Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

International Nuclear Information System (INIS)

Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

1989-01-01

Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

Identification of a mammalian nuclear factor and human cDNA-encoded proteins that recognize DNA containing apurinic sites

International Nuclear Information System (INIS)

Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.

1990-01-01

Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins

Implementation of digital image encryption algorithm using logistic function and DNA encoding

Science.gov (United States)

Suryadi, MT; Satria, Yudi; Fauzi, Muhammad

2018-03-01

Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.

A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

Directory of Open Access Journals (Sweden)

Chunyan Song

2015-10-01

Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

Mucosal delivery of a transmission-blocking DNA vaccine encoding Giardia lamblia CWP2 by Salmonella typhimurium bactofection vehicle.

Science.gov (United States)

Abdul-Wahid, Aws; Faubert, Gaétan

2007-12-05

In this study, we investigated the use of Salmonella typhimurium (STM1 strain) as a bactofection vehicle to deliver a transmission-blocking DNA vaccine (TBDV) plasmid to the intestinal immune system. The gene encoding the full length cyst wall protein-2 (CWP2) from Giardia lamblia was subcloned into the pCDNA3 mammalian expression vector and stably introduced into S. typhimurium STM1. Eight-week-old female BALB/c mice were orally immunized every 2 weeks, for a total of three immunizations. Vaccinated and control mice were sacrificed 1 week following the last injection. Administration of the DNA vaccine led to the production of CWP2-specific cellular immune responses characterized by a mixed Th1/Th2 response. Using ELISA, antigen-specific IgA and IgG antibodies were detected in intestinal secretions. Moreover, analysis of sera demonstrated that the DNA immunization also stimulated the production of CWP2-specific IgG antibodies that were mainly of the IgG2a isotype. Finally, challenge infection with live Giardia muris cysts revealed that mice receiving the CWP2-encoding DNA vaccine were able to reduce cyst shedding by approximately 60% compared to control mice. These results demonstrate, for the first time, the development of parasite transmission-blocking immunity at the intestinal level following the administration of a mucosal DNA vaccine delivered by S. typhimurium STM1.

Molecular cloning of growth hormone encoding cDNA of Indian

Indian Academy of Sciences (India)

A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2a strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats.

Science.gov (United States)

Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M

2003-05-01

Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.

DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

Science.gov (United States)

Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

2018-06-27

DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

Cloning and expression of a cDNA encoding human sterol carrier protein 2

International Nuclear Information System (INIS)

Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

1991-01-01

The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

Science.gov (United States)

Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

2014-04-15

DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

Multicistronic lentiviral vectors containing the FMDV 2A cleavage factor demonstrate robust expression of encoded genes at limiting MOI

Directory of Open Access Journals (Sweden)

Margison Geoffrey P

2006-03-01

Full Text Available Abstract Background A number of gene therapy applications would benefit from vectors capable of expressing multiple genes. In this study we explored the feasibility and efficiency of expressing two or three transgenes in HIV-1 based lentiviral vector. Bicistronic and tricistronic self-inactivating lentiviral vectors were constructed employing the internal ribosomal entry site (IRES sequence of encephalomyocarditis virus (EMCV and/or foot-and-mouth disease virus (FMDV cleavage factor 2A. We employed enhanced green fluorescent protein (eGFP, O6-methylguanine-DNA-methyltransferase (MGMT, and homeobox transcription factor HOXB4 as model genes and their expression was detected by appropriate methods including fluorescence microscopy, flow cytometry, immunocytochemistry, biochemical assay, and western blotting. Results All the multigene vectors produced high titer virus and were able to simultaneously express two or three transgenes in transduced cells. However, the level of expression of individual transgenes varied depending on: the transgene itself; its position within the construct; the total number of transgenes expressed; the strategy used for multigene expression and the average copy number of pro-viral insertions. Notably, at limiting MOI, the expression of eGFP in a bicistronic vector based on 2A was ~4 times greater than that of an IRES based vector. Conclusion The small and efficient 2A sequence can be used alone or in combination with an IRES for the construction of multicistronic lentiviral vectors which can express encoded transgenes at functionally relevant levels in cells containing an average of one pro-viral insert.

Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair

International Nuclear Information System (INIS)

Thomas, S.M.; Sedgwick, S.G.

1989-01-01

Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli

Improved vaccine protection against retrovirus infection after co-administration of adenoviral vectors encoding viral antigens and type I interferon subtypes

Directory of Open Access Journals (Sweden)

Groitl Peter

2011-09-01

Full Text Available Abstract Background Type I interferons (IFNs exhibit direct antiviral effects, but also distinct immunomodulatory properties. In this study, we analyzed type I IFN subtypes for their effect on prophylactic adenovirus-based anti-retroviral vaccination of mice against Friend retrovirus (FV or HIV. Results Mice were vaccinated with adenoviral vectors encoding FV Env and Gag proteins alone or in combination with vectors encoding IFNα1, IFNα2, IFNα4, IFNα5, IFNα6, IFNα9 or IFNβ. Only the co-administration of adenoviral vectors encoding IFNα2, IFNα4, IFNα6 and IFNα9 resulted in strongly improved immune protection of vaccinated mice from subsequent FV challenge infection with high control over FV-induced splenomegaly and reduced viral loads. The level of protection correlated with augmented virus-specific CD4+ T cell responses and enhanced antibody titers. Similar results were obtained when mice were vaccinated against HIV with adenoviral vectors encoding HIV Env and Gag-Pol in combination with various type I IFN encoding vectors. Here mainly CD4+ T cell responses were enhanced by IFNα subtypes. Conclusions Our results indicate that certain IFNα subtypes have the potential to improve the protective effect of adenovirus-based vaccines against retroviruses. This correlated with augmented virus-specific CD4+ T cell and antibody responses. Thus, co-expression of select type I IFNs may be a valuable tool for the development of anti-retroviral vaccines.

Cloning, sequencing and expression of cDNA encoding growth ...

Indian Academy of Sciences (India)

Unknown

of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

Protective effect of the DNA vaccine encoding the major house dust mite allergens on allergic inflammation in the murine model of house dust mite allergy

Directory of Open Access Journals (Sweden)

Lee Jaechun

2006-02-01

Full Text Available Abstract Background Vaccination with naked DNA encoding antigen induces cellular and humoral immunity characterized by the activation of specific Th1 cells. Objective To evaluate the effects of vaccination with mixed naked DNA plasmids encoding Der p 1, Der p 2, Der p 3, Der f 1, Der f 2, and Der f 3, the major house dust mite allergens on the allergic inflammation to the whole house dust mites (HDM crude extract. Methods Three hundred micrograms of these gene mixtures were injected into muscle of BALB/c mice. Control mice were injected with the pcDNA 3.1 blank vector. After 3 weeks, the mice were actively sensitized and inhaled with the whole house dust mite extract intranasally. Results The vaccinated mice showed a significantly decreased synthesis of total and HDM-specific IgE compared with controls. Analysis of the cytokine profile of lymphocytes after challenge with HDM crude extract revealed that mRNA expression of interferon-γ was higher in the vaccinated mice than in the controls. Reduced infiltration of inflammatory cells and the prominent infiltration of CD8+ T cells were observed in histology of lung tissue from the vaccinated mice. Conclusion Vaccination with DNA encoding the major house dust mite allergens provides a promising approach for treating allergic responses to whole house dust mite allergens.

Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

DEFF Research Database (Denmark)

Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

2016-01-01

A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

Isolation and characterisation of the cDNA encoding a glycosylated accessory protein of pea chloroplast DNA polymerase.

OpenAIRE

Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K

1999-01-01

The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...

Construction and identification of eukaryotic expression vector of pcDNA3-UHRF1

International Nuclear Information System (INIS)

Li Xinli; Zhu Ran; Zhu Wei; Fan Saijun; Meng Qinghui

2011-01-01

Objective: To generate eukaryotic expression vector of pcDNA3-UHRF1(ubiquitin-like, containing PHD and RING finger domains 1, UHRF1) and testify its expression in breast cancer cells MDA-MB-231. Methods: A 2.3 kb cDNA fragment was amplified from the total RNA of the human breast cancer cells MCF-7 by the RT-PCR method and was cloned into the plasmid pcDNA3. The vector was identified by the double digestion with restriction enzymes Kpn I and Xho I and was sequenced. The cDNA of UHRF1 was transfected into human breast cancer cells MDA-MB-231 by Lipofactamin2000. The positive clones were selected by G418. The expression of the UHRF1 was detected by RT-PCR and Western blot analysis. Results: The recombinant eukaryotic expression vector pcDNA3-UHRF1 was digested with Kpn I and BamH I, and the electrophoresis of the digested products showed two fragments; 2.3kb fragment of UHRF1 and 5.4 kb fragment of pcDNA3, and the sequence inserted was identical to the published sequence. The MDA-MB-231 cells transfected with the pcDNA3-UHRF1 plasmid expressed a high level of the UHRF1 mRNA and protein. Conclusion: The recombinant eukaryotic cell expression vector of pcDNA3-UHRF1 is constructed successfully. The recombinant plasmid pcDNA3-UHRF1 can provide a very useful tool and lay an important foundation for the research on the function of UHRF1. (authors)

Status and prospects of DNA barcoding in medically important parasites and vectors.

Science.gov (United States)

Ondrejicka, Danielle A; Locke, Sean A; Morey, Kevin; Borisenko, Alex V; Hanner, Robert H

2014-12-01

For over 10 years, DNA barcoding has been used to identify specimens and discern species. Its potential benefits in parasitology were recognized early, but its utility and uptake remain unclear. Here we review studies using DNA barcoding in parasites and vectors affecting humans and find that the technique is accurate (accords with author identifications based on morphology or other markers) in 94-95% of cases, although aspects of DNA barcoding (vouchering, marker implicated) have often been misunderstood. In a newly compiled checklist of parasites, vectors, and hazards, barcodes are available for 43% of all 1403 species and for more than half of 429 species of greater medical importance. This is encouraging coverage that would improve with an active campaign targeting parasites and vectors. Copyright © 2014 Elsevier Ltd. All rights reserved.

cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

International Nuclear Information System (INIS)

D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

1988-01-01

cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

Enhanced cellular immune response against SIV Gag induced by immunization with DNA vaccines expressing assembly and release-defective SIV Gag proteins

International Nuclear Information System (INIS)

Bu Zhigao; Ye Ling; Compans, Richard W.; Yang Chinglai

2003-01-01

Codon-optimized genes were synthesized for the SIVmac239 Gag, a mutant Gag with mutations in the major homology region, and a chimeric Gag containing a protein destruction signal at the N-terminus of Gag. The mutant and chimeric Gag were expressed at levels comparable to that observed for the wild-type Gag protein but their stability and release into the medium were found to be significantly reduced. Immunization of mice with DNA vectors encoding the mutant or chimeric Gag induced fourfold higher levels of anti-SIV Gag CD4 T cell responses than the DNA vector encoding the wild-type SIV Gag. Moreover, anti-SIV Gag CD8 T cell responses induced by DNA vectors encoding the mutant or chimeric Gag were found to be 5- to 10-fold higher than those induced by the DNA construct for the wild-type Gag. These results indicate that mutations disrupting assembly and/or stability of the SIV Gag protein effectively enhance its immunogenicity when expressed from DNA vaccines

Recombinant DNA specifying the human amyloid. beta. precursor protein (ABPP) encodes a 95-kDa polypeptide

Energy Technology Data Exchange (ETDEWEB)

Mita, S; Sadlock, J; Herbert, J; Schon, E A

1988-10-11

Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

Science.gov (United States)

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

DyNAvectors: dynamic constitutional vectors for adaptive DNA transfection.

Science.gov (United States)

Clima, Lilia; Peptanariu, Dragos; Pinteala, Mariana; Salic, Adrian; Barboiu, Mihail

2015-12-25

Dynamic constitutional frameworks, based on squalene, PEG and PEI components, reversibly connected to core centers, allow the efficient identification of adaptive vectors for good DNA transfection efficiency and are well tolerated by mammalian cells.

Design of a titering assay for lentiviral vectors utilizing direct extraction of DNA from transduced cells in microtiter plates

Directory of Open Access Journals (Sweden)

Michele E Murphy

2016-01-01

Full Text Available Using lentiviral vector products in clinical applications requires an accurate method for measuring transduction titer. For vectors lacking a marker gene, quantitative polymerase chain reaction is used to evaluate the number of vector DNA copies in transduced target cells, from which a transduction titer is calculated. Immune Design previously described an integration-deficient lentiviral vector pseudotyped with a modified Sindbis virus envelope for use in cancer immunotherapy (VP02, of the ZVex platform. Standard protocols for titering integration-competent lentiviral vectors employ commercial spin columns to purify vector DNA from transduced cells, but such columns are not optimized for isolation of extrachromosomal (nonintegrated DNA. Here, we describe a 96-well transduction titer assay in which DNA extraction is performed in situ in the transduction plate, yielding quantitative recovery of extrachromosomal DNA. Vector titers measured by this method were higher than when commercial spin columns were used for DNA isolation. Evaluation of the method's specificity, linear range, and precision demonstrate that it is suitable for use as a lot release assay to support clinical trials with VP02. Finally, the method is compatible with titering both integrating and nonintegrating lentiviral vectors, suggesting that it may be used to evaluate the transduction titer for any lentiviral vector.

Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination.

Science.gov (United States)

Revaud, Julien; Unterfinger, Yves; Rol, Nicolas; Suleman, Muhammad; Shaw, Julia; Galea, Sandra; Gavard, Françoise; Lacour, Sandrine A; Coulpier, Muriel; Versillé, Nicolas; Havenga, Menzo; Klonjkowski, Bernard; Zanella, Gina; Biacchesi, Stéphane; Cordonnier, Nathalie; Corthésy, Blaise; Ben Arous, Juliette; Richardson, Jennifer P

2018-01-01

To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches.

Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination

Directory of Open Access Journals (Sweden)

Julien Revaud

2018-01-01

Full Text Available To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches.

A Novel Audio Cryptosystem Using Chaotic Maps and DNA Encoding

Directory of Open Access Journals (Sweden)

S. J. Sheela

2017-01-01

Full Text Available Chaotic maps have good potential in security applications due to their inherent characteristics relevant to cryptography. This paper introduces a new audio cryptosystem based on chaotic maps, hybrid chaotic shift transform (HCST, and deoxyribonucleic acid (DNA encoding rules. The scheme uses chaotic maps such as two-dimensional modified Henon map (2D-MHM and standard map. The 2D-MHM which has sophisticated chaotic behavior for an extensive range of control parameters is used to perform HCST. DNA encoding technology is used as an auxiliary tool which enhances the security of the cryptosystem. The performance of the algorithm is evaluated for various speech signals using different encryption/decryption quality metrics. The simulation and comparison results show that the algorithm can achieve good encryption results and is able to resist several cryptographic attacks. The various types of analysis revealed that the algorithm is suitable for narrow band radio communication and real-time speech encryption applications.

Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

Directory of Open Access Journals (Sweden)

Leontina GURGU

2012-12-01

Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

International Nuclear Information System (INIS)

Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.

1989-01-01

Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

International Nuclear Information System (INIS)

Szopa, J.

1995-01-01

The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

LAMP-1-chimeric DNA vaccines enhance the antibody response in Japanese flounder, Paralichthys olivaceus.

Science.gov (United States)

Rondón-Barragán, Iang; Nozaki, Reiko; Hirono, Ikuo; Kondo, Hidehiro

2017-08-01

DNA vaccination is one method to protect farmed fish from viral and bacterial diseases. Chimeric antigens encoded by DNA vaccines have been shown to increase the resistance to viral diseases. Here, we sequenced the gene encoding lysosome-associated membrane protein-1 from Japanese flounder, Paralichthys olivaceus, (JfLAMP-1) and assessed its use in a chimeric DNA vaccine fused with the major capsule protein (MCP) from red seabream iridovirus (RSIV). JfLAMP-1 cDNA has a length of 1248 bp encoding 415 aa, which contains transmembrane and cytoplasmic domains. JfLAMP-1 is constitutively expressed in several tissues and its expression in spleen was upregulated following injection of formalin-killed cells (FKC) of Edwardsiella tarda. Immunofluorescence analysis showed that JfLAMP-1 is distributed in the small and large granules in the cytoplasm and groups close to the nucleus. The DNA encoding the luminal domain of JfLAMP-1 was replaced with the gene for the RSIV MCP, and the construct was cloned in an expression vector (pCIneo). Fish vaccinated with pCLAMP-MCP had significantly higher antibody levels than fish vaccinated with pCIneo vector harboring the MCP gene (p day 30 post-vaccination. Copyright © 2017 Elsevier Ltd. All rights reserved.

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

Directory of Open Access Journals (Sweden)

Zuiter Afnan

2012-08-01

Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

Efficient gene transfer into nondividing cells by adeno-associated virus-based vectors.

Science.gov (United States)

Podsakoff, G; Wong, K K; Chatterjee, S

1994-09-01

Gene transfer vectors based on adeno-associated virus (AAV) are emerging as highly promising for use in human gene therapy by virtue of their characteristics of wide host range, high transduction efficiencies, and lack of cytopathogenicity. To better define the biology of AAV-mediated gene transfer, we tested the ability of an AAV vector to efficiently introduce transgenes into nonproliferating cell populations. Cells were induced into a nonproliferative state by treatment with the DNA synthesis inhibitors fluorodeoxyuridine and aphidicolin or by contact inhibition induced by confluence and serum starvation. Cells in logarithmic growth or DNA synthesis arrest were transduced with vCWR:beta gal, an AAV-based vector encoding beta-galactosidase under Rous sarcoma virus long terminal repeat promoter control. Under each condition tested, vCWR:beta Gal expression in nondividing cells was at least equivalent to that in actively proliferating cells, suggesting that mechanisms for virus attachment, nuclear transport, virion uncoating, and perhaps some limited second-strand synthesis of AAV vectors were present in nondividing cells. Southern hybridization analysis of vector sequences from cells transduced while in DNA synthetic arrest and expanded after release of the block confirmed ultimate integration of the vector genome into cellular chromosomal DNA. These findings may provide the basis for the use of AAV-based vectors for gene transfer into quiescent cell populations such as totipotent hematopoietic stem cells.

Sequence of a cloned cDNA encoding human ribosomal protein S11

Energy Technology Data Exchange (ETDEWEB)

Lott, J B; Mackie, G A

1988-02-11

The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

Science.gov (United States)

Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

2012-01-01

Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector

Science.gov (United States)

2013-01-01

Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome

Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

Science.gov (United States)

Dunham, S P; Onions, D E

2001-06-21

A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

International Nuclear Information System (INIS)

Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

1988-01-01

A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

Efficacy of chimeric DNA vaccines encoding Eimeria tenella 5401 and chicken IFN-γ or IL-2 against coccidiosis in chickens.

Science.gov (United States)

Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

2015-09-01

Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier

A Vector Printing Method for High-Speed Electrohydrodynamic (EHD Jet Printing Based on Encoder Position Sensors

Directory of Open Access Journals (Sweden)

Thanh Huy Phung

2018-02-01

Full Text Available Electrohyrodynamic (EHD jet printing has been widely used in the field of direct micro-nano patterning applications, due to its high resolution printing capability. So far, vector line printing using a single nozzle has been widely used for most EHD printing applications. However, the application has been limited to low-speed printing, to avoid non-uniform line width near the end points where line printing starts and ends. At end points of line vector printing, the deposited drop amount is likely to be significantly large compared to the rest of the printed lines, due to unavoidable acceleration and deceleration. In this study, we proposed a method to solve the printing quality problems by producing droplets at an equally spaced distance, irrespective of the printing speed. For this purpose, an encoder processing unit (EPU was developed, so that the jetting trigger could be generated according to user-defined spacing by using encoder position signals, which are used for the positioning control of the two linear stages.

Construction of New Campylobacter Cloning Vectors and a New Mutational Cat Cassette

Science.gov (United States)

1993-01-01

mutational cat cassette PE - 61102A PR - 3M161102 6. AUTHOR(S) TA - BS13AK Yao R, Aim RA, Trust TJ, Guerry P WU- 1291 7. PERFORMING ORGANIZATION NAME(S) AND...mutational cat cassette %~ccesion For (Site-specific mutagenesis; recombinant DNA; multiple cloning site; PCR; shuttle vectors) NTIS CRA&I OTIC TAB E...campylobacter portion of these vectors, only three CAT , Cm acetyllraaseriase; car, gene encoding CAT , Cm, restriction sites in the IacZ MCS remain unique

Introduction of optical reporter gene into cancer and immune cells using lentiviral vector

International Nuclear Information System (INIS)

Min, Jung Joon; Le, Uyenchi N.; Moon, Sung Min; Heo, Young Jun; Song, Ho Chun; Bom, Hee Seung; Kim, Yeon Soo

2004-01-01

For some applications such as gene therapy or reporter gene imaging, a gene has to be introduced into the organism of interest. Adenoviral vectors are capable of transducing both replicating and non-dividing cells. The adenoviral vectors do not integrate their DNA into host DNA, but do lead to an immune response. Lentiviruses belong to the retrovirus family and are capable of infecting both dividing and non-dividing cells. The human immunodeficiency virus (HIV) is an example of a lentavirus. A disabled HIV virus has been developed and could be used for in vivo gene delivery. A portion of the viral genome which encodes for accessory proteins canbe deleted without affecting production of the vector and efficiency of infection. Lentiviral delivery into various rodent tissues shows sustained expression of the transgene of up to six months. Furthermore, there seems to be little or no immune response with these vectors. These lentiviral vectors hold significant promise for in vivo gene delivery. We constructed lentiviral vector encoding firefly luciferase (Fluc) and eGFP. Fluc-eGFP fusion gene was inserted into multiple cloning sites of pLentiM1.3 vector. Reporter gene (Fluc-eGFP) was designed to be driven by murine CMV promoter with enhanced efficacy of transgene expression as compared to human CMV promoter. We transfected pLenti1.3-Fluc into human cervix cancer cell line (HeLa) and murine T lymphocytes. We also constructed adenovirus encoding Fluc and transfected to HeLa and T cells. This LentiM1.3-Fluc was transfected into HeLa cells and murine T lymphocytes in vitro, showing consistent expression of eGFP under the fluorescence microscopy from the 2nd day of transfection. Firefly luciferase reporter gene was not expressed in immune cells when it is mediated by adenovirus. Lentivirus was validated as a useful vector for both immune and cancer cells

Effects of Circular DNA Length on Transfection Efficiency by Electroporation into HeLa Cells.

Science.gov (United States)

Hornstein, Benjamin D; Roman, Dany; Arévalo-Soliz, Lirio M; Engevik, Melinda A; Zechiedrich, Lynn

2016-01-01

The ability to produce extremely small and circular supercoiled vectors has opened new territory for improving non-viral gene therapy vectors. In this work, we compared transfection of supercoiled DNA vectors ranging from 383 to 4,548 bp, each encoding shRNA against GFP under control of the H1 promoter. We assessed knockdown of GFP by electroporation into HeLa cells. All of our vectors entered cells in comparable numbers when electroporated with equal moles of DNA. Despite similar cell entry, we found length-dependent differences in how efficiently the vectors knocked down GFP. As vector length increased up to 1,869 bp, GFP knockdown efficiency per mole of transfected DNA increased. From 1,869 to 4,257 bp, GFP knockdown efficiency per mole was steady, then decreased with increasing vector length. In comparing GFP knockdown with equal masses of vectors, we found that the shorter vectors transfect more efficiently per nanogram of DNA transfected. Our results rule out cell entry and DNA mass as determining factors for gene knockdown efficiency via electroporation. The length-dependent effects we have uncovered are likely explained by differences in nuclear translocation or transcription. These data add an important step towards clinical applications of non-viral vector delivery.

A versatile system for USER cloning-based assembly of expression vectors for mammalian cell engineering.

Directory of Open Access Journals (Sweden)

Anne Mathilde Lund

Full Text Available A new versatile mammalian vector system for protein production, cell biology analyses, and cell factory engineering was developed. The vector system applies the ligation-free uracil-excision based technique--USER cloning--to rapidly construct mammalian expression vectors of multiple DNA fragments and with maximum flexibility, both for choice of vector backbone and cargo. The vector system includes a set of basic vectors and a toolbox containing a multitude of DNA building blocks including promoters, terminators, selectable marker- and reporter genes, and sequences encoding an internal ribosome entry site, cellular localization signals and epitope- and purification tags. Building blocks in the toolbox can be easily combined as they contain defined and tested Flexible Assembly Sequence Tags, FASTs. USER cloning with FASTs allows rapid swaps of gene, promoter or selection marker in existing plasmids and simple construction of vectors encoding proteins, which are fused to fluorescence-, purification-, localization-, or epitope tags. The mammalian expression vector assembly platform currently allows for the assembly of up to seven fragments in a single cloning step with correct directionality and with a cloning efficiency above 90%. The functionality of basic vectors for FAST assembly was tested and validated by transient expression of fluorescent model proteins in CHO, U-2-OS and HEK293 cell lines. In this test, we included many of the most common vector elements for heterologous gene expression in mammalian cells, in addition the system is fully extendable by other users. The vector system is designed to facilitate high-throughput genome-scale studies of mammalian cells, such as the newly sequenced CHO cell lines, through the ability to rapidly generate high-fidelity assembly of customizable gene expression vectors.

Retroviral DNA Integration

Science.gov (United States)

2016-01-01

The integration of a DNA copy of the viral RNA genome into host chromatin is the defining step of retroviral replication. This enzymatic process is catalyzed by the virus-encoded integrase protein, which is conserved among retroviruses and LTR-retrotransposons. Retroviral integration proceeds via two integrase activities: 3′-processing of the viral DNA ends, followed by the strand transfer of the processed ends into host cell chromosomal DNA. Herein we review the molecular mechanism of retroviral DNA integration, with an emphasis on reaction chemistries and architectures of the nucleoprotein complexes involved. We additionally discuss the latest advances on anti-integrase drug development for the treatment of AIDS and the utility of integrating retroviral vectors in gene therapy applications. PMID:27198982

Glycoprotein is enough for sindbis virus-derived DNA vector to express heterogenous genes

Directory of Open Access Journals (Sweden)

Fu Juanjuan

2011-07-01

Full Text Available Abstract To investigate the necessity and potential application of structural genes for expressing heterogenous genes from Sindbis virus-derived vector, the DNA-based expression vector pVaXJ was constructed by placing the recombinant genome of sindbis-like virus XJ-160 under the control of the human cytomegalovirus (CMV promoter of the plasmid pVAX1, in which viral structural genes were replaced by a polylinker cassette to allow for insertion of heterologous genes. The defect helper plasmids pVaE or pVaC were developed by cloning the gene of glycoprotein E3E26KE1 or capsid protein of XJ-160 virus into pVAX1, respectively. The report gene cassette pVaXJ-EGFP or pV-Gluc expressing enhanced green fluorescence protein (EGFP or Gaussia luciferase (G.luc were constructed by cloning EGFP or G.luc gene into pVaXJ. EGFP or G.luc was expressed in the BHK-21 cells co-transfected with report gene cassettes and pVaE at levels that were comparable to those produced by report gene cassettes, pVaC and pVaE and were much higher than the levels produced by report gene cassette and pVaC, suggesting that glycoprotein is enough for Sindbis virus-derived DNA vector to express heterogenous genes in host cells. The method of gene expression from Sindbis virus-based DNA vector only co-transfected with envelop E gene increase the conveniency and the utility of alphavirus-based vector systems in general.

Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

Science.gov (United States)

Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.

2017-02-01

The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber

Immune protection of nonhuman primates against Ebola virus with single low-dose adenovirus vectors encoding modified GPs.

Directory of Open Access Journals (Sweden)

Nancy J Sullivan

2006-06-01

Full Text Available Ebola virus causes a hemorrhagic fever syndrome that is associated with high mortality in humans. In the absence of effective therapies for Ebola virus infection, the development of a vaccine becomes an important strategy to contain outbreaks. Immunization with DNA and/or replication-defective adenoviral vectors (rAd encoding the Ebola glycoprotein (GP and nucleoprotein (NP has been previously shown to confer specific protective immunity in nonhuman primates. GP can exert cytopathic effects on transfected cells in vitro, and multiple GP forms have been identified in nature, raising the question of which would be optimal for a human vaccine.To address this question, we have explored the efficacy of mutant GPs from multiple Ebola virus strains with reduced in vitro cytopathicity and analyzed their protective effects in the primate challenge model, with or without NP. Deletion of the GP transmembrane domain eliminated in vitro cytopathicity but reduced its protective efficacy by at least one order of magnitude. In contrast, a point mutation was identified that abolished this cytopathicity but retained immunogenicity and conferred immune protection in the absence of NP. The minimal effective rAd dose was established at 10(10 particles, two logs lower than that used previously.Expression of specific GPs alone vectored by rAd are sufficient to confer protection against lethal challenge in a relevant nonhuman primate model. Elimination of NP from the vaccine and dose reductions to 10(10 rAd particles do not diminish protection and simplify the vaccine, providing the basis for selection of a human vaccine candidate.

Immune Protection of Nonhuman Primates against Ebola Virus with Single Low-Dose Adenovirus Vectors Encoding Modified GPs

Science.gov (United States)

Geisbert, Joan B; Shedlock, Devon J; Xu, Ling; Lamoreaux, Laurie; Custers, Jerome H. H. V; Popernack, Paul M; Yang, Zhi-Yong; Pau, Maria G; Roederer, Mario; Koup, Richard A; Goudsmit, Jaap; Jahrling, Peter B; Nabel, Gary J

2006-01-01

Background Ebola virus causes a hemorrhagic fever syndrome that is associated with high mortality in humans. In the absence of effective therapies for Ebola virus infection, the development of a vaccine becomes an important strategy to contain outbreaks. Immunization with DNA and/or replication-defective adenoviral vectors (rAd) encoding the Ebola glycoprotein (GP) and nucleoprotein (NP) has been previously shown to confer specific protective immunity in nonhuman primates. GP can exert cytopathic effects on transfected cells in vitro, and multiple GP forms have been identified in nature, raising the question of which would be optimal for a human vaccine. Methods and Findings To address this question, we have explored the efficacy of mutant GPs from multiple Ebola virus strains with reduced in vitro cytopathicity and analyzed their protective effects in the primate challenge model, with or without NP. Deletion of the GP transmembrane domain eliminated in vitro cytopathicity but reduced its protective efficacy by at least one order of magnitude. In contrast, a point mutation was identified that abolished this cytopathicity but retained immunogenicity and conferred immune protection in the absence of NP. The minimal effective rAd dose was established at 1010 particles, two logs lower than that used previously. Conclusions Expression of specific GPs alone vectored by rAd are sufficient to confer protection against lethal challenge in a relevant nonhuman primate model. Elimination of NP from the vaccine and dose reductions to 1010 rAd particles do not diminish protection and simplify the vaccine, providing the basis for selection of a human vaccine candidate. PMID:16683867

Biomolecule-to-fluorescent-color encoder: modulation of fluorescence emission via DNA structural changes

Science.gov (United States)

Nishimura, Takahiro; Ogura, Yusuke; Yamada, Kenji; Ohno, Yuko; Tanida, Jun

2014-01-01

A biomolecule-to-fluorescent-color (B/F) encoder for optical readout of biomolecular information is proposed. In the B/F encoder, a set of fluorescence wavelengths and their intensity levels are used for coding of a biomolecular signal. A hybridization chain reaction of hairpin DNAs labeled with fluorescent reporters was performed to generate the fluorescence color codes. The fluorescence is modulated via fluorescence resonance energy transfer, which is controlled by DNA structural changes. The results demonstrate that fluorescent color codes can be configured based on two wavelengths and five intensities using the B/F encoder, and the assigned codes can be retrieved via fluorescence measurements. PMID:25071950

The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.

LENUS (Irish Health Repository)

Tangney, Mark

2012-01-31

Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.

Encoded novel forms of HSP70 or a cytolytic protein increase DNA vaccine potency.

Science.gov (United States)

Garrod, Tamsin; Grubor-Bauk, Branka; Yu, Stanley; Gargett, Tessa; Gowans, Eric J

2014-01-01

In humans, DNA vaccines have failed to demonstrate the equivalent levels of immunogenicity that were shown in smaller animals. Previous studies have encoded adjuvants, predominantly cytokines, within these vaccines in an attempt to increase antigen-specific immune responses. However, these strategies have lacked breadth of innate immune activation and have led to disappointing results in clinical trials. Damage associated molecular patterns (DAMPs) have been identified as pattern recognition receptor (PRR) agonists. DAMPs can bind to a wide range of PRRs on dendritic cells (DCs) and thus our studies have aimed to utilize this characteristic to act as an adjuvant in a DNA vaccine approach. Specifically, HSP70 has been identified as a DAMP, but has been limited by its lack of accessibility to PRRs in and on DCs. Here, we discuss the promising results achieved with the inclusion of membrane-bound or secreted HSP70 into a DNA vaccine encoding HIV gag as the model immunogen.

Sequence of a cDNA encoding turtle high mobility group 1 protein.

Science.gov (United States)

Zheng, Jifang; Hu, Bi; Wu, Duansheng

2005-07-01

In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

DNA transformations of Candida tropicalis with replicating and integrative vectors.

Science.gov (United States)

Sanglard, D; Fiechter, A

1992-12-01

The alkane-assimilating yeast Candida tropicalis was used as a host for DNA transformations. A stable ade2 mutant (Ha900) obtained by UV-mutagenesis was used as a recipient for different vectors carrying selectable markers. A first vector, pMK16, that was developed for the transformation of C. albicans and carries an ADE2 gene marker and a Candida autonomously replicating sequence (CARS) element promoting autonomous replication, was compatible for transforming Ha900. Two transformant types were observed: (i) pink transformants which easily lose pMK16 under non-selective growth conditions; (ii) white transformants, in which the same plasmid exhibited a higher mitotic stability. In both cases pMK16 could be rescued from these cells in Escherichia coli. A second vector, pADE2, containing the isolated C. tropicalis ADE2, gene, was used to transform Ha900. This vector integrated in the yeast genome at homologous sites of the ade2 locus. Different integration types were observed at one or both ade2 alleles in single or in tandem repeats.

The DNA-encoded nucleosome organization of a eukaryotic genome.

Science.gov (United States)

Kaplan, Noam; Moore, Irene K; Fondufe-Mittendorf, Yvonne; Gossett, Andrea J; Tillo, Desiree; Field, Yair; LeProust, Emily M; Hughes, Timothy R; Lieb, Jason D; Widom, Jonathan; Segal, Eran

2009-03-19

Nucleosome organization is critical for gene regulation. In living cells this organization is determined by multiple factors, including the action of chromatin remodellers, competition with site-specific DNA-binding proteins, and the DNA sequence preferences of the nucleosomes themselves. However, it has been difficult to estimate the relative importance of each of these mechanisms in vivo, because in vivo nucleosome maps reflect the combined action of all influencing factors. Here we determine the importance of nucleosome DNA sequence preferences experimentally by measuring the genome-wide occupancy of nucleosomes assembled on purified yeast genomic DNA. The resulting map, in which nucleosome occupancy is governed only by the intrinsic sequence preferences of nucleosomes, is similar to in vivo nucleosome maps generated in three different growth conditions. In vitro, nucleosome depletion is evident at many transcription factor binding sites and around gene start and end sites, indicating that nucleosome depletion at these sites in vivo is partly encoded in the genome. We confirm these results with a micrococcal nuclease-independent experiment that measures the relative affinity of nucleosomes for approximately 40,000 double-stranded 150-base-pair oligonucleotides. Using our in vitro data, we devise a computational model of nucleosome sequence preferences that is significantly correlated with in vivo nucleosome occupancy in Caenorhabditis elegans. Our results indicate that the intrinsic DNA sequence preferences of nucleosomes have a central role in determining the organization of nucleosomes in vivo.

Chitosan-Graft-Polyethylenimine/DNA Nanoparticles as Novel Non-Viral Gene Delivery Vectors Targeting Osteoarthritis

Science.gov (United States)

Lv, Lulu; Zhao, Huiqing

2014-01-01

The development of safe and efficient gene carriers is the key to the clinical success of gene therapy. The present study was designed to develop and evaluate the chitosan-graft-polyethylenimine (CP)/DNA nanoparticles as novel non-viral gene vectors for gene therapy of osteoarthritis. The CP/DNA nanoparticles were produced through a complex coacervation of the cationic polymers with pEGFP after grafting chitosan (CS) with a low molecular weight (Mw) PEI (Mw = 1.8 kDa). Particle size and zeta potential were related to the weight ratio of CP:DNA, where decreases in nanoparticle size and increases in surface charge were observed as CP content increased. The buffering capacity of CP was significantly greater than that of CS. The transfection efficiency of CP/DNA nanoparticles was similar with that of the Lipofectamine™ 2000, and significantly higher than that of CS/DNA and PEI (25 kDa)/DNA nanoparticles. The transfection efficiency of the CP/DNA nanoparticles was dependent on the weight ratio of CP:DNA (w/w). The average cell viability after the treatment with CP/DNA nanoparticles was over 90% in both chondrocytes and synoviocytes, which was much higher than that of PEI (25 kDa)/DNA nanoparticles. The CP copolymers efficiently carried the pDNA inside chondrocytes and synoviocytes, and the pDNA was detected entering into nucleus. These results suggest that CP/DNA nanoparticles with improved transfection efficiency and low cytotoxicity might be a safe and efficient non-viral vector for gene delivery to both chondrocytes and synoviocytes. PMID:24392152

Adeno-associated virus Rep-mediated targeting of integrase-defective retroviral vector DNA circles into human chromosome 19

International Nuclear Information System (INIS)

Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira; Kamihira, Masamichi

2012-01-01

Highlights: ► Adeno-associated virus (AAV) is capable of targeted integration in human cells. ► Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. ► A targeted integration system of IDRV DNA using the AAV integration mechanism. ► Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors, therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.

Quantification of residual host cell DNA in adenoviral vectors produced on PER.C6 cells

NARCIS (Netherlands)

Gijsbers, Linda; Koel, Björn; Weggeman, Miranda; Goudsmit, Jaap; Havenga, Menzo; Marzio, Giuseppe

2005-01-01

Recombinant adenoviral vectors for gene therapy and vaccination are routinely prepared on cultures of immortalized cells, allowing the production of vector batches of high titer and consistent quality. Quantification of residual DNA from the producing cell line is part of the purity tests for

Immunogenicity of DNA vaccines encoding simian immunodeficiency virus antigen targeted to dendritic cells in rhesus macaques.

Directory of Open Access Journals (Sweden)

Matthias Tenbusch

Full Text Available BACKGROUND: Targeting antigens encoded by DNA vaccines to dendritic cells (DCs in the presence of adjuvants enhances their immunogenicity and efficacy in mice. METHODOLOGY/PRINCIPAL FINDINGS: To explore the immunogenicity of this approach in non-human primates, we generated a single chain antibody to the antigen uptake receptor DEC-205 expressed on rhesus macaque DCs. DNA vaccines encoding this single chain antibody fused to the SIV capsid protein were delivered to six monkeys each by either intramuscular electroporation or conventional intramuscular injection co-injected or not with poly ICLC, a stabilized poly I: C analogue, as adjuvant. Antibodies to capsid were induced by the DC-targeting and non-targeting control DNA delivered by electroporation while conventional DNA immunization at a 10-fold higher dose of DNA failed to induce detectable humoral immune responses. Substantial cellular immune responses were also observed after DNA electroporation of both DNAs, but stronger responses were induced by the non-targeting vaccine. Conventional immunization with the DC-targeting DNA at a 10-fold higher dose did not give rise to substantial cellular immune responses, neither when co-injected with poly ICLC. CONCLUSIONS/SIGNIFICANCE: The study confirms the potent immunogenicity of DNA vaccines delivered by electroporation. Targeting the DNA via a single chain antibody to DEC-205 expressed by DCs, however, does not improve the immunogenicity of the antigens in non-human primates.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

RNase-L regulates the stability of mitochondrial DNA-encoded mRNAs in mouse embryo fibroblasts

International Nuclear Information System (INIS)

Chandrasekaran, Krish; Mehrabian, Zara; Li Xiaoling; Hassel, Bret

2004-01-01

Accelerated decrease in the levels of mitochondrial DNA-encoded mRNA (mt-mRNA) occurs in neuronal cells exposed either to the excitatory amino acid, glutamate or to the sodium ionophore, monensin, suggesting a role of mitochondrial RNase(s) on the stability of mt-mRNAs. Here we report that in mouse embryo fibroblasts that are devoid of the interferon-regulated RNase, RNase-L, the monensin-induced decrease in the half-life of mt-mRNA was reduced. In monensin (250 nM)-treated RNase-L +/+ cells the average half-life of mt-mRNA, determined after termination of transcription with actinomycin D, was found to be 3 h, whereas in monensin-treated RNase-L -/- cells the half-life of mt-mRNA was >6 h. In contrast, the stability of nuclear DNA-encoded β-actin mRNA was unaffected. Induction of RNase-L expression in mouse 3T3 fibroblasts further decreased the monensin-induced reduction in mt-mRNA half-life to 1.5 h. The results indicate that the RNase-L-dependent decrease in mtDNA-encoded mRNA transcript levels occurs through a decrease in the half-life of mt-mRNA, and that RNase-L may play a role in the stability of mt-mRNA

Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

Science.gov (United States)

Bell, Nicholas A. W.; Keyser, Ulrich F.

2016-07-01

The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

Long-circulating DNA lipid nanocapsules as new vector for passive tumor targeting.

OpenAIRE

Morille , Marie; Montier , Tristan; Legras , Pierre; Carmoy , Nathalie; Brodin , Priscille; Pitard , Bruno; Benoît , Jean-Pierre; Passirani , Catherine

2010-01-01

International audience; Systemic gene delivery systems are needed for therapeutic application to organs that are inaccessible by percutaneous injection. Currently, the main objective is the development of a stable and non-toxic vector that can encapsulate and deliver foreign genetic material to target cells. To this end, DNA, complexed with cationic lipids i.e. DOTAP/DOPE, was encapsulated into lipid nanocapsules (LNCs) leading to the formation of stable nanocarriers (DNA LNCs) with a size in...

Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

Science.gov (United States)

Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

1997-01-01

The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

International Nuclear Information System (INIS)

Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

1989-01-01

A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

International Nuclear Information System (INIS)

Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

1990-01-01

Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT).

Science.gov (United States)

Ding, Yun; O'Keefe, Heather; DeLorey, Jennifer L; Israel, David I; Messer, Jeffrey A; Chiu, Cynthia H; Skinner, Steven R; Matico, Rosalie E; Murray-Thompson, Monique F; Li, Fan; Clark, Matthew A; Cuozzo, John W; Arico-Muendel, Christopher; Morgan, Barry A

2015-08-13

The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure-activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality.

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

Science.gov (United States)

Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

2009-12-30

Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

Science.gov (United States)

2009-01-01

Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T

Cloning of the human androgen receptor cDNA

International Nuclear Information System (INIS)

Govindan, M.V.; Burelle, M.; Cantin, C.; Kabrie, C.; Labrie, F.; Lachance, Y.; Leblanc, G.; Lefebvre, C.; Patel, P.; Simard, J.

1988-01-01

The authors discuss how in order to define the functional domains of the human androgen receptor, complementary DNA (cDNA) clones encoding the human androgen receptor (hAR) have been isolated from a human testis λgtll cDNA library using synthetic oligonnucleotide probes, homologous to segments of the human glucocorticoid, estradiol and progesterone receptors. The cDNA clones corresponding to the human glucocorticoid, estradiol and progesterone receptors were eliminated after cross-hybridization with their respective cDNA probes and/or after restriction mapping of the cDNA clones. The remaining cDNA clones were classified into different groups after analysis by restriction digestion and cross-hybridization. Two of the largest cDNA clones from each group were inserted into an expression vector in both orientations. The linearized plasmids were used as templates in in vitro transcription with T7 RNA polymerase. Subsequent in vitro translation of the purified transcripts in rabbit reticulocyte lysate followed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) permitted the characterization of the encoded polyeptides. The expressed proteins larger than 30,000 Da were analyzed for their ability to bind tritium-labelled dihydrotestosterone ([ 3 H] DHT) with high affinity and specificity

Longevity of rAAV vector and plasmid DNA in blood after intramuscular injection in nonhuman primates: implications for gene doping.

Science.gov (United States)

Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O

2011-07-01

Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.

Development of oral CTL vaccine using a CTP-integrated Sabin 1 poliovirus-based vector system.

Science.gov (United States)

Han, Seung-Soo; Lee, Jinjoo; Jung, Yideul; Kang, Myeong-Ho; Hong, Jung-Hyub; Cha, Min-Suk; Park, Yu-Jin; Lee, Ezra; Yoon, Cheol-Hee; Bae, Yong-Soo

2015-09-11

We developed a CTL vaccine vector by modification of the RPS-Vax system, a mucosal vaccine vector derived from a poliovirus Sabin 1 strain, and generated an oral CTL vaccine against HIV-1. A DNA fragment encoding a cytoplasmic transduction peptide (CTP) was integrated into the RPS-Vax system to generate RPS-CTP, a CTL vaccine vector. An HIV-1 p24 cDNA fragment was introduced into the RPS-CTP vector system and a recombinant poliovirus (rec-PV) named vRPS-CTP/p24 was produced. vRPS-CTP/p24 was genetically stable and efficiently induced Th1 immunity and p24-specific CTLs in immunized poliovirus receptor-transgenic (PVR-Tg) mice. In challenge experiments, PVR-Tg mice that were pre-immunized orally with vRPS-CTP/p24 were resistant to challenge with a lethal dose of p24-expressing recombinant vaccinia virus (rMVA-p24). These results suggested that the RPS-CTP vector system had potential for developing oral CTL vaccines against infectious diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

International Nuclear Information System (INIS)

Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

1988-01-01

The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

Ectopic expression of the erythrocyte band 3 anion exchange protein, using a new avian retrovirus vector

DEFF Research Database (Denmark)

Fuerstenberg, S; Beug, H; Introna, M

1990-01-01

into protein. Using the Escherichia coli beta-galactosidase gene cloned into the vector as a test construct, expression of enzyme activity could be detected in 90 to 95% of transfected target cells and in 80 to 85% of subsequently infected cells. In addition, a cDNA encoding the avian erythrocyte band 3 anion...... exchange protein has been expressed from the vector in both chicken embryo fibroblasts and QT6 cells and appears to function as an active, plasma membrane-based anion transporter. The ectopic expression of band 3 protein provides a visual marker for vector function in these cells....

Flipped-Adversarial AutoEncoders

OpenAIRE

Zhang, Jiyi; Dang, Hung; Lee, Hwee Kuan; Chang, Ee-Chien

2018-01-01

We propose a flipped-Adversarial AutoEncoder (FAAE) that simultaneously trains a generative model G that maps an arbitrary latent code distribution to a data distribution and an encoder E that embodies an "inverse mapping" that encodes a data sample into a latent code vector. Unlike previous hybrid approaches that leverage adversarial training criterion in constructing autoencoders, FAAE minimizes re-encoding errors in the latent space and exploits adversarial criterion in the data space. Exp...

AAV Vectorization of DSB-mediated Gene Editing Technologies.

Science.gov (United States)

Moser, Rachel J; Hirsch, Matthew L

2016-01-01

Recent work both at the bench and the bedside demonstrate zinc-finger nucleases (ZFNs), CRISPR/Cas9, and other programmable site-specific endonuclease technologies are being successfully utilized within and alongside AAV vectors to induce therapeutically relevant levels of directed gene editing within the human chromosome. Studies from past decades acknowledge that AAV vector genomes are enhanced substrates for homology-directed repair in the presence or absence of targeted DNA damage within the host genome. Additionally, AAV vectors are currently the most efficient format for in vivo gene delivery with no vector related complications in >100 clinical trials for diverse diseases. At the same time, advancements in the design of custom-engineered site-specific endonucleases and the utilization of elucidated endonuclease formats have resulted in efficient and facile genetic engineering for basic science and for clinical therapies. AAV vectors and gene editing technologies are an obvious marriage, using AAV for the delivery of repair substrate and/or a gene encoding a designer endonuclease; however, while efficient delivery and enhanced gene targeting by vector genomes are advantageous, other attributes of AAV vectors are less desirable for gene editing technologies. This review summarizes the various roles that AAV vectors play in gene editing technologies and provides insight into its trending applications for the treatment of genetic diseases.

Validation of SplitVectors Encoding for Quantitative Visualization of Large-Magnitude-Range Vector Fields.

Science.gov (United States)

Henan Zhao; Bryant, Garnett W; Griffin, Wesley; Terrill, Judith E; Jian Chen

2017-06-01

We designed and evaluated SplitVectors, a new vector field display approach to help scientists perform new discrimination tasks on large-magnitude-range scientific data shown in three-dimensional (3D) visualization environments. SplitVectors uses scientific notation to display vector magnitude, thus improving legibility. We present an empirical study comparing the SplitVectors approach with three other approaches - direct linear representation, logarithmic, and text display commonly used in scientific visualizations. Twenty participants performed three domain analysis tasks: reading numerical values (a discrimination task), finding the ratio between values (a discrimination task), and finding the larger of two vectors (a pattern detection task). Participants used both mono and stereo conditions. Our results suggest the following: (1) SplitVectors improve accuracy by about 10 times compared to linear mapping and by four times to logarithmic in discrimination tasks; (2) SplitVectors have no significant differences from the textual display approach, but reduce cluttering in the scene; (3) SplitVectors and textual display are less sensitive to data scale than linear and logarithmic approaches; (4) using logarithmic can be problematic as participants' confidence was as high as directly reading from the textual display, but their accuracy was poor; and (5) Stereoscopy improved performance, especially in more challenging discrimination tasks.

cDNA encoding a polypeptide including a hev ein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

Methods for transforming and expression screening of filamentous fungal cells with a DNA library

Science.gov (United States)

Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

2015-06-02

The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

Low-Dose Gene Therapy for Murine PKU Using Episomal Naked DNA Vectors Expressing PAH from Its Endogenous Liver Promoter

Directory of Open Access Journals (Sweden)

Hiu Man Grisch-Chan

2017-06-01

Full Text Available Limited duration of transgene expression, insertional mutagenesis, and size limitations for transgene cassettes pose challenges and risk factors for many gene therapy vectors. Here, we report on physiological expression of liver phenylalanine hydroxylase (PAH by delivery of naked DNA/minicircle (MC-based vectors for correction of homozygous enu2 mice, a model of human phenylketonuria (PKU. Because MC vectors lack a defined size limit, we constructed a MC vector expressing a codon-optimized murine Pah cDNA that includes a truncated intron and is under the transcriptional control of a 3.6-kb native Pah promoter/enhancer sequence. This vector, delivered via hydrodynamic injection, yielded therapeutic liver PAH activity and sustained correction of blood phenylalanine comparable to viral or synthetic liver promoters. Therapeutic efficacy was seen with vector copy numbers of 95% loss of vector genomes and PAH activity in liver, demonstrating that MC vectors had not integrated into the liver genome. In conclusion, MC vectors, which do not have a defined size-limitation, offer a favorable safety profile for hepatic gene therapy due to their non-integration in combination with native promoters.

Integration of adeno-associated virus vectors in CD34+ human hematopoietic progenitor cells after transduction.

Science.gov (United States)

Fisher-Adams, G; Wong, K K; Podsakoff, G; Forman, S J; Chatterjee, S

1996-07-15

Gene transfer vectors based on adeno-associated virus (AAV) appear promising because of their high transduction frequencies regardless of cell cycle status and ability to integrate into chromosomal DNA. We tested AAV-mediated gene transfer into a panel of human bone marrow or umbilical cord-derived CD34+ hematopoietic progenitor cells, using vectors encoding several transgenes under the control of viral and cellular promoters. Gene transfer was evaluated by (1) chromosomal integration of vector sequences and (2) analysis of transgene expression. Southern hybridization and fluorescence in situ hybridization analysis of transduced CD34 genomic DNA showed the presence of integrated vector sequences in chromosomal DNA in a portion of transduced cells and showed that integrated vector sequences were replicated along with cellular DNA during mitosis. Transgene expression in transduced CD34 cells in suspension cultures and in myeloid colonies differentiating in vitro from transduced CD34 cells approximated that predicted by the multiplicity of transduction. This was true in CD34 cells from different donors, regardless of the transgene or selective pressure. Comparisons of CD34 cell transduction either before or after cytokine stimulation showed similar gene transfer frequencies. Our findings suggest that AAV transduction of CD34+ hematopoietic progenitor cells is efficient, can lead to stable integration in a population of transduced cells, and may therefore provide the basis for safe and efficient ex vivo gene therapy of the hematopoietic system.

Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

Science.gov (United States)

Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

2012-10-01

A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

Directory of Open Access Journals (Sweden)

Emanuela Chiarella

Full Text Available Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6 where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in

UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

Science.gov (United States)

Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni

2014-01-01

Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and

Herpes simplex virus type 1-derived recombinant and amplicon vectors.

Science.gov (United States)

Fraefel, Cornel; Marconi, Peggy; Epstein, Alberto L

2011-01-01

Herpes simplex virus type 1 (HSV-1) is a human pathogen whose lifestyle is based on a long-term dual interaction with the infected host, being able to establish both lytic and latent infections. The virus genome is a 153 kbp double-stranded DNA molecule encoding more than 80 genes. The interest of HSV-1 as gene transfer vector stems from its ability to infect many different cell types, both quiescent and proliferating cells, the very high packaging capacity of the virus capsid, the outstanding neurotropic adaptations that this virus has evolved, and the fact that it never integrates into the cellular chromosomes, thus avoiding the risk of insertional mutagenesis. Two types of vectors can be derived from HSV-1, recombinant vectors and amplicon vectors, and different methodologies have been developed to prepare large stocks of each type of vector. This chapter summarizes (1) the two approaches most commonly used to prepare recombinant vectors through homologous recombination, either in eukaryotic cells or in bacteria, and (2) the two methodologies currently used to generate helper-free amplicon vectors, either using a bacterial artificial chromosome (BAC)-based approach or a Cre/loxP site-specific recombination strategy.

DNA prime/Adenovirus boost malaria vaccine encoding P. falciparum CSP and AMA1 induces sterile protection associated with cell-mediated immunity.

Directory of Open Access Journals (Sweden)

Ilin Chuang

Full Text Available BACKGROUND: Gene-based vaccination using prime/boost regimens protects animals and humans against malaria, inducing cell-mediated responses that in animal models target liver stage malaria parasites. We tested a DNA prime/adenovirus boost malaria vaccine in a Phase 1 clinical trial with controlled human malaria infection. METHODOLOGY/PRINCIPAL FINDINGS: The vaccine regimen was three monthly doses of two DNA plasmids (DNA followed four months later by a single boost with two non-replicating human serotype 5 adenovirus vectors (Ad. The constructs encoded genes expressing P. falciparum circumsporozoite protein (CSP and apical membrane antigen-1 (AMA1. The regimen was safe and well-tolerated, with mostly mild adverse events that occurred at the site of injection. Only one AE (diarrhea, possibly related to immunization, was severe (Grade 3, preventing daily activities. Four weeks after the Ad boost, 15 study subjects were challenged with P. falciparum sporozoites by mosquito bite, and four (27% were sterilely protected. Antibody responses by ELISA rose after Ad boost but were low (CSP geometric mean titer 210, range 44-817; AMA1 geometric mean micrograms/milliliter 11.9, range 1.5-102 and were not associated with protection. Ex vivo IFN-γ ELISpot responses after Ad boost were modest (CSP geometric mean spot forming cells/million peripheral blood mononuclear cells 86, range 13-408; AMA1 348, range 88-1270 and were highest in three protected subjects. ELISpot responses to AMA1 were significantly associated with protection (p = 0.019. Flow cytometry identified predominant IFN-γ mono-secreting CD8+ T cell responses in three protected subjects. No subjects with high pre-existing anti-Ad5 neutralizing antibodies were protected but the association was not statistically significant. SIGNIFICANCE: The DNA/Ad regimen provided the highest sterile immunity achieved against malaria following immunization with a gene-based subunit vaccine (27%. Protection

Arabidopsis thaliana GYRB3 does not encode a DNA gyrase subunit.

Directory of Open Access Journals (Sweden)

Katherine M Evans-Roberts

2010-03-01

Full Text Available DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3.We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer.These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen.

Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

Science.gov (United States)

Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

2014-08-20

DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

Engineering nanoparticle-coated bacteria as oral DNA vaccines for cancer immunotherapy.

Science.gov (United States)

Hu, Qinglian; Wu, Min; Fang, Chun; Cheng, Changyong; Zhao, Mengmeng; Fang, Weihuan; Chu, Paul K; Ping, Yuan; Tang, Guping

2015-04-08

Live attenuated bacteria are of increasing importance in biotechnology and medicine in the emerging field of cancer immunotherapy. Oral DNA vaccination mediated by live attenuated bacteria often suffers from low infection efficiency due to various biological barriers during the infection process. To this end, we herein report, for the first time, a new strategy to engineer cationic nanoparticle-coated bacterial vectors that can efficiently deliver oral DNA vaccine for efficacious cancer immunotherapy. By coating live attenuated bacteria with synthetic nanoparticles self-assembled from cationic polymers and plasmid DNA, the protective nanoparticle coating layer is able to facilitate bacteria to effectively escape phagosomes, significantly enhance the acid tolerance of bacteria in stomach and intestines, and greatly promote dissemination of bacteria into blood circulation after oral administration. Most importantly, oral delivery of DNA vaccines encoding autologous vascular endothelial growth factor receptor 2 (VEGFR2) by this hybrid vector showed remarkable T cell activation and cytokine production. Successful inhibition of tumor growth was also achieved by efficient oral delivery of VEGFR2 with nanoparticle-coated bacterial vectors due to angiogenesis suppression in the tumor vasculature and tumor necrosis. This proof-of-concept work demonstrates that coating live bacterial cells with synthetic nanoparticles represents a promising strategy to engineer efficient and versatile DNA vaccines for the era of immunotherapy.

Cloning, molecular characterization and expression of a cDNA encoding a functional NADH-cytochrome b5 reductase from Mucor racemosus PTCC 5305 in E. coli

Directory of Open Access Journals (Sweden)

NED A SETAYESH

2009-01-01

Full Text Available The present work aims to study a new NADH-cytochrome b5 reductase (cb5r from Mucor racemosus PTCC 5305. A cDNA coding for cb s r was isolated from a Mucor racemosus PTCC 5305 cDNA library. The nucleotide sequence of the cDNA including coding and sequences flanking regions was determined. The open reading frame starting from ATG and ending with TAG stop codon encoded 228 amino acids and displayed the closest similarity (73% with Mortierella alpina cb s r. Lack of hydrophobic residues in the N-terminal sequence was apparent, suggesting that the enzyme is a soluble isoform. The coding sequence was then cloned in the pET16b transcription vector carrying an N-terminal-linked His-Tag® sequence and expressed in Escherichia coli BL21 (DE3. The enzyme was then homogeneously purified by a metal affinity column. The recombinant Mucor enzyme was shown to have its optimal activity at pH and temperature of about 7.5 and 40 °C, respectively. The apparent Km value was calculated to be 13 μM for ferricyanide. To our knowledge, this is the first report on cloning and expression of a native fungal soluble isoform of NADH-cytochrome b5 reductase in E. coli.

Immunogenicity in African Green Monkeys of M Protein Mutant Vesicular Stomatitis Virus Vectors and Contribution of Vector-Encoded Flagellin

Directory of Open Access Journals (Sweden)

Marlena M. Westcott

2018-03-01

Full Text Available Recombinant vesicular stomatitis virus (VSV is a promising platform for vaccine development. M51R VSV, an attenuated, M protein mutant strain, is an effective inducer of Type I interferon and dendritic cell (DC maturation, which are desirable properties to exploit for vaccine design. We have previously evaluated M51R VSV (M51R and M51R VSV that produces flagellin (M51R-F as vaccine vectors using murine models, and found that flagellin enhanced DC activation and VSV-specific antibody production after low-dose vaccination. In this report, the immunogenicity of M51R vectors and the adjuvant effect of virus-produced flagellin were evaluated in nonhuman primates following high-dose (108 pfu and low-dose (105 pfu vaccination. A single intramuscular vaccination of African green monkeys with M51R or M51R-F induced VSV-specific, dose-dependent humoral immune responses. Flagellin induced a significant increase in antibody production (IgM, IgG and neutralizing antibody at the low vaccination dose. A VSV-specific cellular response was detected at 6 weeks post-vaccination, but was neither dose-dependent nor enhanced by flagellin; similar numbers of VSV-specific, IFNγ-producing cells were detected in lymph node and spleen of all animals. These results indicate that virus-directed, intracellular flagellin production may improve VSV-based vaccines encoding heterologous antigens by lowering the dose required to achieve humoral immunity.

Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

Science.gov (United States)

Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

2013-12-01

Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

Science.gov (United States)

Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo

2013-10-01

Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

Smart DNA vectors based on cyclodextrin polymers: compaction and endosomal release.

Science.gov (United States)

Wintgens, Véronique; Leborgne, Christian; Baconnais, Sonia; Burckbuchler, Virginie; Le Cam, Eric; Scherman, Daniel; Kichler, Antoine; Amiel, Catherine

2012-02-01

Neutral β-cyclodextrin polymers (polyβCD) associated with cationic adamantyl derivatives (Ada) can be used to deliver plasmid DNA into cells. In absence of an endosomolytic agent, transfection efficiency remains low because most complexes are trapped in the endosomal compartment. We asked whether addition of an imidazole-modified Ada can increase efficiency of polyβCD/cationic Ada-based delivery system. We synthesized two adamantyl derivatives: Ada5, which has a spacer arm between the Ada moiety and a bi-cationic polar head group, and Ada6, which presents an imidazole group. Strength of association between polyβCD and Ada derivatives was evaluated by fluorimetric titration. Gel mobility shift assay, zeta potential, and dark field transmission electron microscopy experiments demonstrated the system allowed for efficient DNA compaction. In vitro transfection experiments performed on HepG2 and HEK293 cells revealed the quaternary system polyβCD/Ada5/Ada6/DNA has efficiency comparable to cationic lipid DOTAP. We successfully designed fine-tuned DNA vectors based on cyclodextrin polymers combined with two new adamantyl derivatives, leading to significant transfection associated with low toxicity.

Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

Science.gov (United States)

Ficarelli, A; Tassi, F; Restivo, F M

1999-03-01

We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption

Science.gov (United States)

2013-01-01

Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

Ability of herpes simplex virus vectors to boost immune responses to DNA vectors and to protect against challenge by simian immunodeficiency virus

International Nuclear Information System (INIS)

Kaur, Amitinder; Sanford, Hannah B.; Garry, Deirdre; Lang, Sabine; Klumpp, Sherry A.; Watanabe, Daisuke; Bronson, Roderick T.; Lifson, Jeffrey D.; Rosati, Margherita; Pavlakis, George N.; Felber, Barbara K.; Knipe, David M.; Desrosiers, Ronald C.

2007-01-01

The immunogenicity and protective capacity of replication-defective herpes simplex virus (HSV) vector-based vaccines were examined in rhesus macaques. Three macaques were inoculated with recombinant HSV vectors expressing Gag, Env, and a Tat-Rev-Nef fusion protein of simian immunodeficiency virus (SIV). Three other macaques were primed with recombinant DNA vectors expressing Gag, Env, and a Pol-Tat-Nef-Vif fusion protein prior to boosting with the HSV vectors. Robust anti-Gag and anti-Env cellular responses were detected in all six macaques. Following intravenous challenge with wild-type, cloned SIV239, peak and 12-week plasma viremia levels were significantly lower in vaccinated compared to control macaques. Plasma SIV RNA in vaccinated macaques was inversely correlated with anti-Rev ELISPOT responses on the day of challenge (P value < 0.05), anti-Tat ELISPOT responses at 2 weeks post challenge (P value < 0.05) and peak neutralizing antibody titers pre-challenge (P value 0.06). These findings support continued study of recombinant herpesviruses as a vaccine approach for AIDS

Herpes simplex virus type 1 (HSV-1)-derived recombinant vectors for gene transfer and gene therapy.

Science.gov (United States)

Marconi, Peggy; Fraefel, Cornel; Epstein, Alberto L

2015-01-01

Herpes simplex virus type 1 (HSV-1 ) is a human pathogen whose lifestyle is based on a long-term dual interaction with the infected host, being able to establish both lytic and latent infections. The virus genome is a 153-kilobase pair (kbp) double-stranded DNA molecule encoding more than 80 genes. The interest of HSV-1 as gene transfer vector stems from its ability to infect many different cell types, both quiescent and proliferating cells, the very high packaging capacity of the virus capsid, the outstanding neurotropic adaptations that this virus has evolved, and the fact that it never integrates into the cellular chromosomes, thus avoiding the risk of insertional mutagenesis. Two types of vectors can be derived from HSV-1, recombinant vectors and amplicon vectors, and different methodologies have been developed to prepare large stocks of each type of vector. This chapter summarizes the approach most commonly used to prepare recombinant HSV-1 vectors through homologous recombination, either in eukaryotic cells or in bacteria.

Achievements, Challenges, and Opportunities in DNA-Encoded Library Research: An Academic Point of View.

Science.gov (United States)

Yuen, Lik Hang; Franzini, Raphael M

2017-05-04

DNA-encoded chemical libraries (DECLs) are pools of DNA-tagged small molecules that enable facile screening and identification of bio-macromolecule binders. The successful development of DECLs has led to their increasingly important role in drug development, and screening hits have entered clinical trials. In this review, we summarize the development and currently active research areas of DECLs with a focus on contributions from groups at academic institutes. We further look at opportunities and future directions of DECL research in medicinal chemistry and chemical biology based on the symbiotic relationship between academia and industry. Challenges associated with the application of DECLs in academic drug discovery are further discussed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Breadth of T cell responses after immunization with adenovirus vectors encoding ancestral antigens or polyvalent papillomavirus antigens

DEFF Research Database (Denmark)

Ragonnaud, Emeline; Pedersen, Anders Gorm; Holst, Peter Johannes

2017-01-01

to the other PV proteins. The PV sequences were fused to a T cell adjuvant, the murine invariant chain and encoded in a recombinant adenoviral vector which was administered to naïve outbred mice. By measuring T cell responses induced by these different vaccines and towards peptide pools representing 3...... circulating strains and a putative ancestor of oncogenic HPVs, we showed that the ancestral vaccine antigen has to be approximately 90% identical to the circulating PVs before a marked drop of ~90% mean CD8+ T cell responses ensues. Interestingly, the combination of two or three type-specific PV vaccines did...

Hybrid lentivirus-phiC31-int-NLS vector allows site-specific recombination in murine and human cells but induces DNA damage.

Directory of Open Access Journals (Sweden)

Nicolas Grandchamp

Full Text Available Gene transfer allows transient or permanent genetic modifications of cells for experimental or therapeutic purposes. Gene delivery by HIV-derived lentiviral vector (LV is highly effective but the risk of insertional mutagenesis is important and the random/uncontrollable integration of the DNA vector can deregulate the cell transcriptional activity. Non Integrative Lentiviral Vectors (NILVs solve this issue in non-dividing cells, but they do not allow long term expression in dividing cells. In this context, obtaining stable expression while avoiding the problems inherent to unpredictable DNA vector integration requires the ability to control the integration site. One possibility is to use the integrase of phage phiC31 (phiC31-int which catalyzes efficient site-specific recombination between the attP site in the phage genome and the chromosomal attB site of its Streptomyces host. Previous studies showed that phiC31-int is active in many eukaryotic cells, such as murine or human cells, and directs the integration of a DNA substrate into pseudo attP sites (pattP which are homologous to the native attP site. In this study, we combined the efficiency of NILV for gene delivery and the specificity of phiC31-int for DNA substrate integration to engineer a hybrid tool for gene transfer with the aim of allowing long term expression in dividing and non-dividing cells preventing genotoxicity. We demonstrated the feasibility to target NILV integration in human and murine pattP sites with a dual NILV vectors system: one which delivers phiC31-int, the other which constitute the substrate containing an attB site in its DNA sequence. These promising results are however alleviated by the occurrence of significant DNA damages. Further improvements are thus required to prevent chromosomal rearrangements for a therapeutic use of the system. However, its use as a tool for experimental applications such as transgenesis is already applicable.

[Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

Science.gov (United States)

Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng

2008-01-01

To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

Predicting DNA binding proteins using support vector machine with hybrid fractal features.

Science.gov (United States)

Niu, Xiao-Hui; Hu, Xue-Hai; Shi, Feng; Xia, Jing-Bo

2014-02-21

DNA-binding proteins play a vitally important role in many biological processes. Prediction of DNA-binding proteins from amino acid sequence is a significant but not fairly resolved scientific problem. Chaos game representation (CGR) investigates the patterns hidden in protein sequences, and visually reveals previously unknown structure. Fractal dimensions (FD) are good tools to measure sizes of complex, highly irregular geometric objects. In order to extract the intrinsic correlation with DNA-binding property from protein sequences, CGR algorithm, fractal dimension and amino acid composition are applied to formulate the numerical features of protein samples in this paper. Seven groups of features are extracted, which can be computed directly from the primary sequence, and each group is evaluated by the 10-fold cross-validation test and Jackknife test. Comparing the results of numerical experiments, the group of amino acid composition and fractal dimension (21-dimension vector) gets the best result, the average accuracy is 81.82% and average Matthew's correlation coefficient (MCC) is 0.6017. This resulting predictor is also compared with existing method DNA-Prot and shows better performances. © 2013 The Authors. Published by Elsevier Ltd All rights reserved.

Identification and characterization of a novel Cut family cDNA that encodes human copper transporter protein CutC

International Nuclear Information System (INIS)

Li Jixi; Ji Chaoneng; Chen Jinzhong; Yang Zhenxing; Wang Yijing; Fei, Xiangwei; Zheng Mei; Gu Xing; Wen Ge; Xie Yi; Mao Yumin

2005-01-01

Copper is an essential heavy metal trace element that plays important roles in cell physiology. The Cut family was associated with the copper homeostasis and involved in several important metabolisms, such as uptake, storage, delivery, and efflux of copper. In this study, a novel Cut family cDNA was isolated from the human fetal brain library, which encodes a 273 amino acid protein with a molecular mass of about 29.3 kDa and a calculated pI of 8.17. It was named hCutC (human copper transporter protein CutC). The ORF of hCutC gene was cloned into pQE30 vector and expressed in Escherichia coli M15. The secreted hCutC protein was purified to a homogenicity of 95% by using the Ni-NTA affinity chromatography. RT-PCR analysis showed that the hCutC gene expressed extensively in human tissues. Subcellular location analysis of hCutC-EGFP fusion protein revealed that hCutC was distributed to cytoplasm of COS-7 cells, and both cytoplasm and nucleus of AD293 cells. The results suggest that hCutC may be one shuttle protein and play important roles in intracellular copper trafficking

Latency Performance of Encoding with Random Linear Network Coding

DEFF Research Database (Denmark)

Nielsen, Lars; Hansen, René Rydhof; Lucani Rötter, Daniel Enrique

2018-01-01

the encoding process can be parallelized based on system requirements to reduce data access time within the system. Using a counting argument, we focus on predicting the effect of changes of generation (number of original packets) and symbol size (number of bytes per data packet) configurations on the encoding...... latency on full vector and on-the-fly algorithms. We show that the encoding latency doubles when either the generation size or the symbol size double and confirm this via extensive simulations. Although we show that the theoretical speed gain of on-the-fly over full vector is two, our measurements show...

iDNA screening: Disease vectors as vertebrate samplers.

Science.gov (United States)

Kocher, Arthur; de Thoisy, Benoit; Catzeflis, François; Valière, Sophie; Bañuls, Anne-Laure; Murienne, Jérôme

2017-11-01

In the current context of global change and human-induced biodiversity decline, there is an urgent need for developing sampling approaches able to accurately describe the state of biodiversity. Traditional surveys of vertebrate fauna involve time-consuming and skill-demanding field methods. Recently, the use of DNA derived from invertebrate parasites (leeches and blowflies) was suggested as a new tool for vertebrate diversity assessment. Bloodmeal analyses of arthropod disease vectors have long been performed to describe their feeding behaviour, for epidemiological purposes. On the other hand, this existing expertise has not yet been applied to investigate vertebrate fauna per se. Here, we evaluate the usefulness of hematophagous dipterans as vertebrate samplers. Blood-fed sand flies and mosquitoes were collected in Amazonian forest sites and analysed using high-throughput sequencing of short mitochondrial markers. Bloodmeal identifications highlighted contrasting ecological features and feeding behaviour among dipteran species, which allowed unveiling arboreal and terrestrial mammals of various body size, as well as birds, lizards and amphibians. Additionally, lower vertebrate diversity was found in sites undergoing higher levels of human-induced perturbation. These results suggest that, in addition to providing precious information on disease vector host use, dipteran bloodmeal analyses may represent a useful tool in the study of vertebrate communities. Although further effort is required to validate the approach and consider its application to large-scale studies, this first work opens up promising perspectives for biodiversity monitoring and eco-epidemiology. © 2017 John Wiley & Sons Ltd.

Construction of expression vectors carrying mouse peroxisomal ...

African Journals Online (AJOL)

PRECIOUS

2009-11-16

Nov 16, 2009 ... The aim of this study was to construct expression vectors carrying mouse peroxisomal protein gene. (PEP-cDNA) in prokaryotic and mammalian expression vectors in chimeric cDNA types, encompassing. GST and FLAG with PEP-cDNA. PEP-cDNA was sub-cloned in pGEX6p2 prokaryotic expression ...

Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1987-01-01

The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

Efficient Sleeping Beauty DNA Transposition From DNA Minicircles

Directory of Open Access Journals (Sweden)

Nynne Sharma

2013-01-01

Full Text Available DNA transposon-based vectors have emerged as new potential delivery tools in therapeutic gene transfer. Such vectors are now showing promise in hematopoietic stem cells and primary human T cells, and clinical trials with transposon-engineered cells are on the way. However, the use of plasmid DNA as a carrier of the vector raises safety concerns due to the undesirable administration of bacterial sequences. To optimize vectors based on the Sleeping Beauty (SB DNA transposon for clinical use, we examine here SB transposition from DNA minicircles (MCs devoid of the bacterial plasmid backbone. Potent DNA transposition, directed by the hyperactive SB100X transposase, is demonstrated from MC donors, and the stable transfection rate is significantly enhanced by expressing the SB100X transposase from MCs. The stable transfection rate is inversely related to the size of circular donor, suggesting that a MC-based SB transposition system benefits primarily from an increased cellular uptake and/or enhanced expression which can be observed with DNA MCs. DNA transposon and transposase MCs are easily produced, are favorable in size, do not carry irrelevant DNA, and are robust substrates for DNA transposition. In accordance, DNA MCs should become a standard source of DNA transposons not only in therapeutic settings but also in the daily use of the SB system.

Agrobacterium T-DNA-encoded protein Atu6002 interferes with the host auxin response

Science.gov (United States)

Lacroix, Benoît; Gizatullina, Diana I.; Babst, Benjamin A.; Gifford, Andrew N.; Citovsky, Vitaly

2013-01-01

Summary Several genes in the Agrobacterium tumefaciens transferred (T) DNA encode proteins that are involved in developmental alterations leading to the formation of tumors in infected plants. We investigated the role of the protein encoded by the Atu6002 gene, the function of which is completely unknown. The Atu6002 expression occurs in Agrobacterium-induced tumors, and is also activated upon activation of plant cell division by growth hormones. Within the expressing plant cells, the Atu6002 protein is targeted to the plasma membrane. Interestingly, constitutive ectopic expression of Atu6002 in transgenic tobacco plants lead to a severe developmental phenotype characterized by stunted growth, shorter internodes, lanceolate leaves, increased branching, and modified flower morphology. These Atu6002-expressing plants also displayed impaired response to auxin. However, auxin cellular uptake and polar transport were not significantly inhibited in these plants, suggesting that Atu6002 interferes with auxin perception or signaling pathways. PMID:24128370

Long-circulating DNA lipid nanocapsules as new vector for passive tumor targeting.

Science.gov (United States)

Morille, Marie; Montier, Tristan; Legras, Pierre; Carmoy, Nathalie; Brodin, Priscille; Pitard, Bruno; Benoît, Jean-Pierre; Passirani, Catherine

2010-01-01

Systemic gene delivery systems are needed for therapeutic application to organs that are inaccessible by percutaneous injection. Currently, the main objective is the development of a stable and non-toxic vector that can encapsulate and deliver foreign genetic material to target cells. To this end, DNA, complexed with cationic lipids i.e. DOTAP/DOPE, was encapsulated into lipid nanocapsules (LNCs) leading to the formation of stable nanocarriers (DNA LNCs) with a size inferior to 130 nm. Amphiphilic and flexible poly (ethylene glycol) (PEG) polymer coatings [PEG lipid derivative (DSPE-mPEG(2000)) or F108 poloxamer] at different concentrations were selected to make DNA LNCs stealthy. Some of these coated lipid nanocapsules were able to inhibit complement activation and were not phagocytized in vitro by macrophagic THP-1 cells whereas uncoated DNA LNCs accumulated in the vacuolar compartment of THP-1 cells. These results correlated with a significant increase of in vivo circulation time in mice especially for DSPE-mPEG(2000) 10 mm and an early half-life time (t(1/2) of distribution) 5-fold greater than for non-coated DNA LNCs (7.1 h vs 1.4 h). Finally, a tumor accumulation assessed by in vivo fluorescence imaging system was evidenced for these coated LNCs as a passive targeting without causing any hepatic damage.

DNA/MVA Vaccines for HIV/AIDS

Directory of Open Access Journals (Sweden)

Smita S. Iyer

2014-02-01

Full Text Available Since the initial proof-of-concept studies examining the ability of antigen-encoded plasmid DNA to serve as an immunogen, DNA vaccines have evolved as a clinically safe and effective platform for priming HIV-specific cellular and humoral responses in heterologous “prime-boost” vaccination regimens. Direct injection of plasmid DNA into the muscle induces T- and B-cell responses against foreign antigens. However, the insufficient magnitude of this response has led to the development of approaches for enhancing the immunogenicity of DNA vaccines. The last two decades have seen significant progress in the DNA-based vaccine platform with optimized plasmid constructs, improved delivery methods, such as electroporation, the use of molecular adjuvants and novel strategies combining DNA with viral vectors and subunit proteins. These innovations are paving the way for the clinical application of DNA-based HIV vaccines. Here, we review preclinical studies on the DNA-prime/modified vaccinia Ankara (MVA-boost vaccine modality for HIV. There is a great deal of interest in enhancing the immunogenicity of DNA by engineering DNA vaccines to co-express immune modulatory adjuvants. Some of these adjuvants have demonstrated encouraging results in preclinical and clinical studies, and these data will be examined, as well.

Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

DEFF Research Database (Denmark)

Honoré, B; Leffers, H; Madsen, Peder

1994-01-01

We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa...

Implicit Real Vector Automata

Directory of Open Access Journals (Sweden)

Jean-François Degbomont

2010-10-01

Full Text Available This paper addresses the symbolic representation of non-convex real polyhedra, i.e., sets of real vectors satisfying arbitrary Boolean combinations of linear constraints. We develop an original data structure for representing such sets, based on an implicit and concise encoding of a known structure, the Real Vector Automaton. The resulting formalism provides a canonical representation of polyhedra, is closed under Boolean operators, and admits an efficient decision procedure for testing the membership of a vector.

Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

Science.gov (United States)

Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

2015-01-01

Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

The role of DNA polymerase {iota} in UV mutational spectra

Energy Technology Data Exchange (ETDEWEB)

Choi, Jun-Hyuk [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Besaratinia, Ahmad [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Dong-Hyun [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Chong-Soon [Department of Biochemistry, College of Natural Sciences, Yeungnam University, Gyongsan 712-749 (Korea, Republic of); Pfeifer, Gerd P. [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States)]. E-mail: gpfeifer@coh.org

2006-07-25

UVB (280-320 nm) and UVC (200-280 nm) irradiation generate predominantly cyclobutane pyrimidine dimers (CPDs) and (6-4) photoproducts in DNA. CPDs are thought to be responsible for most of the UV-induced mutations. Thymine-thymine CPDs, and probably also CPDs containing cytosine, are replicated in vivo in a largely accurate manner by a DNA polymerase {eta} (Pol {eta}) dependent process. Pol {eta} is a DNA damage-tolerant and error-prone DNA polymerase encoded by the POLH (XPV) gene in humans. Another member of the Y family of error-prone DNA polymerases is POLI encoding DNA polymerase iota (Pol {iota}). In order to clarify the specific role of Pol {iota} in UV mutagenesis, we have used an siRNA knockdown approach in combination with a supF shuttle vector which replicates in mammalian cells, similar as we have previously done for Pol {eta}. Synthetic RNA duplexes were used to efficiently inhibit Pol {iota} expression in 293T cells. The supF shuttle vector was irradiated with 254 nm UVC and replicated in 293T cells in presence of anti-Pol {iota} siRNA. Surprisingly, there was a consistent reduction of recovered plasmid from cells with Pol {iota} knockdown and this was independent of UV irradiation of the plasmid. The supF mutant frequency was unchanged in the siRNA knockdown cells relative to control cells confirming that Pol {iota} does not play an important role in UV mutagenesis. UV-induced supF mutants were sequenced from siRNA-treated cells and controls. Neither the type of mutations nor their distribution along the supF gene were significantly different between controls and siRNA knockdown cells and were predominantly C to T and CC to TT transitions at dipyrimidine sites. These results show that Pol {iota} has no significant role in UV lesion bypass and mutagenesis in vivo and provides some initial data suggesting that this polymerase may be involved in replication of extrachromosomal DNA.

Vector assembly of colloids on monolayer substrates

Science.gov (United States)

Jiang, Lingxiang; Yang, Shenyu; Tsang, Boyce; Tu, Mei; Granick, Steve

2017-06-01

The key to spontaneous and directed assembly is to encode the desired assembly information to building blocks in a programmable and efficient way. In computer graphics, raster graphics encodes images on a single-pixel level, conferring fine details at the expense of large file sizes, whereas vector graphics encrypts shape information into vectors that allow small file sizes and operational transformations. Here, we adapt this raster/vector concept to a 2D colloidal system and realize `vector assembly' by manipulating particles on a colloidal monolayer substrate with optical tweezers. In contrast to raster assembly that assigns optical tweezers to each particle, vector assembly requires a minimal number of optical tweezers that allow operations like chain elongation and shortening. This vector approach enables simple uniform particles to form a vast collection of colloidal arenes and colloidenes, the spontaneous dissociation of which is achieved with precision and stage-by-stage complexity by simply removing the optical tweezers.

A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

Science.gov (United States)

Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

2014-01-01

Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

Directory of Open Access Journals (Sweden)

Teruhiko Suzuki

Full Text Available Human artificial chromosomes (HACs are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

Science.gov (United States)

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

International Nuclear Information System (INIS)

Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

1987-01-01

A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

Safety and Immunogenicity of a Recombinant Adenovirus Serotype 35-Vectored HIV-1 Vaccine in Adenovirus Serotype 5 Seronegative and Seropositive Individuals.

Science.gov (United States)

Fuchs, Jonathan D; Bart, Pierre-Alexandre; Frahm, Nicole; Morgan, Cecilia; Gilbert, Peter B; Kochar, Nidhi; DeRosa, Stephen C; Tomaras, Georgia D; Wagner, Theresa M; Baden, Lindsey R; Koblin, Beryl A; Rouphael, Nadine G; Kalams, Spyros A; Keefer, Michael C; Goepfert, Paul A; Sobieszczyk, Magdalena E; Mayer, Kenneth H; Swann, Edith; Liao, Hua-Xin; Haynes, Barton F; Graham, Barney S; McElrath, M Juliana

2015-05-01

Recombinant adenovirus serotype 5 (rAd5)-vectored HIV-1 vaccines have not prevented HIV-1 infection or disease and pre-existing Ad5 neutralizing antibodies may limit the clinical utility of Ad5 vectors globally. Using a rare Ad serotype vector, such as Ad35, may circumvent these issues, but there are few data on the safety and immunogenicity of rAd35 directly compared to rAd5 following human vaccination. HVTN 077 randomized 192 healthy, HIV-uninfected participants into one of four HIV-1 vaccine/placebo groups: rAd35/rAd5, DNA/rAd5, and DNA/rAd35 in Ad5-seronegative persons; and DNA/rAd35 in Ad5-seropositive persons. All vaccines encoded the HIV-1 EnvA antigen. Antibody and T-cell responses were measured 4 weeks post boost immunization. All vaccines were generally well tolerated and similarly immunogenic. As compared to rAd5, rAd35 was equally potent in boosting HIV-1-specific humoral and cellular immunity and responses were not significantly attenuated in those with baseline Ad5 seropositivity. Like DNA, rAd35 efficiently primed rAd5 boosting. All vaccine regimens tested elicited cross-clade antibody responses, including Env V1/V2-specific IgG responses. Vaccine antigen delivery by rAd35 is well-tolerated and immunogenic as a prime to rAd5 immunization and as a boost to prior DNA immunization with the homologous insert. Further development of rAd35-vectored prime-boost vaccine regimens is warranted.

A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

Science.gov (United States)

Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry

2008-11-01

A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

A deep learning method for lincRNA detection using auto-encoder algorithm.

Science.gov (United States)

Yu, Ning; Yu, Zeng; Pan, Yi

2017-12-06

RNA sequencing technique (RNA-seq) enables scientists to develop novel data-driven methods for discovering more unidentified lincRNAs. Meantime, knowledge-based technologies are experiencing a potential revolution ignited by the new deep learning methods. By scanning the newly found data set from RNA-seq, scientists have found that: (1) the expression of lincRNAs appears to be regulated, that is, the relevance exists along the DNA sequences; (2) lincRNAs contain some conversed patterns/motifs tethered together by non-conserved regions. The two evidences give the reasoning for adopting knowledge-based deep learning methods in lincRNA detection. Similar to coding region transcription, non-coding regions are split at transcriptional sites. However, regulatory RNAs rather than message RNAs are generated. That is, the transcribed RNAs participate the biological process as regulatory units instead of generating proteins. Identifying these transcriptional regions from non-coding regions is the first step towards lincRNA recognition. The auto-encoder method achieves 100% and 92.4% prediction accuracy on transcription sites over the putative data sets. The experimental results also show the excellent performance of predictive deep neural network on the lincRNA data sets compared with support vector machine and traditional neural network. In addition, it is validated through the newly discovered lincRNA data set and one unreported transcription site is found by feeding the whole annotated sequences through the deep learning machine, which indicates that deep learning method has the extensive ability for lincRNA prediction. The transcriptional sequences of lincRNAs are collected from the annotated human DNA genome data. Subsequently, a two-layer deep neural network is developed for the lincRNA detection, which adopts the auto-encoder algorithm and utilizes different encoding schemes to obtain the best performance over intergenic DNA sequence data. Driven by those newly

A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

Science.gov (United States)

Wang, W.; Takezawa, D.; Poovaiah, B. W.

1996-01-01

A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

Frequency and persistency of DNA vaccine encoding GP25 by oral on common carp

Directory of Open Access Journals (Sweden)

Sri Nuryati

2015-05-01

Full Text Available ABSTRACT Koi herpesvirus (KHV is a major viral pathogen that infects common carp and koi. KHV disease outbreak is happened in almost all centre of common carp culture in Indonesia and caused mass mortality. Deoxyribonucleic acid (DNA vaccination method is one of ways to cope with KHV infection. Vaccines were commonly given by injection. The aim of this research was to get frequency and persistency of DNA vaccine encoding GP25 given by oral delivery method in common carp. This research would like to determine dose, frequency of vaccination, persistency of DNA vaccine and culture medium for the bacterial host. DNA vaccine persistency test was done by using polymerase chain reaction (PCR method with the specific primer for GP25 gene. The results showed that level of DNA vaccine that could be detected in feed was 7.56 ng (equal to 1.598×1010 copies. Efficient culture medium for Escherichia coli DH5α carrying DNA vaccine was LB triptone. Feeding fish with diet supplemented with 1 mL E. coli DH5α containing DNA vaccine for each fish and two times a week allowed persistence of DNA vaccine in kindney and spleen. Keywords: common carp, KHV, DNA vaccine, GP25, persistance  ABSTRAK Koi herpesvirus (KHV adalah virus patogen utama yang menginfeksi ikan mas dan ikan koi. Wabah penyakit KHV terjadi di hampir semua sentra budidaya ikan mas di Indonesia dan menyebabkan kematian massal ikan. Metode vaksinasi DNA merupakan salah satu cara yang dapat dilakukan untuk menanggulangi serangan KHV. Pemberian vaksin umumnya dilakukan dengan cara injeksi. Tujuan penelitian ini adalah untuk menguji frekuensi dan persistensi vaksin DNA GP25 antivirus KHV yang diberikan melalui oral pada ikan mas. Pada penelitian ini dilakukan uji dosis, frekuensi pemberian vaksin, persistensi vaksin DNA, dan media kultur bakteri inang. Persistensi vaksin DNA dianalisis menggunakan metode PCR dengan primer spesifik gen GP25. Hasil penelitian menunjukkan bahwa dosis vaksin DNA yang

A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F

DEFF Research Database (Denmark)

Helin, K; Lees, J A; Vidal, M

1992-01-01

The retinoblastoma protein (pRB) plays an important role in the control of cell proliferation, apparently by binding to and regulating cellular transcription factors such as E2F. Here we describe the characterization of a cDNA clone that encodes a protein with properties of E2F. This clone, RBP3...

SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

Directory of Open Access Journals (Sweden)

Benjamin C Hitz

Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.

Chitosan-based DNA delivery vector targeted to gonadotropin-releasing hormone (GnRH) receptor.

Science.gov (United States)

Boonthum, Chatwalee; Namdee, Katawut; Boonrungsiman, Suwimon; Chatdarong, Kaywalee; Saengkrit, Nattika; Sajomsang, Warayuth; Ponglowhapan, Suppawiwat; Yata, Teerapong

2017-02-10

The main purpose of this study was to investigate the application of modified chitosan as a potential vector for gene delivery to gonadotropin-releasing hormone receptor (GnRHR)-expressing cells. Such design of gene carrier could be useful in particular for gene therapy for cancers related to the reproductive system, gene disorders of sexual development, and contraception and fertility control. In this study, a decapeptide GnRH was successfully conjugated to chitosan (CS) as confirmed by proton nuclear magnetic resonance spectroscopy ( 1 H NMR) and Attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR). The synthesized GnRH-conjugated chitosan (GnRH-CS) was able to condense DNA to form positively charged nanoparticles and specifically deliver plasmid DNA to targeted cells in both two-dimensional (2D) and three-dimensional (3D) cell cultures systems. Importantly, GnRH-CS exhibited higher transfection activity compared to unmodified CS. In conclusion, GnRH-conjugated chitosan can be a promising carrier for targeted DNA delivery to GnRHR-expressing cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

Weaving Knotted Vector Fields with Tunable Helicity.

Science.gov (United States)

Kedia, Hridesh; Foster, David; Dennis, Mark R; Irvine, William T M

2016-12-30

We present a general construction of divergence-free knotted vector fields from complex scalar fields, whose closed field lines encode many kinds of knots and links, including torus knots, their cables, the figure-8 knot, and its generalizations. As finite-energy physical fields, they represent initial states for fields such as the magnetic field in a plasma, or the vorticity field in a fluid. We give a systematic procedure for calculating the vector potential, starting from complex scalar functions with knotted zero filaments, thus enabling an explicit computation of the helicity of these knotted fields. The construction can be used to generate isolated knotted flux tubes, filled by knots encoded in the lines of the vector field. Lastly, we give examples of manifestly knotted vector fields with vanishing helicity. Our results provide building blocks for analytical models and simulations alike.

Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

International Nuclear Information System (INIS)

Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

1988-01-01

A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

Science.gov (United States)

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Effect of thiol pendant conjugates on plasmid DNA binding, release, and stability of polymeric delivery vectors.

Science.gov (United States)

Bacalocostantis, Irene; Mane, Viraj P; Kang, Michael S; Goodley, Addison S; Muro, Silvia; Kofinas, Peter

2012-05-14

Polymers have attracted much attention as potential gene delivery vectors due to their chemical and structural versatility. However, several challenges associated with polymeric carriers, including low transfection efficiencies, insufficient cargo release, and high cytotoxicity levels have prevented clinical implementation. Strong electrostatic interactions between polymeric carriers and DNA cargo can prohibit complete cargo release within the cell. As a result, cargo DNA never reaches the cell's nucleus where gene expression takes place. In addition, highly charged cationic polymers have been correlated with high cytotoxicity levels, making them unsuitable carriers in vivo. Using poly(allylamine) (PAA) as a model, we investigated how pH-sensitive disulfide cross-linked polymer networks can improve the delivery potential of cationic polymer carriers. To accomplish this, we conjugated thiol-terminated pendant chains onto the primary amines of PAA using 2-iminothiolane, developing three new polymer vectors with 5, 13, or 20% thiol modification. Unmodified PAA and thiol-conjugated polymers were tested for their ability to bind and release plasmid DNA, their capacity to protect genetic cargo from enzymatic degradation, and their potential for endolysosomal escape. Our results demonstrate that polymer-plasmid complexes (polyplexes) formed by the 13% thiolated polymer demonstrate the greatest delivery potential. At high N/P ratios, all thiolated polymers (but not unmodified counterparts) were able to resist decomplexation in the presence of heparin, a negatively charged polysaccharide used to mimic in vivo polyplex-protein interactions. Further, all thiolated polymers exhibited higher buffering capacities than unmodified PAA and, therefore, have a greater potential for endolysosomal escape. However, 5 and 20% thiolated polymers exhibited poor DNA binding-release kinetics, making them unsuitable carriers for gene delivery. The 13% thiolated polymers, on the other hand

Correction of acid beta-galactosidase deficiency in GM1 gangliosidosis human fibroblasts by retrovirus vector-mediated gene transfer: higher efficiency of release and cross-correction by the murine enzyme.

Science.gov (United States)

Sena-Esteves, M; Camp, S M; Alroy, J; Breakefield, X O; Kaye, E M

2000-03-20

Mutations in the lysosomal acid beta-galactosidase (EC 3.2.1.23) underlie two different disorders: GM1 gangliosidosis, which involves the nervous system and visceral organs to varying extents, and Morquio's syndrome type B (Morquio B disease), which is a skeletal-connective tissue disease without any CNS symptoms. This article shows that transduction of human GM1 gangliosidosis fibroblasts with retrovirus vectors encoding the human acid beta-galactosidase cDNA leads to complete correction of the enzymatic deficiency. The newly synthesized enzyme is correctly processed and targeted to the lysosomes in transduced cells. Cross-correction experiments using retrovirus-modified cells as enzyme donors showed, however, that the human enzyme is transferred at low efficiencies. Experiments using a different retrovirus vector carrying the human cDNA confirmed this observation. Transduction of human GM1 fibroblasts and mouse NIH 3T3 cells with a retrovirus vector encoding the mouse beta-galactosidase cDNA resulted in high levels of enzymatic activity. Furthermore, the mouse enzyme was found to be transferred to human cells at high efficiency. Enzyme activity measurements in medium conditioned by genetically modified cells suggest that the human beta-galactosidase enzyme is less efficiently released to the extracellular space than its mouse counterpart. This study suggests that lysosomal enzymes, contrary to the generalized perception in the field of gene therapy, may differ significantly in their properties and provides insights for design of future gene therapy interventions in acid beta-galactosidase deficiency.

Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

Directory of Open Access Journals (Sweden)

Dongsheng Li

Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

Modified montmorillonite as vector for gene delivery.

Science.gov (United States)

Lin, Feng-Huei; Chen, Chia-Hao; Cheng, Winston T K; Kuo, Tzang-Fu

2006-06-01

Currently, gene delivery systems can be divided into two parts: viral or non-viral vectors. In general, viral vectors have a higher efficiency on gene delivery. However, they may sometimes provoke mutagenesis and carcinogenesis once re-activating in human body. Lots of non-viral vectors have been developed that tried to solve the problems happened on viral vectors. Unfortunately, most of non-viral vectors showed relatively lower transfection rate. The aim of this study is to develop a non-viral vector for gene delivery system. Montmorillonite (MMT) is one of clay minerals that consist of hydrated aluminum with Si-O tetrahedrons on the bottom of the layer and Al-O(OH)2 octahedrons on the top. The inter-layer space is about 12 A. The room is not enough to accommodate DNA for gene delivery. In the study, the cationic hexadecyltrimethylammonium (HDTMA) will be intercalated into the interlayer of MMT as a layer expander to expand the layer space for DNA accommodation. The optimal condition for the preparation of DNA-HDTMA-MMT is as follows: 1 mg of 1.5CEC HDTMA-MMT was prepared under pH value of 10.7 and with soaking time for 2 h. The DNA molecules can be protected from nuclease degradation, which can be proven by the electrophoresis analysis. DNA was successfully transfected into the nucleus of human dermal fibroblast and expressed enhanced green fluorescent protein (EGFP) gene with green fluorescence emission. The HDTMA-MMT has a great potential as a vector for gene delivery in the future.

Constructing of DNA vectors with controlled nanosize and single dispersion by block copolymer coating gold nanoparticles as template assembly

Energy Technology Data Exchange (ETDEWEB)

Li, Junbo, E-mail: Lijunbo@haust.edu.cn [Henan University of Science and Technology, School of Chemical Engineering and Pharmaceutics (China); Wu, Wenlan [Henan University of Science and Technology, School of Medicine (China); Gao, Jiayu; Liang, Ju; Zhou, Huiyun; Liang, Lijuan [Henan University of Science and Technology, School of Chemical Engineering and Pharmaceutics (China)

2017-03-15

Synthesized vectors with nanoscale size and stable colloid dispersion are highly desirable for improving gene delivery efficiency. Here, a core-shell template particle was constructed with polyethylene glycol-b-poly1-(3-aminopropyl)-3-(2-methacryloyloxy propylimidazolium bromine) (PEG-b-PAMPImB) coating gold nanoparticles (PEG-b-PAMPImB-@-Au NPs) for loading DNA and delivering in vitro. Data from transmission electron microscopy (TEM) and dynamic light scattering (DLS) suggest that these nanoplexes, by forming an electrostatic complex with DNA at the inner PAMPImB shell, offer steric protection for the outer PEG corona leading to single dispersion and small size. Notably, higher colloid stability and lower cytotoxicity were achieved with these nanoplexes when compared with PAMPImB monolayer-coated gold nanoparticles (Au NPs). Confocal laser scanning microscopy and intracellular trafficking TEM further indicate that the nanoplexes can translocate across the cell membrane and partly enter the nucleus for high efficient expression. Thus, template assembly represents a promising approach to control the size and colloid stability of gene vectors and ensure safety and efficiency of DNA delivery.

Constructing of DNA vectors with controlled nanosize and single dispersion by block copolymer coating gold nanoparticles as template assembly

Science.gov (United States)

Li, Junbo; Wu, Wenlan; Gao, Jiayu; Liang, Ju; Zhou, Huiyun; Liang, Lijuan

2017-03-01

Synthesized vectors with nanoscale size and stable colloid dispersion are highly desirable for improving gene delivery efficiency. Here, a core-shell template particle was constructed with polyethylene glycol- b-poly1-(3-aminopropyl)-3-(2-methacryloyloxy propylimidazolium bromine) (PEG- b-PAMPImB) coating gold nanoparticles (PEG- b-PAMPImB-@-Au NPs) for loading DNA and delivering in vitro. Data from transmission electron microscopy (TEM) and dynamic light scattering (DLS) suggest that these nanoplexes, by forming an electrostatic complex with DNA at the inner PAMPImB shell, offer steric protection for the outer PEG corona leading to single dispersion and small size. Notably, higher colloid stability and lower cytotoxicity were achieved with these nanoplexes when compared with PAMPImB monolayer-coated gold nanoparticles (Au NPs). Confocal laser scanning microscopy and intracellular trafficking TEM further indicate that the nanoplexes can translocate across the cell membrane and partly enter the nucleus for high efficient expression. Thus, template assembly represents a promising approach to control the size and colloid stability of gene vectors and ensure safety and efficiency of DNA delivery.

Image Coding Based on Address Vector Quantization.

Science.gov (United States)

Feng, Yushu

Image coding is finding increased application in teleconferencing, archiving, and remote sensing. This thesis investigates the potential of Vector Quantization (VQ), a relatively new source coding technique, for compression of monochromatic and color images. Extensions of the Vector Quantization technique to the Address Vector Quantization method have been investigated. In Vector Quantization, the image data to be encoded are first processed to yield a set of vectors. A codeword from the codebook which best matches the input image vector is then selected. Compression is achieved by replacing the image vector with the index of the code-word which produced the best match, the index is sent to the channel. Reconstruction of the image is done by using a table lookup technique, where the label is simply used as an address for a table containing the representative vectors. A code-book of representative vectors (codewords) is generated using an iterative clustering algorithm such as K-means, or the generalized Lloyd algorithm. A review of different Vector Quantization techniques are given in chapter 1. Chapter 2 gives an overview of codebook design methods including the Kohonen neural network to design codebook. During the encoding process, the correlation of the address is considered and Address Vector Quantization is developed for color image and monochrome image coding. Address VQ which includes static and dynamic processes is introduced in chapter 3. In order to overcome the problems in Hierarchical VQ, Multi-layer Address Vector Quantization is proposed in chapter 4. This approach gives the same performance as that of the normal VQ scheme but the bit rate is about 1/2 to 1/3 as that of the normal VQ method. In chapter 5, a Dynamic Finite State VQ based on a probability transition matrix to select the best subcodebook to encode the image is developed. In chapter 6, a new adaptive vector quantization scheme, suitable for color video coding, called "A Self -Organizing

Isolation and characterization of cDNA encoding the 80-kDa subunit protein of the human autoantigen Ku (p70/p80) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome

International Nuclear Information System (INIS)

Mimori, Tsuneyo; Ohosone, Yasuo; Hama, Nobuaki; Suwa, Akira; Akizuki, Masashi; Homma, Mitsuo; Griffith, A.J.; Hardin, J.A.

1990-01-01

Anti-Ku (p70/p80) autoantibodies in patients with scleroderma-polymyositis overlap syndrome recognize a 70-kDa/80-kDa protein heterodimer which binds to terminal regions of double-stranded DNA. In the present study, the authors isolated full-length cDNAs that encode the 80-kDa Ku subunit. Initial screening of a human spleen cDNA library with anti-Ku antibodies yielded a cDNA of 1.0 kilobase (kb) (termed K71) encoding a portion of the 80-kDa Ku polypeptide (identification based on immunological criteria). In RNA blots, this cDNA hybridized with two mRNAs of 3.4 and 2.6 kb. In vitro transcription and translation experiments produced an immunoprecipitable polypeptide which comigrated with the 80-kDa Ku subunit. The Ku80-6 cDNA proved to be 3304 nucleotides in length, with an additional poly(A) tail, closely approximating the size of the larger mRNA. It contains a single long open reading frame encoding 732 amino acids. The putative polypeptide has a high content of acidic amino acids and a region with periodic repeat of leucine in every seventh position which may form the leucine zipper structure. In genomic DNA blots, probes derived from the opposite ends of cDNA Ku80-6 hybridized with several nonoverlapping restriction fragments from human leukocyte DNA, indicating that the gene encoding the 80-kDa Ku polypeptide is divided into several exons by intervening sequences

The protein encoded by the proto-oncogene DEK changes the topology of chromatin and reduces the efficiency of DNA replication in a chromatin-specific manner

DEFF Research Database (Denmark)

Alexiadis, V; Waldmann, T; Andersen, Jens S.

2000-01-01

The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...

Gateway-compatible vectors for high-throughput protein expression in pro- and eukaryotic cell-free systems.

Science.gov (United States)

Gagoski, Dejan; Mureev, Sergey; Giles, Nichole; Johnston, Wayne; Dahmer-Heath, Mareike; Škalamera, Dubravka; Gonda, Thomas J; Alexandrov, Kirill

2015-02-10

Although numerous techniques for protein expression and production are available the pace of genome sequencing outstrips our ability to analyze the encoded proteins. To address this bottleneck, we have established a system for parallelized cloning, DNA production and cell-free expression of large numbers of proteins. This system is based on a suite of pCellFree Gateway destination vectors that utilize a Species Independent Translation Initiation Sequence (SITS) that mediates recombinant protein expression in any in vitro translation system. These vectors introduce C or N terminal EGFP and mCherry fluorescent and affinity tags, enabling direct analysis and purification of the expressed proteins. To maximize throughput and minimize the cost of protein production we combined Gateway cloning with Rolling Circle DNA Amplification. We demonstrate that as little as 0.1 ng of plasmid DNA is sufficient for template amplification and production of recombinant human protein in Leishmania tarentolae and Escherichia coli cell-free expression systems. Our experiments indicate that this approach can be applied to large gene libraries as it can be reliably performed in multi-well plates. The resulting protein expression pipeline provides a valuable new tool for applications of the post genomic era. Copyright © 2014 Elsevier B.V. All rights reserved.

Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

Directory of Open Access Journals (Sweden)

S. S. Hasson

2010-01-01

Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

An adeno-associated viral vector transduces the rat hypothalamus and amygdala more efficient than a lentiviral vector

Directory of Open Access Journals (Sweden)

Vreugdenhil Erno

2010-07-01

Full Text Available Abstract Background This study compared the transduction efficiencies of an adeno-associated viral (AAV vector, which was pseudotyped with an AAV1 capsid and encoded the green fluorescent protein (GFP, with a lentiviral (LV vector, which was pseudotyped with a VSV-G envelop and encoded the discosoma red fluorescent protein (dsRed, to investigate which viral vector transduced the lateral hypothalamus or the amygdala more efficiently. The LV-dsRed and AAV1-GFP vector were mixed and injected into the lateral hypothalamus or into the amygdala of adult rats. The titers that were injected were 1 × 108 or 1 × 109 genomic copies of AAV1-GFP and 1 × 105 transducing units of LV-dsRed. Results Immunostaining for GFP and dsRed showed that AAV1-GFP transduced significantly more cells than LV-dsRed in both the lateral hypothalamus and the amygdala. In addition, the number of LV particles that were injected can not easily be increased, while the number of AAV1 particles can be increased easily with a factor 100 to 1000. Both viral vectors appear to predominantly transduce neurons. Conclusions This study showed that AAV1 vectors are better tools to overexpress or knockdown genes in the lateral hypothalamus and amygdala of adult rats, since more cells can be transduced with AAV1 than with LV vectors and the titer of AAV1 vectors can easily be increased to transduce the area of interest.

Molecular cloning and functional analysis of the gene encoding ...

African Journals Online (AJOL)

Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

Energy Technology Data Exchange (ETDEWEB)

Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

1988-08-11

The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

Transcriptional Response of Human Neurospheres to Helper-Dependent CAV-2 Vectors Involves the Modulation of DNA Damage Response, Microtubule and Centromere Gene Groups.

Directory of Open Access Journals (Sweden)

Stefania Piersanti

Full Text Available Brain gene transfer using viral vectors will likely become a therapeutic option for several disorders. Helper-dependent (HD canine adenovirus type 2 vectors (CAV-2 are well suited for this goal. These vectors are poorly immunogenic, efficiently transduce neurons, are retrogradely transported to afferent structures in the brain and lead to long-term transgene expression. CAV-2 vectors are being exploited to unravel behavior, cognition, neural networks, axonal transport and therapy for orphan diseases. With the goal of better understanding and characterizing HD-CAV-2 for brain therapy, we analyzed the transcriptomic modulation induced by HD-CAV-2 in human differentiated neurospheres derived from midbrain progenitors. This 3D model system mimics several aspects of the dynamic nature of human brain. We found that differentiated neurospheres are readily transduced by HD-CAV-2 and that transduction generates two main transcriptional responses: a DNA damage response and alteration of centromeric and microtubule probes. Future investigations on the biochemistry of processes highlighted by probe modulations will help defining the implication of HD-CAV-2 and CAR receptor binding in enchaining these functional pathways. We suggest here that the modulation of DNA damage genes is related to viral DNA, while the alteration of centromeric and microtubule probes is possibly enchained by the interaction of the HD-CAV-2 fibre with CAR.

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

Science.gov (United States)

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

Science.gov (United States)

Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

2010-01-01

Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

Cloning vector

Science.gov (United States)

Guilfoyle, Richard A.; Smith, Lloyd M.

1994-01-01

A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site.

Cloning vector

Science.gov (United States)

Guilfoyle, R.A.; Smith, L.M.

1994-12-27

A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site. 2 figures.

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

NARCIS (Netherlands)

Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

2002-01-01

Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

Site-specific integration of CAR gene into Jurkat T cells with a linear close-ended AAV-based DNA vector for CAR-T engineering.

Science.gov (United States)

Zhang, Yun; Liu, Xiaomei; Zhang, Jinju; Zhang, Chun

2016-09-01

To develop a site-specific integration strategy for CAR-T engineering by using a non-viral vector dependent on adeno-associated viral (AAV) genome, which tends to be integrated into AAVS1 site with the help of its Rep proteins. AAV-dependent vectors were produced in Sf9 cells. Structural analyses revealed the vector as covalently close-ended, linear duplex molecules, which was termed "CELiD" DNA. A plasmid CMV-Rep was constructed to express the integrases Rep78 and Rep68. Jurkat cells were co-electroporated with "CELiD" DNA and plasmid CMV-Rep in order to specifically integrate CAR gene into AAVS1 site. We examined 71 stably transfected Jurkat clones by nested PCR, sequencing and southern blotting, of which 30 clones bore CAR gene within AAVS1 site. The site-specific integration efficiency was nearly 42.2 %. The AAV-dependent vector preferentially integrated CAR into AAVS1 site, which could be further used in human T cell modification and enhance the security of CAR-T therapy.

A novel two T-DNA binary vector allows efficient generation of marker-free transgenic plants in three elite cultivars of rice (Oryza sativa L.).

Science.gov (United States)

Breitler, Jean-Christophe; Meynard, Donaldo; Van Boxtel, Jos; Royer, Monique; Bonnot, François; Cambillau, Laurence; Guiderdoni, Emmanuel

2004-06-01

A pilot binary vector was constructed to assess the potential of the 2 T-DNA system for generating selectable marker-free progeny plants in three elite rice cultivars (ZhongZuo321, Ariete and Khao Dawk Mali 105) known to exhibit contrasting amenabilities to transformation. The first T-DNA of the vector, delimited by Agrobacterium tumefaciens borders, contains the hygromycin phosphotransferase (hpt) selectable gene and the green fluorescent protein (gfp) reporter gene while the second T-DNA, delimited by Agrobacterium rhizogenes borders, bears the phosphinothricin acetyl transferase (bar) gene, featuring the gene of interest. 82-90% of the hygromycin-resistant primary transformants exhibited tolerance to ammonium glufosinate mediated by the bar gene suggesting very high co-transformation frequency in the three cultivars. All of the regenerated plants were analyzed by Southern blot which confirmed co-integration of the T-DNAs at frequencies consistent with those of co-expression and allowed determination of copy number for each gene as well as detection of two different vector backbone fragments extending between the two T-DNAs. Hygromycin susceptible, ammonium glufosinate tolerant phenotypes represented 14.4, 17.4 and 14.3% of the plants in T1 progenies of ZZ321, Ariete and KDML105 primary transformants, respectively. We developed a statistical model for deducing from the observed copy number of each T-DNA in T0 plants and phenotypic segregations in T1 progenies the most likely constitution and linkage of the T-DNA integration locus. Statistical analysis identified in 40 out of 42 lines a most likely linkage configuration theoretically allowing genetic separation of the two T-DNA types and out segregation of the T-DNA bearing the bar gene. Overall, though improvements of the technology would be beneficial, the 2 T-DNA system appeared to be a useful approach to generate selectable marker-free rice plants with a consistent frequency among cultivars.

Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

Science.gov (United States)

Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

2001-10-31

Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

Science.gov (United States)

Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

2016-06-01

Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

Quantitative PCR is a Valuable Tool to Monitor the Performance of DNA-Encoded Chemical Library Selections.

Science.gov (United States)

Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario

2017-05-04

Phage-display libraries and DNA-encoded chemical libraries (DECLs) represent useful tools for the isolation of specific binding molecules from large combinatorial sets of compounds. With both methods, specific binders are recovered at the end of affinity capture procedures by using target proteins of interest immobilized on a solid support. However, although the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DECL selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency by using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provided rapid information about the performance of selections, thus facilitating the optimization of experimental conditions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp.) Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B.

Science.gov (United States)

Chénard, Caroline; Wirth, Jennifer F; Suttle, Curtis A

2016-06-14

Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. Filamentous cyanobacteria belonging to the genus Nostoc are widespread and ecologically important in freshwater, yet little is known about the genomic content of their viruses. Here we report the first genomic analysis of cyanophages infecting

Systemic Gene Therapy for Tuberous Sclerosis

Science.gov (United States)

2017-07-01

version of tuberin, such that the cDNA encoding it fits into an AAV vector. Initial experiments show that injection of this AAV-cTuberin vector into...tuberin cDNA exceeds the packaging capacity of AAV. Therefore, we engineered a condensed form of the tuberin cDNA (cTuberin) encoding discreet...sequence and other regulatory elements), the cDNA for hamartin (1.5 kb) can easily be accommodated, while that for tuberin (5.4 kb) cannot. In order

ENCODE: A Sourcebook of Epigenomes and Chromatin Language

Directory of Open Access Journals (Sweden)

Maryam Yavartanoo

2013-03-01

Full Text Available Until recently, since the Human Genome Project, the general view has been that the majority of the human genome is composed of junk DNA and has little or no selective advantage to the organism. Now we know that this conclusion is an oversimplification. In April 2003, the National Human Genome Research Institute (NHGRI launched an international research consortium called Encyclopedia of DNA Elements (ENCODE to uncover non-coding functional elements in the human genome. The result of this project has identified a set of new DNA regulatory elements, based on novel relationships among chromatin accessibility, histone modifications, nucleosome positioning, DNA methylation, transcription, and the occupancy of sequence-specific factors. The project gives us new insights into the organization and regulation of the human genome and epigenome. Here, we sought to summarize particular aspects of the ENCODE project and highlight the features and data that have recently been released. At the end of this review, we have summarized a case study we conducted using the ENCODE epigenome data.

Assessment of a DNA vaccine encoding an anchored-glycosylphosphatidylinositol tegumental antigen complexed to protamine sulphate on immunoprotection against murine schistosomiasis

Directory of Open Access Journals (Sweden)

Eduardo JM Nascimento

2007-02-01

Full Text Available Protamine sulphate/DNA complexes have been shown to protect DNA from DNase digestion in a lipid system for gene transfer. A DNA-based vaccine complexed to protamine sulphate was used to induce an immune response against Schistosoma mansoni anchored-glycosylphosphatidylinositol tegumental antigen in BALB/c mice. The protection elicited ranged from 33 to 44%. The spectrum of the elicited immune response induced by the vaccine formulation without protamine was characterized by a high level of IgG (IgG1> IgG2a. Protamine sulphate added to the DNA vaccine formulation retained the green fluorescent protein encoding-plasmid longer in muscle and spleen. The experiments in vivo showed that under protamine sulphate effect, the scope of protection remained unchanged, but a modulation in antibody production (IgG1= IgG2a was observed.

Prioritizing multiple therapeutic targets in parallel using automated DNA-encoded library screening

Science.gov (United States)

Machutta, Carl A.; Kollmann, Christopher S.; Lind, Kenneth E.; Bai, Xiaopeng; Chan, Pan F.; Huang, Jianzhong; Ballell, Lluis; Belyanskaya, Svetlana; Besra, Gurdyal S.; Barros-Aguirre, David; Bates, Robert H.; Centrella, Paolo A.; Chang, Sandy S.; Chai, Jing; Choudhry, Anthony E.; Coffin, Aaron; Davie, Christopher P.; Deng, Hongfeng; Deng, Jianghe; Ding, Yun; Dodson, Jason W.; Fosbenner, David T.; Gao, Enoch N.; Graham, Taylor L.; Graybill, Todd L.; Ingraham, Karen; Johnson, Walter P.; King, Bryan W.; Kwiatkowski, Christopher R.; Lelièvre, Joël; Li, Yue; Liu, Xiaorong; Lu, Quinn; Lehr, Ruth; Mendoza-Losana, Alfonso; Martin, John; McCloskey, Lynn; McCormick, Patti; O'Keefe, Heather P.; O'Keeffe, Thomas; Pao, Christina; Phelps, Christopher B.; Qi, Hongwei; Rafferty, Keith; Scavello, Genaro S.; Steiginga, Matt S.; Sundersingh, Flora S.; Sweitzer, Sharon M.; Szewczuk, Lawrence M.; Taylor, Amy; Toh, May Fern; Wang, Juan; Wang, Minghui; Wilkins, Devan J.; Xia, Bing; Yao, Gang; Zhang, Jean; Zhou, Jingye; Donahue, Christine P.; Messer, Jeffrey A.; Holmes, David; Arico-Muendel, Christopher C.; Pope, Andrew J.; Gross, Jeffrey W.; Evindar, Ghotas

2017-07-01

The identification and prioritization of chemically tractable therapeutic targets is a significant challenge in the discovery of new medicines. We have developed a novel method that rapidly screens multiple proteins in parallel using DNA-encoded library technology (ELT). Initial efforts were focused on the efficient discovery of antibacterial leads against 119 targets from Acinetobacter baumannii and Staphylococcus aureus. The success of this effort led to the hypothesis that the relative number of ELT binders alone could be used to assess the ligandability of large sets of proteins. This concept was further explored by screening 42 targets from Mycobacterium tuberculosis. Active chemical series for six targets from our initial effort as well as three chemotypes for DHFR from M. tuberculosis are reported. The findings demonstrate that parallel ELT selections can be used to assess ligandability and highlight opportunities for successful lead and tool discovery.

Virus neutralizing antibody response in mice and dogs with a bicistronic DNA vaccine encoding rabies virus glycoprotein and canine parvovirus VP2.

Science.gov (United States)

Patial, Sonika; Chaturvedi, V K; Rai, A; Saini, M; Chandra, Rajesh; Saini, Y; Gupta, Praveen K

2007-05-16

A bicistronic DNA vaccine against rabies and parvovirus infection of dogs was developed by subcloning rabies glycoprotein and canine parvovirus (CPV) VP2 genes into a bicistronic vector. After characterizing the expression of both the proteins in vitro, the bicistronic DNA vaccine was injected in mice and induced immune response was compared with monocistronic DNA vaccines. There was no significant difference in ELISA and virus neutralizing (VN) antibody responses against rabies and CPV in mice immunized with either bicistronic or monocistronic DNA vaccine. Further, there was significantly similar protection in mice immunized with either bicistronic or monocistronic rabies DNA vaccine on rabies virus challenge. Similarly, dogs immunized with monocistronic and bicistronic DNA vaccines developed comparable VN antibodies against rabies and CPV. This study indicated that bicistronic DNA vaccine can be used in dogs to induce virus neutralizing immune responses against both rabies and CPV.

Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

Science.gov (United States)

Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

2013-11-15

The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

Engineering of magnetic DNA nanoparticles for tumor-targeted therapy

International Nuclear Information System (INIS)

Hosseinkhani, Hossein; Chen Yiru; He Wenjie; Hong Poda; Yu, Dah-Shyong; Domb, Abraham J.

2013-01-01

This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe 2+ solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.

Engineering of magnetic DNA nanoparticles for tumor-targeted therapy

Energy Technology Data Exchange (ETDEWEB)

Hosseinkhani, Hossein, E-mail: hosseinkhani@yahoo.com [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Chen Yiru [National Yang-Ming University, Department of Biomedical Engineering (China); He Wenjie; Hong Poda [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Yu, Dah-Shyong [Nanomedicine Research Center, National Defense Medical Center (China); Domb, Abraham J. [Institute of Drug Research, The Center for Nanoscience and Nanotechnology, School of Pharmacy, Faculty of Medicine, Hebrew University of Jerusalem (Israel)

2013-01-15

This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe{sup 2+} solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.

[Escherichia coli heat-labile enterotoxin B subunit enhances the immune response against canine parvovirus VP2 in mice immunized by VP2 DNA vaccine].

Science.gov (United States)

Han, Dongmei; Zhong, Fei; Li, Xiujin; Wang, Wei; Wang, Xingxing; Pan, Sumin

2011-01-01

To investigate the effect of Escherichia coli heat-labile enterotoxin (LT) B subunit (LTB) gene on canine parvovirus (CPV) VP2 gene vaccine. The LTB gene was amplified by PCR from genomic DNA of E. coli 44815 strain. The VP2-70 fragment (210 bp) encoding major epitope of VP2 (70 amino acids) was amplified by PCR from a plasmid encoding VP2 gene. VP2-70 and LTB genes were inserted into the eukaryotic vector to construct VP2-70 gene,LTB gene and VP2-70-LTB fused gene vectors. The mice were immunized with VP2-70 vector, VP2-70-LTB fused vector, or VP2-70 vector plus LTB vector, respectively. The antibody titers at the different time were measured by using ELISA method. The spleen lymphocyte proliferation activity was analyzed by 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. The sequence of VP2-70 and LTB genes was identified. The recombinant VP2-70 and LTB proteins could be expressed in HEK293T cells in a secretory manner. The mice immunized with VP2-70 vector, VP2-70-LTB vector or VP2-70 vector plus LTB vector could generate the specific antibody against VP2 protein. The antibody titer immunized with VP2-70-LTB vector reached 1:5120 at 35 d post immunization, significantly higher than that of other two groups (P vaccine in mice.

scsB, a cDNA encoding the hydrogenosomal beta subunit of succinyl-CoA synthetase from the anaerobic fungus Neocallimastix frontalis

NARCIS (Netherlands)

Brondijk, THC; Durand, R; vanderGiezen, M; Gottschal, JC; Prins, RA; Fevre, M

1996-01-01

A clone containing a Neocallimastix frontalis cDNA assumed to encode the beta subunit of succinyl-CoA synthetase (SCSB) was identified by sequence homology with prokaryotic and eukaryotic counterparts. An open reading frame of 1311 bp was found. The deduced 437 amino acid sequence showed a high

Safety and immunogenicity of a novel therapeutic DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

Science.gov (United States)

Juan, Long; Xiao, Zhao; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

2015-01-01

Current clinically available treatments for rheumatoid arthritis (RA) fail to cure the disease or unsatisfactorily halt disease progression. To overcome these limitations, the development of therapeutic DNA vaccines and boosters may offer new promising strategies. Because type II collagen (CII) as a critical autoantigen in RA and native chicken type II collagen (nCCII) has been used to effectively treat RA, we previously developed a novel therapeutic DNA vaccine encoding CCII (pcDNA-CCOL2A1) with efficacy comparable to that of the current "gold standard", methotrexate(MTX). Here, we systemically evaluated the safety and immunogenicity of the pcDNA-CCOL2A1 vaccine in normal Wistar rats. Group 1 received only a single intramuscular injection into the hind leg with pcDNA-CCOL2A1 at the maximum dosage of 3 mg/kg on day 0; Group 2 was injected with normal saline (NS) as a negative control. All rats were monitored daily for any systemic adverse events, reactions at the injection site, and changes in body weights. Plasma and tissues from all experimental rats were collected on day 14 for routine examinations of hematology and biochemistry parameters, anti-CII IgG antibody reactivity, and histopathology. Our results indicated clearly that at the maximum dosage of 3 mg/kg, the pcDNA-CCOL2A1 vaccine was safe and well-tolerated. No abnormal clinical signs or deaths occurred in the pcDNA-CCOL2A1 group compared with the NS group. Furthermore, no major alterations were observed in hematology, biochemistry, and histopathology, even at the maximum dose. In particularly, no anti-CII IgG antibodies were detected in vaccinated normal rats at 14 d after vaccination; this was relevant because we previously demonstrated that the pcDNA-CCOL2A1 vaccine, when administered at the therapeutic dosage of 300 μg/kg alone, did not induce anti-CII IgG antibody production and significantly reduced levels of anti-CII IgG antibodies in the plasma of rats with established collagen-induced arthritis

The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

OpenAIRE

Leem, S H; Ropp, P A; Sugino, A

1994-01-01

We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in ...

Cationic Polybutyl Cyanoacrylate Nanoparticles for DNA Delivery

Directory of Open Access Journals (Sweden)

Jinghua Duan

2009-01-01

Full Text Available To enhance the intracellular delivery potential of plasmid DNA using nonviral vectors, we used polybutyl cyanoacrylate (PBCA and chitosan to prepare PBCA nanoparticles (NPs by emulsion polymerization and prepared NP/DNA complexes through the complex coacervation of nanoparticles with the DNA. The object of our work is to evaluate the characterization and transfection efficiency of PBCA-NPs. The NPs have a zeta potential of 25.53 mV at pH 7.4 and size about 200 nm. Electrophoretic analysis suggested that the NPs with positive charges could protect the DNA from nuclease degradation and cell viability assay showed that the NPs exhibit a low cytotoxicity to human hepatocellular carcinoma (HepG2 cells. Qualitative and quantitative analysis of transfection in HepG2 cells by the nanoparticles carrying plasmid DNA encoding for enhanced green fluorescent protein (EGFP-N1 was done by digital fluorescence imaging microscopy system and fluorescence-activated cell sorting (FACS. Qualitative results showed highly efficient expression of GFP that remained stable for up to 96 hours. Quantitative results from FACS showed that PBCA-NPs were significantly more effective in transfecting HepG2 cells after 72 hours postincubation. The results of this study suggested that PBCA-NPs have favorable properties for nonviral delivery.

MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

DEFF Research Database (Denmark)

Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...

Induction of cytotoxic T-cell responses by gene gun DNA vaccination with minigenes encoding influenza A virus HA and NP CTL-epitopes

DEFF Research Database (Denmark)

Fomsgaard, A; Nielsen, H V; Kirkby, N

1999-01-01

degree of controllability. We have examined the induction of murine CTL's by this approach using DNA plasmid minigene vaccines encoding known mouse K(k) minimal CTL epitopes (8 amino acids) from the influenza A virus hemagglutinin and nucleoprotein. We here report that such an approach is feasible...

Efficacy of DNA vaccine encoding koi herpesvirus glycoprotein GP-25in common carp juvenile by immersion

Directory of Open Access Journals (Sweden)

Soko Nuswantoro

2013-11-01

Full Text Available Koi herpesvirus (KHV is a herpesvirus that particularly infects and causes mass mortality to koi and common carp. Therefore, the protection of common carp from KHV infection is urgently needed. In this study, we developed an application of DNA vaccine encoding KHV glycoprotein-25 by immersion method to increase survival of common carp against KHV infection. A total of 400 common carp juveniles at 30-day-old were immersed in 1-L water containing 1.3×108CFU/mL of the killed Escherichia coli cells carrying DNA vaccine. Three frequencies and three duration of fish immersion were tested, namely: 1×30 minutes, 1×60 minutes, 1× 90 minutes, 2×90 minutes and 3×90 minutes by interval of 24 hours. Reversetranscription polymerase chain reaction analysis showed that DNA vaccine was successfully expressed in the vaccinated fish. Fish at twenty eight days post vaccination were challenged by injecting 10-4 mL of KHV per fish. The result showed that vaccination by 1×30 minutes immersion allowed 61% of fish survived, and this was significantly higher (p<0.05 compared to control (without vaccination, but it was similar among vaccination treatments (p>0.05. The relative percent survival of vaccinated fish were also similar among treatments (p>0.05. DNA vaccination has increased fish survival about two fold higher compared to unvaccinated fish control (26.67%. Thus, DNA vaccination was effectively delivered by immersion for 1×30 minutes, and this technique can be useful to level up the resistance of common carp juveniles against KHV infection. Keywords: DNA vaccine, KHV, glycoprotein, immersion, common carp

Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.

Science.gov (United States)

Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E

2009-11-20

In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply

Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries

Directory of Open Access Journals (Sweden)

Gray Elizabeth C

2009-11-01

Full Text Available Abstract Background In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. Results It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. Conclusion These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The

Enhanced anti-tumor effect of a gene gun-delivered DNA vaccine encoding the human papillomavirus type 16 oncoproteins genetically fused to the herpes simplex virus glycoprotein D

Directory of Open Access Journals (Sweden)

M.O. Diniz

2011-05-01

Full Text Available Anti-cancer DNA vaccines have attracted growing interest as a simple and non-invasive method for both the treatment and prevention of tumors induced by human papillomaviruses. Nonetheless, the low immunogenicity of parenterally administered vaccines, particularly regarding the activation of cytotoxic CD8+ T cell responses, suggests that further improvements in both vaccine composition and administration routes are still required. In the present study, we report the immune responses and anti-tumor effects of a DNA vaccine (pgD-E7E6E5 expressing three proteins (E7, E6, and E5 of the human papillomavirus type 16 genetically fused to the glycoprotein D of the human herpes simplex virus type 1, which was administered to mice by the intradermal (id route using a gene gun. A single id dose of pgD-E7E6E5 (2 µg/dose induced a strong activation of E7-specific interferon-γ (INF-γ-producing CD8+ T cells and full prophylactic anti-tumor effects in the vaccinated mice. Three vaccine doses inhibited tumor growth in 70% of the mice with established tumors. In addition, a single vaccine dose consisting of the co-administration of pgD-E7E6E5 and the vector encoding interleukin-12 or granulocyte-macrophage colony-stimulating factor further enhanced the therapeutic anti-tumor effects and conferred protection to 60 and 50% of the vaccinated mice, respectively. In conclusion, id administration of pgD-E7E6E5 significantly enhanced the immunogenicity and anti-tumor effects of the DNA vaccine, representing a promising administration route for future clinical trials.

Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

OpenAIRE

Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

1989-01-01

A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

Polypeptides having catalase activity and polynucleotides encoding same

Energy Technology Data Exchange (ETDEWEB)

Liu, Ye; Duan, Junxin; Zhang, Yu; Tang, Lan

2017-05-02

Provided are isolated polypeptides having catalase activity and polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

Science.gov (United States)

Mei, Yu; Kernodle, Bliss M.; Hill, John H.

2016-01-01

Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311

Polynucleotides encoding polypeptides having beta-glucosidase activity

Science.gov (United States)

Harris, Paul; Golightly, Elizabeth

2010-03-02

The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

Non-Replicating Adenovirus-Vectored Anthrax Vaccine

International Nuclear Information System (INIS)

Van Kampen, K. R.; Zhang, J.; Jex, E.; Tang, D. C.

2007-01-01

As bioterrorism is emerging as a national threat, it is urgent to develop a new generation of anthrax vaccines that can be rapidly produced and mass administered in an emergency setting. We have demonstrated that protective immunity against anthrax spores could be elicited in mice by intranasal administration of a non-replicating human adenovirus serotype 5 (Ad5)-derived vector encoding Bacillus anthracis protective antigen (PA) in a single-dose regimen. The potency of an Ad5 vector encoding PA was remarkably enhanced by codon optimization of the PA gene to match the tRNA pool found in human cells. This nasal vaccine can be mass-administered by non-medical personnel during a bioterrorist attack. In addition, replication-competent adenovirus (RCA)-free Ad5-vectored anthrax vaccines can be mass produced in PER.C6 cells in serum-free wave bioreactors and purified by column chromatography to meet a surge in demand. The non-replicating nature of this new generation of anthrax vaccine ensures an excellent safety profile for vaccines and the environment.(author)

Stochastic algorithm for channel optimized vector quantization: application to robust narrow-band speech coding

International Nuclear Information System (INIS)

Bouzid, M.; Benkherouf, H.; Benzadi, K.

2011-01-01

In this paper, we propose a stochastic joint source-channel scheme developed for efficient and robust encoding of spectral speech LSF parameters. The encoding system, named LSF-SSCOVQ-RC, is an LSF encoding scheme based on a reduced complexity stochastic split vector quantizer optimized for noisy channel. For transmissions over noisy channel, we will show first that our LSF-SSCOVQ-RC encoder outperforms the conventional LSF encoder designed by the split vector quantizer. After that, we applied the LSF-SSCOVQ-RC encoder (with weighted distance) for the robust encoding of LSF parameters of the 2.4 Kbits/s MELP speech coder operating over a noisy/noiseless channel. The simulation results will show that the proposed LSF encoder, incorporated in the MELP, ensure better performances than the original MELP MSVQ of 25 bits/frame; especially when the transmission channel is highly disturbed. Indeed, we will show that the LSF-SSCOVQ-RC yields significant improvement to the LSFs encoding performances by ensuring reliable transmissions over noisy channel.

The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

Science.gov (United States)

Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

2011-06-10

The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

Directory of Open Access Journals (Sweden)

Jianrao HU, Mingfu CAO, Jiong Chen

2009-10-01

Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

Construction and expression of eukaryotic expression vectors of full-length, amino-terminus and carboxyl-terminus Raf gene

Directory of Open Access Journals (Sweden)

Zhuomin WANG

2008-06-01

Full Text Available Background and objective Raf is a key molecule in the Ras-Raf-MEK-ERK signal transduction pathway and is highly activated in different human carcinomas. However, its biological functions and regulation mechanisms are still unclear. The aims of this study were to construct eukaryotic expression vectors with Raf full encoding region, truncated amino-terminus and carboxyl-terminus, respectively. Methods Eukaryotic expression vectors of pCMV-Tag2b-Raf-1, pCMV-Tag2b-N-Raf and pCMV-Tag2b-C-Raf were constructed by gene recombination technique and confirmed by restriction enzyme analysis and DNA sequencing. Furthermore, the expression of these fusion proteins was detected by western blot in transient transfected 293T cells. Results The sequences and open reading frames of these three vectors were completely consistent with experimental design. All target proteins can be detected in 293T cells. Conclusion Eukaryotic expression vectors of pCMV-Tag2b-Raf-1, pCMV-Tag2b-N-Raf and pCMV-Tag2b-C-Raf were successfully constructed and can be expressed in 293T cells.

repDNA: a Python package to generate various modes of feature vectors for DNA sequences by incorporating user-defined physicochemical properties and sequence-order effects.

Science.gov (United States)

Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen

2015-04-15

In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repDNA/. bliu@insun.hit.edu.cn or kcchou@gordonlifescience.org Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Attenuated Shigella as a DNA Delivery Vehicle for DNA-Mediated Immunization

Science.gov (United States)

Sizemore, Donata R.; Branstrom, Arthur A.; Sadoff, Jerald C.

1995-10-01

Direct inoculation of DNA, in the form of purified bacterial plasmids that are unable to replicate in mammalian cells but are able to direct cell synthesis of foreign proteins, is being explored as an approach to vaccine development. Here, a highly attenuated Shigella vector invaded mammalian cells and delivered such plasmids into the cytoplasm of cells, and subsequent production of functional foreign protein was measured. Because this Shigella vector was designed to deliver DNA to colonic mucosa, the method is a potential basis for oral and other mucosal DNA immunization and gene therapy strategies.

Construction of expression vectors carrying mouse peroxisomal ...

African Journals Online (AJOL)

The aim of this study was to construct expression vectors carrying mouse peroxisomal protein gene (PEP-cDNA) in prokaryotic and mammalian expression vectors in ... pGEX6p2-PEP and pUcD3-FLAG-PEP constructed vectors were transformed into the one shot TOP10 and JM105 bacterial competent cells, respectively.

DNA probes

International Nuclear Information System (INIS)

Castelino, J.

1992-01-01

The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

Diverse replication-associated protein encoding circular DNA viruses in guano samples of Central-Eastern European bats.

Science.gov (United States)

Kemenesi, Gábor; Kurucz, Kornélia; Zana, Brigitta; Földes, Fanni; Urbán, Péter; Vlaschenko, Anton; Kravchenko, Kseniia; Budinski, Ivana; Szodoray-Parádi, Farkas; Bücs, Szilárd; Jére, Csaba; Csősz, István; Szodoray-Parádi, Abigél; Estók, Péter; Görföl, Tamás; Boldogh, Sándor; Jakab, Ferenc

2018-03-01

Circular replication-associated protein encoding single-stranded DNA (CRESS DNA) viruses are increasingly recognized worldwide in a variety of samples. Representative members include well-described veterinary pathogens with worldwide distribution, such as porcine circoviruses or beak and feather disease virus. In addition, numerous novel viruses belonging to the family Circoviridae with unverified pathogenic roles have been discovered in different human samples. Viruses of the family Genomoviridae have also been described as being highly abundant in different faecal and environmental samples, with case reports showing them to be suspected pathogens in human infections. In order to investigate the genetic diversity of these viruses in European bat populations, we tested guano samples from Georgia, Hungary, Romania, Serbia and Ukraine. This resulted in the detection of six novel members of the family Circoviridae and two novel members of the family Genomoviridae. Interestingly, a gemini-like virus, namely niminivirus, which was originally found in raw sewage samples in Nigeria, was also detected in our samples. We analyzed the nucleotide composition of members of the family Circoviridae to determine the possible host origins of these viruses. This study provides the first dataset on CRESS DNA viruses of European bats, and members of several novel viral species were discovered.

Cloning and molecular characterization of the salt-regulated jojoba ScRab cDNA encoding a small GTP-binding protein.

Science.gov (United States)

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2002-10-01

Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.

Comparative Analysis of Repetitive DNA between the Main Vectors of Chagas Disease: Triatoma infestans and Rhodnius prolixus.

Science.gov (United States)

Pita, Sebastián; Mora, Pablo; Vela, Jesús; Palomeque, Teresa; Sánchez, Antonio; Panzera, Francisco; Lorite, Pedro

2018-04-24

Chagas disease or American trypanosomiasis affects six to seven million people worldwide, mostly in Latin America. This disease is transmitted by hematophagous insects known as "kissing bugs" (Hemiptera, Triatominae), with Triatoma infestans and Rhodnius prolixus being the two most important vector species. Despite the fact that both species present the same diploid chromosome number (2 n = 22), they have remarkable differences in their total DNA content, chromosome structure and genome organization. Variations in the DNA genome size are expected to be due to differences in the amount of repetitive DNA sequences. The T. infestans genome-wide analysis revealed the existence of 42 satellite DNA families. BLAST searches of these sequences against the R. prolixus genome assembly revealed that only four of these satellite DNA families are shared between both species, suggesting a great differentiation between the Triatoma and Rhodnius genomes. Fluorescence in situ hybridization (FISH) location of these repetitive DNAs in both species showed that they are dispersed on the euchromatic regions of all autosomes and the X chromosome. Regarding the Y chromosome, these common satellite DNAs are absent in T. infestans but they are present in the R. prolixus Y chromosome. These results support a different origin and/or evolution in the Y chromosome of both species.

Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

Energy Technology Data Exchange (ETDEWEB)

Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

2009-04-27

Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

Science.gov (United States)

Morant, Marc D.; Harris, Paul

2015-10-13

The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having xylanase activity and polynucleotides encoding same

Energy Technology Data Exchange (ETDEWEB)

Spodsberg, Nikolaj

2018-02-06

The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

A combined approach of hollow microneedles and nanocarriers for skin immunization with plasmid DNA encoding ovalbumin

Directory of Open Access Journals (Sweden)

Pamornpathomkul B

2017-01-01

Full Text Available Boonnada Pamornpathomkul,1 Adisak Wongkajornsilp,2 Wanida Laiwattanapaisal,3 Theerasak Rojanarata,1 Praneet Opanasopit,1 Tanasait Ngawhirunpat1 1Department of Pharmaceutical Technology, Faculty of Pharmacy, Pharmaceutical Development of Green Innovations Group, Silpakorn University, Nakhon Pathom, 2Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 3Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, Thailand Abstract: The aim of this study was to investigate the use of different types of microneedles (MNs and nanocarriers for in vitro skin permeation and in vivo immunization of plasmid DNA encoding ovalbumin (pOVA. In vitro skin permeation studies indicated that hollow MNs had a superior enhancing effect on skin permeation compared with solid MN patches, electroporation (EP patches, the combination of MN and EP patches, and untreated skin. Upon using hollow MNs combined with nanocarriers for pOVA delivery, the skin permeation was higher than for the delivery of naked pOVA, as evidenced by the increased amount of pOVA in Franz diffusion cells and immunoglobulin G (IgG antibody responses. When the hollow MNs were used for the delivery of nanocarrier:pOVA complexes into the skin of mice, they induced a stronger IgG immune response than conventional subcutaneous (SC injections. In addition, immunization of mice with the hollow MNs did not induce signs of skin infection or pinpoint bleeding. Accordingly, the hollow MNs combined with a nanocarrier delivery system is a promising approach for delivering pOVA complexes to the skin for promoting successful immunization. Keywords: hollow microneedle, solid microneedle, electroporation, plasmid DNA encoding ovalbumin, skin immunization, nanocarrier

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

Correction of mutant Fanconi anemia gene by homologous recombination in human hematopoietic cells using adeno-associated virus vector.

Science.gov (United States)

Paiboonsukwong, Kittiphong; Ohbayashi, Fumi; Shiiba, Haruka; Aizawa, Emi; Yamashita, Takayuki; Mitani, Kohnosuke

2009-11-01

Adeno-associated virus (AAV) vectors have been shown to correct a variety of mutations in human cells by homologous recombination (HR) at high rates, which can overcome insertional mutagenesis and transgene silencing, two of the major hurdles in conventional gene addition therapy of inherited diseases. We examined an ability of AAV vectors to repair a mutation in human hematopoietic cells by HR. We infected a human B-lymphoblastoid cell line (BCL) derived from a normal subject with an AAV, which disrupts the hypoxanthine phosphoribosyl transferase1 (HPRT1) locus, to measure the frequency of AAV-mediated HR in BCL cells. We subsequently constructed an AAV vector encoding the normal sequences from the Fanconi anemia group A (FANCA) locus to correct a mutation in the gene in BCL derived from a FANCA patient. Under optimal conditions, approximately 50% of BCL cells were transduced with an AAV serotype 2 (AAV-2) vector. In FANCA BCL cells, up to 0.016% of infected cells were gene-corrected by HR. AAV-mediated restoration of normal genotypic and phenotypic characteristics in FANCA-mutant cells was confirmed at the DNA, protein and functional levels. The results obtained in the present study indicate that AAV vectors may be applicable for gene correction therapy of inherited hematopoietic disorders.

Distributed Remote Vector Gaussian Source Coding with Covariance Distortion Constraints

DEFF Research Database (Denmark)

Zahedi, Adel; Østergaard, Jan; Jensen, Søren Holdt

2014-01-01

In this paper, we consider a distributed remote source coding problem, where a sequence of observations of source vectors is available at the encoder. The problem is to specify the optimal rate for encoding the observations subject to a covariance matrix distortion constraint and in the presence...

Encoded libraries of chemically modified peptides.

Science.gov (United States)

Heinis, Christian; Winter, Greg

2015-06-01

The use of powerful technologies for generating and screening DNA-encoded protein libraries has helped drive the development of proteins as pharmaceutical ligands. However the development of peptides as pharmaceutical ligands has been more limited. Although encoded peptide libraries are typically several orders of magnitude larger than classical chemical libraries, can be more readily screened, and can give rise to higher affinity ligands, their use as pharmaceutical ligands is limited by their intrinsic properties. Two of the intrinsic limitations include the rotational flexibility of the peptide backbone and the limited number (20) of natural amino acids. However these limitations can be overcome by use of chemical modification. For example, the libraries can be modified to introduce topological constraints such as cyclization linkers, or to introduce new chemical entities such as small molecule ligands, fluorophores and photo-switchable compounds. This article reviews the chemistry involved, the properties of the peptide ligands, and the new opportunities offered by chemical modification of DNA-encoded peptide libraries. Copyright © 2015. Published by Elsevier Ltd.

Hybrid Lentivirus-transposon Vectors With a Random Integration Profile in Human Cells

DEFF Research Database (Denmark)

Staunstrup, Nicklas H; Moldt, Brian; Mátés, Lajos

2009-01-01

Gene delivery by human immunodeficiency virus type 1 (HIV-1)-based lentiviral vectors (LVs) is efficient, but genomic integration of the viral DNA is strongly biased toward transcriptionally active loci resulting in an increased risk of insertional mutagenesis in gene therapy protocols. Nonviral...... Sleeping Beauty (SB) transposon vectors have a significantly safer insertion profile, but efficient delivery into relevant cell/tissue types is a limitation. In an attempt to combine the favorable features of the two vector systems we established a novel hybrid vector technology based on SB transposase......-mediated insertion of lentiviral DNA circles generated during transduction of target cells with integrase (IN)-defective LVs (IDLVs). By construction of a lentivirus-transposon hybrid vector allowing transposition exclusively from circular viral DNA substrates, we demonstrate that SB transposase added in trans...

Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

Science.gov (United States)

Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

2008-01-01

The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

Safety profile, efficacy, and biodistribution of a bicistronic high-capacity adenovirus vector encoding a combined immunostimulation and cytotoxic gene therapy as a prelude to a phase I clinical trial for glioblastoma

Energy Technology Data Exchange (ETDEWEB)

Puntel, Mariana [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Ghulam, Muhammad A.K.M. [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Farrokhi, Catherine [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); VanderVeen, Nathan; Paran, Christopher; Appelhans, Ashley [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Kroeger, Kurt M.; Salem, Alireza [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Lacayo, Liliana [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Pechnick, Robert N. [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Department of Psychiatry and Behavioral Neurosciences, David Geffen School of Medicine, University of California, Los Angeles, CA (United States); Kelson, Kyle R.; Kaur, Sukhpreet; Kennedy, Sean [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Palmer, Donna; Ng, Philip [Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030 (United States); and others

2013-05-01

Adenoviral vectors (Ads) are promising gene delivery vehicles due to their high transduction efficiency; however, their clinical usefulness has been hampered by their immunogenicity and the presence of anti-Ad immunity in humans. We reported the efficacy of a gene therapy approach for glioma consisting of intratumoral injection of Ads encoding conditionally cytotoxic herpes simplex type 1 thymidine kinase (Ad-TK) and the immunostimulatory cytokine fms-like tyrosine kinase ligand 3 (Ad-Flt3L). Herein, we report the biodistribution, efficacy, and neurological and systemic effects of a bicistronic high-capacity Ad, i.e., HC-Ad-TK/TetOn-Flt3L. HC-Ads elicit sustained transgene expression, even in the presence of anti-Ad immunity, and can encode large therapeutic cassettes, including regulatory elements to enable turning gene expression “on” or “off” according to clinical need. The inclusion of two therapeutic transgenes within a single vector enables a reduction of the total vector load without adversely impacting efficacy. Because clinically the vectors will be delivered into the surgical cavity, normal regions of the brain parenchyma are likely to be transduced. Thus, we assessed any potential toxicities elicited by escalating doses of HC-Ad-TK/TetOn-Flt3L (1 × 10{sup 8}, 1 × 10{sup 9}, or 1 × 10{sup 10} viral particles [vp]) delivered into the rat brain parenchyma. We assessed neuropathology, biodistribution, transgene expression, systemic toxicity, and behavioral impact at acute and chronic time points. The results indicate that doses up to 1 × 10{sup 9} vp of HC-Ad-TK/TetOn-Flt3L can be safely delivered into the normal rat brain and underpin further developments for its implementation in a phase I clinical trial for glioma. - Highlights: ► High capacity Ad vectors elicit sustained therapeutic gene expression in the brain. ► HC-Ad-TK/TetOn-Flt3L encodes two therapeutic genes and a transcriptional switch. ► We performed a dose escalation study at

Thioredoxin suppresses microscopic hopping of T7 DNA polymerase on duplex DNA

NARCIS (Netherlands)

Etson, Candice M.; Hamdan, Samir M.; Richardson, Charles C.; Oijen, Antoine M. van; Richardson, Charles C.

2010-01-01

The DNA polymerases involved in DNA replication achieve high processivity of nucleotide incorporation by forming a complex with processivity factors. A model system for replicative DNA polymerases, the bacteriophage T7 DNA polymerase (gp5), encoded by gene 5, forms a tight, 1:1 complex with

Novel adenoviral vector induces T-cell responses despite anti-adenoviral neutralizing antibodies in colorectal cancer patients.

Science.gov (United States)

Morse, Michael A; Chaudhry, Arvind; Gabitzsch, Elizabeth S; Hobeika, Amy C; Osada, Takuya; Clay, Timothy M; Amalfitano, Andrea; Burnett, Bruce K; Devi, Gayathri R; Hsu, David S; Xu, Younong; Balcaitis, Stephanie; Dua, Rajesh; Nguyen, Susan; Balint, Joseph P; Jones, Frank R; Lyerly, H Kim

2013-08-01

First-generation, E1-deleted adenovirus subtype 5 (Ad5)-based vectors, although promising platforms for use as cancer vaccines, are impeded in activity by naturally occurring or induced Ad-specific neutralizing antibodies. Ad5-based vectors with deletions of the E1 and the E2b regions (Ad5 [E1-, E2b-]), the latter encoding the DNA polymerase and the pre-terminal protein, by virtue of diminished late phase viral protein expression, were hypothesized to avoid immunological clearance and induce more potent immune responses against the encoded tumor antigen transgene in Ad-immune hosts. Indeed, multiple homologous immunizations with Ad5 [E1-, E2b-]-CEA(6D), encoding the tumor antigen carcinoembryonic antigen (CEA), induced CEA-specific cell-mediated immune (CMI) responses with antitumor activity in mice despite the presence of preexisting or induced Ad5-neutralizing antibody. In the present phase I/II study, cohorts of patients with advanced colorectal cancer were immunized with escalating doses of Ad5 [E1-, E2b-]-CEA(6D). CEA-specific CMI responses were observed despite the presence of preexisting Ad5 immunity in a majority (61.3 %) of patients. Importantly, there was minimal toxicity, and overall patient survival (48 % at 12 months) was similar regardless of preexisting Ad5 neutralizing antibody titers. The results demonstrate that, in cancer patients, the novel Ad5 [E1-, E2b-] gene delivery platform generates significant CMI responses to the tumor antigen CEA in the setting of both naturally acquired and immunization-induced Ad5-specific immunity.

Exploring genetic variation in haplotypes of the filariasis vector Culex quinquefasciatus (Diptera: Culicidae) through DNA barcoding.

Science.gov (United States)

Vadivalagan, Chithravel; Karthika, Pushparaj; Murugan, Kadarkarai; Panneerselvam, Chellasamy; Del Serrone, Paola; Benelli, Giovanni

2017-05-01

Culex quinquefasciatus (Diptera: Culicidae) is a vector of many pathogens and parasites of humans, as well as domestic and wild animals. In urban and semi-urban Asian countries, Cx. quinquefasciatus is a main vector of nematodes causing lymphatic filariasis. In the African region, it vectors the Rift Valley fever virus, while in the USA it transmits West Nile, St. Louis encephalitis and Western equine encephalitis virus. In this study, DNA barcoding was used to explore the genetic variation of Cx. quinquefasciatus populations from 88 geographical regions. We presented a comprehensive approach analyzing the effectiveness of two gene markers, i.e. CO1 and 16S rRNA. The high threshold genetic divergence of CO1 (0.47%) gene was reported as an ideal marker for molecular identification of this mosquito vector. Furthermore, null substitutions were lower in CO1 if compared to 16S rRNA, which influenced its differentiating potential among Indian haplotypes. NJ tree was well supported with high branch values for CO1 gene than 16S rRNA, indicating ideal genetic differentiation among haplotypes. TCS haplotype network revealed 14 distinct clusters. The intra- and inter-population polymorphism were calculated among the global and Indian Cx. quinquefasciatus lineages. The genetic diversity index Tajima' D showed negative values for all the 4 intra-population clusters (G2-4, G10). Fu's FS showed negative value for G10 cluster, which was significant and indicated recent population expansion. However, the G2-G4 (i.e. Indian lineages) had positive values, suggesting a bottleneck effect. Overall, our research firstly shed light on the genetic differences among the haplotypes of Cx. quinquefasciatus species complex, adding basic knowledge to the molecular ecology of this important mosquito vector. Copyright © 2017 Elsevier B.V. All rights reserved.

Correlated Topic Vector for Scene Classification.

Science.gov (United States)

Wei, Pengxu; Qin, Fei; Wan, Fang; Zhu, Yi; Jiao, Jianbin; Ye, Qixiang

2017-07-01

Scene images usually involve semantic correlations, particularly when considering large-scale image data sets. This paper proposes a novel generative image representation, correlated topic vector, to model such semantic correlations. Oriented from the correlated topic model, correlated topic vector intends to naturally utilize the correlations among topics, which are seldom considered in the conventional feature encoding, e.g., Fisher vector, but do exist in scene images. It is expected that the involvement of correlations can increase the discriminative capability of the learned generative model and consequently improve the recognition accuracy. Incorporated with the Fisher kernel method, correlated topic vector inherits the advantages of Fisher vector. The contributions to the topics of visual words have been further employed by incorporating the Fisher kernel framework to indicate the differences among scenes. Combined with the deep convolutional neural network (CNN) features and Gibbs sampling solution, correlated topic vector shows great potential when processing large-scale and complex scene image data sets. Experiments on two scene image data sets demonstrate that correlated topic vector improves significantly the deep CNN features, and outperforms existing Fisher kernel-based features.

DNA probes

Energy Technology Data Exchange (ETDEWEB)

Castelino, J

1993-12-31

The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with {sup 32}P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism`s genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens 10 figs, 2 tabs

EGVII endoglucanase and nucleic acids encoding the same

Science.gov (United States)

Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

2009-05-05

The present invention provides an endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

Learning-based encoding with soft assignment for age estimation under unconstrained imaging conditions

NARCIS (Netherlands)

Alnajar, F.; Shan, C.; Gevers, T.; Geusebroek, J.M.

2012-01-01

In this paper we propose to adopt a learning-based encoding method for age estimation under unconstrained imaging conditions. A similar approach [Cao et al., 2010] is applied to face recognition in real-life face images. However, the feature vectors are encoded in hard manner i.e. each feature

DNA-Compatible Nitro Reduction and Synthesis of Benzimidazoles.

Science.gov (United States)

Du, Huang-Chi; Huang, Hongbing

2017-10-18

DNA-encoded chemical libraries have emerged as a cost-effective alternative to high-throughput screening (HTS) for hit identification in drug discovery. A key factor for productive DNA-encoded libraries is the chemical diversity of the small molecule moiety attached to an encoding DNA oligomer. The library structure diversity is often limited to DNA-compatible chemical reactions in aqueous media. Herein, we describe a facile process for reducing aryl nitro groups to aryl amines. The new protocol offers simple operation and circumvents the pyrophoric potential of the conventional method (Raney nickel). The reaction is performed in aqueous solution and does not compromise DNA structural integrity. The utility of this method is demonstrated by the versatile synthesis of benzimidazoles on DNA.

Cloud-based uniform ChIP-Seq processing tools for modENCODE and ENCODE.

Science.gov (United States)

Trinh, Quang M; Jen, Fei-Yang Arthur; Zhou, Ziru; Chu, Kar Ming; Perry, Marc D; Kephart, Ellen T; Contrino, Sergio; Ruzanov, Peter; Stein, Lincoln D

2013-07-22

Funded by the National Institutes of Health (NIH), the aim of the Model Organism ENCyclopedia of DNA Elements (modENCODE) project is to provide the biological research community with a comprehensive encyclopedia of functional genomic elements for both model organisms C. elegans (worm) and D. melanogaster (fly). With a total size of just under 10 terabytes of data collected and released to the public, one of the challenges faced by researchers is to extract biologically meaningful knowledge from this large data set. While the basic quality control, pre-processing, and analysis of the data has already been performed by members of the modENCODE consortium, many researchers will wish to reinterpret the data set using modifications and enhancements of the original protocols, or combine modENCODE data with other data sets. Unfortunately this can be a time consuming and logistically challenging proposition. In recognition of this challenge, the modENCODE DCC has released uniform computing resources for analyzing modENCODE data on Galaxy (https://github.com/modENCODE-DCC/Galaxy), on the public Amazon Cloud (http://aws.amazon.com), and on the private Bionimbus Cloud for genomic research (http://www.bionimbus.org). In particular, we have released Galaxy workflows for interpreting ChIP-seq data which use the same quality control (QC) and peak calling standards adopted by the modENCODE and ENCODE communities. For convenience of use, we have created Amazon and Bionimbus Cloud machine images containing Galaxy along with all the modENCODE data, software and other dependencies. Using these resources provides a framework for running consistent and reproducible analyses on modENCODE data, ultimately allowing researchers to use more of their time using modENCODE data, and less time moving it around.

Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly.

Directory of Open Access Journals (Sweden)

Andreas I Andreou

Full Text Available Synthetic biology builds upon the foundation of engineering principles, prompting innovation and improvement in biotechnology via a design-build-test-learn cycle. A community-wide standard in DNA assembly would enable bio-molecular engineering at the levels of predictivity and universality in design and construction that are comparable to other engineering fields. Golden Gate Assembly technology, with its robust capability to unidirectionally assemble numerous DNA fragments in a one-tube reaction, has the potential to deliver a universal standard framework for DNA assembly. While current Golden Gate Assembly frameworks (e.g. MoClo and Golden Braid render either high cloning capacity or vector toolkit simplicity, the technology can be made more versatile-simple, streamlined, and cost/labor-efficient, without compromising capacity. Here we report the development of a new Golden Gate Assembly framework named Mobius Assembly, which combines vector toolkit simplicity with high cloning capacity. It is based on a two-level, hierarchical approach and utilizes a low-frequency cutter to reduce domestication requirements. Mobius Assembly embraces the standard overhang designs designated by MoClo, Golden Braid, and Phytobricks and is largely compatible with already available Golden Gate part libraries. In addition, dropout cassettes encoding chromogenic proteins were implemented for cost-free visible cloning screening that color-code different cloning levels. As proofs of concept, we have successfully assembled up to 16 transcriptional units of various pigmentation genes in both operon and multigene arrangements. Taken together, Mobius Assembly delivers enhanced versatility and efficiency in DNA assembly, facilitating improved standardization and automation.

A novel DNA vaccine technology conveying protection against a lethal herpes simplex viral challenge in mice.

Directory of Open Access Journals (Sweden)

Julie L Dutton

Full Text Available While there are a number of licensed veterinary DNA vaccines, to date, none have been licensed for use in humans. Here, we demonstrate that a novel technology designed to enhance the immunogenicity of DNA vaccines protects against lethal herpes simplex virus 2 (HSV-2 challenge in a murine model. Polynucleotides were modified by use of a codon optimization algorithm designed to enhance immune responses, and the addition of an ubiquitin-encoding sequence to target the antigen to the proteasome for processing and to enhance cytotoxic T cell responses. We show that a mixture of these codon-optimized ubiquitinated and non-ubiquitinated constructs encoding the same viral envelope protein, glycoprotein D, induced both B and T cell responses, and could protect against lethal viral challenge and reduce ganglionic latency. The optimized vaccines, subcloned into a vector suitable for use in humans, also provided a high level of protection against the establishment of ganglionic latency, an important correlate of HSV reactivation and candidate endpoint for vaccines to proceed to clinical trials.

Noise level and MPEG-2 encoder statistics

Science.gov (United States)

Lee, Jungwoo

1997-01-01

Most software in the movie and broadcasting industries are still in analog film or tape format, which typically contains random noise that originated from film, CCD camera, and tape recording. The performance of the MPEG-2 encoder may be significantly degraded by the noise. It is also affected by the scene type that includes spatial and temporal activity. The statistical property of noise originating from camera and tape player is analyzed and the models for the two types of noise are developed. The relationship between the noise, the scene type, and encoder statistics of a number of MPEG-2 parameters such as motion vector magnitude, prediction error, and quant scale are discussed. This analysis is intended to be a tool for designing robust MPEG encoding algorithms such as preprocessing and rate control.

Viral vectors encoding endomorphins and serine histogranin attenuate neuropathic pain symptoms after spinal cord injury in rats.

Science.gov (United States)

Nasirinezhad, Farinaz; Gajavelli, Shyam; Priddy, Blake; Jergova, Stanislava; Zadina, James; Sagen, Jacqueline

2015-01-07

The treatment of spinal cord injury (SCI)-induced neuropathic pain presents a challenging healthcare problem. The lack of available robust pharmacological treatments underscores the need for novel therapeutic methods and approaches. Due to the complex character of neuropathic pain following SCI, therapies targeting multiple mechanisms may be a better choice for obtaining sufficient long-term pain relief. Previous studies in our lab showed analgesic effects using combinations of an NMDA antagonist peptide [Ser1]histogranin (SHG), and the mu-opioid peptides endomorphins (EMs), in several pain models. As an alternative to drug therapy, this study evaluated the analgesic potential of these peptides when delivered via gene therapy. Lentiviruses encoding SHG and EM-1 and EM-2 were intraspinally injected, either singly or in combination, into rats with clip compression SCI 2 weeks following injury. Treated animals showed significant reduction in mechanical and thermal hypersensitivity, compared to control groups injected with GFP vector only. The antinociceptive effects of individually injected components were modest, but the combination of EMs and SHG produced robust and sustained antinociception. The onset of the analgesic effects was observed between 1-5 weeks post-injection and sustained without decrement for at least 7 weeks. No adverse effects on locomotor function were observed. The involvement of SHG and EMs in the observed antinociception was confirmed by pharmacologic inhibition using intrathecal injection of either the opioid antagonist naloxone or an anti-SHG antibody. Immunohistochemical analysis showed the presence of SHG and EMs in the spinal cord of treated animals, and immunodot-blot analysis of CSF confirmed the presence of these peptides in injected animals. In a separate group of rats, delayed injection of viral vectors was performed in order to mimic a more likely clinical scenario. Comparable and sustained antinociceptive effects were observed in

ENCODE whole-genome data in the UCSC genome browser (2011 update).

Science.gov (United States)

Raney, Brian J; Cline, Melissa S; Rosenbloom, Kate R; Dreszer, Timothy R; Learned, Katrina; Barber, Galt P; Meyer, Laurence R; Sloan, Cricket A; Malladi, Venkat S; Roskin, Krishna M; Suh, Bernard B; Hinrichs, Angie S; Clawson, Hiram; Zweig, Ann S; Kirkup, Vanessa; Fujita, Pauline A; Rhead, Brooke; Smith, Kayla E; Pohl, Andy; Kuhn, Robert M; Karolchik, Donna; Haussler, David; Kent, W James

2011-01-01

The ENCODE project is an international consortium with a goal of cataloguing all the functional elements in the human genome. The ENCODE Data Coordination Center (DCC) at the University of California, Santa Cruz serves as the central repository for ENCODE data. In this role, the DCC offers a collection of high-throughput, genome-wide data generated with technologies such as ChIP-Seq, RNA-Seq, DNA digestion and others. This data helps illuminate transcription factor-binding sites, histone marks, chromatin accessibility, DNA methylation, RNA expression, RNA binding and other cell-state indicators. It includes sequences with quality scores, alignments, signals calculated from the alignments, and in most cases, element or peak calls calculated from the signal data. Each data set is available for visualization and download via the UCSC Genome Browser (http://genome.ucsc.edu/). ENCODE data can also be retrieved using a metadata system that captures the experimental parameters of each assay. The ENCODE web portal at UCSC (http://encodeproject.org/) provides information about the ENCODE data and links for access.

Adeno-associated viral vector-mediated neurotrophin gene transfer in the injured adult rat spinal cord improves hind-limb function

NARCIS (Netherlands)

Blits, B; Oudega, M.; Boer, G J; Bartlett Bunge, M; Verhaagen, J

2003-01-01

To foster axonal growth from a Schwann cell bridge into the caudal spinal cord, spinal cells caudal to the implant were transduced with adeno-associated viral (AAV) vectors encoding for brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (AAV-NT-3). Control rats received AAV vectors encoding

Beta-glucosidase variants and polynucleotides encoding same

Science.gov (United States)

Wogulis, Mark; Harris, Paul; Osborn, David

2017-06-27

The present invention relates to beta-glucosidase variants, e.g. beta-glucosidase variants of a parent Family GH3A beta-glucosidase from Aspergillus fumigatus. The present invention also relates to polynucleotides encoding the beta-glucosidase variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the beta-glucosidase variants.

Construction of expression vector containing glnA gene and detection of NPT II activity in the transgenic rice calli using 32P-labelled compound

International Nuclear Information System (INIS)

Su Jin; Zhang Xueqin; Yan Qiusheng; Chen Zhangliang; You Chongbiao

1993-08-01

The glnA gene encoding glutamine synthetase (GS) was amplified from Azospirillum brasilense Sp7 by PCR technique. the amplified 1.4 kb DNA fragment was cloned at the EcoRV site of Bluescript-SK. Both sequencing and restriction digestion data showed that the 1.4 kb DNA fragment flanked with BamHI site at each end was really the glnA gene of A. brasilense Sp7. The glnA gene was ligated with Bg1 II site of pCo24. As a result, an expression vector pGSC35 with CaMV35S promoter was obtained. Using colony in situ hybridization with α- 32 P-dATP labelled probes to screen the positive clones, another glnA gene expression vector pAGNB92 with rice actin 1 promoter was constructed after three rounds of ligation and transformation. Protoplasts isolated from rice cell suspension line cv. T986 were transformed with glnA expression vectors pGSC35 and pAGNB92 containing neomycin phosphotransferase II (NPTII) gene by using PEG fusion and electroporation. Transformed microcalli were selected on media containing G418 disulfate salt. NPT II activity was detected in 37% of G418 resistant calli by using dot blot hybridization with γ- 32 P-ATP and kanamycin as substrate

Arginine-rich cross-linking peptides with different SV40 nuclear localization signal content as vectors for intranuclear DNA delivery.

Science.gov (United States)

Bogacheva, Mariia; Egorova, Anna; Slita, Anna; Maretina, Marianna; Baranov, Vladislav; Kiselev, Anton

2017-11-01

The major barriers for intracellular DNA transportation by cationic polymers are their toxicity, poor endosomal escape and inefficient nuclear uptake. Therefore, we designed novel modular peptide-based carriers modified with SV40 nuclear localization signal (NLS). Core peptide consists of arginine, histidine and cysteine residues for DNA condensation, endosomal escape promotion and interpeptide cross-linking, respectively. We investigated three polyplexes with different NLS content (10 mol%, 50 mol% and 90 mol% of SV40 NLS) as vectors for intranuclear DNA delivery. All carriers tested were able to condense DNA, to protect it from DNAase I and were not toxic to the cells. We observed that cell cycle arrest by hydroxyurea did not affect transfection efficacy of NLS-modified carriers which we confirmed using quantitative confocal microscopy analysis. Overall, peptide carrier modified with 90 mol% of SV40 NLS provided efficient transfection and nuclear uptake in non-dividing cells. Thus, incorporation of NLS into arginine-rich cross-linking peptides is an adequate approach to the development of efficient intranuclear gene delivery vehicles. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cloning and characterization of cDNA encoding xyloglucan ...

African Journals Online (AJOL)

Jane

2011-08-22

Aug 22, 2011 ... plays important role in growth and development of plants. XETs are a family of enzymes .... cloned into pGEM-T Easy vector (Promega Corporation, WI, USA). The recombinant ..... wall modification in the poaceae. Protein Sci.

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Viral Vectors for Use in the Development of Biodefense Vaccines

National Research Council Canada - National Science Library

Lee, John S; Hadjipanayis, Angela G; Parker, Michael D

2005-01-01

.... DNA vectors, live-attenuated viruses and bacteria, recombinant proteins combined with adjuvant, and viral- or bacterial-vectored vaccines have been developed as countermeasures against many potential...

Molecular Cloning, Expression and Characterization of Plasmid Encoding Rhomboid 4 (ROM4 of Tachyzoite of Toxoplasma gondii RH Strain

Directory of Open Access Journals (Sweden)

Mohammad Taghi RAHIMI

2017-12-01

Full Text Available AbstractBackground: The objective of this study was to clone, express and characterize the gene encoding rhomboid 4 (ROM4 proteins, a vital gene in surface adhesion and host cell invasion process of tachyzoite of T. gondii in an appropriate expression vector and eukaryotic cell for production of recombinant protein.Methods: Toxoplasma RNA was isolated from tachyzoites (RH strain and complementary DNA was synthesized. Oligonucleotide primer pair was designed based on Toxoplasma ROM4 gene sequence with XhoI and EcoRI restriction sites at 5´ end of forward and reverse primers, respectively. ROM4 gene was amplified by PCR, cloned into pTG19-T vector and the recombinant plasmid was sequenced. The gene was subcloned into pcDNA3 plasmid and expressed in CHO cells as eukaryotic cell. SDS-PAGE and western blotting were performed for protein determination and verification.Results: Cloning of ROM4 gene in pTG19-T vector was confirmed by colony-PCR and enzymatic digestion. The results of enzymatic digestion and gene sequencing confirmed successful cloning and subcloning procedures. The nucleotide sequence of the cloned ROM4 gene showed 99% homology compared to the corresponding sequences of original gene. SDS-PAGE and western blotting analyses of the purified protein revealed a single band having expected size of 65 kDa.Conclusion: This eukaryotic expression system is an appropriate system for high-level recombinant protein production of ROM4 gene from T. gondii tachyzoites used as antigenic component for serological assay and vaccine development.

Integration vector for the cyanobacteria Synechocystis sp. 6803

International Nuclear Information System (INIS)

Shestakov, S.V.; Elanskaya, I.V.; Bibikova, M.V.

1985-01-01

The authors have constructed recombinant plasmid DNA molecules with fragments of chromosomal DNA of the cyanobacterium Synechocystis 6803 in the vector plasmid pACYC 184, carrying markers for resistance against tetracycline (TC/sup r/) and chloramphenicol (Cm/sup r/). The authors also present their scheme of constructing integration vectors for Synechocystis 6803. To demonstrate integration of the recombinant plasmids of pSIS and pSIB series into the chromosomes of cyanobacteria, chromosomal DNA was isolated from the Cm/sup r/ transformants of Synechocystis 6803, and used for blot-hybridization using P 32-labeled plasmid DNA of pACYC 184. The hybridization results show that the chromosomal DNA isolated from the Cm/sup r/ transformants of cyanobacteria carries a region homologous with plasmid pACYC 184, whereas the DNA from wild type cells does not hybridize with pACYC 184. The transformation frequency of the Synechocystis 6803 cells by chromosomal DNA from the Cm/sup r/ clones of cyanobacteria was 3-7 x 10 -5 , which corresponds to the frequency of chromosomal transformation for other markers

Vector optimization and needle-free intradermal application of a broadly protective polyvalent influenza A DNA vaccine for pigs and humans

DEFF Research Database (Denmark)

Borggren, Marie; Nielsen, Jens; Bragstad, Karoline

2015-01-01

such as the induction of cellular and humoral immunity, inherent safety and rapid production time. We have previously developed a DNA vaccine encoding selected influenza proteins of pandemic origin and demonstrated broad protective immune responses in ferrets and pigs. In this study, we evaluated our DNA vaccine......The threat posed by the 2009 pandemic H1N1 virus emphasized the need for new influenza A virus vaccines inducing a broad cross-protective immune response for use in both humans and pigs. An effective and broad influenza vaccine for pigs would greatly benefit the pork industry and contribute...... to public health by diminishing the risk of emerging highly pathogenic reassortants. Current inactivated protein vaccines against swine influenza produce only short-lived immunity and have no efficacy against heterologous strains. DNA vaccines are a potential alternative with advantages...

Low-complexity video encoding method for wireless image transmission in capsule endoscope.

Science.gov (United States)

Takizawa, Kenichi; Hamaguchi, Kiyoshi

2010-01-01

This paper presents a low-complexity video encoding method applicable for wireless image transmission in capsule endoscopes. This encoding method is based on Wyner-Ziv theory, in which side information available at a transmitter is treated as side information at its receiver. Therefore complex processes in video encoding, such as estimation of the motion vector, are moved to the receiver side, which has a larger-capacity battery. As a result, the encoding process is only to decimate coded original data through channel coding. We provide a performance evaluation for a low-density parity check (LDPC) coding method in the AWGN channel.

Identification of species based on DNA barcode using k-mer feature vector and Random forest classifier.

Science.gov (United States)

Meher, Prabina Kumar; Sahu, Tanmaya Kumar; Rao, A R

2016-11-05

DNA barcoding is a molecular diagnostic method that allows automated and accurate identification of species based on a short and standardized fragment of DNA. To this end, an attempt has been made in this study to develop a computational approach for identifying the species by comparing its barcode with the barcode sequence of known species present in the reference library. Each barcode sequence was first mapped onto a numeric feature vector based on k-mer frequencies and then Random forest methodology was employed on the transformed dataset for species identification. The proposed approach outperformed similarity-based, tree-based, diagnostic-based approaches and found comparable with existing supervised learning based approaches in terms of species identification success rate, while compared using real and simulated datasets. Based on the proposed approach, an online web interface SPIDBAR has also been developed and made freely available at http://cabgrid.res.in:8080/spidbar/ for species identification by the taxonomists. Copyright © 2016 Elsevier B.V. All rights reserved.

Polypeptides having beta-glucosidase activity and polynucleotides encoding same

Science.gov (United States)

Harris, Paul; Golightly, Elizabeth

2012-11-27

The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

Science.gov (United States)

Maiyuran, Suchindra; Kramer, Randall; Harris, Paul

2013-10-29

The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

Science.gov (United States)

Paximadis, M; Rey, M E

2001-12-01

The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

Isolation and characterization of a cDNA clone coding for a glutathione S-transferase class delta enzyme from the biting midge Culicoides variipennis sonorensis Wirth and Jones.

Science.gov (United States)

Abdallah, M A; Pollenz, R S; Droog, F N; Nunamaker, R A; Tabachnick, W J; Murphy, K E

2000-12-01

Culicoides variipennis sonorensis is the primary vector of bluetongue viruses in North America. Glutathione S-transferases (GSTs) are enzymes that catalyze nucleophilic substitutions, converting reactive lipophilic molecules into soluble conjugates. Increased GST activity is associated with development of insecticide resistance. Described here is the isolation of the first cDNA encoding a C. variipennis GST. The clone consists of 720 translated bases encoding a protein with a M(r) of approximately 24,800 composed of 219 amino acids. The deduced amino acid sequence is similar (64%-74%) to class Delta (previously named Theta) GSTs from the dipteran genera Musca, Drosophila, Lucilia and Anopheles. The cDNA was subcloned into pET-11b, expressed in Epicurian coli BL21 (DE3) and has a specific activity of approximately 28,000 units/mg for the substrate 1-chloro-2,4-dinitrobenzene.

Rapid DNA vaccination against Burkholderia pseudomallei flagellin by tattoo or intranasal application.

Science.gov (United States)

Lankelma, Jacqueline M; Wagemakers, Alex; Birnie, Emma; Haak, Bastiaan W; Trentelman, Jos J A; Weehuizen, Tassili A F; Ersöz, Jasmin; Roelofs, Joris J T H; Hovius, Joppe W; Wiersinga, W Joost; Bins, Adriaan D

2017-11-17

Melioidosis is a severe infectious disease with a high mortality that is endemic in South-East Asia and Northern Australia. The causative pathogen, Burkholderia pseudomallei, is listed as potential bioterror weapon due to its high virulence and potential for easy dissemination. Currently, there is no licensed vaccine for prevention of melioidosis. Here, we explore the use of rapid plasmid DNA vaccination against B. pseudomallei flagellin for protection against respiratory challenge. We tested three flagellin DNA vaccines with different subcellular targeting designs. C57BL/6 mice were vaccinated via skin tattoo on day 0, 3 and 6 before intranasal challenge with B. pseudomallei on day 21. Next, the most effective construct was used as single vaccination on day 0 by tattoo or intranasal formulation. Mice were sacrificed 72 hours post-challenge to assess bacterial loads, cytokine responses, inflammation and microscopic lesions. A construct encoding a cellular secretion signal resulted in the most effective protection against melioidosis via tattooing, with a 10-fold reduction in bacterial loads in lungs and distant organs compared to the empty vector. Strikingly, a single intranasal administration of the same vaccine resulted in >1000-fold lower bacterial loads and increased survival. Pro-inflammatory cytokine responses were significantly diminished and strong reductions in markers for distant organ damage were observed. A rapid vaccination scheme using flagellin DNA tattoo provides significant protection against intranasal challenge with B. pseudomallei, markedly improved by a single administration via airway mucosa. Hence intranasal vaccination with flagellin-encoding DNA may be applicable when acute mass vaccination is indicated and warrants further testing.

DNA Minicircle Technology Improves Purity of Adeno-associated Viral Vector Preparations

Directory of Open Access Journals (Sweden)

Maria Schnödt

2016-01-01

Full Text Available Adeno-associated viral (AAV vectors are considered as one of the most promising delivery systems in human gene therapy. In addition, AAV vectors are frequently applied tools in preclinical and basic research. Despite this success, manufacturing pure AAV vector preparations remains a difficult task. While empty capsids can be removed from vector preparations owing to their lower density, state-of-the-art purification strategies as of yet failed to remove antibiotic resistance genes or other plasmid backbone sequences. Here, we report the development of minicircle (MC constructs to replace AAV vector and helper plasmids for production of both, single-stranded (ss and self-complementary (sc AAV vectors. As bacterial backbone sequences are removed during MC production, encapsidation of prokaryotic plasmid backbone sequences is avoided. This is of particular importance for scAAV vector preparations, which contained an unproportionally high amount of plasmid backbone sequences (up to 26.1% versus up to 2.9% (ssAAV. Replacing standard packaging plasmids by MC constructs not only allowed to reduce these contaminations below quantification limit, but in addition improved transduction efficiencies of scAAV preparations up to 30-fold. Thus, MC technology offers an easy to implement modification of standard AAV packaging protocols that significantly improves the quality of AAV vector preparations.

Identification of the polypeptides encoded in the unassigned reading frames 2, 4, 4L, and 5 of human mitochondrial DNA

International Nuclear Information System (INIS)

Mariottini, P.; Chomyn, A.; Riley, M.; Cottrell, B.; Doolittle, R.F.; Attardi, G.

1986-01-01

In previous work, antibodies prepared against chemically synthesized peptides predicted from the DNA sequence were used to identify the polypeptides encoded in three of the eight unassigned reading frames (URFs) of human mitochondrial DNA (mtDNA). In the present study, this approach has been extended to other human mtDNA URFs. In particular, antibodies directed against the NH 2 -terminal octapeptide of the putative URF2 product specifically precipitated component 11 of the HeLa cell mitochondrial translation products, the reaction being inhibited by the specific peptide. Similarly, antibodies directed against the COOH-terminal nonapeptide of the putative URF4 product reacted specifically with components 4 and 5, and antibodies against a COOH-terminal heptapeptide of the presumptive URF4L product reacted specifically with component 26. Antibodies against the NH 2 -terminal heptapeptide of the putative product of URF5 reacted with component 1, but only to a marginal extent; however, the results of a trypsin fingerprinting analysis of component 1 point strongly to this component as being the authentic product of URF5. The polypeptide assignments to the mtDNA URFs analyzed here are supported by the relative electrophoretic mobilities of proteins 11, 4-5, 26, and 1, which are those expected for the molecular weights predicted from the DNA sequence for the products of URF2, URF4, URF4L, and URF5, respectively. With the present assignment, seven of the eight human mtDNA URFs have been shown to be expressed in HeLa cells

Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

International Nuclear Information System (INIS)

Harper, J.F.; Surowy, T.K.; Sussman, M.R.

1989-01-01

In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

Adenoviral DNA replication: DNA sequences and enzymes required for initiation in vitro

International Nuclear Information System (INIS)

Stillman, B.W.; Tamanoi, F.

1983-01-01

In this paper evidence is provided that the 140,000-dalton DNA polymerase is encoded by the adenoviral genome and is required for the initiation of DNA replication in vitro. The DNA sequences in the template DNA that are required for the initiation of replication have also been identified, using both plasmid DNAs and synthetic oligodeoxyribonucleotides. 48 references, 7 figures, 1 table

Identification and Molecular Characterization of the cDNA Encoding Cucumis melo Allergen, Cuc m 3, a Plant Pathogenesis-Related Protein

Directory of Open Access Journals (Sweden)

Mojtaba Sankian

2014-05-01

Full Text Available Background: Melon (Cucumis melo allergy is one of the most common food allergies, characterized by oral allergy syndrome. To date, two allergen molecules, Cuc m 1 and Cuc m 2, have been fully characterized in melon pulp, but there are few reports about the molecular characteristics of Cuc m 3. Methods:The Cuc m 3 cDNA has been characterized by rapid amplification of cDNA ends (RACE, which revealed a 456 base-pair (bp fragment encoding a 151-amino acid polypeptide with a predicted molecular mass of 16.97 kDa, and identified 79 and 178 bp untranslated sequences at the 5′ and 3´ ends, respectively. Results: In silico analysis showed strong similarities between Cuc m 3 and other plant pathogen-related protein 1s from cucumber, grape, bell pepper, and tomato. Conclusion: Here we report the identification and characterization of the Cuc m 3 cDNA, which will be utilized for further analyses of structural and allergenic features of this allergen

An efficient marker-free vector for clean gene transfer into plants ...

African Journals Online (AJOL)

A marker-free vector, pBINMF, for clean gene transfer was constructed based on the binary vector pBINPLUS. Vector pBINMF, carrying only a multiple cloning site (MCS) between the left and the right T-DNA border, was suitable to directly generate marker-free transgenic plants (MFTPs) without any vector sequences ...

Tests of conspecificity for allopatric vectors: Simulium nodosum and Simulium shirakii (Diptera: Simuliidae) in Asia.

Science.gov (United States)

Low, Van Lun; Adler, Peter H; Sofian-Azirun, Mohd; Srisuka, Wichai; Saeung, Atiporn; Huang, Yao-Te; Hadi, Upik Kesumawati; Da Pham, Xuan; Takaoka, Hiroyuki

2015-05-29

Allopatric populations present challenges for biologists working with vectors. We suggest that conspecificity can be concluded in these cases when data from four character sets-chromosomal, ecological, molecular, and morphological-express variation no greater between the allopatric populations than between corresponding sympatric populations. We use this approach to test the conspecificity of Simulium nodosum Puri on the mainland of Southeast Asia and Simulium shirakii Kono & Takahasi in Taiwan. The validity of these two putative species has long been disputed given that they are morphologically indistinguishable. The mitochondria-encoded cytochrome c oxidase subunit I (COI), 12S rRNA, and 16S rRNA genes and the nuclear-encoded 28S rRNA gene support the conspecific status of S. nodosum from Myanmar, Thailand, and Vietnam and S. shirakii from Taiwan; 0 to 0.19 % genetic differences between the two taxa suggest intraspecific polymorphism. The banding patterns of the polytene chromosomes of the insular Taiwanese population of S. shirakii and mainland populations of S. nodosum are congruent. The overlapping ranges of habitat characteristics and hosts of S. nodosum and S. shirakii corroborate the chromosomal, molecular, and morphological data. Four independent sources of evidence (chromosomes, DNA, ecology, and morphology) support the conspecificity of S. nodosum and S. shirakii. We, therefore, synonymize S. shirakii with S. nodosum. This study provides a guide for applying the procedure of testing conspecificity to other sets of allopatric vectors.

Construction of a new shuttle vector for DNA delivery into mammalian cells using non-invasive Lactococcus lactis.

Science.gov (United States)

Yagnik, Bhrugu; Padh, Harish; Desai, Priti

2016-04-01

Use of food grade Lactococcus lactis (L. lactis) is fast emerging as a safe alternative for delivery of DNA vaccine. To attain efficient DNA delivery, L. lactis, a non-invasive bacterium is converted to invasive strain either by expressing proteins like Internalin A (InlA) or Fibronectin binding protein A (FnBPA) or through chemical treatments. However the safety status of invasive L. lactis is questionable. In the present report, we have shown that non-invasive L. lactis efficiently delivered the newly constructed reporter plasmid pPERDBY to mammalian cells without any chemical enhancers. The salient features of the vector are; I) Ability to replicate in two different hosts; Escherichia coli (E. coli) and Lactic Acid Bacteria (LAB), II) One of the smallest reporter plasmid for DNA vaccine, III) Enhanced Green Fluorescence Protein (EGFP) linked to Multiple Cloning Site (MCS), IV) Immunostimulatory CpG motifs functioning as an adjuvant. Expression of EGFP in pPERDBY transfected CHO-K1 and Caco-2 cells demonstrates its functionality. Non-invasive r-L. lactis was found efficient in delivering pPERDBY to Caco-2 cells. The in vitro data presented in this article supports the hypothesis that in the absence of invasive proteins or relevant chemical treatment, L. lactis was found efficient in delivering DNA to mammalian cells. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Red-shifted fluorescent proteins mPlum and mRaspberry and polynucleotides encoding the same

Science.gov (United States)

Tsien, Roger Y [La Jolla, CA; Wang, Lei [San Diego, CA

2008-07-01

Methods using somatic hypermutation (SHM) for producing polypeptide and nucleic acid variants, and nucleic acids encoding such polypeptide variants are disclosed. Such variants may have desired properties. Also disclosed are novel polypeptides, such as improved fluorescent proteins, produced by the novel methods, and nucleic acids, vectors, and host cells comprising such vectors.

Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy

International Nuclear Information System (INIS)

Mangin, M.; Webb, A.C.; Dreyer, B.E.

1988-01-01

Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12

Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

Directory of Open Access Journals (Sweden)

Kristen K. Merritt

2014-10-01

Full Text Available Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C and weak (A:T nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so.Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS that adds nucleotides to the four (G, A, C, and T found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B, at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes

Interaction of DNA/nuclear protein/polycation and the terplexes for gene delivery

Energy Technology Data Exchange (ETDEWEB)

Shen Yuan; Pan Shirong; Feng Min; Wen Yuting; Deng Jingjing; Luo Xin; Wu Chuanbin [School of Pharmaceutical Sciences, Sun Yat-sen University, Zhongshan II Road 74, Guangzhou 510080 (China); Peng Hui, E-mail: fengmin@mail.sysu.edu.cn [School of Zhongshan Medicine, Sun Yat-sen University, 74 Zhongshan Road II, Guangzhou 510080 (China)

2010-01-29

Nuclear transport of exogenous DNA is a major barrier to nonviral gene delivery that needs to be addressed in the design of new vectors. In this study, we prepared pDNA/HMGB1/PEG-PEI terplexes to promote nuclear import. HMGB1 in the terplexes was used to assist the transportation of pDNA into the nucleus of cells, since it contained nuclear localization signal (NLS); PEG chains were introduced to stabilize pDNA/vector terplexes and reduce the cytotoxicity. HMGB1/PEG-PEI combined vectors have been investigated specifically for their structure interaction by atomic force microscopy and circular dichroic spectroscopy. The results demonstrated that the HMGB1 molecule could bind with the pDNA chains, but not condense pDNA well. The PEG-PEI further compacted pDNA/HMGB1 complexes into nanosized spherical terplexes. The pDNA delivered by HMGB1/PEG-PEI combined vectors was significantly accumulated in the nucleus of cells, as observed by confocal laser scanning microscopy. The percentage of GFP-transfected cells and VEGF protein expression level induced by HMGB1/PEG-PEI were 2.6-4.9-fold and 1.4-2.8-fold higher, respectively, than that of a common cationic polymer PEI 25 kDa. Therefore, the HMGB1/PEG-PEI combined vector could be used as a versatile vector for promoting exogenous DNA nuclear localization, thereby enhancing its expression.

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Isolation and characterisation of cDNA clones representing the genes encoding the major tuber storage protein (dioscorin) of yam (Dioscorea cayenensis Lam.).

Science.gov (United States)

Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C

1995-06-01

cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.

Construction of lentiviral shRNA expression vector targeting ...

African Journals Online (AJOL)

DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

Polypeptides having beta-glucosidase activity and polynucleotides encoding the same

Science.gov (United States)

Brown, Kimberly; Harris, Paul

2013-12-17

The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Ternary polyplex micelles with PEG shells and intermediate barrier to complexed DNA cores for efficient systemic gene delivery.

Science.gov (United States)

Li, Junjie; Chen, Qixian; Zha, Zengshi; Li, Hui; Toh, Kazuko; Dirisala, Anjaneyulu; Matsumoto, Yu; Osada, Kensuke; Kataoka, Kazunori; Ge, Zhishen

2015-07-10

Simultaneous achievement of prolonged retention in blood circulation and efficient gene transfection activity in target tissues has always been a major challenge hindering in vivo applications of nonviral gene vectors via systemic administration. Herein, we constructed novel rod-shaped ternary polyplex micelles (TPMs) via complexation between the mixed block copolymers of poly(ethylene glycol)-b-poly{N'-[N-(2-aminoethyl)-2-aminoethyl]aspartamide} (PEG-b-PAsp(DET)) and poly(N-isopropylacrylamide)-b-PAsp(DET) (PNIPAM-b-PAsp(DET)) and plasmid DNA (pDNA) at room temperature, exhibiting distinct temperature-responsive formation of a hydrophobic intermediate layer between PEG shells and pDNA cores through facile temperature increase from room temperature to body temperature (~37 °C). As compared with binary polyplex micelles of PEG-b-PAsp(DET) (BPMs), TPMs were confirmed to condense pDNA into a more compact structure, which achieved enhanced tolerability to nuclease digestion and strong counter polyanion exchange. In vitro gene transfection results demonstrated TPMs exhibiting enhanced gene transfection efficiency due to efficient cellular uptake and endosomal escape. Moreover, in vivo performance evaluation after intravenous injection confirmed that TPMs achieved significantly prolonged blood circulation, high tumor accumulation, and promoted gene expression in tumor tissue. Moreover, TPMs loading therapeutic pDNA encoding an anti-angiogenic protein remarkably suppressed tumor growth following intravenous injection into H22 tumor-bearing mice. These results suggest TPMs with PEG shells and facilely engineered intermediate barrier to inner complexed pDNA have great potentials as systemic nonviral gene vectors for cancer gene therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

DNA molecules and human therapeutics | Danquah | African Journal ...

African Journals Online (AJOL)

Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...

A flow cytometric assay technology based on quantum dots-encoded beads

International Nuclear Information System (INIS)

Wang Haiqiao; Liu Tiancai; Cao Yuancheng; Huang Zhenli; Wang Jianhao; Li Xiuqing; Zhao Yuandi

2006-01-01

A flow cytometric detecting technology based on quantum dots (QDs)-encoded beads has been described. Using this technology, several QDs-encoded beads with different code were identified effectively, and the target molecule (DNA sequence) in solution was also detected accurately by coupling to its complementary sequence probed on QDs-encoded beads through DNA hybridization assay. The resolution of this technology for encoded beads is resulted from two longer wavelength fluorescence identification signals (yellow and red fluorescent signals of QDs), and the third shorter wavelength fluorescence signal (green reporting signal of fluorescein isothiocyanate (FITC)) for the determination of reaction between probe and target. In experiment, because of QDs' unique optical character, only one excitation light source was needed to excite the QDs and probe dye FITC synchronously comparing with other flow cytometric assay technology. The results show that this technology has present excellent repeatability and good accuracy. It will become a promising multiple assay platform in various application fields after further improvement

Polypeptides having xylanase activity and polynucleotides encoding same

Energy Technology Data Exchange (ETDEWEB)

Spodsberg, Nikolaj; Shaghasi, Tarana

2017-06-20

The present invention relates to polypeptides having xylanase activity, catalytic domains, and carbohydrate binding domains, and polynucleotides encoding the polypeptides, catalytic domains, and carbohydrate binding domains. The present invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides, catalytic domains, and carbohydrate binding domains.

Organometallic DNA-B12 Conjugates as Potential Oligonucleotide Vectors: Synthesis and Structural and Binding Studies with Human Cobalamin-Transport Proteins.

Science.gov (United States)

Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard

2017-11-16

The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

Science.gov (United States)

Wogulis, Mark; Sweeney, Matthew; Heu, Tia

2017-06-14

The present invention relates to chimeric GH61 polypeptides having cellulolytic enhancing activity. The present invention also relates to polynucleotides encoding the chimeric GH61 polypeptides; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the chimeric GH61 polypeptides.

AAV vector encoding human VEGF165-transduced pectineus muscular flaps increase the formation of new tissue through induction of angiogenesis in an in vivo chamber for tissue engineering: A technique to enhance tissue and vessels in microsurgically engineered tissue.

Science.gov (United States)

Moimas, Silvia; Manasseri, Benedetto; Cuccia, Giuseppe; Stagno d'Alcontres, Francesco; Geuna, Stefano; Pattarini, Lucia; Zentilin, Lorena; Giacca, Mauro; Colonna, Michele R

2015-01-01

In regenerative medicine, new approaches are required for the creation of tissue substitutes, and the interplay between different research areas, such as tissue engineering, microsurgery and gene therapy, is mandatory. In this article, we report a modification of a published model of tissue engineering, based on an arterio-venous loop enveloped in a cross-linked collagen-glycosaminoglycan template, which acts as an isolated chamber for angiogenesis and new tissue formation. In order to foster tissue formation within the chamber, which entails on the development of new vessels, we wondered whether we might combine tissue engineering with a gene therapy approach. Based on the well-described tropism of adeno-associated viral vectors for post-mitotic tissues, a muscular flap was harvested from the pectineus muscle, inserted into the chamber and transduced by either AAV vector encoding human VEGF165 or AAV vector expressing the reporter gene β-galactosidase, as a control. Histological analysis of the specimens showed that muscle transduction by AAV vector encoding human VEGF165 resulted in enhanced tissue formation, with a significant increase in the number of arterioles within the chamber in comparison with the previously published model. Pectineus muscular flap, transduced by adeno-associated viral vectors, acted as a source of the proangiogenic factor vascular endothelial growth factor, thus inducing a consistent enhancement of vessel growth into the newly formed tissue within the chamber. In conclusion, our present findings combine three different research fields such as microsurgery, tissue engineering and gene therapy, suggesting and showing the feasibility of a mixed approach for regenerative medicine.

Immunization with a DNA vaccine encoding Toxoplasma gondii Superoxide dismutase (TgSOD) induces partial immune protection against acute toxoplasmosis in BALB/c mice.

Science.gov (United States)

Liu, Yuan; Cao, Aiping; Li, Yawen; Li, Xun; Cong, Hua; He, Shenyi; Zhou, Huaiyu

2017-06-07

Toxoplasma gondii (T. gondii) is an obligate intracellular protozoan parasite that infects all warm-blooded animals including humans and causes toxoplasmosis. An effective vaccine could be an ideal choice for preventing and controlling toxoplasmosis. T. gondii Superoxide dismutase (TgSOD) might participate in affecting the intracellular growth of both bradyzoite and tachyzoite forms. In the present study, the TgSOD gene was used to construct a DNA vaccine (pEGFP-SOD). TgSOD gene was amplified and inserted into eukaryotic vector pEGFP-C1 and formed the DNA vaccine pEGFP-SOD. Then the BALB/c mice were immunized intramuscularly with the DNA vaccine and those injected with pEGFP-C1, PBS or nothing were treated as controls. Four weeks after the last immunization, all mouse groups followed by challenging intraperitoneally with tachyzoites of T. gondii ME49 strain. Results showed higher levels of total IgG, IgG2α in the sera and interferon gamma (IFN-γ) in the splenocytes from pEGFP-SOD inoculated mice than those unvaccinated, or inoculated with either empty plasmid vector or PBS. The proportions of CD4 + T cells and CD8 + T cells in the spleen from pEGFP-SOD inoculated mice were significantly (p < 0.05) increased compared to control groups. In addition, the survival time of mice immunized with pEGFP-SOD was significantly prolonged as compared to the controls (p < 0.05) although all the mice died. The present study revealed that the DNA vaccine triggered strong humoral and cellular immune responses, and aroused partial protective immunity against acute T. gondii infection in BALB/c mice. The collective data suggests the SOD may be a potential vaccine candidate for further development.

Comparison Between Several Integrase-defective Lentiviral Vectors Reveals Increased Integration of an HIV Vector Bearing a D167H Mutant

Directory of Open Access Journals (Sweden)

Muhammad Qamar Saeed

2014-01-01

Full Text Available HIV-1 derived vectors are among the most efficient for gene transduction in mammalian tissues. As the parent virus, they carry out vector genome insertion into the host cell chromatin. Consequently, their preferential integration in transcribed genes raises several conceptual and safety issues. To address part of these questions, HIV-derived vectors have been engineered to be nonintegrating. This was mainly achieved by mutating HIV-1 integrase at functional hotspots of the enzyme enabling the development of streamlined nuclear DNA circles functional for transgene expression. Few integrase mutant vectors have been successfully tested so far for gene transfer. They are cleared with time in mitotic cells, but stable within nondividing retina cells or neurons. Here, we compared six HIV vectors carrying different integrases, either wild type or with different mutations (D64V, D167H, Q168A, K186Q+Q214L+Q216L, and RRK262-264AAH shown to modify integrase enzymatic activity, oligomerization, or interaction with key cellular cofactor of HIV DNA integration as LEDGF/p75 or TNPO3. We show that these mutations differently affect the transduction efficiency as well as rates and patterns of integration of HIV-derived vectors suggesting their different processing in the nucleus. Surprisingly and most interestingly, we report that an integrase carrying the D167H substitution improves vector transduction efficiency and integration in both HEK-293T and primary CD34+ cells.

Phenotypic correction of von Willebrand disease type 3 blood-derived endothelial cells with lentiviral vectors expressing von Willebrand factor

Science.gov (United States)

De Meyer, Simon F.; Vanhoorelbeke, Karen; Chuah, Marinee K.; Pareyn, Inge; Gillijns, Veerle; Hebbel, Robert P.; Collen, Désiré; Deckmyn, Hans; VandenDriessche, Thierry

2006-01-01

Von Willebrand disease (VWD) is an inherited bleeding disorder, caused by quantitative (type 1 and 3) or qualitative (type 2) defects in von Willebrand factor (VWF). Gene therapy is an appealing strategy for treatment of VWD because it is caused by a single gene defect and because VWF is secreted into the circulation, obviating the need for targeting specific organs or tissues. However, development of gene therapy for VWD has been hampered by the considerable length of the VWF cDNA (8.4 kb [kilobase]) and the inherent complexity of the VWF protein that requires extensive posttranslational processing. In this study, a gene-based approach for VWD was developed using lentiviral transduction of blood-outgrowth endothelial cells (BOECs) to express functional VWF. A lentiviral vector encoding complete human VWF was used to transduce BOECs isolated from type 3 VWD dogs resulting in high-transduction efficiencies (95.6% ± 2.2%). Transduced VWD BOECs efficiently expressed functional vector-encoded VWF (4.6 ± 0.4 U/24 hour per 106 cells), with normal binding to GPIbα and collagen and synthesis of a broad range of multimers resulting in phenotypic correction of these cells. These results indicate for the first time that gene therapy of type 3 VWD is feasible and that BOECs are attractive target cells for this purpose. PMID:16478886

Investigation of DNA Integration into Reproductive Organs Following Intramuscular Injection of DNA in Mice

Directory of Open Access Journals (Sweden)

Fatemeh Vahedi

2012-10-01

Full Text Available Background: DNA immunization with plasmid DNA encoding bacterial, viral, parasitic, and tumor antigens has been reported to trigger protective immunity. The use of plasmid DNA vaccinations against many diseases has produced promising results in animal and human clinical trials; however, safety concerns about the use of DNA vaccines exist, such as the possibility of integration into the host genome, and elicitation of adverse immune responses. Methods: In this study, we examined the potential integration and bio-distribution of pcDNA3.1+PA, a new vaccine candidate with GenBank accession # EF550208, encoding the PA63 gene, in reproductive organs of mice; ovaries and uterus in female, and testis in male. Animals of both sexes were injected intramuscularly with pcDNA3.1+PA. Host genome integration and tissue distribution were examined using PCR and RT-PCR two times monthly for six months. Results: RT-PCR confirmed that pcDNA3.1+PA was not integrated into the host genome and did not enter reproductive organs. Conclusions: This finding has important implications for the use of pcDNA3.1+PA plasmid as a vaccine and opens new perspectives in the DNA vaccine area.

Efficient generation of rat induced pluripotent stem cells using a non-viral inducible vector.

Directory of Open Access Journals (Sweden)

Claudia Merkl

Full Text Available Current methods of generating rat induced pluripotent stem cells are based on viral transduction of pluripotency inducing genes (Oct4, Sox2, c-myc and Klf4 into somatic cells. These activate endogenous pluripotency genes and reprogram the identity of the cell to an undifferentiated state. Epigenetic silencing of exogenous genes has to occur to allow normal iPS cell differentiation. To gain more control over the expression of exogenous reprogramming factors, we used a novel doxycycline-inducible plasmid vector encoding Oct4, Sox2, c-Myc and Klf4. To ensure efficient and controlled generation of iPS cells by plasmid transfection we equipped the reprogramming vector with a bacteriophage φC31 attB site and used a φC31 integrase expression vector to enhance vector integration. A series of doxycycline-independent rat iPS cell lines were established. These were characterized by immunocytochemical detection of Oct4, SSEA1 and SSEA4, alkaline phosphatase staining, methylation analysis of the endogenous Oct4 promoter and RT-PCR analysis of endogenous rat pluripotency genes. We also determined the number of vector integrations and the extent to which reprogramming factor gene expression was controlled. Protocols were developed to generate embryoid bodies and rat iPS cells demonstrated as pluripotent by generating derivatives of all three embryonic germ layers in vitro, and teratoma formation in vivo. All data suggest that our rat iPS cells, generated by plasmid based reprogramming, are similar to rat ES cells. Methods of DNA transfection, protein transduction and feeder-free monolayer culture of rat iPS cells were established to enable future applications.

Involvement of the yeast DNA polymerase delta in DNA repair in vivo

Energy Technology Data Exchange (ETDEWEB)

Giot, L. [State University of New York at Stony Brook, Stony Brook, NY. (United States); Chanet, R.; Simon, M.; Facca, C.; Faye, G.

1997-08-15

The POL3 encoded catalytic subunit of DNA polymerase delta possesses a highly conserved C-terminal cysteine-rich domain in Saccharomyces cerevisiae. Mutations in some of its cysteine codons display a lethal phenotype, which demonstrates an essential function of this domain. The thermosensitive mutant pol3-13, in which a serine replaces a cysteine of this domain, exhibits a range of defects in DNA repair, such as hypersensitivity to different DNA-damaging agents and deficiency for induced mutagenesis and for recombination. These phenotypes are observed at 24 degrees, a temperature at which DNA replication is almost normal; this differentiates the functions of POL3 in DNA repair and DNA replication. Since spontaneous mutagenesis and spontaneous recombination are efficient in pol3-13, we propose that POL3 plays an important role in DNA repair after irradiation, particularly in the error-prone and recombinational pathways. Extragenic suppressors of pol3-13 are allelic to sdp5-1, previously identified as an extragenic suppressor of pol3-11. SDP5, which is identical to HYS2, encodes a protein homologous to the p50 subunit of bovine and human DNA polymerase delta. SDP5 is most probably the p55 subunit of Pol delta of S. cerevisiae and seems to be associated with the catalytic subunit for both DNA replication and DNA repair. (author)

Development of shuttle vectors for transformation of diverse Rickettsia species.

Directory of Open Access Journals (Sweden)

Nicole Y Burkhardt

Full Text Available Plasmids have been identified in most species of Rickettsia examined, with some species maintaining multiple different plasmids. Three distinct plasmids were demonstrated in Rickettsia amblyommii AaR/SC by Southern analysis using plasmid specific probes. Copy numbers of pRAM18, pRAM23 and pRAM32 per chromosome in AaR/SC were estimated by real-time PCR to be 2.0, 1.9 and 1.3 respectively. Cloning and sequencing of R. amblyommii AaR/SC plasmids provided an opportunity to develop shuttle vectors for transformation of rickettsiae. A selection cassette encoding rifampin resistance and a fluorescent marker was inserted into pRAM18 yielding a 27.6 kbp recombinant plasmid, pRAM18/Rif/GFPuv. Electroporation of Rickettsia parkeri and Rickettsia bellii with pRAM18/Rif/GFPuv yielded GFPuv-expressing rickettsiae within 2 weeks. Smaller vectors, pRAM18dRG, pRAM18dRGA and pRAM32dRGA each bearing the same selection cassette, were made by moving the parA and dnaA-like genes from pRAM18 or pRAM32 into a vector backbone. R. bellii maintained the highest numbers of pRAM18dRGA (13.3 - 28.1 copies, and R. parkeri, Rickettsia monacensis and Rickettsia montanensis contained 9.9, 5.5 and 7.5 copies respectively. The same species transformed with pRAM32dRGA maintained 2.6, 2.5, 3.2 and 3.6 copies. pRM, the plasmid native to R. monacensis, was still present in shuttle vector transformed R. monacensis at a level similar to that found in wild type R. monacensis after 15 subcultures. Stable transformation of diverse rickettsiae was achieved with a shuttle vector system based on R. amblyommii plasmids pRAM18 and pRAM32, providing a new research tool that will greatly facilitate genetic and biological studies of rickettsiae.

Geminivirus vectors for high-level expression of foreign proteins in plant cells.

Science.gov (United States)

Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S

2003-02-20

Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.

Transcriptome Profiling of Trypanosoma brucei Development in the Tsetse Fly Vector Glossina morsitans.

Directory of Open Access Journals (Sweden)

Amy F Savage

Full Text Available African trypanosomes, the causative agents of sleeping sickness in humans and nagana in animals, have a complex digenetic life cycle between a mammalian host and an insect vector, the blood-feeding tsetse fly. Although the importance of the insect vector to transmit the disease was first realized over a century ago, many aspects of trypanosome development in tsetse have not progressed beyond a morphological analysis, mainly due to considerable challenges to obtain sufficient material for molecular studies. Here, we used high-throughput RNA-Sequencing (RNA-Seq to profile Trypanosoma brucei transcript levels in three distinct tissues of the tsetse fly, namely the midgut, proventriculus and salivary glands. Consistent with current knowledge and providing a proof of principle, transcripts coding for procyclin isoforms and several components of the cytochrome oxidase complex were highly up-regulated in the midgut transcriptome, whereas transcripts encoding metacyclic VSGs (mVSGs and the surface coat protein brucei alanine rich protein or BARP were extremely up-regulated in the salivary gland transcriptome. Gene ontology analysis also supported the up-regulation of biological processes such as DNA metabolism and DNA replication in the proventriculus transcriptome and major changes in signal transduction and cyclic nucleotide metabolism in the salivary gland transcriptome. Our data highlight a small repertoire of expressed mVSGs and potential signaling pathways involving receptor-type adenylate cyclases and members of a surface carboxylate transporter family, called PADs (Proteins Associated with Differentiation, to cope with the changing environment, as well as RNA-binding proteins as a possible global regulators of gene expression.

Modeling DNA affinity landscape through two-round support vector regression with weighted degree kernels

KAUST Repository

Wang, Xiaolei

2014-12-12

Background: A quantitative understanding of interactions between transcription factors (TFs) and their DNA binding sites is key to the rational design of gene regulatory networks. Recent advances in high-throughput technologies have enabled high-resolution measurements of protein-DNA binding affinity. Importantly, such experiments revealed the complex nature of TF-DNA interactions, whereby the effects of nucleotide changes on the binding affinity were observed to be context dependent. A systematic method to give high-quality estimates of such complex affinity landscapes is, thus, essential to the control of gene expression and the advance of synthetic biology. Results: Here, we propose a two-round prediction method that is based on support vector regression (SVR) with weighted degree (WD) kernels. In the first round, a WD kernel with shifts and mismatches is used with SVR to detect the importance of subsequences with different lengths at different positions. The subsequences identified as important in the first round are then fed into a second WD kernel to fit the experimentally measured affinities. To our knowledge, this is the first attempt to increase the accuracy of the affinity prediction by applying two rounds of string kernels and by identifying a small number of crucial k-mers. The proposed method was tested by predicting the binding affinity landscape of Gcn4p in Saccharomyces cerevisiae using datasets from HiTS-FLIP. Our method explicitly identified important subsequences and showed significant performance improvements when compared with other state-of-the-art methods. Based on the identified important subsequences, we discovered two surprisingly stable 10-mers and one sensitive 10-mer which were not reported before. Further test on four other TFs in S. cerevisiae demonstrated the generality of our method. Conclusion: We proposed in this paper a two-round method to quantitatively model the DNA binding affinity landscape. Since the ability to modify

α/sub i/-3 cDNA encodes the α subunit of G/sub k/, the stimulatory G protein of receptor-regulated K+ channels

International Nuclear Information System (INIS)

Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

1988-01-01

cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed

AAV vector encoding human VEGF165–transduced pectineus muscular flaps increase the formation of new tissue through induction of angiogenesis in an in vivo chamber for tissue engineering: A technique to enhance tissue and vessels in microsurgically engineered tissue

Directory of Open Access Journals (Sweden)

Silvia Moimas

2015-12-01

Full Text Available In regenerative medicine, new approaches are required for the creation of tissue substitutes, and the interplay between different research areas, such as tissue engineering, microsurgery and gene therapy, is mandatory. In this article, we report a modification of a published model of tissue engineering, based on an arterio-venous loop enveloped in a cross-linked collagen–glycosaminoglycan template, which acts as an isolated chamber for angiogenesis and new tissue formation. In order to foster tissue formation within the chamber, which entails on the development of new vessels, we wondered whether we might combine tissue engineering with a gene therapy approach. Based on the well-described tropism of adeno-associated viral vectors for post-mitotic tissues, a muscular flap was harvested from the pectineus muscle, inserted into the chamber and transduced by either AAV vector encoding human VEGF165 or AAV vector expressing the reporter gene β-galactosidase, as a control. Histological analysis of the specimens showed that muscle transduction by AAV vector encoding human VEGF165 resulted in enhanced tissue formation, with a significant increase in the number of arterioles within the chamber in comparison with the previously published model. Pectineus muscular flap, transduced by adeno-associated viral vectors, acted as a source of the proangiogenic factor vascular endothelial growth factor, thus inducing a consistent enhancement of vessel growth into the newly formed tissue within the chamber. In conclusion, our present findings combine three different research fields such as microsurgery, tissue engineering and gene therapy, suggesting and showing the feasibility of a mixed approach for regenerative medicine.

C3d enhanced DNA vaccination induced humoral immune response to glycoprotein C of pseudorabies virus

International Nuclear Information System (INIS)

Tong Tiezhu; Fan Huiying; Tan Yadi; Xiao Shaobo; Ling Jieyu; Chen Huanchun; Guo Aizhen

2006-01-01

Murine C3d were utilized to enhance immunogenicity of pseudorabies virus (PrV) gC DNA vaccination. Three copies of C3d and four copies of CR2-binding domain M28 4 were fused, respectively, to truncated gC gene encoding soluble glycoprotein C (sgC) in pcDNA3.1. BALB/c mice were, respectively, immunized with recombinant plasmids, blank vector, and inactivated vaccine. The antibody ELISA titer for sgC-C3d 3 DNA was 49-fold more than that for sgC DNA, and the neutralizing antibody obtained 8-fold rise. Protection of mice from death after lethal PrV (316 LD 5 ) challenge was augmented from 25% to 100%. Furthermore, C3d fusion increased Th2-biased immune response by inducing IL-4 production. The IL-4 level for sgC-C3d 3 DNA immunization approached that for the inactivated vaccine. Compared to C3d, M28 enhanced sgC DNA immunogenicity to a lesser extent. In conclusion, we demonstrated that murine C3d fusion significantly enhanced gC DNA immunity by directing Th1-biased to a balanced and more effective Th1/Th2 response

Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp. Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B

Directory of Open Access Journals (Sweden)

Caroline Chénard

2016-06-01

Full Text Available Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages.

BC047440 antisense eukaryotic expression vectors inhibited HepG2 cell proliferation and suppressed xenograft tumorigenicity

International Nuclear Information System (INIS)

Lu, Zheng; Ping, Liang; JianBo, Zhou; XiaoBing, Huang; Yu, Wen; Zheng, Wang; Jing, Li

2012-01-01

The biological functions of the BC047440 gene highly expressed by hepatocellular carcinoma (HCC) are unknown. The objective of this study was to reconstruct antisense eukaryotic expression vectors of the gene for inhibiting HepG 2 cell proliferation and suppressing their xenograft tumorigenicity. The full-length BC047440 cDNA was cloned from human primary HCC by RT-PCR. BC047440 gene fragments were ligated with pMD18-T simple vectors and subsequent pcDNA3.1(+) plasmids to construct the recombinant antisense eukaryotic vector pcDNA3.1(+)BC047440AS. The endogenous BC047440 mRNA abundance in target gene-transfected, vector-transfected and naive HepG 2 cells was semiquantitatively analyzed by RT-PCR and cell proliferation was measured by the MTT assay. Cell cycle distribution and apoptosis were profiled by flow cytometry. The in vivo xenograft experiment was performed on nude mice to examine the effects of antisense vector on tumorigenicity. BC047440 cDNA fragments were reversely inserted into pcDNA3.1(+) plasmids. The antisense vector significantly reduced the endogenous BC047440 mRNA abundance by 41% in HepG 2 cells and inhibited their proliferation in vitro (P < 0.01). More cells were arrested by the antisense vector at the G 1 phase in an apoptosis-independent manner (P = 0.014). Additionally, transfection with pcDNA3.1(+) BC047440AS significantly reduced the xenograft tumorigenicity in nude mice. As a novel cell cycle regulator associated with HCC, the BC047440 gene was involved in cell proliferation in vitro and xenograft tumorigenicity in vivo through apoptosis-independent mechanisms

BGL6 beta-glucosidase and nucleic acids encoding the same

Science.gov (United States)

Dunn-Coleman, Nigel [Los Gatos, CA; Ward, Michael [San Francisco, CA

2009-09-01

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

Is passive transmission of non-viral vectors through artificial insemination of sperm-DNA mixtures sufficient for chicken transgenesis?

Science.gov (United States)

CHAPARIAN, Shahram; ABDULAHNEJAD, Ahad; RASHIDI, Farzad; TOGHYANI, Majid; GHEISARI, Abbasali; EGHBALSAIED, Shahin

2016-01-01

DNA uptake in the post-acrosomal region of the spermatozoa takes place exclusively in immotile spermatozoa that are naturally unable to fertilize eggs. The present study aimed to assess whether passive transmission of non-viral vectors to the surrounding areas of chicken embryos could be an alternate mechanism in chicken sperm-mediated gene transfer. First, the presence of nucleases in rooster seminal plasma was evaluated. Semen ejaculates from five roosters were centrifuged and the supernatant was incubated with pBL2 for 1 h. A robust nuclease cocktail was detected in the rooster semen. To overcome these nucleases, plasmid-TransIT combinations were incubated with semen for 1 h. Incubation of exogenous DNA in the lipoplex structure could considerably bypass the semen nuclease effect. Then, intravaginal insemination of 1 × 109 sperm mixed with lipoplexes (40 µg pBL2:40 µl TransIT) was carried out in 15 virgin hens. Neither the epithelial tissue from the inseminated female reproductive tracts nor the produced embryos following artificial insemination showed the transgene. To remove any bias in the transgene transmission possibility, the plasmid-TransIT admixture was directly injected in close vicinity of the embryos in newly laid eggs. Nonetheless, none of the produced fetuses or chicks carried the transgene. In conclusion, the results of the present study revealed a nuclease admixture in rooster seminal plasma, and passive/active transmission of the non-viral vector into close vicinity of the chicken embryo was inefficient for producing transgenic chicks. PMID:26935324

Listeria monocytogenes as a vector for anti-cancer therapies.

LENUS (Irish Health Repository)

Tangney, Mark

2012-01-31

The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

Molecular cloning of the cDNA encoding follicle-stimulating hormone beta subunit of the Chinese soft-shell turtle Pelodiscus sinensis, and its gene expression.

Science.gov (United States)

Chien, Jung-Tsun; Shen, San-Tai; Lin, Yao-Sung; Yu, John Yuh-Lin

2005-04-01

Follicle-stimulating hormone (FSH) is a member of the pituitary glycoprotein hormone family. These hormones are composed of two dissimilar subunits, alpha and beta. Very little information is available regarding the nucleotide and amino acid sequence of FSHbeta in reptilian species. For better understanding of the phylogenetic diversity and evolution of FSH molecule, we have isolated and sequenced the complementary DNA (cDNA) encoding the Chinese soft-shell turtle (Pelodiscus sinensis, Family of Trionychidae) FSHbeta precursor molecule by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end (RACE) methods. The cloned Chinese soft-shell turtle FSHbeta cDNA consists of 602-bp nucleotides, including 34-bp nucleotides of the 5'-untranslated region (UTR), 396-bp of the open reading frame, and 3'-UTR of 206-bp nucleotides. It encodes a 131-amino acid precursor molecule of FSHbeta subunit with a signal peptide of 20 amino acids followed by a mature protein of 111 amino acids. Twelve cysteine residues, forming six disulfide bonds within beta-subunit and two putative asparagine-linked glycosylation sites, are also conserved in the Chinese soft-shell turtle FSHbeta subunit. The deduced amino acid sequence of the Chinese soft-shell turtle FSHbeta shares identities of 97% with Reeves's turtle (Family of Bataguridae), 83-89% with birds, 61-70% with mammals, 63-66% with amphibians and 40-58% with fish. By contrast, when comparing the FSHbeta with the beta-subunits of the Chinese soft-shell turtle luteinizing hormone and thyroid stimulating hormone, the homologies are as low as 38 and 39%, respectively. A phylogenetic tree including reptilian species of FSHbeta subunits, is presented for the first time. Out of various tissues examined, FSHbeta mRNA was only expressed in the pituitary gland and can be up-regulated by gonadotropin-releasing hormone in pituitary tissue culture as estimated by fluorescence real-time PCR analysis.

Involvement of transcription factor encoded by the mouse mi locus (MITF) in apoptosis of cultured mast cells induced by removal of interleukin-3.

Science.gov (United States)

Tsujimura, T.; Hashimoto, K.; Morii, E.; Tunio, G. M.; Tsujino, K.; Kondo, T.; Kanakura, Y.; Kitamura, Y.

1997-01-01

Mast cells develop when spleen cells of mice are cultured in the medium containing interleukin (IL)-3. Cultured mast cells (CMCs) show apoptosis when they are incubated in the medium without IL-3. We obtained CMCs from tg/tg mice that did not express the transcription factor encoded by the mi gene (MITF) due to the integration of a transgene at its 5' flanking region. MITF is a member of the basic-helix-loop-helix-leucine zipper (bHLH-Zip) protein family of transcription factors. We investigated the effect of MITF on the apoptosis of CMCs after removal of IL-3. When cDNA encoding normal MITF ((+)-MITF) was introduced into tg/tg CMCs with the retroviral vector, the apoptosis of tg/tg CMCs was significantly accelerated. The mutant mi allele represents a deletion of an arginine at the basic domain of MITF. The apoptosis of tg/tg CMCs was not accelerated by the introduction of cDNA encoding mi-MITF. The overexpression of (+)-MITF was not prerequisite to the acceleration of the apoptosis, as the apoptotic process proceeded faster in +/+ CMCs than in mi/mi CMCs. The Ba/F3 lymphoid cell line is also dependent on IL-3, and Ba/F3 cells show apoptosis after removal of IL-3. The c-myc gene encodes another transcription factor of the bHLH-Zip family, and the overexpression of the c-myc gene accelerated the apoptosis of Ba/F3 cells. However, the overexpression of (+)-MITF did not accelerate the apoptosis of Ba/F3 cells. The (+)-MITF appeared to play some roles for the acceleration of the apoptosis specifically in the mast cell lineage. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:9327738

Deviating T-DNA transfer from Agrobacterium tumefaciens to plants

DEFF Research Database (Denmark)

van der Graaff, Eric; den Dulk-Ras, A; Hooykaas, P J

1996-01-01

-region. On the basis of the structure of the transferred DNA we propose that in these lines T-DNA transfer started at the left-border repeat, continued through the vector part, passed the right border repeat, and ended only after reaching again this left-border repeat.......We analyzed 29 T-DNA inserts in transgenic Arabidopsis thaliana plants for the junction of the right border sequences and the flanking plant DNA. DNA sequencing showed that in most lines the right border sequences transferred had been preserved during integration, corroborating literature data....... Surprisingly, in four independent transgenic lines a complete right border repeat was present followed by binary vector sequences. Cloning of two of these T-DNA inserts by plasmid rescue showed that in these lines the transferred DNA consisted of the complete binary vector sequences in addition to the T...

An improved ternary vector system for Agrobacterium-mediated rapid maize transformation.

Science.gov (United States)

Anand, Ajith; Bass, Steven H; Wu, Emily; Wang, Ning; McBride, Kevin E; Annaluru, Narayana; Miller, Michael; Hua, Mo; Jones, Todd J

2018-05-01

A simple and versatile ternary vector system that utilizes improved accessory plasmids for rapid maize transformation is described. This system facilitates high-throughput vector construction and plant transformation. The super binary plasmid pSB1 is a mainstay of maize transformation. However, the large size of the base vector makes it challenging to clone, the process of co-integration is cumbersome and inefficient, and some Agrobacterium strains are known to give rise to spontaneous mutants resistant to tetracycline. These limitations present substantial barriers to high throughput vector construction. Here we describe a smaller, simpler and versatile ternary vector system for maize transformation that utilizes improved accessory plasmids requiring no co-integration step. In addition, the newly described accessory plasmids have restored virulence genes found to be defective in pSB1, as well as added virulence genes. Testing of different configurations of the accessory plasmids in combination with T-DNA binary vector as ternary vectors nearly doubles both the raw transformation frequency and the number of transformation events of usable quality in difficult-to-transform maize inbreds. The newly described ternary vectors enabled the development of a rapid maize transformation method for elite inbreds. This vector system facilitated screening different origins of replication on the accessory plasmid and T-DNA vector, and four combinations were identified that have high (86-103%) raw transformation frequency in an elite maize inbred.

Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

Science.gov (United States)

Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

2004-09-09

We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

DNA-based machines.

Science.gov (United States)

Wang, Fuan; Willner, Bilha; Willner, Itamar

2014-01-01

The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.

Gene activation by induced DNA rearrangements

International Nuclear Information System (INIS)

Schnipper, L.E.; Chan, V.; Sedivy, J.; Jat, P.; Sharp, P.A.

1989-01-01

A murine cell line (EN/NIH) containing the retroviral vector ZIPNeoSV(x)1 that was modified by deletion of the enhancer elements in the viral long terminal repeats has been used as an assay system to detect induced DNA rearrangements that result in activation of a transcriptionally silent reporter gene encoded by the viral genome. The spontaneous frequency of G418 resistance is less than 10(-7), whereas exposure to the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) or the combination of UV irradiation plus TPA resulted in the emergence of drug resistant cell lines at a frequency of 5 per 10(6) and 67 per 10(6) cells, respectively. In several of the cell lines that were analyzed a low level of amplification of one of the two parental retroviral integrants was observed, whereas in others no alteration in the region of the viral genome was detected. To determine the effect of the SV40 large T antigen on induced DNA rearrangements, EN/NIH cells were transfected with a temperature sensitive (ts) mutant of SV40 T. Transfectants were maintained at the permissive temperature (33 degrees C) for varying periods of time (1-5 days) in order to vary SV40 T antigen exposure, after which they were shifted to 39.5 degrees C for selection in G418. The frequency of emergence of drug resistant cell clones increased with duration of exposure to large T antigen (9-52 per 10(6) cells over 1-5 days, respectively), and all cell lines analyzed demonstrated DNA rearrangements in the region of the neo gene. A novel 18-kilobase pair XbaI fragment was cloned from one cell line which revealed the presence of a 2.0-kilobase pair EcoRI segment containing an inverted duplication which hybridized to neo sequences. It is likely that the observed rearrangement was initiated by the specific binding of large T antigen to the SV40 origin of replication encoded within the viral genome

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Human Transcriptome and Chromatin Modifications: An ENCODE Perspective

Directory of Open Access Journals (Sweden)

Li Shen

2013-06-01

Full Text Available A decade-long project, led by several international research groups, called the Encyclopedia of DNA Elements (ENCODE, recently released an unprecedented amount of data. The ambitious project covers transcriptome, cistrome, epigenome, and interactome data from more than 1,600 sets of experiments in human. To make use of this valuable resource, it is important to understand the information it represents and the techniques that were used to generate these data. In this review, we introduce the data that ENCODE generated, summarize the observations from the data analysis, and revisit a computational approach that ENCODE used to predict gene expression, with a focus on the human transcriptome and its association with chromatin modifications.

Soybean phytase and nucleic acid encoding the same

OpenAIRE

1999-01-01

Isolated soybean phytase polypeptides and isolated nucleic acids encoding soybean phytases are provided. The invention is also directed to nucleic acid expression constructs, vectors, and host cells comprising the isolated soybean phytase nucleic acids, as well as methods for producing recombinant and non-recombinant purified soybean phytase. The invention also relates to transgenic plants expressing the soybean phytase, particularly expression under seed-specific expression control elements.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Construction of gateway-compatible yeast two-hybrid vectors for ...

African Journals Online (AJOL)

Yeast two-hybrid system combined with the gateway technology will greatly facilitate the cloning of interested DNA fragment into yeast two-hybrid vectors and therefore increase the efficiency of yeast two-hybrid analysis. In this study, we constructed a pair of Gateway-compatible yeast two-hybrid vectors pBTM116GW and ...

Identification of genes involved in DNA replication of the Autographa californica baculovirus

NARCIS (Netherlands)

Kool, M.; Ahrens, C. H.; Goldbach, R. W.; Rohrmann, G. F.; Vlak, J. M.

1994-01-01

By use of a transient replication assay, nine genes involved in DNA replication were identified in the genome of the Autographa californica baculovirus. Six genes encoding helicase, DNA polymerase, IE-1, LEF-1, LEF-2, and LEF-3 are essential for DNA replication while three genes encoding P35, IE-2,

Immunogenicity and protective efficacy of Semliki forest virus replicon-based DNA vaccines encoding goatpox virus structural proteins

International Nuclear Information System (INIS)

Zheng Min; Jin Ningyi; Liu Qi; Huo Xiaowei; Li Yang; Hu Bo; Ma Haili; Zhu Zhanbo; Cong Yanzhao; Li Xiao; Jin Minglan; Zhu Guangze

2009-01-01

Goatpox, caused by goatpox virus (GTPV), is an acute feverish and contagious disease in goats often associated with high morbidity and high mortality. To resolve potential safety risks and vaccination side effects of existing live attenuated goatpox vaccine (AV41), two Semliki forest virus (SFV) replicon-based bicistronic expression DNA vaccines (pCSm-AAL and pCSm-BAA) which encode GTPV structural proteins corresponding to the Vaccinia virus proteins A27, L1, A33, and B5, respectively, were constructed. Then, theirs ability to induce humoral and cellular response in mice and goats, and protect goats against virulent virus challenge were evaluated. The results showed that, vaccination with pCSm-AAL and pCSm-BAA in combination could elicit strong humoral and cellular responses in mice and goats, provide partial protection against viral challenge in goats, and reduce disease symptoms. Additionally, priming vaccination with the above-mentioned DNA vaccines could significantly reduce the goats' side reactions from boosting vaccinations with current live vaccine (AV41), which include skin lesions at the inoculation site and fevers. Data obtained in this study could not only facilitate improvement of the current goatpox vaccination strategy, but also provide valuable guidance to suitable candidates for evaluation and development of orthopoxvirus vaccines.

Production of lentiviral vectors

Directory of Open Access Journals (Sweden)

Otto-Wilhelm Merten

2016-01-01

Full Text Available Lentiviral vectors (LV have seen considerably increase in use as gene therapy vectors for the treatment of acquired and inherited diseases. This review presents the state of the art of the production of these vectors with particular emphasis on their large-scale production for clinical purposes. In contrast to oncoretroviral vectors, which are produced using stable producer cell lines, clinical-grade LV are in most of the cases produced by transient transfection of 293 or 293T cells grown in cell factories. However, more recent developments, also, tend to use hollow fiber reactor, suspension culture processes, and the implementation of stable producer cell lines. As is customary for the biotech industry, rather sophisticated downstream processing protocols have been established to remove any undesirable process-derived contaminant, such as plasmid or host cell DNA or host cell proteins. This review compares published large-scale production and purification processes of LV and presents their process performances. Furthermore, developments in the domain of stable cell lines and their way to the use of production vehicles of clinical material will be presented.

Evaluation of protective effect of multiantigenic DNA vaccine encoding MIC3 and ROP18 antigen segments of Toxoplasma gondii in mice.

Science.gov (United States)

Qu, Daofeng; Han, Jianzhong; Du, Aifang

2013-07-01

The high incidence and severe damage caused by Toxoplasma gondii infection clearly indicates the need for the development of a vaccine. In this study, we evaluated the immune responses and protection against toxoplasmosis by immunizing ICR mice with a multiantigenic DNA vaccine. To develop the multiantigenic vaccine, two T. gondii antigens, MIC3 and ROP18, selected on the basis of previous studies were chosen. ICR mice were immunized subcutaneously with PBS, empty pcDNA3.1 vector, pMIC3, pROP18, and pROP18-MIC3, respectively. The results of lymphocyte proliferation assay, cytokine, and antibody determinations showed that mice immunized with pROP18-MIC3 elicited stronger humoral and Th1-type cellular immune responses than those immunized with single-gene plasmids, empty plasmid, or phosphate-buffered saline. After a lethal challenge with the highly virulent T. gondii RH strain, a prolonged survival time in pROP18-MIC3-immunized mice was observed in comparison to control groups. Our study indicates that the introduction of multiantigenic DNA vaccine is more powerful and efficient than single-gene vaccine, and deserves further evaluation and development.

High-fidelity in vivo replication of DNA base shape mimics without Watson–Crick hydrogen bonds

Science.gov (United States)

Delaney, James C.; Henderson, Paul T.; Helquist, Sandra A.; Morales, Juan C.; Essigmann, John M.; Kool, Eric T.

2003-01-01

We report studies testing the importance of Watson–Crick hydrogen bonding, base-pair geometry, and steric effects during DNA replication in living bacterial cells. Nonpolar DNA base shape mimics of thymine and adenine (abbreviated F and Q, respectively) were introduced into Escherichia coli by insertion into a phage genome followed by transfection of the vector into bacteria. Genetic assays showed that these two base mimics were bypassed with moderate to high efficiency in the cells and with very high efficiency under damage-response (SOS induction) conditions. Under both sets of conditions, the T-shape mimic (F) encoded genetic information in the bacteria as if it were thymine, directing incorporation of adenine opposite it with high fidelity. Similarly, the A mimic (Q) directed incorporation of thymine opposite itself with high fidelity. The data establish that Watson–Crick hydrogen bonding is not necessary for high-fidelity replication of a base pair in vivo. The results suggest that recognition of DNA base shape alone serves as the most powerful determinant of fidelity during transfer of genetic information in a living organism. PMID:12676985

A PCR-Based Method to Construct Lentiviral Vector Expressing Double Tough Decoy for miRNA Inhibition.

Directory of Open Access Journals (Sweden)

Huiling Qiu

Full Text Available DNA vector-encoded Tough Decoy (TuD miRNA inhibitor is attracting increased attention due to its high efficiency in miRNA suppression. The current methods used to construct TuD vectors are based on synthesizing long oligonucleotides (~90 mer, which have been costly and problematic because of mutations during synthesis. In this study, we report a PCR-based method for the generation of double Tough Decoy (dTuD vector in which only two sets of shorter oligonucleotides (< 60 mer were used. Different approaches were employed to test the inhibitory potency of dTuDs. We demonstrated that dTuD is the most efficient method in miRNA inhibition in vitro and in vivo. Using this method, a mini dTuD library against 88 human miRNAs was constructed and used for a high-throughput screening (HTS of AP-1 pathway-related miRNAs. Seven miRNAs (miR-18b-5p, -101-3p, -148b-3p, -130b-3p, -186-3p, -187-3p and -1324 were identified as candidates involved in AP-1 pathway regulation. This novel method allows for an accurate and cost-effective generation of dTuD miRNA inhibitor, providing a powerful tool for efficient miRNA suppression in vitro and in vivo.

Prokaryotic DNA segregation by an actin-like filament

DEFF Research Database (Denmark)

Møller-Jensen, Jakob; Bugge Jensen, Rasmus; Löwe, Jan

2002-01-01

The mechanisms responsible for prokaryotic DNA segregation are largely unknown. The partitioning locus (par) encoded by the Escherichia coli plasmid R1 actively segregates its replicon to daughter cells. We show here that the ParM ATPase encoded by par forms dynamic actin-like filaments with prop...... point for ParM polymerization. Hence, we provide evidence for a simple prokaryotic analogue of the eukaryotic mitotic spindle apparatus.......The mechanisms responsible for prokaryotic DNA segregation are largely unknown. The partitioning locus (par) encoded by the Escherichia coli plasmid R1 actively segregates its replicon to daughter cells. We show here that the ParM ATPase encoded by par forms dynamic actin-like filaments...

[New strategy for RNA vectorization in mammalian cells. Use of a peptide vector].

Science.gov (United States)

Vidal, P; Morris, M C; Chaloin, L; Heitz, F; Divita, G

1997-04-01

A major barrier for gene delivery is the low permeability of nucleic acids to cellular membranes. The development of antisenses and gene therapy has focused mainly on improving methods of oligonucleotide or gene delivery to the cell. In this report we described a new strategy for RNA cell delivery, based on a short single peptide. This peptide vector is derived from both the fusion domain of the gp41 protein of HIV and the nuclear localization sequence of the SV40 large T antigen. This peptide vector localizes rapidly to the cytoplasm then to the nucleus of human fibroblasts (HS-68) within a few minutes and exhibits a high affinity for a single-stranded mRNA encoding the p66 subunit of the HIV-1 reverse transcriptase (in a 100 nM range). The peptide/RNA complex formation involves mainly electrostatic interactions between the basic residues of the peptide and the charges on the phosphate group of the RNA. In the presence of the peptide-vector fluorescently-labelled mRNA is delivered into the cytoplasm of mammalian cells (HS68 human fibroblasts) in less than 1 h with a relatively high efficiency (80%). This new concept based on a peptide-derived vector offers several advantages compared to other compounds commonly used in gene delivery. This vector is highly soluble and exhibits no cytotoxicity at the concentrations used for optimal gene delivery. This result clearly supports the fact that this peptide vector is a powerful tool and that it can be used widely, as much for laboratory research as for new applications and development in gene and/or antisense therapy.

Production of glycosylated physiologically normal human α1-antitrypsin by mouse fibroblasts modified by insertion of a human α1-antitrypsin cDNA using a retroviral vector

International Nuclear Information System (INIS)

Garver, R.I. Jr.; Chytil, A.; Karlsson, S.

1987-01-01

α 2 -Antitrypsin (α 1 AT) deficiency is a hereditary disorder characterized by reduced serum levels of α 1 AT, resulting in destruction of the lower respiratory tract by neutrophil elastase. As an approach to augment α 1 AT levels in this disorder with physiologically normal human α 1 AT, the authors have integrated a full-length normal human α 1 AT cDNA into the genome of mouse fibroblasts. To accomplish this, the retroviral vector N2 was modified by inserting the simian virus 40 early promoter followed by the α 1 AT cDNA. Southern analysis demonstrated that the intact cDNA was present in the genome of selected clones of the transfected murine fibroblasts psi2 and infected NIH 3T3. The clones produced three mRNA transcripts containing human α 1 AT sequences, secreted an α 1 AT molecule recognized by an anti-human α 1 AT antibody, with the same molecular mass as normal human α 1 AT and that complexed with and inhibited human neutrophil elastase. The psi2 produced α 1 AT was glycosylated, and when infused intravenously into mice, it had a serum half-life similar to normal α 1 AT purified from human plasma and markedly longer than that of nonglycosylated human α 1 AT cDNA-directed yeast-produced α 1 AT. These studies demonstrate the feasibility of using a retroviral vector to insert the normal human α 1 AT cDNA into non-α 1 AT-producing cells, resulting in the synthesis and secretion of physiologically normal α 1 AT

Amino acid "little Big Bang": representing amino acid substitution matrices as dot products of Euclidian vectors.

Science.gov (United States)

Zimmermann, Karel; Gibrat, Jean-François

2010-01-04

Sequence comparisons make use of a one-letter representation for amino acids, the necessary quantitative information being supplied by the substitution matrices. This paper deals with the problem of finding a representation that provides a comprehensive description of amino acid intrinsic properties consistent with the substitution matrices. We present a Euclidian vector representation of the amino acids, obtained by the singular value decomposition of the substitution matrices. The substitution matrix entries correspond to the dot product of amino acid vectors. We apply this vector encoding to the study of the relative importance of various amino acid physicochemical properties upon the substitution matrices. We also characterize and compare the PAM and BLOSUM series substitution matrices. This vector encoding introduces a Euclidian metric in the amino acid space, consistent with substitution matrices. Such a numerical description of the amino acid is useful when intrinsic properties of amino acids are necessary, for instance, building sequence profiles or finding consensus sequences, using machine learning algorithms such as Support Vector Machine and Neural Networks algorithms.

Amino acid "little Big Bang": Representing amino acid substitution matrices as dot products of Euclidian vectors

Directory of Open Access Journals (Sweden)

Zimmermann Karel

2010-01-01

Full Text Available Abstract Background Sequence comparisons make use of a one-letter representation for amino acids, the necessary quantitative information being supplied by the substitution matrices. This paper deals with the problem of finding a representation that provides a comprehensive description of amino acid intrinsic properties consistent with the substitution matrices. Results We present a Euclidian vector representation of the amino acids, obtained by the singular value decomposition of the substitution matrices. The substitution matrix entries correspond to the dot product of amino acid vectors. We apply this vector encoding to the study of the relative importance of various amino acid physicochemical properties upon the substitution matrices. We also characterize and compare the PAM and BLOSUM series substitution matrices. Conclusions This vector encoding introduces a Euclidian metric in the amino acid space, consistent with substitution matrices. Such a numerical description of the amino acid is useful when intrinsic properties of amino acids are necessary, for instance, building sequence profiles or finding consensus sequences, using machine learning algorithms such as Support Vector Machine and Neural Networks algorithms.

[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

Science.gov (United States)

Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

2010-10-01

This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

On Discrete Killing Vector Fields and Patterns on Surfaces

KAUST Repository

Ben-Chen, Mirela

2010-09-21

Symmetry is one of the most important properties of a shape, unifying form and function. It encodes semantic information on one hand, and affects the shape\\'s aesthetic value on the other. Symmetry comes in many flavors, amongst the most interesting being intrinsic symmetry, which is defined only in terms of the intrinsic geometry of the shape. Continuous intrinsic symmetries can be represented using infinitesimal rigid transformations, which are given as tangent vector fields on the surface - known as Killing Vector Fields. As exact symmetries are quite rare, especially when considering noisy sampled surfaces, we propose a method for relaxing the exact symmetry constraint to allow for approximate symmetries and approximate Killing Vector Fields, and show how to discretize these concepts for generating such vector fields on a triangulated mesh. We discuss the properties of approximate Killing Vector Fields, and propose an application to utilize them for texture and geometry synthesis. Journal compilation © 2010 The Eurographics Association and Blackwell Publishing Ltd.

Isolation of cDNA encoding a newly identified major allergenic protein of rye-grass pollen: intracellular targeting to the amyloplast.

Science.gov (United States)

Singh, M B; Hough, T; Theerakulpisut, P; Avjioglu, A; Davies, S; Smith, P M; Taylor, P; Simpson, R J; Ward, L D; McCluskey, J

1991-01-01

We have identified a major allergenic protein from rye-grass pollen, tentatively designated Lol pIb of 31kDa and with pI 9.0. A cDNA clone encoding Lol pIb has been isolated, sequenced, and characterized. Lol pIb is located mainly in the starch granules. This is a distinct allergen from Lol pI, which is located in the cytosol. Lol pIb is synthesized in pollen as a pre-allergen with a transit peptide targeting the allergen to amyloplasts. Epitope mapping of the fusion protein localized the IgE binding determinant in the C-terminal domain. Images PMID:1671715

Nanoparticle-mediated rhodopsin cDNA but not intron-containing DNA delivery causes transgene silencing in a rhodopsin knockout model.

Science.gov (United States)

Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao

2016-03-01

Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.

Analysis of the role of homology arms in gene-targeting vectors in human cells.

Directory of Open Access Journals (Sweden)

Ayako Ishii

Full Text Available Random integration of targeting vectors into the genome is the primary obstacle in human somatic cell gene targeting. Non-homologous end-joining (NHEJ, a major pathway for repairing DNA double-strand breaks, is thought to be responsible for most random integration events; however, absence of DNA ligase IV (LIG4, the critical NHEJ ligase, does not significantly reduce random integration frequency of targeting vector in human cells, indicating robust integration events occurring via a LIG4-independent mechanism. To gain insights into the mechanism and robustness of LIG4-independent random integration, we employed various types of targeting vectors to examine their integration frequencies in LIG4-proficient and deficient human cell lines. We find that the integration frequency of targeting vector correlates well with the length of homology arms and with the amount of repetitive DNA sequences, especially SINEs, present in the arms. This correlation was prominent in LIG4-deficient cells, but was also seen in LIG4-proficient cells, thus providing evidence that LIG4-independent random integration occurs frequently even when NHEJ is functionally normal. Our results collectively suggest that random integration frequency of conventional targeting vectors is substantially influenced by homology arms, which typically harbor repetitive DNA sequences that serve to facilitate LIG4-independent random integration in human cells, regardless of the presence or absence of functional NHEJ.

Sequential priming with simian immunodeficiency virus (SIV) DNA vaccines, with or without encoded cytokines, and a replicating adenovirus-SIV recombinant followed by protein boosting does not control a pathogenic SIVmac251 mucosal challenge.

Science.gov (United States)

Demberg, Thorsten; Boyer, Jean D; Malkevich, Nina; Patterson, L Jean; Venzon, David; Summers, Ebonita L; Kalisz, Irene; Kalyanaraman, V S; Lee, Eun Mi; Weiner, David B; Robert-Guroff, Marjorie

2008-11-01

Previously, combination DNA/nonreplicating adenovirus (Ad)- or poxvirus-vectored vaccines have strongly protected against SHIV(89.6P), DNAs expressing cytokines have modulated immunity elicited by DNA vaccines, and replication-competent Ad-recombinant priming and protein boosting has strongly protected against simian immunodeficiency virus (SIV) challenge. Here we evaluated a vaccine strategy composed of these promising components. Seven rhesus macaques per group were primed twice with multigenic SIV plasmid DNA with or without interleukin-12 (IL-12) DNA or IL-15 DNA. After a multigenic replicating Ad-SIV immunization, all groups received two booster immunizations with SIV gp140 and SIV Nef protein. Four control macaques received control DNA plasmids, empty Ad vector, and adjuvant. All vaccine components were immunogenic, but the cytokine DNAs had little effect. Macaques that received IL-15-DNA exhibited higher peak anti-Nef titers, a more rapid anti-Nef anamnestic response postchallenge, and expanded CD8(CM) T cells 2 weeks postchallenge compared to the DNA-only group. Other immune responses were indistinguishable between groups. Overall, no protection against intrarectal challenge with SIV(mac251) was observed, although immunized non-Mamu-A*01 macaques as a group exhibited a statistically significant 1-log decline in acute viremia compared to non-Mamu-A*01 controls. Possible factors contributing to the poor outcome include administration of cytokine DNAs to sites different from the Ad recombinants (intramuscular and intratracheal, respectively), too few DNA priming immunizations, a suboptimal DNA delivery method, failure to ensure delivery of SIV and cytokine plasmids to the same cell, and instability and short half-life of the IL-15 component. Future experiments should address these issues to determine if this combination approach is able to control a virulent SIV challenge.

SPATIAL-SPECTRAL CLASSIFICATION BASED ON THE UNSUPERVISED CONVOLUTIONAL SPARSE AUTO-ENCODER FOR HYPERSPECTRAL REMOTE SENSING IMAGERY

Directory of Open Access Journals (Sweden)

X. Han

2016-06-01

Full Text Available Current hyperspectral remote sensing imagery spatial-spectral classification methods mainly consider concatenating the spectral information vectors and spatial information vectors together. However, the combined spatial-spectral information vectors may cause information loss and concatenation deficiency for the classification task. To efficiently represent the spatial-spectral feature information around the central pixel within a neighbourhood window, the unsupervised convolutional sparse auto-encoder (UCSAE with window-in-window selection strategy is proposed in this paper. Window-in-window selection strategy selects the sub-window spatial-spectral information for the spatial-spectral feature learning and extraction with the sparse auto-encoder (SAE. Convolution mechanism is applied after the SAE feature extraction stage with the SAE features upon the larger outer window. The UCSAE algorithm was validated by two common hyperspectral imagery (HSI datasets – Pavia University dataset and the Kennedy Space Centre (KSC dataset, which shows an improvement over the traditional hyperspectral spatial-spectral classification methods.

The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes.

Science.gov (United States)

Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A

2010-07-01

WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.

The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

Science.gov (United States)

Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.

2010-01-01

WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

A DNA-Encoded Library of Chemical Compounds Based on Common Scaffolding Structures Reveals the Impact of Ligand Geometry on Protein Recognition.

Science.gov (United States)

Favalli, Nicholas; Biendl, Stefan; Hartmann, Marco; Piazzi, Jacopo; Sladojevich, Filippo; Gräslund, Susanne; Brown, Peter J; Näreoja, Katja; Schüler, Herwig; Scheuermann, Jörg; Franzini, Raphael; Neri, Dario

2018-06-01

A DNA-encoded chemical library (DECL) with 1.2 million compounds was synthesized by combinatorial reaction of seven central scaffolds with two sets of 343×492 building blocks. Library screening by affinity capture revealed that for some target proteins, the chemical nature of building blocks dominated the selection results, whereas for other proteins, the central scaffold also crucially contributed to ligand affinity. Molecules based on a 3,5-bis(aminomethyl)benzoic acid core structure were found to bind human serum albumin with a K d value of 6 nm, while compounds with the same substituents on an equidistant but flexible l-lysine scaffold showed 140-fold lower affinity. A 18 nm tankyrase-1 binder featured l-lysine as linking moiety, while molecules based on d-Lysine or (2S,4S)-amino-l-proline showed no detectable binding to the target. This work suggests that central scaffolds which predispose the orientation of chemical building blocks toward the protein target may enhance the screening productivity of encoded libraries. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Canine adenovirus type 2 vector generation via I-Sce1-mediated intracellular genome release.

Directory of Open Access Journals (Sweden)

Sandy Ibanes

Full Text Available When canine adenovirus type 2 (CAdV-2, or also commonly referred to as CAV-2 vectors are injected into the brain parenchyma they preferentially transduce neurons, are capable of efficient axonal transport to afferent regions, and allow transgene expression for at last >1 yr. Yet, translating these data into a user-friendly vector platform has been limited because CAV-2 vector generation is challenging. Generation of E1-deleted adenovirus vectors often requires transfection of linear DNA fragments of >30 kb containing the vector genome into an E1-transcomplementing cell line. In contrast to human adenovirus type 5 vector generation, CAV-2 vector generation is less efficient due, in part, to a reduced ability to initiate replication and poor transfectibility of canine cells with large, linear DNA fragments. To improve CAV-2 vector generation, we generated an E1-transcomplementing cell line expressing the estrogen receptor (ER fused to I-SceI, a yeast meganuclease, and plasmids containing the I-SceI recognition sites flanking the CAV-2 vector genome. Using transfection of supercoiled plasmid and intracellular genome release via 4-OH-tamoxifen-induced nuclear translocation of I-SceI, we improved CAV-2 vector titers 1,000 fold, and in turn increased the efficacy of CAV-2 vector generation.

Canine Adenovirus Type 2 Vector Generation via I-Sce1-Mediated Intracellular Genome Release

Science.gov (United States)

Ibanes, Sandy; Kremer, Eric J.

2013-01-01

When canine adenovirus type 2 (CAdV-2, or also commonly referred to as CAV-2) vectors are injected into the brain parenchyma they preferentially transduce neurons, are capable of efficient axonal transport to afferent regions, and allow transgene expression for at last >1 yr. Yet, translating these data into a user-friendly vector platform has been limited because CAV-2 vector generation is challenging. Generation of E1-deleted adenovirus vectors often requires transfection of linear DNA fragments of >30 kb containing the vector genome into an E1-transcomplementing cell line. In contrast to human adenovirus type 5 vector generation, CAV-2 vector generation is less efficient due, in part, to a reduced ability to initiate replication and poor transfectibility of canine cells with large, linear DNA fragments. To improve CAV-2 vector generation, we generated an E1-transcomplementing cell line expressing the estrogen receptor (ER) fused to I-SceI, a yeast meganuclease, and plasmids containing the I-SceI recognition sites flanking the CAV-2 vector genome. Using transfection of supercoiled plasmid and intracellular genome release via 4-OH-tamoxifen-induced nuclear translocation of I-SceI, we improved CAV-2 vector titers 1,000 fold, and in turn increased the efficacy of CAV-2 vector generation. PMID:23936483

Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

You Wanhui

2012-04-01

Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

To DNA, all information is equal

DEFF Research Database (Denmark)

Sennels, Lau; Bentin, Thomas

2012-01-01

Information storage capabilities are key in most aspects of society and the requirement for storage space is rapidly expanding. In principle, DNA could be a high-density medium for information storage. Church and coworkers recently demonstrated how binary data can be encoded, stored in, and retri......Information storage capabilities are key in most aspects of society and the requirement for storage space is rapidly expanding. In principle, DNA could be a high-density medium for information storage. Church and coworkers recently demonstrated how binary data can be encoded, stored in...

A mariner transposon vector adapted for mutagenesis in oral streptococci

DEFF Research Database (Denmark)

Nilsson, Martin; Christiansen, Natalia; Høiby, Niels

2014-01-01

This article describes the construction and characterization of a mariner-based transposon vector designed for use in oral streptococci, but with a potential use in other Gram-positive bacteria. The new transposon vector, termed pMN100, contains the temperature-sensitive origin of replication rep...... 5000 mutants was used in a screen to identify genes involved in the production of sucrose-dependent extracellular matrix components. Mutants with transposon inserts in genes encoding glycosyltransferases and the competence-related secretory locus were predominantly found in this screen....

DNA cloning: a practical approach. Volume 1

Energy Technology Data Exchange (ETDEWEB)

Glover, D M [ed.

1985-01-01

This book is written for the advanced molecular biologist who needs a detailed discussion of cloning technology. Topics of discussion include: genomic library cloning (size of a genomic library, screening methods, chromosome walking, host cell genetics, and general features of bacteriophage Iambda); use of gt10 and gt11 cDNA lambda vectors and general cDNA cloning; RNase H-Pol I cDNA synthesis; method of detecting fusion proteins produced in bacteria; pEMBL family of double-stranded plasmid vectors that can be used to generate single strands; Escherichia coli transformation; production of mutations in cloned sequences; and cloning in gram negative bacteria.

The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

Science.gov (United States)

Leem, S H; Ropp, P A; Sugino, A

1994-08-11

We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.

Transient gene transfer to neurons and glia : analysis of adenoviral vector performance in the CNS and PNS

NARCIS (Netherlands)

Hermens, W.T.J.M.C.; Giger, Roman J; Holtmaat, Anthony J D G; Dijkhuizen, Paul A; Houweling, D A; Verhaagen, J

In this paper a detailed protocol is presented for neuroscientists planning to start work on first generation recombinant adenoviral vectors as gene transfer agents for the nervous system. The performance of a prototype adenoviral vector encoding the bacterial lacZ gene as a reporter was studied,

Lentivector Integration Sites in Ependymal Cells From a Model of Metachromatic Leukodystrophy: Non-B DNA as a New Factor Influencing Integration

Science.gov (United States)

McAllister, Robert G; Liu, Jiahui; Woods, Matthew W; Tom, Sean K; Rupar, C Anthony; Barr, Stephen D

2014-01-01

The blood–brain barrier controls the passage of molecules from the blood into the central nervous system (CNS) and is a major challenge for treatment of neurological diseases. Metachromatic leukodystrophy is a neurodegenerative lysosomal storage disease caused by loss of arylsulfatase A (ARSA) activity. Gene therapy via intraventricular injection of a lentiviral vector is a potential approach to rapidly and permanently deliver therapeutic levels of ARSA to the CNS. We present the distribution of integration sites of a lentiviral vector encoding human ARSA (LV-ARSA) in murine brain choroid plexus and ependymal cells, administered via a single intracranial injection into the CNS. LV-ARSA did not exhibit a strong preference for integration in or near actively transcribed genes, but exhibited a strong preference for integration in or near satellite DNA. We identified several genomic hotspots for LV-ARSA integration and identified a consensus target site sequence characterized by two G-quadruplex-forming motifs flanking the integration site. In addition, our analysis identified several other non-B DNA motifs as new factors that potentially influence lentivirus integration, including human immunodeficiency virus type-1 in human cells. Together, our data demonstrate a clinically favorable integration site profile in the murine brain and identify non-B DNA as a potential new host factor that influences lentiviral integration in murine and human cells. PMID:25158091

Engineering BioBrick vectors from BioBrick parts

Directory of Open Access Journals (Sweden)

Knight Thomas F

2008-04-01

Full Text Available Abstract Background The underlying goal of synthetic biology is to make the process of engineering biological systems easier. Recent work has focused on defining and developing standard biological parts. The technical standard that has gained the most traction in the synthetic biology community is the BioBrick standard for physical composition of genetic parts. Parts that conform to the BioBrick assembly standard are BioBrick standard biological parts. To date, over 2,000 BioBrick parts have been contributed to, and are available from, the Registry of Standard Biological Parts. Results Here we extended the same advantages of BioBrick standard biological parts to the plasmid-based vectors that are used to provide and propagate BioBrick parts. We developed a process for engineering BioBrick vectors from BioBrick parts. We designed a new set of BioBrick parts that encode many useful vector functions. We combined the new parts to make a BioBrick base vector that facilitates BioBrick vector construction. We demonstrated the utility of the process by constructing seven new BioBrick vectors. We also successfully used the resulting vectors to assemble and propagate other BioBrick standard biological parts. Conclusion We extended the principles of part reuse and standardization to BioBrick vectors. As a result, myriad new BioBrick vectors can be readily produced from all existing and newly designed BioBrick parts. We invite the synthetic biology community to (1 use the process to make and share new BioBrick vectors; (2 expand the current collection of BioBrick vector parts; and (3 characterize and improve the available collection of BioBrick vector parts.

Multigenic lentiviral vectors for combined and tissue-specific expression of miRNA- and protein-based antiangiogenic factors

Directory of Open Access Journals (Sweden)

Anne Louise Askou

Full Text Available Lentivirus-based gene delivery vectors carrying multiple gene cassettes are powerful tools in gene transfer studies and gene therapy, allowing coexpression of multiple therapeutic factors and, if desired, fluorescent reporters. Current strategies to express transgenes and microRNA (miRNA clusters from a single vector have certain limitations that affect transgene expression levels and/or vector titers. In this study, we describe a novel vector design that facilitates combined expression of therapeutic RNA- and protein-based antiangiogenic factors as well as a fluorescent reporter from back-to-back RNApolII-driven expression cassettes. This configuration allows effective production of intron-embedded miRNAs that are released upon transduction of target cells. Exploiting such multigenic lentiviral vectors, we demonstrate robust miRNA-directed downregulation of vascular endothelial growth factor (VEGF expression, leading to reduced angiogenesis, and parallel impairment of angiogenic pathways by codelivering the gene encoding pigment epithelium-derived factor (PEDF. Notably, subretinal injections of lentiviral vectors reveal efficient retinal pigment epithelium-specific gene expression driven by the VMD2 promoter, verifying that multigenic lentiviral vectors can be produced with high titers sufficient for in vivo applications. Altogether, our results suggest the potential applicability of combined miRNA- and protein-encoding lentiviral vectors in antiangiogenic gene therapy, including new combination therapies for amelioration of age-related macular degeneration.

Large-scale adenovirus and poxvirus-vectored vaccine manufacturing to enable clinical trials.

Science.gov (United States)

Kallel, Héla; Kamen, Amine A

2015-05-01

Efforts to make vaccines against infectious diseases and immunotherapies for cancer have evolved to utilize a variety of heterologous expression systems such as viral vectors. These vectors are often attenuated or engineered to safely deliver genes encoding antigens of different pathogens. Adenovirus and poxvirus vectors are among the viral vectors that are most frequently used to develop prophylactic vaccines against infectious diseases as well as therapeutic cancer vaccines. This mini-review describes the trends and processes in large-scale production of adenovirus and poxvirus vectors to meet the needs of clinical applications. We briefly describe the general principles for the production and purification of adenovirus and poxvirus viral vectors. Currently, adenovirus and poxvirus vector manufacturing methods rely on well-established cell culture technologies. Several improvements have been evaluated to increase the yield and to reduce the overall manufacturing cost, such as cultivation at high cell densities and continuous downstream processing. Additionally, advancements in vector characterization will greatly facilitate the development of novel vectored vaccine candidates. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Synthesis and characterization of a lamellar hydroxyapatite/DNA nanohybrid

Energy Technology Data Exchange (ETDEWEB)

Zuo Guifu; Wan Yizao; Meng Xianguang [School of Materials Science and Engineering, Tianjin University, Tianjin 300072 (China); Zhao Qing [School of Agriculture and Bioengineering, Tianjin University, Tianjin 300072 (China); Ren Kaijing [Department of Joint Surgery, Tianjin Hospital, Tianjin 300211 (China); Jia Shiru [Key Laboratory of Industrial Microbiology, Ministry of Education, Tianjin University of Science and Technology, 29, 13th Street, TEDA, Tianjin 300457 (China); Wang Jiehua, E-mail: gfzuo@tju.edu.cn [School of Agriculture and Bioengineering, Tianjin University, Tianjin 300072 (China)

2011-04-15

Research highlights: {yields} A lamellar hydroxyapatite (HAp)/DNA nanohybrid was prepared as a novel gene delivering vector. {yields} Gel electrophoresis analysis confirmed that the lamellar HAp could protect DNA from degradation of DNase I. {yields} The protected DNA in the HAp/DNA nanohybrid could be recovered readily under acid conditions. - Abstract: Two-dimensional layered materials exhibit desired functionalities when being used as gene delivery materials. In this study, a novel gene delivering vector, lamellar hydroxyapatite (HAp)/DNA nanohybrid was prepared. The structure of HAp/DNA nanohybrid was investigated by X-ray diffraction (XRD), scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Fourier transform infrared (FT-IR) spectroscopy analysis revealed that ion-exchange occurred during the process. Gel electrophoresis analysis confirmed that the lamellar HAp could protect DNA from degradation of DNase I and the protected DNA could be recovered readily under acid conditions. Furthermore, the integrity of released DNA was confirmed by UV-vis spectra.

Synthesis and characterization of a lamellar hydroxyapatite/DNA nanohybrid

International Nuclear Information System (INIS)

Zuo Guifu; Wan Yizao; Meng Xianguang; Zhao Qing; Ren Kaijing; Jia Shiru; Wang Jiehua

2011-01-01

Research highlights: → A lamellar hydroxyapatite (HAp)/DNA nanohybrid was prepared as a novel gene delivering vector. → Gel electrophoresis analysis confirmed that the lamellar HAp could protect DNA from degradation of DNase I. → The protected DNA in the HAp/DNA nanohybrid could be recovered readily under acid conditions. - Abstract: Two-dimensional layered materials exhibit desired functionalities when being used as gene delivery materials. In this study, a novel gene delivering vector, lamellar hydroxyapatite (HAp)/DNA nanohybrid was prepared. The structure of HAp/DNA nanohybrid was investigated by X-ray diffraction (XRD), scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Fourier transform infrared (FT-IR) spectroscopy analysis revealed that ion-exchange occurred during the process. Gel electrophoresis analysis confirmed that the lamellar HAp could protect DNA from degradation of DNase I and the protected DNA could be recovered readily under acid conditions. Furthermore, the integrity of released DNA was confirmed by UV-vis spectra.

The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase

Directory of Open Access Journals (Sweden)

Santos Diógenes S

2008-04-01

Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and

Oxidants and not alkylating agents induce rapid mtDNA loss and mitochondrial dysfunction

Science.gov (United States)

Furda, Amy M.; Marrangoni, Adele M.; Lokshin, Anna; Van Houten, Bennett

2013-01-01

Mitochondrial DNA (mtDNA) is essential for proper mitochondrial function and encodes 22 tRNAs, 2 rRNAs and 13 polypeptides that make up subunits of complex I, III, IV, in the electron transport chain and complex V, the ATP synthase. Although mitochondrial dysfunction has been implicated in processes such as premature aging, neurodegeneration, and cancer, it has not been shown whether persistent mtDNA damage causes a loss of oxidative phosphorylation. We addressed this question by treating mouse embryonic fibroblasts with either hydrogen peroxide (H2O2) or the alkylating agent methyl methanesulfonate (MMS) and measuring several endpoints, including mtDNA damage and repair rates using QPCR, levels of mitochondrial- and nuclear-encoded proteins using antibody analysis, and a pharmacologic profile of mitochondria using the Seahorse Extracellular Flux Analyzer. We show that a 60 min treatment with H2O2 causes persistent mtDNA lesions, mtDNA loss, decreased levels of a nuclear-encoded mitochondrial subunit, a loss of ATP-linked oxidative phosphorylation and a loss of total reserve capacity. Conversely, a 60 min treatment with 2 mM MMS causes persistent mtDNA lesions but no mtDNA loss, no decrease in levels of a nuclear-encoded mitochondrial subunit, and no mitochondrial dysfunction. These results suggest that persistent mtDNA damage is not sufficient to cause mitochondrial dysfunction. PMID:22766155

Construction and Identification of a Recombinant Plasmid Encoding Echinococcus granulosus Oncosphere Antigen (EG95Abstract Background: Cystic echinococcosis (CE, as a zoonotic disease cause to health threat and economic losses. Despite implemented cont

Directory of Open Access Journals (Sweden)

Nahideh MAZAHERI

2017-12-01

Full Text Available AbstractBackground: Cystic echinococcosis (CE, as a zoonotic disease cause to health threat and economic losses. Despite implemented control programs, few countries have been able to decrease or eliminate this infection. Vaccination of the intermediate host offers an additional strategy to control the parasite transmission and EG95 antigen is considered more than the others in the vaccine issue. According to the high protection induced by the EG95 recombinant vaccine, this study was designed to construct recombinant plasmid formulation of EG95 antigen.Methods: In 2015, the Echinococcus granulosus eggs were recovered from an infected dog in Parasitological laboratory of Tarbiat Modares University in Tehran, Iran. Following hatching, the oncospheres of E. granulosus were activated to increase the presence of the desired mRNA. The extracted mRNA was transcribed to the cDNA which used as template in RT-PCR. Then the EG95 gene cloned into pET28a vector and the recombinant plasmids expression was  investigated in prokaryotic and eukaryotic cells.Results:  The recombinant plasmid encoding EG95 antigen was successfully constructed and identified by PCR, restriction enzyme digestion and sequencing. In vitro expression of the EG95 antigen was confirmed in prokary­otic and eukaryotic systems by SDS-PAGE and western blotting analysis.Conclusion: Because of potential advantages of DNA vaccines, including ability to induce long-term immune responses, low production cost and stability in different temperatures, this study carried out to construct the EG95 gene into a vector. This recombinant vector can be evaluated in further studies as a DNA vaccine may provide new prospects for the development of a vaccine against cystic hydatid disease.

DNA repair and cancer

International Nuclear Information System (INIS)

Rathore, Shakuntla; Joshi, Pankaj Kumar; Gaur, Sudha

2012-01-01

DNA repair refers to a collection of processes by which a cell identifies and corrects damage to the DNA molecule that encode it's genome. In human cells, both normal metabolic activities and environmental factors such as UV light and radiation can cause DNA damage, resulting in as many one million individual molecular lesions per day. Many of these lesions cause structural damage to the DNA molecule and can alter or eliminate the cell's ability to transcribe the gene that the affected DNA encodes. Other lesions include potentially harmful mutation in cell's genome which affect the survival of it's daughter cells after it undergoes mitosis. As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. Inherited mutation that affect DNA repair genes are strongly associated with high cancer risks in humans. Hereditary non polyposis colorectal cancer (HNPCC) is strongly associated with specific mutation in the DNA mismatch repair pathway. BRCA1, BRCA2 two famous mutation conferring a hugely increased risk of breast cancer on carrier, are both associated with a large number of DNA repair pathway, especially NHEJ and homologous recombination. Cancer therapy procedures such as chemotherapy and radiotherapy work by overwhelming the capacity of the cell to repair DNA damage, resulting in cell death. Cells that are most rapidly dividing most typically cancer cells are preferentially affected. The side effect is that other non-cancerous but rapidly dividing cells such as stem cells in the bone marrow are also affected. Modern cancer treatment attempt to localize the DNA damage to cells and tissue only associated with cancer, either by physical means (concentrating the therapeutic agent in the region of the tumor) or by biochemical means (exploiting a feature unique to cancer cells in the body). (author)

Secretion of mature mouse interleukin-2 by Saccharomyces cerevisiae: use of a general secretion vector containing promoter and leader sequences of the mating pheromone alpha-factor.

Science.gov (United States)

Miyajima, A; Bond, M W; Otsu, K; Arai, K; Arai, N

1985-01-01

We have constructed a general expression vector which allows the synthesis and secretion of processed gene products in Saccharomyces cerevisiae. This vector contains yeast DNA, including the promoter of the mating pheromone (alpha-factor), its downstream leader sequence, and the TRP5 terminator. A cDNA [encoding mature mouse interleukin-2 (IL-2); Yokota et al., Proc. Natl. Acad. Sci. USA 82 (1984) 68-72] was fused immediately downstream to the alpha-factor leader sequence. The resulting recombinant plasmid directed the synthesis of mature mouse IL-2 in S. cerevisiae, with most of the T-cell growth-factor (TCGF) activity secreted into the culture fluid and extracellular space. TCGF activities in the cell extract, as well as in the culture fluid, increased in parallel with cell growth. Production of mature mouse IL-2 was inhibited by tunicamycin (TM), with precursor molecules accumulating in the cell extract. The precursor was processed accurately at the junction between the alpha-factor peptide leader sequence and the coding sequence downstream, yielding mature IL-2. The Mr of the secreted mouse IL-2 determined by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) was 17 kDal, a value expected for the mature mouse IL-2 polypeptide based on the nucleotide (nt) sequence.

Yeast DNA-repair gene RAD14 encodes a zinc metalloprotein with affinity for ultraviolet-damaged DNA

International Nuclear Information System (INIS)

Guzder, S.N.; Sung, P.; Prakash, S.; Prakash, L.

1993-01-01

Xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers due to a defect in excision repair of UV light-damaged DNA. Of the seven XP complementation groups, A--G, group A represents a severe and frequent form of the disease. The Saccharomyces cerevisiae RAD14 gene is a homolog of the XP-A correcting (XPAC) gene. Like XP-A cells, rad14-null mutants are defective in the incision step of excision repair of UV-damaged DNA. The authors have purified RAD14 protein to homogeneity from extract of a yeast strain genetically tailored to overexpress RAD14. As determined by atomic emission spectroscopy, RAD14 contains one zinc atom. They also show in vitro that RAD14 binds zinc but does not bind other divalent metal ions. In DNA mobility-shift assays, RAD14 binds specifically to UV-damaged DNA. Removal of cyclobutane pyrimidine dimers from damaged DNA by enzymatic photoreactivation has no effect on binding, strongly suggesting that RAD14 recognizes pyrimidine(6-4)pyrimidone photoproduct sites. These findings indicate that RAD14 functions in damage recognition during excision repair. 37 refs., 4 figs

DNA controlled assembly of liposomes

DEFF Research Database (Denmark)

Vogel, Stefan; Jakobsen, Ulla; Simonsen, Adam Cohen

2009-01-01

DNA-encoding of solid nanoparticles requires surfacechemistry, which is often tedious and not generally applicable. In the present study non-covalently attached DNA are used to assemble soft nanoparticles (liposomes) in solution. This process displays remarkably sharp thermal transitions from...... assembled to disassembled state for which reason this method allows easy and fast detection of polynucleotides (e.g. DNA or RNA), including single nucleotide polymorphisms as well as insertions and deletions....

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Next-generation digital information storage in DNA.

Science.gov (United States)

Church, George M; Gao, Yuan; Kosuri, Sriram

2012-09-28

Digital information is accumulating at an astounding rate, straining our ability to store and archive it. DNA is among the most dense and stable information media known. The development of new technologies in both DNA synthesis and sequencing make DNA an increasingly feasible digital storage medium. We developed a strategy to encode arbitrary digital information in DNA, wrote a 5.27-megabit book using DNA microchips, and read the book by using next-generation DNA sequencing.

A new baseline for fascioliasis in Venezuela: lymnaeid vectors ascertained by DNA sequencing and analysis of their relationships with human and animal infection

Science.gov (United States)

2011-01-01

Background Human and animal fascioliasis poses serious public health problems in South America. In Venezuela, livestock infection represents an important veterinary problem whereas there appear to be few human cases reported, most of which are passively detected in health centres. However, results of recent surveys suggest that the situation may be underestimated in particular areas. To obtain a baseline for future fascioliasis assessment, studies were undertaken by means of rDNA ITS-2 and ITS-1 and mtDNA cox1 sequencing to clarify the specific status of Venezuelan lymnaeids, their geographical distribution and fascioliasis transmission capacity, by comparison with other American countries and other continents. Results Results obtained completely change the lymnaeid scenario known so far. The relatively rich lymnaeid fauna of Venezuela has been proven to include (i) Lymnaea meridensis and L. neotropica as the only native members, (ii) L. cubensis and Pseudosuccinea columella introduced from the Caribbean area, and (iii) Galba truncatula and L. schirazensis introduced from the Old World. The absence of representatives of the stagnicoline and Radix groups is remarkable. Four species are fascioliasis vectors: G. truncatula, L. cubensis and L. neotropica, which have the capacity to give rise to human endemic areas, and P. columella, which is a source of animal infection and is responsible for the spread of disease. Vector capacity in the apparently highland endemic L. meridensis is to be confimed, although may be expected given its phylogenetic relationships. Similarly as elsewhere, the non-transmitting L. schirazensis has been confused with L. cubensis, also with G. truncatula and possibly with L. neotropica. Conclusions The new scenario leads to the re-opening of many disease aspects. In Venezuela, altitude appears to be the main factor influencing fascioliasis distribution. Human infection shows an altitude pattern similar to other Andean countries, although a

A new baseline for fascioliasis in Venezuela: lymnaeid vectors ascertained by DNA sequencing and analysis of their relationships with human and animal infection.

Science.gov (United States)

Bargues, M Dolores; González, L Carolina; Artigas, Patricio; Mas-Coma, Santiago

2011-10-14

Human and animal fascioliasis poses serious public health problems in South America. In Venezuela, livestock infection represents an important veterinary problem whereas there appear to be few human cases reported, most of which are passively detected in health centres. However, results of recent surveys suggest that the situation may be underestimated in particular areas. To obtain a baseline for future fascioliasis assessment, studies were undertaken by means of rDNA ITS-2 and ITS-1 and mtDNA cox1 sequencing to clarify the specific status of Venezuelan lymnaeids, their geographical distribution and fascioliasis transmission capacity, by comparison with other American countries and other continents. Results obtained completely change the lymnaeid scenario known so far. The relatively rich lymnaeid fauna of Venezuela has been proven to include (i) Lymnaea meridensis and L. neotropica as the only native members, (ii) L. cubensis and Pseudosuccinea columella introduced from the Caribbean area, and (iii) Galba truncatula and L. schirazensis introduced from the Old World. The absence of representatives of the stagnicoline and Radix groups is remarkable. Four species are fascioliasis vectors: G. truncatula, L. cubensis and L. neotropica, which have the capacity to give rise to human endemic areas, and P. columella, which is a source of animal infection and is responsible for the spread of disease. Vector capacity in the apparently highland endemic L. meridensis is to be confimed, although may be expected given its phylogenetic relationships. Similarly as elsewhere, the non-transmitting L. schirazensis has been confused with L. cubensis, also with G. truncatula and possibly with L. neotropica. The new scenario leads to the re-opening of many disease aspects. In Venezuela, altitude appears to be the main factor influencing fascioliasis distribution. Human infection shows an altitude pattern similar to other Andean countries, although a differing highland/lowland impact on

Viral Hybrid Vectors for Somatic Integration - Are They the Better Solution?

Directory of Open Access Journals (Sweden)

Anja Ehrhardt

2009-12-01

Full Text Available The turbulent history of clinical trials in viral gene therapy has taught us important lessons about vector design and safety issues. Much effort was spent on analyzing genotoxicity after somatic integration of therapeutic DNA into the host genome. Based on these findings major improvements in vector design including the development of viral hybrid vectors for somatic integration have been achieved. This review provides a state-of-the-art overview of available hybrid vectors utilizing viruses for high transduction efficiencies in concert with various integration machineries for random and targeted integration patterns. It discusses advantages but also limitations of each vector system.

Modular verification of chemical reaction network encodings via serializability analysis

Science.gov (United States)

Lakin, Matthew R.; Stefanovic, Darko; Phillips, Andrew

2015-01-01

Chemical reaction networks are a powerful means of specifying the intended behaviour of synthetic biochemical systems. A high-level formal specification, expressed as a chemical reaction network, may be compiled into a lower-level encoding, which can be directly implemented in wet chemistry and may itself be expressed as a chemical reaction network. Here we present conditions under which a lower-level encoding correctly emulates the sequential dynamics of a high-level chemical reaction network. We require that encodings are transactional, such that their execution is divided by a “commit reaction” that irreversibly separates the reactant-consuming phase of the encoding from the product-generating phase. We also impose restrictions on the sharing of species between reaction encodings, based on a notion of “extra tolerance”, which defines species that may be shared between encodings without enabling unwanted reactions. Our notion of correctness is serializability of interleaved reaction encodings, and if all reaction encodings satisfy our correctness properties then we can infer that the global dynamics of the system are correct. This allows us to infer correctness of any system constructed using verified encodings. As an example, we show how this approach may be used to verify two- and four-domain DNA strand displacement encodings of chemical reaction networks, and we generalize our result to the limit where the populations of helper species are unlimited. PMID:27325906

Genetic analysis of RPA single-stranded DNA binding protein in Haloferax volcanii

OpenAIRE

Stroud, A. L.

2012-01-01

Replication protein A (RPA) is a single-stranded DNA-binding protein that is present in all three domains of life. The roles of RPA include stabilising and protecting single- stranded DNA from nuclease degradation during DNA replication and repair. To achieve this, RPA uses an oligosaccharide-binding fold (OB fold) to bind single- stranded DNA. Haloferax volcanii encodes three RPAs – RPA1, RPA2 and RPA3, of which rpa1 and rpa3 are in operons with genes encoding associated proteins (APs). ...

C-terminal phenylalanine of bacteriophage T7 single-stranded DNA-binding protein is essential for strand displacement synthesis by T7 DNA polymerase at a nick in DNA.

Science.gov (United States)

Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C

2009-10-30

Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.

C-terminal Phenylalanine of Bacteriophage T7 Single-stranded DNA-binding Protein Is Essential for Strand Displacement Synthesis by T7 DNA Polymerase at a Nick in DNA*

Science.gov (United States)

Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.

2009-01-01

Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688

Molecular cloning of a cDNA encoding the precursor of adenoregulin from frog skin. Relationships with the vertebrate defensive peptides, dermaseptins.

Science.gov (United States)

Amiche, M; Ducancel, F; Lajeunesse, E; Boulain, J C; Ménez, A; Nicolas, P

1993-03-31

Adenoregulin has recently been isolated from Phyllomedusa skin as a 33 amino acid residues peptide which enhanced binding of agonists to the A1 adenosine receptor. In order to study the structure of the precursor of adenoregulin we constructed a cDNA library from mRNAs extracted from the skin of Phyllomedusa bicolor. We detected the complete nucleotide sequence of a cDNA encoding the adenoregulin biosynthetic precursor. The deduced sequence of the precursor is 81 amino acids long, exhibits a putative signal sequence at the NH2 terminus and contains a single copy of the biologically active peptide at the COOH terminus. Structural and conformational homologies that are observed between adenoregulin and the dermaseptins, antimicrobial peptides exhibiting strong membranolytic activities against various pathogenic agents, suggest that adenoregulin is an additional member of the growing family of cytotropic antimicrobial peptides that allow vertebrate animals to defend themselves against microorganisms. As such, the adenosine receptor regulating activity of adenoregulin could be due to its ability to interact with and disrupt membranes lipid bilayers.

Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

Science.gov (United States)

Stevens, Mark; Viganó, Felicita

2007-04-01

The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

International Nuclear Information System (INIS)

Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

1988-01-01

A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

New gorilla adenovirus vaccine vectors induce potent immune responses and protection in a mouse malaria model.

Science.gov (United States)

Limbach, Keith; Stefaniak, Maureen; Chen, Ping; Patterson, Noelle B; Liao, Grant; Weng, Shaojie; Krepkiy, Svetlana; Ekberg, Greg; Torano, Holly; Ettyreddy, Damodar; Gowda, Kalpana; Sonawane, Sharvari; Belmonte, Arnel; Abot, Esteban; Sedegah, Martha; Hollingdale, Michael R; Moormann, Ann; Vulule, John; Villasante, Eileen; Richie, Thomas L; Brough, Douglas E; Bruder, Joseph T

2017-07-03

A DNA-human Ad5 (HuAd5) prime-boost malaria vaccine has been shown to protect volunteers against a controlled human malaria infection. The potency of this vaccine, however, appeared to be affected by the presence of pre-existing immunity against the HuAd5 vector. Since HuAd5 seroprevalence is very high in malaria-endemic areas of the world, HuAd5 may not be the most appropriate malaria vaccine vector. This report describes the evaluation of the seroprevalence, immunogenicity and efficacy of three newly identified gorilla adenoviruses, GC44, GC45 and GC46, as potential malaria vaccine vectors. The seroprevalence of GC44, GC45 and GC46 is very low, and the three vectors are not efficiently neutralized by human sera from Kenya and Ghana, two countries where malaria is endemic. In mice, a single administration of GC44, GC45 and GC46 vectors expressing a murine malaria gene, Plasmodium yoelii circumsporozoite protein (PyCSP), induced robust PyCSP-specific T cell and antibody responses that were at least as high as a comparable HuAd5-PyCSP vector. Efficacy studies in a murine malaria model indicated that a prime-boost regimen with DNA-PyCSP and GC-PyCSP vectors can protect mice against a malaria challenge. Moreover, these studies indicated that a DNA-GC46-PyCSP vaccine regimen was significantly more efficacious than a DNA-HuAd5-PyCSP regimen. These data suggest that these gorilla-based adenovectors have key performance characteristics for an effective malaria vaccine. The superior performance of GC46 over HuAd5 highlights its potential for clinical development.

Prime-boost vaccination with heterologous live vectors encoding SIV gag and multimeric HIV-1 gp160 protein: efficacy against repeated mucosal R5 clade C SHIV challenges.

Science.gov (United States)

Lakhashe, Samir K; Velu, Vijayakumar; Sciaranghella, Gaia; Siddappa, Nagadenahalli B; Dipasquale, Janet M; Hemashettar, Girish; Yoon, John K; Rasmussen, Robert A; Yang, Feng; Lee, Sandra J; Montefiori, David C; Novembre, Francis J; Villinger, François; Amara, Rama Rao; Kahn, Maria; Hu, Shiu-Lok; Li, Sufen; Li, Zhongxia; Frankel, Fred R; Robert-Guroff, Marjorie; Johnson, Welkin E; Lieberman, Judy; Ruprecht, Ruth M

2011-08-05

We sought to induce primate immunodeficiency virus-specific cellular and neutralizing antibody (nAb) responses in rhesus macaques (RM) through a bimodal vaccine approach. RM were immunized intragastrically (i.g.) with the live-attenuated Listeria monocytogenes (Lm) vector Lmdd-BdopSIVgag encoding SIVmac239 gag. SIV Gag-specific cellular responses were boosted by intranasal and intratracheal administration of replication-competent adenovirus (Ad5hr-SIVgag) encoding the same gag. To broaden antiviral immunity, the RM were immunized with multimeric HIV clade C (HIV-C) gp160 and HIV Tat. SIV Gag-specific cellular immune responses and HIV-1 nAb developed in some RM. The animals were challenged intrarectally with five low doses of R5 SHIV-1157ipEL-p, encoding a heterologous HIV-C Env (22.1% divergent to the Env immunogen). All five controls became viremic. One out of ten vaccinees was completely protected and another had low peak viremia. Sera from the completely and partially protected RM neutralized the challenge virus > 90%; these RM also had strong SIV Gag-specific proliferation of CD8⁺ T cells. Peak and area under the curve of plasma viremia (during acute phase) among vaccinees was lower than for controls, but did not attain significance. The completely protected RM showed persistently low numbers of the α4β7-expressing CD4⁺ T cells; the latter have been implicated as preferential virus targets in vivo. Thus, vaccine-induced immune responses and relatively lower numbers of potential target cells were associated with protection. Copyright © 2011 Elsevier Ltd. All rights reserved.

A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.

Science.gov (United States)

Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu

2015-05-01

Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Adenovirus Vector-Derived VA-RNA-Mediated Innate Immune Responses

Directory of Open Access Journals (Sweden)

Hiroyuki Mizuguchi

2011-07-01

Full Text Available The major limitation of the clinical use of replication-incompetent adenovirus (Ad vectors is the interference by innate immune responses, including induction of inflammatory cytokines and interferons (IFN, following in vivo application of Ad vectors. Ad vector-induced production of inflammatory cytokines and IFNs also results in severe organ damage and efficient induction of acquired immune responses against Ad proteins and transgene products. Ad vector-induced innate immune responses are triggered by the recognition of Ad components by pattern recognition receptors (PRRs. In order to reduce the side effects by Ad vector-induced innate immune responses and to develop safer Ad vectors, it is crucial to clarify which PRRs and which Ad components are involved in Ad vector-induced innate immune responses. Our group previously demonstrated that myeloid differentiating factor 88 (MyD88 and toll-like receptor 9 (TLR9 play crucial roles in the Ad vector-induced inflammatory cytokine production in mouse bone marrow-derived dendritic cells. Furthermore, our group recently found that virus associated-RNAs (VA-RNAs, which are about 160 nucleotide-long non-coding small RNAs encoded in the Ad genome, are involved in IFN production through the IFN-β promoter stimulator-1 (IPS-1-mediated signaling pathway following Ad vector transduction. The aim of this review is to highlight the Ad vector-induced innate immune responses following transduction, especially VA-RNA-mediated innate immune responses. Our findings on the mechanism of Ad vector-induced innate immune responses should make an important contribution to the development of safer Ad vectors, such as an Ad vector lacking expression of VA-RNAs.

Vector choice determines immunogenicity and potency of genetic vaccines against Angola Marburg virus in nonhuman primates

NARCIS (Netherlands)

Geisbert, Thomas W.; Bailey, Michael; Geisbert, Joan B.; Asiedu, Clement; Roederer, Mario; Grazia-Pau, Maria; Custers, Jerome; Jahrling, Peter; Goudsmit, Jaap; Koup, Richard; Sullivan, Nancy J.

2010-01-01

The immunogenicity and durability of genetic vaccines are influenced by the composition of gene inserts and choice of delivery vector. DNA vectors are a promising vaccine approach showing efficacy when combined in prime-boost regimens with recombinant protein or viral vectors, but they have shown

DNA sequence characterisation and phylogeography of Lymnaea cousini and related species, vectors of fascioliasis in northern Andean countries, with description of L. meridensis n. sp. (Gastropoda: Lymnaeidae

Directory of Open Access Journals (Sweden)

Bargues M Dolores

2011-07-01

Full Text Available Abstract Background Livestock fascioliasis is a problem throughout Ecuador, Colombia and Venezuela, mainly in Andean areas where the disease also appears to affect humans. Transmission patterns and epidemiological scenarios of liver fluke infection have shown to differ according to the lymnaeid vector snail species involved. These Andean countries present the vectors Lymnaea cousini, L. bogotensis and L. ubaquensis, unknown in the rest of Latin America. An exhaustive combined haplotype study of these species is performed by means of DNA sequencing of the nuclear ribosomal 18S RNA gene, ITS-2 and ITS-1, and mitochondrial DNA cox1 gene. Results The conserved 5.8S rDNA sequence corroborated that no pseudogenes are involved in the numerous non-microsatellite/minisatellite-related indels appearing between the ITS-2 and ITS-1 sequences when comparing different L. cousini - L. bogotensis populations. Sequence analyses and phylogenetic reconstruction methods including other lymnaeid vector species show that (i L. bogotensis is a synonym of L. cousini, (ii L. ubaquensis is a synonym of Pseudosuccinea columella, and (iii populations of L. cousini hitherto known from Venezuelan highlands indeed belong to a new species for which the name L. meridensis n. sp. is proposed. This new species is described and a complete phenotypic differentiation provided. Conclusions ITS-2, ITS-1 and cox1 prove to be good markers for specimen classification and haplotype characterisation of these morphologically similar lymnaeids in endemic areas. Analysis of the 18S gene and phylogenetic reconstructions indicate that L. cousini and L. meridensis n. sp. cluster in an evolutionary line different from the one of P. columella, despite their external resemblance. This suggests an evolutionary phenotypic convergence related to similar environments and which has given rise to frequent specimen misclassification. Body size and phylogenetic relationships of L. meridensis n. sp. with

DNA sequence characterisation and phylogeography of Lymnaea cousini and related species, vectors of fascioliasis in northern Andean countries, with description of L. meridensis n. sp. (Gastropoda: Lymnaeidae)

Science.gov (United States)

2011-01-01

Background Livestock fascioliasis is a problem throughout Ecuador, Colombia and Venezuela, mainly in Andean areas where the disease also appears to affect humans. Transmission patterns and epidemiological scenarios of liver fluke infection have shown to differ according to the lymnaeid vector snail species involved. These Andean countries present the vectors Lymnaea cousini, L. bogotensis and L. ubaquensis, unknown in the rest of Latin America. An exhaustive combined haplotype study of these species is performed by means of DNA sequencing of the nuclear ribosomal 18S RNA gene, ITS-2 and ITS-1, and mitochondrial DNA cox1 gene. Results The conserved 5.8S rDNA sequence corroborated that no pseudogenes are involved in the numerous non-microsatellite/minisatellite-related indels appearing between the ITS-2 and ITS-1 sequences when comparing different L. cousini - L. bogotensis populations. Sequence analyses and phylogenetic reconstruction methods including other lymnaeid vector species show that (i) L. bogotensis is a synonym of L. cousini, (ii) L. ubaquensis is a synonym of Pseudosuccinea columella, and (iii) populations of L. cousini hitherto known from Venezuelan highlands indeed belong to a new species for which the name L. meridensis n. sp. is proposed. This new species is described and a complete phenotypic differentiation provided. Conclusions ITS-2, ITS-1 and cox1 prove to be good markers for specimen classification and haplotype characterisation of these morphologically similar lymnaeids in endemic areas. Analysis of the 18S gene and phylogenetic reconstructions indicate that L. cousini and L. meridensis n. sp. cluster in an evolutionary line different from the one of P. columella, despite their external resemblance. This suggests an evolutionary phenotypic convergence related to similar environments and which has given rise to frequent specimen misclassification. Body size and phylogenetic relationships of L. meridensis n. sp. with well-known vectors as

A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

Science.gov (United States)

Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

2014-01-01

The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

APPLICATION OF BIOTECHNOLOGY TO THE STUDY OF FILARIAL PARASITES AND THEIR VECTORS

Directory of Open Access Journals (Sweden)

A. C. Vickery

2012-09-01

Full Text Available Over 200 species of filarial parasites have been described, although the life cycle and nature of their obligate intermediate arthropod vectors have been identified for only about a quarter of them. Traditional methods of studying phylogenetic relationships between closely related parasite species have utilized morphologic, biochemical and biologic characteristics, usually of the microfilarial stage. Identification of competent vectors from among complexes of sibling species, has employed similar techniques, despite the fact that differences between geographical isolates may reflect environmental rather than genetically controlled factors. Studies of the prevalence and transmission of animal, human and zoonotic filarids, so important for vector identification and control, has lead to the examination of filarial parasites at the genetic level. Genomic DNA libraries are being constructed and screened for clones which are species specific. From this work, DNA probes which can accurately enumerate larval stages in vector squash preparations, and monoclonal antibodies specific for defined filarial antigens, are being prepared. The nucleotide sequences of rRNA are also being defined. The application of these technologies to the study of filarial parasites and their vectors, promises to not only allow the construction of accurate phylogenetic trees, but also to provide the data necessary for the identification and control of the vectors of filarial pathogens of animals and man.

Plasmid DNA Delivery: Nanotopography Matters.

Science.gov (United States)

Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong

2017-12-20

Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.

PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

OpenAIRE

Belyavsky, A; Vinogradova, T; Rajewsky, K

1989-01-01

A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

Fanconi anemia (cross)linked to DNA repair.

Science.gov (United States)

Niedernhofer, Laura J; Lalai, Astrid S; Hoeijmakers, Jan H J

2005-12-29

Fanconi anemia is characterized by hypersensitivity to DNA interstrand crosslinks (ICLs) and susceptibility to tumor formation. Despite the identification of numerous Fanconi anemia (FANC) genes, the mechanism by which proteins encoded by these genes protect a cell from DNA interstrand crosslinks remains unclear. The recent discovery of two DNA helicases that, when defective, cause Fanconi anemia tips the balance in favor of the direct involvement of the FANC proteins in DNA repair and the bypass of DNA lesions.

Wavelet transform-vector quantization compression of supercomputer ocean model simulation output

Energy Technology Data Exchange (ETDEWEB)

Bradley, J N; Brislawn, C M

1992-11-12

We describe a new procedure for efficient compression of digital information for storage and transmission purposes. The algorithm involves a discrete wavelet transform subband decomposition of the data set, followed by vector quantization of the wavelet transform coefficients using application-specific vector quantizers. The new vector quantizer design procedure optimizes the assignment of both memory resources and vector dimensions to the transform subbands by minimizing an exponential rate-distortion functional subject to constraints on both overall bit-rate and encoder complexity. The wavelet-vector quantization method, which originates in digital image compression. is applicable to the compression of other multidimensional data sets possessing some degree of smoothness. In this paper we discuss the use of this technique for compressing the output of supercomputer simulations of global climate models. The data presented here comes from Semtner-Chervin global ocean models run at the National Center for Atmospheric Research and at the Los Alamos Advanced Computing Laboratory.

Comparative Immunogenicity in Rhesus Monkeys of DNA Plasmid, Recombinant Vaccinia Virus, and Replication-Defective Adenovirus Vectors Expressing a Human Immunodeficiency Virus Type 1 gag Gene

OpenAIRE

Casimiro, Danilo R.; Chen, Ling; Fu, Tong-Ming; Evans, Robert K.; Caulfield, Michael J.; Davies, Mary-Ellen; Tang, Aimin; Chen, Minchun; Huang, Lingyi; Harris, Virginia; Freed, Daniel C.; Wilson, Keith A.; Dubey, Sheri; Zhu, De-Min; Nawrocki, Denise

2003-01-01

Cellular immune responses, particularly those associated with CD3+ CD8+ cytotoxic T lymphocytes (CTL), play a primary role in controlling viral infection, including persistent infection with human immunodeficiency virus type 1 (HIV-1). Accordingly, recent HIV-1 vaccine research efforts have focused on establishing the optimal means of eliciting such antiviral CTL immune responses. We evaluated several DNA vaccine formulations, a modified vaccinia virus Ankara vector, and a replication-defecti...

CNS-restricted Transduction and CRISPR/Cas9-mediated Gene Deletion with an Engineered AAV Vector

Directory of Open Access Journals (Sweden)

Giridhar Murlidharan

2016-01-01

Full Text Available Gene therapy using recombinant adeno-associated viral (AAV vectors is emerging as a promising approach to treat central nervous system disorders such as Spinal muscular atrophy, Batten, Parkinson and Alzheimer disease amongst others. A critical remaining challenge for central nervous system-targeted gene therapy, silencing or gene editing is to limit potential vector dose-related toxicity in off-target cells and organs. Here, we characterize a lab-derived AAV chimeric (AAV2g9, which displays favorable central nervous system attributes derived from both parental counterparts, AAV2 and AAV9. This synthetic AAV strain displays preferential, robust, and widespread neuronal transduction within the brain and decreased glial tropism. Importantly, we observed minimal systemic leakage, decreased sequestration and gene transfer in off-target organs with AAV2g9, when administered into the cerebrospinal fluid. A single intracranial injection of AAV2g9 vectors encoding guide RNAs targeting the schizophrenia risk gene MIR137 (encoding MIR137 in CRISPR/Cas9 knockin mice resulted in brain-specific gene deletion with no detectable events in the liver. This engineered AAV vector is a promising platform for treating neurological disorders through gene therapy, silencing or editing modalities.

Vaccination with DNA encoding truncated enterohemorrhagic Escherichia coli (EHEC factor for adherence-1 gene (efa-1’ confers protective immunity to mice infected with E. coli O157:H7

Directory of Open Access Journals (Sweden)

Roberto eRiquelme-Neira

2016-01-01

Full Text Available Enterohemorrhagic Escherichia coli (EHEC O157:H7 is the predominant causative agent of hemorrhagic colitis in humans and is the cause of haemolytic uraemic syndrome and other illnesses. Cattle have been implicated as the main reservoir of this organism. Here, we evaluated the immunogenicity and protective efficacy of a DNA vaccine encoding conserved sequences of truncated EHEC factor for adherence-1 (efa-1’ in a mouse model. Intranasal administration of plasmid DNA carrying the efa-1’ gene (pVAXefa-1’ into C57BL/6 mice elicited both humoral and cellular immune responses. In animals immunized with pVAXefa-1`, EHEC-secreted protein-specific IgM and IgG antibodies were detected in sera at day 45. Anti-EHEC-secreted protein sIgA was also detected in nasal and bronchoalveolar lavages. In addition, antigen-specific T-cell-proliferation, IL-10 and IFN-γ were observed upon re-stimulation with either heat-killed bacteria or EHEC-secreted proteins. Vaccinated animals were also protected against challenge with E. coli O157:H7 strain EDL933. These results suggest that DNA vaccine encoding efa-1´ have therapeutic potential in interventions against EHEC infections. This approach could lead to a new strategy in the production of vaccines that prevent infections in cattle.

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Episomal Nonviral Gene Therapy Vectors Slow Progression of Atherosclerosis in a Model of Familial Hypercholesterolemia

Directory of Open Access Journals (Sweden)

Alastair G Kerr

2016-01-01

Full Text Available Familial hypercholesterolemia (FH is a life-threatening genetic disorder characterized by elevated levels of plasma low-density lipoprotein cholesterol (LDL-cholesterol. Current attempts at gene therapy for FH have been limited by the use of strong heterologous promoters which lack genomic DNA elements essential for regulated expression. Here, we have combined a minigene vector expressing the human LDLR cDNA from a 10 kb native human LDLR locus genomic DNA promoter element, with an efficient miRNA targeting 3-hydroxy-3-methylgutaryl-coenzyme A reductase (Hmgcr, to further enhance LDLR expression. We show that the combined vector suppresses endogenous Hmgcr transcripts in vivo, leading to an increase in LDLR transgene expression. In a diet-induced Ldlr-/- mouse model of FH, we show that administration of the combined vector reduces atherogenic plasma lipids by ≃32%. Finally, we demonstrate that our episomal nonviral vectors are able to reduce atherosclerosis by ≃40% after 12 weeks in vivo. Taken together, the vector system we describe exploits the normal cellular regulation of the LDLR to provide prolonged expression of LDLR through targeted knockdown of Hmgcr. This novel gene therapy system could act alone, or in synergy with current therapies that modulate intracellular cholesterol, such as statins, greatly enhancing its therapeutic application for FH.

Strain Variation in the Transcriptome of the Dengue Fever Vector, Aedes aegypti.

Science.gov (United States)

Bonizzoni, Mariangela; Dunn, W Augustine; Campbell, Corey L; Olson, Ken E; Marinotti, Osvaldo; James, Anthony A

2012-01-01

Studies of transcriptome dynamics provide a basis for understanding functional elements of the genome and the complexity of gene regulation. The dengue vector mosquito, Aedes aegypti, exhibits great adaptability to diverse ecological conditions, is phenotypically polymorphic, and shows variation in vectorial capacity to arboviruses. Previous genome sequencing showed richness in repetitive DNA and transposable elements that can contribute to genome plasticity. Population genetic studies revealed a varying degree of worldwide genetic polymorphism. However, the extent of functional genetic polymorphism across strains is unknown. The transcriptomes of three Ae. aegypti strains, Chetumal (CTM), Rexville D-Puerto Rico (Rex-D) and Liverpool (LVP), were compared. CTM is more susceptible than Rex- D to infection by dengue virus serotype 2. A total of 4188 transcripts exhibit either no or small variation (<2-fold) among sugar-fed samples of the three strains and between sugar- and blood-fed samples within each strain, corresponding most likely to genes encoding products necessary for vital functions. Transcripts enriched in blood-fed mosquitoes encode proteins associated with catalytic activities, molecular transport, metabolism of lipids, carbohydrates and amino acids, and functions related to blood digestion and the progression of the gonotropic cycle. Significant qualitative and quantitative differences were found in individual transcripts among strains including differential representation of paralogous gene products. The majority of immunity-associated transcripts decreased in accumulation after a bloodmeal and the results are discussed in relation to the different susceptibility of CTM and Rex-D mosquitoes to DENV2 infection.

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

International Nuclear Information System (INIS)

Chen, J.; Varner, J.E.

1985-01-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) + RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) + RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) + RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 as a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding

Vectorization and parallelization of a production reactor assembly code

International Nuclear Information System (INIS)

Vujic, J.L.; Martin, W.R.; Michigan Univ., Ann Arbor, MI

1991-01-01

In order to use efficiently the new features of supercomputers, production codes, usually written 10 -20 years ago, must be tailored for modern computer architectures. We have chosen to optimize the CPM-2 code, a production reactor assembly code based on the collision probability transport method. Substantial speedup in the execution times was obtained with the parallel/vector version of the CPM-2 code. In addition, we have developed a new transfer probability method, which removes some of the modelling limitations of the collision probability method encoded in the CPM-2 code, and can fully utilize the parallel/vector architecture of a multiprocessor IBM 3090. (author)

Vectorization and parallelization of a production reactor assembly code

International Nuclear Information System (INIS)

Vujic, J.L.; Martin, W.R.

1991-01-01

In order to efficiently use new features of supercomputers, production codes, usually written 10 - 20 years ago, must be tailored for modern computer architectures. We have chosen to optimize the CPM-2 code, a production reactor assembly code based on the collision probability transport method. Substantial speedups in the execution times were obtained with the parallel/vector version of the CPM-2 code. In addition, we have developed a new transfer probability method, which removes some of the modelling limitations of the collision probability method encoded in the CPM-2 code, and can fully utilize parallel/vector architecture of a multiprocessor IBM 3090. (author)

Novel recombinant alphaviral and adenoviral vectors for cancer immunotherapy.

Science.gov (United States)

Osada, Takuya; Morse, Michael A; Hobeika, Amy; Lyerly, H Kim

2012-06-01

Although cellular immunotherapy based on autolgous dendritic cells (DCs) targeting antigens expressed by metastatic cancer has demonstrated clinical efficacy, the logistical challenges in generating an individualized cell product create an imperative to develop alternatives to DC-based cancer vaccines. Particularly attractive alternatives include in situ delivery of antigen and activation signals to resident antigen-presenting cells (APCs), which can be achieved by novel fusion molecules targeting the mannose receptor and by recombinant viral vectors expressing the antigen of interest and capable of infecting DCs. A particular challenge in the use of viral vectors is the well-appreciated clinical obstacles to their efficacy, specifically vector-specific neutralizing immune responses. Because heterologous prime and boost strategies have been demonstrated to be particularly potent, we developed two novel recombinant vectors based on alphaviral replicon particles and a next-generation adenovirus encoding an antigen commonly overexpressed in many human cancers, carcinoembryonic antigen (CEA). The rationale for developing these vectors, their unique characteristics, the preclinical studies and early clinical experience with each, and opportunities to enhance their effectiveness will be reviewed. The potential of each of these potent recombinant vectors to efficiently generate clinically active anti-tumor immune response alone, or in combination, will be discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

Sergentomyia (Neophlebotomus) gemmea, a potential vector of Leishmania siamensis in southern Thailand.

Science.gov (United States)

Kanjanopas, Kobkan; Siripattanapipong, Suradej; Ninsaeng, Ubolrat; Hitakarun, Atitaya; Jitkaew, Somnat; Kaewtaphaya, Preecha; Tan-ariya, Peerapan; Mungthin, Mathirut; Charoenwong, Chetsuda; Leelayoova, Saovanee

2013-07-19

Leishmaniasis, caused by Leishmania siamensis, is an emerging disease in Thailand. Although reported cases have been increasing, epidemiological information of the disease including host and vector aspects is not clearly known. This study was a preliminary survey of the potential vector of L. siamensis in an affected area of leishmaniasis, Trang Province, southern Thailand. The collection of sandflies was performed around the area where a case of leishmaniasis was reported using CDC light traps. Species of sandfly were identified based on morphological characteristics according to Lewis's key. PCR amplification and sequencing of the heat shock protein 70 gene (hsp70) was used to identify L. siamensis DNA in sandflies. A total of 146 male and female sandflies were collected in the affected areas. Of 71 female sandflies, four species were identified, i.e., Sergentomyia (Neophlebotomus) gemmea, S. (Neophlebotomus) iyengari, S. (Parrotomyia) barraudi and Phlebotomus (Anaphlebotomus) stantoni. Among these species, S. (Neophlebotomus) gemmea was the most predominant species in all areas. DNA of L. siamensis was identified in S. (Neophlebotomus) gemmea. Nucleotide sequences of PCR products using DNA extracted from S. (Neophlebotomus) gemmea showed 99.8% identity to L. siamensis. S. (Neophlebotomus) gemmea might be a potential vector of L. siamensis in an affected area, Trang Province, southern Thailand. However further studies are needed to prove whether these sandflies can be natural vectors of leishmaniasis.

Design and Construction of a Cloning Vector Containing the hspX Gene of Mycobacterium tuberculosis.

Science.gov (United States)

Yaghoubi, Atieh; Aryan, Ehsan; Zare, Hosna; Alami, Shadi; Teimourpour, Roghayeh; Meshkat, Zahra

2016-10-01

Tuberculosis (TB) is a major cause of death worldwide. Finding an effective vaccine against TB is the best way to control it. Several vaccines against this disease have been developed but none are completely protective. The aim of this study was to design and construct a cloning vector containing the Mycobacterium tuberculosis (M. tuberculosis) heat shock protein X (hspX) . First, an hspX fragment was amplified by PCR and cloned into plasmid pcDNA3.1(+) and recombinant vector was confirmed. A 435 bp hspX fragment was isolated. The fragment was 100% homologous with hspX of M. tuberculosis strain H37Rv in GenBank. In this study, the cloning vector pcDNA3.1(+), containing a 435-bp hspX fragment of M. tuberculosis , was constructed. This could be used as a DNA vaccine to induce immune responses in animal models in future studies.

Formulation and delivery of dermal DNA vaccines

NARCIS (Netherlands)

van den Berg, J.H.

2009-01-01

DNA vaccination is an appealing strategy of active vaccination, leading to the intracellular production of the encoding antigen which results in an efficient activation of an antigen specific immune response. Intradermal DNA tattooing was recently developed as a simple and robust method to induce

Normalized cDNA libraries

Science.gov (United States)

Soares, Marcelo B.; Efstratiadis, Argiris

1997-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Lectin cDNA and transgenic plants derived therefrom

Science.gov (United States)

Raikhel, Natasha V.

2000-10-03

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

A newly identified DNA ligase of Saccharomyces cerevisiae involved in RAD52-independent repair of DNA double-strand breaks

Science.gov (United States)

Schär, Primo; Herrmann, Gernot; Daly, Graham; Lindahl, Tomas

1997-01-01

Eukaryotic DNA ligases are ATP-dependent DNA strand-joining enzymes that participate in DNA replication, repair, and recombination. Whereas mammalian cells contain several different DNA ligases, encoded by at least three distinct genes, only one DNA ligase has been detected previously in either budding yeast or fission yeast. Here, we describe a newly identified nonessential Saccharomyces cerevisiae gene that encodes a DNA ligase distinct from the CDC9 gene product. This DNA ligase shares significant amino acid sequence homology with human DNA ligase IV; accordingly, we designate the yeast gene LIG4. Recombinant LIG4 protein forms a covalent enzyme-AMP complex and can join a DNA single-strand break in a DNA/RNA hybrid duplex, the preferred substrate in vitro. Disruption of the LIG4 gene causes only marginally increased cellular sensitivity to several DNA damaging agents, and does not further sensitize cdc9 or rad52 mutant cells. In contrast, lig4 mutant cells have a 1000-fold reduced capacity for correct recircularization of linearized plasmids by illegitimate end-joining after transformation. Moreover, homozygous lig4 mutant diploids sporulate less efficiently than isogenic wild-type cells, and show retarded progression through meiotic prophase I. Spore viability is normal, but lig4 mutants appear to produce a higher proportion of tetrads with only three viable spores. The mutant phenotypes are consistent with functions of LIG4 in an illegitimate DNA end-joining pathway and ensuring efficient meiosis. PMID:9271115

Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata.

Science.gov (United States)

Templeton, M D; Rikkerink, E H; Solon, S L; Crowhurst, R N

1992-12-01

The glyceraldehyde-3-phosphate dehydrogenase gene (gpdA) has been identified from a genomic DNA library prepared from the plant pathogenic fungus Glomerella cingulata. Nucleotide sequence data revealed that this gene codes for a putative 338-amino-acid protein encoded by two exons of 129 and 885 bp, separated by an intron 216 bp long. The 5' leader sequence is also spliced by an intron of 156 bp. A cDNA clone was prepared using the polymerase chain reaction, the sequence of which was used to confirm the presence of the intron in the coding sequence and the splicing of the 5' leader sequence. The transcriptional start point (tsp) was mapped at -253 nt from the site of the initiation of translation by primer extension and is adjacent to a 42-bp pyrimidine-rich region. The general structure of the 5' flanking region shows similarities to gpdA from Aspergillus nidulans. The putative protein product is 71-86% identical at the aa level to GPDs from Aspergillus nidulans, Cryphonectria parasitica, Curvularia lunata, Podospora anserina and Ustilago maydis.

Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

International Nuclear Information System (INIS)

Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo

1988-01-01

Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged

Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

International Nuclear Information System (INIS)

Safford, R.; de Silva, J.; Lucas, C.

1987-01-01

Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH

A new approach for weed control in a cucurbit field employing an attenuated potyvirus-vector for herbicide resistance.

Science.gov (United States)

Shiboleth, Y M; Arazi, T; Wang, Y; Gal-On, A

2001-12-14

Expression of bar, a phosphinothricin acetyltransferase, in plant tissues, leads to resistance of these plants to glufosinate ammonium based herbicides. We have created a bar expressing, attenuated zucchini yellow mosaic potyvirus-vector, AGII-Bar, to enable herbicide use in cucurbit fields. The parental vector, ZYMV-AGII, has been rendered environmentally safe by both disease-symptom attenuation and aphid-assisted virus transmission abolishment. The recombinant AGII-Bar virus-encoding cDNA, when inoculated on diverse cucurbits was highly infectious, accumulated to similar levels as AGII, and elicited attenuated AGII-like symptoms. Potted cucurbits inoculated with AGII-Bar became herbicide resistant about a week post-inoculation. Herbicide resistance was sustained in squash over a period of at least 26 days and for at least 60 days in cucumber grown in a net-house under commercial conditions. To test the applicability of AGII-Bar use in a weed-infested field, a controlled experiment including more than 450 plants inoculated with this construct, was performed. Different dosages of glufosinate ammonium were sprayed, 2 weeks after planting, on the foliage of melons, cucumbers, squash, and watermelons. AGII-Bar provided protection to all inoculated plants, of every variety tested, at each dosage applied, including the highest doses that totally eradicated weeds. This study demonstrates that AGII-Bar can be utilized to facilitate weed control in cucurbits and exemplifies the practical potential of attenuated virus-vector use in agriculture.

Construction of improved temperature-sensitive and mobilizable vectors and their use for constructing mutations in the adhesin-encoding acm gene of poorly transformable clinical Enterococcus faecium strains.

Science.gov (United States)

Nallapareddy, Sreedhar R; Singh, Kavindra V; Murray, Barbara E

2006-01-01

Inactivation by allelic exchange in clinical isolates of the emerging nosocomial pathogen Enterococcus faecium has been hindered by lack of efficient tools, and, in this study, transformation of clinical isolates was found to be particularly problematic. For this reason, a vector for allelic replacement (pTEX5500ts) was constructed that includes (i) the pWV01-based gram-positive repAts replication region, which is known to confer a high degree of temperature intolerance, (ii) Escherichia coli oriR from pUC18, (iii) two extended multiple-cloning sites located upstream and downstream of one of the marker genes for efficient cloning of flanking regions for double-crossover mutagenesis, (iv) transcriptional terminator sites to terminate undesired readthrough, and (v) a synthetic extended promoter region containing the cat gene for allelic exchange and a high-level gentamicin resistance gene, aph(2'')-Id, to distinguish double-crossover recombination, both of which are functional in gram-positive and gram-negative backgrounds. To demonstrate the functionality of this vector, the vector was used to construct an acm (encoding an adhesin to collagen from E. faecium) deletion mutant of a poorly transformable multidrug-resistant E. faecium endocarditis isolate, TX0082. The acm-deleted strain, TX6051 (TX0082Deltaacm), was shown to lack Acm on its surface, which resulted in the abolishment of the collagen adherence phenotype observed in TX0082. A mobilizable derivative (pTEX5501ts) that contains oriT of Tn916 to facilitate conjugative transfer from the transformable E. faecalis strain JH2Sm::Tn916 to E. faecium was also constructed. Using this vector, the acm gene of a nonelectroporable E. faecium wound isolate was successfully interrupted. Thus, pTEX5500ts and its mobilizable derivative demonstrated their roles as important tools by helping to create the first reported allelic replacement in E. faecium; the constructed this acm deletion mutant will be useful for assessing the

Recovery of avian metapneumovirus subgroup C from cDNA: cross-recognition of avian and human metapneumovirus support proteins.

Science.gov (United States)

Govindarajan, Dhanasekaran; Buchholz, Ursula J; Samal, Siba K

2006-06-01

Avian metapneumovirus (AMPV) causes an acute respiratory disease in turkeys and is associated with "swollen head syndrome" in chickens, contributing to significant economic losses for the U.S. poultry industry. With a long-term goal of developing a better vaccine for controlling AMPV in the United States, we established a reverse genetics system to produce infectious AMPV of subgroup C entirely from cDNA. A cDNA clone encoding the entire 14,150-nucleotide genome of AMPV subgroup C strain Colorado (AMPV/CO) was generated by assembling five cDNA fragments between the T7 RNA polymerase promoter and the autocatalytic hepatitis delta virus ribozyme of a transcription plasmid, pBR 322. Transfection of this plasmid, along with the expression plasmids encoding the N, P, M2-1, and L proteins of AMPV/CO, into cells stably expressing T7 RNA polymerase resulted in the recovery of infectious AMPV/CO. Characterization of the recombinant AMPV/CO showed that its growth properties in tissue culture were similar to those of the parental virus. The potential of AMPV/CO to serve as a viral vector was also assessed by generating another recombinant virus, rAMPV/CO-GFP, that expressed the enhanced green fluorescent protein (GFP) as a foreign protein. Interestingly, GFP-expressing AMPV and GFP-expressing human metapneumovirus (HMPV) could be recovered using the support plasmids of either virus, denoting that the genome promoters are conserved between the two metapneumoviruses and can be cross-recognized by the polymerase complex proteins of either virus. These results indicate a close functional relationship between AMPV/CO and HMPV.

DNA Methylation Modulates Nociceptive Sensitization after Incision.

Directory of Open Access Journals (Sweden)

Yuan Sun

Full Text Available DNA methylation is a key epigenetic mechanism controlling DNA accessibility and gene expression. Blockade of DNA methylation can significantly affect pain behaviors implicated in neuropathic and inflammatory pain. However, the role of DNA methylation with regard to postoperative pain has not yet been explored. In this study we sought to investigate the role of DNA methylation in modulating incisional pain and identify possible targets under DNA methylation and contributing to incisional pain. DNA methyltranferase (DNMT inhibitor 5-Aza-2'-deoxycytidine significantly reduced incision-induced mechanical allodynia and thermal sensitivity. Aza-2'-deoxycytidine also reduced hindpaw swelling after incision, suggesting an anti-inflammatory effect. Global DNA methylation and DNMT3b expression were increased in skin after incision, but none of DNMT1, DNMT3a or DNMT3b was altered in spinal cord or DRG. The expression of proopiomelanocortin Pomc encoding β-endorphin and Oprm1 encoding the mu-opioid receptor were upregulated peripherally after incision; moreover, Oprm1 expression was further increased under DNMT inhibitor treatment. Finally, local peripheral injection of the opioid receptor antagonist naloxone significantly exacerbated incision-induced mechanical hypersensitivity. These results suggest that DNA methylation is functionally relevant to incisional nociceptive sensitization, and that mu-opioid receptor signaling might be one methylation regulated pathway controlling sensitization after incision.

[Construction of the eukaryotic recombinant vector and expression of the outer membrane protein LipL32 gene from Leptospira serovar Lai].

Science.gov (United States)

Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying

2008-02-01

To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.

Enhancement of Mucosal Immunogenicity of Viral Vectored Vaccines by the NKT Cell Agonist Alpha-Galactosylceramide as Adjuvant

Directory of Open Access Journals (Sweden)

Shailbala Singh

2014-10-01

Full Text Available Gene-based vaccination strategies, specifically viral vectors encoding vaccine immunogens are effective at priming strong immune responses. Mucosal routes offer practical advantages for vaccination by ease of needle-free administration, and immunogen delivery at readily accessible oral/nasal sites to efficiently induce immunity at distant gut and genital tissues. However, since mucosal tissues are inherently tolerant for induction of immune responses, incorporation of adjuvants for optimal mucosal vaccination strategies is important. We report here the effectiveness of alpha-galactosylceramide (α-GalCer, a synthetic glycolipid agonist of natural killer T (NKT cells, as an adjuvant for enhancing immunogenicity of vaccine antigens delivered using viral vectors by mucosal routes in murine and nonhuman primate models. Significant improvement in adaptive immune responses in systemic and mucosal tissues was observed by including α-GalCer adjuvant for intranasal immunization of mice with vesicular stomatitis virus vector encoding the model antigen ovalbumin and adenoviral vectors expressing HIV env and Gag antigens. Activation of NKT cells in systemic and mucosal tissues along with significant increases in adaptive immune responses were observed in rhesus macaques immunized by intranasal and sublingual routes with protein or adenovirus vectored antigens when combined with α-GalCer adjuvant. These results support the utility of α-GalCer adjuvant for enhancing immunogenicity of mucosal vaccines delivered using viral vectors.

AAVPG: A vigilant vector where transgene expression is induced by p53

Energy Technology Data Exchange (ETDEWEB)

Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.; Strauss, Bryan E., E-mail: bstrauss@usp.br

2013-12-15

Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 fold increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.

An introduction to vectors, vector operators and vector analysis