
Sample records for dna vector encoding

  1. Cationic lipid-formulated DNA vaccine against hepatitis B virus: immunogenicity of MIDGE-Th1 vectors encoding small and large surface antigen in comparison to a licensed protein vaccine.

    Anne Endmann

    Full Text Available Currently marketed vaccines against hepatitis B virus (HBV based on the small (S hepatitis B surface antigen (HBsAg fail to induce a protective immune response in about 10% of vaccinees. DNA vaccination and the inclusion of PreS1 and PreS2 domains of HBsAg have been reported to represent feasible strategies to improve the efficacy of HBV vaccines. Here, we evaluated the immunogenicity of SAINT-18-formulated MIDGE-Th1 vectors encoding the S or the large (L protein of HBsAg in mice and pigs. In both animal models, vectors encoding the secretion-competent S protein induced stronger humoral responses than vectors encoding the L protein, which was shown to be retained mainly intracellularly despite the presence of a heterologous secretion signal. In pigs, SAINT-18-formulated MIDGE-Th1 vectors encoding the S protein elicited an immune response of the same magnitude as the licensed protein vaccine Engerix-B, with S protein-specific antibody levels significantly higher than those considered protective in humans, and lasting for at least six months after the third immunization. Thus, our results provide not only the proof of concept for the SAINT-18-formulated MIDGE-Th1 vector approach but also confirm that with a cationic-lipid formulation, a DNA vaccine at a relatively low dose can elicit an immune response similar to a human dose of an aluminum hydroxide-adjuvanted protein vaccine in large animals.

  2. Local Patch Vectors Encoded by Fisher Vectors for Image Classification

    Shuangshuang Chen


    Full Text Available The objective of this work is image classification, whose purpose is to group images into corresponding semantic categories. Four contributions are made as follows: (i For computational simplicity and efficiency, we directly adopt raw image patch vectors as local descriptors encoded by Fisher vector (FV subsequently; (ii For obtaining representative local features within the FV encoding framework, we compare and analyze three typical sampling strategies: random sampling, saliency-based sampling and dense sampling; (iii In order to embed both global and local spatial information into local features, we construct an improved spatial geometry structure which shows good performance; (iv For reducing the storage and CPU costs of high dimensional vectors, we adopt a new feature selection method based on supervised mutual information (MI, which chooses features by an importance sorting algorithm. We report experimental results on dataset STL-10. It shows very promising performance with this simple and efficient framework compared to conventional methods.

  3. Storing data encoded DNA in living organisms

    Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA


    Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

  4. 2D Barcode for DNA Encoding

    Elena Purcaru; Cristian Toma


    The paper presents a solution for endcoding/decoding DNA information in 2D barcodes. First part focuses on the existing techniques and symbologies in 2D barcodes field. The 2D barcode PDF417 is presented as starting point. The adaptations and optimizations on PDF417 and on DataMatrix lead to the solution - DNA2DBC - DeoxyriboNucleic Acid Two Dimensional Barcode. The second part shows the DNA2DBC encoding/decoding process step by step. In conclusions are enumerated the most important features ...

  5. Chemical Space of DNA-Encoded Libraries.

    Franzini, Raphael M; Randolph, Cassie


    In recent years, DNA-encoded chemical libraries (DECLs) have attracted considerable attention as a potential discovery tool in drug development. Screening encoded libraries may offer advantages over conventional hit discovery approaches and has the potential to complement such methods in pharmaceutical research. As a result of the increased application of encoded libraries in drug discovery, a growing number of hit compounds are emerging in scientific literature. In this review we evaluate reported encoded library-derived structures and identify general trends of these compounds in relation to library design parameters. We in particular emphasize the combinatorial nature of these libraries. Generally, the reported molecules demonstrate the ability of this technology to afford hits suitable for further lead development, and on the basis of them, we derive guidelines for DECL design.

  6. DNA-Encoded Dynamic Combinatorial Chemical Libraries.

    Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin


    Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair

    Thomas, S.M.; Sedgwick, S.G.


    Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli

  8. Trial watch: Naked and vectored DNA-based anticancer vaccines.

    Bloy, Norma; Buqué, Aitziber; Aranda, Fernando; Castoldi, Francesca; Eggermont, Alexander; Cremer, Isabelle; Sautès-Fridman, Catherine; Fucikova, Jitka; Galon, Jérôme; Spisek, Radek; Tartour, Eric; Zitvogel, Laurence; Kroemer, Guido; Galluzzi, Lorenzo


    One type of anticancer vaccine relies on the administration of DNA constructs encoding one or multiple tumor-associated antigens (TAAs). The ultimate objective of these preparations, which can be naked or vectored by non-pathogenic viruses, bacteria or yeast cells, is to drive the synthesis of TAAs in the context of an immunostimulatory milieu, resulting in the (re-)elicitation of a tumor-targeting immune response. In spite of encouraging preclinical results, the clinical efficacy of DNA-based vaccines employed as standalone immunotherapeutic interventions in cancer patients appears to be limited. Thus, efforts are currently being devoted to the development of combinatorial regimens that allow DNA-based anticancer vaccines to elicit clinically relevant immune responses. Here, we discuss recent advances in the preclinical and clinical development of this therapeutic paradigm.

  9. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Leontina GURGU


    Full Text Available Cellobiohydrolases (EC are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC and β-glucosidases (EC Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  10. Enhanced immunogenicity of DNA fusion vaccine encoding secreted hepatitis B surface antigen and chemokine RANTES

    Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung


    To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES

  11. Toward a Better Compression for DNA Sequences Using Huffman Encoding.

    Al-Okaily, Anas; Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi


    Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016 ).

  12. Horse cDNA clones encoding two MHC class I genes

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.


    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  13. Cloning, sequencing and expression of cDNA encoding growth ...


    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  14. cDNA encoding a polypeptide including a hevein sequence

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  15. DNA-encoded chemical libraries - achievements and remaining challenges.

    Favalli, Nicholas; Bassi, Gabriele; Scheuermann, Jörg; Neri, Dario


    DNA-encoded chemical libraries (DECLs) are collections of compounds, individually coupled to DNA tags serving as amplifiable identification barcodes. Since individual compounds can be identified by the associated DNA tag, they can be stored as a mixture, allowing the synthesis and screening of combinatorial libraries of unprecedented size, facilitated by the implementation of split-and-pool synthetic procedures or other experimental methodologies. In this review, we briefly present relevant concepts and technologies, which are required for the implementation and interpretation of screening procedures with DNA-encoded chemical libraries. Moreover, we illustrate some success stories, detailing how novel ligands were discovered from encoded libraries. Finally, we critically review what can realistically be achieved with the technology at the present time, highlighting challenges and opportunities for the future. © 2018 Federation of European Biochemical Societies.

  16. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won


    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  17. Development and Synthesis of DNA-Encoded Benzimidazole Library.

    Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A


    Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.

  18. Multi-Probe Based Artificial DNA Encoding and Matching Classifier for Hyperspectral Remote Sensing Imagery

    Ke Wu


    Full Text Available In recent years, a novel matching classification strategy inspired by the artificial deoxyribonucleic acid (DNA technology has been proposed for hyperspectral remote sensing imagery. Such a method can describe brightness and shape information of a spectrum by encoding the spectral curve into a DNA strand, providing a more comprehensive way for spectral similarity comparison. However, it suffers from two problems: data volume is amplified when all of the bands participate in the encoding procedure and full-band comparison degrades the importance of bands carrying key information. In this paper, a new multi-probe based artificial DNA encoding and matching (MADEM method is proposed. In this method, spectral signatures are first transformed into DNA code words with a spectral feature encoding operation. After that, multiple probes for interesting classes are extracted to represent the specific fragments of DNA strands. During the course of spectral matching, the different probes are compared to obtain the similarity of different types of land covers. By computing the absolute vector distance (AVD between different probes of an unclassified spectrum and the typical DNA code words from the database, the class property of each pixel is set as the minimum distance class. The main benefit of this strategy is that the risk of redundant bands can be deeply reduced and critical spectral discrepancies can be enlarged. Two hyperspectral image datasets were tested. Comparing with the other classification methods, the overall accuracy can be improved from 1.22% to 10.09% and 1.19% to 15.87%, respectively. Furthermore, the kappa coefficient can be improved from 2.05% to 15.29% and 1.35% to 19.59%, respectively. This demonstrated that the proposed algorithm outperformed other traditional classification methods.

  19. cDNA encoding a polypeptide including a hevein sequence

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  20. A Novel Audio Cryptosystem Using Chaotic Maps and DNA Encoding

    S. J. Sheela


    Full Text Available Chaotic maps have good potential in security applications due to their inherent characteristics relevant to cryptography. This paper introduces a new audio cryptosystem based on chaotic maps, hybrid chaotic shift transform (HCST, and deoxyribonucleic acid (DNA encoding rules. The scheme uses chaotic maps such as two-dimensional modified Henon map (2D-MHM and standard map. The 2D-MHM which has sophisticated chaotic behavior for an extensive range of control parameters is used to perform HCST. DNA encoding technology is used as an auxiliary tool which enhances the security of the cryptosystem. The performance of the algorithm is evaluated for various speech signals using different encryption/decryption quality metrics. The simulation and comparison results show that the algorithm can achieve good encryption results and is able to resist several cryptographic attacks. The various types of analysis revealed that the algorithm is suitable for narrow band radio communication and real-time speech encryption applications.

  1. DyNAvectors: dynamic constitutional vectors for adaptive DNA transfection.

    Clima, Lilia; Peptanariu, Dragos; Pinteala, Mariana; Salic, Adrian; Barboiu, Mihail


    Dynamic constitutional frameworks, based on squalene, PEG and PEI components, reversibly connected to core centers, allow the efficient identification of adaptive vectors for good DNA transfection efficiency and are well tolerated by mammalian cells.

  2. Validation of SplitVectors Encoding for Quantitative Visualization of Large-Magnitude-Range Vector Fields.

    Henan Zhao; Bryant, Garnett W; Griffin, Wesley; Terrill, Judith E; Jian Chen


    We designed and evaluated SplitVectors, a new vector field display approach to help scientists perform new discrimination tasks on large-magnitude-range scientific data shown in three-dimensional (3D) visualization environments. SplitVectors uses scientific notation to display vector magnitude, thus improving legibility. We present an empirical study comparing the SplitVectors approach with three other approaches - direct linear representation, logarithmic, and text display commonly used in scientific visualizations. Twenty participants performed three domain analysis tasks: reading numerical values (a discrimination task), finding the ratio between values (a discrimination task), and finding the larger of two vectors (a pattern detection task). Participants used both mono and stereo conditions. Our results suggest the following: (1) SplitVectors improve accuracy by about 10 times compared to linear mapping and by four times to logarithmic in discrimination tasks; (2) SplitVectors have no significant differences from the textual display approach, but reduce cluttering in the scene; (3) SplitVectors and textual display are less sensitive to data scale than linear and logarithmic approaches; (4) using logarithmic can be problematic as participants' confidence was as high as directly reading from the textual display, but their accuracy was poor; and (5) Stereoscopy improved performance, especially in more challenging discrimination tasks.

  3. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.


    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  4. Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

    Szopa, J.


    The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

  5. The DNA-encoded nucleosome organization of a eukaryotic genome.

    Kaplan, Noam; Moore, Irene K; Fondufe-Mittendorf, Yvonne; Gossett, Andrea J; Tillo, Desiree; Field, Yair; LeProust, Emily M; Hughes, Timothy R; Lieb, Jason D; Widom, Jonathan; Segal, Eran


    Nucleosome organization is critical for gene regulation. In living cells this organization is determined by multiple factors, including the action of chromatin remodellers, competition with site-specific DNA-binding proteins, and the DNA sequence preferences of the nucleosomes themselves. However, it has been difficult to estimate the relative importance of each of these mechanisms in vivo, because in vivo nucleosome maps reflect the combined action of all influencing factors. Here we determine the importance of nucleosome DNA sequence preferences experimentally by measuring the genome-wide occupancy of nucleosomes assembled on purified yeast genomic DNA. The resulting map, in which nucleosome occupancy is governed only by the intrinsic sequence preferences of nucleosomes, is similar to in vivo nucleosome maps generated in three different growth conditions. In vitro, nucleosome depletion is evident at many transcription factor binding sites and around gene start and end sites, indicating that nucleosome depletion at these sites in vivo is partly encoded in the genome. We confirm these results with a micrococcal nuclease-independent experiment that measures the relative affinity of nucleosomes for approximately 40,000 double-stranded 150-base-pair oligonucleotides. Using our in vitro data, we devise a computational model of nucleosome sequence preferences that is significantly correlated with in vivo nucleosome occupancy in Caenorhabditis elegans. Our results indicate that the intrinsic DNA sequence preferences of nucleosomes have a central role in determining the organization of nucleosomes in vivo.

  6. Multicistronic lentiviral vectors containing the FMDV 2A cleavage factor demonstrate robust expression of encoded genes at limiting MOI

    Margison Geoffrey P


    Full Text Available Abstract Background A number of gene therapy applications would benefit from vectors capable of expressing multiple genes. In this study we explored the feasibility and efficiency of expressing two or three transgenes in HIV-1 based lentiviral vector. Bicistronic and tricistronic self-inactivating lentiviral vectors were constructed employing the internal ribosomal entry site (IRES sequence of encephalomyocarditis virus (EMCV and/or foot-and-mouth disease virus (FMDV cleavage factor 2A. We employed enhanced green fluorescent protein (eGFP, O6-methylguanine-DNA-methyltransferase (MGMT, and homeobox transcription factor HOXB4 as model genes and their expression was detected by appropriate methods including fluorescence microscopy, flow cytometry, immunocytochemistry, biochemical assay, and western blotting. Results All the multigene vectors produced high titer virus and were able to simultaneously express two or three transgenes in transduced cells. However, the level of expression of individual transgenes varied depending on: the transgene itself; its position within the construct; the total number of transgenes expressed; the strategy used for multigene expression and the average copy number of pro-viral insertions. Notably, at limiting MOI, the expression of eGFP in a bicistronic vector based on 2A was ~4 times greater than that of an IRES based vector. Conclusion The small and efficient 2A sequence can be used alone or in combination with an IRES for the construction of multicistronic lentiviral vectors which can express encoded transgenes at functionally relevant levels in cells containing an average of one pro-viral insert.

  7. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.


    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  8. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.


    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  9. cDNA encoding a polypeptide including a hevein sequence

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  10. cDNA encoding a polypeptide including a hevein sequence

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  11. cDNA encoding a polypeptide including a hevein sequence

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  12. cDNA encoding a polypeptide including a hevein sequence

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  13. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

    Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A


    Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements

  14. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression


    Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T

  15. Immunogenicity in African Green Monkeys of M Protein Mutant Vesicular Stomatitis Virus Vectors and Contribution of Vector-Encoded Flagellin

    Marlena M. Westcott


    Full Text Available Recombinant vesicular stomatitis virus (VSV is a promising platform for vaccine development. M51R VSV, an attenuated, M protein mutant strain, is an effective inducer of Type I interferon and dendritic cell (DC maturation, which are desirable properties to exploit for vaccine design. We have previously evaluated M51R VSV (M51R and M51R VSV that produces flagellin (M51R-F as vaccine vectors using murine models, and found that flagellin enhanced DC activation and VSV-specific antibody production after low-dose vaccination. In this report, the immunogenicity of M51R vectors and the adjuvant effect of virus-produced flagellin were evaluated in nonhuman primates following high-dose (108 pfu and low-dose (105 pfu vaccination. A single intramuscular vaccination of African green monkeys with M51R or M51R-F induced VSV-specific, dose-dependent humoral immune responses. Flagellin induced a significant increase in antibody production (IgM, IgG and neutralizing antibody at the low vaccination dose. A VSV-specific cellular response was detected at 6 weeks post-vaccination, but was neither dose-dependent nor enhanced by flagellin; similar numbers of VSV-specific, IFNγ-producing cells were detected in lymph node and spleen of all animals. These results indicate that virus-directed, intracellular flagellin production may improve VSV-based vaccines encoding heterologous antigens by lowering the dose required to achieve humoral immunity.

  16. Implementation of digital image encryption algorithm using logistic function and DNA encoding

    Suryadi, MT; Satria, Yudi; Fauzi, Muhammad


    Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.

  17. Cloning and expression of a cDNA encoding human sterol carrier protein 2

    Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.


    The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

  18. Distribution of Brugia malayi larvae and DNA in vector and non-vector mosquitoes: implications for molecular diagnostics

    Christensen Bruce M


    Full Text Available Abstract Background The purpose of this study was to extend prior studies of molecular detection of Brugia malayi DNA in vector (Aedes aegypti- Liverpool and non-vector (Culex pipiens mosquitoes at different times after ingestion of infected blood. Results Parasite DNA was detected over a two week time course in 96% of pooled thoraces of vector mosquitoes. In contrast, parasite DNA was detected in only 24% of thorax pools from non-vectors; parasite DNA was detected in 56% of midgut pools and 47% of abdomen pools from non-vectors. Parasite DNA was detected in vectors in the head immediately after the blood meal and after 14 days. Parasite DNA was also detected in feces and excreta of the vector and non-vector mosquitoes which could potentially confound results obtained with field samples. However, co-housing experiments failed to demonstrate transfer of parasite DNA from infected to non-infected mosquitoes. Parasites were also visualized in mosquito tissues by immunohistololgy using an antibody to the recombinant filarial antigen Bm14. Parasite larvae were detected consistently after mf ingestion in Ae. aegypti- Liverpool. Infectious L3s were seen in the head, thorax and abdomen of vector mosquitoes 14 days after Mf ingestion. In contrast, parasites were only detected by histology shortly after the blood meal in Cx. pipiens, and these were not labeled by the antibody. Conclusion This study provides new information on the distribution of filarial parasites and parasite DNA in vector and non-vector mosquitoes. This information should be useful for those involved in designing and interpreting molecular xenomonitoring studies.

  19. Identification of a mammalian nuclear factor and human cDNA-encoded proteins that recognize DNA containing apurinic sites

    Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.


    Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins

  20. Molecular cloning of growth hormone encoding cDNA of Indian

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  1. DNA transformations of Candida tropicalis with replicating and integrative vectors.

    Sanglard, D; Fiechter, A


    The alkane-assimilating yeast Candida tropicalis was used as a host for DNA transformations. A stable ade2 mutant (Ha900) obtained by UV-mutagenesis was used as a recipient for different vectors carrying selectable markers. A first vector, pMK16, that was developed for the transformation of C. albicans and carries an ADE2 gene marker and a Candida autonomously replicating sequence (CARS) element promoting autonomous replication, was compatible for transforming Ha900. Two transformant types were observed: (i) pink transformants which easily lose pMK16 under non-selective growth conditions; (ii) white transformants, in which the same plasmid exhibited a higher mitotic stability. In both cases pMK16 could be rescued from these cells in Escherichia coli. A second vector, pADE2, containing the isolated C. tropicalis ADE2, gene, was used to transform Ha900. This vector integrated in the yeast genome at homologous sites of the ade2 locus. Different integration types were observed at one or both ade2 alleles in single or in tandem repeats.

  2. Mucosal delivery of a transmission-blocking DNA vaccine encoding Giardia lamblia CWP2 by Salmonella typhimurium bactofection vehicle.

    Abdul-Wahid, Aws; Faubert, Gaétan


    In this study, we investigated the use of Salmonella typhimurium (STM1 strain) as a bactofection vehicle to deliver a transmission-blocking DNA vaccine (TBDV) plasmid to the intestinal immune system. The gene encoding the full length cyst wall protein-2 (CWP2) from Giardia lamblia was subcloned into the pCDNA3 mammalian expression vector and stably introduced into S. typhimurium STM1. Eight-week-old female BALB/c mice were orally immunized every 2 weeks, for a total of three immunizations. Vaccinated and control mice were sacrificed 1 week following the last injection. Administration of the DNA vaccine led to the production of CWP2-specific cellular immune responses characterized by a mixed Th1/Th2 response. Using ELISA, antigen-specific IgA and IgG antibodies were detected in intestinal secretions. Moreover, analysis of sera demonstrated that the DNA immunization also stimulated the production of CWP2-specific IgG antibodies that were mainly of the IgG2a isotype. Finally, challenge infection with live Giardia muris cysts revealed that mice receiving the CWP2-encoding DNA vaccine were able to reduce cyst shedding by approximately 60% compared to control mice. These results demonstrate, for the first time, the development of parasite transmission-blocking immunity at the intestinal level following the administration of a mucosal DNA vaccine delivered by S. typhimurium STM1.

  3. On the efficacy of malaria DNA vaccination with magnetic gene vectors.

    Nawwab Al-Deen, Fatin; Ma, Charles; Xiang, Sue D; Selomulya, Cordelia; Plebanski, Magdalena; Coppel, Ross L


    We investigated the efficacy and types of immune responses from plasmid malaria DNA vaccine encoding VR1020-PyMSP119 condensed on the surface of polyethyleneimine (PEI)-coated SPIONs. In vivo mouse studies were done firstly to determine the optimum magnetic vector composition, and then to observe immune responses elicited when magnetic vectors were introduced via different administration routes. Higher serum antibody titers against PyMSP119 were observed with intraperitoneal and intramuscular injections than subcutaneous and intradermal injections. Robust IgG2a and IgG1 responses were observed for intraperitoneal administration, which could be due to the physiology of peritoneum as a major reservoir of macrophages and dendritic cells. Heterologous DNA prime followed by single protein boost vaccination regime also enhanced IgG2a, IgG1, and IgG2b responses, indicating the induction of appropriate memory immunity that can be elicited by protein on recall. These outcomes support the possibility to design superparamagnetic nanoparticle-based DNA vaccines to optimally evoke desired antibody responses, useful for a variety of diseases including malaria. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Isolation and characterisation of the cDNA encoding a glycosylated accessory protein of pea chloroplast DNA polymerase.

    Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K


    The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...

  5. Cloning and characterization of cDNA encoding xyloglucan ...



    Aug 22, 2011 ... plays important role in growth and development of plants. XETs are a family of enzymes .... cloned into pGEM-T Easy vector (Promega Corporation, WI, USA). The recombinant ..... wall modification in the poaceae. Protein Sci.

  6. Immune Protection of Nonhuman Primates against Ebola Virus with Single Low-Dose Adenovirus Vectors Encoding Modified GPs

    Geisbert, Joan B; Shedlock, Devon J; Xu, Ling; Lamoreaux, Laurie; Custers, Jerome H. H. V; Popernack, Paul M; Yang, Zhi-Yong; Pau, Maria G; Roederer, Mario; Koup, Richard A; Goudsmit, Jaap; Jahrling, Peter B; Nabel, Gary J


    Background Ebola virus causes a hemorrhagic fever syndrome that is associated with high mortality in humans. In the absence of effective therapies for Ebola virus infection, the development of a vaccine becomes an important strategy to contain outbreaks. Immunization with DNA and/or replication-defective adenoviral vectors (rAd) encoding the Ebola glycoprotein (GP) and nucleoprotein (NP) has been previously shown to confer specific protective immunity in nonhuman primates. GP can exert cytopathic effects on transfected cells in vitro, and multiple GP forms have been identified in nature, raising the question of which would be optimal for a human vaccine. Methods and Findings To address this question, we have explored the efficacy of mutant GPs from multiple Ebola virus strains with reduced in vitro cytopathicity and analyzed their protective effects in the primate challenge model, with or without NP. Deletion of the GP transmembrane domain eliminated in vitro cytopathicity but reduced its protective efficacy by at least one order of magnitude. In contrast, a point mutation was identified that abolished this cytopathicity but retained immunogenicity and conferred immune protection in the absence of NP. The minimal effective rAd dose was established at 1010 particles, two logs lower than that used previously. Conclusions Expression of specific GPs alone vectored by rAd are sufficient to confer protection against lethal challenge in a relevant nonhuman primate model. Elimination of NP from the vaccine and dose reductions to 1010 rAd particles do not diminish protection and simplify the vaccine, providing the basis for selection of a human vaccine candidate. PMID:16683867

  7. Immune protection of nonhuman primates against Ebola virus with single low-dose adenovirus vectors encoding modified GPs.

    Nancy J Sullivan


    Full Text Available Ebola virus causes a hemorrhagic fever syndrome that is associated with high mortality in humans. In the absence of effective therapies for Ebola virus infection, the development of a vaccine becomes an important strategy to contain outbreaks. Immunization with DNA and/or replication-defective adenoviral vectors (rAd encoding the Ebola glycoprotein (GP and nucleoprotein (NP has been previously shown to confer specific protective immunity in nonhuman primates. GP can exert cytopathic effects on transfected cells in vitro, and multiple GP forms have been identified in nature, raising the question of which would be optimal for a human vaccine.To address this question, we have explored the efficacy of mutant GPs from multiple Ebola virus strains with reduced in vitro cytopathicity and analyzed their protective effects in the primate challenge model, with or without NP. Deletion of the GP transmembrane domain eliminated in vitro cytopathicity but reduced its protective efficacy by at least one order of magnitude. In contrast, a point mutation was identified that abolished this cytopathicity but retained immunogenicity and conferred immune protection in the absence of NP. The minimal effective rAd dose was established at 10(10 particles, two logs lower than that used previously.Expression of specific GPs alone vectored by rAd are sufficient to confer protection against lethal challenge in a relevant nonhuman primate model. Elimination of NP from the vaccine and dose reductions to 10(10 rAd particles do not diminish protection and simplify the vaccine, providing the basis for selection of a human vaccine candidate.

  8. Joint capsule treatment with enkephalin-encoding HSV-1 recombinant vector reduces inflammatory damage and behavioural sequelae in rat CFA monoarthritis.

    Lu, Ying; McNearney, Terry A; Wilson, Steven P; Yeomans, David C; Westlund, Karin N


    This study assessed enkephalin expression induced by intra-articular application of recombinant, enkephalin-encoding herpes virus (HSV-1) and the impact of expression on nociceptive behaviours and synovial lining inflammation in arthritic rats. Replication-conditional HSV-1 recombinant vectors with cDNA encoding preproenkephalin (HSV-ENK), or control transgene beta-galactosidase cDNA (HSV-beta-gal; control) were injected into knee joints with complete Freund's adjuvant (CFA). Joint temperatures, circumferences and nociceptive behaviours were monitored on days 0, 7, 14 and 21 post CFA and vector treatments. Lumbar (L4-6) dorsal root ganglia (DRG) and spinal cords were immunostained for met-enkephalin (met-ENK), beta-gal, HSV-1 proteins and Fos. Joint tissues were immunostained for met-ENK, HSV-1 proteins, and inflammatory mediators Regulated on Activation, Normal T-cell Expressed and Secreted (RANTES) and cyclo-oxygenase-2, or stained with haematoxylin and eosin for histopathology. Compared to exuberant synovial hypertrophy and inflammatory cell infiltration seen in arthritic rats treated with CFA only or CFA and HSV-beta-gal, the CFA- and HSV-ENK-treated arthritic rats had: (i) striking preservation of synovial membrane cytoarchitecture with minimal inflammatory cell infiltrates; (ii) significantly improved nociceptive behavioural responses to mechanical and thermal stimuli; (iii) normalized Fos staining in lumbar dorsal horn; and (iv) significantly increased met-ENK staining in ipsilateral synovial tissue, lumbar DRG and spinal cord. The HSV-1 and transgene product expression were confined to ipsilateral lumbar DRG (HSV-1, met-ENK, beta-gal). Only transgene product (met-ENK and beta-gal) was seen in lumbar spinal cord sections. Targeted delivery of enkephalin-encoding HSV-1 vector generated safe, sustained opioid-induced analgesia with protective anti-inflammatory blunting in rat inflammatory arthritis.

  9. Enhancement of the priming efficacy of DNA vaccines encoding dendritic cell-targeted antigens by synergistic toll-like receptor ligands

    Kornbluth Richard S


    Full Text Available Abstract Background Targeting of protein antigens to dendritic cells (DC via the DEC205 receptor enhances presentation of antigen-derived peptides on MHC-I and MHC-II molecules and, in the presence of costimulatory signals, antigen-specific immune responses. The immunogenicity and efficacy of DNA vaccination can also be enhanced by fusing the encoded antigen to single chain antibodies directed against DEC205. To further improve this strategy, we evaluated different toll-like receptor ligands (TLR and CD40 ligands (CD40L as adjuvants for DNA vaccines encoding a DEC205-single-chain antibody fused to the ovalbumin model antigen or HIV-1 Gag and assessed the priming efficacy of DNA in a DNA prime adenoviral vector boost immunization regimen. Results Mice were primed with the adjuvanted DEC-205 targeted DNA vaccines and boosted with adenoviral vectors encoding the same antigens. CD8+ T cell responses were determined after the adenoviral booster immunization, to determine how well the different DNA immunization regimens prime for the adenoviral boost. In the absence of adjuvants, targeting of DNA-encoded ovalbumin to DCs suppressed CD8+ T-cell responses after the adenoviral booster immunization. CD8+ T-cell responses to the DEC205 targeted DNA vaccines increased only slightly by adding either the TLR-9 ligand CpG, the TLR-3 ligand Poly I:C, or CD40 ligand expression plasmids. However, the combination of both TLR-ligands led to a strong enhancement of CD8+ T-cell responses compared to a non-targeted DNA vaccine. This finding was confirmed using HIV Gag as antigen. Conclusion Although DNA prime adenoviral vector boost immunizations belong to the strongest inducers of cytotoxic T cell responses in different animal models and humans, the CD8+ T cell responses can be further improved by targeting the DNA encoded antigen to DEC205 in the presence of synergistic TLR ligands CpG and Poly I:C.

  10. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Zuiter Afnan


    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  11. A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

    Chunyan Song


    Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

  12. iDNA screening: Disease vectors as vertebrate samplers.

    Kocher, Arthur; de Thoisy, Benoit; Catzeflis, François; Valière, Sophie; Bañuls, Anne-Laure; Murienne, Jérôme


    In the current context of global change and human-induced biodiversity decline, there is an urgent need for developing sampling approaches able to accurately describe the state of biodiversity. Traditional surveys of vertebrate fauna involve time-consuming and skill-demanding field methods. Recently, the use of DNA derived from invertebrate parasites (leeches and blowflies) was suggested as a new tool for vertebrate diversity assessment. Bloodmeal analyses of arthropod disease vectors have long been performed to describe their feeding behaviour, for epidemiological purposes. On the other hand, this existing expertise has not yet been applied to investigate vertebrate fauna per se. Here, we evaluate the usefulness of hematophagous dipterans as vertebrate samplers. Blood-fed sand flies and mosquitoes were collected in Amazonian forest sites and analysed using high-throughput sequencing of short mitochondrial markers. Bloodmeal identifications highlighted contrasting ecological features and feeding behaviour among dipteran species, which allowed unveiling arboreal and terrestrial mammals of various body size, as well as birds, lizards and amphibians. Additionally, lower vertebrate diversity was found in sites undergoing higher levels of human-induced perturbation. These results suggest that, in addition to providing precious information on disease vector host use, dipteran bloodmeal analyses may represent a useful tool in the study of vertebrate communities. Although further effort is required to validate the approach and consider its application to large-scale studies, this first work opens up promising perspectives for biodiversity monitoring and eco-epidemiology. © 2017 John Wiley & Sons Ltd.

  13. Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA

    Lin, Chenxiang; Jungmann, Ralf; Leifer, Andrew M.; Li, Chao; Levner, Daniel; Church, George M.; Shih, William M.; Yin, Peng


    The identification and differentiation of a large number of distinct molecular species with high temporal and spatial resolution is a major challenge in biomedical science. Fluorescence microscopy is a powerful tool, but its multiplexing ability is limited by the number of spectrally distinguishable fluorophores. Here, we used (deoxy)ribonucleic acid (DNA)-origami technology to construct submicrometre nanorods that act as fluorescent barcodes. We demonstrate that spatial control over the positioning of fluorophores on the surface of a stiff DNA nanorod can produce 216 distinct barcodes that can be decoded unambiguously using epifluorescence or total internal reflection fluorescence microscopy. Barcodes with higher spatial information density were demonstrated via the construction of super-resolution barcodes with features spaced by ˜40 nm. One species of the barcodes was used to tag yeast surface receptors, which suggests their potential applications as in situ imaging probes for diverse biomolecular and cellular entities in their native environments.

  14. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas


    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  15. DNA Encoding Training Using 3D Gesture Interaction.

    Nicola, Stelian; Handrea, Flavia-Laura; Crişan-Vida, Mihaela; Stoicu-Tivadar, Lăcrămioara


    The work described in this paper summarizes the development process and presents the results of a human genetics training application, studying the 20 amino acids formed by the combination of the 3 nucleotides of DNA targeting mainly medical and bioinformatics students. Currently, the domain applications using recognized human gestures of the Leap Motion sensor are used in molecules controlling and learning from Mendeleev table or in visualizing the animated reactions of specific molecules with water. The novelty in the current application consists in using the Leap Motion sensor creating new gestures for the application control and creating a tag based algorithm corresponding to each amino acid, depending on the position in the 3D virtual space of the 4 nucleotides of DNA and their type. The team proposes a 3D application based on Unity editor and on Leap Motion sensor where the user has the liberty of forming different combinations of the 20 amino acids. The results confirm that this new type of study of medicine/biochemistry using the Leap Motion sensor for handling amino acids is suitable for students. The application is original and interactive and the users can create their own amino acid structures in a 3D-like environment which they could not do otherwise using traditional pen-and-paper.

  16. Biomolecule-to-fluorescent-color encoder: modulation of fluorescence emission via DNA structural changes

    Nishimura, Takahiro; Ogura, Yusuke; Yamada, Kenji; Ohno, Yuko; Tanida, Jun


    A biomolecule-to-fluorescent-color (B/F) encoder for optical readout of biomolecular information is proposed. In the B/F encoder, a set of fluorescence wavelengths and their intensity levels are used for coding of a biomolecular signal. A hybridization chain reaction of hairpin DNAs labeled with fluorescent reporters was performed to generate the fluorescence color codes. The fluorescence is modulated via fluorescence resonance energy transfer, which is controlled by DNA structural changes. The results demonstrate that fluorescent color codes can be configured based on two wavelengths and five intensities using the B/F encoder, and the assigned codes can be retrieved via fluorescence measurements. PMID:25071950

  17. Immunogenicity of DNA vaccines encoding simian immunodeficiency virus antigen targeted to dendritic cells in rhesus macaques.

    Matthias Tenbusch

    Full Text Available BACKGROUND: Targeting antigens encoded by DNA vaccines to dendritic cells (DCs in the presence of adjuvants enhances their immunogenicity and efficacy in mice. METHODOLOGY/PRINCIPAL FINDINGS: To explore the immunogenicity of this approach in non-human primates, we generated a single chain antibody to the antigen uptake receptor DEC-205 expressed on rhesus macaque DCs. DNA vaccines encoding this single chain antibody fused to the SIV capsid protein were delivered to six monkeys each by either intramuscular electroporation or conventional intramuscular injection co-injected or not with poly ICLC, a stabilized poly I: C analogue, as adjuvant. Antibodies to capsid were induced by the DC-targeting and non-targeting control DNA delivered by electroporation while conventional DNA immunization at a 10-fold higher dose of DNA failed to induce detectable humoral immune responses. Substantial cellular immune responses were also observed after DNA electroporation of both DNAs, but stronger responses were induced by the non-targeting vaccine. Conventional immunization with the DC-targeting DNA at a 10-fold higher dose did not give rise to substantial cellular immune responses, neither when co-injected with poly ICLC. CONCLUSIONS/SIGNIFICANCE: The study confirms the potent immunogenicity of DNA vaccines delivered by electroporation. Targeting the DNA via a single chain antibody to DEC-205 expressed by DCs, however, does not improve the immunogenicity of the antigens in non-human primates.

  18. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    Ficarelli, A; Tassi, F; Restivo, F M


    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  19. Encoded novel forms of HSP70 or a cytolytic protein increase DNA vaccine potency.

    Garrod, Tamsin; Grubor-Bauk, Branka; Yu, Stanley; Gargett, Tessa; Gowans, Eric J


    In humans, DNA vaccines have failed to demonstrate the equivalent levels of immunogenicity that were shown in smaller animals. Previous studies have encoded adjuvants, predominantly cytokines, within these vaccines in an attempt to increase antigen-specific immune responses. However, these strategies have lacked breadth of innate immune activation and have led to disappointing results in clinical trials. Damage associated molecular patterns (DAMPs) have been identified as pattern recognition receptor (PRR) agonists. DAMPs can bind to a wide range of PRRs on dendritic cells (DCs) and thus our studies have aimed to utilize this characteristic to act as an adjuvant in a DNA vaccine approach. Specifically, HSP70 has been identified as a DAMP, but has been limited by its lack of accessibility to PRRs in and on DCs. Here, we discuss the promising results achieved with the inclusion of membrane-bound or secreted HSP70 into a DNA vaccine encoding HIV gag as the model immunogen.

  20. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Lott, J B; Mackie, G A


    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  1. Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2a strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats.

    Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M


    Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.

  2. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.


    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  3. Quantification of residual host cell DNA in adenoviral vectors produced on PER.C6 cells

    Gijsbers, Linda; Koel, Björn; Weggeman, Miranda; Goudsmit, Jaap; Havenga, Menzo; Marzio, Giuseppe


    Recombinant adenoviral vectors for gene therapy and vaccination are routinely prepared on cultures of immortalized cells, allowing the production of vector batches of high titer and consistent quality. Quantification of residual DNA from the producing cell line is part of the purity tests for

  4. Protective effect of the DNA vaccine encoding the major house dust mite allergens on allergic inflammation in the murine model of house dust mite allergy

    Lee Jaechun


    Full Text Available Abstract Background Vaccination with naked DNA encoding antigen induces cellular and humoral immunity characterized by the activation of specific Th1 cells. Objective To evaluate the effects of vaccination with mixed naked DNA plasmids encoding Der p 1, Der p 2, Der p 3, Der f 1, Der f 2, and Der f 3, the major house dust mite allergens on the allergic inflammation to the whole house dust mites (HDM crude extract. Methods Three hundred micrograms of these gene mixtures were injected into muscle of BALB/c mice. Control mice were injected with the pcDNA 3.1 blank vector. After 3 weeks, the mice were actively sensitized and inhaled with the whole house dust mite extract intranasally. Results The vaccinated mice showed a significantly decreased synthesis of total and HDM-specific IgE compared with controls. Analysis of the cytokine profile of lymphocytes after challenge with HDM crude extract revealed that mRNA expression of interferon-γ was higher in the vaccinated mice than in the controls. Reduced infiltration of inflammatory cells and the prominent infiltration of CD8+ T cells were observed in histology of lung tissue from the vaccinated mice. Conclusion Vaccination with DNA encoding the major house dust mite allergens provides a promising approach for treating allergic responses to whole house dust mite allergens.

  5. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg


    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  6. Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT).

    Ding, Yun; O'Keefe, Heather; DeLorey, Jennifer L; Israel, David I; Messer, Jeffrey A; Chiu, Cynthia H; Skinner, Steven R; Matico, Rosalie E; Murray-Thompson, Monique F; Li, Fan; Clark, Matthew A; Cuozzo, John W; Arico-Muendel, Christopher; Morgan, Barry A


    The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure-activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality.

  7. Frequency and persistency of DNA vaccine encoding GP25 by oral on common carp

    Sri Nuryati


    Full Text Available ABSTRACT Koi herpesvirus (KHV is a major viral pathogen that infects common carp and koi. KHV disease outbreak is happened in almost all centre of common carp culture in Indonesia and caused mass mortality. Deoxyribonucleic acid (DNA vaccination method is one of ways to cope with KHV infection. Vaccines were commonly given by injection. The aim of this research was to get frequency and persistency of DNA vaccine encoding GP25 given by oral delivery method in common carp. This research would like to determine dose, frequency of vaccination, persistency of DNA vaccine and culture medium for the bacterial host. DNA vaccine persistency test was done by using polymerase chain reaction (PCR method with the specific primer for GP25 gene. The results showed that level of DNA vaccine that could be detected in feed was 7.56 ng (equal to 1.598×1010 copies. Efficient culture medium for Escherichia coli DH5α carrying DNA vaccine was LB triptone. Feeding fish with diet supplemented with 1 mL E. coli DH5α containing DNA vaccine for each fish and two times a week allowed persistence of DNA vaccine in kindney and spleen. Keywords: common carp, KHV, DNA vaccine, GP25, persistance  ABSTRAK Koi herpesvirus (KHV adalah virus patogen utama yang menginfeksi ikan mas dan ikan koi. Wabah penyakit KHV terjadi di hampir semua sentra budidaya ikan mas di Indonesia dan menyebabkan kematian massal ikan. Metode vaksinasi DNA merupakan salah satu cara yang dapat dilakukan untuk menanggulangi serangan KHV. Pemberian vaksin umumnya dilakukan dengan cara injeksi. Tujuan penelitian ini adalah untuk menguji frekuensi dan persistensi vaksin DNA GP25 antivirus KHV yang diberikan melalui oral pada ikan mas. Pada penelitian ini dilakukan uji dosis, frekuensi pemberian vaksin, persistensi vaksin DNA, dan media kultur bakteri inang. Persistensi vaksin DNA dianalisis menggunakan metode PCR dengan primer spesifik gen GP25. Hasil penelitian menunjukkan bahwa dosis vaksin DNA yang

  8. A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector


    Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome

  9. Breadth of T cell responses after immunization with adenovirus vectors encoding ancestral antigens or polyvalent papillomavirus antigens

    Ragonnaud, Emeline; Pedersen, Anders Gorm; Holst, Peter Johannes


    to the other PV proteins. The PV sequences were fused to a T cell adjuvant, the murine invariant chain and encoded in a recombinant adenoviral vector which was administered to naïve outbred mice. By measuring T cell responses induced by these different vaccines and towards peptide pools representing 3...... circulating strains and a putative ancestor of oncogenic HPVs, we showed that the ancestral vaccine antigen has to be approximately 90% identical to the circulating PVs before a marked drop of ~90% mean CD8+ T cell responses ensues. Interestingly, the combination of two or three type-specific PV vaccines did...

  10. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Zheng, Jifang; Hu, Bi; Wu, Duansheng


    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  11. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K


    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Bell, Nicholas A. W.; Keyser, Ulrich F.


    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  13. A Vector Printing Method for High-Speed Electrohydrodynamic (EHD Jet Printing Based on Encoder Position Sensors

    Thanh Huy Phung


    Full Text Available Electrohyrodynamic (EHD jet printing has been widely used in the field of direct micro-nano patterning applications, due to its high resolution printing capability. So far, vector line printing using a single nozzle has been widely used for most EHD printing applications. However, the application has been limited to low-speed printing, to avoid non-uniform line width near the end points where line printing starts and ends. At end points of line vector printing, the deposited drop amount is likely to be significantly large compared to the rest of the printed lines, due to unavoidable acceleration and deceleration. In this study, we proposed a method to solve the printing quality problems by producing droplets at an equally spaced distance, irrespective of the printing speed. For this purpose, an encoder processing unit (EPU was developed, so that the jetting trigger could be generated according to user-defined spacing by using encoder position signals, which are used for the positioning control of the two linear stages.

  14. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong


    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  15. Status and prospects of DNA barcoding in medically important parasites and vectors.

    Ondrejicka, Danielle A; Locke, Sean A; Morey, Kevin; Borisenko, Alex V; Hanner, Robert H


    For over 10 years, DNA barcoding has been used to identify specimens and discern species. Its potential benefits in parasitology were recognized early, but its utility and uptake remain unclear. Here we review studies using DNA barcoding in parasites and vectors affecting humans and find that the technique is accurate (accords with author identifications based on morphology or other markers) in 94-95% of cases, although aspects of DNA barcoding (vouchering, marker implicated) have often been misunderstood. In a newly compiled checklist of parasites, vectors, and hazards, barcodes are available for 43% of all 1403 species and for more than half of 429 species of greater medical importance. This is encouraging coverage that would improve with an active campaign targeting parasites and vectors. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Agrobacterium T-DNA-encoded protein Atu6002 interferes with the host auxin response

    Lacroix, Benoît; Gizatullina, Diana I.; Babst, Benjamin A.; Gifford, Andrew N.; Citovsky, Vitaly


    Summary Several genes in the Agrobacterium tumefaciens transferred (T) DNA encode proteins that are involved in developmental alterations leading to the formation of tumors in infected plants. We investigated the role of the protein encoded by the Atu6002 gene, the function of which is completely unknown. The Atu6002 expression occurs in Agrobacterium-induced tumors, and is also activated upon activation of plant cell division by growth hormones. Within the expressing plant cells, the Atu6002 protein is targeted to the plasma membrane. Interestingly, constitutive ectopic expression of Atu6002 in transgenic tobacco plants lead to a severe developmental phenotype characterized by stunted growth, shorter internodes, lanceolate leaves, increased branching, and modified flower morphology. These Atu6002-expressing plants also displayed impaired response to auxin. However, auxin cellular uptake and polar transport were not significantly inhibited in these plants, suggesting that Atu6002 interferes with auxin perception or signaling pathways. PMID:24128370

  17. Construction and identification of eukaryotic expression vector of pcDNA3-UHRF1

    Li Xinli; Zhu Ran; Zhu Wei; Fan Saijun; Meng Qinghui


    Objective: To generate eukaryotic expression vector of pcDNA3-UHRF1(ubiquitin-like, containing PHD and RING finger domains 1, UHRF1) and testify its expression in breast cancer cells MDA-MB-231. Methods: A 2.3 kb cDNA fragment was amplified from the total RNA of the human breast cancer cells MCF-7 by the RT-PCR method and was cloned into the plasmid pcDNA3. The vector was identified by the double digestion with restriction enzymes Kpn I and Xho I and was sequenced. The cDNA of UHRF1 was transfected into human breast cancer cells MDA-MB-231 by Lipofactamin2000. The positive clones were selected by G418. The expression of the UHRF1 was detected by RT-PCR and Western blot analysis. Results: The recombinant eukaryotic expression vector pcDNA3-UHRF1 was digested with Kpn I and BamH I, and the electrophoresis of the digested products showed two fragments; 2.3kb fragment of UHRF1 and 5.4 kb fragment of pcDNA3, and the sequence inserted was identical to the published sequence. The MDA-MB-231 cells transfected with the pcDNA3-UHRF1 plasmid expressed a high level of the UHRF1 mRNA and protein. Conclusion: The recombinant eukaryotic cell expression vector of pcDNA3-UHRF1 is constructed successfully. The recombinant plasmid pcDNA3-UHRF1 can provide a very useful tool and lay an important foundation for the research on the function of UHRF1. (authors)

  18. Improved vaccine protection against retrovirus infection after co-administration of adenoviral vectors encoding viral antigens and type I interferon subtypes

    Groitl Peter


    Full Text Available Abstract Background Type I interferons (IFNs exhibit direct antiviral effects, but also distinct immunomodulatory properties. In this study, we analyzed type I IFN subtypes for their effect on prophylactic adenovirus-based anti-retroviral vaccination of mice against Friend retrovirus (FV or HIV. Results Mice were vaccinated with adenoviral vectors encoding FV Env and Gag proteins alone or in combination with vectors encoding IFNα1, IFNα2, IFNα4, IFNα5, IFNα6, IFNα9 or IFNβ. Only the co-administration of adenoviral vectors encoding IFNα2, IFNα4, IFNα6 and IFNα9 resulted in strongly improved immune protection of vaccinated mice from subsequent FV challenge infection with high control over FV-induced splenomegaly and reduced viral loads. The level of protection correlated with augmented virus-specific CD4+ T cell responses and enhanced antibody titers. Similar results were obtained when mice were vaccinated against HIV with adenoviral vectors encoding HIV Env and Gag-Pol in combination with various type I IFN encoding vectors. Here mainly CD4+ T cell responses were enhanced by IFNα subtypes. Conclusions Our results indicate that certain IFNα subtypes have the potential to improve the protective effect of adenovirus-based vaccines against retroviruses. This correlated with augmented virus-specific CD4+ T cell and antibody responses. Thus, co-expression of select type I IFNs may be a valuable tool for the development of anti-retroviral vaccines.

  19. Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination.

    Revaud, Julien; Unterfinger, Yves; Rol, Nicolas; Suleman, Muhammad; Shaw, Julia; Galea, Sandra; Gavard, Françoise; Lacour, Sandrine A; Coulpier, Muriel; Versillé, Nicolas; Havenga, Menzo; Klonjkowski, Bernard; Zanella, Gina; Biacchesi, Stéphane; Cordonnier, Nathalie; Corthésy, Blaise; Ben Arous, Juliette; Richardson, Jennifer P


    To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches.

  20. Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination

    Julien Revaud


    Full Text Available To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches.

  1. Achievements, Challenges, and Opportunities in DNA-Encoded Library Research: An Academic Point of View.

    Yuen, Lik Hang; Franzini, Raphael M


    DNA-encoded chemical libraries (DECLs) are pools of DNA-tagged small molecules that enable facile screening and identification of bio-macromolecule binders. The successful development of DECLs has led to their increasingly important role in drug development, and screening hits have entered clinical trials. In this review, we summarize the development and currently active research areas of DECLs with a focus on contributions from groups at academic institutes. We further look at opportunities and future directions of DECL research in medicinal chemistry and chemical biology based on the symbiotic relationship between academia and industry. Challenges associated with the application of DECLs in academic drug discovery are further discussed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Chitosan-Graft-Polyethylenimine/DNA Nanoparticles as Novel Non-Viral Gene Delivery Vectors Targeting Osteoarthritis

    Lv, Lulu; Zhao, Huiqing


    The development of safe and efficient gene carriers is the key to the clinical success of gene therapy. The present study was designed to develop and evaluate the chitosan-graft-polyethylenimine (CP)/DNA nanoparticles as novel non-viral gene vectors for gene therapy of osteoarthritis. The CP/DNA nanoparticles were produced through a complex coacervation of the cationic polymers with pEGFP after grafting chitosan (CS) with a low molecular weight (Mw) PEI (Mw = 1.8 kDa). Particle size and zeta potential were related to the weight ratio of CP:DNA, where decreases in nanoparticle size and increases in surface charge were observed as CP content increased. The buffering capacity of CP was significantly greater than that of CS. The transfection efficiency of CP/DNA nanoparticles was similar with that of the Lipofectamine™ 2000, and significantly higher than that of CS/DNA and PEI (25 kDa)/DNA nanoparticles. The transfection efficiency of the CP/DNA nanoparticles was dependent on the weight ratio of CP:DNA (w/w). The average cell viability after the treatment with CP/DNA nanoparticles was over 90% in both chondrocytes and synoviocytes, which was much higher than that of PEI (25 kDa)/DNA nanoparticles. The CP copolymers efficiently carried the pDNA inside chondrocytes and synoviocytes, and the pDNA was detected entering into nucleus. These results suggest that CP/DNA nanoparticles with improved transfection efficiency and low cytotoxicity might be a safe and efficient non-viral vector for gene delivery to both chondrocytes and synoviocytes. PMID:24392152

  3. Long-circulating DNA lipid nanocapsules as new vector for passive tumor targeting.

    Morille , Marie; Montier , Tristan; Legras , Pierre; Carmoy , Nathalie; Brodin , Priscille; Pitard , Bruno; Benoît , Jean-Pierre; Passirani , Catherine


    International audience; Systemic gene delivery systems are needed for therapeutic application to organs that are inaccessible by percutaneous injection. Currently, the main objective is the development of a stable and non-toxic vector that can encapsulate and deliver foreign genetic material to target cells. To this end, DNA, complexed with cationic lipids i.e. DOTAP/DOPE, was encapsulated into lipid nanocapsules (LNCs) leading to the formation of stable nanocarriers (DNA LNCs) with a size in...

  4. Recombinant DNA specifying the human amyloid. beta. precursor protein (ABPP) encodes a 95-kDa polypeptide

    Mita, S; Sadlock, J; Herbert, J; Schon, E A


    Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.

  5. Identification and characterization of a novel Cut family cDNA that encodes human copper transporter protein CutC

    Li Jixi; Ji Chaoneng; Chen Jinzhong; Yang Zhenxing; Wang Yijing; Fei, Xiangwei; Zheng Mei; Gu Xing; Wen Ge; Xie Yi; Mao Yumin


    Copper is an essential heavy metal trace element that plays important roles in cell physiology. The Cut family was associated with the copper homeostasis and involved in several important metabolisms, such as uptake, storage, delivery, and efflux of copper. In this study, a novel Cut family cDNA was isolated from the human fetal brain library, which encodes a 273 amino acid protein with a molecular mass of about 29.3 kDa and a calculated pI of 8.17. It was named hCutC (human copper transporter protein CutC). The ORF of hCutC gene was cloned into pQE30 vector and expressed in Escherichia coli M15. The secreted hCutC protein was purified to a homogenicity of 95% by using the Ni-NTA affinity chromatography. RT-PCR analysis showed that the hCutC gene expressed extensively in human tissues. Subcellular location analysis of hCutC-EGFP fusion protein revealed that hCutC was distributed to cytoplasm of COS-7 cells, and both cytoplasm and nucleus of AD293 cells. The results suggest that hCutC may be one shuttle protein and play important roles in intracellular copper trafficking

  6. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C


    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  7. Efficacy of DNA vaccine encoding koi herpesvirus glycoprotein GP-25in common carp juvenile by immersion

    Soko Nuswantoro


    Full Text Available Koi herpesvirus (KHV is a herpesvirus that particularly infects and causes mass mortality to koi and common carp. Therefore, the protection of common carp from KHV infection is urgently needed. In this study, we developed an application of DNA vaccine encoding KHV glycoprotein-25 by immersion method to increase survival of common carp against KHV infection. A total of 400 common carp juveniles at 30-day-old were immersed in 1-L water containing 1.3×108CFU/mL of the killed Escherichia coli cells carrying DNA vaccine. Three frequencies and three duration of fish immersion were tested, namely: 1×30 minutes, 1×60 minutes, 1× 90 minutes, 2×90 minutes and 3×90 minutes by interval of 24 hours. Reversetranscription polymerase chain reaction analysis showed that DNA vaccine was successfully expressed in the vaccinated fish. Fish at twenty eight days post vaccination were challenged by injecting 10-4 mL of KHV per fish. The result showed that vaccination by 1×30 minutes immersion allowed 61% of fish survived, and this was significantly higher (p<0.05 compared to control (without vaccination, but it was similar among vaccination treatments (p>0.05. The relative percent survival of vaccinated fish were also similar among treatments (p>0.05. DNA vaccination has increased fish survival about two fold higher compared to unvaccinated fish control (26.67%. Thus, DNA vaccination was effectively delivered by immersion for 1×30 minutes, and this technique can be useful to level up the resistance of common carp juveniles against KHV infection. Keywords: DNA vaccine, KHV, glycoprotein, immersion, common carp

  8. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    S. S. Hasson


    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  9. Arabidopsis thaliana GYRB3 does not encode a DNA gyrase subunit.

    Katherine M Evans-Roberts


    Full Text Available DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3.We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer.These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen.

  10. The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.

    Tangney, Mark


    Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.

  11. cDNA encoding a polypeptide including a hev ein sequence

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  12. Design of a titering assay for lentiviral vectors utilizing direct extraction of DNA from transduced cells in microtiter plates

    Michele E Murphy


    Full Text Available Using lentiviral vector products in clinical applications requires an accurate method for measuring transduction titer. For vectors lacking a marker gene, quantitative polymerase chain reaction is used to evaluate the number of vector DNA copies in transduced target cells, from which a transduction titer is calculated. Immune Design previously described an integration-deficient lentiviral vector pseudotyped with a modified Sindbis virus envelope for use in cancer immunotherapy (VP02, of the ZVex platform. Standard protocols for titering integration-competent lentiviral vectors employ commercial spin columns to purify vector DNA from transduced cells, but such columns are not optimized for isolation of extrachromosomal (nonintegrated DNA. Here, we describe a 96-well transduction titer assay in which DNA extraction is performed in situ in the transduction plate, yielding quantitative recovery of extrachromosomal DNA. Vector titers measured by this method were higher than when commercial spin columns were used for DNA isolation. Evaluation of the method's specificity, linear range, and precision demonstrate that it is suitable for use as a lot release assay to support clinical trials with VP02. Finally, the method is compatible with titering both integrating and nonintegrating lentiviral vectors, suggesting that it may be used to evaluate the transduction titer for any lentiviral vector.

  13. Vectors

    Boeriis, Morten; van Leeuwen, Theo


    should be taken into account in discussing ‘reactions’, which Kress and van Leeuwen link only to eyeline vectors. Finally, the question can be raised as to whether actions are always realized by vectors. Drawing on a re-reading of Rudolf Arnheim’s account of vectors, these issues are outlined......This article revisits the concept of vectors, which, in Kress and van Leeuwen’s Reading Images (2006), plays a crucial role in distinguishing between ‘narrative’, action-oriented processes and ‘conceptual’, state-oriented processes. The use of this concept in image analysis has usually focused...

  14. Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

    Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.


    A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

  15. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.


    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  16. Prioritizing multiple therapeutic targets in parallel using automated DNA-encoded library screening

    Machutta, Carl A.; Kollmann, Christopher S.; Lind, Kenneth E.; Bai, Xiaopeng; Chan, Pan F.; Huang, Jianzhong; Ballell, Lluis; Belyanskaya, Svetlana; Besra, Gurdyal S.; Barros-Aguirre, David; Bates, Robert H.; Centrella, Paolo A.; Chang, Sandy S.; Chai, Jing; Choudhry, Anthony E.; Coffin, Aaron; Davie, Christopher P.; Deng, Hongfeng; Deng, Jianghe; Ding, Yun; Dodson, Jason W.; Fosbenner, David T.; Gao, Enoch N.; Graham, Taylor L.; Graybill, Todd L.; Ingraham, Karen; Johnson, Walter P.; King, Bryan W.; Kwiatkowski, Christopher R.; Lelièvre, Joël; Li, Yue; Liu, Xiaorong; Lu, Quinn; Lehr, Ruth; Mendoza-Losana, Alfonso; Martin, John; McCloskey, Lynn; McCormick, Patti; O'Keefe, Heather P.; O'Keeffe, Thomas; Pao, Christina; Phelps, Christopher B.; Qi, Hongwei; Rafferty, Keith; Scavello, Genaro S.; Steiginga, Matt S.; Sundersingh, Flora S.; Sweitzer, Sharon M.; Szewczuk, Lawrence M.; Taylor, Amy; Toh, May Fern; Wang, Juan; Wang, Minghui; Wilkins, Devan J.; Xia, Bing; Yao, Gang; Zhang, Jean; Zhou, Jingye; Donahue, Christine P.; Messer, Jeffrey A.; Holmes, David; Arico-Muendel, Christopher C.; Pope, Andrew J.; Gross, Jeffrey W.; Evindar, Ghotas


    The identification and prioritization of chemically tractable therapeutic targets is a significant challenge in the discovery of new medicines. We have developed a novel method that rapidly screens multiple proteins in parallel using DNA-encoded library technology (ELT). Initial efforts were focused on the efficient discovery of antibacterial leads against 119 targets from Acinetobacter baumannii and Staphylococcus aureus. The success of this effort led to the hypothesis that the relative number of ELT binders alone could be used to assess the ligandability of large sets of proteins. This concept was further explored by screening 42 targets from Mycobacterium tuberculosis. Active chemical series for six targets from our initial effort as well as three chemotypes for DHFR from M. tuberculosis are reported. The findings demonstrate that parallel ELT selections can be used to assess ligandability and highlight opportunities for successful lead and tool discovery.

  17. A combined approach of hollow microneedles and nanocarriers for skin immunization with plasmid DNA encoding ovalbumin

    Pamornpathomkul B


    Full Text Available Boonnada Pamornpathomkul,1 Adisak Wongkajornsilp,2 Wanida Laiwattanapaisal,3 Theerasak Rojanarata,1 Praneet Opanasopit,1 Tanasait Ngawhirunpat1 1Department of Pharmaceutical Technology, Faculty of Pharmacy, Pharmaceutical Development of Green Innovations Group, Silpakorn University, Nakhon Pathom, 2Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 3Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, Thailand Abstract: The aim of this study was to investigate the use of different types of microneedles (MNs and nanocarriers for in vitro skin permeation and in vivo immunization of plasmid DNA encoding ovalbumin (pOVA. In vitro skin permeation studies indicated that hollow MNs had a superior enhancing effect on skin permeation compared with solid MN patches, electroporation (EP patches, the combination of MN and EP patches, and untreated skin. Upon using hollow MNs combined with nanocarriers for pOVA delivery, the skin permeation was higher than for the delivery of naked pOVA, as evidenced by the increased amount of pOVA in Franz diffusion cells and immunoglobulin G (IgG antibody responses. When the hollow MNs were used for the delivery of nanocarrier:pOVA complexes into the skin of mice, they induced a stronger IgG immune response than conventional subcutaneous (SC injections. In addition, immunization of mice with the hollow MNs did not induce signs of skin infection or pinpoint bleeding. Accordingly, the hollow MNs combined with a nanocarrier delivery system is a promising approach for delivering pOVA complexes to the skin for promoting successful immunization. Keywords: hollow microneedle, solid microneedle, electroporation, plasmid DNA encoding ovalbumin, skin immunization, nanocarrier

  18. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Shiku, Hitoshi, E-mail: [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)


    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  19. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Dunham, S P; Onions, D E


    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  20. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Wang, W.; Takezawa, D.; Poovaiah, B. W.


    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  1. Viral vectors encoding endomorphins and serine histogranin attenuate neuropathic pain symptoms after spinal cord injury in rats.

    Nasirinezhad, Farinaz; Gajavelli, Shyam; Priddy, Blake; Jergova, Stanislava; Zadina, James; Sagen, Jacqueline


    The treatment of spinal cord injury (SCI)-induced neuropathic pain presents a challenging healthcare problem. The lack of available robust pharmacological treatments underscores the need for novel therapeutic methods and approaches. Due to the complex character of neuropathic pain following SCI, therapies targeting multiple mechanisms may be a better choice for obtaining sufficient long-term pain relief. Previous studies in our lab showed analgesic effects using combinations of an NMDA antagonist peptide [Ser1]histogranin (SHG), and the mu-opioid peptides endomorphins (EMs), in several pain models. As an alternative to drug therapy, this study evaluated the analgesic potential of these peptides when delivered via gene therapy. Lentiviruses encoding SHG and EM-1 and EM-2 were intraspinally injected, either singly or in combination, into rats with clip compression SCI 2 weeks following injury. Treated animals showed significant reduction in mechanical and thermal hypersensitivity, compared to control groups injected with GFP vector only. The antinociceptive effects of individually injected components were modest, but the combination of EMs and SHG produced robust and sustained antinociception. The onset of the analgesic effects was observed between 1-5 weeks post-injection and sustained without decrement for at least 7 weeks. No adverse effects on locomotor function were observed. The involvement of SHG and EMs in the observed antinociception was confirmed by pharmacologic inhibition using intrathecal injection of either the opioid antagonist naloxone or an anti-SHG antibody. Immunohistochemical analysis showed the presence of SHG and EMs in the spinal cord of treated animals, and immunodot-blot analysis of CSF confirmed the presence of these peptides in injected animals. In a separate group of rats, delayed injection of viral vectors was performed in order to mimic a more likely clinical scenario. Comparable and sustained antinociceptive effects were observed in

  2. Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.


    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

  3. Glycoprotein is enough for sindbis virus-derived DNA vector to express heterogenous genes

    Fu Juanjuan


    Full Text Available Abstract To investigate the necessity and potential application of structural genes for expressing heterogenous genes from Sindbis virus-derived vector, the DNA-based expression vector pVaXJ was constructed by placing the recombinant genome of sindbis-like virus XJ-160 under the control of the human cytomegalovirus (CMV promoter of the plasmid pVAX1, in which viral structural genes were replaced by a polylinker cassette to allow for insertion of heterologous genes. The defect helper plasmids pVaE or pVaC were developed by cloning the gene of glycoprotein E3E26KE1 or capsid protein of XJ-160 virus into pVAX1, respectively. The report gene cassette pVaXJ-EGFP or pV-Gluc expressing enhanced green fluorescence protein (EGFP or Gaussia luciferase (G.luc were constructed by cloning EGFP or G.luc gene into pVaXJ. EGFP or G.luc was expressed in the BHK-21 cells co-transfected with report gene cassettes and pVaE at levels that were comparable to those produced by report gene cassettes, pVaC and pVaE and were much higher than the levels produced by report gene cassette and pVaC, suggesting that glycoprotein is enough for Sindbis virus-derived DNA vector to express heterogenous genes in host cells. The method of gene expression from Sindbis virus-based DNA vector only co-transfected with envelop E gene increase the conveniency and the utility of alphavirus-based vector systems in general.

  4. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

    Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar


    The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

    Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong


    A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

  6. Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

    Honoré, B; Leffers, H; Madsen, Peder


    We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa...

  7. A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F

    Helin, K; Lees, J A; Vidal, M


    The retinoblastoma protein (pRB) plays an important role in the control of cell proliferation, apparently by binding to and regulating cellular transcription factors such as E2F. Here we describe the characterization of a cDNA clone that encodes a protein with properties of E2F. This clone, RBP3...

  8. Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

    Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.


    Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

  9. Cloning, molecular characterization and expression of a cDNA encoding a functional NADH-cytochrome b5 reductase from Mucor racemosus PTCC 5305 in E. coli



    Full Text Available The present work aims to study a new NADH-cytochrome b5 reductase (cb5r from Mucor racemosus PTCC 5305. A cDNA coding for cb s r was isolated from a Mucor racemosus PTCC 5305 cDNA library. The nucleotide sequence of the cDNA including coding and sequences flanking regions was determined. The open reading frame starting from ATG and ending with TAG stop codon encoded 228 amino acids and displayed the closest similarity (73% with Mortierella alpina cb s r. Lack of hydrophobic residues in the N-terminal sequence was apparent, suggesting that the enzyme is a soluble isoform. The coding sequence was then cloned in the pET16b transcription vector carrying an N-terminal-linked His-Tag® sequence and expressed in Escherichia coli BL21 (DE3. The enzyme was then homogeneously purified by a metal affinity column. The recombinant Mucor enzyme was shown to have its optimal activity at pH and temperature of about 7.5 and 40 °C, respectively. The apparent Km value was calculated to be 13 μM for ferricyanide. To our knowledge, this is the first report on cloning and expression of a native fungal soluble isoform of NADH-cytochrome b5 reductase in E. coli.

  10. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

    Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas


    The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

  11. Effect of thiol pendant conjugates on plasmid DNA binding, release, and stability of polymeric delivery vectors.

    Bacalocostantis, Irene; Mane, Viraj P; Kang, Michael S; Goodley, Addison S; Muro, Silvia; Kofinas, Peter


    Polymers have attracted much attention as potential gene delivery vectors due to their chemical and structural versatility. However, several challenges associated with polymeric carriers, including low transfection efficiencies, insufficient cargo release, and high cytotoxicity levels have prevented clinical implementation. Strong electrostatic interactions between polymeric carriers and DNA cargo can prohibit complete cargo release within the cell. As a result, cargo DNA never reaches the cell's nucleus where gene expression takes place. In addition, highly charged cationic polymers have been correlated with high cytotoxicity levels, making them unsuitable carriers in vivo. Using poly(allylamine) (PAA) as a model, we investigated how pH-sensitive disulfide cross-linked polymer networks can improve the delivery potential of cationic polymer carriers. To accomplish this, we conjugated thiol-terminated pendant chains onto the primary amines of PAA using 2-iminothiolane, developing three new polymer vectors with 5, 13, or 20% thiol modification. Unmodified PAA and thiol-conjugated polymers were tested for their ability to bind and release plasmid DNA, their capacity to protect genetic cargo from enzymatic degradation, and their potential for endolysosomal escape. Our results demonstrate that polymer-plasmid complexes (polyplexes) formed by the 13% thiolated polymer demonstrate the greatest delivery potential. At high N/P ratios, all thiolated polymers (but not unmodified counterparts) were able to resist decomplexation in the presence of heparin, a negatively charged polysaccharide used to mimic in vivo polyplex-protein interactions. Further, all thiolated polymers exhibited higher buffering capacities than unmodified PAA and, therefore, have a greater potential for endolysosomal escape. However, 5 and 20% thiolated polymers exhibited poor DNA binding-release kinetics, making them unsuitable carriers for gene delivery. The 13% thiolated polymers, on the other hand

  12. A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

    Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry


    A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

  13. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Utut Widyastuti Suharsono


    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  14. Long-circulating DNA lipid nanocapsules as new vector for passive tumor targeting.

    Morille, Marie; Montier, Tristan; Legras, Pierre; Carmoy, Nathalie; Brodin, Priscille; Pitard, Bruno; Benoît, Jean-Pierre; Passirani, Catherine


    Systemic gene delivery systems are needed for therapeutic application to organs that are inaccessible by percutaneous injection. Currently, the main objective is the development of a stable and non-toxic vector that can encapsulate and deliver foreign genetic material to target cells. To this end, DNA, complexed with cationic lipids i.e. DOTAP/DOPE, was encapsulated into lipid nanocapsules (LNCs) leading to the formation of stable nanocarriers (DNA LNCs) with a size inferior to 130 nm. Amphiphilic and flexible poly (ethylene glycol) (PEG) polymer coatings [PEG lipid derivative (DSPE-mPEG(2000)) or F108 poloxamer] at different concentrations were selected to make DNA LNCs stealthy. Some of these coated lipid nanocapsules were able to inhibit complement activation and were not phagocytized in vitro by macrophagic THP-1 cells whereas uncoated DNA LNCs accumulated in the vacuolar compartment of THP-1 cells. These results correlated with a significant increase of in vivo circulation time in mice especially for DSPE-mPEG(2000) 10 mm and an early half-life time (t(1/2) of distribution) 5-fold greater than for non-coated DNA LNCs (7.1 h vs 1.4 h). Finally, a tumor accumulation assessed by in vivo fluorescence imaging system was evidenced for these coated LNCs as a passive targeting without causing any hepatic damage.

  15. The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase

    Santos Diógenes S


    Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and

  16. Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

    Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.


    The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber

  17. Efficacy of chimeric DNA vaccines encoding Eimeria tenella 5401 and chicken IFN-γ or IL-2 against coccidiosis in chickens.

    Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui


    Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier

  18. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    You Wanhui


    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  19. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

    Dongsheng Li

    Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

  20. Exploring genetic variation in haplotypes of the filariasis vector Culex quinquefasciatus (Diptera: Culicidae) through DNA barcoding.

    Vadivalagan, Chithravel; Karthika, Pushparaj; Murugan, Kadarkarai; Panneerselvam, Chellasamy; Del Serrone, Paola; Benelli, Giovanni


    Culex quinquefasciatus (Diptera: Culicidae) is a vector of many pathogens and parasites of humans, as well as domestic and wild animals. In urban and semi-urban Asian countries, Cx. quinquefasciatus is a main vector of nematodes causing lymphatic filariasis. In the African region, it vectors the Rift Valley fever virus, while in the USA it transmits West Nile, St. Louis encephalitis and Western equine encephalitis virus. In this study, DNA barcoding was used to explore the genetic variation of Cx. quinquefasciatus populations from 88 geographical regions. We presented a comprehensive approach analyzing the effectiveness of two gene markers, i.e. CO1 and 16S rRNA. The high threshold genetic divergence of CO1 (0.47%) gene was reported as an ideal marker for molecular identification of this mosquito vector. Furthermore, null substitutions were lower in CO1 if compared to 16S rRNA, which influenced its differentiating potential among Indian haplotypes. NJ tree was well supported with high branch values for CO1 gene than 16S rRNA, indicating ideal genetic differentiation among haplotypes. TCS haplotype network revealed 14 distinct clusters. The intra- and inter-population polymorphism were calculated among the global and Indian Cx. quinquefasciatus lineages. The genetic diversity index Tajima' D showed negative values for all the 4 intra-population clusters (G2-4, G10). Fu's FS showed negative value for G10 cluster, which was significant and indicated recent population expansion. However, the G2-G4 (i.e. Indian lineages) had positive values, suggesting a bottleneck effect. Overall, our research firstly shed light on the genetic differences among the haplotypes of Cx. quinquefasciatus species complex, adding basic knowledge to the molecular ecology of this important mosquito vector. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Low-Dose Gene Therapy for Murine PKU Using Episomal Naked DNA Vectors Expressing PAH from Its Endogenous Liver Promoter

    Hiu Man Grisch-Chan


    Full Text Available Limited duration of transgene expression, insertional mutagenesis, and size limitations for transgene cassettes pose challenges and risk factors for many gene therapy vectors. Here, we report on physiological expression of liver phenylalanine hydroxylase (PAH by delivery of naked DNA/minicircle (MC-based vectors for correction of homozygous enu2 mice, a model of human phenylketonuria (PKU. Because MC vectors lack a defined size limit, we constructed a MC vector expressing a codon-optimized murine Pah cDNA that includes a truncated intron and is under the transcriptional control of a 3.6-kb native Pah promoter/enhancer sequence. This vector, delivered via hydrodynamic injection, yielded therapeutic liver PAH activity and sustained correction of blood phenylalanine comparable to viral or synthetic liver promoters. Therapeutic efficacy was seen with vector copy numbers of 95% loss of vector genomes and PAH activity in liver, demonstrating that MC vectors had not integrated into the liver genome. In conclusion, MC vectors, which do not have a defined size-limitation, offer a favorable safety profile for hepatic gene therapy due to their non-integration in combination with native promoters.

  2. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.


    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  3. Smart DNA vectors based on cyclodextrin polymers: compaction and endosomal release.

    Wintgens, Véronique; Leborgne, Christian; Baconnais, Sonia; Burckbuchler, Virginie; Le Cam, Eric; Scherman, Daniel; Kichler, Antoine; Amiel, Catherine


    Neutral β-cyclodextrin polymers (polyβCD) associated with cationic adamantyl derivatives (Ada) can be used to deliver plasmid DNA into cells. In absence of an endosomolytic agent, transfection efficiency remains low because most complexes are trapped in the endosomal compartment. We asked whether addition of an imidazole-modified Ada can increase efficiency of polyβCD/cationic Ada-based delivery system. We synthesized two adamantyl derivatives: Ada5, which has a spacer arm between the Ada moiety and a bi-cationic polar head group, and Ada6, which presents an imidazole group. Strength of association between polyβCD and Ada derivatives was evaluated by fluorimetric titration. Gel mobility shift assay, zeta potential, and dark field transmission electron microscopy experiments demonstrated the system allowed for efficient DNA compaction. In vitro transfection experiments performed on HepG2 and HEK293 cells revealed the quaternary system polyβCD/Ada5/Ada6/DNA has efficiency comparable to cationic lipid DOTAP. We successfully designed fine-tuned DNA vectors based on cyclodextrin polymers combined with two new adamantyl derivatives, leading to significant transfection associated with low toxicity.

  4. Predicting DNA binding proteins using support vector machine with hybrid fractal features.

    Niu, Xiao-Hui; Hu, Xue-Hai; Shi, Feng; Xia, Jing-Bo


    DNA-binding proteins play a vitally important role in many biological processes. Prediction of DNA-binding proteins from amino acid sequence is a significant but not fairly resolved scientific problem. Chaos game representation (CGR) investigates the patterns hidden in protein sequences, and visually reveals previously unknown structure. Fractal dimensions (FD) are good tools to measure sizes of complex, highly irregular geometric objects. In order to extract the intrinsic correlation with DNA-binding property from protein sequences, CGR algorithm, fractal dimension and amino acid composition are applied to formulate the numerical features of protein samples in this paper. Seven groups of features are extracted, which can be computed directly from the primary sequence, and each group is evaluated by the 10-fold cross-validation test and Jackknife test. Comparing the results of numerical experiments, the group of amino acid composition and fractal dimension (21-dimension vector) gets the best result, the average accuracy is 81.82% and average Matthew's correlation coefficient (MCC) is 0.6017. This resulting predictor is also compared with existing method DNA-Prot and shows better performances. © 2013 The Authors. Published by Elsevier Ltd All rights reserved.

  5. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S


    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  6. RNase-L regulates the stability of mitochondrial DNA-encoded mRNAs in mouse embryo fibroblasts

    Chandrasekaran, Krish; Mehrabian, Zara; Li Xiaoling; Hassel, Bret


    Accelerated decrease in the levels of mitochondrial DNA-encoded mRNA (mt-mRNA) occurs in neuronal cells exposed either to the excitatory amino acid, glutamate or to the sodium ionophore, monensin, suggesting a role of mitochondrial RNase(s) on the stability of mt-mRNAs. Here we report that in mouse embryo fibroblasts that are devoid of the interferon-regulated RNase, RNase-L, the monensin-induced decrease in the half-life of mt-mRNA was reduced. In monensin (250 nM)-treated RNase-L +/+ cells the average half-life of mt-mRNA, determined after termination of transcription with actinomycin D, was found to be 3 h, whereas in monensin-treated RNase-L -/- cells the half-life of mt-mRNA was >6 h. In contrast, the stability of nuclear DNA-encoded β-actin mRNA was unaffected. Induction of RNase-L expression in mouse 3T3 fibroblasts further decreased the monensin-induced reduction in mt-mRNA half-life to 1.5 h. The results indicate that the RNase-L-dependent decrease in mtDNA-encoded mRNA transcript levels occurs through a decrease in the half-life of mt-mRNA, and that RNase-L may play a role in the stability of mt-mRNA

  7. rad-Dependent response of the chk1-encoded protein kinase at the DNA damage checkpoint

    Walworth, N.C.; Bernards, R.A.


    Exposure of eukaryotic cells to agents that generate DNA damage results in transient arrest of progression through the cell cycle. In fission yeast, the DNA damage checkpoint associated with cell cycle arrest before mitosis requires the protein kinase p56chk1. DNA damage induced by ultraviolet

  8. Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

    Kristen K. Merritt


    Full Text Available Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C and weak (A:T nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so.Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS that adds nucleotides to the four (G, A, C, and T found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B, at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes

  9. Safety and immunogenicity of a novel therapeutic DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Juan, Long; Xiao, Zhao; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi


    Current clinically available treatments for rheumatoid arthritis (RA) fail to cure the disease or unsatisfactorily halt disease progression. To overcome these limitations, the development of therapeutic DNA vaccines and boosters may offer new promising strategies. Because type II collagen (CII) as a critical autoantigen in RA and native chicken type II collagen (nCCII) has been used to effectively treat RA, we previously developed a novel therapeutic DNA vaccine encoding CCII (pcDNA-CCOL2A1) with efficacy comparable to that of the current "gold standard", methotrexate(MTX). Here, we systemically evaluated the safety and immunogenicity of the pcDNA-CCOL2A1 vaccine in normal Wistar rats. Group 1 received only a single intramuscular injection into the hind leg with pcDNA-CCOL2A1 at the maximum dosage of 3 mg/kg on day 0; Group 2 was injected with normal saline (NS) as a negative control. All rats were monitored daily for any systemic adverse events, reactions at the injection site, and changes in body weights. Plasma and tissues from all experimental rats were collected on day 14 for routine examinations of hematology and biochemistry parameters, anti-CII IgG antibody reactivity, and histopathology. Our results indicated clearly that at the maximum dosage of 3 mg/kg, the pcDNA-CCOL2A1 vaccine was safe and well-tolerated. No abnormal clinical signs or deaths occurred in the pcDNA-CCOL2A1 group compared with the NS group. Furthermore, no major alterations were observed in hematology, biochemistry, and histopathology, even at the maximum dose. In particularly, no anti-CII IgG antibodies were detected in vaccinated normal rats at 14 d after vaccination; this was relevant because we previously demonstrated that the pcDNA-CCOL2A1 vaccine, when administered at the therapeutic dosage of 300 μg/kg alone, did not induce anti-CII IgG antibody production and significantly reduced levels of anti-CII IgG antibodies in the plasma of rats with established collagen-induced arthritis

  10. Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

    Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan


    The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

  11. Chitosan-based DNA delivery vector targeted to gonadotropin-releasing hormone (GnRH) receptor.

    Boonthum, Chatwalee; Namdee, Katawut; Boonrungsiman, Suwimon; Chatdarong, Kaywalee; Saengkrit, Nattika; Sajomsang, Warayuth; Ponglowhapan, Suppawiwat; Yata, Teerapong


    The main purpose of this study was to investigate the application of modified chitosan as a potential vector for gene delivery to gonadotropin-releasing hormone receptor (GnRHR)-expressing cells. Such design of gene carrier could be useful in particular for gene therapy for cancers related to the reproductive system, gene disorders of sexual development, and contraception and fertility control. In this study, a decapeptide GnRH was successfully conjugated to chitosan (CS) as confirmed by proton nuclear magnetic resonance spectroscopy ( 1 H NMR) and Attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR). The synthesized GnRH-conjugated chitosan (GnRH-CS) was able to condense DNA to form positively charged nanoparticles and specifically deliver plasmid DNA to targeted cells in both two-dimensional (2D) and three-dimensional (3D) cell cultures systems. Importantly, GnRH-CS exhibited higher transfection activity compared to unmodified CS. In conclusion, GnRH-conjugated chitosan can be a promising carrier for targeted DNA delivery to GnRHR-expressing cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

    Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo


    Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

  13. DNA prime/Adenovirus boost malaria vaccine encoding P. falciparum CSP and AMA1 induces sterile protection associated with cell-mediated immunity.

    Ilin Chuang

    Full Text Available BACKGROUND: Gene-based vaccination using prime/boost regimens protects animals and humans against malaria, inducing cell-mediated responses that in animal models target liver stage malaria parasites. We tested a DNA prime/adenovirus boost malaria vaccine in a Phase 1 clinical trial with controlled human malaria infection. METHODOLOGY/PRINCIPAL FINDINGS: The vaccine regimen was three monthly doses of two DNA plasmids (DNA followed four months later by a single boost with two non-replicating human serotype 5 adenovirus vectors (Ad. The constructs encoded genes expressing P. falciparum circumsporozoite protein (CSP and apical membrane antigen-1 (AMA1. The regimen was safe and well-tolerated, with mostly mild adverse events that occurred at the site of injection. Only one AE (diarrhea, possibly related to immunization, was severe (Grade 3, preventing daily activities. Four weeks after the Ad boost, 15 study subjects were challenged with P. falciparum sporozoites by mosquito bite, and four (27% were sterilely protected. Antibody responses by ELISA rose after Ad boost but were low (CSP geometric mean titer 210, range 44-817; AMA1 geometric mean micrograms/milliliter 11.9, range 1.5-102 and were not associated with protection. Ex vivo IFN-γ ELISpot responses after Ad boost were modest (CSP geometric mean spot forming cells/million peripheral blood mononuclear cells 86, range 13-408; AMA1 348, range 88-1270 and were highest in three protected subjects. ELISpot responses to AMA1 were significantly associated with protection (p = 0.019. Flow cytometry identified predominant IFN-γ mono-secreting CD8+ T cell responses in three protected subjects. No subjects with high pre-existing anti-Ad5 neutralizing antibodies were protected but the association was not statistically significant. SIGNIFICANCE: The DNA/Ad regimen provided the highest sterile immunity achieved against malaria following immunization with a gene-based subunit vaccine (27%. Protection

  14. Adeno-associated virus Rep-mediated targeting of integrase-defective retroviral vector DNA circles into human chromosome 19

    Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira; Kamihira, Masamichi


    Highlights: ► Adeno-associated virus (AAV) is capable of targeted integration in human cells. ► Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. ► A targeted integration system of IDRV DNA using the AAV integration mechanism. ► Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors, therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.


    Tri Joko Raharjo


    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  16. Yeast DNA-repair gene RAD14 encodes a zinc metalloprotein with affinity for ultraviolet-damaged DNA

    Guzder, S.N.; Sung, P.; Prakash, S.; Prakash, L.


    Xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers due to a defect in excision repair of UV light-damaged DNA. Of the seven XP complementation groups, A--G, group A represents a severe and frequent form of the disease. The Saccharomyces cerevisiae RAD14 gene is a homolog of the XP-A correcting (XPAC) gene. Like XP-A cells, rad14-null mutants are defective in the incision step of excision repair of UV-damaged DNA. The authors have purified RAD14 protein to homogeneity from extract of a yeast strain genetically tailored to overexpress RAD14. As determined by atomic emission spectroscopy, RAD14 contains one zinc atom. They also show in vitro that RAD14 binds zinc but does not bind other divalent metal ions. In DNA mobility-shift assays, RAD14 binds specifically to UV-damaged DNA. Removal of cyclobutane pyrimidine dimers from damaged DNA by enzymatic photoreactivation has no effect on binding, strongly suggesting that RAD14 recognizes pyrimidine(6-4)pyrimidone photoproduct sites. These findings indicate that RAD14 functions in damage recognition during excision repair. 37 refs., 4 figs

  17. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)


    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  18. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp.) Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B.

    Chénard, Caroline; Wirth, Jennifer F; Suttle, Curtis A


    Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. Filamentous cyanobacteria belonging to the genus Nostoc are widespread and ecologically important in freshwater, yet little is known about the genomic content of their viruses. Here we report the first genomic analysis of cyanophages infecting

  19. Identification of the polypeptides encoded in the unassigned reading frames 2, 4, 4L, and 5 of human mitochondrial DNA

    Mariottini, P.; Chomyn, A.; Riley, M.; Cottrell, B.; Doolittle, R.F.; Attardi, G.


    In previous work, antibodies prepared against chemically synthesized peptides predicted from the DNA sequence were used to identify the polypeptides encoded in three of the eight unassigned reading frames (URFs) of human mitochondrial DNA (mtDNA). In the present study, this approach has been extended to other human mtDNA URFs. In particular, antibodies directed against the NH 2 -terminal octapeptide of the putative URF2 product specifically precipitated component 11 of the HeLa cell mitochondrial translation products, the reaction being inhibited by the specific peptide. Similarly, antibodies directed against the COOH-terminal nonapeptide of the putative URF4 product reacted specifically with components 4 and 5, and antibodies against a COOH-terminal heptapeptide of the presumptive URF4L product reacted specifically with component 26. Antibodies against the NH 2 -terminal heptapeptide of the putative product of URF5 reacted with component 1, but only to a marginal extent; however, the results of a trypsin fingerprinting analysis of component 1 point strongly to this component as being the authentic product of URF5. The polypeptide assignments to the mtDNA URFs analyzed here are supported by the relative electrophoretic mobilities of proteins 11, 4-5, 26, and 1, which are those expected for the molecular weights predicted from the DNA sequence for the products of URF2, URF4, URF4L, and URF5, respectively. With the present assignment, seven of the eight human mtDNA URFs have been shown to be expressed in HeLa cells

  20. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete


    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  1. Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

    Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian


    Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  2. An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply

    Reisfeld, Ralph A


    In an effort to meet the urgent need for the development of novel and effective treatments for metastatic breast cancer, we developed and evaluated a novel, oral DNA vaccine targeting endoglin (CD105...

  3. The protein encoded by the proto-oncogene DEK changes the topology of chromatin and reduces the efficiency of DNA replication in a chromatin-specific manner

    Alexiadis, V; Waldmann, T; Andersen, Jens S.


    The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...

  4. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon


    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  5. Ability of herpes simplex virus vectors to boost immune responses to DNA vectors and to protect against challenge by simian immunodeficiency virus

    Kaur, Amitinder; Sanford, Hannah B.; Garry, Deirdre; Lang, Sabine; Klumpp, Sherry A.; Watanabe, Daisuke; Bronson, Roderick T.; Lifson, Jeffrey D.; Rosati, Margherita; Pavlakis, George N.; Felber, Barbara K.; Knipe, David M.; Desrosiers, Ronald C.


    The immunogenicity and protective capacity of replication-defective herpes simplex virus (HSV) vector-based vaccines were examined in rhesus macaques. Three macaques were inoculated with recombinant HSV vectors expressing Gag, Env, and a Tat-Rev-Nef fusion protein of simian immunodeficiency virus (SIV). Three other macaques were primed with recombinant DNA vectors expressing Gag, Env, and a Pol-Tat-Nef-Vif fusion protein prior to boosting with the HSV vectors. Robust anti-Gag and anti-Env cellular responses were detected in all six macaques. Following intravenous challenge with wild-type, cloned SIV239, peak and 12-week plasma viremia levels were significantly lower in vaccinated compared to control macaques. Plasma SIV RNA in vaccinated macaques was inversely correlated with anti-Rev ELISPOT responses on the day of challenge (P value < 0.05), anti-Tat ELISPOT responses at 2 weeks post challenge (P value < 0.05) and peak neutralizing antibody titers pre-challenge (P value 0.06). These findings support continued study of recombinant herpesviruses as a vaccine approach for AIDS

  6. Modeling DNA affinity landscape through two-round support vector regression with weighted degree kernels

    Wang, Xiaolei


    Background: A quantitative understanding of interactions between transcription factors (TFs) and their DNA binding sites is key to the rational design of gene regulatory networks. Recent advances in high-throughput technologies have enabled high-resolution measurements of protein-DNA binding affinity. Importantly, such experiments revealed the complex nature of TF-DNA interactions, whereby the effects of nucleotide changes on the binding affinity were observed to be context dependent. A systematic method to give high-quality estimates of such complex affinity landscapes is, thus, essential to the control of gene expression and the advance of synthetic biology. Results: Here, we propose a two-round prediction method that is based on support vector regression (SVR) with weighted degree (WD) kernels. In the first round, a WD kernel with shifts and mismatches is used with SVR to detect the importance of subsequences with different lengths at different positions. The subsequences identified as important in the first round are then fed into a second WD kernel to fit the experimentally measured affinities. To our knowledge, this is the first attempt to increase the accuracy of the affinity prediction by applying two rounds of string kernels and by identifying a small number of crucial k-mers. The proposed method was tested by predicting the binding affinity landscape of Gcn4p in Saccharomyces cerevisiae using datasets from HiTS-FLIP. Our method explicitly identified important subsequences and showed significant performance improvements when compared with other state-of-the-art methods. Based on the identified important subsequences, we discovered two surprisingly stable 10-mers and one sensitive 10-mer which were not reported before. Further test on four other TFs in S. cerevisiae demonstrated the generality of our method. Conclusion: We proposed in this paper a two-round method to quantitatively model the DNA binding affinity landscape. Since the ability to modify

  7. Immune protection of nonhuman primates against Ebola virus with single low-dose adenovirus vectors encoding modified GPs

    Sullivan, Nancy J.; Geisbert, Thomas W.; Geisbert, Joan B.; Shedlock, Devon J.; Xu, Ling; Lamoreaux, Laurie; Custers, Jerome H. H. V.; Popernack, Paul M.; Yang, Zhi-Yong; Pau, Maria G.; Roederer, Mario; Koup, Richard A.; Goudsmit, Jaap; Jahrling, Peter B.; Nabel, Gary J.


    BACKGROUND: Ebola virus causes a hemorrhagic fever syndrome that is associated with high mortality in humans. In the absence of effective therapies for Ebola virus infection, the development of a vaccine becomes an important strategy to contain outbreaks. Immunization with DNA and/or

  8. Strategies to enhance immunogenicity of cDNA vaccine encoded antigens by modulation of antigen processing

    Platteel, Anouk C M; Marit de Groot, A; Andersen, Peter; Ovaa, Huib; Kloetzel, Peter M; Mishto, Michele; Sijts, Alice J A M


    Most vaccines are based on protective humoral responses while for intracellular pathogens CD8(+) T cells are regularly needed to provide protection. However, poor processing efficiency of antigens is often a limiting factor in CD8(+) T cell priming, hampering vaccine efficacy. The multistage cDNA

  9. Diverse replication-associated protein encoding circular DNA viruses in guano samples of Central-Eastern European bats.

    Kemenesi, Gábor; Kurucz, Kornélia; Zana, Brigitta; Földes, Fanni; Urbán, Péter; Vlaschenko, Anton; Kravchenko, Kseniia; Budinski, Ivana; Szodoray-Parádi, Farkas; Bücs, Szilárd; Jére, Csaba; Csősz, István; Szodoray-Parádi, Abigél; Estók, Péter; Görföl, Tamás; Boldogh, Sándor; Jakab, Ferenc


    Circular replication-associated protein encoding single-stranded DNA (CRESS DNA) viruses are increasingly recognized worldwide in a variety of samples. Representative members include well-described veterinary pathogens with worldwide distribution, such as porcine circoviruses or beak and feather disease virus. In addition, numerous novel viruses belonging to the family Circoviridae with unverified pathogenic roles have been discovered in different human samples. Viruses of the family Genomoviridae have also been described as being highly abundant in different faecal and environmental samples, with case reports showing them to be suspected pathogens in human infections. In order to investigate the genetic diversity of these viruses in European bat populations, we tested guano samples from Georgia, Hungary, Romania, Serbia and Ukraine. This resulted in the detection of six novel members of the family Circoviridae and two novel members of the family Genomoviridae. Interestingly, a gemini-like virus, namely niminivirus, which was originally found in raw sewage samples in Nigeria, was also detected in our samples. We analyzed the nucleotide composition of members of the family Circoviridae to determine the possible host origins of these viruses. This study provides the first dataset on CRESS DNA viruses of European bats, and members of several novel viral species were discovered.

  10. Quantitative PCR is a Valuable Tool to Monitor the Performance of DNA-Encoded Chemical Library Selections.

    Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario


    Phage-display libraries and DNA-encoded chemical libraries (DECLs) represent useful tools for the isolation of specific binding molecules from large combinatorial sets of compounds. With both methods, specific binders are recovered at the end of affinity capture procedures by using target proteins of interest immobilized on a solid support. However, although the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DECL selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency by using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provided rapid information about the performance of selections, thus facilitating the optimization of experimental conditions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Characterization of Recombinant Thermococcus kodakaraensis (KOD) DNA Polymerases Produced Using Silkworm-Baculovirus Expression Vector System

    Yamashita, Mami; Xu, Jian; Morokuma, Daisuke; Hirata, Kazuma; Hino, Masato; Mon, Hiroaki; Takahashi, Masateru; Hamdan, Samir; Sakashita, Kosuke; Iiyama, Kazuhiro; Banno, Yutaka; Kusakabe, Takahiro; Lee, Jae Man


    The KOD DNA polymerase from Thermococcus kodakarensis (Tkod-Pol) has been preferred for PCR due to its rapid elongation rate, extreme thermostability and outstanding fidelity. Here in this study, we utilized silkworm-baculovirus expression vector system (silkworm-BEVS) to express the recombinant Tkod-Pol (rKOD) with N-terminal (rKOD-N) or C-terminal (rKOD-C) tandem fusion tags. By using BEVS, we produced functional rKODs with satisfactory yields, about 1.1 mg/larva for rKOD-N and 0.25 mg/larva for rKOD-C, respectively. Interestingly, we found that rKOD-C shows higher thermostability at 95 °C than that of rKOD-N, while that rKOD-N is significantly unstable after exposing to long period of heat-shock. We also assessed the polymerase activity as well as the fidelity of purified rKODs under various conditions. Compared with commercially available rKOD, which is expressed in E. coli expression system, rKOD-C exhibited almost the same PCR performance as the commercial rKOD did, while rKOD-N did lower performance. Taken together, our results suggested that silkworm-BEVS can be used to express and purify efficient rKOD in a commercial way.

  12. Characterization of Recombinant Thermococcus kodakaraensis (KOD) DNA Polymerases Produced Using Silkworm-Baculovirus Expression Vector System

    Yamashita, Mami


    The KOD DNA polymerase from Thermococcus kodakarensis (Tkod-Pol) has been preferred for PCR due to its rapid elongation rate, extreme thermostability and outstanding fidelity. Here in this study, we utilized silkworm-baculovirus expression vector system (silkworm-BEVS) to express the recombinant Tkod-Pol (rKOD) with N-terminal (rKOD-N) or C-terminal (rKOD-C) tandem fusion tags. By using BEVS, we produced functional rKODs with satisfactory yields, about 1.1 mg/larva for rKOD-N and 0.25 mg/larva for rKOD-C, respectively. Interestingly, we found that rKOD-C shows higher thermostability at 95 °C than that of rKOD-N, while that rKOD-N is significantly unstable after exposing to long period of heat-shock. We also assessed the polymerase activity as well as the fidelity of purified rKODs under various conditions. Compared with commercially available rKOD, which is expressed in E. coli expression system, rKOD-C exhibited almost the same PCR performance as the commercial rKOD did, while rKOD-N did lower performance. Taken together, our results suggested that silkworm-BEVS can be used to express and purify efficient rKOD in a commercial way.

  13. Prime-boost vaccination with heterologous live vectors encoding SIV gag and multimeric HIV-1 gp160 protein: efficacy against repeated mucosal R5 clade C SHIV challenges.

    Lakhashe, Samir K; Velu, Vijayakumar; Sciaranghella, Gaia; Siddappa, Nagadenahalli B; Dipasquale, Janet M; Hemashettar, Girish; Yoon, John K; Rasmussen, Robert A; Yang, Feng; Lee, Sandra J; Montefiori, David C; Novembre, Francis J; Villinger, François; Amara, Rama Rao; Kahn, Maria; Hu, Shiu-Lok; Li, Sufen; Li, Zhongxia; Frankel, Fred R; Robert-Guroff, Marjorie; Johnson, Welkin E; Lieberman, Judy; Ruprecht, Ruth M


    We sought to induce primate immunodeficiency virus-specific cellular and neutralizing antibody (nAb) responses in rhesus macaques (RM) through a bimodal vaccine approach. RM were immunized intragastrically (i.g.) with the live-attenuated Listeria monocytogenes (Lm) vector Lmdd-BdopSIVgag encoding SIVmac239 gag. SIV Gag-specific cellular responses were boosted by intranasal and intratracheal administration of replication-competent adenovirus (Ad5hr-SIVgag) encoding the same gag. To broaden antiviral immunity, the RM were immunized with multimeric HIV clade C (HIV-C) gp160 and HIV Tat. SIV Gag-specific cellular immune responses and HIV-1 nAb developed in some RM. The animals were challenged intrarectally with five low doses of R5 SHIV-1157ipEL-p, encoding a heterologous HIV-C Env (22.1% divergent to the Env immunogen). All five controls became viremic. One out of ten vaccinees was completely protected and another had low peak viremia. Sera from the completely and partially protected RM neutralized the challenge virus > 90%; these RM also had strong SIV Gag-specific proliferation of CD8⁺ T cells. Peak and area under the curve of plasma viremia (during acute phase) among vaccinees was lower than for controls, but did not attain significance. The completely protected RM showed persistently low numbers of the α4β7-expressing CD4⁺ T cells; the latter have been implicated as preferential virus targets in vivo. Thus, vaccine-induced immune responses and relatively lower numbers of potential target cells were associated with protection. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp. Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B

    Caroline Chénard


    Full Text Available Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages.

  15. Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

    Harper, J.F.; Surowy, T.K.; Sussman, M.R.


    In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

  16. Virus neutralizing antibody response in mice and dogs with a bicistronic DNA vaccine encoding rabies virus glycoprotein and canine parvovirus VP2.

    Patial, Sonika; Chaturvedi, V K; Rai, A; Saini, M; Chandra, Rajesh; Saini, Y; Gupta, Praveen K


    A bicistronic DNA vaccine against rabies and parvovirus infection of dogs was developed by subcloning rabies glycoprotein and canine parvovirus (CPV) VP2 genes into a bicistronic vector. After characterizing the expression of both the proteins in vitro, the bicistronic DNA vaccine was injected in mice and induced immune response was compared with monocistronic DNA vaccines. There was no significant difference in ELISA and virus neutralizing (VN) antibody responses against rabies and CPV in mice immunized with either bicistronic or monocistronic DNA vaccine. Further, there was significantly similar protection in mice immunized with either bicistronic or monocistronic rabies DNA vaccine on rabies virus challenge. Similarly, dogs immunized with monocistronic and bicistronic DNA vaccines developed comparable VN antibodies against rabies and CPV. This study indicated that bicistronic DNA vaccine can be used in dogs to induce virus neutralizing immune responses against both rabies and CPV.

  17. repDNA: a Python package to generate various modes of feature vectors for DNA sequences by incorporating user-defined physicochemical properties and sequence-order effects.

    Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen


    In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at or Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  18. A plastome mutation affects processing of both chloroplast and nuclear DNA-encoded plastid proteins.

    Johnson, E M; Schnabelrauch, L S; Sears, B B


    Immunoblotting of a chloroplast mutant (pm7) of Oenothera showed that three proteins, cytochrome f and the 23 kDa and 16 kDa subunits of the oxygen-evolving subcomplex of photosystem II, were larger than the corresponding mature proteins of the wild type and, thus, appear to be improperly processed in pm7. The mutant is also chlorotic and has little or no internal membrane development in the plastids. The improperly processed proteins, and other proteins that are completely missing, represent products of both the plastid and nuclear genomes. To test for linkage of these defects, a green revertant of pm7 was isolated from cultures in which the mutant plastids were maintained in a nuclear background homozygous for the plastome mutator (pm) gene. In this revertant, all proteins analyzed co-reverted to the wild-type condition, indicating that a single mutation in a plastome gene is responsible for the complex phenotype of pm7. These results suggest that the defect in pm7 lies in a gene that affects a processing protease encoded in the chloroplast genome.

  19. Immunogenicity and protective efficacy of Semliki forest virus replicon-based DNA vaccines encoding goatpox virus structural proteins

    Zheng Min; Jin Ningyi; Liu Qi; Huo Xiaowei; Li Yang; Hu Bo; Ma Haili; Zhu Zhanbo; Cong Yanzhao; Li Xiao; Jin Minglan; Zhu Guangze


    Goatpox, caused by goatpox virus (GTPV), is an acute feverish and contagious disease in goats often associated with high morbidity and high mortality. To resolve potential safety risks and vaccination side effects of existing live attenuated goatpox vaccine (AV41), two Semliki forest virus (SFV) replicon-based bicistronic expression DNA vaccines (pCSm-AAL and pCSm-BAA) which encode GTPV structural proteins corresponding to the Vaccinia virus proteins A27, L1, A33, and B5, respectively, were constructed. Then, theirs ability to induce humoral and cellular response in mice and goats, and protect goats against virulent virus challenge were evaluated. The results showed that, vaccination with pCSm-AAL and pCSm-BAA in combination could elicit strong humoral and cellular responses in mice and goats, provide partial protection against viral challenge in goats, and reduce disease symptoms. Additionally, priming vaccination with the above-mentioned DNA vaccines could significantly reduce the goats' side reactions from boosting vaccinations with current live vaccine (AV41), which include skin lesions at the inoculation site and fevers. Data obtained in this study could not only facilitate improvement of the current goatpox vaccination strategy, but also provide valuable guidance to suitable candidates for evaluation and development of orthopoxvirus vaccines.

  20. Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

    Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.


    The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

  1. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario


    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  2. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten


    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  3. DNA Minicircle Technology Improves Purity of Adeno-associated Viral Vector Preparations

    Maria Schnödt


    Full Text Available Adeno-associated viral (AAV vectors are considered as one of the most promising delivery systems in human gene therapy. In addition, AAV vectors are frequently applied tools in preclinical and basic research. Despite this success, manufacturing pure AAV vector preparations remains a difficult task. While empty capsids can be removed from vector preparations owing to their lower density, state-of-the-art purification strategies as of yet failed to remove antibiotic resistance genes or other plasmid backbone sequences. Here, we report the development of minicircle (MC constructs to replace AAV vector and helper plasmids for production of both, single-stranded (ss and self-complementary (sc AAV vectors. As bacterial backbone sequences are removed during MC production, encapsidation of prokaryotic plasmid backbone sequences is avoided. This is of particular importance for scAAV vector preparations, which contained an unproportionally high amount of plasmid backbone sequences (up to 26.1% versus up to 2.9% (ssAAV. Replacing standard packaging plasmids by MC constructs not only allowed to reduce these contaminations below quantification limit, but in addition improved transduction efficiencies of scAAV preparations up to 30-fold. Thus, MC technology offers an easy to implement modification of standard AAV packaging protocols that significantly improves the quality of AAV vector preparations.

  4. MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

    Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

    particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...

  5. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.


    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  6. scsB, a cDNA encoding the hydrogenosomal beta subunit of succinyl-CoA synthetase from the anaerobic fungus Neocallimastix frontalis

    Brondijk, THC; Durand, R; vanderGiezen, M; Gottschal, JC; Prins, RA; Fevre, M


    A clone containing a Neocallimastix frontalis cDNA assumed to encode the beta subunit of succinyl-CoA synthetase (SCSB) was identified by sequence homology with prokaryotic and eukaryotic counterparts. An open reading frame of 1311 bp was found. The deduced 437 amino acid sequence showed a high

  7. Induction of cytotoxic T-cell responses by gene gun DNA vaccination with minigenes encoding influenza A virus HA and NP CTL-epitopes

    Fomsgaard, A; Nielsen, H V; Kirkby, N


    degree of controllability. We have examined the induction of murine CTL's by this approach using DNA plasmid minigene vaccines encoding known mouse K(k) minimal CTL epitopes (8 amino acids) from the influenza A virus hemagglutinin and nucleoprotein. We here report that such an approach is feasible...

  8. Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids.

    Gerasimenko, Irina; Sheludko, Yuri; Ma, Xueyan; Stöckigt, Joachim


    Strictosidine glucosidase (SG) is an enzyme that catalyses the second step in the biosynthesis of various classes of monoterpenoid indole alkaloids. Based on the comparison of cDNA sequences of SG from Catharanthus roseus and raucaffricine glucosidase (RG) from Rauvolfia serpentina, primers for RT-PCR were designed and the cDNA encoding SG was cloned from R. serpentina cell suspension cultures. The active enzyme was expressed in Escherichia coli and purified to homogeneity. Analysis of its deduced amino-acid sequence assigned the SG from R. serpentina to family 1 of glycosyl hydrolases. In contrast to the SG from C. roseus, the enzyme from R. serpentina is predicted to lack an uncleavable N-terminal signal sequence, which is believed to direct proteins to the endoplasmic reticulum. The temperature and pH optimum, enzyme kinetic parameters and substrate specificity of the heterologously expressed SG were studied and compared to those of the C. roseus enzyme, revealing some differences between the two glucosidases. In vitro deglucosylation of strictosidine by R. serpentina SG proceeds by the same mechanism as has been shown for the C. roseus enzyme preparation. The reaction gives rise to the end product cathenamine and involves 4,21-dehydrocorynantheine aldehyde as an intermediate. The enzymatic hydrolysis of dolichantoside (Nbeta-methylstrictosidine) leads to several products. One of them was identified as a new compound, 3-isocorreantine A. From the data it can be concluded that the divergence of the biosynthetic pathways leading to different classes of indole alkaloids formed in R. serpentina and C. roseus cell suspension cultures occurs at a later stage than strictosidine deglucosylation.

  9. Constructing of DNA vectors with controlled nanosize and single dispersion by block copolymer coating gold nanoparticles as template assembly

    Li, Junbo, E-mail: [Henan University of Science and Technology, School of Chemical Engineering and Pharmaceutics (China); Wu, Wenlan [Henan University of Science and Technology, School of Medicine (China); Gao, Jiayu; Liang, Ju; Zhou, Huiyun; Liang, Lijuan [Henan University of Science and Technology, School of Chemical Engineering and Pharmaceutics (China)


    Synthesized vectors with nanoscale size and stable colloid dispersion are highly desirable for improving gene delivery efficiency. Here, a core-shell template particle was constructed with polyethylene glycol-b-poly1-(3-aminopropyl)-3-(2-methacryloyloxy propylimidazolium bromine) (PEG-b-PAMPImB) coating gold nanoparticles (PEG-b-PAMPImB-@-Au NPs) for loading DNA and delivering in vitro. Data from transmission electron microscopy (TEM) and dynamic light scattering (DLS) suggest that these nanoplexes, by forming an electrostatic complex with DNA at the inner PAMPImB shell, offer steric protection for the outer PEG corona leading to single dispersion and small size. Notably, higher colloid stability and lower cytotoxicity were achieved with these nanoplexes when compared with PAMPImB monolayer-coated gold nanoparticles (Au NPs). Confocal laser scanning microscopy and intracellular trafficking TEM further indicate that the nanoplexes can translocate across the cell membrane and partly enter the nucleus for high efficient expression. Thus, template assembly represents a promising approach to control the size and colloid stability of gene vectors and ensure safety and efficiency of DNA delivery.

  10. Constructing of DNA vectors with controlled nanosize and single dispersion by block copolymer coating gold nanoparticles as template assembly

    Li, Junbo; Wu, Wenlan; Gao, Jiayu; Liang, Ju; Zhou, Huiyun; Liang, Lijuan


    Synthesized vectors with nanoscale size and stable colloid dispersion are highly desirable for improving gene delivery efficiency. Here, a core-shell template particle was constructed with polyethylene glycol- b-poly1-(3-aminopropyl)-3-(2-methacryloyloxy propylimidazolium bromine) (PEG- b-PAMPImB) coating gold nanoparticles (PEG- b-PAMPImB-@-Au NPs) for loading DNA and delivering in vitro. Data from transmission electron microscopy (TEM) and dynamic light scattering (DLS) suggest that these nanoplexes, by forming an electrostatic complex with DNA at the inner PAMPImB shell, offer steric protection for the outer PEG corona leading to single dispersion and small size. Notably, higher colloid stability and lower cytotoxicity were achieved with these nanoplexes when compared with PAMPImB monolayer-coated gold nanoparticles (Au NPs). Confocal laser scanning microscopy and intracellular trafficking TEM further indicate that the nanoplexes can translocate across the cell membrane and partly enter the nucleus for high efficient expression. Thus, template assembly represents a promising approach to control the size and colloid stability of gene vectors and ensure safety and efficiency of DNA delivery.

  11. Covalently bound DNA on naked iron oxide nanoparticles: Intelligent colloidal nano-vector for cell transfection.

    Magro, Massimiliano; Martinello, Tiziana; Bonaiuto, Emanuela; Gomiero, Chiara; Baratella, Davide; Zoppellaro, Giorgio; Cozza, Giorgio; Patruno, Marco; Zboril, Radek; Vianello, Fabio


    Conversely to common coated iron oxide nanoparticles, novel naked surface active maghemite nanoparticles (SAMNs) can covalently bind DNA. Plasmid (pDNA) harboring the coding gene for GFP was directly chemisorbed onto SAMNs, leading to a novel DNA nanovector (SAMN@pDNA). The spontaneous internalization of SAMN@pDNA into cells was compared with an extensively studied fluorescent SAMN derivative (SAMN@RITC). Moreover, the transfection efficiency of SAMN@pDNA was evaluated and explained by computational model. SAMN@pDNA was prepared and characterized by spectroscopic and computational methods, and molecular dynamic simulation. The size and hydrodynamic properties of SAMN@pDNA and SAMN@RITC were studied by electron transmission microscopy, light scattering and zeta-potential. The two nanomaterials were tested by confocal scanning microscopy on equine peripheral blood-derived mesenchymal stem cells (ePB-MSCs) and GFP expression by SAMN@pDNA was determined. Nanomaterials characterized by similar hydrodynamic properties were successfully internalized and stored into mesenchymal stem cells. Transfection by SAMN@pDNA occurred and GFP expression was higher than lipofectamine procedure, even in the absence of an external magnetic field. A computational model clarified that transfection efficiency can be ascribed to DNA availability inside cells. Direct covalent binding of DNA on naked magnetic nanoparticles led to an extremely robust gene delivery tool. Hydrodynamic and chemical-physical properties of SAMN@pDNA were responsible of the successful uptake by cells and of the efficiency of GFP gene transfection. SAMNs are characterized by colloidal stability, excellent cell uptake, persistence in the host cells, low toxicity and are proposed as novel intelligent DNA nanovectors for efficient cell transfection. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Comparative Analysis of Repetitive DNA between the Main Vectors of Chagas Disease: Triatoma infestans and Rhodnius prolixus.

    Pita, Sebastián; Mora, Pablo; Vela, Jesús; Palomeque, Teresa; Sánchez, Antonio; Panzera, Francisco; Lorite, Pedro


    Chagas disease or American trypanosomiasis affects six to seven million people worldwide, mostly in Latin America. This disease is transmitted by hematophagous insects known as "kissing bugs" (Hemiptera, Triatominae), with Triatoma infestans and Rhodnius prolixus being the two most important vector species. Despite the fact that both species present the same diploid chromosome number (2 n = 22), they have remarkable differences in their total DNA content, chromosome structure and genome organization. Variations in the DNA genome size are expected to be due to differences in the amount of repetitive DNA sequences. The T. infestans genome-wide analysis revealed the existence of 42 satellite DNA families. BLAST searches of these sequences against the R. prolixus genome assembly revealed that only four of these satellite DNA families are shared between both species, suggesting a great differentiation between the Triatoma and Rhodnius genomes. Fluorescence in situ hybridization (FISH) location of these repetitive DNAs in both species showed that they are dispersed on the euchromatic regions of all autosomes and the X chromosome. Regarding the Y chromosome, these common satellite DNAs are absent in T. infestans but they are present in the R. prolixus Y chromosome. These results support a different origin and/or evolution in the Y chromosome of both species.

  13. Discovery of cofactor-specific, bactericidal Mycobacterium tuberculosis InhA inhibitors using DNA-encoded library technology.

    Soutter, Holly H; Centrella, Paolo; Clark, Matthew A; Cuozzo, John W; Dumelin, Christoph E; Guie, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Kennedy, Kaitlyn M; Sigel, Eric A; Troast, Dawn M; Zhang, Ying; Ferguson, Andrew D; Davies, Gareth; Stead, Eleanor R; Breed, Jason; Madhavapeddi, Prashanti; Read, Jon A


    Millions of individuals are infected with and die from tuberculosis (TB) each year, and multidrug-resistant (MDR) strains of TB are increasingly prevalent. As such, there is an urgent need to identify novel drugs to treat TB infections. Current frontline therapies include the drug isoniazid, which inhibits the essential NADH-dependent enoyl-acyl-carrier protein (ACP) reductase, InhA. To inhibit InhA, isoniazid must be activated by the catalase-peroxidase KatG. Isoniazid resistance is linked primarily to mutations in the katG gene. Discovery of InhA inhibitors that do not require KatG activation is crucial to combat MDR TB. Multiple discovery efforts have been made against InhA in recent years. Until recently, despite achieving high potency against the enzyme, these efforts have been thwarted by lack of cellular activity. We describe here the use of DNA-encoded X-Chem (DEX) screening, combined with selection of appropriate physical properties, to identify multiple classes of InhA inhibitors with cell-based activity. The utilization of DEX screening allowed the interrogation of very large compound libraries (10 11 unique small molecules) against multiple forms of the InhA enzyme in a multiplexed format. Comparison of the enriched library members across various screening conditions allowed the identification of cofactor-specific inhibitors of InhA that do not require activation by KatG, many of which had bactericidal activity in cell-based assays.

  14. Loss of long term protection with the inclusion of HIV pol to a DNA vaccine encoding gag.

    Garrod, Tamsin J; Gargett, Tessa; Yu, Wenbo; Major, Lee; Burrell, Christopher J; Wesselingh, Steven; Suhrbier, Andreas; Grubor-Bauk, Branka; Gowans, Eric J


    Traditional vaccine strategies that induce antibody responses have failed to protect against HIV infection in clinical trials, and thus cell-mediated immunity is now an additional criterion. Recent clinical trials that aimed to induce strong T cell responses failed to do so. Therefore, to enhance induction of protective T cell responses, it is crucial that the optimum antigen combination is chosen. Limited research has been performed into the number of antigens selected for an HIV vaccine. This study aimed to compare DNA vaccines encoding either a single HIV antigen or a combination of two antigens, using intradermal vaccination of C57BL/6 mice. Immune assays were performed on splenocytes, and in vivo protection was examined by challenge with a chimeric virus, EcoHIV, able to infect mouse but not human leukocytes, at 10 days (short term) and 60 days (long term) post final vaccination. At 60 days there was significantly lower frequency of induced antigen-specific CD8(+) T cells in the spleens of pCMVgag-pol-vaccinated mice compared with mice which received pCMVgag only. Most importantly, short term viral control of EcoHIV was similar for pCMVgag and pCMVgag-pol-vaccinated mice at day 10, but only the pCMVgag-vaccinated significantly controlled EcoHIV at day 60 compared with pCMV-vaccinated mice, showing that control was reduced with the inclusion of the HIV pol gene. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. ARG1 (altered response to gravity) encodes a DnaJ-like protein that potentially interacts with the cytoskeleton

    Sedbrook, J. C.; Chen, R.; Masson, P. H.


    Gravitropism allows plant organs to direct their growth at a specific angle from the gravity vector, promoting upward growth for shoots and downward growth for roots. Little is known about the mechanisms underlying gravitropic signal transduction. We found that mutations in the ARG1 locus of Arabidopsis thaliana alter root and hypocotyl gravitropism without affecting phototropism, root growth responses to phytohormones or inhibitors of auxin transport, or starch accumulation. The positional cloning of ARG1 revealed a DnaJ-like protein containing a coiled-coil region homologous to coiled coils found in cytoskeleton-interacting proteins. These data suggest that ARG1 participates in a gravity-signaling process involving the cytoskeleton. A combination of Northern blot studies and analysis of ARG1-GUS fusion-reporter expression in transgenic plants demonstrated that ARG1 is expressed in all organs. Ubiquitous ARG1 expression in Arabidopsis and the identification of an ortholog in Caenorhabditis elegans suggest that ARG1 is involved in other essential processes.

  16. Development of a gene silencing DNA vector derived from a broad host range geminivirus

    Hancock Leandria C


    Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

  17. Construction of a new shuttle vector for DNA delivery into mammalian cells using non-invasive Lactococcus lactis.

    Yagnik, Bhrugu; Padh, Harish; Desai, Priti


    Use of food grade Lactococcus lactis (L. lactis) is fast emerging as a safe alternative for delivery of DNA vaccine. To attain efficient DNA delivery, L. lactis, a non-invasive bacterium is converted to invasive strain either by expressing proteins like Internalin A (InlA) or Fibronectin binding protein A (FnBPA) or through chemical treatments. However the safety status of invasive L. lactis is questionable. In the present report, we have shown that non-invasive L. lactis efficiently delivered the newly constructed reporter plasmid pPERDBY to mammalian cells without any chemical enhancers. The salient features of the vector are; I) Ability to replicate in two different hosts; Escherichia coli (E. coli) and Lactic Acid Bacteria (LAB), II) One of the smallest reporter plasmid for DNA vaccine, III) Enhanced Green Fluorescence Protein (EGFP) linked to Multiple Cloning Site (MCS), IV) Immunostimulatory CpG motifs functioning as an adjuvant. Expression of EGFP in pPERDBY transfected CHO-K1 and Caco-2 cells demonstrates its functionality. Non-invasive r-L. lactis was found efficient in delivering pPERDBY to Caco-2 cells. The in vitro data presented in this article supports the hypothesis that in the absence of invasive proteins or relevant chemical treatment, L. lactis was found efficient in delivering DNA to mammalian cells. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  18. Assessment of a DNA vaccine encoding an anchored-glycosylphosphatidylinositol tegumental antigen complexed to protamine sulphate on immunoprotection against murine schistosomiasis

    Eduardo JM Nascimento


    Full Text Available Protamine sulphate/DNA complexes have been shown to protect DNA from DNase digestion in a lipid system for gene transfer. A DNA-based vaccine complexed to protamine sulphate was used to induce an immune response against Schistosoma mansoni anchored-glycosylphosphatidylinositol tegumental antigen in BALB/c mice. The protection elicited ranged from 33 to 44%. The spectrum of the elicited immune response induced by the vaccine formulation without protamine was characterized by a high level of IgG (IgG1> IgG2a. Protamine sulphate added to the DNA vaccine formulation retained the green fluorescent protein encoding-plasmid longer in muscle and spleen. The experiments in vivo showed that under protamine sulphate effect, the scope of protection remained unchanged, but a modulation in antibody production (IgG1= IgG2a was observed.

  19. Longevity of rAAV vector and plasmid DNA in blood after intramuscular injection in nonhuman primates: implications for gene doping.

    Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O


    Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.

  20. Modeling DNA affinity landscape through two-round support vector regression with weighted degree kernels

    Wang, Xiaolei; Kuwahara, Hiroyuki; Gao, Xin


    high-quality estimates of such complex affinity landscapes is, thus, essential to the control of gene expression and the advance of synthetic biology. Results: Here, we propose a two-round prediction method that is based on support vector regression

  1. Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

    Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W


    A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

  2. Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

    Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.


    A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

  3. Molecular cloning and characterization of the full-length cDNA encoding the tree shrew (tupaia belangeri) CD28

    Huang, Xiaoyan; Yan, Yan; Wang, Sha; Wang, Qinying; Shi, Jian; Shao, Zhanshe; Dai, Jiejie


    CD28 is one of the most important co-stimulatory molecules expressed by naive and primed T cells. The tree shrews (Tupaia belangeri), as an ideal animal model for analyzing mechanism of human diseases receiving extensive attentions, demands essential research tools, in particular in the study of cellular markers and monoclonal antibodies for immunological studies. However, little is known about tree shrew CD28 (tsCD28) until now. In this study, a 663 bp of the full-length CD28 cDNA, encoding a polypeptide of 220 amino acids was cloned from tree shrew spleen lymphocytes. The nucleotide sequence of the tsCD28 showed 85%, 76%, and 75% similarities with human, rat, and mouse, respectively, which showed the affinity relationship between tree shrew and human is much closer than between human and rodents. The open reading frame (ORF) sequence of tsCD28 gene was predicted to be in correspondence with the signal sequence, immunoglobulin variable-like (IgV) domain, transmembrane domain and cytoplasmic tail, respectively.We also analyzed its molecular characteristics with other mammals by using biology software such as Clustal W 2.0 and so forth. Our results showed that tsCD28 contained many features conserved in CD28 genes from other mammals, including conserved signal peptide and glycosylation sites, and several residues responsible for binding to the CD28R, and the tsCD28 amino acid sequence were found a close genetic relationship with human and monkey. The crystal structure and surface charge revealed most regions of tree shrew CD28 molecule surface charges are similar as human. However, compared with human CD28 (hCD28) regions, in some areas, the surface positive charge of tsCD28 was less than hCD28, which may affect antibody binding. The present study is the first report of cloning and characterization of CD28 in tree shrew. This study provides a theoretical basis for the further study the structure and function of tree shrew CD28 and utilize tree shrew as an effective

  4. Polymeric nanoparticles as cancer-specific DNA delivery vectors to human hepatocellular carcinoma.

    Zamboni, Camila G; Kozielski, Kristen L; Vaughan, Hannah J; Nakata, Maisa M; Kim, Jayoung; Higgins, Luke J; Pomper, Martin G; Green, Jordan J


    Hepatocellular carcinoma (HCC) is the third most deadly cancer in the US, with a meager 5-year survival rate of effective and cancer-specific DNA delivery to human HCC using biodegradable poly(beta-amino ester) (PBAE) nanoparticles (NPs). Varied PBAE NP formulations were evaluated for transfection efficacy and cytotoxicity to a range of human HCC cells as well as healthy human hepatocytes. To address HCC heterogeneity, nine different sources of human HCC cells were utilized. The polymeric NPs composed of 2-((3-aminopropyl)amino) ethanol end-modified poly(1,5-pentanediol diacrylate-co-3-amino-1-propanol) ('536') at a 25 polymer-to-DNA weight-to-weight ratio led to high transfection efficacy to all of the liver cancer lines, but not to hepatocytes. Each individual HCC line had a significantly higher percentage of exogenous gene expression than the healthy liver cells (Peffective DNA transfection in vivo. PBAE-based NPs enabled high and preferential DNA delivery to HCC cells, sparing healthy hepatocytes. These biodegradable and liver cancer-selective NPs are a promising technology to deliver therapeutic genes to liver cancer. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Efficient method for extracting DNA of parasites causing bovine babesiosis from tick vectors

    The southern cattle tick, Rhipicephalus (Boophilus) microplus, is an economically important pest costing animal agriculture billions of dollars worldwide. This research focuses on a comparison of three different tick DNA extraction methods: phenol-chloroform extraction (method 1), a modified version...

  6. Is passive transmission of non-viral vectors through artificial insemination of sperm-DNA mixtures sufficient for chicken transgenesis?



    DNA uptake in the post-acrosomal region of the spermatozoa takes place exclusively in immotile spermatozoa that are naturally unable to fertilize eggs. The present study aimed to assess whether passive transmission of non-viral vectors to the surrounding areas of chicken embryos could be an alternate mechanism in chicken sperm-mediated gene transfer. First, the presence of nucleases in rooster seminal plasma was evaluated. Semen ejaculates from five roosters were centrifuged and the supernatant was incubated with pBL2 for 1 h. A robust nuclease cocktail was detected in the rooster semen. To overcome these nucleases, plasmid-TransIT combinations were incubated with semen for 1 h. Incubation of exogenous DNA in the lipoplex structure could considerably bypass the semen nuclease effect. Then, intravaginal insemination of 1 × 109 sperm mixed with lipoplexes (40 µg pBL2:40 µl TransIT) was carried out in 15 virgin hens. Neither the epithelial tissue from the inseminated female reproductive tracts nor the produced embryos following artificial insemination showed the transgene. To remove any bias in the transgene transmission possibility, the plasmid-TransIT admixture was directly injected in close vicinity of the embryos in newly laid eggs. Nonetheless, none of the produced fetuses or chicks carried the transgene. In conclusion, the results of the present study revealed a nuclease admixture in rooster seminal plasma, and passive/active transmission of the non-viral vector into close vicinity of the chicken embryo was inefficient for producing transgenic chicks. PMID:26935324

  7. Seasonality of sand flies (Diptera: Psychodidae) and Leishmania DNA detection in vector species in an area with endemic visceral leishmaniasis.

    Saraiva, Lara; Leite, Camila Gonçalves; Lima, Ana Cristina Vianna Mariano da Rocha; Carvalho, Luiz Otávio Alves de; Pereira, Agnes Antônia Sampaio; Rugani, Jerônimo Marteleto Nunes; Rego, Felipe Dutra; Gontijo, Célia Maria Ferreira; Andrade, José Dilermando


    Leishmaniases are a serious health problem in southeast Brazil, including the city of Belo Horizonte (BH), Minas Gerais state (MG), where there are high rates of incidence and mortality due to visceral leishmaniases. BH is divided into nine sanitary districts (SD) of which one, the Venda Nova SD, was selected for this study because it has high rates of positivity for canine leishmaniasis and high incidence of human leishmaniasis. This study aimed to survey the sand fly fauna in Venda Nova SD from August 2011 to July 2013 and perform a descriptive analysis of the vector population. The sampling was carried out using automatic HP light traps at all covered areas of the Venda Nova SD, in a total of eighteen light traps. Sampled specimens were identified following Galati (2003), and females were submitted to molecular techniques for the detection and identification of Leishmania DNA. A simple environmental description was done for it area and Kernel estimation was used to infer vector density for each study site. A total of 2,427 sand fly specimens belonging to eight species and five genera were collected of which 95.3% were Lutzomyia longipalpis. The seasonal variation curve was delineated by this species. Lu. longipalpis was the most abundant at all collection points and in all months of the study, and exhibited a natural infection rate of 1.01% for Leishmania infantum and 1.77% for Leishmania braziliensis. The results show the presence and adaptation of Lu. longipalpis to the anthropic environment of BH and reinforces its role as the main vector of L. infantum in the region.

  8. Seasonality of sand flies (Diptera: Psychodidae) and Leishmania DNA detection in vector species in an area with endemic visceral leishmaniasis

    Saraiva, Lara; Leite, Camila Gonçalves; Lima, Ana Cristina Vianna Mariano da Rocha; de Carvalho, Luiz Otávio Alves; Pereira, Agnes Antônia Sampaio; Rugani, Jerônimo Marteleto Nunes; Rego, Felipe Dutra; Gontijo, Célia Maria Ferreira; Andrade, José Dilermando


    BACKGROUND Leishmaniases are a serious health problem in southeast Brazil, including the city of Belo Horizonte (BH), Minas Gerais state (MG), where there are high rates of incidence and mortality due to visceral leishmaniases. BH is divided into nine sanitary districts (SD) of which one, the Venda Nova SD, was selected for this study because it has high rates of positivity for canine leishmaniasis and high incidence of human leishmaniasis. OBJECTIVES This study aimed to survey the sand fly fauna in Venda Nova SD from August 2011 to July 2013 and perform a descriptive analysis of the vector population. METHODS The sampling was carried out using automatic HP light traps at all covered areas of the Venda Nova SD, in a total of eighteen light traps. Sampled specimens were identified following Galati (2003), and females were submitted to molecular techniques for the detection and identification of Leishmania DNA. A simple environmental description was done for it area and Kernel estimation was used to infer vector density for each study site. FINDINGS A total of 2,427 sand fly specimens belonging to eight species and five genera were collected of which 95.3% were Lutzomyia longipalpis. The seasonal variation curve was delineated by this species. Lu. longipalpis was the most abundant at all collection points and in all months of the study, and exhibited a natural infection rate of 1.01% for Leishmania infantum and 1.77% for Leishmania braziliensis. MAIN CONCLUSIONS The results show the presence and adaptation of Lu. longipalpis to the anthropic environment of BH and reinforces its role as the main vector of L. infantum in the region. PMID:28327794

  9. Identification of species based on DNA barcode using k-mer feature vector and Random forest classifier.

    Meher, Prabina Kumar; Sahu, Tanmaya Kumar; Rao, A R


    DNA barcoding is a molecular diagnostic method that allows automated and accurate identification of species based on a short and standardized fragment of DNA. To this end, an attempt has been made in this study to develop a computational approach for identifying the species by comparing its barcode with the barcode sequence of known species present in the reference library. Each barcode sequence was first mapped onto a numeric feature vector based on k-mer frequencies and then Random forest methodology was employed on the transformed dataset for species identification. The proposed approach outperformed similarity-based, tree-based, diagnostic-based approaches and found comparable with existing supervised learning based approaches in terms of species identification success rate, while compared using real and simulated datasets. Based on the proposed approach, an online web interface SPIDBAR has also been developed and made freely available at for species identification by the taxonomists. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. AAV vector encoding human VEGF165-transduced pectineus muscular flaps increase the formation of new tissue through induction of angiogenesis in an in vivo chamber for tissue engineering: A technique to enhance tissue and vessels in microsurgically engineered tissue.

    Moimas, Silvia; Manasseri, Benedetto; Cuccia, Giuseppe; Stagno d'Alcontres, Francesco; Geuna, Stefano; Pattarini, Lucia; Zentilin, Lorena; Giacca, Mauro; Colonna, Michele R


    In regenerative medicine, new approaches are required for the creation of tissue substitutes, and the interplay between different research areas, such as tissue engineering, microsurgery and gene therapy, is mandatory. In this article, we report a modification of a published model of tissue engineering, based on an arterio-venous loop enveloped in a cross-linked collagen-glycosaminoglycan template, which acts as an isolated chamber for angiogenesis and new tissue formation. In order to foster tissue formation within the chamber, which entails on the development of new vessels, we wondered whether we might combine tissue engineering with a gene therapy approach. Based on the well-described tropism of adeno-associated viral vectors for post-mitotic tissues, a muscular flap was harvested from the pectineus muscle, inserted into the chamber and transduced by either AAV vector encoding human VEGF165 or AAV vector expressing the reporter gene β-galactosidase, as a control. Histological analysis of the specimens showed that muscle transduction by AAV vector encoding human VEGF165 resulted in enhanced tissue formation, with a significant increase in the number of arterioles within the chamber in comparison with the previously published model. Pectineus muscular flap, transduced by adeno-associated viral vectors, acted as a source of the proangiogenic factor vascular endothelial growth factor, thus inducing a consistent enhancement of vessel growth into the newly formed tissue within the chamber. In conclusion, our present findings combine three different research fields such as microsurgery, tissue engineering and gene therapy, suggesting and showing the feasibility of a mixed approach for regenerative medicine.

  11. Enhanced anti-tumor effect of a gene gun-delivered DNA vaccine encoding the human papillomavirus type 16 oncoproteins genetically fused to the herpes simplex virus glycoprotein D

    M.O. Diniz


    Full Text Available Anti-cancer DNA vaccines have attracted growing interest as a simple and non-invasive method for both the treatment and prevention of tumors induced by human papillomaviruses. Nonetheless, the low immunogenicity of parenterally administered vaccines, particularly regarding the activation of cytotoxic CD8+ T cell responses, suggests that further improvements in both vaccine composition and administration routes are still required. In the present study, we report the immune responses and anti-tumor effects of a DNA vaccine (pgD-E7E6E5 expressing three proteins (E7, E6, and E5 of the human papillomavirus type 16 genetically fused to the glycoprotein D of the human herpes simplex virus type 1, which was administered to mice by the intradermal (id route using a gene gun. A single id dose of pgD-E7E6E5 (2 µg/dose induced a strong activation of E7-specific interferon-γ (INF-γ-producing CD8+ T cells and full prophylactic anti-tumor effects in the vaccinated mice. Three vaccine doses inhibited tumor growth in 70% of the mice with established tumors. In addition, a single vaccine dose consisting of the co-administration of pgD-E7E6E5 and the vector encoding interleukin-12 or granulocyte-macrophage colony-stimulating factor further enhanced the therapeutic anti-tumor effects and conferred protection to 60 and 50% of the vaccinated mice, respectively. In conclusion, id administration of pgD-E7E6E5 significantly enhanced the immunogenicity and anti-tumor effects of the DNA vaccine, representing a promising administration route for future clinical trials.

  12. Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

    Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C


    Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

  13. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J


    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  14. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.


    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  15. Cloning vector

    Guilfoyle, Richard A.; Smith, Lloyd M.


    A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site.

  16. Cloning vector

    Guilfoyle, R.A.; Smith, L.M.


    A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site. 2 figures.

  17. Cloning and expression of DNA encoding a ripening form of a polypeptide having rhamno-galacturonase activity.

    Musters, W.; Stam, H.; Suykerbuyk, M.E.; Visser, J.; Verbakel, J.M.


    The invention relates to isolation of an Aspergillus gene encoding rhamnogalacturonase (RG-ase) and the construction of recombinant Aspergillus strains with overexpression of RG-ase. These strains can be used for the commercial production of RG-ase. RG-ase is an important enzyme in processes

  18. Cloning and molecular characterization of the salt-regulated jojoba ScRab cDNA encoding a small GTP-binding protein.

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy


    Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.

  19. A novel two T-DNA binary vector allows efficient generation of marker-free transgenic plants in three elite cultivars of rice (Oryza sativa L.).

    Breitler, Jean-Christophe; Meynard, Donaldo; Van Boxtel, Jos; Royer, Monique; Bonnot, François; Cambillau, Laurence; Guiderdoni, Emmanuel


    A pilot binary vector was constructed to assess the potential of the 2 T-DNA system for generating selectable marker-free progeny plants in three elite rice cultivars (ZhongZuo321, Ariete and Khao Dawk Mali 105) known to exhibit contrasting amenabilities to transformation. The first T-DNA of the vector, delimited by Agrobacterium tumefaciens borders, contains the hygromycin phosphotransferase (hpt) selectable gene and the green fluorescent protein (gfp) reporter gene while the second T-DNA, delimited by Agrobacterium rhizogenes borders, bears the phosphinothricin acetyl transferase (bar) gene, featuring the gene of interest. 82-90% of the hygromycin-resistant primary transformants exhibited tolerance to ammonium glufosinate mediated by the bar gene suggesting very high co-transformation frequency in the three cultivars. All of the regenerated plants were analyzed by Southern blot which confirmed co-integration of the T-DNAs at frequencies consistent with those of co-expression and allowed determination of copy number for each gene as well as detection of two different vector backbone fragments extending between the two T-DNAs. Hygromycin susceptible, ammonium glufosinate tolerant phenotypes represented 14.4, 17.4 and 14.3% of the plants in T1 progenies of ZZ321, Ariete and KDML105 primary transformants, respectively. We developed a statistical model for deducing from the observed copy number of each T-DNA in T0 plants and phenotypic segregations in T1 progenies the most likely constitution and linkage of the T-DNA integration locus. Statistical analysis identified in 40 out of 42 lines a most likely linkage configuration theoretically allowing genetic separation of the two T-DNA types and out segregation of the T-DNA bearing the bar gene. Overall, though improvements of the technology would be beneficial, the 2 T-DNA system appeared to be a useful approach to generate selectable marker-free rice plants with a consistent frequency among cultivars.

  20. Molecular cloning of the cDNA encoding follicle-stimulating hormone beta subunit of the Chinese soft-shell turtle Pelodiscus sinensis, and its gene expression.

    Chien, Jung-Tsun; Shen, San-Tai; Lin, Yao-Sung; Yu, John Yuh-Lin


    Follicle-stimulating hormone (FSH) is a member of the pituitary glycoprotein hormone family. These hormones are composed of two dissimilar subunits, alpha and beta. Very little information is available regarding the nucleotide and amino acid sequence of FSHbeta in reptilian species. For better understanding of the phylogenetic diversity and evolution of FSH molecule, we have isolated and sequenced the complementary DNA (cDNA) encoding the Chinese soft-shell turtle (Pelodiscus sinensis, Family of Trionychidae) FSHbeta precursor molecule by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end (RACE) methods. The cloned Chinese soft-shell turtle FSHbeta cDNA consists of 602-bp nucleotides, including 34-bp nucleotides of the 5'-untranslated region (UTR), 396-bp of the open reading frame, and 3'-UTR of 206-bp nucleotides. It encodes a 131-amino acid precursor molecule of FSHbeta subunit with a signal peptide of 20 amino acids followed by a mature protein of 111 amino acids. Twelve cysteine residues, forming six disulfide bonds within beta-subunit and two putative asparagine-linked glycosylation sites, are also conserved in the Chinese soft-shell turtle FSHbeta subunit. The deduced amino acid sequence of the Chinese soft-shell turtle FSHbeta shares identities of 97% with Reeves's turtle (Family of Bataguridae), 83-89% with birds, 61-70% with mammals, 63-66% with amphibians and 40-58% with fish. By contrast, when comparing the FSHbeta with the beta-subunits of the Chinese soft-shell turtle luteinizing hormone and thyroid stimulating hormone, the homologies are as low as 38 and 39%, respectively. A phylogenetic tree including reptilian species of FSHbeta subunits, is presented for the first time. Out of various tissues examined, FSHbeta mRNA was only expressed in the pituitary gland and can be up-regulated by gonadotropin-releasing hormone in pituitary tissue culture as estimated by fluorescence real-time PCR analysis.

  1. Immunization with a DNA vaccine encoding Toxoplasma gondii Superoxide dismutase (TgSOD) induces partial immune protection against acute toxoplasmosis in BALB/c mice.

    Liu, Yuan; Cao, Aiping; Li, Yawen; Li, Xun; Cong, Hua; He, Shenyi; Zhou, Huaiyu


    Toxoplasma gondii (T. gondii) is an obligate intracellular protozoan parasite that infects all warm-blooded animals including humans and causes toxoplasmosis. An effective vaccine could be an ideal choice for preventing and controlling toxoplasmosis. T. gondii Superoxide dismutase (TgSOD) might participate in affecting the intracellular growth of both bradyzoite and tachyzoite forms. In the present study, the TgSOD gene was used to construct a DNA vaccine (pEGFP-SOD). TgSOD gene was amplified and inserted into eukaryotic vector pEGFP-C1 and formed the DNA vaccine pEGFP-SOD. Then the BALB/c mice were immunized intramuscularly with the DNA vaccine and those injected with pEGFP-C1, PBS or nothing were treated as controls. Four weeks after the last immunization, all mouse groups followed by challenging intraperitoneally with tachyzoites of T. gondii ME49 strain. Results showed higher levels of total IgG, IgG2α in the sera and interferon gamma (IFN-γ) in the splenocytes from pEGFP-SOD inoculated mice than those unvaccinated, or inoculated with either empty plasmid vector or PBS. The proportions of CD4 + T cells and CD8 + T cells in the spleen from pEGFP-SOD inoculated mice were significantly (p < 0.05) increased compared to control groups. In addition, the survival time of mice immunized with pEGFP-SOD was significantly prolonged as compared to the controls (p < 0.05) although all the mice died. The present study revealed that the DNA vaccine triggered strong humoral and cellular immune responses, and aroused partial protective immunity against acute T. gondii infection in BALB/c mice. The collective data suggests the SOD may be a potential vaccine candidate for further development.

  2. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.


    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  3. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.


    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  4. Safety profile, efficacy, and biodistribution of a bicistronic high-capacity adenovirus vector encoding a combined immunostimulation and cytotoxic gene therapy as a prelude to a phase I clinical trial for glioblastoma

    Puntel, Mariana [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Ghulam, Muhammad A.K.M. [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Farrokhi, Catherine [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); VanderVeen, Nathan; Paran, Christopher; Appelhans, Ashley [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Kroeger, Kurt M.; Salem, Alireza [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Lacayo, Liliana [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Pechnick, Robert N. [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Department of Psychiatry and Behavioral Neurosciences, David Geffen School of Medicine, University of California, Los Angeles, CA (United States); Kelson, Kyle R.; Kaur, Sukhpreet; Kennedy, Sean [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Palmer, Donna; Ng, Philip [Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030 (United States); and others


    Adenoviral vectors (Ads) are promising gene delivery vehicles due to their high transduction efficiency; however, their clinical usefulness has been hampered by their immunogenicity and the presence of anti-Ad immunity in humans. We reported the efficacy of a gene therapy approach for glioma consisting of intratumoral injection of Ads encoding conditionally cytotoxic herpes simplex type 1 thymidine kinase (Ad-TK) and the immunostimulatory cytokine fms-like tyrosine kinase ligand 3 (Ad-Flt3L). Herein, we report the biodistribution, efficacy, and neurological and systemic effects of a bicistronic high-capacity Ad, i.e., HC-Ad-TK/TetOn-Flt3L. HC-Ads elicit sustained transgene expression, even in the presence of anti-Ad immunity, and can encode large therapeutic cassettes, including regulatory elements to enable turning gene expression “on” or “off” according to clinical need. The inclusion of two therapeutic transgenes within a single vector enables a reduction of the total vector load without adversely impacting efficacy. Because clinically the vectors will be delivered into the surgical cavity, normal regions of the brain parenchyma are likely to be transduced. Thus, we assessed any potential toxicities elicited by escalating doses of HC-Ad-TK/TetOn-Flt3L (1 × 10{sup 8}, 1 × 10{sup 9}, or 1 × 10{sup 10} viral particles [vp]) delivered into the rat brain parenchyma. We assessed neuropathology, biodistribution, transgene expression, systemic toxicity, and behavioral impact at acute and chronic time points. The results indicate that doses up to 1 × 10{sup 9} vp of HC-Ad-TK/TetOn-Flt3L can be safely delivered into the normal rat brain and underpin further developments for its implementation in a phase I clinical trial for glioma. - Highlights: ► High capacity Ad vectors elicit sustained therapeutic gene expression in the brain. ► HC-Ad-TK/TetOn-Flt3L encodes two therapeutic genes and a transcriptional switch. ► We performed a dose escalation study at

  5. Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

    Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo


    Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged

  6. Safety and efficacy of a xenogeneic DNA vaccine encoding for human tyrosinase as adjunctive treatment for oral malignant melanoma in dogs following surgical excision of the primary tumor.

    Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D


    To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.

  7. Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy

    Mangin, M.; Webb, A.C.; Dreyer, B.E.


    Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12

  8. Production of recombinant AAV vectors encoding insulin-like growth factor I is enhanced by interaction among AAV rep regulatory sequences

    Dilley Robert


    Full Text Available Abstract Background Adeno-associated virus (AAV vectors are promising tools for gene therapy. Currently, their potential is limited by difficulties in producing high vector yields with which to generate transgene protein product. AAV vector production depends in part upon the replication (Rep proteins required for viral replication. We tested the hypothesis that mutations in the start codon and upstream regulatory elements of Rep78/68 in AAV helper plasmids can regulate recombinant AAV (rAAV vector production. We further tested whether the resulting rAAV vector preparation augments the production of the potentially therapeutic transgene, insulin-like growth factor I (IGF-I. Results We constructed a series of AAV helper plasmids containing different Rep78/68 start codon in combination with different gene regulatory sequences. rAAV vectors carrying the human IGF-I gene were prepared with these vectors and the vector preparations used to transduce HT1080 target cells. We found that the substitution of ATG by ACG in the Rep78/68 start codon in an AAV helper plasmid (pAAV-RC eliminated Rep78/68 translation, rAAV and IGF-I production. Replacement of the heterologous sequence upstream of Rep78/68 in pAAV-RC with the AAV2 endogenous p5 promoter restored translational activity to the ACG mutant, and restored rAAV and IGF-I production. Insertion of the AAV2 p19 promoter sequence into pAAV-RC in front of the heterologous sequence also enabled ACG to function as a start codon for Rep78/68 translation. The data further indicate that the function of the AAV helper construct (pAAV-RC, that is in current widespread use for rAAV production, may be improved by replacement of its AAV2 unrelated heterologous sequence with the native AAV2 p5 promoter. Conclusion Taken together, the data demonstrate an interplay between the start codon and upstream regulatory sequences in the regulation of Rep78/68 and indicate that selective mutations in Rep78/68 regulatory elements

  9. Transcriptional Response of Human Neurospheres to Helper-Dependent CAV-2 Vectors Involves the Modulation of DNA Damage Response, Microtubule and Centromere Gene Groups.

    Stefania Piersanti

    Full Text Available Brain gene transfer using viral vectors will likely become a therapeutic option for several disorders. Helper-dependent (HD canine adenovirus type 2 vectors (CAV-2 are well suited for this goal. These vectors are poorly immunogenic, efficiently transduce neurons, are retrogradely transported to afferent structures in the brain and lead to long-term transgene expression. CAV-2 vectors are being exploited to unravel behavior, cognition, neural networks, axonal transport and therapy for orphan diseases. With the goal of better understanding and characterizing HD-CAV-2 for brain therapy, we analyzed the transcriptomic modulation induced by HD-CAV-2 in human differentiated neurospheres derived from midbrain progenitors. This 3D model system mimics several aspects of the dynamic nature of human brain. We found that differentiated neurospheres are readily transduced by HD-CAV-2 and that transduction generates two main transcriptional responses: a DNA damage response and alteration of centromeric and microtubule probes. Future investigations on the biochemistry of processes highlighted by probe modulations will help defining the implication of HD-CAV-2 and CAR receptor binding in enchaining these functional pathways. We suggest here that the modulation of DNA damage genes is related to viral DNA, while the alteration of centromeric and microtubule probes is possibly enchained by the interaction of the HD-CAV-2 fibre with CAR.

  10. Isolation and characterisation of cDNA clones representing the genes encoding the major tuber storage protein (dioscorin) of yam (Dioscorea cayenensis Lam.).

    Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C


    cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.

  11. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Jianrao HU, Mingfu CAO, Jiong Chen


    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  12. α/sub i/-3 cDNA encodes the α subunit of G/sub k/, the stimulatory G protein of receptor-regulated K+ channels

    Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.


    cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed

  13. Effect of cytokine-encoding plasmid delivery on immune response to Japanese encephalitis virus DNA vaccine in mice.

    Bharati, Kaushik; Appaiahgari, Mohan Babu; Vrati, Sudhanshu


    We have previously shown that immunization of mice with plasmid pMEa synthesizing Japanese encephalitis virus (JEV) envelope protein induced anti-JEV humoral and cellular immune responses. We now show that intra-muscular co-administration of mice with pMEa and pGM-CSF, encoding murine granulocyte-macrophage colony-stimulating factor or pIL-2, encoding murine interleukin-2 given 4 days after pMEa, augmented anti-JEV antibody titers. This did not enhance the level of protection in immunized mice against JEV. However, intra-dermal co-administration of pMEa and pGM-CSF in mice using the gene gun, enhanced anti-JEV antibody titers resulting in an increased level of protection in mice against lethal JEV challenge.

  14. Mucosal application of gp140 encoding DNA polyplexes to different tissues results in altered immunological outcomes in mice.

    Jamie F S Mann

    Full Text Available Increasing evidence suggests that mucosally targeted vaccines will enhance local humoral and cellular responses whilst still eliciting systemic immunity. We therefore investigated the capacity of nasal, sublingual or vaginal delivery of DNA-PEI polyplexes to prime immune responses prior to mucosal protein boost vaccination. Using a plasmid expressing the model antigen HIV CN54gp140 we show that each of these mucosal surfaces were permissive for DNA priming and production of antigen-specific antibody responses. The elicitation of systemic immune responses using nasally delivered polyplexed DNA followed by recombinant protein boost vaccination was equivalent to a systemic prime-boost regimen, but the mucosally applied modality had the advantage in that significant levels of antigen-specific IgA were detected in vaginal mucosal secretions. Moreover, mucosal vaccination elicited both local and systemic antigen-specific IgG(+ and IgA(+ antibody secreting cells. Finally, using an Influenza challenge model we found that a nasal or sublingual, but not vaginal, DNA prime/protein boost regimen protected against infectious challenge. These data demonstrate that mucosally applied plasmid DNA complexed to PEI followed by a mucosal protein boost generates sufficient antigen-specific humoral antibody production to protect from mucosal viral challenge.

  15. Validation of the use of an artificial mitochondrial reporter DNA vector containing a Cytomegalovirus promoter for mitochondrial transgene expression.

    Yamada, Yuma; Ishikawa, Takuya; Harashima, Hideyoshi


    Mitochondria have their own gene expression system that is independent of the nuclear system, and control cellular functions in cooperation with the nucleus. While a number of useful technologies for achieving nuclear transgene expression have been reported, only a few have focused on mitochondria. In this study, we validated the utility of an artificial mitochondrial DNA vector with a virus promoter on mitochondrial transgene expression. We designed and constructed pCMV-mtLuc (CGG) that contains a CMV promotor derived from Cytomegalovirus and an artificial mitochondrial genome with a NanoLuc (Nluc) luciferase gene that records adjustments to the mitochondrial codon system. Nluc luciferase activity measurements showed that the pCMV-mtLuc (CGG) efficiently produced the Nluc luciferase protein in human HeLa cells. Moreover, we optimized the mitochondrial transfection of pCMV-mtLuc (CGG) using a MITO-Porter system, a liposome-based carrier for mitochondrial delivery via membrane fusion. As a result, we found that transfection of pCMV-mtLuc (CGG) by MITO-Porter modified with the KALA peptide (cationic amphipathic cell-penetrating peptide) showed a high mitochondrial transgene expression. The developed mitochondrial transgene expression system represents a potentially useful tool for the fields of nanoscience and nanotechnology for controlling the intracellular microenvironment via the regulation of mitochondrial function and promises to open additional innovative research fields of study. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Determination of cDNA encoding BCR/ABL fusion gene in patients with chronic myelogenous leukemia using a novel FRET-based quantum dots-DNA nanosensor.

    Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila


    In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7  M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10  M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Dendritic cell mediated delivery of plasmid DNA encoding LAMP/HIV-1 Gag fusion immunogen enhances T cell epitope responses in HLA DR4 transgenic mice.

    Gregory G Simon


    Full Text Available This report describes the identification and bioinformatics analysis of HLA-DR4-restricted HIV-1 Gag epitope peptides, and the application of dendritic cell mediated immunization of DNA plasmid constructs. BALB/c (H-2d and HLA-DR4 (DRA1*0101, DRB1*0401 transgenic mice were immunized with immature dendritic cells transfected by a recombinant DNA plasmid encoding the lysosome-associated membrane protein-1/HIV-1 Gag (pLAMP/gag chimera antigen. Three immunization protocols were compared: 1 primary subcutaneous immunization with 1x10(5 immature dendritic cells transfected by electroporation with the pLAMP/gag DNA plasmid, and a second subcutaneous immunization with the naked pLAMP/gag DNA plasmid; 2 primary immunization as above, and a second subcutaneous immunization with a pool of overlapping peptides spanning the HIV-1 Gag sequence; and 3 immunization twice by subcutaneous injection of the pLAMP/gag DNA plasmid. Primary immunization with pLAMP/gag-transfected dendritic cells elicited the greatest number of peptide specific T-cell responses, as measured by ex vivo IFN-gamma ELISpot assay, both in BALB/c and HLA-DR4 transgenic mice. The pLAMP/gag-transfected dendritic cells prime and naked DNA boost immunization protocol also resulted in an increased apparent avidity of peptide in the ELISpot assay. Strikingly, 20 of 25 peptide-specific T-cell responses in the HLA-DR4 transgenic mice contained sequences that corresponded, entirely or partially to 18 of the 19 human HLA-DR4 epitopes listed in the HIV molecular immunology database. Selection of the most conserved epitope peptides as vaccine targets was facilitated by analysis of their representation and variability in all reported sequences. These data provide a model system that demonstrates a the superiority of immunization with dendritic cells transfected with LAMP/gag plasmid DNA, as compared to naked DNA, b the value of HLA transgenic mice as a model system for the identification and evaluation

  18. Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer's disease: Identification as the microtubule-associated protein tau

    Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.


    Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease

  19. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    Verónica Loera-Castañeda


    Full Text Available Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS. Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12% harbored the A8027G polymorphism and three of them were early onset (EO AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn’t been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

  20. Identification and Molecular Characterization of the cDNA Encoding Cucumis melo Allergen, Cuc m 3, a Plant Pathogenesis-Related Protein

    Mojtaba Sankian


    Full Text Available Background: Melon (Cucumis melo allergy is one of the most common food allergies, characterized by oral allergy syndrome. To date, two allergen molecules, Cuc m 1 and Cuc m 2, have been fully characterized in melon pulp, but there are few reports about the molecular characteristics of Cuc m 3. Methods:The Cuc m 3 cDNA has been characterized by rapid amplification of cDNA ends (RACE, which revealed a 456 base-pair (bp fragment encoding a 151-amino acid polypeptide with a predicted molecular mass of 16.97 kDa, and identified 79 and 178 bp untranslated sequences at the 5′ and 3´ ends, respectively. Results: In silico analysis showed strong similarities between Cuc m 3 and other plant pathogen-related protein 1s from cucumber, grape, bell pepper, and tomato. Conclusion: Here we report the identification and characterization of the Cuc m 3 cDNA, which will be utilized for further analyses of structural and allergenic features of this allergen

  1. Evaluation of protective effect of multiantigenic DNA vaccine encoding MIC3 and ROP18 antigen segments of Toxoplasma gondii in mice.

    Qu, Daofeng; Han, Jianzhong; Du, Aifang


    The high incidence and severe damage caused by Toxoplasma gondii infection clearly indicates the need for the development of a vaccine. In this study, we evaluated the immune responses and protection against toxoplasmosis by immunizing ICR mice with a multiantigenic DNA vaccine. To develop the multiantigenic vaccine, two T. gondii antigens, MIC3 and ROP18, selected on the basis of previous studies were chosen. ICR mice were immunized subcutaneously with PBS, empty pcDNA3.1 vector, pMIC3, pROP18, and pROP18-MIC3, respectively. The results of lymphocyte proliferation assay, cytokine, and antibody determinations showed that mice immunized with pROP18-MIC3 elicited stronger humoral and Th1-type cellular immune responses than those immunized with single-gene plasmids, empty plasmid, or phosphate-buffered saline. After a lethal challenge with the highly virulent T. gondii RH strain, a prolonged survival time in pROP18-MIC3-immunized mice was observed in comparison to control groups. Our study indicates that the introduction of multiantigenic DNA vaccine is more powerful and efficient than single-gene vaccine, and deserves further evaluation and development.

  2. Genetic population structure of the malaria vector Anopheles baimaii in north-east India using mitochondrial DNA.

    Sarma, Devojit K; Prakash, Anil; O'Loughlin, Samantha M; Bhattacharyya, Dibya R; Mohapatra, Pradumnya K; Bhattacharjee, Kanta; Das, Kanika; Singh, Sweta; Sarma, Nilanju P; Ahmed, Gias U; Walton, Catherine; Mahanta, Jagadish


    Anopheles baimaii is a primary vector of human malaria in the forest settings of Southeast Asia including the north-eastern region of India. Here, the genetic population structure and the basic population genetic parameters of An. baimaii in north-east India were estimated using DNA sequences of the mitochondrial cytochrome oxidase sub unit II (COII) gene. Anopheles baimaii were collected from 26 geo-referenced locations across the seven north-east Indian states and the COII gene was sequenced from 176 individuals across these sites. Fifty-seven COII sequences of An. baimaii from six locations in Bangladesh, Myanmar and Thailand from a previous study were added to this dataset. Altogether, 233 sequences were grouped into eight population groups, to facilitate analyses of genetic diversity, population structure and population history. A star-shaped median joining haplotype network, unimodal mismatch distribution and significantly negative neutrality tests indicated population expansion in An. baimaii with the start of expansion estimated to be ~0.243 million years before present (MYBP) in north-east India. The populations of An. baimaii from north-east India had the highest haplotype and nucleotide diversity with all other populations having a subset of this diversity, likely as the result of range expansion from north-east India. The north-east Indian populations were genetically distinct from those in Bangladesh, Myanmar and Thailand, indicating that mountains, such as the Arakan mountain range between north-east India and Myanmar, are a significant barrier to gene flow. Within north-east India, there was no genetic differentiation among populations with the exception of the Central 2 population in the Barail hills area that was significantly differentiated from other populations. The high genetic distinctiveness of the Central 2 population in the Barail hills area of the north-east India should be confirmed and its epidemiological significance further

  3. Genetic population structure of the malaria vector Anopheles baimaii in north-east India using mitochondrial DNA

    Sarma Devojit K


    Full Text Available Abstract Background Anopheles baimaii is a primary vector of human malaria in the forest settings of Southeast Asia including the north-eastern region of India. Here, the genetic population structure and the basic population genetic parameters of An. baimaii in north-east India were estimated using DNA sequences of the mitochondrial cytochrome oxidase sub unit II (COII gene. Methods Anopheles baimaii were collected from 26 geo-referenced locations across the seven north-east Indian states and the COII gene was sequenced from 176 individuals across these sites. Fifty-seven COII sequences of An. baimaii from six locations in Bangladesh, Myanmar and Thailand from a previous study were added to this dataset. Altogether, 233 sequences were grouped into eight population groups, to facilitate analyses of genetic diversity, population structure and population history. Results A star-shaped median joining haplotype network, unimodal mismatch distribution and significantly negative neutrality tests indicated population expansion in An. baimaii with the start of expansion estimated to be ~0.243 million years before present (MYBP in north-east India. The populations of An. baimaii from north-east India had the highest haplotype and nucleotide diversity with all other populations having a subset of this diversity, likely as the result of range expansion from north-east India. The north-east Indian populations were genetically distinct from those in Bangladesh, Myanmar and Thailand, indicating that mountains, such as the Arakan mountain range between north-east India and Myanmar, are a significant barrier to gene flow. Within north-east India, there was no genetic differentiation among populations with the exception of the Central 2 population in the Barail hills area that was significantly differentiated from other populations. Conclusions The high genetic distinctiveness of the Central 2 population in the Barail hills area of the north-east India should be

  4. Comparative Immunogenicity in Rhesus Monkeys of DNA Plasmid, Recombinant Vaccinia Virus, and Replication-Defective Adenovirus Vectors Expressing a Human Immunodeficiency Virus Type 1 gag Gene

    Casimiro, Danilo R.; Chen, Ling; Fu, Tong-Ming; Evans, Robert K.; Caulfield, Michael J.; Davies, Mary-Ellen; Tang, Aimin; Chen, Minchun; Huang, Lingyi; Harris, Virginia; Freed, Daniel C.; Wilson, Keith A.; Dubey, Sheri; Zhu, De-Min; Nawrocki, Denise


    Cellular immune responses, particularly those associated with CD3+ CD8+ cytotoxic T lymphocytes (CTL), play a primary role in controlling viral infection, including persistent infection with human immunodeficiency virus type 1 (HIV-1). Accordingly, recent HIV-1 vaccine research efforts have focused on establishing the optimal means of eliciting such antiviral CTL immune responses. We evaluated several DNA vaccine formulations, a modified vaccinia virus Ankara vector, and a replication-defecti...

  5. Hybrid lentivirus-phiC31-int-NLS vector allows site-specific recombination in murine and human cells but induces DNA damage.

    Nicolas Grandchamp

    Full Text Available Gene transfer allows transient or permanent genetic modifications of cells for experimental or therapeutic purposes. Gene delivery by HIV-derived lentiviral vector (LV is highly effective but the risk of insertional mutagenesis is important and the random/uncontrollable integration of the DNA vector can deregulate the cell transcriptional activity. Non Integrative Lentiviral Vectors (NILVs solve this issue in non-dividing cells, but they do not allow long term expression in dividing cells. In this context, obtaining stable expression while avoiding the problems inherent to unpredictable DNA vector integration requires the ability to control the integration site. One possibility is to use the integrase of phage phiC31 (phiC31-int which catalyzes efficient site-specific recombination between the attP site in the phage genome and the chromosomal attB site of its Streptomyces host. Previous studies showed that phiC31-int is active in many eukaryotic cells, such as murine or human cells, and directs the integration of a DNA substrate into pseudo attP sites (pattP which are homologous to the native attP site. In this study, we combined the efficiency of NILV for gene delivery and the specificity of phiC31-int for DNA substrate integration to engineer a hybrid tool for gene transfer with the aim of allowing long term expression in dividing and non-dividing cells preventing genotoxicity. We demonstrated the feasibility to target NILV integration in human and murine pattP sites with a dual NILV vectors system: one which delivers phiC31-int, the other which constitute the substrate containing an attB site in its DNA sequence. These promising results are however alleviated by the occurrence of significant DNA damages. Further improvements are thus required to prevent chromosomal rearrangements for a therapeutic use of the system. However, its use as a tool for experimental applications such as transgenesis is already applicable.

  6. Site-specific integration of CAR gene into Jurkat T cells with a linear close-ended AAV-based DNA vector for CAR-T engineering.

    Zhang, Yun; Liu, Xiaomei; Zhang, Jinju; Zhang, Chun


    To develop a site-specific integration strategy for CAR-T engineering by using a non-viral vector dependent on adeno-associated viral (AAV) genome, which tends to be integrated into AAVS1 site with the help of its Rep proteins. AAV-dependent vectors were produced in Sf9 cells. Structural analyses revealed the vector as covalently close-ended, linear duplex molecules, which was termed "CELiD" DNA. A plasmid CMV-Rep was constructed to express the integrases Rep78 and Rep68. Jurkat cells were co-electroporated with "CELiD" DNA and plasmid CMV-Rep in order to specifically integrate CAR gene into AAVS1 site. We examined 71 stably transfected Jurkat clones by nested PCR, sequencing and southern blotting, of which 30 clones bore CAR gene within AAVS1 site. The site-specific integration efficiency was nearly 42.2 %. The AAV-dependent vector preferentially integrated CAR into AAVS1 site, which could be further used in human T cell modification and enhance the security of CAR-T therapy.


    Mazor, Tali; Pankov, Aleksandr; Johnson, Brett E.; Hong, Chibo; Bell, Robert J.A.; Smirnov, Ivan V.; Reis, Gerald F.; Phillips, Joanna J.; Barnes, Michael; Bollen, Andrew W.; Taylor, Barry S.; Molinaro, Annette M.; Olshen, Adam B.; Song, Jun S.; Berger, Mitchel S.; Chang, Susan M.; Costello, Joseph F.


    The clonal evolution of tumor cell populations can be reconstructed from patterns of genetic alterations. In contrast, tumor epigenetic states, including DNA methylation, are reversible and sensitive to the tumor microenvironment, presumably precluding the use of epigenetics to discover tumor phylogeny. Here we examined the spatial and temporal dynamics of DNA methylation in a clinically and genetically characterized cohort of IDH1-mutant low-grade gliomas and their patient-matched recurrences. WHO grade II gliomas are diffuse, infiltrative tumors that frequently recur and may undergo malignant progression to a higher grade with a worse prognosis. The extent to which epigenetic alterations contribute to the evolution of low-grade gliomas, including malignant progression, is unknown. While all gliomas in the cohort exhibited the hypermethylation signature associated with IDH1 mutation, low-grade gliomas that underwent malignant progression to high-grade glioblastoma (GBM) had a unique signature of DNA hypomethylation enriched for active enhancers, as well as sites of age-related hypermethylation in the brain. Genes with promoter hypomethylation and concordant transcriptional upregulation during evolution to GBM were enriched in cell cycle function, evolving in concert with genetic alterations that deregulate the G1/S cell cycle checkpoint. Despite the plasticity of tumor epigenetic states, phyloepigenetic trees robustly recapitulated phylogenetic trees derived from somatic mutations in the same patients. These findings highlight widespread co-dependency of genetic and epigenetic events throughout the clonal evolution of initial and recurrent glioma.

  8. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi


    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  9. DNA Barcode Reference Library for the African Citrus Triozid, Trioza erytreae (Hemiptera: Triozidae): Vector of African Citrus Greening.

    Khamis, F M; Rwomushana, I; Ombura, L O; Cook, G; Mohamed, S A; Tanga, C M; Nderitu, P W; Borgemeister, C; Sétamou, M; Grout, T G; Ekesi, S


    Citrus (Citrus spp.) production continues to decline in East Africa, particularly in Kenya and Tanzania, the two major producers in the region. This decline is attributed to pests and diseases including infestation by the African citrus triozid, Trioza erytreae (Del Guercio) (Hemiptera: Triozidae). Besides direct feeding damage by adults and immature stages, T. erytreae is the main vector of 'Candidatus Liberibacter africanus', the causative agent of Greening disease in Africa, closely related to Huanglongbing. This study aimed to generate a novel barcode reference library for T. erytreae in order to use DNA barcoding as a rapid tool for accurate identification of the pest to aid phytosanitary measures. Triozid samples were collected from citrus orchards in Kenya, Tanzania, and South Africa and from alternative host plants. Sequences generated from populations in the study showed very low variability within acceptable ranges of species. All samples analyzed were linked to T. erytreae of GenBank accession number KU517195. Phylogeny of samples in this study and other Trioza reference species was inferred using the Maximum Likelihood method. The phylogenetic tree was paraphyletic with two distinct branches. The first branch had two clusters: 1) cluster of all populations analyzed with GenBank accession of T. erytreae and 2) cluster of all the other GenBank accession of Trioza species analyzed except T. incrustata Percy, 2016 (KT588307.1), T. eugeniae Froggatt (KY294637.1), and T. grallata Percy, 2016 (KT588308.1) that occupied the second branch as outgroups forming sister clade relationships. These results were further substantiated with genetic distance values and principal component analyses. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  10. Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

    Safford, R.; de Silva, J.; Lucas, C.


    Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH

  11. [Molecular cloning and characterization of cDNA of the rpc10+ gene encoding the smallest subunit of nuclear RNA polymerases of Schizosaccharomyces pombe].

    Shpakovskiĭ, G V; Lebedenko, E N


    The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.

  12. Isolation of cDNA encoding a newly identified major allergenic protein of rye-grass pollen: intracellular targeting to the amyloplast.

    Singh, M B; Hough, T; Theerakulpisut, P; Avjioglu, A; Davies, S; Smith, P M; Taylor, P; Simpson, R J; Ward, L D; McCluskey, J


    We have identified a major allergenic protein from rye-grass pollen, tentatively designated Lol pIb of 31kDa and with pI 9.0. A cDNA clone encoding Lol pIb has been isolated, sequenced, and characterized. Lol pIb is located mainly in the starch granules. This is a distinct allergen from Lol pI, which is located in the cytosol. Lol pIb is synthesized in pollen as a pre-allergen with a transit peptide targeting the allergen to amyloplasts. Epitope mapping of the fusion protein localized the IgE binding determinant in the C-terminal domain. Images PMID:1671715

  13. The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

    Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis


    The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  14. Organometallic DNA-B12 Conjugates as Potential Oligonucleotide Vectors: Synthesis and Structural and Binding Studies with Human Cobalamin-Transport Proteins.

    Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard


    The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. DNA vaccine encoding myristoylated membrane protein (MMP) of rock bream iridovirus (RBIV) induces protective immunity in rock bream (Oplegnathus fasciatus).

    Jung, Myung-Hwa; Nikapitiya, Chamilani; Jung, Sung-Ju


    Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream (Oplegnathus fasciatus) in Korea. In this study, we investigated the potential of viral membrane protein to induce antiviral status protecting rock bream against RBIV infection. We found that fish administered with ORF008L (myristoylated membrane protein, MMP) vaccine exhibited significantly higher levels of survival compared to ORF007L (major capsid protein, MCP). Moreover, ORF008L-based DNA vaccinated fish showed significant protection at 4 and 8 weeks post vaccination (wpv) than non-vaccinated fish after infected with RBIV (6.7 × 10 5 ) at 23 °C, with relative percent survival (RPS) of 73.36% and 46.72%, respectively. All of the survivors from the first RBIV infection were strongly protected (100% RPS) from re-infected with RBIV (1.1 × 10 7 ) at 100 dpi. In addition, the MMP (ORF008L)-based DNA vaccine significantly induced the gene expression of TLR3 (14.2-fold), MyD88 (11.6-fold), Mx (84.7-fold), ISG15 (8.7-fold), PKR (25.6-fold), MHC class I (13.3-fold), Fas (6.7-fold), Fas ligand (6.7-fold), caspase9 (17.0-fold) and caspase3 (15.3-fold) at 7 days post vaccination in the muscle (vaccine injection site). Our results showed the induction of immune responses and suggest the possibility of developing preventive measures against RBIV using myristoylated membrane protein-based DNA vaccine. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes.

    Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A


    WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.

  17. The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

    Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.


    WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

  18. A DNA-Encoded Library of Chemical Compounds Based on Common Scaffolding Structures Reveals the Impact of Ligand Geometry on Protein Recognition.

    Favalli, Nicholas; Biendl, Stefan; Hartmann, Marco; Piazzi, Jacopo; Sladojevich, Filippo; Gräslund, Susanne; Brown, Peter J; Näreoja, Katja; Schüler, Herwig; Scheuermann, Jörg; Franzini, Raphael; Neri, Dario


    A DNA-encoded chemical library (DECL) with 1.2 million compounds was synthesized by combinatorial reaction of seven central scaffolds with two sets of 343×492 building blocks. Library screening by affinity capture revealed that for some target proteins, the chemical nature of building blocks dominated the selection results, whereas for other proteins, the central scaffold also crucially contributed to ligand affinity. Molecules based on a 3,5-bis(aminomethyl)benzoic acid core structure were found to bind human serum albumin with a K d value of 6 nm, while compounds with the same substituents on an equidistant but flexible l-lysine scaffold showed 140-fold lower affinity. A 18 nm tankyrase-1 binder featured l-lysine as linking moiety, while molecules based on d-Lysine or (2S,4S)-amino-l-proline showed no detectable binding to the target. This work suggests that central scaffolds which predispose the orientation of chemical building blocks toward the protein target may enhance the screening productivity of encoded libraries. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Cloning of a cDNA encoding the human cation-dependent mannose 6-phosphate-specific receptor

    Pohlmann, R.; Nagel, G.; Schmidt, B.


    Complementary DNA clones for the human cation-dependent mannose 6-phosphate-specific receptor have been isolated from a human placenta library in λgt11. The nucleotide sequence of the 2463-base-pair cDNA insert includes a 145-base-pair 5' untranslated region, an open reading frame of 831 base pairs corresponding to 277 amino acids, and a 1487-base-pair 3' untranslated region. The deduced amino acid sequence is colinear with that determined by amino acid sequencing of the N-terminus peptide (41 residues) and nine tryptic peptides (93 additional residues). The receptor is synthesized as a precursor with a signal peptide of 20 amino acids. The hydrophobicity profile of the receptor indicates a single membrane-spanning domain, which separates an N-terminal region containing five potential N-glycosylation sites from a C-terminal region lacking N-glycosylation sites. Thus the N-terminal (M/sub r/ = 18,299) and C-terminal (M/sub r/ ≤ 7648) segments of the mature receptor are assumed to be exposed to the extracytosolic and cytosolic sides of the membrane, respectively. Analysis of a panel of somatic cell (mouse-human) hybrids shows that the gene for the receptor is located on human chromosome 12

  20. Protective efficacy of cationic-PLGA microspheres loaded with DNA vaccine encoding the sip gene of Streptococcus agalactiae in tilapia.

    Ma, Yan-Ping; Ke, Hao; Liang, Zhi-Ling; Ma, Jiang-Yao; Hao, Le; Liu, Zhen-Xing


    Streptococcus agalactiae (S. agalactiae) is an important fish pathogen, which has received more attention in the past decade due to the increasing economic losses in the tilapia industry worldwide. As existing effective vaccines of S. agalactiae in fish have obvious disadvantage, to select immunoprotective antigens and package materials would undoubtedly contribute to the development of novel oral vaccines. In the present study, surface immunogenic protein (sip) was selected from the S. agalactiae serovar I a genomes as immunogenic protein in DNA vaccine form with cationic chitosan and biodegradable and biocompatible PLGA. The pcSip plasmid in cationic-PLGA was successfully expressed in tissues of immunized tilapia and the immunogenicity was assessed in tilapia challenge model. A significant increase was observed in the cytokine levels of IL-1β, TNF-α, CC1, CC2 in spleen and kidney tissues. Furthermore, immunized tilapia conferred different levels of protection against challenge with a lethal dose of highly virulent serovar I a S. agalactiae. Our results indicated that the pcSip plasmid in cationic-PLGA induced high level of antibodies and protection against S. agalactiae infection, could be effective oral DNA vaccine candidates. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Vector optimization and needle-free intradermal application of a broadly protective polyvalent influenza A DNA vaccine for pigs and humans

    Borggren, Marie; Nielsen, Jens; Bragstad, Karoline


    such as the induction of cellular and humoral immunity, inherent safety and rapid production time. We have previously developed a DNA vaccine encoding selected influenza proteins of pandemic origin and demonstrated broad protective immune responses in ferrets and pigs. In this study, we evaluated our DNA vaccine......The threat posed by the 2009 pandemic H1N1 virus emphasized the need for new influenza A virus vaccines inducing a broad cross-protective immune response for use in both humans and pigs. An effective and broad influenza vaccine for pigs would greatly benefit the pork industry and contribute...... to public health by diminishing the risk of emerging highly pathogenic reassortants. Current inactivated protein vaccines against swine influenza produce only short-lived immunity and have no efficacy against heterologous strains. DNA vaccines are a potential alternative with advantages...

  2. Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers

    Pattana Srifah Huehne


    Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.

  3. DNA vaccine encoding nucleocapsid and surface proteins of wild type canine distemper virus protects its natural host against distemper.

    Cherpillod, P; Tipold, A; Griot-Wenk, M; Cardozo, C; Schmid, I; Fatzer, R; Schobesberger, M; Zurbriggen, R; Bruckner, L; Roch, F; Vandevelde, M; Wittek, R; Zurbriggen, A


    Canine distemper virus (CDV), a member of the genus Morbillivirus induces a highly infectious, frequently lethal disease in dogs and other carnivores. Current vaccines against canine distemper consisting of attenuated viruses have been in use for many years and have greatly reduced the incidence of distemper in the dog population. However, certain strains may not guarantee adequate protection and others can induce post vaccinal encephalitis. We tested a DNA vaccine for its ability to protect dogs, the natural host of CDV, against distemper. We constructed plasmids containing the nucleocapsid, the fusion, and the attachment protein genes of a virulent canine distemper virus strain. Mice inoculated with these plasmids developed humoral and cellular immune responses against CDV antigens. Dogs immunized with the expression plasmids developed virus-neutralizing antibodies. Significantly, vaccinated dogs were protected against challenge with virulent CDV, whereas unvaccinated animals succumbed to distemper.

  4. Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata.

    Templeton, M D; Rikkerink, E H; Solon, S L; Crowhurst, R N


    The glyceraldehyde-3-phosphate dehydrogenase gene (gpdA) has been identified from a genomic DNA library prepared from the plant pathogenic fungus Glomerella cingulata. Nucleotide sequence data revealed that this gene codes for a putative 338-amino-acid protein encoded by two exons of 129 and 885 bp, separated by an intron 216 bp long. The 5' leader sequence is also spliced by an intron of 156 bp. A cDNA clone was prepared using the polymerase chain reaction, the sequence of which was used to confirm the presence of the intron in the coding sequence and the splicing of the 5' leader sequence. The transcriptional start point (tsp) was mapped at -253 nt from the site of the initiation of translation by primer extension and is adjacent to a 42-bp pyrimidine-rich region. The general structure of the 5' flanking region shows similarities to gpdA from Aspergillus nidulans. The putative protein product is 71-86% identical at the aa level to GPDs from Aspergillus nidulans, Cryphonectria parasitica, Curvularia lunata, Podospora anserina and Ustilago maydis.

  5. Molecular cloning of a cDNA encoding the precursor of adenoregulin from frog skin. Relationships with the vertebrate defensive peptides, dermaseptins.

    Amiche, M; Ducancel, F; Lajeunesse, E; Boulain, J C; Ménez, A; Nicolas, P


    Adenoregulin has recently been isolated from Phyllomedusa skin as a 33 amino acid residues peptide which enhanced binding of agonists to the A1 adenosine receptor. In order to study the structure of the precursor of adenoregulin we constructed a cDNA library from mRNAs extracted from the skin of Phyllomedusa bicolor. We detected the complete nucleotide sequence of a cDNA encoding the adenoregulin biosynthetic precursor. The deduced sequence of the precursor is 81 amino acids long, exhibits a putative signal sequence at the NH2 terminus and contains a single copy of the biologically active peptide at the COOH terminus. Structural and conformational homologies that are observed between adenoregulin and the dermaseptins, antimicrobial peptides exhibiting strong membranolytic activities against various pathogenic agents, suggest that adenoregulin is an additional member of the growing family of cytotropic antimicrobial peptides that allow vertebrate animals to defend themselves against microorganisms. As such, the adenosine receptor regulating activity of adenoregulin could be due to its ability to interact with and disrupt membranes lipid bilayers.

  6. Vaccination with an adenoviral vector encoding the tumor antigen directly linked to invariant chain induces potent CD4(+) T-cell-independent CD8(+) T-cell-mediated tumor control

    Sorensen, Maria R; Holst, Peter J; Pircher, Hanspeter


    of the vaccine antigen to invariant chain (Ii). To evaluate this strategy we used a mouse model, in which an immunodominant epitope (GP33) of the LCMV glycoprotein (GP) represents the tumor-associated neoantigen. Prophylactic vaccination of C57BL/6 mice with a replication-deficient human adenovirus 5 vector...... encoding GP linked to Ii (Ad-Ii-GP) resulted in complete protection against GP33-expressing B16.F10 tumors. Therapeutic vaccination with Ad-Ii-GP delayed tumor growth by more than 2 wk compared with sham vaccination. Notably, therapeutic vaccination with the linked vaccine was significantly better than...... the tumor degradation. Finally, Ad-Ii-GP but not Ad-GP vaccination can break the immunological non-reactivity in GP transgenic mice indicating that our vaccine strategy will prove efficient also against endogenous tumor antigens....

  7. Isolation and characterization of cDNA encoding the 80-kDa subunit protein of the human autoantigen Ku (p70/p80) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome

    Mimori, Tsuneyo; Ohosone, Yasuo; Hama, Nobuaki; Suwa, Akira; Akizuki, Masashi; Homma, Mitsuo; Griffith, A.J.; Hardin, J.A.


    Anti-Ku (p70/p80) autoantibodies in patients with scleroderma-polymyositis overlap syndrome recognize a 70-kDa/80-kDa protein heterodimer which binds to terminal regions of double-stranded DNA. In the present study, the authors isolated full-length cDNAs that encode the 80-kDa Ku subunit. Initial screening of a human spleen cDNA library with anti-Ku antibodies yielded a cDNA of 1.0 kilobase (kb) (termed K71) encoding a portion of the 80-kDa Ku polypeptide (identification based on immunological criteria). In RNA blots, this cDNA hybridized with two mRNAs of 3.4 and 2.6 kb. In vitro transcription and translation experiments produced an immunoprecipitable polypeptide which comigrated with the 80-kDa Ku subunit. The Ku80-6 cDNA proved to be 3304 nucleotides in length, with an additional poly(A) tail, closely approximating the size of the larger mRNA. It contains a single long open reading frame encoding 732 amino acids. The putative polypeptide has a high content of acidic amino acids and a region with periodic repeat of leucine in every seventh position which may form the leucine zipper structure. In genomic DNA blots, probes derived from the opposite ends of cDNA Ku80-6 hybridized with several nonoverlapping restriction fragments from human leukocyte DNA, indicating that the gene encoding the 80-kDa Ku polypeptide is divided into several exons by intervening sequences

  8. Comparative analysis and molecular characterization of a gene BANF1 encoded a DNA-binding protein during mitosis from the Giant Panda and Black Bear.

    Zeng, Yichun; Hou, Yi-Ling; Ding, Xiang; Hou, Wan-Ru; Li, Jian


    Barrier to autointegration factor 1 (BANF1) is a DNA-binding protein found in the nucleus and cytoplasm of eukaryotic cells that functions to establish nuclear architecture during mitosis. The cDNA and the genomic sequence of BANF1 were cloned from the Giant Panda (Ailuropoda melanoleuca) and Black Bear (Ursus thibetanus mupinensis) using RT-PCR technology and Touchdown-PCR, respectively. The cDNA of the BANF1 cloned from Giant Panda and Black Bear is 297 bp in size, containing an open reading frame of 270 bp encoding 89 amino acids. The length of the genomic sequence from Giant Panda is 521 bp, from Black Bear is 536 bp, which were found both to possess 2 exons. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to some mammalian species studied. Topology prediction showed there is one Protein kinase C phosphorylation site, one Casein kinase II phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Giant Panda, and there is one Protein kinase C phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Black Bear. The BANF1 gene can be readily expressed in E. coli. Results showed that the protein BANF1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 14 kD polypeptide that formed inclusion bodies. The expression products obtained could be used to purify the proteins and study their function further.

  9. Safety and immunogenicity of an oral DNA vaccine encoding Sip of Streptococcus agalactiae from Nile tilapia Oreochromis niloticus delivered by live attenuated Salmonella typhimurium.

    Huang, L Y; Wang, K Y; Xiao, D; Chen, D F; Geng, Y; Wang, J; He, Y; Wang, E L; Huang, J L; Xiao, G Y


    Attenuated Salmonella typhimurium SL7207 was used as a carrier for a reconstructed DNA vaccine against Streptococcus agalactiae. A 1.02 kb DNA fragment, encoding for a portion of the surface immunogenic protein (Sip) of S. agalactiae was inserted into pVAX1. The recombinant plasmid pVAX1-sip was transfected in EPC cells to detect the transient expression by an indirect immunofluorescence assay, together with Western blot analysis. The pVAX1-sip was transformed by electroporation into SL7207. The stability of pVAX1-sip into Salmonella was over 90% after 50 generations with antibiotic selection in vitro while remained stable over 80% during 35 generations under antibiotic-free conditions. The LD50 of SL/pVAX1-sip was 1.7 × 10(11) CFU/fish by intragastric administration which indicated a quite low virulence. Tilapias were inoculated orally at 10(8) CFU/fish, the recombinant bacteria were found present in intestinal tract, spleens and livers and eventually eliminated from the tissues 4 weeks after immunization. Fish immunized at 10(7), 10(8) and 10(9) CFU/fish with different immunization times caused various levels of serum antibody and an effective protection against lethal challenge with the wild-type strain S. agalactiae. Integration studies showed that the pVAX1-sip did not integrate with tilapia chromosomes. The DNA vaccine SL/pVAX1-sip was proved to be safe and effective in protecting tilapias against S. agalactiae infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Cloning and functional expression of a cDNA encoding stearoyl-ACP Δ9-desaturase from the endosperm of coconut (Cocos nucifera L.).

    Gao, Lingchao; Sun, Ruhao; Liang, Yuanxue; Zhang, Mengdan; Zheng, Yusheng; Li, Dongdong


    Coconut (Cocos nucifera L.) is an economically tropical fruit tree with special fatty acid compositions. The stearoyl-acyl carrier protein (ACP) desaturase (SAD) plays a key role in the properties of the majority of cellular glycerolipids. In this paper, a full-length cDNA of a stearoyl-acyl carrier protein desaturase, designated CocoFAD, was isolated from cDNA library prepared from the endosperm of coconut (C. nucifera L.). An 1176 bp cDNA from overlapped PCR products containing ORF encoding a 391-amino acid (aa) protein was obtained. The coded protein was virtually identical and shared the homology to other Δ9-desaturase plant sequences (greater than 80% as similarity to that of Elaeis guineensis Jacq). The real-time fluorescent quantitative PCR result indicated that the yield of CocoFAD was the highest in the endosperm of 8-month-old coconut and leaf, and the yield was reduced to 50% of the highest level in the endosperm of 15-month-old coconut. The coding region showed heterologous expression in strain INVSc1 of yeast (Saccharomyces cerevisiae). GC-MS analysis showed that the levels of palmitoleic acid (16:1) and oleic acid (18:1) were improved significantly; meanwhile stearic acid (18:0) was reduced. These results indicated that the plastidial Δ9 desaturase from the endosperm of coconut was involved in the biosynthesis of hexadecenoic acid and octadecenoic acid, which was similar with other plants. These results may be valuable for understanding the mechanism of fatty acid metabolism and the genetic improvement of CocoFAD gene in palm plants in the future. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. DNA Vaccine Encoding the Chimeric Form of Schistosoma mansoni Sm-TSP2 and Sm29 Confers Partial Protection against Challenge Infection

    Gonçalves de Assis, Natan Raimundo; Batistoni de Morais, Suellen; Figueiredo, Bárbara Castro Pimentel; Ricci, Natasha Delaqua; de Almeida, Leonardo Augusto; da Silva Pinheiro, Carina; Martins, Vicente de Paulo; Oliveira, Sergio Costa


    Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2) are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed. PMID:25942636

  12. DNA Vaccine Encoding the Chimeric Form of Schistosoma mansoni Sm-TSP2 and Sm29 Confers Partial Protection against Challenge Infection.

    Natan Raimundo Gonçalves de Assis

    Full Text Available Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2 are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed.

  13. Generation of neutralizing monoclonal antibodies against a conformational epitope of human adenovirus type 7 (HAdv-7 incorporated in capsid encoded in a HAdv-3-based vector.

    Minglong Liu

    Full Text Available The generation of monoclonal antibodies (MAbs by epitope-based immunization is difficult because the immunogenicity of simple peptides is poor and T cells must be potently stimulated and immunological memory elicited. A strategy in which antigen is incorporated into the adenoviral capsid protein has been used previously to develop antibody responses against several vaccine targets and may offer a solution to this problem. In this study, we used a similar strategy to develop HAdv-7-neutralizing MAbs using rAdMHE3 virions into which hexon hypervariable region 5 (HVR5 of adenovirus type 7 (HAdv-7 was incorporated. The epitope mutant rAdMHE3 was generated by replacing HVR5 of Ad3EGFP, a recombinant HAdv-3-based vector expressing enhanced green fluorescence protein, with HVR5 of HAdv-7. We immunized BALB/c mice with rAdMHE3 virions and produced 22 different MAbs against them, four of which showed neutralizing activity against HAdv-7 in vitro. Using an indirect enzyme-linked immunosorbent assay (ELISA analysis and an antibody-binding-competition ELISA with Ad3EGFP, HAdv-7, and a series of chimeric adenoviral particles containing epitope mutants, we demonstrated that the four MAbs recognize the neutralization site within HVR5 of the HAdv-7 virion. Using an immunoblotting analysis and ELISA with HAdv-7, recombinant peptides, and a synthetic peptide, we also showed that the neutralizing epitope within HVR5 of the HAdv-7 virion is a conformational epitope. These findings suggest that it is feasible to use a strategy in which antigen is incorporated into the adenoviral capsid protein to generate neutralizing MAbs. This strategy may also be useful for developing therapeutic neutralizing MAbs and designing recombinant vector vaccines against HAdv-7, and in structural analysis of adenoviruses.

  14. Immuno-efficacy of DNA vaccines encoding PLP1 and ROP18 against experimental Toxoplasma gondii infection in mice.

    Chen, Yajun; Yu, Miao; Hemandez, J A; Li, Jiexi; Yuan, Zi-Guo; Yan, Haikuo


    We constructed a new plasmid pIRESneo/ROP18/PLP1 that was injected intramuscularly into Kunming mice to evaluate its immune efficacy. The immunized mice exhibited significantly increased serum IgG2a levels, lymphocyte counts and Th1-type cytokine (IL-2, IL-12 and IFN-γ) levels. Moreover, the immunized mice exhibited longer survival times (44.7 ± 2.1 days for ROP18/PLP1 and 47.2 ± 2.9 days for ROP18/PLP1 + IL-18) and lower brain cyst burden (68.9% for ROP18/PLP1 and 72.4% for ROP18/PLP1 + IL-18) than control mice after T. gondii challenge. Our results demonstrate that the multiple-gene DNA vaccine including both ROP18 and PLP1 elicits greater protection against T. gondii challenge and stronger immunogenicity than single-gene vaccines. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. DNA vaccination with a plasmid encoding LACK-TSA fusion against Leishmania major infection in BALB/c mice.

    Maspi, N; Ghaffarifar, F; Sharifi, Z; Dalimi, A; Khademi, S Z


    Vaccination would be the most important strategy for the prevention and elimination of leishmaniasis. The aim of the present study was to compare the immune responses induced following DNA vaccination with LACK (Leishmania analogue of the receptor kinase C), TSA (Thiol-specific-antioxidant) genes alone or LACK-TSA fusion against cutaneous leishmaniasis (CL). Cellular and humoral immune responses were evaluated before and after challenge with Leishmania major (L. major). In addition, the mean lesion size was also measured from 3th week post-infection. All immunized mice showed a partial immunity characterized by higher interferon (IFN)-γ and Immunoglobulin G (IgG2a) levels compared to control groups (pTSA fusion. Mean lesion sizes reduced significantly in all immunized mice compared with control groups at 7th week post-infection (pTSA and TSA groups than LACK group after challenge (pTSA antigens against CL. Furthermore, this study demonstrated that a bivalent vaccine can induce stronger immune responses and protection against infectious challenge with L. major.

  16. Cloning of a cDNA encoding a surface antigen of Schistosoma mansoni schistosomula recognized by sera of vassinated mice

    Dalton, J.P.; Tom, T.D.; Strand, M.


    Spleen cells of mice vaccinated with radiation-attenuated Schistosoma mansoni cercariae were used to produce monoclonal antibodies directed against newly transformed schistosomular surface antigens. One of these monoclonal antibodies recognized a polypeptide of 18 kDa. Binding was measured by radioimmunoassay. This glycoprotein was purified by monoclonal antibody immunoaffinity chromatography and a polyclonal antiserum was prepared against it. Immunofluorescence assays showed that the polyclonal antiserum bound to the surface of newly transformed schistosomula and lung-stage organisms but not to the surface of liver-stage and adult worms. Using this polyclonal antiserum we isolated recombinant clones from an adult worm cDNA expression library constructed in λgt11. Clone 654.2 contained an insert of 0.52 kilobase and hybridized to a 1.2-kilobase mRNA species from adult worms. Most importantly, clone 654.2 produced a fusion protein of 125 kDa that was reactive with sera of vaccinated mice that are capable of transferring resistance. This result encourages future vaccination trials with the fusion protein

  17. Implicit Real Vector Automata

    Jean-François Degbomont


    Full Text Available This paper addresses the symbolic representation of non-convex real polyhedra, i.e., sets of real vectors satisfying arbitrary Boolean combinations of linear constraints. We develop an original data structure for representing such sets, based on an implicit and concise encoding of a known structure, the Real Vector Automaton. The resulting formalism provides a canonical representation of polyhedra, is closed under Boolean operators, and admits an efficient decision procedure for testing the membership of a vector.

  18. Production of glycosylated physiologically normal human α1-antitrypsin by mouse fibroblasts modified by insertion of a human α1-antitrypsin cDNA using a retroviral vector

    Garver, R.I. Jr.; Chytil, A.; Karlsson, S.


    α 2 -Antitrypsin (α 1 AT) deficiency is a hereditary disorder characterized by reduced serum levels of α 1 AT, resulting in destruction of the lower respiratory tract by neutrophil elastase. As an approach to augment α 1 AT levels in this disorder with physiologically normal human α 1 AT, the authors have integrated a full-length normal human α 1 AT cDNA into the genome of mouse fibroblasts. To accomplish this, the retroviral vector N2 was modified by inserting the simian virus 40 early promoter followed by the α 1 AT cDNA. Southern analysis demonstrated that the intact cDNA was present in the genome of selected clones of the transfected murine fibroblasts psi2 and infected NIH 3T3. The clones produced three mRNA transcripts containing human α 1 AT sequences, secreted an α 1 AT molecule recognized by an anti-human α 1 AT antibody, with the same molecular mass as normal human α 1 AT and that complexed with and inhibited human neutrophil elastase. The psi2 produced α 1 AT was glycosylated, and when infused intravenously into mice, it had a serum half-life similar to normal α 1 AT purified from human plasma and markedly longer than that of nonglycosylated human α 1 AT cDNA-directed yeast-produced α 1 AT. These studies demonstrate the feasibility of using a retroviral vector to insert the normal human α 1 AT cDNA into non-α 1 AT-producing cells, resulting in the synthesis and secretion of physiologically normal α 1 AT

  19. Retroviral DNA Integration


    The integration of a DNA copy of the viral RNA genome into host chromatin is the defining step of retroviral replication. This enzymatic process is catalyzed by the virus-encoded integrase protein, which is conserved among retroviruses and LTR-retrotransposons. Retroviral integration proceeds via two integrase activities: 3′-processing of the viral DNA ends, followed by the strand transfer of the processed ends into host cell chromosomal DNA. Herein we review the molecular mechanism of retroviral DNA integration, with an emphasis on reaction chemistries and architectures of the nucleoprotein complexes involved. We additionally discuss the latest advances on anti-integrase drug development for the treatment of AIDS and the utility of integrating retroviral vectors in gene therapy applications. PMID:27198982

  20. A DNA vaccine encoding multiple HIV CD4 epitopes elicits vigorous polyfunctional, long-lived CD4+ and CD8+ T cell responses.

    Daniela Santoro Rosa

    Full Text Available T-cell based vaccines against HIV have the goal of limiting both transmission and disease progression by inducing broad and functionally relevant T cell responses. Moreover, polyfunctional and long-lived specific memory T cells have been associated to vaccine-induced protection. CD4(+ T cells are important for the generation and maintenance of functional CD8(+ cytotoxic T cells. We have recently developed a DNA vaccine encoding 18 conserved multiple HLA-DR-binding HIV-1 CD4 epitopes (HIVBr18, capable of eliciting broad CD4(+ T cell responses in multiple HLA class II transgenic mice. Here, we evaluated the breadth and functional profile of HIVBr18-induced immune responses in BALB/c mice. Immunized mice displayed high-magnitude, broad CD4(+/CD8(+ T cell responses, and 8/18 vaccine-encoded peptides were recognized. In addition, HIVBr18 immunization was able to induce polyfunctional CD4(+ and CD8(+ T cells that proliferate and produce any two cytokines (IFNγ/TNFα, IFNγ/IL-2 or TNFα/IL-2 simultaneously in response to HIV-1 peptides. For CD4(+ T cells exclusively, we also detected cells that proliferate and produce all three tested cytokines simultaneously (IFNγ/TNFα/IL-2. The vaccine also generated long-lived central and effector memory CD4(+ T cells, a desirable feature for T-cell based vaccines. By virtue of inducing broad, polyfunctional and long-lived T cell responses against conserved CD4(+ T cell epitopes, combined administration of this vaccine concept may provide sustained help for CD8(+ T cells and antibody responses- elicited by other HIV immunogens.

  1. Lineage analysis of the late otocyst stage mouse inner ear by transuterine microinjection of a retroviral vector encoding alkaline phosphatase and an oligonucleotide library.

    Han Jiang

    Full Text Available The mammalian inner ear subserves the special senses of hearing and balance. The auditory and vestibular sensory epithelia consist of mechanically sensitive hair cells and associated supporting cells. Hearing loss and balance dysfunction are most frequently caused by compromise of hair cells and/or their innervating neurons. The development of gene- and cell-based therapeutics will benefit from a thorough understanding of the molecular basis of patterning and cell fate specification in the mammalian inner ear. This includes analyses of cell lineages and cell dispersals across anatomical boundaries (such as sensory versus nonsensory territories. The goal of this study was to conduct retroviral lineage analysis of the embryonic day 11.5(E11.5 mouse otic vesicle. A replication-defective retrovirus encoding human placental alkaline phosphatase (PLAP and a variable 24-bp oligonucleotide tag was microinjected into the E11.5 mouse otocyst. PLAP-positive cells were microdissected from cryostat sections of the postnatal inner ear and subjected to nested PCR. PLAP-positive cells sharing the same sequence tag were assumed to have arisen from a common progenitor and are clonally related. Thirty five multicellular clones consisting of an average of 3.4 cells per clone were identified in the auditory and vestibular sensory epithelia, ganglia, spiral limbus, and stria vascularis. Vestibular hair cells in the posterior crista were related to one another, their supporting cells, and nonsensory epithelial cells lining the ampulla. In the organ of Corti, outer hair cells were related to a supporting cell type and were tightly clustered. By contrast, spiral ganglion neurons, interdental cells, and Claudius' cells were related to cells of the same type and could be dispersed over hundreds of microns. These data contribute new information about the developmental potential of mammalian otic precursors in vivo.

  2. Construction of improved temperature-sensitive and mobilizable vectors and their use for constructing mutations in the adhesin-encoding acm gene of poorly transformable clinical Enterococcus faecium strains.

    Nallapareddy, Sreedhar R; Singh, Kavindra V; Murray, Barbara E


    Inactivation by allelic exchange in clinical isolates of the emerging nosocomial pathogen Enterococcus faecium has been hindered by lack of efficient tools, and, in this study, transformation of clinical isolates was found to be particularly problematic. For this reason, a vector for allelic replacement (pTEX5500ts) was constructed that includes (i) the pWV01-based gram-positive repAts replication region, which is known to confer a high degree of temperature intolerance, (ii) Escherichia coli oriR from pUC18, (iii) two extended multiple-cloning sites located upstream and downstream of one of the marker genes for efficient cloning of flanking regions for double-crossover mutagenesis, (iv) transcriptional terminator sites to terminate undesired readthrough, and (v) a synthetic extended promoter region containing the cat gene for allelic exchange and a high-level gentamicin resistance gene, aph(2'')-Id, to distinguish double-crossover recombination, both of which are functional in gram-positive and gram-negative backgrounds. To demonstrate the functionality of this vector, the vector was used to construct an acm (encoding an adhesin to collagen from E. faecium) deletion mutant of a poorly transformable multidrug-resistant E. faecium endocarditis isolate, TX0082. The acm-deleted strain, TX6051 (TX0082Deltaacm), was shown to lack Acm on its surface, which resulted in the abolishment of the collagen adherence phenotype observed in TX0082. A mobilizable derivative (pTEX5501ts) that contains oriT of Tn916 to facilitate conjugative transfer from the transformable E. faecalis strain JH2Sm::Tn916 to E. faecium was also constructed. Using this vector, the acm gene of a nonelectroporable E. faecium wound isolate was successfully interrupted. Thus, pTEX5500ts and its mobilizable derivative demonstrated their roles as important tools by helping to create the first reported allelic replacement in E. faecium; the constructed this acm deletion mutant will be useful for assessing the

  3. Combined virus-like particle and fusion protein-encoding DNA vaccination of cotton rats induces protection against respiratory syncytial virus without causing vaccine-enhanced disease

    Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Jong Seok [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); National Institute of Biological Resources, Incheon (Korea, Republic of); Kim, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Yu-Na; Kim, Min-Chul [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Animal and Plant Quarantine Agency, Gyeonggi-do, Gimcheon, Gyeongsangbukdo (Korea, Republic of); Cho, Minkyoung [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Kang, Sang-Moo, E-mail: [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States)


    A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.

  4. Cloning of cDNA sequences encoding cowpea (Vigna unguiculata) vicilins: Computational simulations suggest a binding mode of cowpea vicilins to chitin oligomers.

    Rocha, Antônio J; Sousa, Bruno L; Girão, Matheus S; Barroso-Neto, Ito L; Monteiro-Júnior, José E; Oliveira, José T A; Nagano, Celso S; Carneiro, Rômulo F; Monteiro-Moreira, Ana C O; Rocha, Bruno A M; Freire, Valder N; Grangeiro, Thalles B


    Vicilins are 7S globulins which constitute the major seed storage proteins in leguminous species. Variant vicilins showing differential binding affinities for chitin have been implicated in the resistance and susceptibility of cowpea to the bruchid Callosobruchus maculatus. These proteins are members of the cupin superfamily, which includes a wide variety of enzymes and non-catalytic seed storage proteins. The cupin fold does not share similarity with any known chitin-biding domain. Therefore, it is poorly understood how these storage proteins bind to chitin. In this work, partial cDNA sequences encoding β-vignin, the major component of cowpea vicilins, were obtained from developing seeds. Three-dimensional molecular models of β-vignin showed the characteristic cupin fold and computational simulations revealed that each vicilin trimer contained 3 chitin-binding sites. Interaction models showed that chito-oligosaccharides bound to β-vignin were stabilized mainly by hydrogen bonds, a common structural feature of typical carbohydrate-binding proteins. Furthermore, many of the residues involved in the chitin-binding sites of β-vignin are conserved in other 7S globulins. These results support previous experimental evidences on the ability of vicilin-like proteins from cowpea and other leguminous species to bind in vitro to chitin as well as in vivo to chitinous structures of larval C. maculatus midgut. Copyright © 2018. Published by Elsevier B.V.

  5. Isolation and characterization of a cDNA encoding phytochrome A in the non-photosynthetic parasitic plant, Orobanche minor Sm.

    Trakulnaleamsai, Chitra; Okazawa, Atsushi; An, Chung-Il; Kajiyama, Shin'ichiro; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio


    In this study, the isolation and characterization of a phytochrome A (PHYA) homologous cDNA (OmPHYA) in the non-photosynthetic holoparasitic plant Orobanche minor are described. The present findings provide the first report of the presence of a PHYA homolog in the holoparasite. This study found that OmPHYA is of similar size to the other PHYAs of green plants and shows 72, 77, and 77% amino acid sequence identity with PHYA in Arabidopsis, potato, and tobacco respectively. The OmPHYA contains a conserved chromophore attachment cysteine at position 323. Although OmPHYA shows high sequence identity with other PHYAs in green plants, 13 amino acid substitutions located in both the N and C-terminal domains are observed (a total of 26 amino acids). OmPHYA is encoded by a single gene within the O. minor genome. The abundance of the OmPHYA transcript as well as nuclear translocation of OmphyA occurs in a light-dependent manner.

  6. Combined virus-like particle and fusion protein-encoding DNA vaccination of cotton rats induces protection against respiratory syncytial virus without causing vaccine-enhanced disease

    Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin; Lee, Jong Seok; Kim, Yu-Jin; Lee, Yu-Na; Kim, Min-Chul; Cho, Minkyoung; Kang, Sang-Moo


    A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.

  7. Alphavirus Replicon DNA Vectors Expressing Ebola GP and VP40 Antigens Induce Humoral and Cellular Immune Responses in Mice

    Shoufeng Ren


    Full Text Available Ebola virus (EBOV causes severe hemorrhagic fevers in humans, and no approved therapeutics or vaccine is currently available. Glycoprotein (GP is the major protective antigen of EBOV, and can generate virus-like particles (VLPs by co-expression with matrix protein (VP40. In this study, we constructed a recombinant Alphavirus Semliki Forest virus (SFV replicon vector DREP to express EBOV GP and matrix viral protein (VP40. EBOV VLPs were successfully generated and achieved budding from 293 cells after co-transfection with DREP-based GP and VP40 vectors (DREP-GP+DREP-VP40. Vaccination of BALB/c mice with DREP-GP, DREP-VP40, or DREP-GP+DREP-VP40 vectors, followed by immediate electroporation resulted in a mixed IgG subclass production, which recognized EBOV GP and/or VP40 proteins. This vaccination regimen also led to the generation of both Th1 and Th2 cellular immune responses in mice. Notably, vaccination with DREP-GP and DREP-VP40, which produces both GP and VP40 antigens, induced a significantly higher level of anti-GP IgG2a antibody and increased IFN-γ secreting CD8+ T-cell responses relative to vaccination with DREP-GP or DREP-VP40 vector alone. Our study indicates that co-expression of GP and VP40 antigens based on the SFV replicon vector generates EBOV VLPs in vitro, and vaccination with recombinant DREP vectors containing GP and VP40 antigens induces Ebola antigen-specific humoral and cellular immune responses in mice. This novel approach provides a simple and efficient vaccine platform for Ebola disease prevention.

  8. Sequential priming with simian immunodeficiency virus (SIV) DNA vaccines, with or without encoded cytokines, and a replicating adenovirus-SIV recombinant followed by protein boosting does not control a pathogenic SIVmac251 mucosal challenge.

    Demberg, Thorsten; Boyer, Jean D; Malkevich, Nina; Patterson, L Jean; Venzon, David; Summers, Ebonita L; Kalisz, Irene; Kalyanaraman, V S; Lee, Eun Mi; Weiner, David B; Robert-Guroff, Marjorie


    Previously, combination DNA/nonreplicating adenovirus (Ad)- or poxvirus-vectored vaccines have strongly protected against SHIV(89.6P), DNAs expressing cytokines have modulated immunity elicited by DNA vaccines, and replication-competent Ad-recombinant priming and protein boosting has strongly protected against simian immunodeficiency virus (SIV) challenge. Here we evaluated a vaccine strategy composed of these promising components. Seven rhesus macaques per group were primed twice with multigenic SIV plasmid DNA with or without interleukin-12 (IL-12) DNA or IL-15 DNA. After a multigenic replicating Ad-SIV immunization, all groups received two booster immunizations with SIV gp140 and SIV Nef protein. Four control macaques received control DNA plasmids, empty Ad vector, and adjuvant. All vaccine components were immunogenic, but the cytokine DNAs had little effect. Macaques that received IL-15-DNA exhibited higher peak anti-Nef titers, a more rapid anti-Nef anamnestic response postchallenge, and expanded CD8(CM) T cells 2 weeks postchallenge compared to the DNA-only group. Other immune responses were indistinguishable between groups. Overall, no protection against intrarectal challenge with SIV(mac251) was observed, although immunized non-Mamu-A*01 macaques as a group exhibited a statistically significant 1-log decline in acute viremia compared to non-Mamu-A*01 controls. Possible factors contributing to the poor outcome include administration of cytokine DNAs to sites different from the Ad recombinants (intramuscular and intratracheal, respectively), too few DNA priming immunizations, a suboptimal DNA delivery method, failure to ensure delivery of SIV and cytokine plasmids to the same cell, and instability and short half-life of the IL-15 component. Future experiments should address these issues to determine if this combination approach is able to control a virulent SIV challenge.

  9. Arginine-rich cross-linking peptides with different SV40 nuclear localization signal content as vectors for intranuclear DNA delivery.

    Bogacheva, Mariia; Egorova, Anna; Slita, Anna; Maretina, Marianna; Baranov, Vladislav; Kiselev, Anton


    The major barriers for intracellular DNA transportation by cationic polymers are their toxicity, poor endosomal escape and inefficient nuclear uptake. Therefore, we designed novel modular peptide-based carriers modified with SV40 nuclear localization signal (NLS). Core peptide consists of arginine, histidine and cysteine residues for DNA condensation, endosomal escape promotion and interpeptide cross-linking, respectively. We investigated three polyplexes with different NLS content (10 mol%, 50 mol% and 90 mol% of SV40 NLS) as vectors for intranuclear DNA delivery. All carriers tested were able to condense DNA, to protect it from DNAase I and were not toxic to the cells. We observed that cell cycle arrest by hydroxyurea did not affect transfection efficacy of NLS-modified carriers which we confirmed using quantitative confocal microscopy analysis. Overall, peptide carrier modified with 90 mol% of SV40 NLS provided efficient transfection and nuclear uptake in non-dividing cells. Thus, incorporation of NLS into arginine-rich cross-linking peptides is an adequate approach to the development of efficient intranuclear gene delivery vehicles. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Intranasal delivery of cationic PLGA nano/microparticles-loaded FMDV DNA vaccine encoding IL-6 elicited protective immunity against FMDV challenge.

    Gang Wang

    Full Text Available Mucosal vaccination has been demonstrated to be an effective means of eliciting protective immunity against aerosol infections of foot and mouth disease virus (FMDV and various approaches have been used to improve mucosal response to this pathogen. In this study, cationic PLGA (poly(lactide-co-glycolide nano/microparticles were used as an intranasal delivery vehicle as a means administering FMDV DNA vaccine encoding the FMDV capsid protein and the bovine IL-6 gene as a means of enhancing mucosal and systemic immune responses in animals. Three eukaryotic expression plasmids with or without bovine IL-6 gene (pc-P12A3C, pc-IL2AP12A3C and pc-P12AIL3C were generated. The two latter plasmids were designed with the IL-6 gene located either before or between the P12A and 3C genes, respectively, as a means of determining if the location of the IL-6 gene affected capsid assembly and the subsequent immune response. Guinea pigs and rats were intranasally vaccinated with the respective chitosan-coated PLGA nano/microparticles-loaded FMDV DNA vaccine formulations. Animals immunized with pc-P12AIL3C (followed by animals vaccinated with pc-P12A3C and pc-IL2AP12A3C developed the highest levels of antigen-specific serum IgG and IgA antibody responses and the highest levels of sIgA (secretory IgA present in mucosal tissues. However, the highest levels of neutralizing antibodies were generated in pc-IL2AP12A3C-immunized animals (followed by pc-P12AIL3C- and then in pc-P12A3C-immunized animals. pc-IL2AP12A3C-immunized animals also developed stronger cell mediated immune responses (followed by pc-P12AIL3C- and pc-P12A3C-immunized animals as evidenced by antigen-specific T-cell proliferation and expression levels of IFN-γ by both CD4+ and CD8+ splenic T cells. The percentage of animals protected against FMDV challenge following immunizations with pc-IL2AP12A3C, pc-P12AIL3C or pc-P12A3C were 3/5, 1/5 and 0/5, respectively. These data suggested that intranasal delivery

  11. DNA sequence characterisation and phylogeography of Lymnaea cousini and related species, vectors of fascioliasis in northern Andean countries, with description of L. meridensis n. sp. (Gastropoda: Lymnaeidae

    Bargues M Dolores


    Full Text Available Abstract Background Livestock fascioliasis is a problem throughout Ecuador, Colombia and Venezuela, mainly in Andean areas where the disease also appears to affect humans. Transmission patterns and epidemiological scenarios of liver fluke infection have shown to differ according to the lymnaeid vector snail species involved. These Andean countries present the vectors Lymnaea cousini, L. bogotensis and L. ubaquensis, unknown in the rest of Latin America. An exhaustive combined haplotype study of these species is performed by means of DNA sequencing of the nuclear ribosomal 18S RNA gene, ITS-2 and ITS-1, and mitochondrial DNA cox1 gene. Results The conserved 5.8S rDNA sequence corroborated that no pseudogenes are involved in the numerous non-microsatellite/minisatellite-related indels appearing between the ITS-2 and ITS-1 sequences when comparing different L. cousini - L. bogotensis populations. Sequence analyses and phylogenetic reconstruction methods including other lymnaeid vector species show that (i L. bogotensis is a synonym of L. cousini, (ii L. ubaquensis is a synonym of Pseudosuccinea columella, and (iii populations of L. cousini hitherto known from Venezuelan highlands indeed belong to a new species for which the name L. meridensis n. sp. is proposed. This new species is described and a complete phenotypic differentiation provided. Conclusions ITS-2, ITS-1 and cox1 prove to be good markers for specimen classification and haplotype characterisation of these morphologically similar lymnaeids in endemic areas. Analysis of the 18S gene and phylogenetic reconstructions indicate that L. cousini and L. meridensis n. sp. cluster in an evolutionary line different from the one of P. columella, despite their external resemblance. This suggests an evolutionary phenotypic convergence related to similar environments and which has given rise to frequent specimen misclassification. Body size and phylogenetic relationships of L. meridensis n. sp. with

  12. DNA sequence characterisation and phylogeography of Lymnaea cousini and related species, vectors of fascioliasis in northern Andean countries, with description of L. meridensis n. sp. (Gastropoda: Lymnaeidae)


    Background Livestock fascioliasis is a problem throughout Ecuador, Colombia and Venezuela, mainly in Andean areas where the disease also appears to affect humans. Transmission patterns and epidemiological scenarios of liver fluke infection have shown to differ according to the lymnaeid vector snail species involved. These Andean countries present the vectors Lymnaea cousini, L. bogotensis and L. ubaquensis, unknown in the rest of Latin America. An exhaustive combined haplotype study of these species is performed by means of DNA sequencing of the nuclear ribosomal 18S RNA gene, ITS-2 and ITS-1, and mitochondrial DNA cox1 gene. Results The conserved 5.8S rDNA sequence corroborated that no pseudogenes are involved in the numerous non-microsatellite/minisatellite-related indels appearing between the ITS-2 and ITS-1 sequences when comparing different L. cousini - L. bogotensis populations. Sequence analyses and phylogenetic reconstruction methods including other lymnaeid vector species show that (i) L. bogotensis is a synonym of L. cousini, (ii) L. ubaquensis is a synonym of Pseudosuccinea columella, and (iii) populations of L. cousini hitherto known from Venezuelan highlands indeed belong to a new species for which the name L. meridensis n. sp. is proposed. This new species is described and a complete phenotypic differentiation provided. Conclusions ITS-2, ITS-1 and cox1 prove to be good markers for specimen classification and haplotype characterisation of these morphologically similar lymnaeids in endemic areas. Analysis of the 18S gene and phylogenetic reconstructions indicate that L. cousini and L. meridensis n. sp. cluster in an evolutionary line different from the one of P. columella, despite their external resemblance. This suggests an evolutionary phenotypic convergence related to similar environments and which has given rise to frequent specimen misclassification. Body size and phylogenetic relationships of L. meridensis n. sp. with well-known vectors as

  13. Utilization of a tobacco rattle virus vector to clone an Nicotiana benthamiana cDNA library for VIGS

    Virus-induced gene silencing (VIGS) is an efficient and rapid method to identify plant gene functions. One of the most widely used VIGS vectors is Tobacco rattle virus (TRV) which has been used successfully for RNA interference (RNAi) in N. benthamiana and tomato. We previously modified a TRV VIGS v...

  14. Ectopic expression of the erythrocyte band 3 anion exchange protein, using a new avian retrovirus vector

    Fuerstenberg, S; Beug, H; Introna, M


    into protein. Using the Escherichia coli beta-galactosidase gene cloned into the vector as a test construct, expression of enzyme activity could be detected in 90 to 95% of transfected target cells and in 80 to 85% of subsequently infected cells. In addition, a cDNA encoding the avian erythrocyte band 3 anion...... exchange protein has been expressed from the vector in both chicken embryo fibroblasts and QT6 cells and appears to function as an active, plasma membrane-based anion transporter. The ectopic expression of band 3 protein provides a visual marker for vector function in these cells....

  15. Effects of Circular DNA Length on Transfection Efficiency by Electroporation into HeLa Cells.

    Hornstein, Benjamin D; Roman, Dany; Arévalo-Soliz, Lirio M; Engevik, Melinda A; Zechiedrich, Lynn


    The ability to produce extremely small and circular supercoiled vectors has opened new territory for improving non-viral gene therapy vectors. In this work, we compared transfection of supercoiled DNA vectors ranging from 383 to 4,548 bp, each encoding shRNA against GFP under control of the H1 promoter. We assessed knockdown of GFP by electroporation into HeLa cells. All of our vectors entered cells in comparable numbers when electroporated with equal moles of DNA. Despite similar cell entry, we found length-dependent differences in how efficiently the vectors knocked down GFP. As vector length increased up to 1,869 bp, GFP knockdown efficiency per mole of transfected DNA increased. From 1,869 to 4,257 bp, GFP knockdown efficiency per mole was steady, then decreased with increasing vector length. In comparing GFP knockdown with equal masses of vectors, we found that the shorter vectors transfect more efficiently per nanogram of DNA transfected. Our results rule out cell entry and DNA mass as determining factors for gene knockdown efficiency via electroporation. The length-dependent effects we have uncovered are likely explained by differences in nuclear translocation or transcription. These data add an important step towards clinical applications of non-viral vector delivery.

  16. Generation of a Lineage II Powassan Virus (Deer Tick Virus) cDNA Clone: Assessment of Flaviviral Genetic Determinants of Tick and Mosquito Vector Competence.

    Kenney, Joan L; Anishchenko, Michael; Hermance, Meghan; Romo, Hannah; Chen, Ching-I; Thangamani, Saravanan; Brault, Aaron C


    The Flavivirus genus comprises a diverse group of viruses that utilize a wide range of vertebrate hosts and arthropod vectors. The genus includes viruses that are transmitted solely by mosquitoes or vertebrate hosts as well as viruses that alternate transmission between mosquitoes or ticks and vertebrates. Nevertheless, the viral genetic determinants that dictate these unique flaviviral host and vector specificities have been poorly characterized. In this report, a cDNA clone of a flavivirus that is transmitted between ticks and vertebrates (Powassan lineage II, deer tick virus [DTV]) was generated and chimeric viruses between the mosquito/vertebrate flavivirus, West Nile virus (WNV), were constructed. These chimeric viruses expressed the prM and E genes of either WNV or DTV in the heterologous nonstructural (NS) backbone. Recombinant chimeric viruses rescued from cDNAs were characterized for their capacity to grow in vertebrate and arthropod (mosquito and tick) cells as well as for in vivo vector competence in mosquitoes and ticks. Results demonstrated that the NS elements were insufficient to impart the complete mosquito or tick growth phenotypes of parental viruses; however, these NS genetic elements did contribute to a 100- and 100,000-fold increase in viral growth in vitro in tick and mosquito cells, respectively. Mosquito competence was observed only with parental WNV, while infection and transmission potential by ticks were observed with both DTV and WNV-prME/DTV chimeric viruses. These data indicate that NS genetic elements play a significant, but not exclusive, role for vector usage of mosquito- and tick-borne flaviviruses.

  17. A versatile system for USER cloning-based assembly of expression vectors for mammalian cell engineering.

    Anne Mathilde Lund

    Full Text Available A new versatile mammalian vector system for protein production, cell biology analyses, and cell factory engineering was developed. The vector system applies the ligation-free uracil-excision based technique--USER cloning--to rapidly construct mammalian expression vectors of multiple DNA fragments and with maximum flexibility, both for choice of vector backbone and cargo. The vector system includes a set of basic vectors and a toolbox containing a multitude of DNA building blocks including promoters, terminators, selectable marker- and reporter genes, and sequences encoding an internal ribosome entry site, cellular localization signals and epitope- and purification tags. Building blocks in the toolbox can be easily combined as they contain defined and tested Flexible Assembly Sequence Tags, FASTs. USER cloning with FASTs allows rapid swaps of gene, promoter or selection marker in existing plasmids and simple construction of vectors encoding proteins, which are fused to fluorescence-, purification-, localization-, or epitope tags. The mammalian expression vector assembly platform currently allows for the assembly of up to seven fragments in a single cloning step with correct directionality and with a cloning efficiency above 90%. The functionality of basic vectors for FAST assembly was tested and validated by transient expression of fluorescent model proteins in CHO, U-2-OS and HEK293 cell lines. In this test, we included many of the most common vector elements for heterologous gene expression in mammalian cells, in addition the system is fully extendable by other users. The vector system is designed to facilitate high-throughput genome-scale studies of mammalian cells, such as the newly sequenced CHO cell lines, through the ability to rapidly generate high-fidelity assembly of customizable gene expression vectors.

  18. Hydrodynamic delivery of plasmid DNA encoding human FcγR-Ig dimers blocks immune-complex mediated inflammation in mice.

    Shashidharamurthy, R; Machiah, D; Bozeman, E N; Srivatsan, S; Patel, J; Cho, A; Jacob, J; Selvaraj, P


    Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcγ receptor-Ig fusion molecules (FcγR-Igs) in mice by administering FcγR-Ig plasmid DNAs hydrodynamically and compared their effectiveness with purified molecules in blocking immune-complex (IC)-mediated inflammation in mice. The concentration of hydrodynamically expressed FcγR-Igs (CD16A(F)-Ig, CD32A(R)-Ig and CD32A(H)-Ig) reached a maximum of 130 μg ml(-1) of blood within 24 h after plasmid DNA administration. The in vivo half-life of FcγR-Igs was found to be 9-16 days and western blot analysis showed that the FcγR-Igs were expressed as a homodimer. The hydrodynamically expressed FcγR-Igs blocked 50-80% of IC-mediated inflammation up to 3 days in a reverse passive Arthus reaction model. Comparative analysis with purified molecules showed that hydrodynamically expressed FcγR-Igs are more efficient than purified molecules in blocking IC-mediated inflammation and had a higher half-life. In summary, these results suggest that the administration of a plasmid vector with the FcγR-Ig gene can be used to study the consequences of blocking IC binding to FcγRs during the development of inflammatory diseases. This approach may have potential therapeutic value in treating IC-mediated inflammatory autoimmune diseases such as lupus, arthritis and autoimmune vasculitis.

  19. Displacement encoder

    Hesketh, T.G.


    In an optical encoder, light from an optical fibre input A is encoded by means of the encoding disc and is subsequently collected for transmission via optical fibre B. At some point in the optical path between the fibres A and B, the light is separated into component form by means of a filtering or dispersive system and each colour component is associated with a respective one of the coding channels of the disc. In this way, the significance of each bit of the coded information is represented by a respective colour thereby enabling the components to be re-combined for transmission by the fibre B without loss of information. (author)

  20. Flipped-Adversarial AutoEncoders

    Zhang, Jiyi; Dang, Hung; Lee, Hwee Kuan; Chang, Ee-Chien


    We propose a flipped-Adversarial AutoEncoder (FAAE) that simultaneously trains a generative model G that maps an arbitrary latent code distribution to a data distribution and an encoder E that embodies an "inverse mapping" that encodes a data sample into a latent code vector. Unlike previous hybrid approaches that leverage adversarial training criterion in constructing autoencoders, FAAE minimizes re-encoding errors in the latent space and exploits adversarial criterion in the data space. Exp...

  1. Efficient gene transfer into nondividing cells by adeno-associated virus-based vectors.

    Podsakoff, G; Wong, K K; Chatterjee, S


    Gene transfer vectors based on adeno-associated virus (AAV) are emerging as highly promising for use in human gene therapy by virtue of their characteristics of wide host range, high transduction efficiencies, and lack of cytopathogenicity. To better define the biology of AAV-mediated gene transfer, we tested the ability of an AAV vector to efficiently introduce transgenes into nonproliferating cell populations. Cells were induced into a nonproliferative state by treatment with the DNA synthesis inhibitors fluorodeoxyuridine and aphidicolin or by contact inhibition induced by confluence and serum starvation. Cells in logarithmic growth or DNA synthesis arrest were transduced with vCWR:beta gal, an AAV-based vector encoding beta-galactosidase under Rous sarcoma virus long terminal repeat promoter control. Under each condition tested, vCWR:beta Gal expression in nondividing cells was at least equivalent to that in actively proliferating cells, suggesting that mechanisms for virus attachment, nuclear transport, virion uncoating, and perhaps some limited second-strand synthesis of AAV vectors were present in nondividing cells. Southern hybridization analysis of vector sequences from cells transduced while in DNA synthetic arrest and expanded after release of the block confirmed ultimate integration of the vector genome into cellular chromosomal DNA. These findings may provide the basis for the use of AAV-based vectors for gene transfer into quiescent cell populations such as totipotent hematopoietic stem cells.

  2. AAV Vectorization of DSB-mediated Gene Editing Technologies.

    Moser, Rachel J; Hirsch, Matthew L


    Recent work both at the bench and the bedside demonstrate zinc-finger nucleases (ZFNs), CRISPR/Cas9, and other programmable site-specific endonuclease technologies are being successfully utilized within and alongside AAV vectors to induce therapeutically relevant levels of directed gene editing within the human chromosome. Studies from past decades acknowledge that AAV vector genomes are enhanced substrates for homology-directed repair in the presence or absence of targeted DNA damage within the host genome. Additionally, AAV vectors are currently the most efficient format for in vivo gene delivery with no vector related complications in >100 clinical trials for diverse diseases. At the same time, advancements in the design of custom-engineered site-specific endonucleases and the utilization of elucidated endonuclease formats have resulted in efficient and facile genetic engineering for basic science and for clinical therapies. AAV vectors and gene editing technologies are an obvious marriage, using AAV for the delivery of repair substrate and/or a gene encoding a designer endonuclease; however, while efficient delivery and enhanced gene targeting by vector genomes are advantageous, other attributes of AAV vectors are less desirable for gene editing technologies. This review summarizes the various roles that AAV vectors play in gene editing technologies and provides insight into its trending applications for the treatment of genetic diseases.

  3. Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

    Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E


    Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable

  4. A new baseline for fascioliasis in Venezuela: lymnaeid vectors ascertained by DNA sequencing and analysis of their relationships with human and animal infection


    Background Human and animal fascioliasis poses serious public health problems in South America. In Venezuela, livestock infection represents an important veterinary problem whereas there appear to be few human cases reported, most of which are passively detected in health centres. However, results of recent surveys suggest that the situation may be underestimated in particular areas. To obtain a baseline for future fascioliasis assessment, studies were undertaken by means of rDNA ITS-2 and ITS-1 and mtDNA cox1 sequencing to clarify the specific status of Venezuelan lymnaeids, their geographical distribution and fascioliasis transmission capacity, by comparison with other American countries and other continents. Results Results obtained completely change the lymnaeid scenario known so far. The relatively rich lymnaeid fauna of Venezuela has been proven to include (i) Lymnaea meridensis and L. neotropica as the only native members, (ii) L. cubensis and Pseudosuccinea columella introduced from the Caribbean area, and (iii) Galba truncatula and L. schirazensis introduced from the Old World. The absence of representatives of the stagnicoline and Radix groups is remarkable. Four species are fascioliasis vectors: G. truncatula, L. cubensis and L. neotropica, which have the capacity to give rise to human endemic areas, and P. columella, which is a source of animal infection and is responsible for the spread of disease. Vector capacity in the apparently highland endemic L. meridensis is to be confimed, although may be expected given its phylogenetic relationships. Similarly as elsewhere, the non-transmitting L. schirazensis has been confused with L. cubensis, also with G. truncatula and possibly with L. neotropica. Conclusions The new scenario leads to the re-opening of many disease aspects. In Venezuela, altitude appears to be the main factor influencing fascioliasis distribution. Human infection shows an altitude pattern similar to other Andean countries, although a

  5. A new baseline for fascioliasis in Venezuela: lymnaeid vectors ascertained by DNA sequencing and analysis of their relationships with human and animal infection

    Artigas Patricio


    Full Text Available Abstract Background Human and animal fascioliasis poses serious public health problems in South America. In Venezuela, livestock infection represents an important veterinary problem whereas there appear to be few human cases reported, most of which are passively detected in health centres. However, results of recent surveys suggest that the situation may be underestimated in particular areas. To obtain a baseline for future fascioliasis assessment, studies were undertaken by means of rDNA ITS-2 and ITS-1 and mtDNA cox1 sequencing to clarify the specific status of Venezuelan lymnaeids, their geographical distribution and fascioliasis transmission capacity, by comparison with other American countries and other continents. Results Results obtained completely change the lymnaeid scenario known so far. The relatively rich lymnaeid fauna of Venezuela has been proven to include (i Lymnaea meridensis and L. neotropica as the only native members, (ii L. cubensis and Pseudosuccinea columella introduced from the Caribbean area, and (iii Galba truncatula and L. schirazensis introduced from the Old World. The absence of representatives of the stagnicoline and Radix groups is remarkable. Four species are fascioliasis vectors: G. truncatula, L. cubensis and L. neotropica, which have the capacity to give rise to human endemic areas, and P. columella, which is a source of animal infection and is responsible for the spread of disease. Vector capacity in the apparently highland endemic L. meridensis is to be confimed, although may be expected given its phylogenetic relationships. Similarly as elsewhere, the non-transmitting L. schirazensis has been confused with L. cubensis, also with G. truncatula and possibly with L. neotropica. Conclusions The new scenario leads to the re-opening of many disease aspects. In Venezuela, altitude appears to be the main factor influencing fascioliasis distribution. Human infection shows an altitude pattern similar to other Andean

  6. A new baseline for fascioliasis in Venezuela: lymnaeid vectors ascertained by DNA sequencing and analysis of their relationships with human and animal infection.

    Bargues, M Dolores; González, L Carolina; Artigas, Patricio; Mas-Coma, Santiago


    Human and animal fascioliasis poses serious public health problems in South America. In Venezuela, livestock infection represents an important veterinary problem whereas there appear to be few human cases reported, most of which are passively detected in health centres. However, results of recent surveys suggest that the situation may be underestimated in particular areas. To obtain a baseline for future fascioliasis assessment, studies were undertaken by means of rDNA ITS-2 and ITS-1 and mtDNA cox1 sequencing to clarify the specific status of Venezuelan lymnaeids, their geographical distribution and fascioliasis transmission capacity, by comparison with other American countries and other continents. Results obtained completely change the lymnaeid scenario known so far. The relatively rich lymnaeid fauna of Venezuela has been proven to include (i) Lymnaea meridensis and L. neotropica as the only native members, (ii) L. cubensis and Pseudosuccinea columella introduced from the Caribbean area, and (iii) Galba truncatula and L. schirazensis introduced from the Old World. The absence of representatives of the stagnicoline and Radix groups is remarkable. Four species are fascioliasis vectors: G. truncatula, L. cubensis and L. neotropica, which have the capacity to give rise to human endemic areas, and P. columella, which is a source of animal infection and is responsible for the spread of disease. Vector capacity in the apparently highland endemic L. meridensis is to be confimed, although may be expected given its phylogenetic relationships. Similarly as elsewhere, the non-transmitting L. schirazensis has been confused with L. cubensis, also with G. truncatula and possibly with L. neotropica. The new scenario leads to the re-opening of many disease aspects. In Venezuela, altitude appears to be the main factor influencing fascioliasis distribution. Human infection shows an altitude pattern similar to other Andean countries, although a differing highland/lowland impact on

  7. Genetic variations of ND5 gene of mtDNA in populations of Anopheles sinensis (Diptera: Culicidae) malaria vector in China


    Background Anopheles sinensis is a principal vector for Plasmodium vivax malaria in most parts of China. Understanding of genetic structure and genetic differentiation of the mosquito should contribute to the vector control and malaria elimination in China. Methods The present study investigated the genetic structure of An. sinensis populations using a 729 bp fragment of mtDNA ND5 among 10 populations collected from seven provinces in China. Results ND5 was polymorphic by single mutations within three groups of An. sinensis that were collected from 10 different geographic populations in China. Out of 140 specimens collected from 10 representative sites, 84 haplotypes and 71 variable positions were determined. The overall level of genetic differentiation of An. sinensis varied from low to moderate across China and with a FST range of 0.00065 – 0.341. Genealogy analysis clustered the populations of An. sinensis into three main clusters. Each cluster shared one main haplotype. Pairwise variations within populations were higher (68.68%) than among populations (31.32%) and with high fixation index (FST = 0.313). The results of the present study support population growth and expansion in the An. sinensis populations from China. Three clusters of An. sinensis populations were detected in this study with each displaying different proportion patterns over seven Chinese provinces. No correlation between genetic and geographic distance was detected in overall populations of An. sinensis (R2 = 0.058; P = 0.301). Conclusions The results indicate that the ND5 gene of mtDNA is highly polymorphic in An. sinensis and has moderate genetic variability in the populations of this mosquito in China. Demographic and spatial results support evidence of expansion in An. sinensis populations. PMID:24192424

  8. Construction of expression vectors carrying mouse peroxisomal ...



    Nov 16, 2009 ... The aim of this study was to construct expression vectors carrying mouse peroxisomal protein gene. (PEP-cDNA) in prokaryotic and mammalian expression vectors in chimeric cDNA types, encompassing. GST and FLAG with PEP-cDNA. PEP-cDNA was sub-cloned in pGEX6p2 prokaryotic expression ...

  9. An HIV-1 encoded peptide mimics the DNA binding loop of NF-κB and binds thioredoxin with high affinity

    Su Guoping; Wang Min; Taylor, Ethan Will


    Pro-fs is a human immunodeficiency virus type 1 (HIV-l)-encoded putative selenoprotein, predicted by a theoretical analysis of the viral genome; it is potentially expressed by a -1 frameshift from the protease coding region. Pro-fs has significant sequence similarity to the DNA binding loop of nuclear factor kappa B (NF-κB), which is known to bind thioredoxin (Trx). We hypothesize that the putative HIV-1 pro-fs gene product functions by mimicry of NF-κB via binding to Trx. The hypothesis was tested in vitro by co-immunoprecipitation and GST-pull down assays, using a purified mutant pro-fs protein, in which the two potential selenocysteine residues were mutated to cysteines, in order to permit expression in bacteria. Both experiments showed that pro-fs binds to human wild type Trx (Trx-wt) with high affinity. Mutation of the two conserved cysteine residues in the Trx active site redox center to serine (Ser) (Trx-CS) weakened but failed to abolish the interaction. In pro-fs-transfected 293T cells, using confocal microscopy and fluorescence resonance energy transfer (FRET), we have observed that pro-fs localizes in cell nuclei and forms oligomers. Upon stimulation by phorbol 12-myristate 13-acetate (PMA), Trx translocates into cell nuclei. Significant FRET efficiency was detected in the nuclei of PMA-stimulated 293T cells co-expressing fluorescence-tagged pro-fs and Trx-wt or Trx-CS. These results indicate that in living cells the double cysteine mutant of pro-fs binds to both Trx and Trx-CS with high affinity, suggesting that Trx-pro-fs binding is a structurally-specific interaction, involving more of the Trx molecule than just its active site cysteine residues. These results establish the capacity for functional mimicry of the Trx binding ability of the NF-κB/Rel family of transcription factors by the putative HIV-1 pro-fs protein

  10. Induction of CML28-specific cytotoxic T cell responses using co-transfected dendritic cells with CML28 DNA vaccine and SOCS1 small interfering RNA expression vector

    Zhou Hongsheng; Zhang Donghua; Wang Yaya; Dai Ming; Zhang Lu; Liu Wenli; Liu Dan; Tan Huo; Huang Zhenqian


    CML28 is an attractive target for antigen-specific immunotherapy. SOCS1 represents an inhibitory control mechanism for DC antigen presentation and the magnitude of adaptive immunity. In this study, we evaluated the potential for inducing CML28-specific cytotoxic T lymphocytes (CTL) responses by dendritic cells (DCs)-based vaccination. We constructed a CML28 DNA vaccine and a SOCS1 siRNA vector and then cotransfect monocyte-derived DCs. Flow cytometry analysis showed gene silencing of SOCS1 resulted in higher expressions of costimulative moleculars in DCs. Mixed lymphocyte reaction (MLR) indicated downregulation of SOCS1 stronger capability to stimulate proliferation of responder cell in DCs. The CTL assay revealed transfected DCs effectively induced autologous CML28-specific CTL responses and the lytic activities induced by SOCS1-silenced DCs were significantly higher compared with those induced by SOCS1-expressing DCs. These results in our study indicates gene silencing of SOCS1 remarkably enhanced the cytotoxicity efficiency of CML28 DNA vaccine in DCs

  11. Herpes simplex virus type 1-derived recombinant and amplicon vectors.

    Fraefel, Cornel; Marconi, Peggy; Epstein, Alberto L


    Herpes simplex virus type 1 (HSV-1) is a human pathogen whose lifestyle is based on a long-term dual interaction with the infected host, being able to establish both lytic and latent infections. The virus genome is a 153 kbp double-stranded DNA molecule encoding more than 80 genes. The interest of HSV-1 as gene transfer vector stems from its ability to infect many different cell types, both quiescent and proliferating cells, the very high packaging capacity of the virus capsid, the outstanding neurotropic adaptations that this virus has evolved, and the fact that it never integrates into the cellular chromosomes, thus avoiding the risk of insertional mutagenesis. Two types of vectors can be derived from HSV-1, recombinant vectors and amplicon vectors, and different methodologies have been developed to prepare large stocks of each type of vector. This chapter summarizes (1) the two approaches most commonly used to prepare recombinant vectors through homologous recombination, either in eukaryotic cells or in bacteria, and (2) the two methodologies currently used to generate helper-free amplicon vectors, either using a bacterial artificial chromosome (BAC)-based approach or a Cre/loxP site-specific recombination strategy.

  12. DNA multigene sequencing of topotypic specimens of the fascioliasis vector Lymnaea diaphana and phylogenetic analysis of the genus Pectinidens (Gastropoda

    Maria Dolores Bargues


    Full Text Available Freshwater lymnaeid snails are crucial in defining transmission and epidemiology of fascioliasis. In South America, human endemic areas are related to high altitudes in Andean regions. The species Lymnaea diaphana has, however, been involved in low altitude areas of Chile, Argentina and Peru where human infection also occurs. Complete nuclear ribosomal DNA 18S, internal transcribed spacer (ITS-2 and ITS-1 and fragments of mitochondrial DNA 16S and cytochrome c oxidase (cox1 genes of L. diaphana specimens from its type locality offered 1,848, 495, 520, 424 and 672 bp long sequences. Comparisons with New and Old World Galba/Fossaria, Palaearctic stagnicolines, Nearctic stagnicolines, Old World Radix and Pseudosuccinea allowed to conclude that (i L. diaphana shows sequences very different from all other lymnaeids, (ii each marker allows its differentiation, except cox1 amino acid sequence, and (iii L. diaphana is not a fossarine lymnaeid, but rather an archaic relict form derived from the oldest North American stagnicoline ancestors. Phylogeny and large genetic distances support the genus Pectinidens as the first stagnicoline representative in the southern hemisphere, including colonization of extreme world regions, as most southern Patagonia, long time ago. The phylogenetic link of L. diaphana with the stagnicoline group may give light to the aforementioned peculiar low altitude epidemiological scenario of fascioliasis.

  13. Radiation-Induced Upregulation of Gene Expression From Adenoviral Vectors Mediated by DNA Damage Repair and Regulation

    Nokisalmi, Petri; Rajecki, Maria; Pesonen, Sari; Escutenaire, Sophie; Soliymani, Rabah; Tenhunen, Mikko; Ahtiainen, Laura; Hemminki, Akseli


    Purpose: In the present study, we evaluated the combination of replication-deficient adenoviruses and radiotherapy in vitro. The purpose of the present study was to analyze the mechanism of radiation-mediated upregulation of adenoviral transgene expression. Methods and Materials: Adenoviral transgene expression (luciferase or green fluorescent protein) was studied with and without radiation in three cell lines: breast cancer M4A4-LM3, prostate cancer PC-3MM2, and lung cancer LNM35/enhanced green fluorescent protein. The effect of the radiation dose, modification of the viral capsid, and five different transgene promoters were studied. The cellular responses were studied using mass spectrometry and immunofluorescence analysis. Double strand break repair was modulated by inhibitors of heat shock protein 90, topoisomerase-I, and DNA protein kinase, and transgene expression was measured. Results: We found that a wide range of radiation doses increased adenoviral transgene expression regardless of the cell line, transgene, promoter, or viral capsid modification. Treatment with adenovirus, radiation, and double strand break repair inhibitors resulted in persistence of double strand breaks and subsequent increases in adenovirus transgene expression. Conclusions: Radiation-induced enhancement of adenoviral transgene expression is linked to DNA damage recognition and repair. Radiation induces a global cellular response that results in increased production of RNA and proteins, including adenoviral transgene products. This study provides a mechanistic rationale for combining radiation with adenoviral gene delivery.

  14. Phylogeographic pattern and extensive mitochondrial DNA divergence disclose a species complex within the Chagas disease vector Triatoma dimidiata.

    Fernando A Monteiro

    Full Text Available BACKGROUND: Triatoma dimidiata is among the main vectors of Chagas disease in Latin America. However, and despite important advances, there is no consensus about the taxonomic status of phenotypically divergent T. dimidiata populations, which in most recent papers are regarded as subspecies. METHODOLOGY AND FINDINGS: A total of 126 cyt b sequences (621 bp long were produced for specimens from across the species range. Forty-seven selected specimens representing the main cyt b clades observed (after a preliminary phylogenetic analysis were also sequenced for an ND4 fragment (554 bp long and concatenated with their respective cyt b sequences to produce a combined data set totalling 1175 bp/individual. Bayesian and Maximum-Likelihood phylogenetic analyses of both data sets (cyt b, and cyt b+ND4 disclosed four strongly divergent (all pairwise Kimura 2-parameter distances >0.08, monophyletic groups: Group I occurs from Southern Mexico through Central America into Colombia, with Ecuadorian specimens resembling Nicaraguan material; Group II includes samples from Western-Southwestern Mexico; Group III comprises specimens from the Yucatán peninsula; and Group IV consists of sylvatic samples from Belize. The closely-related, yet formally recognized species T. hegneri from the island of Cozumel falls within the divergence range of the T. dimidiata populations studied. CONCLUSIONS: We propose that Groups I-IV, as well as T. hegneri, should be regarded as separate species. In the Petén of Guatemala, representatives of Groups I, II, and III occur in sympatry; the absence of haplotypes with intermediate genetic distances, as shown by multimodal mismatch distribution plots, clearly indicates that reproductive barriers actively promote within-group cohesion. Some sylvatic specimens from Belize belong to a different species - likely the basal lineage of the T. dimidiata complex, originated ~8.25 Mya. The evidence presented here strongly supports the proposition

  15. Introduction of optical reporter gene into cancer and immune cells using lentiviral vector

    Min, Jung Joon; Le, Uyenchi N.; Moon, Sung Min; Heo, Young Jun; Song, Ho Chun; Bom, Hee Seung; Kim, Yeon Soo


    For some applications such as gene therapy or reporter gene imaging, a gene has to be introduced into the organism of interest. Adenoviral vectors are capable of transducing both replicating and non-dividing cells. The adenoviral vectors do not integrate their DNA into host DNA, but do lead to an immune response. Lentiviruses belong to the retrovirus family and are capable of infecting both dividing and non-dividing cells. The human immunodeficiency virus (HIV) is an example of a lentavirus. A disabled HIV virus has been developed and could be used for in vivo gene delivery. A portion of the viral genome which encodes for accessory proteins canbe deleted without affecting production of the vector and efficiency of infection. Lentiviral delivery into various rodent tissues shows sustained expression of the transgene of up to six months. Furthermore, there seems to be little or no immune response with these vectors. These lentiviral vectors hold significant promise for in vivo gene delivery. We constructed lentiviral vector encoding firefly luciferase (Fluc) and eGFP. Fluc-eGFP fusion gene was inserted into multiple cloning sites of pLentiM1.3 vector. Reporter gene (Fluc-eGFP) was designed to be driven by murine CMV promoter with enhanced efficacy of transgene expression as compared to human CMV promoter. We transfected pLenti1.3-Fluc into human cervix cancer cell line (HeLa) and murine T lymphocytes. We also constructed adenovirus encoding Fluc and transfected to HeLa and T cells. This LentiM1.3-Fluc was transfected into HeLa cells and murine T lymphocytes in vitro, showing consistent expression of eGFP under the fluorescence microscopy from the 2nd day of transfection. Firefly luciferase reporter gene was not expressed in immune cells when it is mediated by adenovirus. Lentivirus was validated as a useful vector for both immune and cancer cells

  16. Viral Vectors for Use in the Development of Biodefense Vaccines

    Lee, John S; Hadjipanayis, Angela G; Parker, Michael D


    .... DNA vectors, live-attenuated viruses and bacteria, recombinant proteins combined with adjuvant, and viral- or bacterial-vectored vaccines have been developed as countermeasures against many potential...

  17. Vaccination with DNA encoding truncated enterohemorrhagic Escherichia coli (EHEC factor for adherence-1 gene (efa-1’ confers protective immunity to mice infected with E. coli O157:H7

    Roberto eRiquelme-Neira


    Full Text Available Enterohemorrhagic Escherichia coli (EHEC O157:H7 is the predominant causative agent of hemorrhagic colitis in humans and is the cause of haemolytic uraemic syndrome and other illnesses. Cattle have been implicated as the main reservoir of this organism. Here, we evaluated the immunogenicity and protective efficacy of a DNA vaccine encoding conserved sequences of truncated EHEC factor for adherence-1 (efa-1’ in a mouse model. Intranasal administration of plasmid DNA carrying the efa-1’ gene (pVAXefa-1’ into C57BL/6 mice elicited both humoral and cellular immune responses. In animals immunized with pVAXefa-1`, EHEC-secreted protein-specific IgM and IgG antibodies were detected in sera at day 45. Anti-EHEC-secreted protein sIgA was also detected in nasal and bronchoalveolar lavages. In addition, antigen-specific T-cell-proliferation, IL-10 and IFN-γ were observed upon re-stimulation with either heat-killed bacteria or EHEC-secreted proteins. Vaccinated animals were also protected against challenge with E. coli O157:H7 strain EDL933. These results suggest that DNA vaccine encoding efa-1´ have therapeutic potential in interventions against EHEC infections. This approach could lead to a new strategy in the production of vaccines that prevent infections in cattle.

  18. Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.

    Kant, Ravi; Dasgupta, Indranil


    Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.

  19. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα-encoding (GNAS genomic imprinting domain are associated with performance traits

    Mullen Michael P


    Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs

  20. Tlys, a newly identified Sulfolobus spindle-shaped virus 1 transcript expressed in the lysogenic state, encodes a DNA-binding protein interacting at the promoters of the early genes

    Fusco, Salvatore; She, Qunxin; Bartolucci, Simonetta


    -binding motif. DNA-binding assays demonstrated that the recombinant F55, purified from Escherichia coli, is indeed a putative transcription factor able to recognize site specifically target sequences in the promoters of the early induced T5, T6, and Tind transcripts, as well as of its own promoter. Binding...... the growth of the lysogenic host. The correponding gene f55 lies between two transcriptional units (T6 and Tind) that are upregulated upon UV irradiation. The open reading frame f55 encodes a 6.3-kDa protein which shows sequence identity with negative regulators that fold into the ribbon-helix-helix DNA....... Taking together the transcriptional analysis data and the biochemical evidences, we surmise that the protein F55 is involved in the regulation of the lysogenic state of SSV1....

  1. Construction of New Campylobacter Cloning Vectors and a New Mutational Cat Cassette


    mutational cat cassette PE - 61102A PR - 3M161102 6. AUTHOR(S) TA - BS13AK Yao R, Aim RA, Trust TJ, Guerry P WU- 1291 7. PERFORMING ORGANIZATION NAME(S) AND...mutational cat cassette %~ccesion For (Site-specific mutagenesis; recombinant DNA; multiple cloning site; PCR; shuttle vectors) NTIS CRA&I OTIC TAB E...campylobacter portion of these vectors, only three CAT , Cm acetyllraaseriase; car, gene encoding CAT , Cm, restriction sites in the IacZ MCS remain unique

  2. AAV vector encoding human VEGF165–transduced pectineus muscular flaps increase the formation of new tissue through induction of angiogenesis in an in vivo chamber for tissue engineering: A technique to enhance tissue and vessels in microsurgically engineered tissue

    Silvia Moimas


    Full Text Available In regenerative medicine, new approaches are required for the creation of tissue substitutes, and the interplay between different research areas, such as tissue engineering, microsurgery and gene therapy, is mandatory. In this article, we report a modification of a published model of tissue engineering, based on an arterio-venous loop enveloped in a cross-linked collagen–glycosaminoglycan template, which acts as an isolated chamber for angiogenesis and new tissue formation. In order to foster tissue formation within the chamber, which entails on the development of new vessels, we wondered whether we might combine tissue engineering with a gene therapy approach. Based on the well-described tropism of adeno-associated viral vectors for post-mitotic tissues, a muscular flap was harvested from the pectineus muscle, inserted into the chamber and transduced by either AAV vector encoding human VEGF165 or AAV vector expressing the reporter gene β-galactosidase, as a control. Histological analysis of the specimens showed that muscle transduction by AAV vector encoding human VEGF165 resulted in enhanced tissue formation, with a significant increase in the number of arterioles within the chamber in comparison with the previously published model. Pectineus muscular flap, transduced by adeno-associated viral vectors, acted as a source of the proangiogenic factor vascular endothelial growth factor, thus inducing a consistent enhancement of vessel growth into the newly formed tissue within the chamber. In conclusion, our present findings combine three different research fields such as microsurgery, tissue engineering and gene therapy, suggesting and showing the feasibility of a mixed approach for regenerative medicine.

  3. Integration of adeno-associated virus vectors in CD34+ human hematopoietic progenitor cells after transduction.

    Fisher-Adams, G; Wong, K K; Podsakoff, G; Forman, S J; Chatterjee, S


    Gene transfer vectors based on adeno-associated virus (AAV) appear promising because of their high transduction frequencies regardless of cell cycle status and ability to integrate into chromosomal DNA. We tested AAV-mediated gene transfer into a panel of human bone marrow or umbilical cord-derived CD34+ hematopoietic progenitor cells, using vectors encoding several transgenes under the control of viral and cellular promoters. Gene transfer was evaluated by (1) chromosomal integration of vector sequences and (2) analysis of transgene expression. Southern hybridization and fluorescence in situ hybridization analysis of transduced CD34 genomic DNA showed the presence of integrated vector sequences in chromosomal DNA in a portion of transduced cells and showed that integrated vector sequences were replicated along with cellular DNA during mitosis. Transgene expression in transduced CD34 cells in suspension cultures and in myeloid colonies differentiating in vitro from transduced CD34 cells approximated that predicted by the multiplicity of transduction. This was true in CD34 cells from different donors, regardless of the transgene or selective pressure. Comparisons of CD34 cell transduction either before or after cytokine stimulation showed similar gene transfer frequencies. Our findings suggest that AAV transduction of CD34+ hematopoietic progenitor cells is efficient, can lead to stable integration in a population of transduced cells, and may therefore provide the basis for safe and efficient ex vivo gene therapy of the hematopoietic system.

  4. Chondroitin sulfate-polyethylenimine copolymer-coated superparamagnetic iron oxide nanoparticles as an efficient magneto-gene carrier for microRNA-encoding plasmid DNA delivery

    Lo, Yu-Lun; Chou, Han-Lin; Liao, Zi-Xian; Huang, Shih-Jer; Ke, Jyun-Han; Liu, Yu-Sheng; Chiu, Chien-Chih; Wang, Li-Fang


    MicroRNA-128 (miR-128) is an attractive therapeutic molecule with powerful glioblastoma regulation properties. However, miR-128 lacks biological stability and leads to poor delivery efficacy in clinical applications. In our previous study, we demonstrated two effective transgene carriers, including polyethylenimine (PEI)-decorated superparamagnetic iron oxide nanoparticles (SPIONs) as well as chemically-conjugated chondroitin sulfate-PEI copolymers (CPs). In this contribution, we report optimized conditions for coating CPs onto the surfaces of SPIONs, forming CPIOs, for magneto-gene delivery systems. The optimized weight ratio of the CPs and SPIONs is 2 : 1, which resulted in the formation of a stable particle as a good transgene carrier. The hydrodynamic diameter of the CPIOs is ~136 nm. The gel electrophoresis results demonstrate that the weight ratio of CPIO/DNA required to completely encapsulate pDNA is >=3. The in vitro tests of CPIO/DNA were done in 293 T, CRL5802, and U87-MG cells in the presence and absence of an external magnetic field. The magnetofection efficiency of CPIO/DNA was measured in the three cell lines with or without fetal bovine serum (FBS). CPIO/DNA exhibited remarkably improved gene expression in the presence of the magnetic field and 10% FBS as compared with a gold non-viral standard, PEI/DNA, and a commercial magnetofection reagent, PolyMag/DNA. In addition, CPIO/DNA showed less cytotoxicity than PEI/DNA and PolyMag/DNA against the three cell lines. The transfection efficiency of the magnetoplex improved significantly with an assisted magnetic field. In miR-128 delivery, a microRNA plate array and fluorescence in situ hybridization were used to demonstrate that CPIO/pMIRNA-128 indeed expresses more miR-128 with the assisted magnetic field than without. In a biodistribution test, CPIO/Cy5-DNA showed higher accumulation at the tumor site where an external magnet is placed nearby.MicroRNA-128 (miR-128) is an attractive therapeutic molecule

  5. cDNA for the human β2-adrenergic receptor: a protein with multiple membrane-spanning domains and encoded by a gene whose chromosomal location is shared with that of the receptor for platelet-derived growth factor

    Kobilka, B.K.; Dixon, R.A.F.; Frielle, T.


    The authors have isolated and sequenced a cDNA encoding the human β 2 -adrenergic receptor. The deduced amino acid sequence (413 residues) is that of a protein containing seven clusters of hydrophobic amino acids suggestive of membrane-spanning domains. While the protein is 87% identical overall with the previously cloned hamster β 2 -adrenergic receptor, the most highly conserved regions are the putative transmembrane helices (95% identical) and cytoplasmic loops (93% identical), suggesting that these regions of the molecule harbor important functional domains. Several of the transmembrane helices also share lesser degrees of identity with comparable regions of select members of the opsin family of visual pigments. They have localized the gene for the β 2 -adrenergic receptor to q31-q32 on chromosome 5. This is the same position recently determined for the gene encoding the receptor for platelet-derived growth factor and is adjacent to that for the FMS protooncogene, which encodes the receptor for the macrophage colony-stimulating factor

  6. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

    Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao


    We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

  7. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi


    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  8. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef


    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  9. Identification of cDNA encoding an additional α subunit of a human GTP-binding protein: Expression of three αi subtypes in human tissues and cell lines

    Kim, S.; Ang, S.L.; Bloch, D.B.; Bloch, K.D.; Kawahara, Y.; Tolman, C.; Lee, R.; Seidman, J.G.; Neer, E.J.


    The guanine nucleotide-binding proteins (G proteins), which mediate hormonal regulation of many membrane functions, are composed of α, β, and γ subunits. The authors have cloned and characterized cDNA from a human T-cell library encoding a form of α i that is different from the human α i subtypes previously reported. α i is the α subunit of a class of G proteins that inhibits adenylate cyclase and regulates other enzymes and ion channels. This cDNA encodes a polypeptide of 354 amino acids and is assigned to encode the α i-3 subtype of G proteins on the basis of its similarity to other α i -like cDNAs and the presence of a predicted site for ADP ribosylation by pertussis toxin. They have determined the expression of mRNA for this and two other subtypes of human α i (α i-1 and α i-2 ) in a variety of human fetal tissues and in human cell lines. All three α i subtypes were present in the tissues tested. However, analysis of individual cell types reveals specificity of α i-1 expression. mRNA for α i-1 is absent in T cells, B cells, and monocytes but is present in other cell lines. The finding of differential expression of α i-1 genes may permit characterization of distinct physiological roles for this α i subunit. mRNA for α i-2 and α i-3 was found in all the primary and transformed cell lines tested. Thus, some cells contain all three α i subtypes. This observation raises the question of how cells prevent cross talk among receptors that are coupled to effectors through such similar α proteins

  10. Cloning of a cDNA encoding the rat high molecular weight neurofilament peptide (NF-H): Developmental and tissue expression in the rat, and mapping of its human homologue to chromosomes 1 and 22

    Lieberburg, I.; Spinner, N.; Snyder, S.


    Neurofilaments (NFs) are the intermediate filaments specific to nervous tissue. Three peptides with apparent molecular masses of approximately 68 (NF-L), 145 (NF-M), and 200 (NF-H) kDa appear to be the major components of NF. The expression of these peptides is specific to nervous tissue and is developmentally regulated. Recently, complete cDNAs encoding NF-L and NF-M, and partial cDNAs encoding NF-H, have been described. To better understand the normal pathophysiology of NFs the authors chose to clone the cDNA encoding the rat NF-H peptide. Using monoclonal antibodies that recognized NF-H, they screened a rat brain λgt11 library and identified a clone that contained a 2,100-nucleotide cDNA insert representing the carboxyl-terminal portion of the NF-H protein. Levels of NF-H mRNA varied 20-fold among brain regions, with highest levels in pons/medulla, spinal cord, and cerebellum, and lowest levels in olfactory bulb and hypothalamus. Based on these results, the authors infer that half of the developmental increase and most of the interregional variation in the levels of the NF-H mRNA are mediated through message stabilization. Sequence information revealed that the carboxyl-terminal region of the NF-H peptide contained a unique serine-, proline-, alanine-, glutamic acid-, and lysine-rich repeat. Genomic blots revealed a single copy of the gene in the rat genome and two copies in the human genome. In situ hybridizations performed on human chromosomes mapped the NF-H gene to chromosomes 1 and 22

  11. Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

    Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K


    We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

  12. DNA vaccines encoding proteins from wild-type and attenuated canine distemper virus protect equally well against wild-type virus challenge.

    Nielsen, Line; Jensen, Trine Hammer; Kristensen, Birte; Jensen, Tove Dannemann; Karlskov-Mortensen, Peter; Lund, Morten; Aasted, Bent; Blixenkrone-Møller, Merete


    Immunity induced by DNA vaccines containing the hemagglutinin (H) and nucleoprotein (N) genes of wild-type and attenuated canine distemper virus (CDV) was investigated in mink (Mustela vison), a highly susceptible natural host of CDV. All DNA-immunized mink seroconverted, and significant levels of virus-neutralizing (VN) antibodies were present on the day of challenge with wild-type CDV. The DNA vaccines also primed the cell-mediated memory responses, as indicated by an early increase in the number of interferon-gamma (IFN-γ)-producing lymphocytes after challenge. Importantly, the wild-type and attenuated CDV DNA vaccines had a long-term protective effect against wild-type CDV challenge. The vaccine-induced immunity induced by the H and N genes from wild-type CDV and those from attenuated CDV was comparable. Because these two DNA vaccines were shown to protect equally well against wild-type virus challenge, it is suggested that the genetic/antigenic heterogeneity between vaccine strains and contemporary wild-type strains are unlikely to cause vaccine failure.

  13. Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption


    Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

  14. Molecular cloning of a cDNA encoding human calumenin, expression in Escherichia coli and analysis of its Ca2+-binding activity

    Vorum, H; Liu, X; Madsen, Peder


    By microsequencing and cDNA cloning we have identified the transformation-sensitive protein No. IEF SSP 9302 as the human homologue of calumenin. The nucleotide sequence predicts a 315 amino acid protein with high identity to murine and rat calumenin. The deduced protein contains a 19 amino acid N...

  15. Enhanced immune response and protective effects of nano-chitosan-based DNA vaccine encoding T cell epitopes of Esat-6 and FL against Mycobacterium tuberculosis infection.

    Ganzhu Feng

    Full Text Available Development of a novel and effective vaccine against Mycobacterium tuberculosis (M.tb is a challenging for preventing TB infection. In this study, a novel nanoparticle-based recombinant DNA vaccine was developed, which contains Esat-6 three T cell epitopes (Esat-6/3e and fms-like tyrosine kinase 3 ligand (FL genes (termed Esat-6/3e-FL, and was enveloped with chitosan (CS nanoparticles (nano-chitosan. The immunologic and protective efficacy of the nano-chitosan-based DNA vaccine (termed nano-Esat-6/3e-FL was assessed in C57BL/6 mice after intramuscular prime vaccination with the plasmids DNA and nasal boost with the Esat-6/3e peptides. The results showed that the immunized mice remarkably elicited enhanced T cell responses and protection against M.tb H37Rv challenge. These findings indicate that the nano-chitosan can significantly elevate the immunologic and protective effects of the DNA vaccine, and the nano-Esat-6/3e-FL is a useful vaccine for preventing M.tb infection in mice.

  16. DNA binding sites recognised in vitro by a knotted class 1 homeodomain protein encoded by the hooded gene, k, in barley (Hordeum vulgare)

    Krusell, L; Rasmussen, I; Gausing, K


    of knotted1 from maize was isolated from barley seedlings and expressed as a maltose binding protein fusion in E. coli. The purified HvH21-fusion protein selected DNA fragments with 1-3 copies of the sequence TGAC. Gel shift experiments showed that the TGAC element was required for binding and the results...

  17. Vector analysis

    Newell, Homer E


    When employed with skill and understanding, vector analysis can be a practical and powerful tool. This text develops the algebra and calculus of vectors in a manner useful to physicists and engineers. Numerous exercises (with answers) not only provide practice in manipulation but also help establish students' physical and geometric intuition in regard to vectors and vector concepts.Part I, the basic portion of the text, consists of a thorough treatment of vector algebra and the vector calculus. Part II presents the illustrative matter, demonstrating applications to kinematics, mechanics, and e

  18. About vectors

    Hoffmann, Banesh


    From his unusual beginning in ""Defining a vector"" to his final comments on ""What then is a vector?"" author Banesh Hoffmann has written a book that is provocative and unconventional. In his emphasis on the unresolved issue of defining a vector, Hoffmann mixes pure and applied mathematics without using calculus. The result is a treatment that can serve as a supplement and corrective to textbooks, as well as collateral reading in all courses that deal with vectors. Major topics include vectors and the parallelogram law; algebraic notation and basic ideas; vector algebra; scalars and scalar p

  19. Tensor GSVD of Patient- and Platform-Matched Tumor and Normal DNA Copy-Number Profiles Uncovers Chromosome Arm-Wide Patterns of Tumor-Exclusive Platform-Consistent Alterations Encoding for Cell Transformation and Predicting Ovarian Cancer Survival

    Sankaranarayanan, Preethi; Schomay, Theodore E.; Aiello, Katherine A.; Alter, Orly


    The number of large-scale high-dimensional datasets recording different aspects of a single disease is growing, accompanied by a need for frameworks that can create one coherent model from multiple tensors of matched columns, e.g., patients and platforms, but independent rows, e.g., probes. We define and prove the mathematical properties of a novel tensor generalized singular value decomposition (GSVD), which can simultaneously find the similarities and dissimilarities, i.e., patterns of varying relative significance, between any two such tensors. We demonstrate the tensor GSVD in comparative modeling of patient- and platform-matched but probe-independent ovarian serous cystadenocarcinoma (OV) tumor, mostly high-grade, and normal DNA copy-number profiles, across each chromosome arm, and combination of two arms, separately. The modeling uncovers previously unrecognized patterns of tumor-exclusive platform-consistent co-occurring copy-number alterations (CNAs). We find, first, and validate that each of the patterns across only 7p and Xq, and the combination of 6p+12p, is correlated with a patient’s prognosis, is independent of the tumor’s stage, the best predictor of OV survival to date, and together with stage makes a better predictor than stage alone. Second, these patterns include most known OV-associated CNAs that map to these chromosome arms, as well as several previously unreported, yet frequent focal CNAs. Third, differential mRNA, microRNA, and protein expression consistently map to the DNA CNAs. A coherent picture emerges for each pattern, suggesting roles for the CNAs in OV pathogenesis and personalized therapy. In 6p+12p, deletion of the p21-encoding CDKN1A and p38-encoding MAPK14 and amplification of RAD51AP1 and KRAS encode for human cell transformation, and are correlated with a cell’s immortality, and a patient’s shorter survival time. In 7p, RPA3 deletion and POLD2 amplification are correlated with DNA stability, and a longer survival. In Xq

  20. Tensor GSVD of patient- and platform-matched tumor and normal DNA copy-number profiles uncovers chromosome arm-wide patterns of tumor-exclusive platform-consistent alterations encoding for cell transformation and predicting ovarian cancer survival.

    Preethi Sankaranarayanan

    Full Text Available The number of large-scale high-dimensional datasets recording different aspects of a single disease is growing, accompanied by a need for frameworks that can create one coherent model from multiple tensors of matched columns, e.g., patients and platforms, but independent rows, e.g., probes. We define and prove the mathematical properties of a novel tensor generalized singular value decomposition (GSVD, which can simultaneously find the similarities and dissimilarities, i.e., patterns of varying relative significance, between any two such tensors. We demonstrate the tensor GSVD in comparative modeling of patient- and platform-matched but probe-independent ovarian serous cystadenocarcinoma (OV tumor, mostly high-grade, and normal DNA copy-number profiles, across each chromosome arm, and combination of two arms, separately. The modeling uncovers previously unrecognized patterns of tumor-exclusive platform-consistent co-occurring copy-number alterations (CNAs. We find, first, and validate that each of the patterns across only 7p and Xq, and the combination of 6p+12p, is correlated with a patient's prognosis, is independent of the tumor's stage, the best predictor of OV survival to date, and together with stage makes a better predictor than stage alone. Second, these patterns include most known OV-associated CNAs that map to these chromosome arms, as well as several previously unreported, yet frequent focal CNAs. Third, differential mRNA, microRNA, and protein expression consistently map to the DNA CNAs. A coherent picture emerges for each pattern, suggesting roles for the CNAs in OV pathogenesis and personalized therapy. In 6p+12p, deletion of the p21-encoding CDKN1A and p38-encoding MAPK14 and amplification of RAD51AP1 and KRAS encode for human cell transformation, and are correlated with a cell's immortality, and a patient's shorter survival time. In 7p, RPA3 deletion and POLD2 amplification are correlated with DNA stability, and a longer survival

  1. The effects of gamma irradiation on growth and expression of genes encoding DNA repair-related proteins in Lombardy poplar (Populus nigra var. italica).

    Nishiguchi, Mitsuru; Nanjo, Tokihiko; Yoshida, Kazumasa


    In this study, to elucidate the mechanisms of adaptation and tolerance to ionizing radiation in woody plants, we investigated the various biological effects of γ-rays on the Lombardy poplar (Populus nigra L. var. italica Du Roi). We detected abnormal leaf shape and color, fusion, distorted venation, shortened internode, fasciation and increased axillary shoots in γ-irradiated poplar plants. Acute γ-irradiation with a dose of 100Gy greatly reduced the height, stem diameter and biomass of poplar plantlets. After receiving doses of 200 and 300Gy, all the plantlets stopped growing, and then most of them withered after 4-10 weeks of γ-irradiation. Comet assays showed that nuclear DNA in suspension-cultured poplar cells had been damaged by γ-rays. To determine whether DNA repair-related proteins are involved in the response to γ-rays in Lombardy poplars, we cloned the PnRAD51, PnLIG4, PnKU70, PnXRCC4, PnPCNA and PnOGG1 cDNAs and investigated their mRNA expression. The PnRAD51, PnLIG4, PnKU70, PnXRCC4 and PnPCNA mRNAs were increased by γ-rays, but the PnOGG1 mRNA was decreased. Moreover, the expression of PnLIG4, PnKU70 and PnRAD51 was also up-regulated by Zeocin known as a DNA cleavage agent. These observations suggest that the morphogenesis, growth and protective gene expression in Lombardy poplars are severely affected by the DNA damage and unknown cellular events caused by γ-irradiation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.).

    Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y


    The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

  3. Impact of a Central Scaffold on the Binding Affinity of Fragment Pairs Isolated from DNA-Encoded Self-Assembling Chemical Libraries.

    Bigatti, Martina; Dal Corso, Alberto; Vanetti, Sara; Cazzamalli, Samuele; Rieder, Ulrike; Scheuermann, Jörg; Neri, Dario; Sladojevich, Filippo


    The screening of encoded self-assembling chemical libraries allows the identification of fragment pairs that bind to adjacent pockets on target proteins of interest. For practical applications, it is necessary to link these ligand pairs into discrete organic molecules, devoid of any nucleic acid component. Here we describe the discovery of a synergistic binding pair for acid alpha-1 glycoprotein and a chemical strategy for the identification of optimal linkers, connecting the two fragments. The procedure yielded a set of small organic ligands, the best of which exhibited a dissociation constant of 9.9 nm, as measured in solution by fluorescence polarization. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. In vitro efficacy of a gene-activated nerve guidance conduit incorporating non-viral PEI-pDNA nanoparticles carrying genes encoding for NGF, GDNF and c-Jun.

    Lackington, William A; Raftery, Rosanne M; O'Brien, Fergal J


    Despite the success of tissue engineered nerve guidance conduits (NGCs) for the treatment of small peripheral nerve injuries, autografts remain the clinical gold standard for larger injuries. The delivery of neurotrophic factors from conduits might enhance repair for more effective treatment of larger injuries but the efficacy of such systems is dependent on a safe, effective platform for controlled and localised therapeutic delivery. Gene therapy might offer an innovative approach to control the timing, release and level of neurotrophic factor production by directing cells to transiently sustain therapeutic protein production in situ. In this study, a gene-activated NGC was developed by incorporating non-viral polyethyleneimine-plasmid DNA (PEI-pDNA) nanoparticles (N/P 7 ratio, 2μg dose) with the pDNA encoding for nerve growth factor (NGF), glial derived neurotrophic factor (GDNF) or the transcription factor c-Jun. The physicochemical properties of PEI-pDNA nanoparticles, morphology, size and charge, were shown to be suitable for gene delivery and demonstrated high Schwann cell transfection efficiency (60±13%) in vitro. While all three genes showed therapeutic potential in terms of enhancing neurotrophic cytokine production while promoting neurite outgrowth, delivery of the gene encoding for c-Jun showed the greatest capacity to enhance regenerative cellular processes in vitro. Ultimately, this gene-activated NGC construct was shown to be capable of transfecting both Schwann cells (S42 cells) and neuronal cells (PC12 and dorsal root ganglia) in vitro, demonstrating potential for future therapeutic applications in vivo. The basic requirements of biomaterial-based nerve guidance conduits have now been well established and include being able to bridge a nerve injury to support macroscopic guidance between nerve stumps, while being strong enough to withstand longitudinal tension and circumferential compression, in addition to being mechanically sound to facilitate

  5. Elementary vectors

    Wolstenholme, E Œ


    Elementary Vectors, Third Edition serves as an introductory course in vector analysis and is intended to present the theoretical and application aspects of vectors. The book covers topics that rigorously explain and provide definitions, principles, equations, and methods in vector analysis. Applications of vector methods to simple kinematical and dynamical problems; central forces and orbits; and solutions to geometrical problems are discussed as well. This edition of the text also provides an appendix, intended for students, which the author hopes to bridge the gap between theory and appl

  6. Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

    Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L


    Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. LAMP-1-chimeric DNA vaccines enhance the antibody response in Japanese flounder, Paralichthys olivaceus.

    Rondón-Barragán, Iang; Nozaki, Reiko; Hirono, Ikuo; Kondo, Hidehiro


    DNA vaccination is one method to protect farmed fish from viral and bacterial diseases. Chimeric antigens encoded by DNA vaccines have been shown to increase the resistance to viral diseases. Here, we sequenced the gene encoding lysosome-associated membrane protein-1 from Japanese flounder, Paralichthys olivaceus, (JfLAMP-1) and assessed its use in a chimeric DNA vaccine fused with the major capsule protein (MCP) from red seabream iridovirus (RSIV). JfLAMP-1 cDNA has a length of 1248 bp encoding 415 aa, which contains transmembrane and cytoplasmic domains. JfLAMP-1 is constitutively expressed in several tissues and its expression in spleen was upregulated following injection of formalin-killed cells (FKC) of Edwardsiella tarda. Immunofluorescence analysis showed that JfLAMP-1 is distributed in the small and large granules in the cytoplasm and groups close to the nucleus. The DNA encoding the luminal domain of JfLAMP-1 was replaced with the gene for the RSIV MCP, and the construct was cloned in an expression vector (pCIneo). Fish vaccinated with pCLAMP-MCP had significantly higher antibody levels than fish vaccinated with pCIneo vector harboring the MCP gene (p day 30 post-vaccination. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J


    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  9. Construction of expression vectors carrying mouse peroxisomal ...

    The aim of this study was to construct expression vectors carrying mouse peroxisomal protein gene (PEP-cDNA) in prokaryotic and mammalian expression vectors in ... pGEX6p2-PEP and pUcD3-FLAG-PEP constructed vectors were transformed into the one shot TOP10 and JM105 bacterial competent cells, respectively.

  10. Molecular cloning and cold shock induced overexpression of the DNA encoding phor sensor domain from Mycobacterium tuberculosis as a target molecule for novel anti-tubercular drugs

    Langi, Gladys Emmanuella Putri; Moeis, Maelita R.; Ihsanawati, Giri-Rachman, Ernawati Arifin


    Mycobacterium tuberculosis (Mtb), the sole cause of Tuberculosis (TB), is still a major global problem. The discovery of new anti-tubercular drugs is needed to face the increasing TB cases, especially to prevent the increase of cases with resistant Mtb. A potential novel drug target is the Mtb PhoR sensor domain protein which is the histidine kinase extracellular domain for receiving environmental signals. This protein is the initial part of the two-component system PhoR-PhoP regulating 114 genes related to the virulence of Mtb. In this study, the gene encoding PhoR sensor domain (SensPhoR) was subcloned from pGEM-T SensPhoR from the previous study (Suwanto, 2012) to pColdII. The construct pColdII SensPhoR was confirmed through restriction analysis and sequencing. Using the construct, SensPhoR was overexpressed at 15°C using Escherichia coli BL21 (DE3). Low temperature was chosen because according to the solubility prediction program of recombinant proteins from The University of Oklahama, the PhoR sensor domain has a chance of 79.8% to be expressed as insoluble proteins in Escherichia coli's (E. coli) cytoplasm. This prediction is also supported by other similar programs: PROSO and PROSO II. The SDS PAGE result indicated that the PhoR sensor domain recombinant protein was overexpressed. For future studies, this protein will be purified and used for structure analysis which can be used to find potential drugs through rational drug design.

  11. High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss

    Pereira Fred A


    Full Text Available Abstract Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45. The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330. Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5. Conclusion These data suggest that the IVS2-2A>G variant may not occur more frequently in hearing impaired subjects than in controls. The identification of five potential alternative splice acceptor sites in

  12. [Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

    Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng


    To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

  13. Engineering of magnetic DNA nanoparticles for tumor-targeted therapy

    Hosseinkhani, Hossein; Chen Yiru; He Wenjie; Hong Poda; Yu, Dah-Shyong; Domb, Abraham J.


    This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe 2+ solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.

  14. Engineering of magnetic DNA nanoparticles for tumor-targeted therapy

    Hosseinkhani, Hossein, E-mail: [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Chen Yiru [National Yang-Ming University, Department of Biomedical Engineering (China); He Wenjie; Hong Poda [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Yu, Dah-Shyong [Nanomedicine Research Center, National Defense Medical Center (China); Domb, Abraham J. [Institute of Drug Research, The Center for Nanoscience and Nanotechnology, School of Pharmacy, Faculty of Medicine, Hebrew University of Jerusalem (Israel)


    This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe{sup 2+} solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.

  15. Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.

    Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E


    In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply

  16. Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries

    Gray Elizabeth C


    Full Text Available Abstract Background In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. Results It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. Conclusion These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The

  17. Vector analysis

    Brand, Louis


    The use of vectors not only simplifies treatments of differential geometry, mechanics, hydrodynamics, and electrodynamics, but also makes mathematical and physical concepts more tangible and easy to grasp. This text for undergraduates was designed as a short introductory course to give students the tools of vector algebra and calculus, as well as a brief glimpse into these subjects' manifold applications. The applications are developed to the extent that the uses of the potential function, both scalar and vector, are fully illustrated. Moreover, the basic postulates of vector analysis are brou

  18. Enhanced Efficacy of a Codon-Optimized DNA Vaccine Encoding the Glycoprotein Precursor Gene of Lassa Virus in a Guinea Pig Disease Model When Delivered by Dermal Electroporation

    Niranjan Y. Sardesai


    Full Text Available Lassa virus (LASV causes a severe, often fatal, hemorrhagic fever endemic to West Africa. Presently, there are no FDA-licensed medical countermeasures for this disease. In a pilot study, we constructed a DNA vaccine (pLASV-GPC that expressed the LASV glycoprotein precursor gene (GPC. This plasmid was used to vaccinate guinea pigs (GPs using intramuscular electroporation as the delivery platform. Vaccinated GPs were protected from lethal infection (5/6 with LASV compared to the controls. However, vaccinated GPs experienced transient viremia after challenge, although lower than the mock-vaccinated controls. In a follow-on study, we developed a new device that allowed for both the vaccine and electroporation pulse to be delivered to the dermis. We also codon-optimized the GPC sequence of the vaccine to enhance expression in GPs. Together, these innovations resulted in enhanced efficacy of the vaccine. Unlike the pilot study where neutralizing titers were not detected until after virus challenge, modest neutralizing titers were detected in guinea pigs before challenge, with escalating titers detected after challenge. The vaccinated GPs were never ill and were not viremic at any timepoint. The combination of the codon-optimized vaccine and dermal electroporation delivery is a worthy candidate for further development.

  19. Efficient replication of the in vitro transcripts from cloned cDNA of tomato black ring virus satellite RNA requires the 48K satellite RNA-encoded protein.

    Hemmer, O; Oncino, C; Fritsch, C


    Tomato black ring virus isolate L supports the multiplication of a large satellite RNA of 1376 nt which has no common features with the two genomic RNAs except for the terminal motif 5' VPg UUGAAAA and a 3' poly(A) tail. The TBRV sat-RNA contains an ORF for a protein of 48K which is translated both in vitro and in vivo. To determine the function of the 48K protein we have studied the effect of different mutations introduced in the ORF of the cDNA clone on the capacity of transcripts to multiply in Chenopodium quinoa plants or protoplasts when inoculated along with the genomic RNAs. Transcripts in which nucleotides have been substituted within the 5' proximal region of the ORF multiplied poorly even when the modification conserved the 48K protein sequence, suggesting that this portion of the ORF contains cis-acting RNA sequences. Transcripts with alterations in the internal region of the ORF retained their multiplication capacity provided the mutation did not destroy the ORF or modify the length of the protein expressed. The absence of multiplication in plants of transcripts unable to express the 48K protein and their inability to replicate in protoplasts suggest strongly that the sat-RNA translation product itself is implicated in the replication of sat-RNA.

  20. Isolation and characterization of a cDNA encoding (S)-cis-N-methylstylopine 14-hydroxylase from opium poppy, a key enzyme in sanguinarine biosynthesis.

    Beaudoin, Guillaume A W; Facchini, Peter J


    Sanguinarine is a benzo[c]phenenthridine alkaloid with potent antimicrobial properties found commonly in plants of the Papaveraceae, including the roots of opium poppy (Papaver somniferum). Sanguinarine is formed from the central 1-benzylisoquinoline intermediate (S)-reticuline via the protoberberine alkaloid (S)-scoulerine, which undergoes five enzymatic oxidations and an N-methylation. The first four oxidations from (S)-scoulerine are catalyzed by cytochromes P450, whereas the final conversion involves a flavoprotein oxidase. All but one gene in the biosynthetic pathway from (S)-reticuline to sanguinarine has been identified. In this communication, we report the isolation and characterization of (S)-cis-N-methylstylopine 14-hydroxylase (MSH) from opium poppy based on the transcriptional induction in elicitor-treated cell suspension cultures and root-specific expression of the corresponding gene. Along with protopine 6-hydroxylase, which catalyzes the subsequent and penultimate step in sanguinarine biosynthesis, MSH is a member of the CYP82N subfamily of cytochromes P450. The full-length MSH cDNA was expressed in Saccharomyces cerevisiae and the recombinant microsomal protein was tested for enzymatic activity using 25 benzylisoquinoline alkaloids representing a wide range of structural subgroups. The only enzymatic substrates were the N-methylated protoberberine alkaloids N-methylstylopine and N-methylcanadine, which were converted to protopine and allocryptopine, respectively. Copyright © 2013. Published by Elsevier Inc.

  1. Human C6orf211 Encodes Armt1, a Protein Carboxyl Methyltransferase that Targets PCNA and Is Linked to the DNA Damage Response

    J. Jefferson P. Perry


    Full Text Available Recent evidence supports the presence of an L-glutamyl methyltransferase(s in eukaryotic cells, but this enzyme class has been defined only in certain prokaryotic species. Here, we characterize the human C6orf211 gene product as “acidic residue methyltransferase-1” (Armt1, an enzyme that specifically targets proliferating cell nuclear antigen (PCNA in breast cancer cells, predominately methylating glutamate side chains. Armt1 homologs share structural similarities with the SAM-dependent methyltransferases, and negative regulation of activity by automethylation indicates a means for cellular control. Notably, shRNA-based knockdown of Armt1 expression in two breast cancer cell lines altered survival in response to genotoxic stress. Increased sensitivity to UV, adriamycin, and MMS was observed in SK-Br-3 cells, while in contrast, increased resistance to these agents was observed in MCF7 cells. Together, these results lay the foundation for defining the mechanism by which this post-translational modification operates in the DNA damage response (DDR.

  2. DNA Fragmentation Factor 45 (DFF45 Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line

    Hong Wei Yang


    Full Text Available Recently, loss of heterozygosity (LOH studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p in neuroblastoma (NB. To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1 p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45 gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT-polymerase chain reaction (PCR and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region.

  3. Cloning of the human androgen receptor cDNA

    Govindan, M.V.; Burelle, M.; Cantin, C.; Kabrie, C.; Labrie, F.; Lachance, Y.; Leblanc, G.; Lefebvre, C.; Patel, P.; Simard, J.


    The authors discuss how in order to define the functional domains of the human androgen receptor, complementary DNA (cDNA) clones encoding the human androgen receptor (hAR) have been isolated from a human testis λgtll cDNA library using synthetic oligonnucleotide probes, homologous to segments of the human glucocorticoid, estradiol and progesterone receptors. The cDNA clones corresponding to the human glucocorticoid, estradiol and progesterone receptors were eliminated after cross-hybridization with their respective cDNA probes and/or after restriction mapping of the cDNA clones. The remaining cDNA clones were classified into different groups after analysis by restriction digestion and cross-hybridization. Two of the largest cDNA clones from each group were inserted into an expression vector in both orientations. The linearized plasmids were used as templates in in vitro transcription with T7 RNA polymerase. Subsequent in vitro translation of the purified transcripts in rabbit reticulocyte lysate followed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) permitted the characterization of the encoded polyeptides. The expressed proteins larger than 30,000 Da were analyzed for their ability to bind tritium-labelled dihydrotestosterone ([ 3 H] DHT) with high affinity and specificity

  4. Vector velocimeter


    The present invention relates to a compact, reliable and low-cost vector velocimeter for example for determining velocities of particles suspended in a gas or fluid flow, or for determining velocity, displacement, rotation, or vibration of a solid surface, the vector velocimeter comprising a laser...

  5. Vector assembly of colloids on monolayer substrates

    Jiang, Lingxiang; Yang, Shenyu; Tsang, Boyce; Tu, Mei; Granick, Steve


    The key to spontaneous and directed assembly is to encode the desired assembly information to building blocks in a programmable and efficient way. In computer graphics, raster graphics encodes images on a single-pixel level, conferring fine details at the expense of large file sizes, whereas vector graphics encrypts shape information into vectors that allow small file sizes and operational transformations. Here, we adapt this raster/vector concept to a 2D colloidal system and realize `vector assembly' by manipulating particles on a colloidal monolayer substrate with optical tweezers. In contrast to raster assembly that assigns optical tweezers to each particle, vector assembly requires a minimal number of optical tweezers that allow operations like chain elongation and shortening. This vector approach enables simple uniform particles to form a vast collection of colloidal arenes and colloidenes, the spontaneous dissociation of which is achieved with precision and stage-by-stage complexity by simply removing the optical tweezers.

  6. Polypeptides having catalase activity and polynucleotides encoding same

    Liu, Ye; Duan, Junxin; Zhang, Yu; Tang, Lan


    Provided are isolated polypeptides having catalase activity and polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  7. Polypeptides having xylanase activity and polynucleotides encoding same

    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  8. Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored Meleagrid herpesvirus type 1 vaccines

    Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspe...

  9. The uvsI gene of Aspergillus nidulans required for UV-mutagenesis encodes a homolog to REV3, a subunit of the DNA polymerase zeta of yeast involved in translesion DNA synthesis.

    Han, K Y; Chae, S K; Han, D M


    Defects in the uvsI gene of Aspergillus nidulans resulted in high UV sensitivity and reductions of spontaneous and UV-induced reversion of certain alleles, uvsl;uvsA double mutants exhibited high methyl methane sulfonate (MMS)-sensitivity in contrast to the slight sensitivity of the component single mutants. Using such a double mutant as recipient, a clone complementing uvsI501 has been isolated from a chromosome III specific library. The deduced amino acid sequence from the 1.1-kb sequenced region, a part of the 5.2-kb DNA fragment showing uvsI-complementing activity, had a 62% identity with REV3 of yeast. Disruptants of the cloned gene demonstrated the same level of sensitivity to UV light as uvsI and failed to complement uvsI501 in heterozygous diploids.

  10. Equivalent Vectors

    Levine, Robert


    The cross-product is a mathematical operation that is performed between two 3-dimensional vectors. The result is a vector that is orthogonal or perpendicular to both of them. Learning about this for the first time while taking Calculus-III, the class was taught that if AxB = AxC, it does not necessarily follow that B = C. This seemed baffling. The…

  11. SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

    Benjamin C Hitz

    Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: (for the generic database and to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.

  12. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I


    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  13. DNA/MVA Vaccines for HIV/AIDS

    Smita S. Iyer


    Full Text Available Since the initial proof-of-concept studies examining the ability of antigen-encoded plasmid DNA to serve as an immunogen, DNA vaccines have evolved as a clinically safe and effective platform for priming HIV-specific cellular and humoral responses in heterologous “prime-boost” vaccination regimens. Direct injection of plasmid DNA into the muscle induces T- and B-cell responses against foreign antigens. However, the insufficient magnitude of this response has led to the development of approaches for enhancing the immunogenicity of DNA vaccines. The last two decades have seen significant progress in the DNA-based vaccine platform with optimized plasmid constructs, improved delivery methods, such as electroporation, the use of molecular adjuvants and novel strategies combining DNA with viral vectors and subunit proteins. These innovations are paving the way for the clinical application of DNA-based HIV vaccines. Here, we review preclinical studies on the DNA-prime/modified vaccinia Ankara (MVA-boost vaccine modality for HIV. There is a great deal of interest in enhancing the immunogenicity of DNA by engineering DNA vaccines to co-express immune modulatory adjuvants. Some of these adjuvants have demonstrated encouraging results in preclinical and clinical studies, and these data will be examined, as well.

  14. Herpes simplex virus type 1 (HSV-1)-derived recombinant vectors for gene transfer and gene therapy.

    Marconi, Peggy; Fraefel, Cornel; Epstein, Alberto L


    Herpes simplex virus type 1 (HSV-1 ) is a human pathogen whose lifestyle is based on a long-term dual interaction with the infected host, being able to establish both lytic and latent infections. The virus genome is a 153-kilobase pair (kbp) double-stranded DNA molecule encoding more than 80 genes. The interest of HSV-1 as gene transfer vector stems from its ability to infect many different cell types, both quiescent and proliferating cells, the very high packaging capacity of the virus capsid, the outstanding neurotropic adaptations that this virus has evolved, and the fact that it never integrates into the cellular chromosomes, thus avoiding the risk of insertional mutagenesis. Two types of vectors can be derived from HSV-1, recombinant vectors and amplicon vectors, and different methodologies have been developed to prepare large stocks of each type of vector. This chapter summarizes the approach most commonly used to prepare recombinant HSV-1 vectors through homologous recombination, either in eukaryotic cells or in bacteria.

  15. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.


    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  16. Molecular Cloning of a cDNA Encoding for Taenia solium TATA-Box Binding Protein 1 (TsTBP1) and Study of Its Interactions with the TATA-Box of Actin 5 and Typical 2-Cys Peroxiredoxin Genes.

    Rodríguez-Lima, Oscar; García-Gutierrez, Ponciano; Jiménez, Lucía; Zarain-Herzberg, Ángel; Lazzarini, Roberto; Landa, Abraham


    TATA-box binding protein (TBP) is an essential regulatory transcription factor for the TATA-box and TATA-box-less gene promoters. We report the cloning and characterization of a full-length cDNA that encodes a Taenia solium TATA-box binding protein 1 (TsTBP1). Deduced amino acid composition from its nucleotide sequence revealed that encodes a protein of 238 residues with a predicted molecular weight of 26.7 kDa, and a theoretical pI of 10.6. The NH2-terminal domain shows no conservation when compared with to pig and human TBP1s. However, it shows high conservation in size and amino acid identity with taeniids TBP1s. In contrast, the TsTBP1 COOH-terminal domain is highly conserved among organisms, and contains the amino acids involved in interactions with the TATA-box, as well as with TFIIA and TFIIB. In silico TsTBP1 modeling reveals that the COOH-terminal domain forms the classical saddle structure of the TBP family, with one α-helix at the end, not present in pig and human. Native TsTBP1 was detected in T. solium cysticerci´s nuclear extract by western blot using rabbit antibodies generated against two synthetic peptides located in the NH2 and COOH-terminal domains of TsTBP1. These antibodies, through immunofluorescence technique, identified the TBP1 in the nucleus of cells that form the bladder wall of cysticerci of Taenia crassiceps, an organism close related to T. solium. Electrophoretic mobility shift assays using nuclear extracts from T. solium cysticerci and antibodies against the NH2-terminal domain of TsTBP1 showed the interaction of native TsTBP1 with the TATA-box present in T. solium actin 5 (pAT5) and 2-Cys peroxiredoxin (Ts2-CysPrx) gene promoters; in contrast, when antibodies against the anti-COOH-terminal domain of TsTBP1 were used, they inhibited the binding of TsTBP1 to the TATA-box of the pAT5 promoter gene.

  17. Latency Performance of Encoding with Random Linear Network Coding

    Nielsen, Lars; Hansen, René Rydhof; Lucani Rötter, Daniel Enrique


    the encoding process can be parallelized based on system requirements to reduce data access time within the system. Using a counting argument, we focus on predicting the effect of changes of generation (number of original packets) and symbol size (number of bytes per data packet) configurations on the encoding...... latency on full vector and on-the-fly algorithms. We show that the encoding latency doubles when either the generation size or the symbol size double and confirm this via extensive simulations. Although we show that the theoretical speed gain of on-the-fly over full vector is two, our measurements show...

  18. DNA probes

    Castelino, J.


    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  19. DNA probes

    Castelino, J


    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with {sup 32}P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism`s genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens 10 figs, 2 tabs

  20. CpG island protects Rous sarcoma virus-derived vectors integrated into nonpermissive cells from DNA methylation and transcriptional suppression

    Hejnar, Jiří; Hájková, P.; Plachý, Jiří; Elleder, Daniel; Stepanets, Volodymyr; Svoboda, Jan


    Roč. 98, č. 2 (2001), s. 565-569 ISSN 0027-8424 R&D Projects: GA ČR GA312/97/P082; GA ČR GA312/98/0825 Keywords : CpG island * provirus silencing * DNA methylation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.890, year: 2001

  1. Enhanced cellular immune response against SIV Gag induced by immunization with DNA vaccines expressing assembly and release-defective SIV Gag proteins

    Bu Zhigao; Ye Ling; Compans, Richard W.; Yang Chinglai


    Codon-optimized genes were synthesized for the SIVmac239 Gag, a mutant Gag with mutations in the major homology region, and a chimeric Gag containing a protein destruction signal at the N-terminus of Gag. The mutant and chimeric Gag were expressed at levels comparable to that observed for the wild-type Gag protein but their stability and release into the medium were found to be significantly reduced. Immunization of mice with DNA vectors encoding the mutant or chimeric Gag induced fourfold higher levels of anti-SIV Gag CD4 T cell responses than the DNA vector encoding the wild-type SIV Gag. Moreover, anti-SIV Gag CD8 T cell responses induced by DNA vectors encoding the mutant or chimeric Gag were found to be 5- to 10-fold higher than those induced by the DNA construct for the wild-type Gag. These results indicate that mutations disrupting assembly and/or stability of the SIV Gag protein effectively enhance its immunogenicity when expressed from DNA vaccines

  2. Vector geometry

    Robinson, Gilbert de B


    This brief undergraduate-level text by a prominent Cambridge-educated mathematician explores the relationship between algebra and geometry. An elementary course in plane geometry is the sole requirement for Gilbert de B. Robinson's text, which is the result of several years of teaching and learning the most effective methods from discussions with students. Topics include lines and planes, determinants and linear equations, matrices, groups and linear transformations, and vectors and vector spaces. Additional subjects range from conics and quadrics to homogeneous coordinates and projective geom

  3. Partial mitochondrial DNA sequences suggest the existence of a cryptic species within the Leucosphyrus group of the genus Anopheles (Diptera: Culicidae), forest malaria vectors, in northern Vietnam.

    Takano, Kohei Takenaka; Nguyen, Ngoc Thi Hong; Nguyen, Binh Thi Huong; Sunahara, Toshihiko; Yasunami, Michio; Nguyen, Manh Duc; Takagi, Masahiro


    During the last decade, Southeast Asian countries have been very successful in reducing the burden of malaria. However, malaria remains endemic in these countries, especially in remote and forested areas. The Leucosphyrus group of the genus Anopheles harbors the most important malaria vectors in forested areas of Southeast Asia. In Vietnam, previous molecular studies have resulted in the identification of only Anopheles dirus sensu stricto (previously known as An. dirus species A) among the Leucosphyrus group members. However, Vietnamese entomologists have recognized that mosquitoes belonging to the Leucosphyrus group in northern Vietnam exhibit morphological characteristics similar to those of Anopheles takasagoensis, which has been reported only from Taiwan. Here, we aimed to confirm the genetic and morphological identities of the members of the Leucosphyrus group in Vietnam. In the molecular phylogenetic trees reconstructed using partial COI and ND6 mitochondrial gene sequences, samples collected from southern and central Vietnam clustered together with GenBank sequences of An. dirus that were obtained from Thailand. However, samples from northern Vietnam formed a distinct clade separated from both An. dirus and An. takasagoensis by other valid species. The results suggest the existence of a cryptic species in northern Vietnam that is morphologically similar to, but phylogenetically distant from both An. dirus and An. takasagoensis. We have tentatively designated this possible cryptic species as Anopheles aff. takasagoensis for convenience, until a valid name is assigned. However, it is difficult to distinguish the species solely on the basis of morphological characteristics. Further studies on such as karyotypes and polytene chromosome banding patterns are necessary to confirm whether An. aff. takasagoensis is a valid species. Moreover, studies on (1) the geographic distribution, which is potentially spreading along the Vietnam, China, Laos, and Myanmar borders

  4. Production of lentiviral vectors

    Otto-Wilhelm Merten


    Full Text Available Lentiviral vectors (LV have seen considerably increase in use as gene therapy vectors for the treatment of acquired and inherited diseases. This review presents the state of the art of the production of these vectors with particular emphasis on their large-scale production for clinical purposes. In contrast to oncoretroviral vectors, which are produced using stable producer cell lines, clinical-grade LV are in most of the cases produced by transient transfection of 293 or 293T cells grown in cell factories. However, more recent developments, also, tend to use hollow fiber reactor, suspension culture processes, and the implementation of stable producer cell lines. As is customary for the biotech industry, rather sophisticated downstream processing protocols have been established to remove any undesirable process-derived contaminant, such as plasmid or host cell DNA or host cell proteins. This review compares published large-scale production and purification processes of LV and presents their process performances. Furthermore, developments in the domain of stable cell lines and their way to the use of production vehicles of clinical material will be presented.


    Thomas, E. G. F.


    This paper deals with the theory of integration of scalar functions with respect to a measure with values in a, not necessarily locally convex, topological vector space. It focuses on the extension of such integrals from bounded measurable functions to the class of integrable functions, proving

  6. Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

    Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K


    A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

  7. Partial mitochondrial DNA sequences suggest the existence of a cryptic species within the Leucosphyrus group of the genus Anopheles (Diptera: Culicidae, forest malaria vectors, in northern Vietnam

    Yasunami Michio


    Full Text Available Abstract Background During the last decade, Southeast Asian countries have been very successful in reducing the burden of malaria. However, malaria remains endemic in these countries, especially in remote and forested areas. The Leucosphyrus group of the genus Anopheles harbors the most important malaria vectors in forested areas of Southeast Asia. In Vietnam, previous molecular studies have resulted in the identification of only Anopheles dirus sensu stricto (previously known as An. dirus species A among the Leucosphyrus group members. However, Vietnamese entomologists have recognized that mosquitoes belonging to the Leucosphyrus group in northern Vietnam exhibit morphological characteristics similar to those of Anopheles takasagoensis, which has been reported only from Taiwan. Here, we aimed to confirm the genetic and morphological identities of the members of the Leucosphyrus group in Vietnam. Results In the molecular phylogenetic trees reconstructed using partial COI and ND6 mitochondrial gene sequences, samples collected from southern and central Vietnam clustered together with GenBank sequences of An. dirus that were obtained from Thailand. However, samples from northern Vietnam formed a distinct clade separated from both An. dirus and An. takasagoensis by other valid species. Conclusions The results suggest the existence of a cryptic species in northern Vietnam that is morphologically similar to, but phylogenetically distant from both An. dirus and An. takasagoensis. We have tentatively designated this possible cryptic species as Anopheles aff. takasagoensis for convenience, until a valid name is assigned. However, it is difficult to distinguish the species solely on the basis of morphological characteristics. Further studies on such as karyotypes and polytene chromosome banding patterns are necessary to confirm whether An. aff. takasagoensis is a valid species. Moreover, studies on (1 the geographic distribution, which is potentially

  8. Synthesis and characterization of nitrile functionalized silver(I)-N-heterocyclic carbene complexes: DNA binding, cleavage studies, antibacterial properties and mosquitocidal activity against the dengue vector, Aedes albopictus.

    Asekunowo, Patrick O; Haque, Rosenani A; Razali, Mohd R; Avicor, Silas W; Wajidi, Mustafa F F


    A series of four benzimidazolium based nitrile-functionalized mononuclear-Ag(I)-N-heterocyclic carbene and binuclear-Ag(I)-N-heterocyclic carbene (Ag(I)-NHC) hexafluorophosphate complexes (5b-8b) were synthesized by reacting the corresponding hexafluorophosphate salts (1b-4b) with Ag 2 O in acetonitrile, respectively. These compounds were characterized by 1 H NMR, 13 C NMR, IR, UV-visible spectroscopic techniques, elemental analyses and molar conductivity. Additionally, 8b was structurally characterized by single crystal X-ray diffraction technique. Preliminary in vitro antibacterial evaluation was conducted for all the compounds against two standard bacteria; gram-positive (Staphylococcus aureus) and gram-negative (Escherichia coli) bacterial strains. Most of the Ag(I)-NHC complexes (5b-8b) showed moderate to good antibacterial activity with MIC values in the range of 12.5-100 μg/mL. Especially, compound 8b exhibited promising anti-Staphylococcus aureus activity with a low MIC value (12.5 μg/mL). However, all the hexafluorophosphate salts (1b-4b) were inactive against the bacteria strains. The preliminary interactive investigation revealed that the most active compound, 8b, could effectively intercalate into DNA to form 8b-DNA complex which shows a better binding ability for DNA (K b  = 3.627 × 10 6 ) than the complexes 5b-7b (2.177 × 10 6 , 8.672 × 10 5 and 6.665 × 10 5 , respectively). Nuclease activity of the complexes on plasmid DNA and Aedes albopictus genomic DNA was time-dependent, although minimal. The complexes were larvicidal to the mosquito, with 5b, 6b and 8b being highly active. Developmental progression from the larval to the adult stage was affected by the complexes, progressively being toxic to the insect's development with increasing concentration. These indicate the potential use of these complexes as control agents against bacteria and the dengue mosquito Ae. albopictus. Copyright © 2018 Elsevier Masson SAS. All

  9. An introduction to vectors, vector operators and vector analysis

    Joag, Pramod S


    Ideal for undergraduate and graduate students of science and engineering, this book covers fundamental concepts of vectors and their applications in a single volume. The first unit deals with basic formulation, both conceptual and theoretical. It discusses applications of algebraic operations, Levi-Civita notation, and curvilinear coordinate systems like spherical polar and parabolic systems and structures, and analytical geometry of curves and surfaces. The second unit delves into the algebra of operators and their types and also explains the equivalence between the algebra of vector operators and the algebra of matrices. Formulation of eigen vectors and eigen values of a linear vector operator are elaborated using vector algebra. The third unit deals with vector analysis, discussing vector valued functions of a scalar variable and functions of vector argument (both scalar valued and vector valued), thus covering both the scalar vector fields and vector integration.

  10. Development of oral CTL vaccine using a CTP-integrated Sabin 1 poliovirus-based vector system.

    Han, Seung-Soo; Lee, Jinjoo; Jung, Yideul; Kang, Myeong-Ho; Hong, Jung-Hyub; Cha, Min-Suk; Park, Yu-Jin; Lee, Ezra; Yoon, Cheol-Hee; Bae, Yong-Soo


    We developed a CTL vaccine vector by modification of the RPS-Vax system, a mucosal vaccine vector derived from a poliovirus Sabin 1 strain, and generated an oral CTL vaccine against HIV-1. A DNA fragment encoding a cytoplasmic transduction peptide (CTP) was integrated into the RPS-Vax system to generate RPS-CTP, a CTL vaccine vector. An HIV-1 p24 cDNA fragment was introduced into the RPS-CTP vector system and a recombinant poliovirus (rec-PV) named vRPS-CTP/p24 was produced. vRPS-CTP/p24 was genetically stable and efficiently induced Th1 immunity and p24-specific CTLs in immunized poliovirus receptor-transgenic (PVR-Tg) mice. In challenge experiments, PVR-Tg mice that were pre-immunized orally with vRPS-CTP/p24 were resistant to challenge with a lethal dose of p24-expressing recombinant vaccinia virus (rMVA-p24). These results suggested that the RPS-CTP vector system had potential for developing oral CTL vaccines against infectious diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Safety and tolerability of conserved region vaccines vectored by plasmid DNA, simian adenovirus and modified vaccinia virus ankara administered to human immunodeficiency virus type 1-uninfected adults in a randomized, single-blind phase I trial.

    Emma-Jo Hayton

    Full Text Available HIV-1 vaccine development has advanced slowly due to viral antigenic diversity, poor immunogenicity and recently, safety concerns associated with human adenovirus serotype-5 vectors. To tackle HIV-1 variation, we designed a unique T-cell immunogen HIVconsv from functionally conserved regions of the HIV-1 proteome, which were presented to the immune system using a heterologous prime-boost combination of plasmid DNA, a non-replicating simian (chimpanzee adenovirus ChAdV-63 and a non-replicating poxvirus, modified vaccinia virus Ankara. A block-randomized, single-blind, placebo-controlled phase I trial HIV-CORE 002 administered for the first time candidate HIV-1- vaccines or placebo to 32 healthy HIV-1/2-uninfected adults in Oxford, UK and elicited high frequencies of HIV-1-specific T cells capable of inhibiting HIV-1 replication in vitro. Here, detail safety and tolerability of these vaccines are reported.Local and systemic reactogenicity data were collected using structured interviews and study-specific diary cards. Data on all other adverse events were collected using open questions. Serum neutralizing antibody titres to ChAdV-63 were determined before and after vaccination.Two volunteers withdrew for vaccine-unrelated reasons. No vaccine-related serious adverse events or reactions occurred during 190 person-months of follow-up. Local and systemic events after vaccination occurred in 27/32 individuals and most were mild (severity grade 1 and predominantly transient (<48 hours. Myalgia and flu-like symptoms were more strongly associated with MVA than ChAdV63 or DNA vectors and more common in vaccine recipients than in placebo. There were no intercurrent HIV-1 infections during follow-up. 2/24 volunteers had low ChAdV-63-neutralizing titres at baseline and 7 increased their titres to over 200 with a median (range of 633 (231-1533 post-vaccination, which is of no safety concern.These data demonstrate safety and good tolerability of the pSG2

  12. Weaving Knotted Vector Fields with Tunable Helicity.

    Kedia, Hridesh; Foster, David; Dennis, Mark R; Irvine, William T M


    We present a general construction of divergence-free knotted vector fields from complex scalar fields, whose closed field lines encode many kinds of knots and links, including torus knots, their cables, the figure-8 knot, and its generalizations. As finite-energy physical fields, they represent initial states for fields such as the magnetic field in a plasma, or the vorticity field in a fluid. We give a systematic procedure for calculating the vector potential, starting from complex scalar functions with knotted zero filaments, thus enabling an explicit computation of the helicity of these knotted fields. The construction can be used to generate isolated knotted flux tubes, filled by knots encoded in the lines of the vector field. Lastly, we give examples of manifestly knotted vector fields with vanishing helicity. Our results provide building blocks for analytical models and simulations alike.

  13. Cloning, expression and characterisation of a novel gene encoding ...



    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  14. Noise level and MPEG-2 encoder statistics

    Lee, Jungwoo


    Most software in the movie and broadcasting industries are still in analog film or tape format, which typically contains random noise that originated from film, CCD camera, and tape recording. The performance of the MPEG-2 encoder may be significantly degraded by the noise. It is also affected by the scene type that includes spatial and temporal activity. The statistical property of noise originating from camera and tape player is analyzed and the models for the two types of noise are developed. The relationship between the noise, the scene type, and encoder statistics of a number of MPEG-2 parameters such as motion vector magnitude, prediction error, and quant scale are discussed. This analysis is intended to be a tool for designing robust MPEG encoding algorithms such as preprocessing and rate control.

  15. Molecular cloning and functional analysis of the gene encoding ...

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  16. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    B Kazemi


    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  17. GDP-L-fucose: .beta.-D-galactoside 2-.alpha.-L-fucosyltransferases, DNA sequences encoding the same, method for producing the same and a method of genotyping a person

    Lowe, John B.; Lennon, Gregory; Rouquier, Sylvie; Giorgi, Dominique; Kelly, Robert J.


    The gene encoding GDP-L-fucose: .beta.-D-Galactoside 2-.alpha.-L-fucosyltransferase has been cloned, and a mutation in this gene has been found to be responsible for an individual being a non-secretor.

  18. GDP-L-fucose: {beta}-D-galactoside 2-{alpha}-Lfucosyltransferases, DNA sequences encoding the same, method for producing the same and a method of genotyping a person

    Lowe, J.B.; Lennon, G.; Rouquier, S.; Giorgi, D.; Kelly, R.J.


    The gene encoding GDP-L-fucose: {beta}-D-Galactoside 2-{alpha}-Lfucosyltransferase has been cloned, and a mutation in this gene has been found to be responsible for an individual being a non-secretor. 30 figs.

  19. Cationic Polybutyl Cyanoacrylate Nanoparticles for DNA Delivery

    Jinghua Duan


    Full Text Available To enhance the intracellular delivery potential of plasmid DNA using nonviral vectors, we used polybutyl cyanoacrylate (PBCA and chitosan to prepare PBCA nanoparticles (NPs by emulsion polymerization and prepared NP/DNA complexes through the complex coacervation of nanoparticles with the DNA. The object of our work is to evaluate the characterization and transfection efficiency of PBCA-NPs. The NPs have a zeta potential of 25.53 mV at pH 7.4 and size about 200 nm. Electrophoretic analysis suggested that the NPs with positive charges could protect the DNA from nuclease degradation and cell viability assay showed that the NPs exhibit a low cytotoxicity to human hepatocellular carcinoma (HepG2 cells. Qualitative and quantitative analysis of transfection in HepG2 cells by the nanoparticles carrying plasmid DNA encoding for enhanced green fluorescent protein (EGFP-N1 was done by digital fluorescence imaging microscopy system and fluorescence-activated cell sorting (FACS. Qualitative results showed highly efficient expression of GFP that remained stable for up to 96 hours. Quantitative results from FACS showed that PBCA-NPs were significantly more effective in transfecting HepG2 cells after 72 hours postincubation. The results of this study suggested that PBCA-NPs have favorable properties for nonviral delivery.

  20. Landscape encodings enhance optimization.

    Konstantin Klemm

    Full Text Available Hard combinatorial optimization problems deal with the search for the minimum cost solutions (ground states of discrete systems under strong constraints. A transformation of state variables may enhance computational tractability. It has been argued that these state encodings are to be chosen invertible to retain the original size of the state space. Here we show how redundant non-invertible encodings enhance optimization by enriching the density of low-energy states. In addition, smooth landscapes may be established on encoded state spaces to guide local search dynamics towards the ground state.

  1. Landscape Encodings Enhance Optimization

    Klemm, Konstantin; Mehta, Anita; Stadler, Peter F.


    Hard combinatorial optimization problems deal with the search for the minimum cost solutions (ground states) of discrete systems under strong constraints. A transformation of state variables may enhance computational tractability. It has been argued that these state encodings are to be chosen invertible to retain the original size of the state space. Here we show how redundant non-invertible encodings enhance optimization by enriching the density of low-energy states. In addition, smooth landscapes may be established on encoded state spaces to guide local search dynamics towards the ground state. PMID:22496860

  2. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich


    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  3. Cloud-based uniform ChIP-Seq processing tools for modENCODE and ENCODE.

    Trinh, Quang M; Jen, Fei-Yang Arthur; Zhou, Ziru; Chu, Kar Ming; Perry, Marc D; Kephart, Ellen T; Contrino, Sergio; Ruzanov, Peter; Stein, Lincoln D


    Funded by the National Institutes of Health (NIH), the aim of the Model Organism ENCyclopedia of DNA Elements (modENCODE) project is to provide the biological research community with a comprehensive encyclopedia of functional genomic elements for both model organisms C. elegans (worm) and D. melanogaster (fly). With a total size of just under 10 terabytes of data collected and released to the public, one of the challenges faced by researchers is to extract biologically meaningful knowledge from this large data set. While the basic quality control, pre-processing, and analysis of the data has already been performed by members of the modENCODE consortium, many researchers will wish to reinterpret the data set using modifications and enhancements of the original protocols, or combine modENCODE data with other data sets. Unfortunately this can be a time consuming and logistically challenging proposition. In recognition of this challenge, the modENCODE DCC has released uniform computing resources for analyzing modENCODE data on Galaxy (, on the public Amazon Cloud (, and on the private Bionimbus Cloud for genomic research ( In particular, we have released Galaxy workflows for interpreting ChIP-seq data which use the same quality control (QC) and peak calling standards adopted by the modENCODE and ENCODE communities. For convenience of use, we have created Amazon and Bionimbus Cloud machine images containing Galaxy along with all the modENCODE data, software and other dependencies. Using these resources provides a framework for running consistent and reproducible analyses on modENCODE data, ultimately allowing researchers to use more of their time using modENCODE data, and less time moving it around.

  4. Blind encoding into qudits

    Shaari, J.S.; Wahiddin, M.R.B.; Mancini, S.


    We consider the problem of encoding classical information into unknown qudit states belonging to any basis, of a maximal set of mutually unbiased bases, by one party and then decoding by another party who has perfect knowledge of the basis. Working with qudits of prime dimensions, we point out a no-go theorem that forbids 'shift' operations on arbitrary unknown states. We then provide the necessary conditions for reliable encoding/decoding

  5. Safety and immunogenicity of an HIV adenoviral vector boost after DNA plasmid vaccine prime by route of administration: a randomized clinical trial.

    Beryl A Koblin

    Full Text Available In the development of HIV vaccines, improving immunogenicity while maintaining safety is critical. Route of administration can be an important factor.This multicenter, open-label, randomized trial, HVTN 069, compared routes of administration on safety and immunogenicity of a DNA vaccine prime given intramuscularly at 0, 1 and 2 months and a recombinant replication-defective adenovirus type 5 (rAd5 vaccine boost given at 6 months by intramuscular (IM, intradermal (ID, or subcutaneous (SC route. Randomization was computer-generated by a central data management center; participants and staff were not blinded to group assignment. The outcomes were vaccine reactogenicity and humoral and cellular immunogenicity. Ninety healthy, HIV-1 uninfected adults in the US and Peru, aged 18-50 were enrolled and randomized. Due to the results of the Step Study, injections with rAd5 vaccine were halted; thus 61 received the booster dose of rAd5 vaccine (IM: 20; ID:21; SC:20. After the rAd5 boost, significant differences by study arm were found in severity of headache, pain and erythema/induration. Immune responses (binding and neutralizing antibodies, IFN-γ ELISpot HIV-specific responses and CD4+ and CD8+ T-cell responses by ICS at four weeks after the rAd5 booster were not significantly different by administration route of the rAd5 vaccine boost (Binding antibody responses: IM: 66.7%; ID: 70.0%; SC: 77.8%; neutralizing antibody responses: IM: 11.1%; ID: 0.0%; SC 16.7%; ELISpot responses: IM: 46.7%; ID: 35.3%; SC: 44.4%; CD4+ T-cell responses: IM: 29.4%; ID: 20.0%; SC: 35.3%; CD8+ T-cell responses: IM: 29.4%; ID: 16.7%; SC: 50.0%.This study was limited by the reduced sample size. The higher frequency of local reactions after ID and SC administration and the lack of sufficient evidence to show that there were any differences in immunogenicity by route of administration do not support changing route of administration for the rAd5 NCT00384787.

  6. An encoding device and a method of encoding


    The present invention relates to an encoding device, such as an optical position encoder, for encoding input from an object, and a method for encoding input from an object, for determining a position of an object that interferes with light of the device. The encoding device comprises a light source...... in the area in the space and may interfere with the light, which interference may be encoded into a position or activation....

  7. Engineering nanoparticle-coated bacteria as oral DNA vaccines for cancer immunotherapy.

    Hu, Qinglian; Wu, Min; Fang, Chun; Cheng, Changyong; Zhao, Mengmeng; Fang, Weihuan; Chu, Paul K; Ping, Yuan; Tang, Guping


    Live attenuated bacteria are of increasing importance in biotechnology and medicine in the emerging field of cancer immunotherapy. Oral DNA vaccination mediated by live attenuated bacteria often suffers from low infection efficiency due to various biological barriers during the infection process. To this end, we herein report, for the first time, a new strategy to engineer cationic nanoparticle-coated bacterial vectors that can efficiently deliver oral DNA vaccine for efficacious cancer immunotherapy. By coating live attenuated bacteria with synthetic nanoparticles self-assembled from cationic polymers and plasmid DNA, the protective nanoparticle coating layer is able to facilitate bacteria to effectively escape phagosomes, significantly enhance the acid tolerance of bacteria in stomach and intestines, and greatly promote dissemination of bacteria into blood circulation after oral administration. Most importantly, oral delivery of DNA vaccines encoding autologous vascular endothelial growth factor receptor 2 (VEGFR2) by this hybrid vector showed remarkable T cell activation and cytokine production. Successful inhibition of tumor growth was also achieved by efficient oral delivery of VEGFR2 with nanoparticle-coated bacterial vectors due to angiogenesis suppression in the tumor vasculature and tumor necrosis. This proof-of-concept work demonstrates that coating live bacterial cells with synthetic nanoparticles represents a promising strategy to engineer efficient and versatile DNA vaccines for the era of immunotherapy.

  8. Image Coding Based on Address Vector Quantization.

    Feng, Yushu

    Image coding is finding increased application in teleconferencing, archiving, and remote sensing. This thesis investigates the potential of Vector Quantization (VQ), a relatively new source coding technique, for compression of monochromatic and color images. Extensions of the Vector Quantization technique to the Address Vector Quantization method have been investigated. In Vector Quantization, the image data to be encoded are first processed to yield a set of vectors. A codeword from the codebook which best matches the input image vector is then selected. Compression is achieved by replacing the image vector with the index of the code-word which produced the best match, the index is sent to the channel. Reconstruction of the image is done by using a table lookup technique, where the label is simply used as an address for a table containing the representative vectors. A code-book of representative vectors (codewords) is generated using an iterative clustering algorithm such as K-means, or the generalized Lloyd algorithm. A review of different Vector Quantization techniques are given in chapter 1. Chapter 2 gives an overview of codebook design methods including the Kohonen neural network to design codebook. During the encoding process, the correlation of the address is considered and Address Vector Quantization is developed for color image and monochrome image coding. Address VQ which includes static and dynamic processes is introduced in chapter 3. In order to overcome the problems in Hierarchical VQ, Multi-layer Address Vector Quantization is proposed in chapter 4. This approach gives the same performance as that of the normal VQ scheme but the bit rate is about 1/2 to 1/3 as that of the normal VQ method. In chapter 5, a Dynamic Finite State VQ based on a probability transition matrix to select the best subcodebook to encode the image is developed. In chapter 6, a new adaptive vector quantization scheme, suitable for color video coding, called "A Self -Organizing

  9. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Yusuf, Y.; Hidayati, W.


    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  10. Distributed Remote Vector Gaussian Source Coding with Covariance Distortion Constraints

    Zahedi, Adel; Østergaard, Jan; Jensen, Søren Holdt


    In this paper, we consider a distributed remote source coding problem, where a sequence of observations of source vectors is available at the encoder. The problem is to specify the optimal rate for encoding the observations subject to a covariance matrix distortion constraint and in the presence...

  11. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Laing, E; Pretorius, I S


    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  12. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    Siebert, P.D.; Fukuda, M.


    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  13. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    Krath, Britta N.; Hove-Jensen, Bjarne


    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  14. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

    Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A


    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

  15. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

    Mei, Yu; Kernodle, Bliss M.; Hill, John H.


    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311

  16. [Escherichia coli heat-labile enterotoxin B subunit enhances the immune response against canine parvovirus VP2 in mice immunized by VP2 DNA vaccine].

    Han, Dongmei; Zhong, Fei; Li, Xiujin; Wang, Wei; Wang, Xingxing; Pan, Sumin


    To investigate the effect of Escherichia coli heat-labile enterotoxin (LT) B subunit (LTB) gene on canine parvovirus (CPV) VP2 gene vaccine. The LTB gene was amplified by PCR from genomic DNA of E. coli 44815 strain. The VP2-70 fragment (210 bp) encoding major epitope of VP2 (70 amino acids) was amplified by PCR from a plasmid encoding VP2 gene. VP2-70 and LTB genes were inserted into the eukaryotic vector to construct VP2-70 gene,LTB gene and VP2-70-LTB fused gene vectors. The mice were immunized with VP2-70 vector, VP2-70-LTB fused vector, or VP2-70 vector plus LTB vector, respectively. The antibody titers at the different time were measured by using ELISA method. The spleen lymphocyte proliferation activity was analyzed by 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. The sequence of VP2-70 and LTB genes was identified. The recombinant VP2-70 and LTB proteins could be expressed in HEK293T cells in a secretory manner. The mice immunized with VP2-70 vector, VP2-70-LTB vector or VP2-70 vector plus LTB vector could generate the specific antibody against VP2 protein. The antibody titer immunized with VP2-70-LTB vector reached 1:5120 at 35 d post immunization, significantly higher than that of other two groups (P vaccine in mice.

  17. A deep learning method for lincRNA detection using auto-encoder algorithm.

    Yu, Ning; Yu, Zeng; Pan, Yi


    RNA sequencing technique (RNA-seq) enables scientists to develop novel data-driven methods for discovering more unidentified lincRNAs. Meantime, knowledge-based technologies are experiencing a potential revolution ignited by the new deep learning methods. By scanning the newly found data set from RNA-seq, scientists have found that: (1) the expression of lincRNAs appears to be regulated, that is, the relevance exists along the DNA sequences; (2) lincRNAs contain some conversed patterns/motifs tethered together by non-conserved regions. The two evidences give the reasoning for adopting knowledge-based deep learning methods in lincRNA detection. Similar to coding region transcription, non-coding regions are split at transcriptional sites. However, regulatory RNAs rather than message RNAs are generated. That is, the transcribed RNAs participate the biological process as regulatory units instead of generating proteins. Identifying these transcriptional regions from non-coding regions is the first step towards lincRNA recognition. The auto-encoder method achieves 100% and 92.4% prediction accuracy on transcription sites over the putative data sets. The experimental results also show the excellent performance of predictive deep neural network on the lincRNA data sets compared with support vector machine and traditional neural network. In addition, it is validated through the newly discovered lincRNA data set and one unreported transcription site is found by feeding the whole annotated sequences through the deep learning machine, which indicates that deep learning method has the extensive ability for lincRNA prediction. The transcriptional sequences of lincRNAs are collected from the annotated human DNA genome data. Subsequently, a two-layer deep neural network is developed for the lincRNA detection, which adopts the auto-encoder algorithm and utilizes different encoding schemes to obtain the best performance over intergenic DNA sequence data. Driven by those newly

  18. A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

    Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko


    Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

  19. A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

    Teruhiko Suzuki

    Full Text Available Human artificial chromosomes (HACs are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

  20. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.


    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  1. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    Leem, S H; Ropp, P A; Sugino, A


    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in ...

  2. Correction of mutant Fanconi anemia gene by homologous recombination in human hematopoietic cells using adeno-associated virus vector.

    Paiboonsukwong, Kittiphong; Ohbayashi, Fumi; Shiiba, Haruka; Aizawa, Emi; Yamashita, Takayuki; Mitani, Kohnosuke


    Adeno-associated virus (AAV) vectors have been shown to correct a variety of mutations in human cells by homologous recombination (HR) at high rates, which can overcome insertional mutagenesis and transgene silencing, two of the major hurdles in conventional gene addition therapy of inherited diseases. We examined an ability of AAV vectors to repair a mutation in human hematopoietic cells by HR. We infected a human B-lymphoblastoid cell line (BCL) derived from a normal subject with an AAV, which disrupts the hypoxanthine phosphoribosyl transferase1 (HPRT1) locus, to measure the frequency of AAV-mediated HR in BCL cells. We subsequently constructed an AAV vector encoding the normal sequences from the Fanconi anemia group A (FANCA) locus to correct a mutation in the gene in BCL derived from a FANCA patient. Under optimal conditions, approximately 50% of BCL cells were transduced with an AAV serotype 2 (AAV-2) vector. In FANCA BCL cells, up to 0.016% of infected cells were gene-corrected by HR. AAV-mediated restoration of normal genotypic and phenotypic characteristics in FANCA-mutant cells was confirmed at the DNA, protein and functional levels. The results obtained in the present study indicate that AAV vectors may be applicable for gene correction therapy of inherited hematopoietic disorders.

  3. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    Wogulis, Mark; Sweeney, Matthew; Heu, Tia


    The present invention relates to chimeric GH61 polypeptides having cellulolytic enhancing activity. The present invention also relates to polynucleotides encoding the chimeric GH61 polypeptides; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the chimeric GH61 polypeptides.

  4. Polypeptides having xylanase activity and polynucleotides encoding same

    Spodsberg, Nikolaj; Shaghasi, Tarana


    The present invention relates to polypeptides having xylanase activity, catalytic domains, and carbohydrate binding domains, and polynucleotides encoding the polypeptides, catalytic domains, and carbohydrate binding domains. The present invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides, catalytic domains, and carbohydrate binding domains.

  5. EGVII endoglucanase and nucleic acids encoding the same

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA


    The present invention provides an endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  6. Beta-glucosidase variants and polynucleotides encoding same

    Wogulis, Mark; Harris, Paul; Osborn, David


    The present invention relates to beta-glucosidase variants, e.g. beta-glucosidase variants of a parent Family GH3A beta-glucosidase from Aspergillus fumigatus. The present invention also relates to polynucleotides encoding the beta-glucosidase variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the beta-glucosidase variants.

  7. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    Harris, Paul; Golightly, Elizabeth


    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  8. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    Morant, Marc D.; Harris, Paul


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  9. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    Maiyuran, Suchindra; Kramer, Randall; Harris, Paul


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  10. Polynucleotides encoding polypeptides having beta-glucosidase activity

    Harris, Paul; Golightly, Elizabeth


    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  11. Modified montmorillonite as vector for gene delivery.

    Lin, Feng-Huei; Chen, Chia-Hao; Cheng, Winston T K; Kuo, Tzang-Fu


    Currently, gene delivery systems can be divided into two parts: viral or non-viral vectors. In general, viral vectors have a higher efficiency on gene delivery. However, they may sometimes provoke mutagenesis and carcinogenesis once re-activating in human body. Lots of non-viral vectors have been developed that tried to solve the problems happened on viral vectors. Unfortunately, most of non-viral vectors showed relatively lower transfection rate. The aim of this study is to develop a non-viral vector for gene delivery system. Montmorillonite (MMT) is one of clay minerals that consist of hydrated aluminum with Si-O tetrahedrons on the bottom of the layer and Al-O(OH)2 octahedrons on the top. The inter-layer space is about 12 A. The room is not enough to accommodate DNA for gene delivery. In the study, the cationic hexadecyltrimethylammonium (HDTMA) will be intercalated into the interlayer of MMT as a layer expander to expand the layer space for DNA accommodation. The optimal condition for the preparation of DNA-HDTMA-MMT is as follows: 1 mg of 1.5CEC HDTMA-MMT was prepared under pH value of 10.7 and with soaking time for 2 h. The DNA molecules can be protected from nuclease degradation, which can be proven by the electrophoresis analysis. DNA was successfully transfected into the nucleus of human dermal fibroblast and expressed enhanced green fluorescent protein (EGFP) gene with green fluorescence emission. The HDTMA-MMT has a great potential as a vector for gene delivery in the future.

  12. An efficient marker-free vector for clean gene transfer into plants ...

    A marker-free vector, pBINMF, for clean gene transfer was constructed based on the binary vector pBINPLUS. Vector pBINMF, carrying only a multiple cloning site (MCS) between the left and the right T-DNA border, was suitable to directly generate marker-free transgenic plants (MFTPs) without any vector sequences ...

  13. Specific DNA Binding of a Potential Transcriptional Regulator, Inosine 5′-Monophosphate Dehydrogenase-Related Protein VII, to the Promoter Region of a Methyl Coenzyme M Reductase I-Encoding Operon Retrieved from Methanothermobacter thermautotrophicus Strain ΔH▿

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi


    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus ΔH are expressed in response to H2 availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cul...

  14. The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

    Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H


    Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Efficient Sleeping Beauty DNA Transposition From DNA Minicircles

    Nynne Sharma


    Full Text Available DNA transposon-based vectors have emerged as new potential delivery tools in therapeutic gene transfer. Such vectors are now showing promise in hematopoietic stem cells and primary human T cells, and clinical trials with transposon-engineered cells are on the way. However, the use of plasmid DNA as a carrier of the vector raises safety concerns due to the undesirable administration of bacterial sequences. To optimize vectors based on the Sleeping Beauty (SB DNA transposon for clinical use, we examine here SB transposition from DNA minicircles (MCs devoid of the bacterial plasmid backbone. Potent DNA transposition, directed by the hyperactive SB100X transposase, is demonstrated from MC donors, and the stable transfection rate is significantly enhanced by expressing the SB100X transposase from MCs. The stable transfection rate is inversely related to the size of circular donor, suggesting that a MC-based SB transposition system benefits primarily from an increased cellular uptake and/or enhanced expression which can be observed with DNA MCs. DNA transposon and transposase MCs are easily produced, are favorable in size, do not carry irrelevant DNA, and are robust substrates for DNA transposition. In accordance, DNA MCs should become a standard source of DNA transposons not only in therapeutic settings but also in the daily use of the SB system.

  16. UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

    Emanuela Chiarella

    Full Text Available Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6 where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in

  17. UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

    Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni


    Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and

  18. Modular verification of chemical reaction network encodings via serializability analysis

    Lakin, Matthew R.; Stefanovic, Darko; Phillips, Andrew


    Chemical reaction networks are a powerful means of specifying the intended behaviour of synthetic biochemical systems. A high-level formal specification, expressed as a chemical reaction network, may be compiled into a lower-level encoding, which can be directly implemented in wet chemistry and may itself be expressed as a chemical reaction network. Here we present conditions under which a lower-level encoding correctly emulates the sequential dynamics of a high-level chemical reaction network. We require that encodings are transactional, such that their execution is divided by a “commit reaction” that irreversibly separates the reactant-consuming phase of the encoding from the product-generating phase. We also impose restrictions on the sharing of species between reaction encodings, based on a notion of “extra tolerance”, which defines species that may be shared between encodings without enabling unwanted reactions. Our notion of correctness is serializability of interleaved reaction encodings, and if all reaction encodings satisfy our correctness properties then we can infer that the global dynamics of the system are correct. This allows us to infer correctness of any system constructed using verified encodings. As an example, we show how this approach may be used to verify two- and four-domain DNA strand displacement encodings of chemical reaction networks, and we generalize our result to the limit where the populations of helper species are unlimited. PMID:27325906

  19. Methods for transforming and expression screening of filamentous fungal cells with a DNA library

    Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie


    The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

  20. Correction of acid beta-galactosidase deficiency in GM1 gangliosidosis human fibroblasts by retrovirus vector-mediated gene transfer: higher efficiency of release and cross-correction by the murine enzyme.

    Sena-Esteves, M; Camp, S M; Alroy, J; Breakefield, X O; Kaye, E M


    Mutations in the lysosomal acid beta-galactosidase (EC underlie two different disorders: GM1 gangliosidosis, which involves the nervous system and visceral organs to varying extents, and Morquio's syndrome type B (Morquio B disease), which is a skeletal-connective tissue disease without any CNS symptoms. This article shows that transduction of human GM1 gangliosidosis fibroblasts with retrovirus vectors encoding the human acid beta-galactosidase cDNA leads to complete correction of the enzymatic deficiency. The newly synthesized enzyme is correctly processed and targeted to the lysosomes in transduced cells. Cross-correction experiments using retrovirus-modified cells as enzyme donors showed, however, that the human enzyme is transferred at low efficiencies. Experiments using a different retrovirus vector carrying the human cDNA confirmed this observation. Transduction of human GM1 fibroblasts and mouse NIH 3T3 cells with a retrovirus vector encoding the mouse beta-galactosidase cDNA resulted in high levels of enzymatic activity. Furthermore, the mouse enzyme was found to be transferred to human cells at high efficiency. Enzyme activity measurements in medium conditioned by genetically modified cells suggest that the human beta-galactosidase enzyme is less efficiently released to the extracellular space than its mouse counterpart. This study suggests that lysosomal enzymes, contrary to the generalized perception in the field of gene therapy, may differ significantly in their properties and provides insights for design of future gene therapy interventions in acid beta-galactosidase deficiency.

  1. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)


    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  2. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee


    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  3. Tests of conspecificity for allopatric vectors: Simulium nodosum and Simulium shirakii (Diptera: Simuliidae) in Asia.

    Low, Van Lun; Adler, Peter H; Sofian-Azirun, Mohd; Srisuka, Wichai; Saeung, Atiporn; Huang, Yao-Te; Hadi, Upik Kesumawati; Da Pham, Xuan; Takaoka, Hiroyuki


    Allopatric populations present challenges for biologists working with vectors. We suggest that conspecificity can be concluded in these cases when data from four character sets-chromosomal, ecological, molecular, and morphological-express variation no greater between the allopatric populations than between corresponding sympatric populations. We use this approach to test the conspecificity of Simulium nodosum Puri on the mainland of Southeast Asia and Simulium shirakii Kono & Takahasi in Taiwan. The validity of these two putative species has long been disputed given that they are morphologically indistinguishable. The mitochondria-encoded cytochrome c oxidase subunit I (COI), 12S rRNA, and 16S rRNA genes and the nuclear-encoded 28S rRNA gene support the conspecific status of S. nodosum from Myanmar, Thailand, and Vietnam and S. shirakii from Taiwan; 0 to 0.19 % genetic differences between the two taxa suggest intraspecific polymorphism. The banding patterns of the polytene chromosomes of the insular Taiwanese population of S. shirakii and mainland populations of S. nodosum are congruent. The overlapping ranges of habitat characteristics and hosts of S. nodosum and S. shirakii corroborate the chromosomal, molecular, and morphological data. Four independent sources of evidence (chromosomes, DNA, ecology, and morphology) support the conspecificity of S. nodosum and S. shirakii. We, therefore, synonymize S. shirakii with S. nodosum. This study provides a guide for applying the procedure of testing conspecificity to other sets of allopatric vectors.

  4. Raster images vectorization system

    Genytė, Jurgita


    The problem of raster images vectorization was analyzed and researched in this work. Existing vectorization systems are quite expensive, the results are inaccurate, and the manual vectorization of a large number of drafts is impossible. That‘s why our goal was to design and develop a new raster images vectorization system using our suggested automatic vectorization algorithm and the way to record results in a new universal vectorial file format. The work consists of these main parts: analysis...

  5. Learning-based encoding with soft assignment for age estimation under unconstrained imaging conditions

    Alnajar, F.; Shan, C.; Gevers, T.; Geusebroek, J.M.


    In this paper we propose to adopt a learning-based encoding method for age estimation under unconstrained imaging conditions. A similar approach [Cao et al., 2010] is applied to face recognition in real-life face images. However, the feature vectors are encoded in hard manner i.e. each feature

  6. Kochen-Specker vectors

    Pavicic, Mladen; Merlet, Jean-Pierre; McKay, Brendan; Megill, Norman D


    We give a constructive and exhaustive definition of Kochen-Specker (KS) vectors in a Hilbert space of any dimension as well as of all the remaining vectors of the space. KS vectors are elements of any set of orthonormal states, i.e., vectors in an n-dimensional Hilbert space, H n , n≥3, to which it is impossible to assign 1s and 0s in such a way that no two mutually orthogonal vectors from the set are both assigned 1 and that not all mutually orthogonal vectors are assigned 0. Our constructive definition of such KS vectors is based on algorithms that generate MMP diagrams corresponding to blocks of orthogonal vectors in R n , on algorithms that single out those diagrams on which algebraic (0)-(1) states cannot be defined, and on algorithms that solve nonlinear equations describing the orthogonalities of the vectors by means of statistically polynomially complex interval analysis and self-teaching programs. The algorithms are limited neither by the number of dimensions nor by the number of vectors. To demonstrate the power of the algorithms, all four-dimensional KS vector systems containing up to 24 vectors were generated and described, all three-dimensional vector systems containing up to 30 vectors were scanned, and several general properties of KS vectors were found

  7. Development of shuttle vectors for transformation of diverse Rickettsia species.

    Nicole Y Burkhardt

    Full Text Available Plasmids have been identified in most species of Rickettsia examined, with some species maintaining multiple different plasmids. Three distinct plasmids were demonstrated in Rickettsia amblyommii AaR/SC by Southern analysis using plasmid specific probes. Copy numbers of pRAM18, pRAM23 and pRAM32 per chromosome in AaR/SC were estimated by real-time PCR to be 2.0, 1.9 and 1.3 respectively. Cloning and sequencing of R. amblyommii AaR/SC plasmids provided an opportunity to develop shuttle vectors for transformation of rickettsiae. A selection cassette encoding rifampin resistance and a fluorescent marker was inserted into pRAM18 yielding a 27.6 kbp recombinant plasmid, pRAM18/Rif/GFPuv. Electroporation of Rickettsia parkeri and Rickettsia bellii with pRAM18/Rif/GFPuv yielded GFPuv-expressing rickettsiae within 2 weeks. Smaller vectors, pRAM18dRG, pRAM18dRGA and pRAM32dRGA each bearing the same selection cassette, were made by moving the parA and dnaA-like genes from pRAM18 or pRAM32 into a vector backbone. R. bellii maintained the highest numbers of pRAM18dRGA (13.3 - 28.1 copies, and R. parkeri, Rickettsia monacensis and Rickettsia montanensis contained 9.9, 5.5 and 7.5 copies respectively. The same species transformed with pRAM32dRGA maintained 2.6, 2.5, 3.2 and 3.6 copies. pRM, the plasmid native to R. monacensis, was still present in shuttle vector transformed R. monacensis at a level similar to that found in wild type R. monacensis after 15 subcultures. Stable transformation of diverse rickettsiae was achieved with a shuttle vector system based on R. amblyommii plasmids pRAM18 and pRAM32, providing a new research tool that will greatly facilitate genetic and biological studies of rickettsiae.

  8. Correlated Topic Vector for Scene Classification.

    Wei, Pengxu; Qin, Fei; Wan, Fang; Zhu, Yi; Jiao, Jianbin; Ye, Qixiang


    Scene images usually involve semantic correlations, particularly when considering large-scale image data sets. This paper proposes a novel generative image representation, correlated topic vector, to model such semantic correlations. Oriented from the correlated topic model, correlated topic vector intends to naturally utilize the correlations among topics, which are seldom considered in the conventional feature encoding, e.g., Fisher vector, but do exist in scene images. It is expected that the involvement of correlations can increase the discriminative capability of the learned generative model and consequently improve the recognition accuracy. Incorporated with the Fisher kernel method, correlated topic vector inherits the advantages of Fisher vector. The contributions to the topics of visual words have been further employed by incorporating the Fisher kernel framework to indicate the differences among scenes. Combined with the deep convolutional neural network (CNN) features and Gibbs sampling solution, correlated topic vector shows great potential when processing large-scale and complex scene image data sets. Experiments on two scene image data sets demonstrate that correlated topic vector improves significantly the deep CNN features, and outperforms existing Fisher kernel-based features.

  9. a permutation encoding te algorithm solution of reso tation encoding


    Keywords: Genetic algorithm, resource constrained. 1. INTRODUCTION. 1. .... Nigerian Journal of Technology. Vol. 34, No. 1, January 2015. 128 ... 4. ENCODING OF CHROMOSOME. ENCODING OF CHROMOSOME .... International Multi conference of Engineers and ... method”, Naval Research Logistics, vol 48, issue 2,.

  10. Immune-enhancing effect of nano-DNA vaccine encoding a gene of the prME protein of Japanese encephalitis virus and BALB/c mouse granulocyte-macrophage colony-stimulating factor.

    Zhai, Yongzhen; Zhou, Yan; Li, Ximei; Feng, Guohe


    Plasmid-encoded granulocyte-macrophage colony-stimulating factor (GM‑CSF) is an adjuvant for genetic vaccines; however, how GM-CSF enhances immunogenicity remains to be elucidated. In the present study, it was demonstrated that injection of a plasmid encoding the premembrane (prM) and envelope (E) protein of Japanese encephalitis virus and mouse GM-CSF (pJME/GM-CSF) into mouse muscle recruited large and multifocal conglomerates of macrophages and granulocytes, predominantly neutrophils. During the peak of the infiltration, an appreciable number of immature dendritic cells (DCs) appeared, although no T and B-cells was detected. pJME/GM-CSF increased the number of splenic DCs and the expression of major histocompatibility complex class II (MHCII) on splenic DC, and enhanced the antigenic capture, processing and presentation functions of splenic DCs, and the cell-mediated immunity induced by the vaccine. These findings suggested that the immune-enhancing effect by pJME/GM-CSF was associated with infiltrate size and the appearance of integrin αx (CD11c)+cells. Chitosan-pJME/GM-CSF nanoparticles, prepared by coacervation via intramuscular injection, outperformed standard pJME/GM-CSF administrations in DC recruitment, antigen processing and presentation, and vaccine enhancement. This revealed that muscular injection of chitosan‑pJME/GM-CSF nanoparticles may enhance the immunoadjuvant properties of GM-CSF.

  11. Encoded libraries of chemically modified peptides.

    Heinis, Christian; Winter, Greg


    The use of powerful technologies for generating and screening DNA-encoded protein libraries has helped drive the development of proteins as pharmaceutical ligands. However the development of peptides as pharmaceutical ligands has been more limited. Although encoded peptide libraries are typically several orders of magnitude larger than classical chemical libraries, can be more readily screened, and can give rise to higher affinity ligands, their use as pharmaceutical ligands is limited by their intrinsic properties. Two of the intrinsic limitations include the rotational flexibility of the peptide backbone and the limited number (20) of natural amino acids. However these limitations can be overcome by use of chemical modification. For example, the libraries can be modified to introduce topological constraints such as cyclization linkers, or to introduce new chemical entities such as small molecule ligands, fluorophores and photo-switchable compounds. This article reviews the chemistry involved, the properties of the peptide ligands, and the new opportunities offered by chemical modification of DNA-encoded peptide libraries. Copyright © 2015. Published by Elsevier Ltd.

  12. Safety and Immunogenicity of a Recombinant Adenovirus Serotype 35-Vectored HIV-1 Vaccine in Adenovirus Serotype 5 Seronegative and Seropositive Individuals.

    Fuchs, Jonathan D; Bart, Pierre-Alexandre; Frahm, Nicole; Morgan, Cecilia; Gilbert, Peter B; Kochar, Nidhi; DeRosa, Stephen C; Tomaras, Georgia D; Wagner, Theresa M; Baden, Lindsey R; Koblin, Beryl A; Rouphael, Nadine G; Kalams, Spyros A; Keefer, Michael C; Goepfert, Paul A; Sobieszczyk, Magdalena E; Mayer, Kenneth H; Swann, Edith; Liao, Hua-Xin; Haynes, Barton F; Graham, Barney S; McElrath, M Juliana


    Recombinant adenovirus serotype 5 (rAd5)-vectored HIV-1 vaccines have not prevented HIV-1 infection or disease and pre-existing Ad5 neutralizing antibodies may limit the clinical utility of Ad5 vectors globally. Using a rare Ad serotype vector, such as Ad35, may circumvent these issues, but there are few data on the safety and immunogenicity of rAd35 directly compared to rAd5 following human vaccination. HVTN 077 randomized 192 healthy, HIV-uninfected participants into one of four HIV-1 vaccine/placebo groups: rAd35/rAd5, DNA/rAd5, and DNA/rAd35 in Ad5-seronegative persons; and DNA/rAd35 in Ad5-seropositive persons. All vaccines encoded the HIV-1 EnvA antigen. Antibody and T-cell responses were measured 4 weeks post boost immunization. All vaccines were generally well tolerated and similarly immunogenic. As compared to rAd5, rAd35 was equally potent in boosting HIV-1-specific humoral and cellular immunity and responses were not significantly attenuated in those with baseline Ad5 seropositivity. Like DNA, rAd35 efficiently primed rAd5 boosting. All vaccine regimens tested elicited cross-clade antibody responses, including Env V1/V2-specific IgG responses. Vaccine antigen delivery by rAd35 is well-tolerated and immunogenic as a prime to rAd5 immunization and as a boost to prior DNA immunization with the homologous insert. Further development of rAd35-vectored prime-boost vaccine regimens is warranted.

  13. Vector regression introduced

    Mok Tik


    Full Text Available This study formulates regression of vector data that will enable statistical analysis of various geodetic phenomena such as, polar motion, ocean currents, typhoon/hurricane tracking, crustal deformations, and precursory earthquake signals. The observed vector variable of an event (dependent vector variable is expressed as a function of a number of hypothesized phenomena realized also as vector variables (independent vector variables and/or scalar variables that are likely to impact the dependent vector variable. The proposed representation has the unique property of solving the coefficients of independent vector variables (explanatory variables also as vectors, hence it supersedes multivariate multiple regression models, in which the unknown coefficients are scalar quantities. For the solution, complex numbers are used to rep- resent vector information, and the method of least squares is deployed to estimate the vector model parameters after transforming the complex vector regression model into a real vector regression model through isomorphism. Various operational statistics for testing the predictive significance of the estimated vector parameter coefficients are also derived. A simple numerical example demonstrates the use of the proposed vector regression analysis in modeling typhoon paths.

  14. Parallel encoders for pixel detectors

    Nikityuk, N.M.


    A new method of fast encoding and determining the multiplicity and coordinates of fired pixels is described. A specific example construction of parallel encodes and MCC for n=49 and t=2 is given. 16 refs.; 6 figs.; 2 tabs

  15. Efficient generation of rat induced pluripotent stem cells using a non-viral inducible vector.

    Claudia Merkl

    Full Text Available Current methods of generating rat induced pluripotent stem cells are based on viral transduction of pluripotency inducing genes (Oct4, Sox2, c-myc and Klf4 into somatic cells. These activate endogenous pluripotency genes and reprogram the identity of the cell to an undifferentiated state. Epigenetic silencing of exogenous genes has to occur to allow normal iPS cell differentiation. To gain more control over the expression of exogenous reprogramming factors, we used a novel doxycycline-inducible plasmid vector encoding Oct4, Sox2, c-Myc and Klf4. To ensure efficient and controlled generation of iPS cells by plasmid transfection we equipped the reprogramming vector with a bacteriophage φC31 attB site and used a φC31 integrase expression vector to enhance vector integration. A series of doxycycline-independent rat iPS cell lines were established. These were characterized by immunocytochemical detection of Oct4, SSEA1 and SSEA4, alkaline phosphatase staining, methylation analysis of the endogenous Oct4 promoter and RT-PCR analysis of endogenous rat pluripotency genes. We also determined the number of vector integrations and the extent to which reprogramming factor gene expression was controlled. Protocols were developed to generate embryoid bodies and rat iPS cells demonstrated as pluripotent by generating derivatives of all three embryonic germ layers in vitro, and teratoma formation in vivo. All data suggest that our rat iPS cells, generated by plasmid based reprogramming, are similar to rat ES cells. Methods of DNA transfection, protein transduction and feeder-free monolayer culture of rat iPS cells were established to enable future applications.

  16. Construction and expression of eukaryotic expression vectors of full-length, amino-terminus and carboxyl-terminus Raf gene

    Zhuomin WANG


    Full Text Available Background and objective Raf is a key molecule in the Ras-Raf-MEK-ERK signal transduction pathway and is highly activated in different human carcinomas. However, its biological functions and regulation mechanisms are still unclear. The aims of this study were to construct eukaryotic expression vectors with Raf full encoding region, truncated amino-terminus and carboxyl-terminus, respectively. Methods Eukaryotic expression vectors of pCMV-Tag2b-Raf-1, pCMV-Tag2b-N-Raf and pCMV-Tag2b-C-Raf were constructed by gene recombination technique and confirmed by restriction enzyme analysis and DNA sequencing. Furthermore, the expression of these fusion proteins was detected by western blot in transient transfected 293T cells. Results The sequences and open reading frames of these three vectors were completely consistent with experimental design. All target proteins can be detected in 293T cells. Conclusion Eukaryotic expression vectors of pCMV-Tag2b-Raf-1, pCMV-Tag2b-N-Raf and pCMV-Tag2b-C-Raf were successfully constructed and can be expressed in 293T cells.

  17. Construction of lentiviral shRNA expression vector targeting ...

    DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

  18. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R


    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  19. VectorBase

    U.S. Department of Health & Human Services — VectorBase is a Bioinformatics Resource Center for invertebrate vectors. It is one of four Bioinformatics Resource Centers funded by NIAID to provide web-based...

  20. Gateway-compatible vectors for high-throughput protein expression in pro- and eukaryotic cell-free systems.

    Gagoski, Dejan; Mureev, Sergey; Giles, Nichole; Johnston, Wayne; Dahmer-Heath, Mareike; Škalamera, Dubravka; Gonda, Thomas J; Alexandrov, Kirill


    Although numerous techniques for protein expression and production are available the pace of genome sequencing outstrips our ability to analyze the encoded proteins. To address this bottleneck, we have established a system for parallelized cloning, DNA production and cell-free expression of large numbers of proteins. This system is based on a suite of pCellFree Gateway destination vectors that utilize a Species Independent Translation Initiation Sequence (SITS) that mediates recombinant protein expression in any in vitro translation system. These vectors introduce C or N terminal EGFP and mCherry fluorescent and affinity tags, enabling direct analysis and purification of the expressed proteins. To maximize throughput and minimize the cost of protein production we combined Gateway cloning with Rolling Circle DNA Amplification. We demonstrate that as little as 0.1 ng of plasmid DNA is sufficient for template amplification and production of recombinant human protein in Leishmania tarentolae and Escherichia coli cell-free expression systems. Our experiments indicate that this approach can be applied to large gene libraries as it can be reliably performed in multi-well plates. The resulting protein expression pipeline provides a valuable new tool for applications of the post genomic era. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. The humoral immune response to recombinant nucleocapsid antigen of canine distemper virus in dogs vaccinated with attenuated distemper virus or DNA encoding the nucleocapsid of wild-type virus.

    Griot-Wenk, M E; Cherpillod, P; Koch, A; Zurbriggen, R; Bruckner, L; Wittek, R; Zurbriggen, A


    This study compared the humoral immune response against the nucleocapsid-(N) protein of canine distemper virus (CDV) of dogs vaccinated with a multivalent vaccine against parvo-, adeno-, and parainfluenza virus and leptospira combined with either the attenuated CDV Onderstepoort strain (n = 15) or an expression plasmid containing the N-gene of CDV (n = 30). The vaccinations were applied intramuscularly three times at 2-week intervals beginning at the age of 6 weeks. None of the pre-immune sera recognized the recombinant N-protein, confirming the lack of maternal antibodies at this age. Immunization with DNA vaccine for CDV resulted in positive serum N-specific IgG response. However, their IgG (and IgA) titres were lower than those of CDV-vaccinated dogs. Likewise, DNA-vaccinated dogs did not show an IgM peak. There was no increase in N-specific serum IgE titres in either group. Serum titres to the other multivalent vaccine components were similar in both groups.

  2. A single dose of a DNA vaccine encoding apa coencapsulated with 6,6'-trehalose dimycolate in microspheres confers long-term protection against tuberculosis in Mycobacterium bovis BCG-primed mice.

    Carlétti, Dyego; Morais da Fonseca, Denise; Gembre, Ana Flávia; Masson, Ana Paula; Weijenborg Campos, Lívia; Leite, Luciana C C; Rodrigues Pires, Andréa; Lannes-Vieira, Joseli; Lopes Silva, Célio; Bonato, Vânia Luiza Deperon; Horn, Cynthia


    Mycobacterium bovis BCG prime DNA (Mycobacterium tuberculosis genes)-booster vaccinations have been shown to induce greater protection against tuberculosis (TB) than BCG alone. This heterologous prime-boost strategy is perhaps the most realistic vaccination for the future of TB infection control, especially in countries where TB is endemic. Moreover, a prime-boost regimen using biodegradable microspheres seems to be a promising immunization to stimulate a long-lasting immune response. The alanine proline antigen (Apa) is a highly immunogenic glycoprotein secreted by M. tuberculosis. This study investigated the immune protection of Apa DNA vaccine against intratracheal M. tuberculosis challenge in mice on the basis of a heterologous prime-boost regimen. BALB/c mice were subcutaneously primed with BCG and intramuscularly boosted with a single dose of plasmid carrying apa and 6,6'-trehalose dimycolate (TDM) adjuvant, coencapsulated in microspheres (BCG-APA), and were evaluated 30 and 70 days after challenge. This prime-boost strategy (BCG-APA) resulted in a significant reduction in the bacterial load in the lungs, thus leading to better preservation of the lung parenchyma, 70 days postinfection compared to BCG vaccinated mice. The profound effect of this heterologous prime-boost regimen in the experimental model supports its development as a feasible strategy for prevention of TB.

  3. Generalization of concurrence vectors

    Yu Changshui; Song Heshan


    In this Letter, based on the generalization of concurrence vectors for bipartite pure state with respect to employing tensor product of generators of the corresponding rotation groups, we generalize concurrence vectors to the case of mixed states; a new criterion of separability of multipartite pure states is given out, for which we define a concurrence vector; we generalize the vector to the case of multipartite mixed state and give out a good measure of free entanglement

  4. Vector Network Coding

    Ebrahimi, Javad; Fragouli, Christina


    We develop new algebraic algorithms for scalar and vector network coding. In vector network coding, the source multicasts information by transmitting vectors of length L, while intermediate nodes process and combine their incoming packets by multiplying them with L X L coding matrices that play a similar role as coding coefficients in scalar coding. Our algorithms for scalar network jointly optimize the employed field size while selecting the coding coefficients. Similarly, for vector co...

  5. Vector Network Coding Algorithms

    Ebrahimi, Javad; Fragouli, Christina


    We develop new algebraic algorithms for scalar and vector network coding. In vector network coding, the source multicasts information by transmitting vectors of length L, while intermediate nodes process and combine their incoming packets by multiplying them with L x L coding matrices that play a similar role as coding c in scalar coding. Our algorithms for scalar network jointly optimize the employed field size while selecting the coding coefficients. Similarly, for vector coding, our algori...

  6. Thioredoxin suppresses microscopic hopping of T7 DNA polymerase on duplex DNA

    Etson, Candice M.; Hamdan, Samir M.; Richardson, Charles C.; Oijen, Antoine M. van; Richardson, Charles C.


    The DNA polymerases involved in DNA replication achieve high processivity of nucleotide incorporation by forming a complex with processivity factors. A model system for replicative DNA polymerases, the bacteriophage T7 DNA polymerase (gp5), encoded by gene 5, forms a tight, 1:1 complex with

  7. Adenoviral DNA replication: DNA sequences and enzymes required for initiation in vitro

    Stillman, B.W.; Tamanoi, F.


    In this paper evidence is provided that the 140,000-dalton DNA polymerase is encoded by the adenoviral genome and is required for the initiation of DNA replication in vitro. The DNA sequences in the template DNA that are required for the initiation of replication have also been identified, using both plasmid DNAs and synthetic oligodeoxyribonucleotides. 48 references, 7 figures, 1 table

  8. Convexity and Marginal Vectors

    van Velzen, S.; Hamers, H.J.M.; Norde, H.W.


    In this paper we construct sets of marginal vectors of a TU game with the property that if the marginal vectors from these sets are core elements, then the game is convex.This approach leads to new upperbounds on the number of marginal vectors needed to characterize convexity.An other result is that

  9. Custodial vector model

    Becciolini, Diego; Franzosi, Diogo Buarque; Foadi, Roshan


    We analyze the Large Hadron Collider (LHC) phenomenology of heavy vector resonances with a $SU(2)_L\\times SU(2)_R$ spectral global symmetry. This symmetry partially protects the electroweak S-parameter from large contributions of the vector resonances. The resulting custodial vector model spectrum...

  10. The role of DNA polymerase {iota} in UV mutational spectra

    Choi, Jun-Hyuk [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Besaratinia, Ahmad [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Dong-Hyun [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Chong-Soon [Department of Biochemistry, College of Natural Sciences, Yeungnam University, Gyongsan 712-749 (Korea, Republic of); Pfeifer, Gerd P. [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States)]. E-mail:


    UVB (280-320 nm) and UVC (200-280 nm) irradiation generate predominantly cyclobutane pyrimidine dimers (CPDs) and (6-4) photoproducts in DNA. CPDs are thought to be responsible for most of the UV-induced mutations. Thymine-thymine CPDs, and probably also CPDs containing cytosine, are replicated in vivo in a largely accurate manner by a DNA polymerase {eta} (Pol {eta}) dependent process. Pol {eta} is a DNA damage-tolerant and error-prone DNA polymerase encoded by the POLH (XPV) gene in humans. Another member of the Y family of error-prone DNA polymerases is POLI encoding DNA polymerase iota (Pol {iota}). In order to clarify the specific role of Pol {iota} in UV mutagenesis, we have used an siRNA knockdown approach in combination with a supF shuttle vector which replicates in mammalian cells, similar as we have previously done for Pol {eta}. Synthetic RNA duplexes were used to efficiently inhibit Pol {iota} expression in 293T cells. The supF shuttle vector was irradiated with 254 nm UVC and replicated in 293T cells in presence of anti-Pol {iota} siRNA. Surprisingly, there was a consistent reduction of recovered plasmid from cells with Pol {iota} knockdown and this was independent of UV irradiation of the plasmid. The supF mutant frequency was unchanged in the siRNA knockdown cells relative to control cells confirming that Pol {iota} does not play an important role in UV mutagenesis. UV-induced supF mutants were sequenced from siRNA-treated cells and controls. Neither the type of mutations nor their distribution along the supF gene were significantly different between controls and siRNA knockdown cells and were predominantly C to T and CC to TT transitions at dipyrimidine sites. These results show that Pol {iota} has no significant role in UV lesion bypass and mutagenesis in vivo and provides some initial data suggesting that this polymerase may be involved in replication of extrachromosomal DNA.

  11. DNA-based machines.

    Wang, Fuan; Willner, Bilha; Willner, Itamar


    The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.

  12. DNA repair and cancer

    Rathore, Shakuntla; Joshi, Pankaj Kumar; Gaur, Sudha


    DNA repair refers to a collection of processes by which a cell identifies and corrects damage to the DNA molecule that encode it's genome. In human cells, both normal metabolic activities and environmental factors such as UV light and radiation can cause DNA damage, resulting in as many one million individual molecular lesions per day. Many of these lesions cause structural damage to the DNA molecule and can alter or eliminate the cell's ability to transcribe the gene that the affected DNA encodes. Other lesions include potentially harmful mutation in cell's genome which affect the survival of it's daughter cells after it undergoes mitosis. As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. Inherited mutation that affect DNA repair genes are strongly associated with high cancer risks in humans. Hereditary non polyposis colorectal cancer (HNPCC) is strongly associated with specific mutation in the DNA mismatch repair pathway. BRCA1, BRCA2 two famous mutation conferring a hugely increased risk of breast cancer on carrier, are both associated with a large number of DNA repair pathway, especially NHEJ and homologous recombination. Cancer therapy procedures such as chemotherapy and radiotherapy work by overwhelming the capacity of the cell to repair DNA damage, resulting in cell death. Cells that are most rapidly dividing most typically cancer cells are preferentially affected. The side effect is that other non-cancerous but rapidly dividing cells such as stem cells in the bone marrow are also affected. Modern cancer treatment attempt to localize the DNA damage to cells and tissue only associated with cancer, either by physical means (concentrating the therapeutic agent in the region of the tumor) or by biochemical means (exploiting a feature unique to cancer cells in the body). (author)

  13. Improved humoral and cellular immune response against the gp120 V3 loop of HIV-1 following genetic immunization with a chimeric DNA vaccine encoding the V3 inserted into the hepatites B surface antigen

    Fomsgaard, A.; Nielsen, H.V.; Bryder, K.


    response and a uniform strong anti-HBs CTL response already 1 week p.i. in all mice. DNA vaccination with the chimeric MN V2/HBsAg plasmid elicited humoral responses against both viruses within 3-6 weeks which peaked at 6-12 weeks and remained stable for at least 25 weeks. In addition, specific CTL...... responses were induced in all mice against both MN V3 and HBsAg already within the first 3 weeks, lasting at least 11 weeks. Thus, HBsAg acts as a `genetic vaccine adjuvant' augmenting and accelerating the cellular and humoral immune response against the inserted MN V3 loop. Such chimeric HIV-HbsAg plasmid...

  14. Improved humoral and cellular immune responses against the gp120 V3 loop of HIV-1 following genetic immunization with a chimeric DNA vaccine encoding the V3 inserted into the hepatitis B surface antigen

    Fomsgaard, A; Nielsen, H V; Bryder, K


    response and a uniform strong anti-HBs CTL response already 1 week p.i. in all mice. DNA vaccination with the chimeric MN V3/HBsAg plasmid elicited humoral responses against both viruses within 3-6 weeks which peaked at 6-12 weeks and remained stable for at least 25 weeks. In addition, specific CTL...... responses were induced in all mice against both MN V3 and HBsAg already within the first 3 weeks, lasting at least 11 weeks. Thus, HBsAg acts as a 'genetic vaccine adjuvant' augmenting and accelerating the cellular and humoral immune response against the inserted MN V3 loop. Such chimeric HIV-HBsAg plasmid...

  15. Vaxvec: The first web-based recombinant vaccine vector database and its data analysis

    Deng, Shunzhou; Martin, Carly; Patil, Rasika; Zhu, Felix; Zhao, Bin; Xiang, Zuoshuang; He, Yongqun


    A recombinant vector vaccine uses an attenuated virus, bacterium, or parasite as the carrier to express a heterologous antigen(s). Many recombinant vaccine vectors and related vaccines have been developed and extensively investigated. To compare and better understand recombinant vectors and vaccines, we have generated Vaxvec (, the first web-based database that stores various recombinant vaccine vectors and those experimentally verified vaccines that use these vectors. Vaxvec has now included 59 vaccine vectors that have been used in 196 recombinant vector vaccines against 66 pathogens and cancers. These vectors are classified to 41 viral vectors, 15 bacterial vectors, 1 parasitic vector, and 1 fungal vector. The most commonly used viral vaccine vectors are double-stranded DNA viruses, including herpesviruses, adenoviruses, and poxviruses. For example, Vaxvec includes 63 poxvirus-based recombinant vaccines for over 20 pathogens and cancers. Vaxvec collects 30 recombinant vector influenza vaccines that use 17 recombinant vectors and were experimentally tested in 7 animal models. In addition, over 60 protective antigens used in recombinant vector vaccines are annotated and analyzed. User-friendly web-interfaces are available for querying various data in Vaxvec. To support data exchange, the information of vaccine vectors, vaccines, and related information is stored in the Vaccine Ontology (VO). Vaxvec is a timely and vital source of vaccine vector database and facilitates efficient vaccine vector research and development. PMID:26403370

  16. C3d enhanced DNA vaccination induced humoral immune response to glycoprotein C of pseudorabies virus

    Tong Tiezhu; Fan Huiying; Tan Yadi; Xiao Shaobo; Ling Jieyu; Chen Huanchun; Guo Aizhen


    Murine C3d were utilized to enhance immunogenicity of pseudorabies virus (PrV) gC DNA vaccination. Three copies of C3d and four copies of CR2-binding domain M28 4 were fused, respectively, to truncated gC gene encoding soluble glycoprotein C (sgC) in pcDNA3.1. BALB/c mice were, respectively, immunized with recombinant plasmids, blank vector, and inactivated vaccine. The antibody ELISA titer for sgC-C3d 3 DNA was 49-fold more than that for sgC DNA, and the neutralizing antibody obtained 8-fold rise. Protection of mice from death after lethal PrV (316 LD 5 ) challenge was augmented from 25% to 100%. Furthermore, C3d fusion increased Th2-biased immune response by inducing IL-4 production. The IL-4 level for sgC-C3d 3 DNA immunization approached that for the inactivated vaccine. Compared to C3d, M28 enhanced sgC DNA immunogenicity to a lesser extent. In conclusion, we demonstrated that murine C3d fusion significantly enhanced gC DNA immunity by directing Th1-biased to a balanced and more effective Th1/Th2 response

  17. Ancient DNA

    Willerslev, Eske; Cooper, Alan


    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  18. Rotations with Rodrigues' vector

    Pina, E


    The rotational dynamics was studied from the point of view of Rodrigues' vector. This vector is defined here by its connection with other forms of parametrization of the rotation matrix. The rotation matrix was expressed in terms of this vector. The angular velocity was computed using the components of Rodrigues' vector as coordinates. It appears to be a fundamental matrix that is used to express the components of the angular velocity, the rotation matrix and the angular momentum vector. The Hamiltonian formalism of rotational dynamics in terms of this vector uses the same matrix. The quantization of the rotational dynamics is performed with simple rules if one uses Rodrigues' vector and similar formal expressions for the quantum operators that mimic the Hamiltonian classical dynamics.

  19. An adeno-associated viral vector transduces the rat hypothalamus and amygdala more efficient than a lentiviral vector

    Vreugdenhil Erno


    Full Text Available Abstract Background This study compared the transduction efficiencies of an adeno-associated viral (AAV vector, which was pseudotyped with an AAV1 capsid and encoded the green fluorescent protein (GFP, with a lentiviral (LV vector, which was pseudotyped with a VSV-G envelop and encoded the discosoma red fluorescent protein (dsRed, to investigate which viral vector transduced the lateral hypothalamus or the amygdala more efficiently. The LV-dsRed and AAV1-GFP vector were mixed and injected into the lateral hypothalamus or into the amygdala of adult rats. The titers that were injected were 1 × 108 or 1 × 109 genomic copies of AAV1-GFP and 1 × 105 transducing units of LV-dsRed. Results Immunostaining for GFP and dsRed showed that AAV1-GFP transduced significantly more cells than LV-dsRed in both the lateral hypothalamus and the amygdala. In addition, the number of LV particles that were injected can not easily be increased, while the number of AAV1 particles can be increased easily with a factor 100 to 1000. Both viral vectors appear to predominantly transduce neurons. Conclusions This study showed that AAV1 vectors are better tools to overexpress or knockdown genes in the lateral hypothalamus and amygdala of adult rats, since more cells can be transduced with AAV1 than with LV vectors and the titer of AAV1 vectors can easily be increased to transduce the area of interest.

  20. Selecting Operations for Assembler Encoding

    Tomasz Praczyk


    Full Text Available Assembler Encoding is a neuro-evolutionary method in which a neural network is represented in the form of a simple program called Assembler Encoding Program. The task of the program is to create the so-called Network Definition Matrix which maintains all the information necessary to construct the network. To generate Assembler Encoding Programs and the subsequent neural networks evolutionary techniques are used.
    The performance of Assembler Encoding strongly depends on operations used in Assembler Encoding Programs. To select the most effective operations, experiments in the optimization and the predator-prey problem were carried out. In the experiments, Assembler Encoding Programs equipped with different types of operations were tested. The results of the tests are presented at the end of the paper.

  1. Molecular Cloning, Expression and Characterization of Plasmid Encoding Rhomboid 4 (ROM4 of Tachyzoite of Toxoplasma gondii RH Strain

    Mohammad Taghi RAHIMI


    Full Text Available AbstractBackground: The objective of this study was to clone, express and characterize the gene encoding rhomboid 4 (ROM4 proteins, a vital gene in surface adhesion and host cell invasion process of tachyzoite of T. gondii in an appropriate expression vector and eukaryotic cell for production of recombinant protein.Methods: Toxoplasma RNA was isolated from tachyzoites (RH strain and complementary DNA was synthesized. Oligonucleotide primer pair was designed based on Toxoplasma ROM4 gene sequence with XhoI and EcoRI restriction sites at 5´ end of forward and reverse primers, respectively. ROM4 gene was amplified by PCR, cloned into pTG19-T vector and the recombinant plasmid was sequenced. The gene was subcloned into pcDNA3 plasmid and expressed in CHO cells as eukaryotic cell. SDS-PAGE and western blotting were performed for protein determination and verification.Results: Cloning of ROM4 gene in pTG19-T vector was confirmed by colony-PCR and enzymatic digestion. The results of enzymatic digestion and gene sequencing confirmed successful cloning and subcloning procedures. The nucleotide sequence of the cloned ROM4 gene showed 99% homology compared to the corresponding sequences of original gene. SDS-PAGE and western blotting analyses of the purified protein revealed a single band having expected size of 65 kDa.Conclusion: This eukaryotic expression system is an appropriate system for high-level recombinant protein production of ROM4 gene from T. gondii tachyzoites used as antigenic component for serological assay and vaccine development.

  2. Low-complexity video encoding method for wireless image transmission in capsule endoscope.

    Takizawa, Kenichi; Hamaguchi, Kiyoshi


    This paper presents a low-complexity video encoding method applicable for wireless image transmission in capsule endoscopes. This encoding method is based on Wyner-Ziv theory, in which side information available at a transmitter is treated as side information at its receiver. Therefore complex processes in video encoding, such as estimation of the motion vector, are moved to the receiver side, which has a larger-capacity battery. As a result, the encoding process is only to decimate coded original data through channel coding. We provide a performance evaluation for a low-density parity check (LDPC) coding method in the AWGN channel.

  3. Soybean phytase and nucleic acid encoding the same


    Isolated soybean phytase polypeptides and isolated nucleic acids encoding soybean phytases are provided. The invention is also directed to nucleic acid expression constructs, vectors, and host cells comprising the isolated soybean phytase nucleic acids, as well as methods for producing recombinant and non-recombinant purified soybean phytase. The invention also relates to transgenic plants expressing the soybean phytase, particularly expression under seed-specific expression control elements.

  4. Molecular characterization of genome segments 1 and 3 encoding two capsid proteins of Antheraea mylitta cytoplasmic polyhedrosis virus

    Chakrabarti Mrinmay


    Full Text Available Abstract Background Antheraea mylitta cytoplasmic polyhedrosis virus (AmCPV, a cypovirus of Reoviridae family, infects Indian non-mulberry silkworm, Antheraea mylitta, and contains 11 segmented double stranded RNA (S1-S11 in its genome. Some of its genome segments (S2 and S6-S11 have been previously characterized but genome segments encoding viral capsid have not been characterized. Results In this study genome segments 1 (S1 and 3 (S3 of AmCPV were converted to cDNA, cloned and sequenced. S1 consisted of 3852 nucleotides, with one long ORF of 3735 nucleotides and could encode a protein of 1245 amino acids with molecular mass of ~141 kDa. Similarly, S3 consisted of 3784 nucleotides having a long ORF of 3630 nucleotides and could encode a protein of 1210 amino acids with molecular mass of ~137 kDa. BLAST analysis showed 20-22% homology of S1 and S3 sequence with spike and capsid proteins, respectively, of other closely related cypoviruses like Bombyx mori CPV (BmCPV, Lymantria dispar CPV (LdCPV, and Dendrolimus punctatus CPV (DpCPV. The ORFs of S1 and S3 were expressed as 141 kDa and 137 kDa insoluble His-tagged fusion proteins, respectively, in Escherichia coli M15 cells via pQE-30 vector, purified through Ni-NTA chromatography and polyclonal antibodies were raised. Immunoblot analysis of purified polyhedra, virion particles and virus infected mid-gut cells with the raised anti-p137 and anti-p141 antibodies showed specific immunoreactive bands and suggest that S1 and S3 may code for viral structural proteins. Expression of S1 and S3 ORFs in insect cells via baculovirus recombinants showed to produce viral like particles (VLPs by transmission electron microscopy. Immunogold staining showed that S3 encoded proteins self assembled to form viral outer capsid and VLPs maintained their stability at different pH in presence of S1 encoded protein. Conclusion Our results of cloning, sequencing and functional analysis of AmCPV S1 and S3 indicate that S3

  5. DNA controlled assembly of liposomes

    Vogel, Stefan; Jakobsen, Ulla; Simonsen, Adam Cohen


    DNA-encoding of solid nanoparticles requires surfacechemistry, which is often tedious and not generally applicable. In the present study non-covalently attached DNA are used to assemble soft nanoparticles (liposomes) in solution. This process displays remarkably sharp thermal transitions from...... assembled to disassembled state for which reason this method allows easy and fast detection of polynucleotides (e.g. DNA or RNA), including single nucleotide polymorphisms as well as insertions and deletions....

  6. Vector choice determines immunogenicity and potency of genetic vaccines against Angola Marburg virus in nonhuman primates

    Geisbert, Thomas W.; Bailey, Michael; Geisbert, Joan B.; Asiedu, Clement; Roederer, Mario; Grazia-Pau, Maria; Custers, Jerome; Jahrling, Peter; Goudsmit, Jaap; Koup, Richard; Sullivan, Nancy J.


    The immunogenicity and durability of genetic vaccines are influenced by the composition of gene inserts and choice of delivery vector. DNA vectors are a promising vaccine approach showing efficacy when combined in prime-boost regimens with recombinant protein or viral vectors, but they have shown

  7. Phenotypic correction of von Willebrand disease type 3 blood-derived endothelial cells with lentiviral vectors expressing von Willebrand factor

    De Meyer, Simon F.; Vanhoorelbeke, Karen; Chuah, Marinee K.; Pareyn, Inge; Gillijns, Veerle; Hebbel, Robert P.; Collen, Désiré; Deckmyn, Hans; VandenDriessche, Thierry


    Von Willebrand disease (VWD) is an inherited bleeding disorder, caused by quantitative (type 1 and 3) or qualitative (type 2) defects in von Willebrand factor (VWF). Gene therapy is an appealing strategy for treatment of VWD because it is caused by a single gene defect and because VWF is secreted into the circulation, obviating the need for targeting specific organs or tissues. However, development of gene therapy for VWD has been hampered by the considerable length of the VWF cDNA (8.4 kb [kilobase]) and the inherent complexity of the VWF protein that requires extensive posttranslational processing. In this study, a gene-based approach for VWD was developed using lentiviral transduction of blood-outgrowth endothelial cells (BOECs) to express functional VWF. A lentiviral vector encoding complete human VWF was used to transduce BOECs isolated from type 3 VWD dogs resulting in high-transduction efficiencies (95.6% ± 2.2%). Transduced VWD BOECs efficiently expressed functional vector-encoded VWF (4.6 ± 0.4 U/24 hour per 106 cells), with normal binding to GPIbα and collagen and synthesis of a broad range of multimers resulting in phenotypic correction of these cells. These results indicate for the first time that gene therapy of type 3 VWD is feasible and that BOECs are attractive target cells for this purpose. PMID:16478886

  8. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    Hove-Jensen, Bjarne; Maigaard, Marianne


    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  9. Supergravity inspired vector curvaton

    Dimopoulos, Konstantinos


    It is investigated whether a massive Abelian vector field, whose gauge kinetic function is growing during inflation, can be responsible for the generation of the curvature perturbation in the Universe. Particle production is studied and it is shown that the vector field can obtain a scale-invariant superhorizon spectrum of perturbations with a reasonable choice of kinetic function. After inflation the vector field begins coherent oscillations, during which it corresponds to pressureless isotropic matter. When the vector field dominates the Universe, its perturbations give rise to the observed curvature perturbation following the curvaton scenario. It is found that this is possible if, after the end of inflation, the mass of the vector field increases at a phase transition at temperature of order 1 TeV or lower. Inhomogeneous reheating, whereby the vector field modulates the decay rate of the inflaton, is also studied

  10. Custodial vector model

    Becciolini, Diego; Franzosi, Diogo Buarque; Foadi, Roshan; Frandsen, Mads T.; Hapola, Tuomas; Sannino, Francesco


    We analyze the Large Hadron Collider (LHC) phenomenology of heavy vector resonances with a S U (2 )L×S U (2 )R spectral global symmetry. This symmetry partially protects the electroweak S parameter from large contributions of the vector resonances. The resulting custodial vector model spectrum and interactions with the standard model fields lead to distinct signatures at the LHC in the diboson, dilepton, and associated Higgs channels.

  11. Vector Differential Calculus

    HITZER, Eckhard MS


    This paper treats the fundamentals of the vector differential calculus part of universal geometric calculus. Geometric calculus simplifies and unifies the structure and notation of mathematics for all of science and engineering, and for technological applications. In order to make the treatment self-contained, I first compile all important geometric algebra relationships,which are necesssary for vector differential calculus. Then differentiation by vectors is introduced and a host of major ve...

  12. Vectorized Monte Carlo

    Brown, F.B.


    Examination of the global algorithms and local kernels of conventional general-purpose Monte Carlo codes shows that multigroup Monte Carlo methods have sufficient structure to permit efficient vectorization. A structured multigroup Monte Carlo algorithm for vector computers is developed in which many particle events are treated at once on a cell-by-cell basis. Vectorization of kernels for tracking and variance reduction is described, and a new method for discrete sampling is developed to facilitate the vectorization of collision analysis. To demonstrate the potential of the new method, a vectorized Monte Carlo code for multigroup radiation transport analysis was developed. This code incorporates many features of conventional general-purpose production codes, including general geometry, splitting and Russian roulette, survival biasing, variance estimation via batching, a number of cutoffs, and generalized tallies of collision, tracklength, and surface crossing estimators with response functions. Predictions of vectorized performance characteristics for the CYBER-205 were made using emulated coding and a dynamic model of vector instruction timing. Computation rates were examined for a variety of test problems to determine sensitivities to batch size and vector lengths. Significant speedups are predicted for even a few hundred particles per batch, and asymptotic speedups by about 40 over equivalent Amdahl 470V/8 scalar codes arepredicted for a few thousand particles per batch. The principal conclusion is that vectorization of a general-purpose multigroup Monte Carlo code is well worth the significant effort required for stylized coding and major algorithmic changes

  13. Vectors and their applications

    Pettofrezzo, Anthony J


    Geared toward undergraduate students, this text illustrates the use of vectors as a mathematical tool in plane synthetic geometry, plane and spherical trigonometry, and analytic geometry of two- and three-dimensional space. Its rigorous development includes a complete treatment of the algebra of vectors in the first two chapters.Among the text's outstanding features are numbered definitions and theorems in the development of vector algebra, which appear in italics for easy reference. Most of the theorems include proofs, and coordinate position vectors receive an in-depth treatment. Key concept

  14. Symbolic computer vector analysis

    Stoutemyer, D. R.


    A MACSYMA program is described which performs symbolic vector algebra and vector calculus. The program can combine and simplify symbolic expressions including dot products and cross products, together with the gradient, divergence, curl, and Laplacian operators. The distribution of these operators over sums or products is under user control, as are various other expansions, including expansion into components in any specific orthogonal coordinate system. There is also a capability for deriving the scalar or vector potential of a vector field. Examples include derivation of the partial differential equations describing fluid flow and magnetohydrodynamics, for 12 different classic orthogonal curvilinear coordinate systems.

  15. Involvement of transcription factor encoded by the mouse mi locus (MITF) in apoptosis of cultured mast cells induced by removal of interleukin-3.

    Tsujimura, T.; Hashimoto, K.; Morii, E.; Tunio, G. M.; Tsujino, K.; Kondo, T.; Kanakura, Y.; Kitamura, Y.


    Mast cells develop when spleen cells of mice are cultured in the medium containing interleukin (IL)-3. Cultured mast cells (CMCs) show apoptosis when they are incubated in the medium without IL-3. We obtained CMCs from tg/tg mice that did not express the transcription factor encoded by the mi gene (MITF) due to the integration of a transgene at its 5' flanking region. MITF is a member of the basic-helix-loop-helix-leucine zipper (bHLH-Zip) protein family of transcription factors. We investigated the effect of MITF on the apoptosis of CMCs after removal of IL-3. When cDNA encoding normal MITF ((+)-MITF) was introduced into tg/tg CMCs with the retroviral vector, the apoptosis of tg/tg CMCs was significantly accelerated. The mutant mi allele represents a deletion of an arginine at the basic domain of MITF. The apoptosis of tg/tg CMCs was not accelerated by the introduction of cDNA encoding mi-MITF. The overexpression of (+)-MITF was not prerequisite to the acceleration of the apoptosis, as the apoptotic process proceeded faster in +/+ CMCs than in mi/mi CMCs. The Ba/F3 lymphoid cell line is also dependent on IL-3, and Ba/F3 cells show apoptosis after removal of IL-3. The c-myc gene encodes another transcription factor of the bHLH-Zip family, and the overexpression of the c-myc gene accelerated the apoptosis of Ba/F3 cells. However, the overexpression of (+)-MITF did not accelerate the apoptosis of Ba/F3 cells. The (+)-MITF appeared to play some roles for the acceleration of the apoptosis specifically in the mast cell lineage. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:9327738

  16. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    Labuschagne, M


    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  17. Lectin cDNA and transgenic plants derived therefrom

    Raikhel, Natasha V.


    Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

  18. On Discrete Killing Vector Fields and Patterns on Surfaces

    Ben-Chen, Mirela


    Symmetry is one of the most important properties of a shape, unifying form and function. It encodes semantic information on one hand, and affects the shape\\'s aesthetic value on the other. Symmetry comes in many flavors, amongst the most interesting being intrinsic symmetry, which is defined only in terms of the intrinsic geometry of the shape. Continuous intrinsic symmetries can be represented using infinitesimal rigid transformations, which are given as tangent vector fields on the surface - known as Killing Vector Fields. As exact symmetries are quite rare, especially when considering noisy sampled surfaces, we propose a method for relaxing the exact symmetry constraint to allow for approximate symmetries and approximate Killing Vector Fields, and show how to discretize these concepts for generating such vector fields on a triangulated mesh. We discuss the properties of approximate Killing Vector Fields, and propose an application to utilize them for texture and geometry synthesis. Journal compilation © 2010 The Eurographics Association and Blackwell Publishing Ltd.

  19. Construction of expression vector containing glnA gene and detection of NPT II activity in the transgenic rice calli using 32P-labelled compound

    Su Jin; Zhang Xueqin; Yan Qiusheng; Chen Zhangliang; You Chongbiao


    The glnA gene encoding glutamine synthetase (GS) was amplified from Azospirillum brasilense Sp7 by PCR technique. the amplified 1.4 kb DNA fragment was cloned at the EcoRV site of Bluescript-SK. Both sequencing and restriction digestion data showed that the 1.4 kb DNA fragment flanked with BamHI site at each end was really the glnA gene of A. brasilense Sp7. The glnA gene was ligated with Bg1 II site of pCo24. As a result, an expression vector pGSC35 with CaMV35S promoter was obtained. Using colony in situ hybridization with α- 32 P-dATP labelled probes to screen the positive clones, another glnA gene expression vector pAGNB92 with rice actin 1 promoter was constructed after three rounds of ligation and transformation. Protoplasts isolated from rice cell suspension line cv. T986 were transformed with glnA expression vectors pGSC35 and pAGNB92 containing neomycin phosphotransferase II (NPTII) gene by using PEG fusion and electroporation. Transformed microcalli were selected on media containing G418 disulfate salt. NPT II activity was detected in 37% of G418 resistant calli by using dot blot hybridization with γ- 32 P-ATP and kanamycin as substrate

  20. Red-shifted fluorescent proteins mPlum and mRaspberry and polynucleotides encoding the same

    Tsien, Roger Y [La Jolla, CA; Wang, Lei [San Diego, CA


    Methods using somatic hypermutation (SHM) for producing polypeptide and nucleic acid variants, and nucleic acids encoding such polypeptide variants are disclosed. Such variants may have desired properties. Also disclosed are novel polypeptides, such as improved fluorescent proteins, produced by the novel methods, and nucleic acids, vectors, and host cells comprising such vectors.

  1. Vector-Vector Scattering on the Lattice

    Romero-López, Fernando; Urbach, Carsten; Rusetsky, Akaki


    In this work we present an extension of the LüScher formalism to include the interaction of particles with spin, focusing on the scattering of two vector particles. The derived formalism will be applied to Scalar QED in the Higgs Phase, where the U(1) gauge boson acquires mass.

  2. Selection vector filter framework

    Lukac, Rastislav; Plataniotis, Konstantinos N.; Smolka, Bogdan; Venetsanopoulos, Anastasios N.


    We provide a unified framework of nonlinear vector techniques outputting the lowest ranked vector. The proposed framework constitutes a generalized filter class for multichannel signal processing. A new class of nonlinear selection filters are based on the robust order-statistic theory and the minimization of the weighted distance function to other input samples. The proposed method can be designed to perform a variety of filtering operations including previously developed filtering techniques such as vector median, basic vector directional filter, directional distance filter, weighted vector median filters and weighted directional filters. A wide range of filtering operations is guaranteed by the filter structure with two independent weight vectors for angular and distance domains of the vector space. In order to adapt the filter parameters to varying signal and noise statistics, we provide also the generalized optimization algorithms taking the advantage of the weighted median filters and the relationship between standard median filter and vector median filter. Thus, we can deal with both statistical and deterministic aspects of the filter design process. It will be shown that the proposed method holds the required properties such as the capability of modelling the underlying system in the application at hand, the robustness with respect to errors in the model of underlying system, the availability of the training procedure and finally, the simplicity of filter representation, analysis, design and implementation. Simulation studies also indicate that the new filters are computationally attractive and have excellent performance in environments corrupted by bit errors and impulsive noise.

  3. Brane vector phenomenology

    Clark, T.E.; Love, S.T.; Nitta, Muneto; Veldhuis, T. ter; Xiong, C.


    Local oscillations of the brane world are manifested as massive vector fields. Their coupling to the Standard Model can be obtained using the method of nonlinear realizations of the spontaneously broken higher-dimensional space-time symmetries, and to an extent, are model independent. Phenomenological limits on these vector field parameters are obtained using LEP collider data and dark matter constraints

  4. Complex Polynomial Vector Fields

    The two branches of dynamical systems, continuous and discrete, correspond to the study of differential equations (vector fields) and iteration of mappings respectively. In holomorphic dynamics, the systems studied are restricted to those described by holomorphic (complex analytic) functions...... or meromorphic (allowing poles as singularities) functions. There already exists a well-developed theory for iterative holomorphic dynamical systems, and successful relations found between iteration theory and flows of vector fields have been one of the main motivations for the recent interest in holomorphic...... vector fields. Since the class of complex polynomial vector fields in the plane is natural to consider, it is remarkable that its study has only begun very recently. There are numerous fundamental questions that are still open, both in the general classification of these vector fields, the decomposition...

  5. Complex Polynomial Vector Fields

    Dias, Kealey

    vector fields. Since the class of complex polynomial vector fields in the plane is natural to consider, it is remarkable that its study has only begun very recently. There are numerous fundamental questions that are still open, both in the general classification of these vector fields, the decomposition...... of parameter spaces into structurally stable domains, and a description of the bifurcations. For this reason, the talk will focus on these questions for complex polynomial vector fields.......The two branches of dynamical systems, continuous and discrete, correspond to the study of differential equations (vector fields) and iteration of mappings respectively. In holomorphic dynamics, the systems studied are restricted to those described by holomorphic (complex analytic) functions...

  6. A new approach for weed control in a cucurbit field employing an attenuated potyvirus-vector for herbicide resistance.

    Shiboleth, Y M; Arazi, T; Wang, Y; Gal-On, A


    Expression of bar, a phosphinothricin acetyltransferase, in plant tissues, leads to resistance of these plants to glufosinate ammonium based herbicides. We have created a bar expressing, attenuated zucchini yellow mosaic potyvirus-vector, AGII-Bar, to enable herbicide use in cucurbit fields. The parental vector, ZYMV-AGII, has been rendered environmentally safe by both disease-symptom attenuation and aphid-assisted virus transmission abolishment. The recombinant AGII-Bar virus-encoding cDNA, when inoculated on diverse cucurbits was highly infectious, accumulated to similar levels as AGII, and elicited attenuated AGII-like symptoms. Potted cucurbits inoculated with AGII-Bar became herbicide resistant about a week post-inoculation. Herbicide resistance was sustained in squash over a period of at least 26 days and for at least 60 days in cucumber grown in a net-house under commercial conditions. To test the applicability of AGII-Bar use in a weed-infested field, a controlled experiment including more than 450 plants inoculated with this construct, was performed. Different dosages of glufosinate ammonium were sprayed, 2 weeks after planting, on the foliage of melons, cucumbers, squash, and watermelons. AGII-Bar provided protection to all inoculated plants, of every variety tested, at each dosage applied, including the highest doses that totally eradicated weeds. This study demonstrates that AGII-Bar can be utilized to facilitate weed control in cucurbits and exemplifies the practical potential of attenuated virus-vector use in agriculture.

  7. A PCR-Based Method to Construct Lentiviral Vector Expressing Double Tough Decoy for miRNA Inhibition.

    Huiling Qiu

    Full Text Available DNA vector-encoded Tough Decoy (TuD miRNA inhibitor is attracting increased attention due to its high efficiency in miRNA suppression. The current methods used to construct TuD vectors are based on synthesizing long oligonucleotides (~90 mer, which have been costly and problematic because of mutations during synthesis. In this study, we report a PCR-based method for the generation of double Tough Decoy (dTuD vector in which only two sets of shorter oligonucleotides (< 60 mer were used. Different approaches were employed to test the inhibitory potency of dTuDs. We demonstrated that dTuD is the most efficient method in miRNA inhibition in vitro and in vivo. Using this method, a mini dTuD library against 88 human miRNAs was constructed and used for a high-throughput screening (HTS of AP-1 pathway-related miRNAs. Seven miRNAs (miR-18b-5p, -101-3p, -148b-3p, -130b-3p, -186-3p, -187-3p and -1324 were identified as candidates involved in AP-1 pathway regulation. This novel method allows for an accurate and cost-effective generation of dTuD miRNA inhibitor, providing a powerful tool for efficient miRNA suppression in vitro and in vivo.

  8. Adeno-associated viral vector-mediated neurotrophin gene transfer in the injured adult rat spinal cord improves hind-limb function

    Blits, B; Oudega, M.; Boer, G J; Bartlett Bunge, M; Verhaagen, J


    To foster axonal growth from a Schwann cell bridge into the caudal spinal cord, spinal cells caudal to the implant were transduced with adeno-associated viral (AAV) vectors encoding for brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (AAV-NT-3). Control rats received AAV vectors encoding

  9. ENCODE: A Sourcebook of Epigenomes and Chromatin Language

    Maryam Yavartanoo


    Full Text Available Until recently, since the Human Genome Project, the general view has been that the majority of the human genome is composed of junk DNA and has little or no selective advantage to the organism. Now we know that this conclusion is an oversimplification. In April 2003, the National Human Genome Research Institute (NHGRI launched an international research consortium called Encyclopedia of DNA Elements (ENCODE to uncover non-coding functional elements in the human genome. The result of this project has identified a set of new DNA regulatory elements, based on novel relationships among chromatin accessibility, histone modifications, nucleosome positioning, DNA methylation, transcription, and the occupancy of sequence-specific factors. The project gives us new insights into the organization and regulation of the human genome and epigenome. Here, we sought to summarize particular aspects of the ENCODE project and highlight the features and data that have recently been released. At the end of this review, we have summarized a case study we conducted using the ENCODE epigenome data.

  10. Strain Variation in the Transcriptome of the Dengue Fever Vector, Aedes aegypti.

    Bonizzoni, Mariangela; Dunn, W Augustine; Campbell, Corey L; Olson, Ken E; Marinotti, Osvaldo; James, Anthony A


    Studies of transcriptome dynamics provide a basis for understanding functional elements of the genome and the complexity of gene regulation. The dengue vector mosquito, Aedes aegypti, exhibits great adaptability to diverse ecological conditions, is phenotypically polymorphic, and shows variation in vectorial capacity to arboviruses. Previous genome sequencing showed richness in repetitive DNA and transposable elements that can contribute to genome plasticity. Population genetic studies revealed a varying degree of worldwide genetic polymorphism. However, the extent of functional genetic polymorphism across strains is unknown. The transcriptomes of three Ae. aegypti strains, Chetumal (CTM), Rexville D-Puerto Rico (Rex-D) and Liverpool (LVP), were compared. CTM is more susceptible than Rex- D to infection by dengue virus serotype 2. A total of 4188 transcripts exhibit either no or small variation (<2-fold) among sugar-fed samples of the three strains and between sugar- and blood-fed samples within each strain, corresponding most likely to genes encoding products necessary for vital functions. Transcripts enriched in blood-fed mosquitoes encode proteins associated with catalytic activities, molecular transport, metabolism of lipids, carbohydrates and amino acids, and functions related to blood digestion and the progression of the gonotropic cycle. Significant qualitative and quantitative differences were found in individual transcripts among strains including differential representation of paralogous gene products. The majority of immunity-associated transcripts decreased in accumulation after a bloodmeal and the results are discussed in relation to the different susceptibility of CTM and Rex-D mosquitoes to DENV2 infection.

  11. DNA sequence variants in PPARGC1A, a gene encoding a coactivator of the ω-3 LCPUFA sensing PPAR-RXR transcription complex, are associated with NV AMD and AMD-associated loci in genes of complement and VEGF signaling pathways.

    John Paul SanGiovanni

    Full Text Available Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs and use of peroxisome proliferator activator receptor (PPAR-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG co-activator 1 alpha (PPARGC1A, a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR transcription complex, may influence neovascularization (NV in age-related macular degeneration (AMD.We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A.A DNA coding variant (rs3736265 and a 3'UTR-resident regulatory variant (rs3774923 in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs. SNP-SNP interactions existed for NV AMD (P<0.005 with rs3736265 and a AMD-associated variant in complement factor B (CFB, rs512559. PPARGC1A influences activation of the AMD-associated complement component 3 (C3 promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P ≤ 0.003 of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033, a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678 showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P ≤ 0.003. C3 expression was down-regulated 2-fold in retinas of ω-3 LCPUFA-fed mice

  12. DNA sequence variants in PPARGC1A, a gene encoding a coactivator of the ω-3 LCPUFA sensing PPAR-RXR transcription complex, are associated with NV AMD and AMD-associated loci in genes of complement and VEGF signaling pathways.

    SanGiovanni, John Paul; Chen, Jing; Sapieha, Przemyslaw; Aderman, Christopher M; Stahl, Andreas; Clemons, Traci E; Chew, Emily Y; Smith, Lois E H


    Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs) and use of peroxisome proliferator activator receptor (PPAR)-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG) co-activator 1 alpha (PPARGC1A), a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR) transcription complex, may influence neovascularization (NV) in age-related macular degeneration (AMD). We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A. A DNA coding variant (rs3736265) and a 3'UTR-resident regulatory variant (rs3774923) in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs). SNP-SNP interactions existed for NV AMD (Pcomplement factor B (CFB, rs512559). PPARGC1A influences activation of the AMD-associated complement component 3 (C3) promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P ≤ 0.003) of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033), a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678) showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P ≤ 0.003). C3 expression was down-regulated 2-fold in retinas of ω-3 LCPUFA-fed mice - these animals also showed 70% reduction in retinal NV (P

  13. Engineering BioBrick vectors from BioBrick parts

    Knight Thomas F


    Full Text Available Abstract Background The underlying goal of synthetic biology is to make the process of engineering biological systems easier. Recent work has focused on defining and developing standard biological parts. The technical standard that has gained the most traction in the synthetic biology community is the BioBrick standard for physical composition of genetic parts. Parts that conform to the BioBrick assembly standard are BioBrick standard biological parts. To date, over 2,000 BioBrick parts have been contributed to, and are available from, the Registry of Standard Biological Parts. Results Here we extended the same advantages of BioBrick standard biological parts to the plasmid-based vectors that are used to provide and propagate BioBrick parts. We developed a process for engineering BioBrick vectors from BioBrick parts. We designed a new set of BioBrick parts that encode many useful vector functions. We combined the new parts to make a BioBrick base vector that facilitates BioBrick vector construction. We demonstrated the utility of the process by constructing seven new BioBrick vectors. We also successfully used the resulting vectors to assemble and propagate other BioBrick standard biological parts. Conclusion We extended the principles of part reuse and standardization to BioBrick vectors. As a result, myriad new BioBrick vectors can be readily produced from all existing and newly designed BioBrick parts. We invite the synthetic biology community to (1 use the process to make and share new BioBrick vectors; (2 expand the current collection of BioBrick vector parts; and (3 characterize and improve the available collection of BioBrick vector parts.

  14. Analysing and Comparing Encodability Criteria

    Kirstin Peters


    Full Text Available Encodings or the proof of their absence are the main way to compare process calculi. To analyse the quality of encodings and to rule out trivial or meaningless encodings, they are augmented with quality criteria. There exists a bunch of different criteria and different variants of criteria in order to reason in different settings. This leads to incomparable results. Moreover it is not always clear whether the criteria used to obtain a result in a particular setting do indeed fit to this setting. We show how to formally reason about and compare encodability criteria by mapping them on requirements on a relation between source and target terms that is induced by the encoding function. In particular we analyse the common criteria full abstraction, operational correspondence, divergence reflection, success sensitiveness, and respect of barbs; e.g. we analyse the exact nature of the simulation relation (coupled simulation versus bisimulation that is induced by different variants of operational correspondence. This way we reduce the problem of analysing or comparing encodability criteria to the better understood problem of comparing relations on processes.

  15. Next-generation digital information storage in DNA.

    Church, George M; Gao, Yuan; Kosuri, Sriram


    Digital information is accumulating at an astounding rate, straining our ability to store and archive it. DNA is among the most dense and stable information media known. The development of new technologies in both DNA synthesis and sequencing make DNA an increasingly feasible digital storage medium. We developed a strategy to encode arbitrary digital information in DNA, wrote a 5.27-megabit book using DNA microchips, and read the book by using next-generation DNA sequencing.

  16. Fractal vector optical fields.

    Pan, Yue; Gao, Xu-Zhen; Cai, Meng-Qiang; Zhang, Guan-Lin; Li, Yongnan; Tu, Chenghou; Wang, Hui-Tian


    We introduce the concept of a fractal, which provides an alternative approach for flexibly engineering the optical fields and their focal fields. We propose, design, and create a new family of optical fields-fractal vector optical fields, which build a bridge between the fractal and vector optical fields. The fractal vector optical fields have polarization states exhibiting fractal geometry, and may also involve the phase and/or amplitude simultaneously. The results reveal that the focal fields exhibit self-similarity, and the hierarchy of the fractal has the "weeding" role. The fractal can be used to engineer the focal field.

  17. Novel adenoviral vector induces T-cell responses despite anti-adenoviral neutralizing antibodies in colorectal cancer patients.

    Morse, Michael A; Chaudhry, Arvind; Gabitzsch, Elizabeth S; Hobeika, Amy C; Osada, Takuya; Clay, Timothy M; Amalfitano, Andrea; Burnett, Bruce K; Devi, Gayathri R; Hsu, David S; Xu, Younong; Balcaitis, Stephanie; Dua, Rajesh; Nguyen, Susan; Balint, Joseph P; Jones, Frank R; Lyerly, H Kim


    First-generation, E1-deleted adenovirus subtype 5 (Ad5)-based vectors, although promising platforms for use as cancer vaccines, are impeded in activity by naturally occurring or induced Ad-specific neutralizing antibodies. Ad5-based vectors with deletions of the E1 and the E2b regions (Ad5 [E1-, E2b-]), the latter encoding the DNA polymerase and the pre-terminal protein, by virtue of diminished late phase viral protein expression, were hypothesized to avoid immunological clearance and induce more potent immune responses against the encoded tumor antigen transgene in Ad-immune hosts. Indeed, multiple homologous immunizations with Ad5 [E1-, E2b-]-CEA(6D), encoding the tumor antigen carcinoembryonic antigen (CEA), induced CEA-specific cell-mediated immune (CMI) responses with antitumor activity in mice despite the presence of preexisting or induced Ad5-neutralizing antibody. In the present phase I/II study, cohorts of patients with advanced colorectal cancer were immunized with escalating doses of Ad5 [E1-, E2b-]-CEA(6D). CEA-specific CMI responses were observed despite the presence of preexisting Ad5 immunity in a majority (61.3 %) of patients. Importantly, there was minimal toxicity, and overall patient survival (48 % at 12 months) was similar regardless of preexisting Ad5 neutralizing antibody titers. The results demonstrate that, in cancer patients, the novel Ad5 [E1-, E2b-] gene delivery platform generates significant CMI responses to the tumor antigen CEA in the setting of both naturally acquired and immunization-induced Ad5-specific immunity.

  18. Use of adenoviral vectors as veterinary vaccines.

    Ferreira, T B; Alves, P M; Aunins, J G; Carrondo, M J T


    Vaccines are the most effective and inexpensive prophylactic tool in veterinary medicine. Ideally, vaccines should induce a lifelong protective immunity against the target pathogen while not causing clinical or pathological signs of diseases in the vaccinated animals. However, such ideal vaccines are rare in the veterinary field. Many vaccines are either of limited effectiveness or have harmful side effects. In addition, there are still severe diseases with no effective vaccines. A very important criterion for an ideal vaccine in veterinary medicine is low cost; this is especially important in developing countries and even more so for poultry vaccination, where vaccines must sell for a few cents a dose. Traditional approaches include inactivated vaccines, attenuated live vaccines and subunit vaccines. Recently, genetic engineering has been applied to design new, improved vaccines. Adenovirus vectors are highly efficient for gene transfer in a broad spectrum of cell types and species. Moreover, adenoviruses often induce humoral, mucosal and cellular immune responses to antigens encoded by the inserted foreign genes. Thus, adenoviruses have become a vector of choice for delivery and expression of foreign proteins for vaccination. Consequently, the market requirements for adenovirus vaccines are increasing, creating a need for production methodologies of concentrated vectors with warranted purity and efficacy. This review summarizes recent developments and approaches of adenovirus production and purification as the application of these vectors, including successes and failures in clinical applications to date.

  19. DNA fusion gene vaccines

    Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup


    DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... of antigens into molecular domains that enhance antigen presentation. More specifically, the immunogenicity of DNA vaccines may benefit from increased protein synthesis, increased T-cell help and MHC class I presentation, and the addition of a range of specific cytokines and pathogen-associated molecular...... with viral-vectored vaccines, various synergistic components may need to be incorporated into DNA vaccines. From the perspective of the future clinical use of DNA vaccines, it has been suggested that antigen presentation should be improved and cytokine coadministration attempted. However, even...

  20. DNA replication stress restricts ribosomal DNA copy number

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin


    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repea