorhynchus mykiss, Walbaum) following DNA vaccination

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    1998-01-01

    Rainbow trout fingerlings were immunized by intramuscular injection of a plasmid DNA vector encoding the viral haemorrhagic septicaemia virus (VHSV) glycoprotein (G) or nucleocapsid protein (N) genes under the control of a cytomegalovirus promoter. Challenge with VHSV 52 days later demonstrated...

  12. Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

    Science.gov (United States)

    Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

    1987-08-28

    A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.

  13. A presumed DNA helicase, encoded by the excision repair gene ERCC-3 is involved in the human repair disorders xeroderma pigmentosum and Cockayne's syndrome.

    NARCIS (Netherlands)

    G. Weeda (Geert); R.C.A. van Ham; W. Vermeulen (Wim); D. Bootsma (Dirk); A.J. van der Eb; J.H.J. Hoeijmakers (Jan)

    1990-01-01

    textabstractThe human gene ERCC-3 specifically corrects the defect in an early step of the DNA excision repair pathway of UV-sensitive rodent mutants of complementation group 3. The predicted 782 animo acid ERCC-3 protein harbors putative nucleotide, chromatin, and helix-turn-helix DNA binding

  14. Generation of Helper Plasmids Encoding Mutant Adeno-associated Virus Type 2 Capsid Proteins with Increased Resistance against Proteasomal Degradation

    Directory of Open Access Journals (Sweden)

    Naghmeh Ahmadiankia

    2013-07-01

    Full Text Available   Objective(s: Adeno-associated virus type 2 (AAV2 vectors are widely used for both experimental and clinical gene therapy. A recent research has shown that the performance of these vectors can be greatly improved by substitution of specific surface-exposed tyrosine residues with phenylalanines. In this study, a fast and simple method is presented to generate AAV2 vector helper plasmids encoding capsid proteins with single, double or triple Y→F mutations.   Materials and Methods: A one-step, high-fidelity polymerase chain reaction (PCR cloning procedure involving the use of two partially overlapping primers to amplify a circular DNA template was applied to produce AAV2 cap genes encoding VP1 mutants with Y→F substitutions in residues 444, 500 or 730. The resulting constructs were used to make the different double and triple mutant by another round of PCR (Y444500F mutant, subcloning (Y444730F and Y500730F mutants or a combination of both techniques (Y444500730F mutant. Results: Nucleotide sequence analysis revealed successful introduction of the desired mutations in the AAV2 cap gene and showed the absence of any unintended mutations in the DNA fragments used to assemble the final set of AAV2 vector helper plasmids. The correctness of these plasmids was further confirmed by restriction mapping. Conclusion: PCR-based, single-step site-directed mutagenesis of circular DNA templates is a highly efficient and cost-effective method to generate AAV2 vector helper plasmids encoding mutant Cap proteins for the production of vector particles with increased gene transfer efficiency.

  15. Hypervirulence of Agrobacterium tumefaciens A281 is encoded in a region of pTiBo542 outside of T-DNA

    Energy Technology Data Exchange (ETDEWEB)

    Hood, E.E.; Helmer, G.L.; Fraley, R.T.; Chilton, M.D.

    1986-12-01

    A binary-vectory strategy was used to study the hypervirulence of Agrobacterium tumefaciens A281, an L,L-succinamopine strain. Strain A281 is hypervirulent on several solanaceous plants. Plasmids were constructed (pCS65 and pCS277) carrying either the transferred DNA (T-DNA) or the remainder of the tumor-inducing (Ti) plasmid (pEHA101) from this strain and tested each of these constructs were tested in trans with complementary each of regions from heterologous Ti plasmids. Hypervirulence on tobacco could be reconstructed in a bipartite strain with the L,L-succinamopine T-DNA and the vir region on separate plasmids. pEHA101 was able to complement octopine T-DNA to hypervirulence on tobacco and tomato plants. Nopaline T-DNA was complemented better on tomato plants by pEHA101 than it was by its own nopaline vir region, but not to hypervirulence. L,L-Succinamopine T-DNA could not be complemented to hypervirulence on tobacco and tomato plants with either heterologous vir region. From these results the authors suggest that the hypervirulence of strain A281 is due to non-T-DNA sequences on the Ti plasmid.

  16. AAV vector encoding human VEGF165–transduced pectineus muscular flaps increase the formation of new tissue through induction of angiogenesis in an in vivo chamber for tissue engineering: A technique to enhance tissue and vessels in microsurgically engineered tissue

    Directory of Open Access Journals (Sweden)

    Silvia Moimas

    2015-12-01

    Full Text Available In regenerative medicine, new approaches are required for the creation of tissue substitutes, and the interplay between different research areas, such as tissue engineering, microsurgery and gene therapy, is mandatory. In this article, we report a modification of a published model of tissue engineering, based on an arterio-venous loop enveloped in a cross-linked collagen–glycosaminoglycan template, which acts as an isolated chamber for angiogenesis and new tissue formation. In order to foster tissue formation within the chamber, which entails on the development of new vessels, we wondered whether we might combine tissue engineering with a gene therapy approach. Based on the well-described tropism of adeno-associated viral vectors for post-mitotic tissues, a muscular flap was harvested from the pectineus muscle, inserted into the chamber and transduced by either AAV vector encoding human VEGF165 or AAV vector expressing the reporter gene β-galactosidase, as a control. Histological analysis of the specimens showed that muscle transduction by AAV vector encoding human VEGF165 resulted in enhanced tissue formation, with a significant increase in the number of arterioles within the chamber in comparison with the previously published model. Pectineus muscular flap, transduced by adeno-associated viral vectors, acted as a source of the proangiogenic factor vascular endothelial growth factor, thus inducing a consistent enhancement of vessel growth into the newly formed tissue within the chamber. In conclusion, our present findings combine three different research fields such as microsurgery, tissue engineering and gene therapy, suggesting and showing the feasibility of a mixed approach for regenerative medicine.

  17. Tlys, a newly identified Sulfolobus spindle-shaped virus 1 transcript expressed in the lysogenic state, encodes a DNA-binding protein interacting at the promoters of the early genes

    DEFF Research Database (Denmark)

    Fusco, Salvatore; She, Qunxin; Bartolucci, Simonetta

    2013-01-01

    the growth of the lysogenic host. The correponding gene f55 lies between two transcriptional units (T6 and Tind) that are upregulated upon UV irradiation. The open reading frame f55 encodes a 6.3-kDa protein which shows sequence identity with negative regulators that fold into the ribbon-helix-helix DNA......-binding motif. DNA-binding assays demonstrated that the recombinant F55, purified from Escherichia coli, is indeed a putative transcription factor able to recognize site specifically target sequences in the promoters of the early induced T5, T6, and Tind transcripts, as well as of its own promoter. Binding...... sites of F55 are included within a tandem-repeated sequence overlapping the transcription start sites and/or the B recognition element of the pertinent genes. The strongest binding was observed with the promoters of T5 and T6, and an apparent cooperativity in binding was observed with the Tind promoter...

  18. Eliciting specific humoral immunity from a plasmid DNA encoding infectious bursal disease virus polyprotein gene fused with avian influenza virus hemagglutinin gene.

    Science.gov (United States)

    Mosley, Yung-Yi C; Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long

    2015-01-01

    DNA vaccine coding for infectious bursal disease virus (IBDV) polyprotein gene and that for avian influenza virus (AIV) hemagglutinin (HA) gene have been shown to induce immunity and provide protection against the respective disease. The present study was carried out to determine whether an IBDV polyprotein gene-based DNA fused with AIV HA gene could trigger immune response to both IBDV and AIV. After transfection, VP2 and HA were detected in the cytoplasm and at cell membrane, respectively, by immunofluorescent antibody double staining method, suggesting the fusion strategy did not affect the location of protein expression. VP4 cleavage between VP2 and HA was confirmed by Western blot, indicating the fusion strategy did not affect VP4 function in transfected cells. After vaccination in chickens, the DNA construct VP24-HA/pcDNA induced ELISA and virus neutralizing antibodies against VP2 and hemagglutination inhibition antibody against the HA subtype. The results indicated that a single plasmid construct carrying IBDV VP243 gene-based DNA fused with AIV HA gene can elicit specific antibody responses to both IBDV and AIV by DNA vaccination. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption

    Science.gov (United States)

    2013-01-01

    Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

  20. Chondroitin sulfate-polyethylenimine copolymer-coated superparamagnetic iron oxide nanoparticles as an efficient magneto-gene carrier for microRNA-encoding plasmid DNA delivery

    Science.gov (United States)

    Lo, Yu-Lun; Chou, Han-Lin; Liao, Zi-Xian; Huang, Shih-Jer; Ke, Jyun-Han; Liu, Yu-Sheng; Chiu, Chien-Chih; Wang, Li-Fang

    2015-04-01

    MicroRNA-128 (miR-128) is an attractive therapeutic molecule with powerful glioblastoma regulation properties. However, miR-128 lacks biological stability and leads to poor delivery efficacy in clinical applications. In our previous study, we demonstrated two effective transgene carriers, including polyethylenimine (PEI)-decorated superparamagnetic iron oxide nanoparticles (SPIONs) as well as chemically-conjugated chondroitin sulfate-PEI copolymers (CPs). In this contribution, we report optimized conditions for coating CPs onto the surfaces of SPIONs, forming CPIOs, for magneto-gene delivery systems. The optimized weight ratio of the CPs and SPIONs is 2 : 1, which resulted in the formation of a stable particle as a good transgene carrier. The hydrodynamic diameter of the CPIOs is ~136 nm. The gel electrophoresis results demonstrate that the weight ratio of CPIO/DNA required to completely encapsulate pDNA is >=3. The in vitro tests of CPIO/DNA were done in 293 T, CRL5802, and U87-MG cells in the presence and absence of an external magnetic field. The magnetofection efficiency of CPIO/DNA was measured in the three cell lines with or without fetal bovine serum (FBS). CPIO/DNA exhibited remarkably improved gene expression in the presence of the magnetic field and 10% FBS as compared with a gold non-viral standard, PEI/DNA, and a commercial magnetofection reagent, PolyMag/DNA. In addition, CPIO/DNA showed less cytotoxicity than PEI/DNA and PolyMag/DNA against the three cell lines. The transfection efficiency of the magnetoplex improved significantly with an assisted magnetic field. In miR-128 delivery, a microRNA plate array and fluorescence in situ hybridization were used to demonstrate that CPIO/pMIRNA-128 indeed expresses more miR-128 with the assisted magnetic field than without. In a biodistribution test, CPIO/Cy5-DNA showed higher accumulation at the tumor site where an external magnet is placed nearby.MicroRNA-128 (miR-128) is an attractive therapeutic molecule

  1. Construction and immunogenicity of DNA vaccines encoding fusion protein of murine complement C3d-p28 and GP5 gene of porcine reproductive and respiratory syndrome virus.

    Science.gov (United States)

    Zhang, Deqing; Xia, Qingxiang; Wu, Jiaqiang; Liu, Dong; Wang, Xiaolong; Niu, Zhongxiang

    2011-01-17

    Porcine reproductive and respiratory syndrome virus (PRRSV) has recently caused catastrophic losses in swine industry worldwide. The commercial vaccines only provide a limited protection against PRRSV infection. At present, DNA vaccine is the focus on the new vaccines. The gene fragment (p28) coding for the molecular adjuvants complement protein C3d (mC3d) from BALB/c mouse was cloned and expressed as a fusion protein for its application in the vaccine study of mice. Three potential vaccines construct units were engineered to contain two, four and six copies of mC3d-p28 coding gene linked to the GP5 gene of PRRSV and one vaccine expressing GP5 alone (pcDNA3.1-GP5) was constructed. Subsequently, the vaccines' abilities to elicit the humoral and cellular immune responses were investigated in mice. These results showed that significantly enhanced GP5-specific ELISA antibody, GP5-specific neutralizing antibody, IFN-γ level, and IL-4 level, could be induced in mice immunized with DNA construct units encoding the pcDNA3.1-C3d-p28.n-GP5 than those received DNA vaccine expressing GP5 alone (pcDNA3.1-GP5). Analysis of the immunogenicity of different repeats of mC3d-p28 revealed that mC3d-p28 had an enhancing effect on the immunogenicity of antigens, and that six or more repeats of mC3d-p28 may be necessary for efficient enhancement of antigen specific immune responses. This approach may provide a new strategy for the development of efficient vaccines against the PRRSV for pigs in the future. Copyright © 2010 Elsevier Ltd. All rights reserved.

  2. Evaluation of Immunogenicity of Cocktail DNA Vaccine Contain¬ing Plasmids Encoding Complete GRA5, SAG1, and ROP2 Antigens of Toxoplasma gondii in BALB/C Mice

    Directory of Open Access Journals (Sweden)

    Razi NASERIFAR

    2015-12-01

    Full Text Available Background: Severe and fatal complications of toxoplasmosis urge development of effective vaccines against the disease. The current study was performed to evalu­ate cocktail DNA vaccine containing plasmids encoding GRA5, SAG1, and ROP2 genes of Toxoplasma gondii in BALB/c mice in Tarbiat Modares University in 2012.Methods: The plasmids containing complete GRA5, SAG1, and ROP2 genes were mass extracted and then the recombinant plasmids were administered via intramuscu­lar injections according to immunized mice three times with three-week intervals. Then splenocytes were cultured, and proliferation as well as cytokine as­says were carried out. The other mice in each group were inoculated by the parasite and mortality of the mice was evaluated on a daily basis.Results: The results of cytokine assay for INF-γ were higher in the mice that re­ceived the cocktail DNA containing recombinant plasmids. Evaluation of prolifera­tion of splenocytes using the MTT (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazo­lium bromide assay indicated induction of cellular response. Measurement of total IgG and the isotypes of IgG1 and IgG2a showed that the cocktail DNA stimulated IgG and IgG2a production in comparison with the control groups (P<0.05. Furthermore, the survival rate of mice in the groups that received the cocktail DNA was significantly higher than that in the control groups (P<0.05.Conclusion: Administration of the cocktail DNA vaccine led to production of higher levels of IFN-γ, confirmed by secretion of IgG2a, and the immune response was shifted toward Th1. Thus, the cocktail DNA containing the recombinant plas­mids can be an appropriate candidate for immunization against toxoplasmosis.

  3. Genome segment S8 of grass carp hemorrhage virus encodes a virion protein.

    Science.gov (United States)

    Qiu, T; Zhang, J; Lu, R; Zhu, Z

    2001-01-01

    The complete nucleotide sequence of the genome segment S8 of grass carp hemorrhage virus (GCHV) was determined from cDNA corresponding to the viral genomic RNA. It is 1,287 nucleotides in length and contains a large open reading frame that could encode a protein of 409 amino acids with a predicted molecular mass of 44 kD. The S8 was expressed using the pET fusion protein vector and detected by Western blotting analysis using the chicken egg IgY against intact GCHV particles, indicating that S8 encodes a virion protein. Amino acid sequence comparisons revealed that the protein encoded by S8 is closely related to protein sigma2 of mammalian reovirus, suggesting that the deduced protein of S8 is an inner capsid protein. Copyright 2001 S. Karger AG, Basel

  4. Vector analysis

    CERN Document Server

    Newell, Homer E

    2006-01-01

    When employed with skill and understanding, vector analysis can be a practical and powerful tool. This text develops the algebra and calculus of vectors in a manner useful to physicists and engineers. Numerous exercises (with answers) not only provide practice in manipulation but also help establish students' physical and geometric intuition in regard to vectors and vector concepts.Part I, the basic portion of the text, consists of a thorough treatment of vector algebra and the vector calculus. Part II presents the illustrative matter, demonstrating applications to kinematics, mechanics, and e

  5. About vectors

    CERN Document Server

    Hoffmann, Banesh

    1975-01-01

    From his unusual beginning in ""Defining a vector"" to his final comments on ""What then is a vector?"" author Banesh Hoffmann has written a book that is provocative and unconventional. In his emphasis on the unresolved issue of defining a vector, Hoffmann mixes pure and applied mathematics without using calculus. The result is a treatment that can serve as a supplement and corrective to textbooks, as well as collateral reading in all courses that deal with vectors. Major topics include vectors and the parallelogram law; algebraic notation and basic ideas; vector algebra; scalars and scalar p

  6. Identification of cDNA encoding an additional α subunit of a human GTP-binding protein: Expression of three αi subtypes in human tissues and cell lines

    International Nuclear Information System (INIS)

    Kim, S.; Ang, S.L.; Bloch, D.B.; Bloch, K.D.; Kawahara, Y.; Tolman, C.; Lee, R.; Seidman, J.G.; Neer, E.J.

    1988-01-01

    The guanine nucleotide-binding proteins (G proteins), which mediate hormonal regulation of many membrane functions, are composed of α, β, and γ subunits. The authors have cloned and characterized cDNA from a human T-cell library encoding a form of α i that is different from the human α i subtypes previously reported. α i is the α subunit of a class of G proteins that inhibits adenylate cyclase and regulates other enzymes and ion channels. This cDNA encodes a polypeptide of 354 amino acids and is assigned to encode the α i-3 subtype of G proteins on the basis of its similarity to other α i -like cDNAs and the presence of a predicted site for ADP ribosylation by pertussis toxin. They have determined the expression of mRNA for this and two other subtypes of human α i (α i-1 and α i-2 ) in a variety of human fetal tissues and in human cell lines. All three α i subtypes were present in the tissues tested. However, analysis of individual cell types reveals specificity of α i-1 expression. mRNA for α i-1 is absent in T cells, B cells, and monocytes but is present in other cell lines. The finding of differential expression of α i-1 genes may permit characterization of distinct physiological roles for this α i subunit. mRNA for α i-2 and α i-3 was found in all the primary and transformed cell lines tested. Thus, some cells contain all three α i subtypes. This observation raises the question of how cells prevent cross talk among receptors that are coupled to effectors through such similar α proteins

  7. Permutations as a means to encode order in word space

    OpenAIRE

    Sahlgren, Magnus; Holst, Anders; Kanerva, Pentti

    2008-01-01

    We show that sequence information can be encoded into high-dimensional fixed-width vectors using permutations of coordinates. Computational models of language often represent words with high-dimensional semantic vectors compiled from word-use statistics. A word's semantic vector usually encodes the contexts in which the word appears in a large body of text but ignores word order. However, word order often signals a word's grammatical role in a sentence and thus tells of the word's meaning. Jo...

  8. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

    Science.gov (United States)

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

    2012-01-01

    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  9. Lymphocyte responses of rats vaccinated with cDNA encoding a phosphoglycerate kinase of Fasciola hepatica (FhPGK) and F. hepatica infection.

    Science.gov (United States)

    Wesołowska, Agnieszka; Zawistowska-Deniziak, Anna; Norbury, Luke J; Wilkowski, Przemysław; Pyziel, Anna M; Zygner, Wojciech; Wędrychowicz, Halina

    2018-02-01

    Lymphocyte responses in the blood, peritoneal fluid and both mesenteric and hepatic lymph nodes of cDNA-FhPGK/pCMV vaccinated and/or Fasciola hepatica infected rats of both sexes were investigated to provide an insight into the immune responses that develop in different body compartments. The immune response that developed in cDNA-FhPGK/pCMV vaccinated females contributed to partial protection against F. hepatica infection (54% reduction in fluke recovery), while more liver flukes were found in the livers and bile ducts of cDNA-FhPGK/pCMV vaccinated male rats than in unvaccinated animals (increase of 13%). Rat sex not only affected the ultimate effectiveness of vaccination but also lymphocyte responses following vaccination and/or infection. Different CD4+ and CD8+ T cell profiles were noted in peritoneal fluid and lymph nodes, but not in blood, during acute and chronic fasciolosis. Moreover, independent lymphocyte responses developed in distinct body compartments. Immune responses of rats were polarized towards Th2/Treg with lymphocytes isolated from male rats showing higher IL-4 and IL-10 production than females. Lymphocyte proliferative capacities in response to mitogen (PHA) or vaccine antigen (FhPGK) were impaired in both sexes with a considerably higher reduction observed for males and restored lymphocyte proliferative capacities reported for females vaccinated with cDNA-FhPGK/pCMV during chronic fasciolosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Enhanced immune response and protective effects of nano-chitosan-based DNA vaccine encoding T cell epitopes of Esat-6 and FL against Mycobacterium tuberculosis infection.

    Directory of Open Access Journals (Sweden)

    Ganzhu Feng

    Full Text Available Development of a novel and effective vaccine against Mycobacterium tuberculosis (M.tb is a challenging for preventing TB infection. In this study, a novel nanoparticle-based recombinant DNA vaccine was developed, which contains Esat-6 three T cell epitopes (Esat-6/3e and fms-like tyrosine kinase 3 ligand (FL genes (termed Esat-6/3e-FL, and was enveloped with chitosan (CS nanoparticles (nano-chitosan. The immunologic and protective efficacy of the nano-chitosan-based DNA vaccine (termed nano-Esat-6/3e-FL was assessed in C57BL/6 mice after intramuscular prime vaccination with the plasmids DNA and nasal boost with the Esat-6/3e peptides. The results showed that the immunized mice remarkably elicited enhanced T cell responses and protection against M.tb H37Rv challenge. These findings indicate that the nano-chitosan can significantly elevate the immunologic and protective effects of the DNA vaccine, and the nano-Esat-6/3e-FL is a useful vaccine for preventing M.tb infection in mice.

  11. DNA analysis of the genes encoding acidocin LF221 A and acidocin LF221 B, two bacteriocins produced by Lactobacillus gasseri LF221

    NARCIS (Netherlands)

    Majhenič, A.Č.; Venema, K.; Allison, G.E.; Matijašić, B.B.; Rogelj, I.; Klaenhammer, T.R.

    2004-01-01

    Lactobacillus gasseri LF221, an isolate from the feces of a child, produces two bacteriocins. Standard procedures for molecular techniques were used to locate, clone and sequence the fragments of LF221 chromosomal DNA carrying the acidocin LF221 A and B structural genes, respectively. Sequencing

  12. DNA binding sites recognised in vitro by a knotted class 1 homeodomain protein encoded by the hooded gene, k, in barley (Hordeum vulgare)

    DEFF Research Database (Denmark)

    Krusell, L; Rasmussen, I; Gausing, K

    1997-01-01

    of knotted1 from maize was isolated from barley seedlings and expressed as a maltose binding protein fusion in E. coli. The purified HvH21-fusion protein selected DNA fragments with 1-3 copies of the sequence TGAC. Gel shift experiments showed that the TGAC element was required for binding and the results...

  13. Geminiviral vectors based on bean yellow dwarf virus for production of vaccine antigens and monoclonal antibodies in plants.

    Science.gov (United States)

    Chen, Qiang; He, Junyun; Phoolcharoen, Waranyoo; Mason, Hugh S

    2011-03-01

    Expression of recombinant vaccine antigens and monoclonal antibodies using plant viral vectors has developed extensively during the past several years. The approach benefits from high yields of recombinant protein obtained within days after transient delivery of viral vectors to leaves of Nicotiana benthamiana, a tobacco relative. Modified viral genomes of both RNA and DNA viruses have been created. Geminiviruses such as bean yellow dwarf virus (BeYDV) have a small, single stranded DNA genome that replicates in the nucleus of an infected plant cell, using the cellular DNA synthesis apparatus and a virus-encoded replication initiator protein (Rep). BeYDV-derived expression vectors contain deletions of the viral genes encoding coat and movement proteins and insertion of an expression cassette for a protein of interest. Delivery of the geminiviral vector to leaf cells via Agrobacterium-mediated delivery produces very high levels of recombinant DNA that can act as a transcription template, yielding high levels of mRNA for the protein of interest. Several vaccine antigens, including Norwalk virus capsid protein and hepatitis B core antigen, were expressed using the BeYDV vector at levels up to 1 mg per g of leaf mass. BeYDV replicons can be stacked in the same vector molecule by linking them in tandem, which enables production of multi-subunit proteins like monoclonal antibody (mAb) heavy and light chains. The protective mAb 6D8 against Ebola virus was produced at 0.5 mg per g of leaf mass. Multi-replicon vectors could be conveniently used to produce protein complexes, e.g. virus-like particles that require two or more subunits.

  14. Elementary vectors

    CERN Document Server

    Wolstenholme, E Œ

    1978-01-01

    Elementary Vectors, Third Edition serves as an introductory course in vector analysis and is intended to present the theoretical and application aspects of vectors. The book covers topics that rigorously explain and provide definitions, principles, equations, and methods in vector analysis. Applications of vector methods to simple kinematical and dynamical problems; central forces and orbits; and solutions to geometrical problems are discussed as well. This edition of the text also provides an appendix, intended for students, which the author hopes to bridge the gap between theory and appl

  15. Tensor GSVD of Patient- and Platform-Matched Tumor and Normal DNA Copy-Number Profiles Uncovers Chromosome Arm-Wide Patterns of Tumor-Exclusive Platform-Consistent Alterations Encoding for Cell Transformation and Predicting Ovarian Cancer Survival

    Science.gov (United States)

    Sankaranarayanan, Preethi; Schomay, Theodore E.; Aiello, Katherine A.; Alter, Orly

    2015-01-01

    The number of large-scale high-dimensional datasets recording different aspects of a single disease is growing, accompanied by a need for frameworks that can create one coherent model from multiple tensors of matched columns, e.g., patients and platforms, but independent rows, e.g., probes. We define and prove the mathematical properties of a novel tensor generalized singular value decomposition (GSVD), which can simultaneously find the similarities and dissimilarities, i.e., patterns of varying relative significance, between any two such tensors. We demonstrate the tensor GSVD in comparative modeling of patient- and platform-matched but probe-independent ovarian serous cystadenocarcinoma (OV) tumor, mostly high-grade, and normal DNA copy-number profiles, across each chromosome arm, and combination of two arms, separately. The modeling uncovers previously unrecognized patterns of tumor-exclusive platform-consistent co-occurring copy-number alterations (CNAs). We find, first, and validate that each of the patterns across only 7p and Xq, and the combination of 6p+12p, is correlated with a patient’s prognosis, is independent of the tumor’s stage, the best predictor of OV survival to date, and together with stage makes a better predictor than stage alone. Second, these patterns include most known OV-associated CNAs that map to these chromosome arms, as well as several previously unreported, yet frequent focal CNAs. Third, differential mRNA, microRNA, and protein expression consistently map to the DNA CNAs. A coherent picture emerges for each pattern, suggesting roles for the CNAs in OV pathogenesis and personalized therapy. In 6p+12p, deletion of the p21-encoding CDKN1A and p38-encoding MAPK14 and amplification of RAD51AP1 and KRAS encode for human cell transformation, and are correlated with a cell’s immortality, and a patient’s shorter survival time. In 7p, RPA3 deletion and POLD2 amplification are correlated with DNA stability, and a longer survival. In Xq

  16. The effects of gamma irradiation on growth and expression of genes encoding DNA repair-related proteins in Lombardy poplar (Populus nigra var. italica).

    Science.gov (United States)

    Nishiguchi, Mitsuru; Nanjo, Tokihiko; Yoshida, Kazumasa

    2012-07-01

    In this study, to elucidate the mechanisms of adaptation and tolerance to ionizing radiation in woody plants, we investigated the various biological effects of γ-rays on the Lombardy poplar (Populus nigra L. var. italica Du Roi). We detected abnormal leaf shape and color, fusion, distorted venation, shortened internode, fasciation and increased axillary shoots in γ-irradiated poplar plants. Acute γ-irradiation with a dose of 100Gy greatly reduced the height, stem diameter and biomass of poplar plantlets. After receiving doses of 200 and 300Gy, all the plantlets stopped growing, and then most of them withered after 4-10 weeks of γ-irradiation. Comet assays showed that nuclear DNA in suspension-cultured poplar cells had been damaged by γ-rays. To determine whether DNA repair-related proteins are involved in the response to γ-rays in Lombardy poplars, we cloned the PnRAD51, PnLIG4, PnKU70, PnXRCC4, PnPCNA and PnOGG1 cDNAs and investigated their mRNA expression. The PnRAD51, PnLIG4, PnKU70, PnXRCC4 and PnPCNA mRNAs were increased by γ-rays, but the PnOGG1 mRNA was decreased. Moreover, the expression of PnLIG4, PnKU70 and PnRAD51 was also up-regulated by Zeocin known as a DNA cleavage agent. These observations suggest that the morphogenesis, growth and protective gene expression in Lombardy poplars are severely affected by the DNA damage and unknown cellular events caused by γ-irradiation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. DNA Vaccine Encoding the Chimeric Form of Schistosoma mansoni Sm-TSP2 and Sm29 Confers Partial Protection against Challenge Infection

    OpenAIRE

    Gon?alves de Assis, Natan Raimundo; Batistoni de Morais, Suellen; Figueiredo, B?rbara Castro Pimentel; Ricci, Natasha Delaqua; de Almeida, Leonardo Augusto; da Silva Pinheiro, Carina; Martins, Vicente de Paulo; Oliveira, Sergio Costa

    2015-01-01

    Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2) are two proteins that are ...

  18. Positive-selection and ligation-independent cloning vectors for large scale in planta expression for plant functional genomics.

    Science.gov (United States)

    Oh, Sang-Keun; Kim, Saet-Byul; Yeom, Seon-In; Lee, Hyun-Ah; Choi, Doil

    2010-12-01

    Transient expression is an easy, rapid and powerful technique for producing proteins of interest in plants. Recombinational cloning is highly efficient but has disadvantages, including complicated, time consuming cloning procedures and expensive enzymes for large-scale gene cloning. To overcome these limitations, we developed new ligation-independent cloning (LIC) vectors derived from binary vectors including tobacco mosaic virus (pJL-TRBO), potato virus X (pGR106) and the pBI121 vector-based pMBP1. LIC vectors were modified to enable directional cloning of PCR products without restriction enzyme digestion or ligation reactions. In addition, the ccdB gene, which encodes a potent cell-killing protein, was introduced between the two LIC adapter sites in the pJL-LIC, pGR-LIC, and pMBP-LIC vectors for the efficient selection of recombinant clones. This new vector does not require restriction enzymes, alkaline phosphatase, or DNA ligase for cloning. To clone, the three LIC vectors are digested with SnaBI and treated with T4 DNA polymerase, which includes 3' to 5' exonuclease activity in the presence of only one dNTP (dGTP for the inserts and dCTP for the vector). To make recombinants, the vector plasmid and the insert PCR fragment were annealed at room temperature for 20 min prior to transformation into the host. Bacterial transformation was accomplished with 100% efficiency. To validate the new LIC vector systems, we were used to coexpressed the Phytophthora AVR and potato resistance (R) genes in N. benthamiana by infiltration of Agrobacterium. Coexpressed AVR and R genes in N. benthamiana induced the typical hypersensitive cell death resulting from in vivo interaction of the two proteins. These LIC vectors could be efficiently used for high-throughput cloning and laboratory-scale in planta expression. These vectors could provide a powerful tool for high-throughput transient expression assays for functional genomic studies in plants.

  19. Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.).

    Science.gov (United States)

    Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y

    1996-08-01

    The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

  20. The All-Alpha Domains of Coupling Proteins from the Agrobacterium tumefaciens VirB/VirD4 and Enterococcus faecalis pCF10-Encoded Type IV Secretion Systems Confer Specificity to Binding of Cognate DNA Substrates.

    Science.gov (United States)

    Whitaker, Neal; Chen, Yuqing; Jakubowski, Simon J; Sarkar, Mayukh K; Li, Feng; Christie, Peter J

    2015-07-01

    Bacterial type IV coupling proteins (T4CPs) bind and mediate the delivery of DNA substrates through associated type IV secretion systems (T4SSs). T4CPs consist of a transmembrane domain, a conserved nucleotide-binding domain (NBD), and a sequence-variable helical bundle called the all-alpha domain (AAD). In the T4CP structural prototype, plasmid R388-encoded TrwB, the NBD assembles as a homohexamer resembling RecA and DNA ring helicases, and the AAD, which sits at the channel entrance of the homohexamer, is structurally similar to N-terminal domain 1 of recombinase XerD. Here, we defined the contributions of AADs from the Agrobacterium tumefaciens VirD4 and Enterococcus faecalis PcfC T4CPs to DNA substrate binding. AAD deletions abolished DNA transfer, whereas production of the AAD in otherwise wild-type donor strains diminished the transfer of cognate but not heterologous substrates. Reciprocal swaps of AADs between PcfC and VirD4 abolished the transfer of cognate DNA substrates, although strikingly, the VirD4-AADPcfC chimera (VirD4 with the PcfC AAD) supported the transfer of a mobilizable plasmid. Purified AADs from both T4CPs bound DNA substrates without sequence preference but specifically bound cognate processing proteins required for cleavage at origin-of-transfer sequences. The soluble domains of VirD4 and PcfC lacking their AADs neither exerted negative dominance in vivo nor specifically bound cognate processing proteins in vitro. Our findings support a model in which the T4CP AADs contribute to DNA substrate selection through binding of associated processing proteins. Furthermore, MOBQ plasmids have evolved a docking mechanism that bypasses the AAD substrate discrimination checkpoint, which might account for their capacity to promiscuously transfer through many different T4SSs. For conjugative transfer of mobile DNA elements, members of the VirD4/TraG/TrwB receptor superfamily bind cognate DNA substrates through mechanisms that are largely undefined. Here

  1. Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

    Science.gov (United States)

    Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

    2015-03-01

    Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Impact of a Central Scaffold on the Binding Affinity of Fragment Pairs Isolated from DNA-Encoded Self-Assembling Chemical Libraries.

    Science.gov (United States)

    Bigatti, Martina; Dal Corso, Alberto; Vanetti, Sara; Cazzamalli, Samuele; Rieder, Ulrike; Scheuermann, Jörg; Neri, Dario; Sladojevich, Filippo

    2017-11-08

    The screening of encoded self-assembling chemical libraries allows the identification of fragment pairs that bind to adjacent pockets on target proteins of interest. For practical applications, it is necessary to link these ligand pairs into discrete organic molecules, devoid of any nucleic acid component. Here we describe the discovery of a synergistic binding pair for acid alpha-1 glycoprotein and a chemical strategy for the identification of optimal linkers, connecting the two fragments. The procedure yielded a set of small organic ligands, the best of which exhibited a dissociation constant of 9.9 nm, as measured in solution by fluorescence polarization. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants.

    Science.gov (United States)

    Naderian, Homayoun; Rezvani, Zahra; Atlasi, Mohammad Ali; Nikzad, Hossein; Antoine, Af de Vries

    2011-07-01

    Nonviral vector can be an attractive alternative to gene delivery in experimental study. In spite of some advantages in comparison with the viral vectors, there are still some limitations for efficiency of gene delivery in nonviral vectors. To determine the effective expression, the recombinant Escherichia coli lacZ genes were cloned into the different variants of pcDNA3.1 and then the mammalian cells were transfected. The coding sequences of cytoplasmic and nuclear variants of lacZ gene were inserted downstream of the human cytomegalovirus immediate-early gene promoter of plasmid pcDNA3.1/myc-His C. The new cytoplasmic and nuclear constricts of E. coli β-galactosidase-coding sequences were introduced into HeLa cells with the aid of linear polyethylenimine and at 2 days post-transfection the cells were stained using 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal). Restriction enzyme analyses revealed the proper insertion of E. coli β-galactosidase-coding sequences into the multiple cloning site of pcDNA3.1/myc-His C. The functionality of the resulting constructs designated pcDNA3.1-cyt.lacZ and pcDNA3.1-nls.lacZ(+) was confirmed by X-gal staining of HeLa cells transfected with these recombinant plasmids. While pcDNA3.1-cyt.lacZ directed the synthesis of cytoplasmically located β-galactosidase molecules, the β-galactosidase protein encoded by pcDNA3.1-nls.lacZ(+) was predominantly detected in the cell nucleus. The expression of cytoplasmic and nuclear variant of LacZ gene confirmed the ability of pcDNA3.1 as versatility nonviral vector for the experimental gene delivery study in mammalian cells.

  4. Protective efficacy of a broadly cross-reactive swine influenza DNA vaccine encoding M2e, cytotoxic T lymphocyte epitope and consensus H3 hemagglutinin

    Science.gov (United States)

    2012-01-01

    Background Pigs have been implicated as mixing reservoir for the generation of new pandemic influenza strains, control of swine influenza has both veterinary and public health significance. Unlike human influenza vaccines, strains used for commercially available swine influenza vaccines are not regularly replaced, making the vaccines provide limited protection against antigenically diverse viruses. It is therefore necessary to develop broadly protective swine influenza vaccines that are efficacious to both homologous and heterologous virus infections. In this study, two forms of DNA vaccines were constructed, one was made by fusing M2e to consensus H3HA (MHa), which represents the majority of the HA sequences of H3N2 swine influenza viruses. Another was made by fusing M2e and a conserved CTL epitope (NP147-155) to consensus H3HA (MNHa). Their protective efficacies against homologous and heterologous challenges were tested. Results BALB/c mice were immunized twice by particle-mediated epidermal delivery (gene gun) with the two DNA vaccines. It was shown that the two vaccines elicited substantial antibody responses, and MNHa induced more significant T cell-mediated immune response than MHa did. Then two H3N2 strains representative of different evolutional and antigenic clusters were used to challenge the vaccine-immunized mice (homosubtypic challenge). Results indicated that both of the DNA vaccines prevented homosubtypic virus infections completely. The vaccines’ heterologous protective efficacies were further tested by challenging with a H1N1 swine influenza virus and a reassortant 2009 pandemic strain. It was found that MNHa reduced the lung viral titers significantly in both challenge groups, histopathological observation showed obvious reduction of lung pathogenesis as compared to MHa and control groups. Conclusions The combined utility of the consensus HA and the conserved M2e and CTL epitope can confer complete and partial protection against homologous and

  5. Assembly of functional proton-translocating ATPase complex in yeast mitochondria with cytoplasmically synthesized subunit 8, a polypeptide normally encoded within the organelle.

    OpenAIRE

    Nagley, P; Farrell, L B; Gearing, D P; Nero, D; Meltzer, S; Devenish, R J

    1988-01-01

    A mitochondrial gene from Saccharomyces cerevisiae encoding a hydrophobic membrane protein, subunit 8 of the F0/F1-type mitochondrial ATPase complex, has been functionally replaced by an artificial nuclear gene specifying an imported version of this protein. The experiments reported here utilized a multicopy expression vector (pLF1) that replicates in the nucleus of yeast cells and that carries an inserted DNA segment, specifying a precursor protein (N9/Y8) consisting of subunit 8 fused to an...

  6. Co-administration of plasmid-encoded granulocyte-macrophage colony-stimulating factor increases human immunodeficiency virus-1 DNA vaccine-induced polyfunctional CD4+ T-cell responses.

    Science.gov (United States)

    Santana, Vinicius Canato; Almeida, Rafael Ribeiro; Ribeiro, Susan Pereira; Ferreira, Luís Carlos de Souza; Kalil, Jorge; Rosa, Daniela Santoro; Cunha-Neto, Edecio

    2015-12-01

    T-cell based vaccines against human immunodeficiency virus (HIV) generate specific responses that may limit both transmission and disease progression by controlling viral load. Broad, polyfunctional, and cytotoxic CD4+T-cell responses have been associated with control of simian immunodeficiency virus/HIV-1 replication, supporting the inclusion of CD4+ T-cell epitopes in vaccine formulations. Plasmid-encoded granulocyte-macrophage colony-stimulating factor (pGM-CSF) co-administration has been shown to induce potent CD4+ T-cell responses and to promote accelerated priming and increased migration of antigen-specific CD4+ T-cells. However, no study has shown whether co-immunisation with pGM-CSF enhances the number of vaccine-induced polyfunctional CD4+ T-cells. Our group has previously developed a DNA vaccine encoding conserved, multiple human leukocyte antigen (HLA)-DR binding HIV-1 subtype B peptides, which elicited broad, polyfunctional and long-lived CD4+ T-cell responses. Here, we show that pGM-CSF co-immunisation improved both magnitude and quality of vaccine-induced T-cell responses, particularly by increasing proliferating CD4+ T-cells that produce simultaneously interferon-γ, tumour necrosis factor-α and interleukin-2. Thus, we believe that the use of pGM-CSF may be helpful for vaccine strategies focused on the activation of anti-HIV CD4+ T-cell immunity.

  7. Attenuated Salmonella typhimurium delivering DNA vaccine encoding duck enteritis virus UL24 induced systemic and mucosal immune responses and conferred good protection against challenge

    Directory of Open Access Journals (Sweden)

    Yu Xia

    2012-07-01

    Full Text Available Abstract Orally delivered DNA vaccines against duck enteritis virus (DEV were developed using live attenuated Salmonella typhimurium (SL7207 as a carrier and Escherichia coli heat labile enterotoxin B subunit (LTB as a mucosal adjuvant. DNA vaccine plasmids pVAX-UL24 and pVAX-LTB-UL24 were constructed and transformed into attenuated Salmonella typhimurium SL7207 resulting SL7207 (pVAX-UL24 and SL7207 (pVAX-LTB-UL24 respectively. After ducklings were orally inoculated with SL7207 (pVAX-UL24 or SL7207 (pVAX-LTB-UL24, the anti-DEV mucosal and systemic immune responses were recorded. To identify the optimum dose that confers maximum protection, we used different doses of the candidate vaccine SL7207 (pVAX-LTB-UL24 during oral immunization. The strongest mucosal and systemic immune responses developed in the SL7207 (pVAX-LTB-UL24 (1011 CFU immunized group. Accordingly, oral immunization of ducklings with SL7207 (pVAX-LTB-UL24 showed superior efficacy of protection (60-80% against a lethal DEV challenge (1000 LD50, compared with the limited survival rate (40% of ducklings immunized with SL7207 (pVAX-UL24. Our study suggests that the SL7207 (pVAX-LTB-UL24 can be a candidate DEV vaccine.

  8. Construction of expression vectors carrying mouse peroxisomal ...

    African Journals Online (AJOL)

    The aim of this study was to construct expression vectors carrying mouse peroxisomal protein gene (PEP-cDNA) in prokaryotic and mammalian expression vectors in ... pGEX6p2-PEP and pUcD3-FLAG-PEP constructed vectors were transformed into the one shot TOP10 and JM105 bacterial competent cells, respectively.

  9. Vector analysis

    CERN Document Server

    Brand, Louis

    2006-01-01

    The use of vectors not only simplifies treatments of differential geometry, mechanics, hydrodynamics, and electrodynamics, but also makes mathematical and physical concepts more tangible and easy to grasp. This text for undergraduates was designed as a short introductory course to give students the tools of vector algebra and calculus, as well as a brief glimpse into these subjects' manifold applications. The applications are developed to the extent that the uses of the potential function, both scalar and vector, are fully illustrated. Moreover, the basic postulates of vector analysis are brou

  10. Protective efficacy of a broadly cross-reactive swine influenza DNA vaccine encoding M2e, cytotoxic T lymphocyte epitope and consensus H3 hemagglutinin

    Directory of Open Access Journals (Sweden)

    Wang Bin

    2012-06-01

    Full Text Available Abstract Background Pigs have been implicated as mixing reservoir for the generation of new pandemic influenza strains, control of swine influenza has both veterinary and public health significance. Unlike human influenza vaccines, strains used for commercially available swine influenza vaccines are not regularly replaced, making the vaccines provide limited protection against antigenically diverse viruses. It is therefore necessary to develop broadly protective swine influenza vaccines that are efficacious to both homologous and heterologous virus infections. In this study, two forms of DNA vaccines were constructed, one was made by fusing M2e to consensus H3HA (MHa, which represents the majority of the HA sequences of H3N2 swine influenza viruses. Another was made by fusing M2e and a conserved CTL epitope (NP147-155 to consensus H3HA (MNHa. Their protective efficacies against homologous and heterologous challenges were tested. Results BALB/c mice were immunized twice by particle-mediated epidermal delivery (gene gun with the two DNA vaccines. It was shown that the two vaccines elicited substantial antibody responses, and MNHa induced more significant T cell-mediated immune response than MHa did. Then two H3N2 strains representative of different evolutional and antigenic clusters were used to challenge the vaccine-immunized mice (homosubtypic challenge. Results indicated that both of the DNA vaccines prevented homosubtypic virus infections completely. The vaccines’ heterologous protective efficacies were further tested by challenging with a H1N1 swine influenza virus and a reassortant 2009 pandemic strain. It was found that MNHa reduced the lung viral titers significantly in both challenge groups, histopathological observation showed obvious reduction of lung pathogenesis as compared to MHa and control groups. Conclusions The combined utility of the consensus HA and the conserved M2e and CTL epitope can confer complete and partial protection

  11. Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries

    Directory of Open Access Journals (Sweden)

    Gray Elizabeth C

    2009-11-01

    Full Text Available Abstract Background In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. Results It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. Conclusion These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The

  12. Cloning of a mitogen-inducible gene encoding a kappa B DNA-binding protein with homology to the rel oncogene and to cell-cycle motifs.

    Science.gov (United States)

    Bours, V; Villalobos, J; Burd, P R; Kelly, K; Siebenlist, U

    1990-11-01

    We have cloned and characterized a mitogen-inducible gene isolated from human T cells that predicts a protein of 968 amino acids. The amino-terminal domain has regions homologous to the oncogene rel and to the developmentally important gene dorsal of Drosophila. The carboxy-terminal domain contains repeat structures found in a variety of proteins that are involved in cell-cycle control of yeast and in tissue differentiation in Drosophila and Ceanorhabditis elegans, as well as in the putative human oncogene bcl-3 and in the ankyrin protein. A truncated form of the product of this gene translated in vitro is a DNA-binding protein which interacts specifically with the kappa B binding site found in many inducible genes, including the enhancer in human immunodeficiency virus. This gene is yet another in a growing list of important regulatory molecules whose expression is transcriptionally induced upon cellular activation.

  13. cDNA encoding the chicken ortholog of the mouse dilute gene product. Sequence comparison reveals a myosin I subfamily with conserved C-terminal domains.

    Science.gov (United States)

    Sanders, G; Lichte, B; Meyer, H E; Kilimann, M W

    1992-10-26

    We report the cDNA-deduced primary structure of the chicken counterpart of the murine dilute gene product, a member of the myosin I family. Comparison of the chicken and mouse sequences reveals a distinct pattern of domains of high and low sequence conservation. An internal deletion of 25 amino acids probably reflects differential mRNA processing. Compared with other myosin heavy chain molecules, sequence similarity is highest with the MYO2 gene product of Saccharomyces cerevisiae. The MYO2 protein, implicated in vectorial vesicle transport, is homologous to the dilute protein over practically its entire length. In addition, the C-terminal domain of the dilute protein is highly similar to a putative glutamic acid decarboxylase sequence cloned from mouse brain. Alternatively, this closely related clone might represent an isoform of the dilute protein derived from a second gene, potentially involved in genetic conditions related to dilute.

  14. Preliminary investigation of resistance of plasmid DNA to neon ion beams using transformation into recipient Escherichia coli cells.

    Science.gov (United States)

    Imamura, M; Seki, T; Tamai, T; Nakagawa, T; Nishimura, A; Yamashiki, N; Inoue, K; Akagi, K; Sawada, S; Kasahara-Imamura, M; Okamura, A; Takimoto, K; Watanabe, H; Ohnishi, T; Harada, K

    1999-07-01

    The sensitivity of the vector plasmid pKmK8 DNA to neon ion beams was studied under dry conditions. This plasmid contains the cloning vector pJKKmf(-) and a 3.6 kbp segment encoding the Escherichia coli crp gene that can be used in mutagenesis analysis. The survival curve of the plasmid indicated an exponential profile and a D10 value of about 16 kGy in the E. coli wild-type strain for DNA repair capability. This was similar to the D10 value for the shuttle vector plasmid pZ189 DNA. Therefore, it was assumed that the excision repair system in E. coli was not effective for repairing DNA lesions induced by irradiation with heavy ion beams.

  15. Cloning of a horn fly cDNA, HialphaE7, encoding an esterase whose transcript concentration is elevated in diazinon-resistant flies.

    Science.gov (United States)

    Guerrero, F D

    2000-11-01

    Reverse transcriptase-polymerase chain reaction (PCR) was used to clone two esterase cDNAs from a diazinon-resistant field population of horn flies that expresses qualitative and quantitative differences in esterases compared with a susceptible population. The open reading frame from one of the esterase cDNAs, HialphaE7, exhibits substantial amino-acid identity to an esterase associated with diazinon resistance in Lucilia cuprina. RNA Northern blots showed that HialphaE7 mRNA was more abundant in the diazinon-resistant population than the susceptible population. DNA copy number analysis did not reveal major differences in HialphaE7 gene copy number between the two populations. The full-length cDNA to HialphaE7 was cloned and sequenced, and found to contain all of the highly conserved sequence elements associated with carboxyl/cholinesterases. The HialphaE7 homologs in diazinon-resistant strains of L. cuprina and Musca domestica have been shown to possess an amino-acid substitution conferring diazinon hydrolytic activity to the esterase enzyme. This amino-acid substitution was not found in diazinon-resistant horn flies examined by allele-specific PCR. Individual flies from the resistant field population were phenotyped as diazinon-resistant or diazinon-susceptible by topical diazinon application bioassays and total RNA isolated and hybridized to HialphaE7 probe in ribonuclease protection assays. HialphaE7 transcript was expressed at a five-fold higher level in resistant female individual flies than in susceptible female individuals.

  16. Improved humoral and cellular immune responses against the gp120 V3 loop of HIV-1 following genetic immunization with a chimeric DNA vaccine encoding the V3 inserted into the hepatitis B surface antigen

    DEFF Research Database (Denmark)

    Fomsgaard, A; Nielsen, H V; Bryder, K

    1998-01-01

    with the HIV MN gp160 envelope plasmid induced a slow and low titred anti-MN V3 antibody response at 12 weeks post-inoculation (p.i.) and a late appearing (7 weeks), weak and variable CTL response. In contrast, DNA vaccination with the HBsAg-encoding plasmid induced a rapid and high titred anti-HBsAg antibody...... response and a uniform strong anti-HBs CTL response already 1 week p.i. in all mice. DNA vaccination with the chimeric MN V3/HBsAg plasmid elicited humoral responses against both viruses within 3-6 weeks which peaked at 6-12 weeks and remained stable for at least 25 weeks. In addition, specific CTL......The gp120-derived V3 loop of HIV-1 is involved in co-receptor interaction, it guides cell tropism, and contains an epitope for antibody neutralization. Thus, HIV-1 V3 is an attractive vaccine candidate. The V3 of the MN strain (MN V3) contains both B- and T-cell epitopes, including a known mouse H...

  17. DNA Vaccine Encoding HPV16 Oncogenes E6 and E7 Induces Potent Cell-mediated and Humoral Immunity Which Protects in Tumor Challenge and Drives E7-expressing Skin Graft Rejection.

    Science.gov (United States)

    Chandra, Janin; Dutton, Julie L; Li, Bo; Woo, Wai-Ping; Xu, Yan; Tolley, Lynn K; Yong, Michelle; Wells, James W; R Leggatt, Graham; Finlayson, Neil; Frazer, Ian H

    We have previously shown that a novel DNA vaccine technology of codon optimization and the addition of ubiquitin sequences enhanced immunogenicity of a herpes simplex virus 2 polynucleotide vaccine in mice, and induced cell-mediated immunity when administered in humans at relatively low doses of naked DNA. We here show that a new polynucleotide vaccine using the same technology and encoding a fusion protein of the E6 and E7 oncogenes of high-risk human papillomavirus type 16 (HPV16) is immunogenic in mice. This vaccine induces long-lasting humoral and cell-mediated immunity and protects mice from establishment of HPV16-E7-expressing tumors. In addition, it suppresses growth of readily established tumors and shows enhanced efficacy when combined with immune checkpoint blockade targeted at PD-L1. This vaccine also facilitates rejection of HPV16-E7-expressing skin grafts that demonstrate epidermal hyperplasia with characteristics of cervical and vulvar intraepithelial neoplasia. Clinical studies evaluating the efficacy of this vaccine in patients with HPV16 premalignancies are planned.

  18. PEG-b-PPS-b-PEI micelles and PEG-b-PPS/PEG-b-PPS-b-PEI mixed micelles as non-viral vectors for plasmid DNA: tumor immunotoxicity in B16F10 melanoma.

    Science.gov (United States)

    Velluto, Diana; Thomas, Susan N; Simeoni, Eleonora; Swartz, Melody A; Hubbell, Jeffrey A

    2011-12-01

    Cationic micelles formed from poly(ethylene glycol)-bl-poly(propylene sulfide)-bl-poly(ethylene imine) (PEG-b-PPS-b-PEI) and from mixtures of poly(ethylene glycol)-bl-poly(propylene sulfide) (PEG-b-PPS) with PEG-b-PPS-b-PEI were explored as non-viral vectors for plasmid DNA (pDNA) transfection in a tumor immunotoxicity model. Complexes with pDNA were found to be templated exclusively by the size of the pDNA-free micelles and ranged from 240 nm (for PEG-b-PPS-b-PEI) to 30 nm (for mixed micelles of PEG-b-PPS/PEG-b-PPS-b-PEI). Both formulations transfected melanoma cells well in vitro. As a model with a functional read-out of tumor cell death, one with likely only small bystander effects, tumors were transfected with an antigen transgene, using an antigen to which the recipient animals had been previously vaccinated with a Th1-biasing adjuvant. Reduction in tumor growth, increase in intratumoral infiltration of cytotoxic T lymphocytes and accumulation of Th1-biasing cytokines indicated that both micelle formulations transfected efficiently compared with naked pDNA and with low cytotoxicity. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. The ENCODE project: missteps overshadowing a success.

    Science.gov (United States)

    Eddy, Sean R

    2013-04-08

    Two clichés of science journalism have now played out around the ENCODE project. ENCODE's publicity first presented a misleading "all the textbooks are wrong" narrative about noncoding human DNA. Now several critiques of ENCODE's narrative have been published, and one was so vitriolic that it fueled "undignified academic squabble" stories that focused on tone more than substance. Neither story line does justice to our actual understanding of genomes, to ENCODE's results, or to the role of big science in biology. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Molecular cloning and cold shock induced overexpression of the DNA encoding phor sensor domain from Mycobacterium tuberculosis as a target molecule for novel anti-tubercular drugs

    Science.gov (United States)

    Langi, Gladys Emmanuella Putri; Moeis, Maelita R.; Ihsanawati, Giri-Rachman, Ernawati Arifin

    2014-03-01

    Mycobacterium tuberculosis (Mtb), the sole cause of Tuberculosis (TB), is still a major global problem. The discovery of new anti-tubercular drugs is needed to face the increasing TB cases, especially to prevent the increase of cases with resistant Mtb. A potential novel drug target is the Mtb PhoR sensor domain protein which is the histidine kinase extracellular domain for receiving environmental signals. This protein is the initial part of the two-component system PhoR-PhoP regulating 114 genes related to the virulence of Mtb. In this study, the gene encoding PhoR sensor domain (SensPhoR) was subcloned from pGEM-T SensPhoR from the previous study (Suwanto, 2012) to pColdII. The construct pColdII SensPhoR was confirmed through restriction analysis and sequencing. Using the construct, SensPhoR was overexpressed at 15°C using Escherichia coli BL21 (DE3). Low temperature was chosen because according to the solubility prediction program of recombinant proteins from The University of Oklahama, the PhoR sensor domain has a chance of 79.8% to be expressed as insoluble proteins in Escherichia coli's (E. coli) cytoplasm. This prediction is also supported by other similar programs: PROSO and PROSO II. The SDS PAGE result indicated that the PhoR sensor domain recombinant protein was overexpressed. For future studies, this protein will be purified and used for structure analysis which can be used to find potential drugs through rational drug design.

  1. Vector velocimeter

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to a compact, reliable and low-cost vector velocimeter for example for determining velocities of particles suspended in a gas or fluid flow, or for determining velocity, displacement, rotation, or vibration of a solid surface, the vector velocimeter comprising a laser...

  2. Isolation and characterization of a cDNA from flowers of Cynara cardunculus encoding cyprosin (an aspartic proteinase) and its use to study the organ-specific expression of cyprosin.

    Science.gov (United States)

    Cordeiro, M C; Xue, Z T; Pietrzak, M; Pais, M S; Brodelius, P E

    1994-03-01

    Poly(A)+ RNA isolated from flower buds of Cynara cardunculus has been used to prepare a cDNA library. Screening of the cDNA after expression of cloned DNA with antibodies raised against the large subunit of cyprosin 3 resulted in the isolation of six positive clones. One of these clones (cypro1s; a 1.7 kb Eco RI fragment) codes for cyprosin. The nucleotide sequence contain a 1419 bp open reading frame coding for 473 amino acids (aa) including a putative full-length mature protein (440 aa) and a partial prosequence (33 aa). Cypro1s contains a 162 bp 3' non-coding region followed by a poly(A) tail. The deduced amino acid sequence shows high homology to other plant aspartic proteinases. The homology to mammalian and microbial aspartic proteinases is somewhat lower. Plant aspartic proteinases contain an insert of around 100 aa. We are modelling where this plant-specific insert will appear in the structure of cyprosin. Using cypro1s as a probe in northern blot analysis, the expression of cyprosin in developing flowers and other tissues has been studied. The signal on the northern blot increased for RNA samples from early (flower buds 6 mm in length) to later stages of floral development (flower buds up to 40 mm in length). In late stages of floral development (open flowers 50 mm in length and styles from such flowers) no hybridization signal was visualized showing that the synthesis of mRNA encoding the cyprosin starts in early stages of floral development and switches off at maturation of the flower.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss

    Directory of Open Access Journals (Sweden)

    Pereira Fred A

    2005-08-01

    Full Text Available Abstract Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45. The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330. Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5. Conclusion These data suggest that the IVS2-2A>G variant may not occur more frequently in hearing impaired subjects than in controls. The identification of five potential alternative splice acceptor sites in

  4. Vaccination with a plasmid DNA encoding HER-2/neu together with low doses of GM-CSF and IL-2 in patients with metastatic breast carcinoma: a pilot clinical trial

    Directory of Open Access Journals (Sweden)

    Knutson Keith L

    2010-06-01

    Full Text Available Abstract Background Adjuvant trastuzumab (Herceptin treatment of breast cancer patients significantly improves their clinical outcome. Vaccination is an attractive alternative approach to provide HER-2/neu (Her2-specific antibodies and may in addition concomitantly stimulate Her2-reactive T-cells. Here we report the first administration of a Her2-plasmid DNA (pDNA vaccine in humans. Patients and Methods The vaccine, encoding a full-length signaling-deficient version of the oncogene Her2, was administered together with low doses of GM-CSF and IL-2 to patients with metastatic Her2-expressing breast carcinoma who were also treated with trastuzumab. Six of eight enrolled patients completed all three vaccine cycles. In the remaining two patients treatment was discontinued after one vaccine cycle due to rapid tumor progression or disease-related complications. The primary objective was the evaluation of safety and tolerability of the vaccine regimen. As a secondary objective, treatment-induced Her2-specific immunity was monitored by measuring antibody production as well as T-cell proliferation and cytokine production in response to Her2-derived antigens. Results No clinical manifestations of acute toxicity, autoimmunity or cardiotoxicity were observed after administration of Her2-pDNA in combination with GM-CSF, IL-2 and trastuzumab. No specific T-cell proliferation following in vitro stimulation of freshly isolated PBMC with recombinant human Her2 protein was induced by the vaccination. Immediately after all three cycles of vaccination no or even decreased CD4+ T-cell responses towards Her2-derived peptide epitopes were observed, but a significant increase of MHC class II restricted T-cell responses to Her2 was detected at long term follow-up. Since concurrent trastuzumab therapy was permitted, λ-subclass specific ELISAs were performed to specifically measure endogenous antibody production without interference by trastuzumab. Her2-pDNA vaccination

  5. Vector assembly of colloids on monolayer substrates

    Science.gov (United States)

    Jiang, Lingxiang; Yang, Shenyu; Tsang, Boyce; Tu, Mei; Granick, Steve

    2017-06-01

    The key to spontaneous and directed assembly is to encode the desired assembly information to building blocks in a programmable and efficient way. In computer graphics, raster graphics encodes images on a single-pixel level, conferring fine details at the expense of large file sizes, whereas vector graphics encrypts shape information into vectors that allow small file sizes and operational transformations. Here, we adapt this raster/vector concept to a 2D colloidal system and realize `vector assembly' by manipulating particles on a colloidal monolayer substrate with optical tweezers. In contrast to raster assembly that assigns optical tweezers to each particle, vector assembly requires a minimal number of optical tweezers that allow operations like chain elongation and shortening. This vector approach enables simple uniform particles to form a vast collection of colloidal arenes and colloidenes, the spontaneous dissociation of which is achieved with precision and stage-by-stage complexity by simply removing the optical tweezers.

  6. Human C6orf211 Encodes Armt1, a Protein Carboxyl Methyltransferase that Targets PCNA and Is Linked to the DNA Damage Response

    Directory of Open Access Journals (Sweden)

    J. Jefferson P. Perry

    2015-03-01

    Full Text Available Recent evidence supports the presence of an L-glutamyl methyltransferase(s in eukaryotic cells, but this enzyme class has been defined only in certain prokaryotic species. Here, we characterize the human C6orf211 gene product as “acidic residue methyltransferase-1” (Armt1, an enzyme that specifically targets proliferating cell nuclear antigen (PCNA in breast cancer cells, predominately methylating glutamate side chains. Armt1 homologs share structural similarities with the SAM-dependent methyltransferases, and negative regulation of activity by automethylation indicates a means for cellular control. Notably, shRNA-based knockdown of Armt1 expression in two breast cancer cell lines altered survival in response to genotoxic stress. Increased sensitivity to UV, adriamycin, and MMS was observed in SK-Br-3 cells, while in contrast, increased resistance to these agents was observed in MCF7 cells. Together, these results lay the foundation for defining the mechanism by which this post-translational modification operates in the DNA damage response (DDR.

  7. SCIB2, an antibody DNA vaccine encoding NY-ESO-1 epitopes, induces potent antitumor immunity which is further enhanced by checkpoint blockade.

    Science.gov (United States)

    Xue, Wei; Metheringham, Rachael L; Brentville, Victoria A; Gunn, Barbara; Symonds, Peter; Yagita, Hideo; Ramage, Judith M; Durrant, Lindy G

    2016-06-01

    Checkpoint blockade has demonstrated promising antitumor responses in approximately 10-40% of patients. However, the majority of patients do not make a productive immune response to their tumors and do not respond to checkpoint blockade. These patients may benefit from an effective vaccine that stimulates high-avidity T cell responses in combination with checkpoint blockade. We have previously shown that incorporating TRP-2 and gp100 epitopes into the CDR regions of a human IgG1 DNA (ImmunoBody®: IB) results in significant tumor regression both in animal models and patients. This vaccination strategy is superior to others as it targets antigen to antigen-presenting cells and stimulates high-avidity T cell responses. To broaden the application of this vaccination strategy, 16 NY-ESO-1 epitopes, covering over 80% of HLA phenotypes, were incorporated into the IB (SCIB2). They produced higher frequency and avidity T cell responses than peptide vaccination. These T cells were of sufficient avidity to kill NY-ESO-1-expressing tumor cells, and in vivo controlled the growth of established B16-NY-ESO-1 tumors, resulting in long-term survival (35%). When SCIB2 was given in combination with Treg depletion, CTLA-4 blockade or PD-1 blockade, long-term survival from established tumors was significantly enhanced to 56, 67 and 100%, respectively. Translating these responses into the clinic by using a combination of SCIB2 vaccination and checkpoint blockade can only further improve clinical responses.

  8. Cloning and characterization of an Armillaria gallica cDNA encoding protoilludene synthase, which catalyzes the first committed step in the synthesis of antimicrobial melleolides.

    Science.gov (United States)

    Engels, Benedikt; Heinig, Uwe; Grothe, Torsten; Stadler, Marc; Jennewein, Stefan

    2011-03-04

    Melleolides and related fungal sesquiterpenoid aryl esters are antimicrobial and cytotoxic natural products derived from cultures of the Homobasidiomycetes genus Armillaria. The initial step in the biosynthesis of all melleolides involves cyclization of the universal sesquiterpene precursor farnesyl diphosphate to produce protoilludene, a reaction catalyzed by protoilludene synthase. We achieved the partial purification of protoilludene synthase from a mycelial culture of Armillaria gallica and found that 6-protoilludene was its exclusive reaction product. Therefore, a further isomerization reaction is necessary to convert the 6-7 double bond into the 7-8 double bond found in melleolides. We expressed an A. gallica protoilludene synthase cDNA in Escherichia coli, and this also led to the exclusive production of 6-protoilludene. Sequence comparison of the isolated sesquiterpene synthase revealed a distant relationship to other fungal terpene synthases. The isolation of the genomic sequence identified the 6-protoilludene synthase to be present as a single copy gene in the genome of A. gallica, possessing an open reading frame interrupted with eight introns.

  9. Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides*

    Science.gov (United States)

    Engels, Benedikt; Heinig, Uwe; Grothe, Torsten; Stadler, Marc; Jennewein, Stefan

    2011-01-01

    Melleolides and related fungal sesquiterpenoid aryl esters are antimicrobial and cytotoxic natural products derived from cultures of the Homobasidiomycetes genus Armillaria. The initial step in the biosynthesis of all melleolides involves cyclization of the universal sesquiterpene precursor farnesyl diphosphate to produce protoilludene, a reaction catalyzed by protoilludene synthase. We achieved the partial purification of protoilludene synthase from a mycelial culture of Armillaria gallica and found that 6-protoilludene was its exclusive reaction product. Therefore, a further isomerization reaction is necessary to convert the 6–7 double bond into the 7–8 double bond found in melleolides. We expressed an A. gallica protoilludene synthase cDNA in Escherichia coli, and this also led to the exclusive production of 6-protoilludene. Sequence comparison of the isolated sesquiterpene synthase revealed a distant relationship to other fungal terpene synthases. The isolation of the genomic sequence identified the 6-protoilludene synthase to be present as a single copy gene in the genome of A. gallica, possessing an open reading frame interrupted with eight introns. PMID:21148562

  10. Isolation and characterization of a cDNA encoding (S)-cis-N-methylstylopine 14-hydroxylase from opium poppy, a key enzyme in sanguinarine biosynthesis.

    Science.gov (United States)

    Beaudoin, Guillaume A W; Facchini, Peter J

    2013-02-15

    Sanguinarine is a benzo[c]phenenthridine alkaloid with potent antimicrobial properties found commonly in plants of the Papaveraceae, including the roots of opium poppy (Papaver somniferum). Sanguinarine is formed from the central 1-benzylisoquinoline intermediate (S)-reticuline via the protoberberine alkaloid (S)-scoulerine, which undergoes five enzymatic oxidations and an N-methylation. The first four oxidations from (S)-scoulerine are catalyzed by cytochromes P450, whereas the final conversion involves a flavoprotein oxidase. All but one gene in the biosynthetic pathway from (S)-reticuline to sanguinarine has been identified. In this communication, we report the isolation and characterization of (S)-cis-N-methylstylopine 14-hydroxylase (MSH) from opium poppy based on the transcriptional induction in elicitor-treated cell suspension cultures and root-specific expression of the corresponding gene. Along with protopine 6-hydroxylase, which catalyzes the subsequent and penultimate step in sanguinarine biosynthesis, MSH is a member of the CYP82N subfamily of cytochromes P450. The full-length MSH cDNA was expressed in Saccharomyces cerevisiae and the recombinant microsomal protein was tested for enzymatic activity using 25 benzylisoquinoline alkaloids representing a wide range of structural subgroups. The only enzymatic substrates were the N-methylated protoberberine alkaloids N-methylstylopine and N-methylcanadine, which were converted to protopine and allocryptopine, respectively. Copyright © 2013. Published by Elsevier Inc.

  11. Molecular cloning and characterization of a putative cDNA encoding endoglucanase IV from Trichoderma viride and its expression in Bombyx mori.

    Science.gov (United States)

    Li, Xing-Hua; Zhang, Peng; Liang, Shuang; Zhou, Fang; Wang, Mei-Xian; Bhaskar, Roy; Malik, Firdose Ahmad; Niu, Yan-Shan; Miao, Yun-Gen

    2012-01-01

    The development of cellulase production technology has greatly contributed to the successful use of cellulosic materials as renewable carbon sources. In this study, a putative endoglucanase IV (EG IV) complementary DNA was cloned from the mycelium of a strain of the filamentous fungus Trichoderma viride using a PCR-based exon-splicing method and expressed in both a silkworm BmN cell line and in silkworm larvae. Western blot analysis detected a band of 42 kDa in BmN cells after infection with a recombinant mBacmid/BmNPV/EG IV baculovirus. Sequence alignment analysis of the T. viride EG IV gene showed two domains that were highly conserved with glycosyl hydrolases and a funga-type cellulose-binding domain. Analysis of variance showed that silkworms infected with recombinant baculoviruses exhibited significantly higher enzyme activity that was 48.84% higher than silkworms infected with blank baculoviruses and 46.61% higher than normal silkworms. The expressed bioactive EG IV was also stable at the pH range from 5.0 to 10.0. The availability of large quantities of bioactive EG IV in silkworm provided a possibility to produce cellulase transgenic silkworm, which express bioactive cellulase specially in its digestive tract and improve its metabolism efficiency of mulberry leaves. Its application in the sericulture industry may be very promising.

  12. Ectopic expression of the erythrocyte band 3 anion exchange protein, using a new avian retrovirus vector

    DEFF Research Database (Denmark)

    Fuerstenberg, S; Beug, H; Introna, M

    1990-01-01

    -erbB sequences following the splice acceptor were replaced by a cloning linker allowing insertion of foreign genes. The vector has been tested in conjunction with several helper viruses for the transmission of G418 resistance, titer, stability, transcription, and the transduction and expression of foreign genes...... in both chicken embryo fibroblasts and the QT6 quail cell line. The results show that the vector is capable of producing high titers of Neor virus from stably integrated proviruses. These proviruses express a balanced ratio of genome length to spliced transcripts which are efficiently translated...... into protein. Using the Escherichia coli beta-galactosidase gene cloned into the vector as a test construct, expression of enzyme activity could be detected in 90 to 95% of transfected target cells and in 80 to 85% of subsequently infected cells. In addition, a cDNA encoding the avian erythrocyte band 3 anion...

  13. Ectopic expression of the erythrocyte band 3 anion exchange protein, using a new avian retrovirus vector

    DEFF Research Database (Denmark)

    Fuerstenberg, S; Beug, H; Introna, M

    1990-01-01

    A retrovirus vector was constructed from the genome of avian erythroblastosis virus ES4. The v-erbA sequences of avian erythroblastosis virus were replaced by those coding for neomycin phosphotransferase, creating a gag-neo fusion protein which provides G418 resistance as a selectable marker. The v...... into protein. Using the Escherichia coli beta-galactosidase gene cloned into the vector as a test construct, expression of enzyme activity could be detected in 90 to 95% of transfected target cells and in 80 to 85% of subsequently infected cells. In addition, a cDNA encoding the avian erythrocyte band 3 anion......-erbB sequences following the splice acceptor were replaced by a cloning linker allowing insertion of foreign genes. The vector has been tested in conjunction with several helper viruses for the transmission of G418 resistance, titer, stability, transcription, and the transduction and expression of foreign genes...

  14. Engineering of magnetic DNA nanoparticles for tumor-targeted therapy

    International Nuclear Information System (INIS)

    Hosseinkhani, Hossein; Chen Yiru; He Wenjie; Hong Poda; Yu, Dah-Shyong; Domb, Abraham J.

    2013-01-01

    This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe 2+ solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.

  15. Engineering of magnetic DNA nanoparticles for tumor-targeted therapy

    Energy Technology Data Exchange (ETDEWEB)

    Hosseinkhani, Hossein, E-mail: hosseinkhani@yahoo.com [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Chen Yiru [National Yang-Ming University, Department of Biomedical Engineering (China); He Wenjie; Hong Poda [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Yu, Dah-Shyong [Nanomedicine Research Center, National Defense Medical Center (China); Domb, Abraham J. [Institute of Drug Research, The Center for Nanoscience and Nanotechnology, School of Pharmacy, Faculty of Medicine, Hebrew University of Jerusalem (Israel)

    2013-01-15

    This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe{sup 2+} solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.

  16. Engineering of magnetic DNA nanoparticles for tumor-targeted therapy

    Science.gov (United States)

    Hosseinkhani, Hossein; Chen, Yi-Ru; He, Wenjie; Hong, Po-Da; Yu, Dah-Shyong; Domb, Abraham J.

    2013-01-01

    This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe2+ solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.

  17. Polypeptides having catalase activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ye; Duan, Junxin; Zhang, Yu; Tang, Lan

    2017-05-02

    Provided are isolated polypeptides having catalase activity and polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  18. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    Science.gov (United States)

    Spodsberg, Nikolaj

    2015-07-14

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  19. Hybrid polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ye; Shaghasi, Tarana

    2016-11-01

    The present invention provides hybrid polypeptides having cellobiohydrolase activity. The present invention also provides polynucleotides encoding the hybrid polypeptides; nucleic acid constructs, vectors and host cells comprising the polynucleotides; and processes of using the hybrid polypeptides.

  20. Polypeptides having beta-xylosidase activity and polynucleotides encoding same

    Science.gov (United States)

    Liu, Ye; Tang, Lan; Zhang, Yu; Duan, Junxin

    2017-04-18

    Provided are isolated polypeptides having beta-xylosidase activity and polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  1. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ye; Duan, Junxin; Zhang, Yu; Tang, Lan

    2017-09-26

    Provided are isolated polypeptides having beta-glucosidase activity and polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  2. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Spodsberg, Nikolaj

    2016-06-28

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  3. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Spodsberg, Nikolaj

    2016-12-13

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  4. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Spodsberg, Nikolaj

    2017-11-21

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  5. Polypeptides having endoglucanase activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yu; Liu, Ye; Duan, Junxin; Tang, Lan

    2017-07-18

    Provided are isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  6. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    Science.gov (United States)

    Spodsberg, Nikolaj

    2015-11-17

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  7. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yu; Tang, Lan; Henriksen, Svend Hostgaard Bang

    2016-05-17

    The present invention provides isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  8. Polypeptides having xylanase activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Spodsberg, Nikolaj

    2017-05-02

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  9. Polypeptides having cellobiohydrolase activitiy and polynucleotides encoding same

    Science.gov (United States)

    Liu, Ye; Tang, Lan; Duan, Junxin

    2015-12-15

    The present invention provides isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  10. Polypeptides having xylanase activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Spodsberg, Nikolaj

    2018-02-06

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  11. Vaccination with an adenoviral vector encoding the tumor antigen directly linked to invariant chain induces potent CD4(+) T-cell-independent CD8(+) T-cell-mediated tumor control

    DEFF Research Database (Denmark)

    Sorensen, Maria R; Holst, Peter J; Pircher, Hanspeter

    2009-01-01

    of the vaccine antigen to invariant chain (Ii). To evaluate this strategy we used a mouse model, in which an immunodominant epitope (GP33) of the LCMV glycoprotein (GP) represents the tumor-associated neoantigen. Prophylactic vaccination of C57BL/6 mice with a replication-deficient human adenovirus 5 vector...... vaccination with adenovirus expressing GP alone (Ad-GP), or GP and Ii unlinked (Ad-GP+Ii). Ad-Ii-GP- induced tumor control depended on an improved generation of the tumor-associated neoantigen-specific CD8(+) T-cell response and was independent of CD4(+) T cells. IFN-gamma was shown to be a key player during...

  12. cDNA clone for the alpha-chain of human beta-hexosaminidase: deficiency of alpha-chain mRNA in Ashkenazi Tay-Sachs fibroblasts.

    OpenAIRE

    Myerowitz, R; Proia, R L

    1984-01-01

    We have isolated a cDNA clone containing sequences complementary to mRNA encoding the alpha-chain of the lysosomal enzyme beta-hexosaminidase. RNA from a human lung fibroblast strain, IMR90, was enriched for beta-hexosaminidase messenger by polysome immunoselection with antiserum against beta-hexosaminidase A. This preparation was used to construct cDNA recombinant plasmids by the Okayama-Berg vector primer procedure. After transformation of Escherichia coli, 385 ampicillin-resistant colonies...

  13. Cloning of the human androgen receptor cDNA

    International Nuclear Information System (INIS)

    Govindan, M.V.; Burelle, M.; Cantin, C.; Kabrie, C.; Labrie, F.; Lachance, Y.; Leblanc, G.; Lefebvre, C.; Patel, P.; Simard, J.

    1988-01-01

    The authors discuss how in order to define the functional domains of the human androgen receptor, complementary DNA (cDNA) clones encoding the human androgen receptor (hAR) have been isolated from a human testis λgtll cDNA library using synthetic oligonnucleotide probes, homologous to segments of the human glucocorticoid, estradiol and progesterone receptors. The cDNA clones corresponding to the human glucocorticoid, estradiol and progesterone receptors were eliminated after cross-hybridization with their respective cDNA probes and/or after restriction mapping of the cDNA clones. The remaining cDNA clones were classified into different groups after analysis by restriction digestion and cross-hybridization. Two of the largest cDNA clones from each group were inserted into an expression vector in both orientations. The linearized plasmids were used as templates in in vitro transcription with T7 RNA polymerase. Subsequent in vitro translation of the purified transcripts in rabbit reticulocyte lysate followed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) permitted the characterization of the encoded polyeptides. The expressed proteins larger than 30,000 Da were analyzed for their ability to bind tritium-labelled dihydrotestosterone ([ 3 H] DHT) with high affinity and specificity

  14. Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored Meleagrid herpesvirus type 1 vaccines

    Science.gov (United States)

    Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspe...

  15. Gene-based neonatal immune priming potentiates a mucosal adenoviral vaccine encoding mycobacterial Ag85B.

    Science.gov (United States)

    Dai, Guixiang; Rady, Hamada F; Huang, Weitao; Shellito, Judd E; Mason, Carol; Ramsay, Alistair J

    2016-12-07

    Tuberculosis remains a major public health hazard worldwide, with neonates and young infants potentially more susceptible to infection than adults. BCG, the only vaccine currently available, provides some protection against tuberculous meningitis in children but variable efficacy in adults, and is not safe to use in immune compromised individuals. A safe and effective vaccine that could be given early in life, and that could also potentiate subsequent booster immunization, would represent a significant advance. To test this proposition, we have generated gene-based vaccine vectors expressing Ag85B from Mycobacterium tuberculosis (Mtb) and designed experiments to test their immunogenicity and protective efficacy particularly when given in heterologous prime-boost combination, with the initial DNA vaccine component given soon after birth. Intradermal delivery of DNA vaccines elicited Th1-based immune responses against Ag85B in neonatal mice but did not protect them from subsequent aerosol challenge with virulent Mtb H37Rv. Recombinant adenovirus vectors encoding Ag85B, given via the intranasal route at six weeks of age, generated moderate immune responses and were poorly protective. However, neonatal DNA priming following by mucosal boosting with recombinant adenovirus generated strong immune responses, as evidenced by strong Ag85B-specific CD4+ and CD8+ T cell responses, both in the lung-associated lymph nodes and the spleen, by the quality of these responding cells (assessed by their capacity to secrete multiple antimicrobial factors), and by improved protection, as indicated by reduced bacterial burden in the lungs following pulmonary TB challenge. These results suggest that neonatal immunization with gene-based vaccines may create a favorable immunological environment that potentiates the pulmonary mucosal boosting effects of a subsequent heterologous vector vaccine encoding the same antigen. Our data indicate that immunization early in life with mycobacterial

  16. Polypeptides having laccase activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ye; Tang, Lan; Duan, Junxin; Zhang, Yu

    2017-08-22

    The present invention relates to isolated polypeptides having laccase activity and polynucleotides encoding the polypeptides and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  17. A New Method for Forensic DNA Analysis of the Blood Meal in Chagas Disease Vectors Demonstrated Using Triatoma infestans from Chuquisaca, Bolivia

    Science.gov (United States)

    Pizarro, Juan Carlos; Stevens, Lori

    2008-01-01

    Background Feeding patterns of the vector are important in the epidemiology of Chagas disease, the leading cause of heart disease in Latin America. Chagas disease is caused by the parasite, Trypanasoma cruzi, which is transmitted by blood feeding insects. Historically, feeding behaviours of haematophagous insects have been investigated using serological reactions, which have detection limits in terms of both taxonomic resolution, and quantity and quality of the blood meal. They are labor intensive, require technical expertise, need fresh or frozen samples and antibodies often are either not available commercially or the resources for synthesis and purification are not available. We describe an assay to identify vertebrate blood meal sources, and the parasite T. cruzi using species-specific PCR assays from insect vectors and use the method to provide information regarding three questions: (1) Do domestic and peri-domestic (chicken coop and animal corral) habitats vary in the blood meals detected in the vectors? (2) What is the pattern of multiple blood meals? (3) Does the rate of T. cruzi infection vary among habitats and is it associated with specific blood meal types? Methodology/Principal Findings Assays based on the polymerase chain reaction were evaluated for identification of the blood meal source in the heamatophagous Chagas disease vector Triatoma infestans. We evaluate a technique to identify 11 potential vertebrate food sources from the complex mixture extracted from the vector's abdomen. We tested the assay on 81 T. infestans specimens collected from the Andean highlands in the department of Chuquisaca, located in central Bolivia, one of the regions in South America where sylvatic T. infestans have been reported. This area is suggested to be the geographic origin of T. infestans and has very high human infection rates that may be related to sylvatic vector populations. Conclusion/Significance The results of the assays revealed that a high percentage of

  18. A new method for forensic DNA analysis of the blood meal in chagas disease vectors demonstrated using Triatoma infestans from Chuquisaca, Bolivia.

    Directory of Open Access Journals (Sweden)

    Juan Carlos Pizarro

    Full Text Available BACKGROUND: Feeding patterns of the vector are important in the epidemiology of Chagas disease, the leading cause of heart disease in Latin America. Chagas disease is caused by the parasite, Trypanasoma cruzi, which is transmitted by blood feeding insects. Historically, feeding behaviours of haematophagous insects have been investigated using serological reactions, which have detection limits in terms of both taxonomic resolution, and quantity and quality of the blood meal. They are labor intensive, require technical expertise, need fresh or frozen samples and antibodies often are either not available commercially or the resources for synthesis and purification are not available. We describe an assay to identify vertebrate blood meal sources, and the parasite T. cruzi using species-specific PCR assays from insect vectors and use the method to provide information regarding three questions: (1 Do domestic and peri-domestic (chicken coop and animal corral habitats vary in the blood meals detected in the vectors? (2 What is the pattern of multiple blood meals? (3 Does the rate of T. cruzi infection vary among habitats and is it associated with specific blood meal types? METHODOLOGY/PRINCIPAL FINDINGS: Assays based on the polymerase chain reaction were evaluated for identification of the blood meal source in the heamatophagous Chagas disease vector Triatoma infestans. We evaluate a technique to identify 11 potential vertebrate food sources from the complex mixture extracted from the vector's abdomen. We tested the assay on 81 T. infestans specimens collected from the Andean highlands in the department of Chuquisaca, located in central Bolivia, one of the regions in South America where sylvatic T. infestans have been reported. This area is suggested to be the geographic origin of T. infestans and has very high human infection rates that may be related to sylvatic vector populations. CONCLUSION/SIGNIFICANCE: The results of the assays revealed that a

  19. The uvsI gene of Aspergillus nidulans required for UV-mutagenesis encodes a homolog to REV3, a subunit of the DNA polymerase zeta of yeast involved in translesion DNA synthesis.

    Science.gov (United States)

    Han, K Y; Chae, S K; Han, D M

    1998-07-01

    Defects in the uvsI gene of Aspergillus nidulans resulted in high UV sensitivity and reductions of spontaneous and UV-induced reversion of certain alleles, uvsl;uvsA double mutants exhibited high methyl methane sulfonate (MMS)-sensitivity in contrast to the slight sensitivity of the component single mutants. Using such a double mutant as recipient, a clone complementing uvsI501 has been isolated from a chromosome III specific library. The deduced amino acid sequence from the 1.1-kb sequenced region, a part of the 5.2-kb DNA fragment showing uvsI-complementing activity, had a 62% identity with REV3 of yeast. Disruptants of the cloned gene demonstrated the same level of sensitivity to UV light as uvsI and failed to complement uvsI501 in heterozygous diploids.

  20. SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

    Science.gov (United States)

    Hitz, Benjamin C; Rowe, Laurence D; Podduturi, Nikhil R; Glick, David I; Baymuradov, Ulugbek K; Malladi, Venkat S; Chan, Esther T; Davidson, Jean M; Gabdank, Idan; Narayana, Aditi K; Onate, Kathrina C; Hilton, Jason; Ho, Marcus C; Lee, Brian T; Miyasato, Stuart R; Dreszer, Timothy R; Sloan, Cricket A; Strattan, J Seth; Tanaka, Forrest Y; Hong, Eurie L; Cherry, J Michael

    2017-01-01

    The Encyclopedia of DNA elements (ENCODE) project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC) for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database) and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data) has been released as a separate Python package.

  1. SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

    Directory of Open Access Journals (Sweden)

    Benjamin C Hitz

    Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.

  2. The exome sequencing identified the mutation in YARS2 encoding the mitochondrial tyrosyl-tRNA synthetase as a nuclear modifier for the phenotypic manifestation of Leber's hereditary optic neuropathy-associated mitochondrial DNA mutation.

    Science.gov (United States)

    Jiang, Pingping; Jin, Xiaofen; Peng, Yanyan; Wang, Meng; Liu, Hao; Liu, Xiaoling; Zhang, Zengjun; Ji, Yanchun; Zhang, Juanjuan; Liang, Min; Zhao, Fuxin; Sun, Yan-Hong; Zhang, Minglian; Zhou, Xiangtian; Chen, Ye; Mo, Jun Qin; Huang, Taosheng; Qu, Jia; Guan, Min-Xin

    2016-02-01

    Leber's hereditary optic neuropathy (LHON) is the most common mitochondrial disorder. Nuclear modifier genes are proposed to modify the phenotypic expression of LHON-associated mitochondrial DNA (mtDNA) mutations. By using an exome sequencing approach, we identified a LHON susceptibility allele (c.572G>T, p.191Gly>Val) in YARS2 gene encoding mitochondrial tyrosyl-tRNA synthetase, which interacts with m.11778G>A mutation to cause visual failure. We performed functional assays by using lymphoblastoid cell lines derived from members of Chinese families (asymptomatic individuals carrying m.11778G>A mutation, or both m.11778G>A and heterozygous p.191Gly>Val mutations and symptomatic subjects harboring m.11778G>A and homozygous p.191Gly>Val mutations) and controls lacking these mutations. The 191Gly>Val mutation reduced the YARS2 protein level in the mutant cells. The aminoacylated efficiency and steady-state level of tRNA(Tyr) were markedly decreased in the cell lines derived from patients both carrying homozygous YARS2 p.191Gly>Val and m.11778G>A mutations. The failure in tRNA(Tyr) metabolism impaired mitochondrial translation, especially for polypeptides with high content of tyrosine codon such as ND4, ND5, ND6 and COX2 in cells lines carrying homozygous YARS2 p.191Gly>Val and m.11778G>A mutations. The YARS2 p.191Gly>Val mutation worsened the respiratory phenotypes associated with m.11778G>A mutation, especially reducing activities of complexes I and IV. The respiratory deficiency altered the efficiency of mitochondrial ATP synthesis and increased the production of reactive oxygen species. Thus, mutated YARS2 aggravates mitochondrial dysfunctions associated with the m.11778G>A mutation, exceeding the threshold for the expression of blindness phenotype. Our findings provided new insights into the pathophysiology of LHON that were manifested by interaction between mtDNA mutation and mutated nuclear-modifier YARS2. © The Author 2015. Published by Oxford University Press

  3. Acid- and Au(i)-mediated synthesis of hexathymidine-DNA-heterocycle chimeras, an efficient entry to DNA-encoded libraries inspired by drug structures† †Electronic supplementary information (ESI) available: Experimental procedures, compound characterization data, analysis of ligation reactions, and analysis of the tiDEL. See DOI: 10.1039/c7sc00455a Click here for additional data file.

    Science.gov (United States)

    Škopić, Mateja Klika; Salamon, Hazem; Bugain, Olivia; Jung, Kathrin; Gohla, Anne; Doetsch, Lara J.; dos Santos, Denise; Bhat, Avinash; Wagner, Bernd

    2017-01-01

    Libraries of DNA-tagged compounds are a validated screening technology for drug discovery. They are synthesized through combinatorial iterations of alternated coding and preparative synthesis steps. Thus, large chemical space can be accessed for target-based screening. However, the need to preserve the functionality of the DNA tag severely restricts the choice of chemical methods for library synthesis. Acidic organocatalysts, transition metals, and oxidants furnish diverse drug-like structures from simple starting materials, but cause loss of genetic information by depurination. A hexathymidine oligonucleotide, called “hexT” allows the chemist utilizing these classes of catalysts to access a potentially broad variety of structures in the initial step of library synthesis. We exploited its catalyst tolerance to efficiently synthesize diverse substituted β-carbolines, pyrazolines, and pyrazoles from readily available starting materials as hexT conjugates by acid- and Au(i)-catalysis, respectively. The hexT conjugates were ligated to coding DNA sequences yielding encoded screening libraries inspired by drug structures. PMID:28507705

  4. Vector geometry

    CERN Document Server

    Robinson, Gilbert de B

    2011-01-01

    This brief undergraduate-level text by a prominent Cambridge-educated mathematician explores the relationship between algebra and geometry. An elementary course in plane geometry is the sole requirement for Gilbert de B. Robinson's text, which is the result of several years of teaching and learning the most effective methods from discussions with students. Topics include lines and planes, determinants and linear equations, matrices, groups and linear transformations, and vectors and vector spaces. Additional subjects range from conics and quadrics to homogeneous coordinates and projective geom

  5. Molecular Cloning of a cDNA Encoding for Taenia solium TATA-Box Binding Protein 1 (TsTBP1) and Study of Its Interactions with the TATA-Box of Actin 5 and Typical 2-Cys Peroxiredoxin Genes.

    Science.gov (United States)

    Rodríguez-Lima, Oscar; García-Gutierrez, Ponciano; Jiménez, Lucía; Zarain-Herzberg, Ángel; Lazzarini, Roberto; Landa, Abraham

    2015-01-01

    TATA-box binding protein (TBP) is an essential regulatory transcription factor for the TATA-box and TATA-box-less gene promoters. We report the cloning and characterization of a full-length cDNA that encodes a Taenia solium TATA-box binding protein 1 (TsTBP1). Deduced amino acid composition from its nucleotide sequence revealed that encodes a protein of 238 residues with a predicted molecular weight of 26.7 kDa, and a theoretical pI of 10.6. The NH2-terminal domain shows no conservation when compared with to pig and human TBP1s. However, it shows high conservation in size and amino acid identity with taeniids TBP1s. In contrast, the TsTBP1 COOH-terminal domain is highly conserved among organisms, and contains the amino acids involved in interactions with the TATA-box, as well as with TFIIA and TFIIB. In silico TsTBP1 modeling reveals that the COOH-terminal domain forms the classical saddle structure of the TBP family, with one α-helix at the end, not present in pig and human. Native TsTBP1 was detected in T. solium cysticerci´s nuclear extract by western blot using rabbit antibodies generated against two synthetic peptides located in the NH2 and COOH-terminal domains of TsTBP1. These antibodies, through immunofluorescence technique, identified the TBP1 in the nucleus of cells that form the bladder wall of cysticerci of Taenia crassiceps, an organism close related to T. solium. Electrophoretic mobility shift assays using nuclear extracts from T. solium cysticerci and antibodies against the NH2-terminal domain of TsTBP1 showed the interaction of native TsTBP1 with the TATA-box present in T. solium actin 5 (pAT5) and 2-Cys peroxiredoxin (Ts2-CysPrx) gene promoters; in contrast, when antibodies against the anti-COOH-terminal domain of TsTBP1 were used, they inhibited the binding of TsTBP1 to the TATA-box of the pAT5 promoter gene.

  6. VECTOR INTEGRATION

    NARCIS (Netherlands)

    Thomas, E. G. F.

    2012-01-01

    This paper deals with the theory of integration of scalar functions with respect to a measure with values in a, not necessarily locally convex, topological vector space. It focuses on the extension of such integrals from bounded measurable functions to the class of integrable functions, proving

  7. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  8. CpG island protects Rous sarcoma virus-derived vectors integrated into nonpermissive cells from DNA methylation and transcriptional suppression

    Czech Academy of Sciences Publication Activity Database

    Hejnar, Jiří; Hájková, P.; Plachý, Jiří; Elleder, Daniel; Stepanets, Volodymyr; Svoboda, Jan

    2001-01-01

    Roč. 98, č. 2 (2001), s. 565-569 ISSN 0027-8424 R&D Projects: GA ČR GA312/97/P082; GA ČR GA312/98/0825 Keywords : CpG island * provirus silencing * DNA methylation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.890, year: 2001

  9. Molecular Cloning of cDNA Encoding an Aquaglyceroporin, AQP-h9, in the Japanese Tree Frog, Hyla japonica: Possible Roles of AQP-h9 in Freeze Tolerance.

    Science.gov (United States)

    Hirota, Atsushi; Takiya, Yu; Sakamoto, Joe; Shiojiri, Nobuyoshi; Suzuki, Masakazu; Tanaka, Shigeyasu; Okada, Reiko

    2015-06-01

    In order to study the freeze-tolerance mechanism in the Japanese tree frog, Hyla japonica, wecloned a eDNA encoding aquaporin (AQP) 9 from its liver. The predicted amino acid sequence ofH. japonica AQP9 (AQP-h9) contained six putative transmembrane domains and two conservedAsn-Pro-Aia motifs, which are characteristic of AQPs. A swelling assay using Xenopus laevisoocytes injected with AQP-h9 cRNA showed that AQP-h9 facilitated water and glycerol permeation,confirming its property as an aquaglyceroporin. Subsequently, glycerol concentrations in serumand tissue extracts were compared among tree frogs that were hibernating, frozen, or thawed afterfreezing. Serum glycerol concentration of thawed frogs was significantly higher than that of hibernatingfrogs. Glycerol content in the liver did not change in the freezing experiment, whereas thatin the skeletal muscle was elevated in thawed frogs as compared with hibernating or frozen frogs. Histological examination of the liver showed that erythrocytes aggregated in the sinusoids during hibernation and freezing, and immunoreactive AQP-h9 protein was detected over the erythrocytes. The AQP-h9 labeling was more intense in frozen frogs than in hibernating frogs, but nearly undetectable in thawed frogs. For the skeletal muscle, weak labels for AQP-h9 were observed in the cytoplasm of myocytes of hibernating frogs. AQP-h9 labeling was markedly enhanced by freezing and was decreased by thawing. These results indicate that glycerol may act as a c;:ryoprotectant in H. japonica and that during hibernation, particularly during freezing, AQP-h9 may be involved in glycerol uptake in erythrocytes in the liver and in intracellular glycerol transport in the skeletal muscle cells.

  10. An introduction to vectors, vector operators and vector analysis

    CERN Document Server

    Joag, Pramod S

    2016-01-01

    Ideal for undergraduate and graduate students of science and engineering, this book covers fundamental concepts of vectors and their applications in a single volume. The first unit deals with basic formulation, both conceptual and theoretical. It discusses applications of algebraic operations, Levi-Civita notation, and curvilinear coordinate systems like spherical polar and parabolic systems and structures, and analytical geometry of curves and surfaces. The second unit delves into the algebra of operators and their types and also explains the equivalence between the algebra of vector operators and the algebra of matrices. Formulation of eigen vectors and eigen values of a linear vector operator are elaborated using vector algebra. The third unit deals with vector analysis, discussing vector valued functions of a scalar variable and functions of vector argument (both scalar valued and vector valued), thus covering both the scalar vector fields and vector integration.

  11. DNA probes

    International Nuclear Information System (INIS)

    Castelino, J.

    1992-01-01

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  12. Molecular Adjuvant Ag85A Enhances Protection against Influenza A Virus in Mice Following DNA Vaccination

    Directory of Open Access Journals (Sweden)

    Hong Li

    2012-12-01

    Full Text Available A novel DNA vaccine vector encoding the Mycobacterium tuberculosis secreted antigen Ag85A fused with the influenza A virus (IAV HA2 protein epitopes, pEGFP/Ag85A-sHA2 (pAg85A-sHA2, was designed to provide protection against influenza. The antigen encoded by the DNA vaccine vector was efficiently expressed in mammalian cells, as determined by reverse transcription polymerase chain reaction (RT-PCR and fluorescence analyses. Mice were immunized with the vaccine vector by intramuscular injection before challenge with A/Puerto Rico/8/34 virus (PR8 virus. Sera and the splenocyte culture IFN-γ levels were significantly higher in immunized mice compared with the control mice. The novel vaccine group showed a high neutralization antibody titer in vitro. The novel vaccine vector also reduced the viral loads, increased the survival rates in mice after the PR8 virus challenge and reduced the alveolar inflammatory cell numbers. Sera IL-4 concentrations were significantly increased in mice immunized with the novel vaccine vector on Day 12 after challenge with the PR8 virus. These results demonstrated that short HA2 (sHA2 protein epitopes may provide protection against the PR8 virus and that Ag85A could strengthen the immune response to HA2 epitopes, thus, Ag85A may be developed as a new adjuvant for influenza vaccines.

  13. A platform for high-throughput screening of DNA-encoded catalyst libraries in organic solvents† †Electronic supplementary information (ESI) available: Supplemental figures, supporting data, detailed experimental methods, and molecular characterisations. See DOI: 10.1039/c7sc02779f Click here for additional data file.

    Science.gov (United States)

    Hook, K. Delaney; Chambers, John T.

    2017-01-01

    We have developed a novel high-throughput screening platform for the discovery of small-molecules catalysts for bond-forming reactions. The method employs an in vitro selection for bond-formation using amphiphilic DNA-encoded small molecules charged with reaction substrate, which enables selections to be conducted in a variety of organic or aqueous solvents. Using the amine-catalysed aldol reaction as a catalytic model and high-throughput DNA sequencing as a selection read-out, we demonstrate the 1200-fold enrichment of a known aldol catalyst from a library of 16.7-million uncompetitive library members. PMID:29147535

  14. DNA polymerase having modified nucleotide binding site for DNA sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles

    1997-01-01

    Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

  15. Development of oral CTL vaccine using a CTP-integrated Sabin 1 poliovirus-based vector system.

    Science.gov (United States)

    Han, Seung-Soo; Lee, Jinjoo; Jung, Yideul; Kang, Myeong-Ho; Hong, Jung-Hyub; Cha, Min-Suk; Park, Yu-Jin; Lee, Ezra; Yoon, Cheol-Hee; Bae, Yong-Soo

    2015-09-11

    We developed a CTL vaccine vector by modification of the RPS-Vax system, a mucosal vaccine vector derived from a poliovirus Sabin 1 strain, and generated an oral CTL vaccine against HIV-1. A DNA fragment encoding a cytoplasmic transduction peptide (CTP) was integrated into the RPS-Vax system to generate RPS-CTP, a CTL vaccine vector. An HIV-1 p24 cDNA fragment was introduced into the RPS-CTP vector system and a recombinant poliovirus (rec-PV) named vRPS-CTP/p24 was produced. vRPS-CTP/p24 was genetically stable and efficiently induced Th1 immunity and p24-specific CTLs in immunized poliovirus receptor-transgenic (PVR-Tg) mice. In challenge experiments, PVR-Tg mice that were pre-immunized orally with vRPS-CTP/p24 were resistant to challenge with a lethal dose of p24-expressing recombinant vaccinia virus (rMVA-p24). These results suggested that the RPS-CTP vector system had potential for developing oral CTL vaccines against infectious diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. in rice encoding a flavin monooxygenase

    Indian Academy of Sciences (India)

    Cloning, characterization and expression of OsFMO(t) in rice encoding a flavin monooxygenase. Jicai Yi, Lanna Liu, Youpei Cao, Jiazuo Li and Mantong Mei. J. Genet. 92, 471–480. Figure 1. Examples of PCR analysis of the presence of the genes for HPT and GUS in transgenic plants. Genomic DNA of putative.

  17. Synthesis and evaluation of L-arabinose-based cationic glycolipids as effective vectors for pDNA and siRNA in vitro.

    Directory of Open Access Journals (Sweden)

    Bo Li

    Full Text Available Glycolipids might become a new type of promising non-viral gene delivery systems because of their low cytotoxicity, structural diversity, controllable aqua- and lipo-solubility, appropriate density and distribution of positive charges, high transfer efficiency and potential targeting function. In this study, four kinds of L-arabinose-based cationic glycolipids (Ara-DiC12MA, Ara-DiC14MA, Ara-DiC16MA and Ara-DiC18MA containing quaternary ammonium as hydrophilic headgroup and two alkane chains as hydrophobic domain were synthesized and characterized. They were observed to have strong affinities for plasmid DNA (pDNA and siRNA, the pDNA can be completely condensed at N/P ratio less than 2, and the siRNA can be completely retarded at N/P ratio less than 3. The dynamic light scattering (DLS experiment and atomic force microscopy (AFM experiment demonstrated that cationic lipids and their lipoplexes possessed suitable particle sizes with near-spherical shape and proper ζ-potentials for cell transfection. The Ara-DiC16MA liposome was found to have good transfection efficacy in HEK293, PC-3 and Mat cells compared with other three kinds of liposomes, and also maintain low cytotoxicity and better uptake capability in vitro. Furthermore, the gene silencing assay showed that Ara-DiC14MA and Ara-DiC16MA liposomes have demonstrated effective delivery and higher gene knockdown activity (>80% in the above mentioned cells than Lipofectamine 2000. These results indicated Ara-DiC16MA can be developed for efficient and low toxic gene delivery.

  18. Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

    Science.gov (United States)

    Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

    2012-10-01

    A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

  19. Safety and tolerability of conserved region vaccines vectored by plasmid DNA, simian adenovirus and modified vaccinia virus ankara administered to human immunodeficiency virus type 1-uninfected adults in a randomized, single-blind phase I trial.

    Directory of Open Access Journals (Sweden)

    Emma-Jo Hayton

    Full Text Available HIV-1 vaccine development has advanced slowly due to viral antigenic diversity, poor immunogenicity and recently, safety concerns associated with human adenovirus serotype-5 vectors. To tackle HIV-1 variation, we designed a unique T-cell immunogen HIVconsv from functionally conserved regions of the HIV-1 proteome, which were presented to the immune system using a heterologous prime-boost combination of plasmid DNA, a non-replicating simian (chimpanzee adenovirus ChAdV-63 and a non-replicating poxvirus, modified vaccinia virus Ankara. A block-randomized, single-blind, placebo-controlled phase I trial HIV-CORE 002 administered for the first time candidate HIV-1- vaccines or placebo to 32 healthy HIV-1/2-uninfected adults in Oxford, UK and elicited high frequencies of HIV-1-specific T cells capable of inhibiting HIV-1 replication in vitro. Here, detail safety and tolerability of these vaccines are reported.Local and systemic reactogenicity data were collected using structured interviews and study-specific diary cards. Data on all other adverse events were collected using open questions. Serum neutralizing antibody titres to ChAdV-63 were determined before and after vaccination.Two volunteers withdrew for vaccine-unrelated reasons. No vaccine-related serious adverse events or reactions occurred during 190 person-months of follow-up. Local and systemic events after vaccination occurred in 27/32 individuals and most were mild (severity grade 1 and predominantly transient (<48 hours. Myalgia and flu-like symptoms were more strongly associated with MVA than ChAdV63 or DNA vectors and more common in vaccine recipients than in placebo. There were no intercurrent HIV-1 infections during follow-up. 2/24 volunteers had low ChAdV-63-neutralizing titres at baseline and 7 increased their titres to over 200 with a median (range of 633 (231-1533 post-vaccination, which is of no safety concern.These data demonstrate safety and good tolerability of the pSG2

  20. Neonatal intramuscular injection of plasmid encoding glucagon-like ...

    Indian Academy of Sciences (India)

    Prakash

    -A) was significantly elevated in GP rats. These results suggest that neonatal intramuscular injection of plasmid DNA encoding GLP-1 affects anxiety behaviour in adolescent rats, probably through NGFI-A-activated upregulation of hippocampal ...

  1. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  2. Shuttle vector system for Methanococcus maripaludis with improved transformation efficiency.

    Science.gov (United States)

    Walters, Alison D; Smith, Sarah E; Chong, James P J

    2011-04-01

    We have identified an open reading frame and DNA element that are sufficient to maintain shuttle vectors in Methanococcus maripaludis. Strain S0001, containing ORF1 from pURB500 integrated into the M. maripaludis genome, supports a significantly smaller shuttle vector, pAW42, and a 7,000-fold increase in transformation efficiency for pURB500-based vectors.

  3. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  4. Construction of CTLA-4-Ig Fusion Gene in pBudCE4.1 Expression Vector.

    Science.gov (United States)

    Yazdanpanah-Samani, Mahsa; Mahmoudi Maymand, Elham; Jahangeerfam, Tayebeh; Ghaderi, Abbas

    2015-01-01

    CTLA-4 inhibitory signals prevent cell cycle progression and IL-2 production, leading to a halt on an ongoing immune response. CTLA4-Ig fusion proteins contain the extracellular domain of CTLA-4 and Fc fragment of human IgG antibody. In this study we aimed to fuse the ctla-4 gene encoding the extracellular domain of CTLA-4 molecule with igg1 gene encoding Fc region of human IgG. After primer design, PCR reaction was performed using pfu polymerase enzyme and specific primers. PCR amplified fragment was ligated into the vector containing the human igg1 gene. The resulting fusion fragment of ctla-4 and human igg1 genes was ligated to pBudCE4.1 expression vector. Extracellular domain of ctla-4 gene was ligated to igg1 gene and then ctla4-ig fragment was cloned into pBudCE4.1 vector. Construction of the expression vector was confirmed by restriction pattern analysis and sequencing. By confirming the construct, in the next step, the recombinant DNA will be used to produce CTLA4-Ig recombinant protein for the clinical uses.

  5. Isolation, cloning and characterisation of the abiI gene from Lactococcus lactis subsp. lactis M138 encoding abortive phage infection

    Science.gov (United States)

    Su, Ping; Harvey, Melissa; Im, Hee J.

    2010-01-01

    Plasmid pND852 (56 kb) encodes nisin resistance and was isolated from Lactococcus lactis ssp lactis (L. lactis) M138 by conjugation to L. lactis LM0230. It conferred strong resistance to the isometric-headed phage φ712 and partial resistance to the prolate-headed phage φc2. A 2.6 kb HpaII fragment encoding phage resistance was cloned into the streptococcal/Bacillus hybrid vector pGB301 to generate pND817. The mechanism of phage resistance encoded by pND817 involved abortive infection and this was illustrated by a reduction in burst size from 166 to 6 at 30°C and from 160 to 90 at 37°C. Partial resistance was therefore retained at 37°C. DNA sequencing revealed that the abortive infection was encoded by a single open reading frame (ORF), designated abiI, encoding a 332 amino acid prote