
Sample records for dna polymerase molecules

  1. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution. (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David


    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  2. Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET

    NARCIS (Netherlands)

    Hohlbein, J.; Kapanidis, A.N.


    Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open

  3. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)


    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  4. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)


    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  5. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    International Nuclear Information System (INIS)

    Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.


    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  6. DNA Polymerase Fidelity: Beyond Right and Wrong. (United States)

    Washington, M Todd


    Accurate DNA replication depends on the ability of DNA polymerases to discriminate between correctly and incorrectly paired nucleotides. In this issue of Structure, Batra et al. (2016) show the structural basis for why DNA polymerases do not efficiently add correctly paired nucleotides immediately after incorporating incorrectly paired ones. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. DNA repair synthesis in human fibroblasts requires DNA polymerase delta

    International Nuclear Information System (INIS)

    Nishida, C.; Reinhard, P.; Linn, S.


    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone

  8. The interplay between polymerase organization and nucleosome occupancy along DNA : How dynamic roadblocks on the DNA induce the formation of RNA polymerase pelotons

    NARCIS (Netherlands)

    van den Berg, A.A.


    During transcription RNA polymerase (RNAP) moves along a DNA molecule to copy the information on the DNA to an RNA molecule. Many textbook pictures show an RNAP sliding along empty DNA, but in reality it is crowded on the DNA and RNAP competes for space with many proteins such as other RNAP’s and

  9. DNA polymerase preference determines PCR priming efficiency. (United States)

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian


    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

  10. Structure and function of DNA polymerase μ

    International Nuclear Information System (INIS)

    Matsumoto, Takuro; Maezawa, So


    DNA polymerases are enzymes playing the central role in DNA metabolism, including DNA replication, DNA repair and recombination. DNA polymerase μ (pol μ DNA polymerase λ (pol λ) and terminal deoxynucleotidyltransferase (TdT) in X family DNA polymerases function in non-homologous end-joining (NHEJ), which is the predonmiant repair pathway for DNA double-strand breaks (DSBs). NHEJ involves enzymes that capture both ends of the broken DNA strand, bring them together in a synaptic DNA-protein complex, and repair the DSB. Pol μ and pol λ fill in the gaps at the junction to maintain the genomic integrity. TdT synthesizes N region at the junction during V(D)J recombination and promotes diversity of immunoglobulin or T-cell receptor gene. Among these three polymerases, the regulatory mechanisms of pol μ remain rather unclear. We have approached the mechanism of pol μ from both sides of structure and cellular dynamics. Here, we propose some new insights into pol μ and the probable NHEJ model including our findings. (author)

  11. Functional roles of DNA polymerases β and γ

    International Nuclear Information System (INIS)

    Huebscher, U.; Kuenzle, C.C.; Spadari, S.


    The physiological functions of DNA polymerases (deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC2.7.7.7)β and γ were investigated by using neuronal nuclei and synaptosomes isolated from rat brain. uv irradiation of neuronal nuclei from 60-day-old rats resulted in a 7- to 10-fold stimulation of DNA repair synthesis attributable to DNA polymerase β which, at this developmental stage, is virtually the only DNA polymerase present in the nuclei. No repair synthesis could be elicited by treating the nuclei with N-methyl-N-nitrosourea, but this was probably due to the inability of brain tissue to excise alkylated bases from DNA. The role of DNA polymerase γ was studied in synaptosomes by using a system mimicking in vivo mitochondrial DNA synthesis. By showing that under these conditions, DNA replication occurs in miatochondria, and exploiting the fact that DNA polymerase γ is the only DNA polymerase present in mitochondria, evidence was obtained for a role of DNA polymerase γ in mitochondrial DNA replication. Based on these results and on the wealth of literature on DNA polymerase α, we conclude that DNA polymerase α is mainly responsible for DNA replication in nuclei, DNA polymerase β is involved in nuclear DNA repair, and DNA polymerase γ is the mitochondrial replicating enzyme. However, minor roles for DNA polymerase α in DNA repair or for DNA polymerase β in DNA replication cannot be excluded

  12. Site-directed mutational analysis of structural interactions of low molecule compounds binding to the N-terminal 8 kDa domain of DNA polymerase β

    International Nuclear Information System (INIS)

    Murakami, Shizuka; Kamisuki, Shinji; Takata, Kei-ichi; Kasai, Nobuyuki; Kimura, Seisuke; Mizushina, Yoshiyuki; Ohta, Keisuke; Sugawara, Fumio; Sakaguchi, Kengo


    We previously reported the mode of inhibition of DNA polymerase β (pol. β) by long chain fatty acids and a bile acid, involving binding analyses to the N-terminal 8-kDa DNA binding domain. Here we describe a site-directed mutational analysis in which the key amino acids (L11, K35, H51, K60, L77, and T79), which are direct interaction sites in the domain, were substituted with K, A, A, A, K, and A, respectively. And their pol. β interactions with a C24-long chain fatty acid, nervonic acid (NA), and a bile acid, lithocholic acid (LCA), were investigated by gel mobility shift assay and NMR spectroscopy. In the case of K35A, there was complete loss of DNA binding activity while K60A hardly has any activity. In contrast the other mutations had no appreciable effects. Thus, K35 and K60 are key amino acid sites for binding to template DNA. The DNA binding activities of L11K, H51A, and T79A as well as the wild type were inhibited by NA to the same extent. T79A demonstrated a disturbed interaction with LCA. 1 H- 15 N HSQC NMR analysis indicated that despite their many similarities, the wild-type and the mutant proteins displayed some significant chemical shift differences. Not only were the substituted amino acid residues three-dimensionally shifted, but some amino acids which are positioned far distant from the key amino acids showed a shift. These results suggest that the interaction surface was significantly distorted with the result that LCA could not bind to the domain. These findings confirm our previous biochemical and 3D structural proposals concerning inhibition by NA and LCA

  13. DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present

    Directory of Open Access Journals (Sweden)

    Cheng-Yao eChen


    Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

  14. DNA polymerase. beta. reaction with ultraviolet-irradiated DNA incised by correndonuclease

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, R; Zarebska, Z [Instytut Onkologii, Warsaw (Poland); Zmudzka, B [Polska Akademia Nauk, Warsaw. Inst. Biochemii i Biofizyki


    Covalently closed circular Col E1 DNA was ultraviolet-irradiated with a dose of 60 J/m/sup 2/, thus introducing about 3.2 pyrimidine dimers per DNA molecule. Treatment of irradiated Col E1 DNA with Micrococcus luteus correndonuclease resulted, in the vicinity of pyrimidine dimers, in an average of 3.3 incisions per DNA molecule, and converted DNA to the open circular form. Incised Col E1 DNA stimulated no reaction with calf thymus DNA polymerase ..cap alpha.. but was recognized as a template by DNA polymerase ..beta... The latter enzyme incorporated about 1.6 molecules of dTMP (corresponding to 6 molecules of dNMP) per one correndonuclease incision. The length of the DNA polymerase ..beta.. product was comparable to the anticipated length of the DNA region within which the hydrogen bonds were disrupted owing to dimer formation. The enzyme required Mg/sup 2 +/ and four dNTPs for reaction and was resistant to N-ethylmaleimide or p-mercuribenzoate.

  15. Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase


    Davidson, John F.; Fox, Richard; Harris, Dawn D.; Lyons-Abbott, Sally; Loeb, Lawrence A.


    Insertion of the T3 DNA polymerase thioredoxin binding domain (TBD) into the distantly related thermostable Taq DNA polymerase at an analogous position in the thumb domain, converts the Taq DNA polymerase from a low processive to a highly processive enzyme. Processivity is dependent on the presence of thioredoxin. The enhancement in processivity is 20–50-fold when compared with the wild-type Taq DNA polymerase or to the recombinant polymerase in the absence of thioredoxin. The recombinant Taq...

  16. Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols. (United States)

    Angers, M; Cloutier, J F; Castonguay, A; Drouin, R


    Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

  17. PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases. (United States)

    Cline, J; Braman, J C; Hogrefe, H H


    The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at pH 8.5-9.1. Under these conditions, the error rate of exo- Pfu was approximately 40-fold higher (5 x 10(-5)) than the error rate of Pfu. As the reaction pH was raised from pH 8 to 9, the error rate of Pfu decreased approximately 2-fold, while the error rate of exo- Pfu increased approximately 9-fold. An increase in error rate with pH has also been noted for the exonuclease-deficient DNA polymerases Taq and exo- Klenow, suggesting that the parameters which influence replication error rates may be similar in pol l- and alpha-like polymerases. Finally, the fidelity of 'long PCR' DNA polymerase mixtures was examined. The error rates of a Taq/Pfu DNA polymerase mixture and a Klentaq/Pfu DNA polymerase mixture were found to be less than the error rate of Taq DNA polymerase, but approximately 3-4-fold higher than the error rate of Pfu DNA polymerase.

  18. Kinetic mechanism of DNA polymerase I (Klenow)

    International Nuclear Information System (INIS)

    Kuchta, R.D.; Mizrahi, V.; Benkovic, P.A.; Johnson, K.A.; Benkovic, S.J.


    The minimal kinetic scheme for DNA polymerization catalyzed by the Klenow fragment of DNA polymerase I (KF) from Escherichia coli has been determined with short DNA oligomers of defined sequence, labeled with [ 32 P]-nucleotides. A key feature of this scheme is a minimal two-step sequence that interconverts the ternary KF-DNA/sub n/-dNTP and KF-DNA/sub n+1/-PP/sub i/ complexes. The rate is not limited by the actual polymerization but by a separate step, possibly important in ensuring fidelity. Evidence for this sequence is supplied by the observation of biphasic kinetics in single-turnover pyrophosphorolysis experiments (the microscopic reverse of polymerization). Data analysis then provides an estimate of the internal equilibrium constant. The dissociations of DNA, dNTP, and PP/sub i/ from the various binary and ternary complexes were measured by partitioning (isotope-trapping) experiments. The rate constant for DNA dissociation from KF is sequence dependent and is rate limiting during nonprocessive DNA synthesis. The combination of single-turnover (both directions) and isotope-trapping experiments provides sufficient information to permit a quantitative evaluation of the kinetic scheme for specific DNA sequences

  19. Bayesian estimation for quantification by real-time polymerase chain reaction under a branching process model of the DNA molecules amplification process

    NARCIS (Netherlands)

    Lalam, N.; Jacob, C.


    The aim of Quantitative Polymerase Chain Reaction is to determine the initial amount X0 of specific nucleic acids from an observed trajectory of the amplification process, the amplification being achieved through successive replication cycles. This process depends on the efficiency fpngn of

  20. Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction. (United States)

    Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q


    The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.

  1. Replicative DNA polymerase mutations in cancer☆ (United States)

    Heitzer, Ellen; Tomlinson, Ian


    Three DNA polymerases — Pol α, Pol δ and Pol ɛ — are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson–Crick base pairing and 3′exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to ‘polymerase proofreading associated polyposis’ (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an ‘ultramutator’ phenotype, with a dramatic increase in base substitutions. PMID:24583393

  2. Replicative DNA polymerase mutations in cancer. (United States)

    Heitzer, Ellen; Tomlinson, Ian


    Three DNA polymerases - Pol α, Pol δ and Pol ɛ - are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson-Crick base pairing and 3'exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to 'polymerase proofreading associated polyposis' (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an 'ultramutator' phenotype, with a dramatic increase in base substitutions. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions (United States)

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S


    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  4. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis


    Xu, Cuiling; Maxwell, Brian A.; Suo, Zucai


    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme c...

  5. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.


    Leem, S H; Ropp, P A; Sugino, A


    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in ...

  6. Repair of Clustered Damage and DNA Polymerase Iota. (United States)

    Belousova, E A; Lavrik, O I


    Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.

  7. Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling. (United States)

    Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L


    The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.

  8. Inhibiting DNA Polymerases as a Therapeutic Intervention against Cancer

    Directory of Open Access Journals (Sweden)

    Anthony J. Berdis


    Full Text Available Inhibiting DNA synthesis is an important therapeutic strategy that is widely used to treat a number of hyperproliferative diseases including viral infections, autoimmune disorders, and cancer. This chapter describes two major categories of therapeutic agents used to inhibit DNA synthesis. The first category includes purine and pyrmidine nucleoside analogs that directly inhibit DNA polymerase activity. The second category includes DNA damaging agents including cisplatin and chlorambucil that modify the composition and structure of the nucleic acid substrate to indirectly inhibit DNA synthesis. Special emphasis is placed on describing the molecular mechanisms of these inhibitory effects against chromosomal and mitochondrial DNA polymerases. Discussions are also provided on the mechanisms associated with resistance to these therapeutic agents. A primary focus is toward understanding the roles of specialized DNA polymerases that by-pass DNA lesions produced by DNA damaging agents. Finally, a section is provided that describes emerging areas in developing new therapeutic strategies targeting specialized DNA polymerases.

  9. DNA-polymerase induced by Herpesvirus papio (HVP) in cells of lymphoblastoid cultures derived from lymphomatous baboons. Report V. (United States)

    Djachenko, A G; Lapin, B A


    A new DNA-polymerase was found in the cells of suspension lymphoblastoid cultures which produce lymphotropic baboon herpesvirus (HVP). This enzyme was isolated in a partially purified form. Some of its properties vary from those of other cellular DNA-polymerases. HVP-induced DNA-polymerase has a molecule weight of 160,000 and sedimentation coefficient of about 8 S. The enzyme is resistant to high salt concentration and N-ethylmaleimide, but it is very sensitive to phosphonoacetate. It effectively copies "activated" DNA and synthetic deoxyribohomopolymers. Attempts to reveal the DNA-polymerase activity in HVP virions were unsuccessful.

  10. DNA polymerase beta participates in mitochondrial DNA repair

    DEFF Research Database (Denmark)

    Sykora, P; Kanno, S; Akbari, M


    We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments, mitocho......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...... in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation...

  11. Thioredoxin suppresses microscopic hopping of T7 DNA polymerase on duplex DNA

    NARCIS (Netherlands)

    Etson, Candice M.; Hamdan, Samir M.; Richardson, Charles C.; Oijen, Antoine M. van; Richardson, Charles C.


    The DNA polymerases involved in DNA replication achieve high processivity of nucleotide incorporation by forming a complex with processivity factors. A model system for replicative DNA polymerases, the bacteriophage T7 DNA polymerase (gp5), encoded by gene 5, forms a tight, 1:1 complex with

  12. Interactions and Localization of Escherichia coli Error-Prone DNA Polymerase IV after DNA Damage. (United States)

    Mallik, Sarita; Popodi, Ellen M; Hanson, Andrew J; Foster, Patricia L


    Escherichia coli's DNA polymerase IV (Pol IV/DinB), a member of the Y family of error-prone polymerases, is induced during the SOS response to DNA damage and is responsible for translesion bypass and adaptive (stress-induced) mutation. In this study, the localization of Pol IV after DNA damage was followed using fluorescent fusions. After exposure of E. coli to DNA-damaging agents, fluorescently tagged Pol IV localized to the nucleoid as foci. Stepwise photobleaching indicated ∼60% of the foci consisted of three Pol IV molecules, while ∼40% consisted of six Pol IV molecules. Fluorescently tagged Rep, a replication accessory DNA helicase, was recruited to the Pol IV foci after DNA damage, suggesting that the in vitro interaction between Rep and Pol IV reported previously also occurs in vivo. Fluorescently tagged RecA also formed foci after DNA damage, and Pol IV localized to them. To investigate if Pol IV localizes to double-strand breaks (DSBs), an I-SceI endonuclease-mediated DSB was introduced close to a fluorescently labeled LacO array on the chromosome. After DSB induction, Pol IV localized to the DSB site in ∼70% of SOS-induced cells. RecA also formed foci at the DSB sites, and Pol IV localized to the RecA foci. These results suggest that Pol IV interacts with RecA in vivo and is recruited to sites of DSBs to aid in the restoration of DNA replication. DNA polymerase IV (Pol IV/DinB) is an error-prone DNA polymerase capable of bypassing DNA lesions and aiding in the restart of stalled replication forks. In this work, we demonstrate in vivo localization of fluorescently tagged Pol IV to the nucleoid after DNA damage and to DNA double-strand breaks. We show colocalization of Pol IV with two proteins: Rep DNA helicase, which participates in replication, and RecA, which catalyzes recombinational repair of stalled replication forks. Time course experiments suggest that Pol IV recruits Rep and that RecA recruits Pol IV. These findings provide in vivo evidence

  13. Mechanistic Studies with DNA Polymerases Reveal Complex Outcomes following Bypass of DNA Damage

    Directory of Open Access Journals (Sweden)

    Robert L. Eoff


    Full Text Available DNA is a chemically reactive molecule that is subject to many different covalent modifications from sources that are both endogenous and exogenous in origin. The inherent instability of DNA is a major obstacle to genomic maintenance and contributes in varying degrees to cellular dysfunction and disease in multi-cellular organisms. Investigations into the chemical and biological aspects of DNA damage have identified multi-tiered and overlapping cellular systems that have evolved as a means of stabilizing the genome. One of these pathways supports DNA replication events by in a sense adopting the mantra that one must “make the best of a bad situation” and tolerating covalent modification to DNA through less accurate copying of the damaged region. Part of this so-called DNA damage tolerance pathway involves the recruitment of specialized DNA polymerases to sites of stalled or collapsed replication forks. These enzymes have unique structural and functional attributes that often allow bypass of adducted template DNA and successful completion of genomic replication. What follows is a selective description of the salient structural features and bypass properties of specialized DNA polymerases with an emphasis on Y-family members.

  14. Translesion DNA polymerases Pol ζ, Pol η, Pol ι, Pol κ and Rev1 are ...

    Indian Academy of Sciences (India)


    Specialized DNA polymerases called translesion polymerases are among the major determinants of spontaneous and DNA damage-induced mutation in both prokaryotes and eukaryotes. (Livneh 2001). The classical replicative DNA polymerases can synthesize DNA with remarkable efficiency and fidelity.

  15. PCNA mono-ubiquitination and activation of translesion DNA polymerases by DNA polymerase {alpha}. (United States)

    Suzuki, Motoshi; Niimi, Atsuko; Limsirichaikul, Siripan; Tomida, Shuta; Miao Huang, Qin; Izuta, Shunji; Usukura, Jiro; Itoh, Yasutomo; Hishida, Takashi; Akashi, Tomohiro; Nakagawa, Yoshiyuki; Kikuchi, Akihiko; Pavlov, Youri; Murate, Takashi; Takahashi, Takashi


    Translesion DNA synthesis (TLS) involves PCNA mono-ubiquitination and TLS DNA polymerases (pols). Recent evidence has shown that the mono-ubiquitination is induced not only by DNA damage but also by other factors that induce stalling of the DNA replication fork. We studied the effect of spontaneous DNA replication errors on PCNA mono-ubiquitination and TLS induction. In the pol1L868F strain, which expressed an error-prone pol alpha, PCNA was spontaneously mono-ubiquitinated. Pol alpha L868F had a rate-limiting step at the extension from mismatched primer termini. Electron microscopic observation showed the accumulation of a single-stranded region at the DNA replication fork in yeast cells. For pol alpha errors, pol zeta participated in a generation of +1 frameshifts. Furthermore, in the pol1L868F strain, UV-induced mutations were lower than in the wild-type and a pol delta mutant strain (pol3-5DV), and deletion of the RAD30 gene (pol eta) suppressed this defect. These data suggest that nucleotide misincorporation by pol alpha induces exposure of single-stranded DNA, PCNA mono-ubiquitination and activates TLS pols.

  16. Enhancement of DNA polymerase activity in potato tuber slices

    International Nuclear Information System (INIS)

    Watanabe, Akira; Imaseki, Hidemasa


    DNA polymerase was extracted from potato (Soleum tuberosum L.) tuber discs and the temporal correlation of its activity change to DNA synthesis in vivo was examined during aging of the discs. Most of the DNA polymerase was recovered as a bound form in the 18,000 x g precipitate. Reaction with the bound-form enzyme was dependent on the presence of four deoxynucleoside triphosphates, Mg 2+ , and a template. ''Activated'' DNA and heat-denatured DNA, but not native DNA, were utilized as templates. The polymerase activity was sensitive to SH reagents. Fresh discs, which do not synthesize DNA in vivo, contained a significant amount of DNA polymerase and its activity increased linearly with time until 48 hr after slicing and became four times that of fresh discs after 72 hr, whereas the activity of DNA synthesis in vivo increased with time and decreased after reaching a maximum at 30 hr. Cycloheximide inhibited the enhancement of polymerase activity. DNA polymerase from aged and fresh discs had identical requirements for deoxynucleotides and a template in their reactions, sensitivity to SH reagent, and affinity to thymidine triphosphate. (auth.)

  17. Discovery of cyanophage genomes which contain mitochondrial DNA polymerase. (United States)

    Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J


    DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

  18. UVB DNA dosimeters analyzed by polymerase chain reactors

    International Nuclear Information System (INIS)

    Yoshida, Hiroko; Regan, J.D.; Florida Inst. of Tech., Melbourne, FL


    Purified bacteriophage λ DNA was dried on a UV-transparent polymer film and served as a UVB dosimeter for personal and ecological applications. Bacteriophage λ DNA was chosen because it is commercially available and inexpensive, and its entire sequence is known. Each dosimeter contained two sets of DNA sandwiched between UV-transparent polymer films, one exposed to solar radiation (experimental) and another protected from UV radiation by black paper (control). The DNA dosimeter was then analyzed by a polymerase chain reaction (PCR) that amplifies a 500 base pair specific region of λ DNA. Photoinduced damage in DNA blocks polymerase from synthesizing a new strand; therefore, the amount of amplified product in UV-exposed DNA was reduced from that found in control DNA. The dried λ DNA dosimeter is compact, robust, safe and transportable, stable over long storage times and provides the total UVB dose integrated over the exposure time. (author)

  19. Hepatitis B virus DNA polymerase gene polymorphism based ...

    African Journals Online (AJOL)

    Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

  20. Recent Insight into the Kinetic Mechanisms and Conformational Dynamics of Y-Family DNA Polymerases


    Maxwell, Brian A.; Suo, Zucai


    The kinetic mechanisms by which DNA polymerases catalyze DNA replication and repair have long been areas of active research. Recently discovered Y-family DNA polymerases catalyze the bypass of damaged DNA bases that would otherwise block replicative DNA polymerases and stall replication forks. Unlike DNA polymerases from the five other families, the Y-family DNA polymerases have flexible, solvent-accessible active sites that are able to tolerate various types of damaged template bases and all...

  1. [Single-molecule detection and characterization of DNA replication based on DNA origami]. (United States)

    Wang, Qi; Fan, Youjie; Li, Bin


    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  2. [DNA-dependent DNA polymerase induced by herpes virus papio (HVP) in producing cells]. (United States)

    D'iachenko, A G; Beriia, L Ia; Matsenko, L D; Kakubava, V V; Kokosh, L V


    A new DNA polymerase was found in the cells of suspension lymphoblastoid cultures, which produce lymphotropic baboon herpes virus (HVP). The enzyme was isolated in a partially purified form. In some properties the enzyme differs from other cellular DNA polymerases. The HVP-induced DNA polymerase has the molecular weight of 1,6 x 10(5) and sedimentation coefficient of about 8S. The enzyme is resistant to high salt concentrations and N-ethylmaleimide, but shows a pronounced sensitivity to phosphonoacetate. The enzyme effectively copies "activated" DNA and synthetic deoxyribohomopolymers. The attempts to detect the DNA polymerase activity in HVP virions were unsuccessful.

  3. Inhibition of polymerases-alpha and -beta completely blocks DNA repair induced by UV irradiation in cultured mouse neuronal cells

    International Nuclear Information System (INIS)

    Licastro, F.; Sarafian, T.; Verity, A.M.; Walford, R.L.


    The effects of hydroxyurea, aphidicolin and dideoxythymidine on UV-induced DNA repair of mouse neuronal granular cells were studied. Aphidicolin, which is considered a specific inhibitor of polymerase-alpha, decreased spontaneous DNA synthesis by 93% and totally suppressed DNA repair. Dideoxythymidine, an inhibitor of polymerase-beta, was more potent in decreasing scheduled DNA synthesis than aphidicolin, and also completely blocked the UV-induced DNA repair. Hydroxyurea, a specific inhibitor of ribonucleotide reductase, inhibited scheduled DNA synthesis, but unscheduled DNA synthesis after UV irradiation was always well detectable. Our data suggest that in neuronal cells from 5 to 10 days old mice both polymerases-alpha and -beta are required for both DNA synthesis and repair. These two enzymes may act jointly in filling up the gaps along the DNA molecule and elongating the DNA chain

  4. PCR performance of a thermostable heterodimeric archaeal DNA polymerase (United States)

    Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine


    DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315

  5. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Directory of Open Access Journals (Sweden)

    Tom eKillelea


    Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.

  6. PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.


    Cline, J; Braman, J C; Hogrefe, H H


    The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) < Deep Vent (2.7 x 10(-6)) < Vent (2.8 x 10(-6)) < Taq (8.0 x 10(-6)) < < exo- Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at p...

  7. Prediction of Active Site and Distal Residues in E. coli DNA Polymerase III alpha Polymerase Activity. (United States)

    Parasuram, Ramya; Coulther, Timothy A; Hollander, Judith M; Keston-Smith, Elise; Ondrechen, Mary Jo; Beuning, Penny J


    The process of DNA replication is carried out with high efficiency and accuracy by DNA polymerases. The replicative polymerase in E. coli is DNA Pol III, which is a complex of 10 different subunits that coordinates simultaneous replication on the leading and lagging strands. The 1160-residue Pol III alpha subunit is responsible for the polymerase activity and copies DNA accurately, making one error per 10 5 nucleotide incorporations. The goal of this research is to determine the residues that contribute to the activity of the polymerase subunit. Homology modeling and the computational methods of THEMATICS and POOL were used to predict functionally important amino acid residues through their computed chemical properties. Site-directed mutagenesis and biochemical assays were used to validate these predictions. Primer extension, steady-state single-nucleotide incorporation kinetics, and thermal denaturation assays were performed to understand the contribution of these residues to the function of the polymerase. This work shows that the top 15 residues predicted by POOL, a set that includes the three previously known catalytic aspartate residues, seven remote residues, plus five previously unexplored first-layer residues, are important for function. Six previously unidentified residues, R362, D405, K553, Y686, E688, and H760, are each essential to Pol III activity; three additional residues, Y340, R390, and K758, play important roles in activity.

  8. Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases. (United States)

    Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I


    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases.

  9. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis (United States)

    Suo, Zucai


    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550

  10. Effect of γ-irradiated DNA on the activity of DNA polymerase

    International Nuclear Information System (INIS)

    Leadon, S.A.; Ward, J.F.


    A cell-free assay was developed to measure the effect of γ-irradiated DNA template on the ability of DNA polymerase to copy unirradiated template. Doses as low as 1 krad were able to decrease (approx. 15%) the activity of both bacterial and mammalian DNA polymerases in the assay. The percentage of polymerase activity decreased as the dose received by the template increased. The reduction in DNA polymerase activity was shown to be due to an inhibition of the enzyme by the irradiated DNA. Irradiated poly(dA-dT) was more effective in reducing polymerase activity than calf thymus DNA. Thus the polymerase-inhibition site(s) appears to be associated with base damage, specifically adenine or thymine. Using a free-radical scavenger, OH radicals were found to be involved in producing the damage sites. The interaction between irradiated DNA and DNA polymerase was found to be specific for the enzyme and not for other proteins present in the assay. The inhibition of DNA polymerase occurred prior to or during the initiation of DNA synthesis rather than after initiation of synthesis, i.e., during elongation

  11. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication. (United States)

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang


    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  12. Atomistic Molecular Dynamics Simulations of Mitochondrial DNA Polymerase γ

    DEFF Research Database (Denmark)

    Euro, Liliya; Haapanen, Outi; Róg, Tomasz


    of replisomal interactions, and functional effects of patient mutations that do not affect direct catalysis have remained elusive. Here we report the first atomistic classical molecular dynamics simulations of the human Pol γ replicative complex. Our simulation data show that DNA binding triggers remarkable......DNA polymerase γ (Pol γ) is a key component of the mitochondrial DNA replisome and an important cause of neurological diseases. Despite the availability of its crystal structures, the molecular mechanism of DNA replication, the switch between polymerase and exonuclease activities, the site...... changes in the enzyme structure, including (1) completion of the DNA-binding channel via a dynamic subdomain, which in the apo form blocks the catalytic site, (2) stabilization of the structure through the distal accessory β-subunit, and (3) formation of a putative transient replisome-binding platform...

  13. EBV DNA polymerase inhibition of tannins from Eugenia uniflora. (United States)

    Lee, M H; Chiou, J F; Yen, K Y; Yang, L L


    Nasopharyngeal carcinoma (NPC) is one of the high population malignant tumors among Chinese in southern China and southeast Asia. Epstein-Barr virus (EBV) is a human B lymphotropic herpes virus which is known to be closely associated with NPC. EBV DNA polymerase is a key enzyme during EBV replication and is measured by its radioactivity. The addition of phorbol 12-myristate 13-acetate to Raji cell cultures led to a large increase in EBV DNA polymerase, which was purified by sequential DEAE-cellulose, phosphocellulose and DNA-cellulose column chromatography. Four tannins were isolated from the active fractions of Eugenia uniflora L., which were tested for the inhibition of EBV DNA polymerase. The results showed the 50% inhibitory concentration (IC(50)) values of gallocatechin, oenothein B, eugeniflorins D(1) and D(2) were 26.5 62.3, 3.0 and 3.5 microM, respectively. Furthermore, when compared with the positive control (phosphonoacetic acid), an inhibitor of EBV replication, the IC(50) value was 16.4 microM. In view of the results, eugeniflorins D(1) and D(2) are the potency principles in the inhibition of EBV DNA polymerase from E. uniflora.

  14. Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication.

    Directory of Open Access Journals (Sweden)

    Fabio Lapenta

    Full Text Available DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics.

  15. Chromosomal location of the human gene for DNA polymerase β

    International Nuclear Information System (INIS)

    McBride, O.W.; Zmudzka, B.Z.; Wilson, S.H.


    Inhibition studies indicate that DNA polymerase β has a synthetic role in DNA repair after exposure of mammalian cells to some types of DNA-damaging agents. The primary structure of the enzyme is highly conserved in vertebrates, and nearly full-length cDNAs for the enzyme were recently cloned from mammalian cDNA libraries. Southern blot analysis of DNA from a panel of human-rodent somatic cell hybrids, using portions of the cDNA as probe, indicates that the gene for human DNA polymerase β is single copy and located on the short arm or proximal long arm of chromosome 8 (8pter-8q22). A restriction fragment length polymorphism (RFLP) was detected in normal individuals by using a probe from the 5' end of the cDNA, and this RFLP probably is due to an insertion or duplication of DNA in 20-25% of the population. This restriction site can be used as one marker for chromosome 8 genetic linkage studies and for family studies of traits potentially involving this DNA repair gene

  16. Structure of human DNA polymerase iota and the mechanism of DNA synthesis. (United States)

    Makarova, A V; Kulbachinskiy, A V


    Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.

  17. Separation of DNA-dependent polymerase activities in Micrococcus radiodurans

    Energy Technology Data Exchange (ETDEWEB)

    Kitayama, S; Matsuyama, A [Institute of Physical and Chemical Research, Wako, Saitama (Japan)


    DNA polymerase activities in Micrococcus radiodurans were separated into two fractions after purification more than 2000 fold. They differ in pH optimum and residual activities in the absence of a full deoxyribonucleoside triphosphates complement. NAD partly inhibited one of the activities. Both activities were eluted as a single peak on gel filtration and sedimented at the same rate on glycerol gradient centrifugation. Molecular weight 140000 was calculated from Stokes radius and sedimentation constant. Deoxyribonuclease activity was detected on one of the polymerase activities which preferentially degraded double-stranded DNA. Priming activity of nicked DNA was reduced by ..gamma.. radiation. These results have been related to the possible roles in repair synthesis in vivo or DNA synthesis in permeable cells of M. radiodurans.

  18. Accurate Digital Polymerase Chain Reaction Quantification of Challenging Samples Applying Inhibitor-Tolerant DNA Polymerases. (United States)

    Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes


    Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.

  19. Difference Raman spectroscopy of DNA molecules

    International Nuclear Information System (INIS)

    Anokhin, Andrey S; Yuzyuk, Yury I; Gorelik, Vladimir S; Dovbeshko, Galina I; Pyatyshev, Alexander Yu


    In this paper the micro-Raman spectra of calf DNA for different points of DNA sample have been recorded. The Raman spectra were made with help of difference Raman spectroscopy technique. Raman spectra were recorded with high spatial resolution from different points of the wet and dry samples in different spectral range (100÷4000cm −1 ) using two lasers: argon (514.5 nm) and helium -neon (632.8 nm). The significant differences in the Raman spectra for dry and wet DNA and for different points of DNA molecules were observed. The obtained data on difference Raman scattering spectra of DNA molecules may be used for identification of DNA types and for analysis of genetic information associated with the molecular structure of this molecule

  20. Promoter binding, initiation, and elongation by bacteriophage T7 RNA polymerase. A single-molecule view of the transcription cycle. (United States)

    Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G


    A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.


    Directory of Open Access Journals (Sweden)

    Masashi Miura


    Full Text Available SUMMARY The use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.

  2. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair. (United States)

    Leem, S H; Ropp, P A; Sugino, A


    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.

  3. The role of DNA polymerase {iota} in UV mutational spectra

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Jun-Hyuk [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Besaratinia, Ahmad [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Dong-Hyun [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Chong-Soon [Department of Biochemistry, College of Natural Sciences, Yeungnam University, Gyongsan 712-749 (Korea, Republic of); Pfeifer, Gerd P. [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States)]. E-mail:


    UVB (280-320 nm) and UVC (200-280 nm) irradiation generate predominantly cyclobutane pyrimidine dimers (CPDs) and (6-4) photoproducts in DNA. CPDs are thought to be responsible for most of the UV-induced mutations. Thymine-thymine CPDs, and probably also CPDs containing cytosine, are replicated in vivo in a largely accurate manner by a DNA polymerase {eta} (Pol {eta}) dependent process. Pol {eta} is a DNA damage-tolerant and error-prone DNA polymerase encoded by the POLH (XPV) gene in humans. Another member of the Y family of error-prone DNA polymerases is POLI encoding DNA polymerase iota (Pol {iota}). In order to clarify the specific role of Pol {iota} in UV mutagenesis, we have used an siRNA knockdown approach in combination with a supF shuttle vector which replicates in mammalian cells, similar as we have previously done for Pol {eta}. Synthetic RNA duplexes were used to efficiently inhibit Pol {iota} expression in 293T cells. The supF shuttle vector was irradiated with 254 nm UVC and replicated in 293T cells in presence of anti-Pol {iota} siRNA. Surprisingly, there was a consistent reduction of recovered plasmid from cells with Pol {iota} knockdown and this was independent of UV irradiation of the plasmid. The supF mutant frequency was unchanged in the siRNA knockdown cells relative to control cells confirming that Pol {iota} does not play an important role in UV mutagenesis. UV-induced supF mutants were sequenced from siRNA-treated cells and controls. Neither the type of mutations nor their distribution along the supF gene were significantly different between controls and siRNA knockdown cells and were predominantly C to T and CC to TT transitions at dipyrimidine sites. These results show that Pol {iota} has no significant role in UV lesion bypass and mutagenesis in vivo and provides some initial data suggesting that this polymerase may be involved in replication of extrachromosomal DNA.

  4. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  5. Bypass of a psoralen DNA interstrand cross-link by DNA polymerases beta, iota, and kappa in vitro (United States)

    Smith, Leigh A.; Makarova, Alena V.; Samson, Laura; Thiesen, Katherine E.; Dhar, Alok; Bessho, Tadayoshi


    Repair of DNA inter-strand cross-links in mammalian cells involves several biochemically distinctive processes, including the release of one of the cross-linked strands and translesion DNA synthesis (TLS). In this report, we investigated in vitro TLS activity of psoralen DNA inter-strand cross-link by three DNA repair polymerases, DNA polymerase beta, kappa and iota. DNA polymerase beta is capable of bypassing a psoralen cross-link with a low efficiency. Cell extracts prepared from DNA polymerase beta knockout mouse embryonic fibroblast showed a reduced bypass activity of the psoralen cross-link and purified DNA polymerase beta restored the bypass activity. In addition, DNA polymerase iota mis-incorporated thymine across the psoralen cross-link and DNA polymerase kappa extended these mis-paired primer ends, suggesting that DNA polymerase iota may serve as an inserter and DNA polymerase kappa may play a role as an extender in the repair of psoralen DNA inter-strand cross-links. The results demonstrated here indicate that multiple DNA polymerases could participate in TLS steps in mammalian DNA inter-strand cross-link repair. PMID:23106263

  6. Structure and mechanism of human DNA polymerase [eta

    Energy Technology Data Exchange (ETDEWEB)

    Biertümpfel, Christian; Zhao, Ye; Kondo, Yuji; Ramón-Maiques, Santiago; Gregory, Mark; Lee, Jae Young; Masutani, Chikahide; Lehmann, Alan R.; Hanaoka, Fumio; Yang, Wei (Sussex); (NIH); (Gakushuin); (Osaka)


    The variant form of the human syndrome xeroderma pigmentosum (XPV) is caused by a deficiency in DNA polymerase {eta} (Pol{eta}), a DNA polymerase that enables replication through ultraviolet-induced pyrimidine dimers. Here we report high-resolution crystal structures of human Pol{eta} at four consecutive steps during DNA synthesis through cis-syn cyclobutane thymine dimers. Pol{eta} acts like a 'molecular splint' to stabilize damaged DNA in a normal B-form conformation. An enlarged active site accommodates the thymine dimer with excellent stereochemistry for two-metal ion catalysis. Two residues conserved among Pol{eta} orthologues form specific hydrogen bonds with the lesion and the incoming nucleotide to assist translesion synthesis. On the basis of the structures, eight Pol{eta} missense mutations causing XPV can be rationalized as undermining the molecular splint or perturbing the active-site alignment. The structures also provide an insight into the role of Pol{eta} in replicating through D loop and DNA fragile sites.

  7. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair

    Directory of Open Access Journals (Sweden)

    Elisa Mentegari


    Full Text Available DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell’s genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.

  8. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair. (United States)

    Mentegari, Elisa; Kissova, Miroslava; Bavagnoli, Laura; Maga, Giovanni; Crespan, Emmanuele


    DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell's genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.

  9. Characterization of DNA polymerase. beta. mRNA: cell-cycle growth response in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Zmudzka, B Z; Fornace, A; Collins, J; Wilson, S H


    DNA polymerase ..beta.. (..beta..-polymerase) is a housekeeping enzyme involved in DNA repair in vertebrate cells. The authors used a cDNA probe to study abundance of ..beta..-polymerase mRNA in cultured human cells. The mRNA level in synchronized HeLa cells, representing different stages of the cell-cycle, varied only slightly. Contact inhibited fibroblasts AG-1522 contained the same level of mRNA as growing cells. The steady-state level of mRNA in fibroblasts is equivalent to 6 molecules per cell. The results indicate that the ..beta..-polymerase transcript is low abundance and is neither cell-cycles nor growth phase responsive.

  10. Archaeal RNA polymerase arrests transcription at DNA lesions. (United States)

    Gehring, Alexandra M; Santangelo, Thomas J


    Transcription elongation is not uniform and transcription is often hindered by protein-bound factors or DNA lesions that limit translocation and impair catalysis. Despite the high degree of sequence and structural homology of the multi-subunit RNA polymerases (RNAP), substantial differences in response to DNA lesions have been reported. Archaea encode only a single RNAP with striking structural conservation with eukaryotic RNAP II (Pol II). Here, we demonstrate that the archaeal RNAP from Thermococcus kodakarensis is sensitive to a variety of DNA lesions that pause and arrest RNAP at or adjacent to the site of DNA damage. DNA damage only halts elongation when present in the template strand, and the damage often results in RNAP arresting such that the lesion would be encapsulated with the transcription elongation complex. The strand-specific halt to archaeal transcription elongation on modified templates is supportive of RNAP recognizing DNA damage and potentially initiating DNA repair through a process akin to the well-described transcription-coupled DNA repair (TCR) pathways in Bacteria and Eukarya.

  11. DNA repair in DNA-polymerase-deficient mutants of Escherichia coli

    International Nuclear Information System (INIS)

    Smith, D.W.; Tait, R.C.; Harris, A.L.


    Escherichia coli mutants deficient in DNA polymerase I, in DNA polymerases I and II, or in DNA polymerase III can efficiently and completely execute excision-repair and postreplication repair of the uv-damaged DNA at 30 0 C and 43 0 C when assayed by alkaline sucrose gradients. Repair by Pol I - and Pol I - , Pol II - cells is inhibited by 1-β-D-arabinofuranosylcytosine (araC) at 43 0 C but not at 30 0 C, whereas that by Pol III - cells is insensitive to araC at any temperature. Thus, either Pol I or Pol III is required for complete and efficient repair, and in their absence Pol II mediates a limited, incomplete dark repair of uv-damaged DNA

  12. Nano-manipulation of single DNA molecules

    International Nuclear Information System (INIS)

    Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie


    Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)

  13. Inhibition of DNA replication, DNA repair synthesis, and DNA polymerases α and δ by butylphenyl deoxyguanosine triphosphate

    International Nuclear Information System (INIS)

    Dreslor, S.L.; Frattini, M.G.


    Semiconservative DNA replication in growing mammalian cells and ultraviolet (UV)-induced DNA repair synthesis in nongrowing mammalian cells are mediated by one or both of the aphidicolin-sensitive DNA polymerases, α and/or δ. They have studied the inhibition of replication and repair synthesis in permeable human cells by N 2 (p-n-butylphenyl)-2'-deoxyguanosine-5'-triphosphate (BuPh dGTP), an agent which inhibits polymerase α strongly and polymerase δ weakly. Both processes are inhibited by BuPh-dGTP in competition with dGTP. The K/sub i/'s are, for replication, 2-3 μM and, for repair synthesis, 3-4 μM, consistent with the involvement of the same DNA polymerase in both processes. Inhibition of isolated human polymerase α by BuPh-dGTP is also competitive with dGTP, but the K/sub i/ is approximately 10 nM, several hundred-fold lower than the K/sub i/'s of replication and repair synthesis. Isolated polymerase δ is inhibited by BuPh-dGTP at doses similar to those which inhibit replication and repair synthesis, however, attempts to determine the K/sub i/ of polymerase δ were hampered by the finding that the dependence of δ activity on deoxyribunucleotide concentration is parabolic at low doses. This behavior differs from the behavior of polymerase α and of cellular DNA replication and repair synthesis, all of which show a simple, hyperbolic relationship between activity and deoxyribonucleotide concentration. Thus, inhibition of DNA replication and UV induced DNA repair synthesis by BuPh dGTP is quantitatively similar to DNA polymerase δ, but some other characteristics of the cellular processes are more similar to those of polymerase α

  14. DNA structure in human RNA polymerase II promoters

    DEFF Research Database (Denmark)

    Pedersen, Anders Gorm; Baldi, Pierre; Chauvin, Yves


    with a very low level of sequence similarity. The sequences, which include both TATA-containing and TATA-less promoters, are aligned by hidden Markov models. Using three different models of sequence-derived DNA bendability, the aligned promoters display a common structural profile with bendability being low...... protein in a manner reminiscent of DNA in a nucleosome. This notion is further supported by the finding that the periodic bendability is caused mainly by the complementary triplet pairs CAG/CTG and GGC/GCC, which previously have been found to correlate with nucleosome positioning. We present models where......The fact that DNA three-dimensional structure is important for transcriptional regulation begs the question of whether eukaryotic promoters contain general structural features independently of what genes they control. We present an analysis of a large set of human RNA polymerase II promoters...

  15. Lesion Orientation of O4-Alkylthymidine Influences Replication by Human DNA Polymerase η


    O’Flaherty, D. K.; Patra, A.; Su, Y.; Guengerich, F. P.; Egli, M.; Wilds, C. J.


    DNA lesions that elude repair may undergo translesion synthesis catalyzed by Y-family DNA polymerases. O4-Alkylthymidines, persistent adducts that can result from carcinogenic agents, may be encountered by DNA polymerases. The influence of lesion orientation around the C4-O4 bond on processing by human DNA polymerase η (hPol η) was studied for oligonucleotides containing O4-methylthymidine, O4-ethylthymidine, and analogs restricting the O4-methylene group in an anti-orientation. Primer extens...

  16. Replicative DNA polymerase δ but not ε proofreads errors in Cis and in Trans.

    Directory of Open Access Journals (Sweden)

    Carrie L Flood


    Full Text Available It is now well established that in yeast, and likely most eukaryotic organisms, initial DNA replication of the leading strand is by DNA polymerase ε and of the lagging strand by DNA polymerase δ. However, the role of Pol δ in replication of the leading strand is uncertain. In this work, we use a reporter system in Saccharomyces cerevisiae to measure mutation rates at specific base pairs in order to determine the effect of heterozygous or homozygous proofreading-defective mutants of either Pol ε or Pol δ in diploid strains. We find that wild-type Pol ε molecules cannot proofread errors created by proofreading-defective Pol ε molecules, whereas Pol δ can not only proofread errors created by proofreading-defective Pol δ molecules, but can also proofread errors created by Pol ε-defective molecules. These results suggest that any interruption in DNA synthesis on the leading strand is likely to result in completion by Pol δ and also explain the higher mutation rates observed in Pol δ-proofreading mutants compared to Pol ε-proofreading defective mutants. For strains reverting via AT→GC, TA→GC, CG→AT, and GC→AT mutations, we find in addition a strong effect of gene orientation on mutation rate in proofreading-defective strains and demonstrate that much of this orientation dependence is due to differential efficiencies of mispair elongation. We also find that a 3'-terminal 8 oxoG, unlike a 3'-terminal G, is efficiently extended opposite an A and is not subject to proofreading. Proofreading mutations have been shown to result in tumor formation in both mice and humans; the results presented here can help explain the properties exhibited by those proofreading mutants.

  17. General misincorporation frequency: Re-evaluation of the fidelity of DNA polymerases. (United States)

    Yang, Jie; Li, Bianbian; Liu, Xiaoying; Tang, Hong; Zhuang, Xiyao; Yang, Mingqi; Xu, Ying; Zhang, Huidong; Yang, Chun


    DNA replication in cells is performed in the presence of four dNTPs and four rNTPs. In this study, we re-evaluated the fidelity of DNA polymerases using the general misincorporation frequency consisting of three incorrect dNTPs and four rNTPs but not using the traditional special misincorporation frequency with only the three incorrect dNTPs. We analyzed both the general and special misincorporation frequencies of nucleotide incorporation opposite dG, rG, or 8-oxoG by Pseudomonas aeruginosa phage 1 (PaP1) DNA polymerase Gp90 or Sulfolobus solfataricus DNA polymerase Dpo4. Both misincorporation frequencies of other DNA polymerases published were also summarized and analyzed. The general misincorporation frequency is obviously higher than the special misincorporation frequency for many DNA polymerases, indicating the real fidelity of a DNA polymerase should be evaluated using the general misincorporation frequency. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. The proofreading 3'→5' exonuclease activity of DNA polymerases: a kinetic barrier to translesion DNA synthesis

    International Nuclear Information System (INIS)

    Khare, Vineeta; Eckert, Kristin A.


    The 3'→5' exonuclease activity intrinsic to several DNA polymerases plays a primary role in genetic stability; it acts as a first line of defense in correcting DNA polymerase errors. A mismatched basepair at the primer terminus is the preferred substrate for the exonuclease activity over a correct basepair. The efficiency of the exonuclease as a proofreading activity for mispairs containing a DNA lesion varies, however, being dependent upon both the DNA polymerase/exonuclease and the type of DNA lesion. The exonuclease activities intrinsic to the T4 polymerase (family B) and DNA polymerase γ (family A) proofread DNA mispairs opposite endogenous DNA lesions, including alkylation, oxidation, and abasic adducts. However, the exonuclease of the Klenow polymerase cannot discriminate between correct and incorrect bases opposite alkylation and oxidative lesions. DNA damage alters the dynamics of the intramolecular partitioning of DNA substrates between the 3'→5' exonuclease and polymerase activities. Enzymatic idling at lesions occurs when an exonuclease activity efficiently removes the same base that is preferentially incorporated by the DNA polymerase activity. Thus, the exonuclease activity can also act as a kinetic barrier to translesion synthesis (TLS) by preventing the stable incorporation of bases opposite DNA lesions. Understanding the downstream consequences of exonuclease activity at DNA lesions is necessary for elucidating the mechanisms of translesion synthesis and damage-induced cytotoxicity

  19. Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis (United States)

    Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai


    The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

  20. Role of exonucleolytic processing and polymerase-DNA association in bypass of lesions during replication in vitro. Significance for SOS-targeted mutagenesis

    International Nuclear Information System (INIS)

    Shwartz, H.; Shavitt, O.; Livneh, Z.


    The role of exonuclease activity in trans-lesion DNA replication with Escherichia coli DNA polymerase III holoenzyme was investigated. RecA protein inhibited the 3'----5' exonuclease activity of the polymerase 2-fold when assayed in the absence of replication and had no effect on turnover of dNTPs into dNMPs. In contrast, single-stranded DNA-binding protein, which had no effect on the exonuclease activity in the absence of replication, showed a pronounced 7-fold suppression of the 3'----5' exonuclease activity during replication. The excision of incorporated dNMP alpha S residues from DNA by the 3'----5' exonuclease activity of DNA polymerase III holoenzyme was inhibited 10-20-fold; still no increase in bypass of pyrimidine photodimers was observed. Thus, in agreement with our previous results in which the exonuclease activity was inhibited at the protein level, inhibition at the DNA level also did not increase bypass of photodimers. Fractionation of the replication mixture after termination of DNA synthesis on a Bio-Gel A-5m column under conditions which favor polymerase-DNA binding yielded a termination complex which could perform turnover of dNTPs into dNMPs. Adding challenge-primed single-stranded DNA to the complex yielded a burst of DNA synthesis which was promoted most likely by DNA polymerase III holoenzyme molecules transferred from the termination complex to the challenge DNA thus demonstrating the instability of the polymerase-DNA association. Addition of a fresh sample of DNA polymerase III holoenzyme to purified termination products, which consist primarily of partially replicated molecules with nascent chains terminated at UV lesions, did not result in any net DNA synthesis as expected

  1. Involvement of the yeast DNA polymerase delta in DNA repair in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Giot, L. [State University of New York at Stony Brook, Stony Brook, NY. (United States); Chanet, R.; Simon, M.; Facca, C.; Faye, G.


    The POL3 encoded catalytic subunit of DNA polymerase delta possesses a highly conserved C-terminal cysteine-rich domain in Saccharomyces cerevisiae. Mutations in some of its cysteine codons display a lethal phenotype, which demonstrates an essential function of this domain. The thermosensitive mutant pol3-13, in which a serine replaces a cysteine of this domain, exhibits a range of defects in DNA repair, such as hypersensitivity to different DNA-damaging agents and deficiency for induced mutagenesis and for recombination. These phenotypes are observed at 24 degrees, a temperature at which DNA replication is almost normal; this differentiates the functions of POL3 in DNA repair and DNA replication. Since spontaneous mutagenesis and spontaneous recombination are efficient in pol3-13, we propose that POL3 plays an important role in DNA repair after irradiation, particularly in the error-prone and recombinational pathways. Extragenic suppressors of pol3-13 are allelic to sdp5-1, previously identified as an extragenic suppressor of pol3-11. SDP5, which is identical to HYS2, encodes a protein homologous to the p50 subunit of bovine and human DNA polymerase delta. SDP5 is most probably the p55 subunit of Pol delta of S. cerevisiae and seems to be associated with the catalytic subunit for both DNA replication and DNA repair. (author)

  2. A specific subdomain in φ29 DNA polymerase confers both processivity and strand-displacement capacity (United States)

    Rodríguez, Irene; Lázaro, José M.; Blanco, Luis; Kamtekar, Satwik; Berman, Andrea J.; Wang, Jimin; Steitz, Thomas A.; Salas, Margarita; de Vega, Miguel


    Recent crystallographic studies of φ29 DNA polymerase have provided structural insights into its strand displacement and processivity. A specific insertion named terminal protein region 2 (TPR2), present only in protein-primed DNA polymerases, together with the exonuclease, thumb, and palm subdomains, forms two tori capable of interacting with DNA. To analyze the functional role of this insertion, we constructed a φ29 DNA polymerase deletion mutant lacking TPR2 amino acid residues Asp-398 to Glu-420. Biochemical analysis of the mutant DNA polymerase indicates that its DNA-binding capacity is diminished, drastically decreasing its processivity. In addition, removal of the TPR2 insertion abolishes the intrinsic capacity of φ29 DNA polymerase to perform strand displacement coupled to DNA synthesis. Therefore, the biochemical results described here directly demonstrate that TPR2 plays a critical role in strand displacement and processivity. PMID:15845765

  3. DNA polymerase ι: The long and the short of it! (United States)

    Frank, Ekaterina G; McLenigan, Mary P; McDonald, John P; Huston, Donald; Mead, Samantha; Woodgate, Roger


    The cDNA encoding human DNA polymerase ι (POLI) was cloned in 1999. At that time, it was believed that the POLI gene encoded a protein of 715 amino acids. Advances in DNA sequencing technologies led to the realization that there is an upstream, in-frame initiation codon that would encode a DNA polymerase ι (polι) protein of 740 amino acids. The extra 25 amino acid region is rich in acidic residues (11/25) and is reasonably conserved in eukaryotes ranging from fish to humans. As a consequence, the curated Reference Sequence (RefSeq) database identified polι as a 740 amino acid protein. However, the existence of the 740 amino acid polι has never been shown experimentally. Using highly specific antibodies to the 25 N-terminal amino acids of polι, we were unable to detect the longer 740 amino acid (ι-long) isoform in western blots. However, trace amounts of the ι-long isoform were detected after enrichment by immunoprecipitation. One might argue that the longer isoform may have a distinct biological function, if it exhibits significant differences in its enzymatic properties from the shorter, well-characterized 715 amino acid polι. We therefore purified and characterized recombinant full-length (740 amino acid) polι-long and compared it to full-length (715 amino acid) polι-short in vitro. The metal ion requirements for optimal catalytic activity differ slightly between ι-long and ι-short, but under optimal conditions, both isoforms exhibit indistinguishable enzymatic properties in vitro. We also report that like ι-short, the ι-long isoform can be monoubiquitinated and polyubiuquitinated in vivo, as well as form damage induced foci in vivo. We conclude that the predominant isoform of DNA polι in human cells is the shorter 715 amino acid protein and that if, or when, expressed, the longer 740 amino acid isoform has identical properties to the considerably more abundant shorter isoform. Published by Elsevier B.V.

  4. A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity. (United States)

    Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M


    The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

  5. DNA polymerase zeta cooperates with polymerases kappa and iota in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients. (United States)

    Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi


    Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase eta, the POLH gene product. A deficiency in DNA polymerase eta due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase zeta cooperates with DNA polymerases kappa and iota to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases zeta and kappa, but not iota, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load.

  6. DNA polymerase ζ cooperates with polymerases κ and ι in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients (United States)

    Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi


    Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase η, the POLH gene product. A deficiency in DNA polymerase η due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase ζ cooperates with DNA polymerases κ and ι to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases ζ and κ, but not ι, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load. PMID:19564618

  7. In vitro gap-directed translesion DNA synthesis of an abasic site involving human DNA polymerases epsilon, lambda, and beta

    Czech Academy of Sciences Publication Activity Database

    Villani, G.; Hübscher, U.; Gironis, N.; Parkkinen, S.; Pospiech, H.; Shevelev, Igor; di Cicco, G.; Markennen, E.; Syvaaja, J.E.; Le Gac, N.T.


    Roč. 286, č. 37 (2011), s. 32094-32104 ISSN 0021-9258 Grant - others:Academy of Finland(FI) 106986; Academy of Finland(FI) 123082 Institutional research plan: CEZ:AV0Z50520514 Keywords : DNA damage * DNA polymerase * DNA repair * DNA replication * DNA -protein interaction Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.773, year: 2011

  8. Interaction between DNA Polymerase β and BRCA1.

    Directory of Open Access Journals (Sweden)

    Aya Masaoka

    Full Text Available The breast cancer 1 (BRCA1 protein is a tumor suppressor playing roles in DNA repair and cell cycle regulation. Studies of DNA repair functions of BRCA1 have focused on double-strand break (DSB repair pathways and have recently included base excision repair (BER. However, the function of BRCA1 in BER is not well defined. Here, we examined a BRCA1 role in BER, first in relation to alkylating agent (MMS treatment of cells and the BER enzyme DNA polymerase β (pol β. MMS treatment of BRCA1 negative human ovarian and chicken DT40 cells revealed hypersensitivity, and the combined gene deletion of BRCA1 and pol β in DT40 cells was consistent with these factors acting in the same repair pathway, possibly BER. Using cell extracts and purified proteins, BRCA1 and pol β were found to interact in immunoprecipitation assays, yet in vivo and in vitro assays for a BER role of BRCA1 were negative. An alternate approach with the human cells of immunofluorescence imaging and laser-induced DNA damage revealed negligible BRCA1 recruitment during the first 60 s after irradiation, the period typical of recruitment of pol β and other BER factors. Instead, 15 min after irradiation, BRCA1 recruitment was strong and there was γ-H2AX co-localization, consistent with DSBs and repair. The rapid recruitment of pol β was similar in BRCA1 positive and negative cells. However, a fraction of pol β initially recruited remained associated with damage sites much longer in BRCA1 positive than negative cells. Interestingly, pol β expression was required for BRCA1 recruitment, suggesting a partnership between these repair factors in DSB repair.

  9. Evidence that DNA polymerase δ contributes to initiating leading strand DNA replication in Saccharomyces cerevisiae. (United States)

    Garbacz, Marta A; Lujan, Scott A; Burkholder, Adam B; Cox, Phillip B; Wu, Qiuqin; Zhou, Zhi-Xiong; Haber, James E; Kunkel, Thomas A


    To investigate nuclear DNA replication enzymology in vivo, we have studied Saccharomyces cerevisiae strains containing a pol2-16 mutation that inactivates the catalytic activities of DNA polymerase ε (Pol ε). Although pol2-16 mutants survive, they present very tiny spore colonies, increased doubling time, larger than normal cells, aberrant nuclei, and rapid acquisition of suppressor mutations. These phenotypes reveal a severe growth defect that is distinct from that of strains that lack only Pol ε proofreading (pol2-4), consistent with the idea that Pol ε is the major leading-strand polymerase used for unstressed DNA replication. Ribonucleotides are incorporated into the pol2-16 genome in patterns consistent with leading-strand replication by Pol δ when Pol ε is absent. More importantly, ribonucleotide distributions at replication origins suggest that in strains encoding all three replicases, Pol δ contributes to initiation of leading-strand replication. We describe two possible models.

  10. Electron microscope autoradiography of isolated DNA molecules

    International Nuclear Information System (INIS)

    Delain, Etienne; Bouteille, Michel


    Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections

  11. DNA polymerase I is required for premeiotic DNA replication and sporulation but not for X-ray repair in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Budd, M.E.; Wittrup, K.D.; Bailey, J.E.; Campbell, J.L.


    We have used a set of seven temperature-sensitive mutants in the DNA polymerase I gene of Saccharomyces cerevisiae to investigate the role of DNA polymerase I in various aspects of DNA synthesis in vivo. Previously, we showed that DNA polymerase I is required for mitotic DNA replication. Here we extend our studies to several stages of meiosis and repair of X-ray-induced damage. We find that sporulation is blocked in all of the DNA polymerase temperature-sensitive mutants and that premeiotic DNA replication does not occur. Commitment to meiotic recombination is only 2% of wild-type levels. Thus, DNA polymerase I is essential for these steps. However, repair of X-ray-induced single-strand breaks is not defective in the DNA polymerase temperature-sensitive mutants, and DNA polymerase I is therefore not essential for repair of such lesions. These results suggest that DNA polymerase II or III or both, the two other nuclear yeast DNA polymerases for which roles have not yet been established, carry out repair in the absence of DNA polymerase I, but that DNA polymerase II and III cannot compensate for loss of DNA polymerase I in meiotic replication and recombination. These results do not, however, rule out essential roles for DNA polymerase II or III or both in addition to that for DNA polymerase I

  12. Involvement of DNA polymerase δ in DNA repair synthesis in human fibroblasts at late times after ultraviolet irradiation

    International Nuclear Information System (INIS)

    Dresler, S.L.; Gowans, B.J.; Robinson-Hill, R.M.; Hunting, D.J.


    DNA repair synthesis following UV irradiation of confluent human fibroblasts has a biphasic time course with an early phase of rapid nucleotide incorporation and a late phase of much slower nucleotide incorporation. The biphasic nature of this curve suggests that two distinct DNA repair systems may be operative. Previous studies have specifically implicated DNA polymerase δ as the enzyme involved in DNA repair synthesis occurring immediately after UV damage. In this paper, the authors describe studies of DNA polymerase involvement in DNA repair synthesis in confluent human fibroblasts at late times after UV irradiation. Late UV-induced DNA repair synthesis in both intact and permeable cells was found to be inhibited by aphidicolin, indicating the involvement of one of the aphidicolin-sensitive DNA polymerases, α or δ. In permeable cells, the process was further analyzed by using the nucleotide analogue (butylphenyl)-2'-deoxyguanosine 5'-triphosphate, which inhibits DNA polymerase α several hundred times more strongly than it inhibits DNA polymerase δ. The (butylphenyl)-2'-deoxyguanosine 5'-triphosphate inhibition curve for late UV-induced repair synthesis was very similar to that for polymerase δ. It appears that repair synthesis at late time after UV irradiation, like repair synthesis at early times, is mediated by DNA polymerase δ

  13. Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence. (United States)

    André, P; Kim, A; Khrapko, K; Thilly, W G


    The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10(-6) must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or "PCR noise". Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 x 10(-7), and five of its more frequent mutations (hot spots) consisted of three transversions (GC-->TA, AT-->TA, and AT-->CG), one transition (AT-->GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be reduced.

  14. Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases (United States)

    Pavlov, Andrey R.; Pavlova, Nadejda V.; Kozyavkin, Sergei A.; Slesarev, Alexei I.


    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases (Pavlov et. al., (2002) Proc. Natl. Acad. Sci. USA 99, 13510–13515). The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various non-specific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting Helix-hairpin-Helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species, but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of TopoV HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105°C by maintaining processivity of DNA synthesis at high temperatures. We also found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. PMID:22320201

  15. Sulfolobus Replication Factor C stimulates the activity of DNA Polymerase B1

    DEFF Research Database (Denmark)

    Xing, Xuanxuan; Zhang, Likui; Guo, Li


    the hyperthermophilic archaea of the genus Sulfolobus physically interacts with DNA polymerase B1 (PolB1) and enhances both the polymerase and 3'-5' exonuclease activities of PolB1 in an ATP-independent manner. Stimulation of the PolB1 activity by RFC is independent of the ability of RFC to bind DNA but is consistent...... with the ability of RFC to facilitate DNA binding by PolB1 through protein-protein interaction. These results suggest that Sulfolobus RFC may play a role in recruiting DNA polymerase for efficient primer extension, in addition to clamp loading, during DNA replication....

  16. First-passage problems in DNA replication: effects of template tension on stepping and exonuclease activities of a DNA polymerase motor

    International Nuclear Information System (INIS)

    Sharma, Ajeet K; Chowdhury, Debashish


    A DNA polymerase (DNAP) replicates a template DNA strand. It also exploits the template as the track for its own motor-like mechanical movement. In the polymerase mode it elongates the nascent DNA by one nucleotide in each step. However, whenever it commits an error by misincorporating an incorrect nucleotide, it can switch to an exonuclease mode. In the latter mode it excises the wrong nucleotide before switching back to its polymerase mode. We develop a stochastic kinetic model of DNA replication that mimics an in vitro experiment where single-stranded DNA, subjected to a mechanical tension F, is converted to double-stranded DNA by a single DNAP. The F-dependence of the average rate of replication, which depends on the rates of both polymerase and exonuclease activities of the DNAP, is in good qualitative agreement with the corresponding experimental results. We introduce nine novel distinct conditional dwell times of a DNAP. Using the method of first-passage times, we also derive the exact analytical expressions for the probability distributions of these conditional dwell times. The predicted F-dependences of these distributions are, in principle, accessible to single-molecule experiments. (paper)

  17. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.


    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  18. Cell cycle phase dependent role of DNA polymerase beta in DNA repair and survival after ionizing radiation.

    NARCIS (Netherlands)

    Vermeulen, C.; Verwijs-Janssen, M.; Begg, A.C.; Vens, C.


    PURPOSE: The purpose of the present study was to determine the role of DNA polymerase beta in repair and response after ionizing radiation in different phases of the cell cycle. METHODS AND MATERIALS: Synchronized cells deficient and proficient in DNA polymerase beta were irradiated in different

  19. DNA polymerases in the rat pituitary gland. Effect of oestrogens and sulpiride. (United States)

    Jahn, G A; Kalbermann, L E; Machiavelli, G; Szijan, I; Burdman, J A


    Changes in the activity of DNA polymerase and [3H]thymidine incorporation into the DNA of the anterior pituitary gland were studied in oestrogenized male and pregnant rats. The activities of DNA polymerases alpha and beta, extracted in Tris--HCl or in sodium phosphate buffer were characterized according to their optimum pH and sensitivity to N-ethyl-maleimide. In the Tris-soluble fraction DNA polymerase activity is almost exclusively alpha, while in the phosphate soluble fraction it is a mixture of alpha and beta. The administration of oestrogens to male rats increases [3H]thymidine incorporation and enhances the activity of DNA polymerases in the Tris-soluble fraction, while the activity of the phosphate-soluble enzyme does not change. Sulpiride administration results in a further increment of [3H]thymidine incorporation and of DNA polymerase activity in the Tris-soluble fraction. In pregnant rats sulpiride also produces an increment of DNA polymerase activity only in the Tris-soluble fraction. Thus, the activity of the Tris-soluble fraction from APG behaves as DNA polymerase alpha. This activity changes in parallel with [3H]thymidine incorporation into DNA which is an indication of cell proliferation in the gland. This is discussed with respect to a negative feedback mechanism between intracellular prolactin concentration and DNA synthesis in the APG.

  20. Variants of sequence family B Thermococcus kodakaraensis DNA polymerase with increased mismatch extension selectivity.

    Directory of Open Access Journals (Sweden)

    Claudia Huber

    Full Text Available Fidelity and selectivity of DNA polymerases are critical determinants for the biology of life, as well as important tools for biotechnological applications. DNA polymerases catalyze the formation of DNA strands by adding deoxynucleotides to a primer, which is complementarily bound to a template. To ensure the integrity of the genome, DNA polymerases select the correct nucleotide and further extend the nascent DNA strand. Thus, DNA polymerase fidelity is pivotal for ensuring that cells can replicate their genome with minimal error. DNA polymerases are, however, further optimized for more specific biotechnological or diagnostic applications. Here we report on the semi-rational design of mutant libraries derived by saturation mutagenesis at single sites of a 3'-5'-exonuclease deficient variant of Thermococcus kodakaraensis DNA polymerase (KOD pol and the discovery for variants with enhanced mismatch extension selectivity by screening. Sites of potential interest for saturation mutagenesis were selected by their proximity to primer or template strands. The resulting libraries were screened via quantitative real-time PCR. We identified three variants with single amino acid exchanges-R501C, R606Q, and R606W-which exhibited increased mismatch extension selectivity. These variants were further characterized towards their potential in mismatch discrimination. Additionally, the identified enzymes were also able to differentiate between cytosine and 5-methylcytosine. Our results demonstrate the potential in characterizing and developing DNA polymerases for specific PCR based applications in DNA biotechnology and diagnostics.

  1. α,β-D-constrained nucleic acids are strong terminators of thermostable DNA polymerases in polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Olivier Martínez

    Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.

  2. Mutations of mtDNA polymerase-γ and hyperlactataemia in the HIV ...

    African Journals Online (AJOL)

    Mutations of mtDNA polymerase-γ and hyperlactataemia in the HIV-infected Zulu population of South Africa. ... D B A Ojwach, C Aldous, P Kocheleff, B Sartorius ... of their capacity to impede human mitochondrial DNA polymerase-γ (POLG), ...

  3. How to switch the motor on: RNA polymerase initiation steps at the single-molecule level

    NARCIS (Netherlands)

    Marchetti, M.; Malinowska, A.; Heller, I.; Wuite, G. J. L.

    RNA polymerase (RNAP) is the central motor of gene expression since it governs the process of transcription. In prokaryotes, this holoenzyme is formed by the RNAP core and a sigma factor. After approaching and binding the specific promoter site on the DNA, the holoenzyme-promoter complex undergoes

  4. Isolation and characterization of high affinity aptamers against DNA polymerase iota. (United States)

    Lakhin, Andrei V; Kazakov, Andrei A; Makarova, Alena V; Pavlov, Yuri I; Efremova, Anna S; Shram, Stanislav I; Tarantul, Viacheslav Z; Gening, Leonid V


    Human DNA-polymerase iota (Pol ι) is an extremely error-prone enzyme and the fidelity depends on the sequence context of the template. Using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) procedure, we obtained an oligoribonucleotide with a high affinity to human Pol ι, named aptamer IKL5. We determined its dissociation constant with homogenous preparation of Pol ι and predicted its putative secondary structure. The aptamer IKL5 specifically inhibits DNA-polymerase activity of the purified enzyme Pol ι, but did not inhibit the DNA-polymerase activities of human DNA polymerases beta and kappa. IKL5 suppressed the error-prone DNA-polymerase activity of Pol ι also in cellular extracts of the tumor cell line SKOV-3. The aptamer IKL5 is useful for studies of the biological role of Pol ι and as a potential drug to suppress the increase of the activity of this enzyme in malignant cells.

  5. Effect of DNA polymerase inhibitors on DNA repair in intact and permeable human fibroblasts: Evidence that DNA polymerases δ and β are involved in DNA repair synthesis induced by N-methyl-N'-nitro-N-nitrosoguanidine

    International Nuclear Information System (INIS)

    Hammond, R.A.; Miller, M.R.; McClung, J.K.


    The involvement of DNA polymerases α, β, and δ in DNA repair synthesis induced by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) was investigated in human fibroblasts (HF). The effects of anti-(DNA polymerase α) monoclonal antibody, (p-n-butylphenyl)deoxyguanosine triphosphate (BuPdGTP), dideoxythymidine triphosphate (ddTTP), and aphidicolin on MNNG-induced DNA repair synthesis were investigated to dissect the roles of the different DNA polymerases. A subcellular system (permeable cells), in which DNA repair synthesis and DNA replication were differentiated by CsCl gradient centrifugation of BrdUMP density-labeled DNA, was used to examine the effects of the polymerase inhibitors. Another approach investigated the effects of several of these inhibitors of MNNG-induced DNA repair synthesis in intact cells by measuring the amount of [ 3 H]thymidine incorporated into repair DNA as determined by autoradiography and quantitation with an automated video image analysis system. In permeable cells, MNNG-induced DNA repair synthesis was inhibited 56% by 50 μg of aphidicolin/mL, 6% by 10 μM BuPdGTP, 13% by anti-(DNA polymerse α) monoclonal antibodies, and 29% by ddTTP. In intact cells, MNNG-induced DNA repair synthesis was inhibited 57% by 50 μg of aphidicolin/mL and was not significantly inhibited by microinjecting anti-(DNA polymerase α) antibodies into HF nuclei. These results indicate that both DNA polymerase δ and β are involved in repairing DNA damage caused by MNNG

  6. Bacillus subtilis DNA polymerases, PolC and DnaE, are required for both leading and lagging strand synthesis in SPP1 origin-dependent DNA replication (United States)

    Seco, Elena M.


    Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448

  7. A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering. (United States)

    Nørholm, Morten H H


    The combined use of restriction enzymes with PCR has revolutionized molecular cloning, but is inherently restricted by the content of the manipulated DNA sequences. Uracil-excision based cloning is ligase and sequence independent and allows seamless fusion of multiple DNA sequences in simple one-tube reactions, with higher accuracy than overlapping PCR. Here, the addition of a highly efficient DNA polymerase and a low-background-, large-insertion- compatible site-directed mutagenesis protocol is described, largely expanding the versatility of uracil-excision DNA engineering. The different uracil-excision based molecular tools that have been developed in an open-source fashion, constitute a comprehensive, yet simple and inexpensive toolkit for any need in molecular cloning.

  8. Gastrointestinal hyperplasia with altered expression of DNA polymerase beta.

    Directory of Open Access Journals (Sweden)

    Katsuhiko Yoshizawa


    Full Text Available Altered expression of DNA polymerase beta (Pol beta has been documented in a large percentage of human tumors. However, tumor prevalence or predisposition resulting from Pol beta over-expression has not yet been evaluated in a mouse model.We have recently developed a novel transgenic mouse model that over-expresses Pol beta. These mice present with an elevated incidence of spontaneous histologic lesions, including cataracts, hyperplasia of Brunner's gland and mucosal hyperplasia in the duodenum. In addition, osteogenic tumors in mice tails, such as osteoma and osteosarcoma were detected. This is the first report of elevated tumor incidence in a mouse model of Pol beta over-expression. These findings prompted an evaluation of human gastrointestinal tumors with regard to Pol beta expression. We observed elevated expression of Pol beta in stomach adenomas and thyroid follicular carcinomas, but reduced Pol beta expression in esophageal adenocarcinomas and squamous carcinomas.These data support the hypothesis that balanced and proficient base excision repair protein expression and base excision repair capacity is required for genome stability and protection from hyperplasia and tumor formation.

  9. Isolation and characterisation of the cDNA encoding a glycosylated accessory protein of pea chloroplast DNA polymerase.


    Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K


    The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...

  10. Conformational Selection and Induced Fit for RNA Polymerase and RNA/DNA Hybrid Backtracked Recognition

    Directory of Open Access Journals (Sweden)

    Haifeng eChen


    Full Text Available RNA polymerase catalyzes transcription with a high fidelity. If DNA/RNA mismatch or DNA damage occurs downstream, a backtracked RNA polymerase can proofread this situation. However, the backtracked mechanism is still poorly understood. Here we have performed multiple explicit-solvent molecular dynamics (MD simulations on bound and apo DNA/RNA hybrid to study backtracked recognition. MD simulations at room temperature suggest that specific electrostatic interactions play key roles in the backtracked recognition between the polymerase and DNA/RNA hybrid. Kinetics analysis at high temperature shows that bound and apo DNA/RNA hybrid unfold via a two-state process. Both kinetics and free energy landscape analyses indicate that bound DNA/RNA hybrid folds in the order of DNA/RNA contracting, the tertiary folding and polymerase binding. The predicted Φ-values suggest that C7, G9, dC12, dC15 and dT16 are key bases for the backtracked recognition of DNA/RNA hybrid. The average RMSD values between the bound structures and the corresponding apo ones and Kolmogorov-Smirnov (KS P test analyses indicate that the recognition between DNA/RNA hybrid and polymerase might follow an induced fit mechanism for DNA/RNA hybrid and conformation selection for polymerase. Furthermore, this method could be used to relative studies of specific recognition between nucleic acid and protein.

  11. DNA Polymerase κ Is a Key Cellular Factor for the Formation of Covalently Closed Circular DNA of Hepatitis B Virus.

    Directory of Open Access Journals (Sweden)

    Yonghe Qi


    Full Text Available Hepatitis B virus (HBV infection of hepatocytes begins by binding to its cellular receptor sodium taurocholate cotransporting polypeptide (NTCP, followed by the internalization of viral nucleocapsid into the cytoplasm. The viral relaxed circular (rc DNA genome in nucleocapsid is transported into the nucleus and converted into covalently closed circular (ccc DNA to serve as a viral persistence reservoir that is refractory to current antiviral therapies. Host DNA repair enzymes have been speculated to catalyze the conversion of rcDNA to cccDNA, however, the DNA polymerase(s that fills the gap in the plus strand of rcDNA remains to be determined. Here we conducted targeted genetic screening in combination with chemical inhibition to identify the cellular DNA polymerase(s responsible for cccDNA formation, and exploited recombinant HBV with capsid coding deficiency which infects HepG2-NTCP cells with similar efficiency of wild-type HBV to assure cccDNA synthesis is exclusively from de novo HBV infection. We found that DNA polymerase κ (POLK, a Y-family DNA polymerase with maximum activity in non-dividing cells, substantially contributes to cccDNA formation during de novo HBV infection. Depleting gene expression of POLK in HepG2-NTCP cells by either siRNA knockdown or CRISPR/Cas9 knockout inhibited the conversion of rcDNA into cccDNA, while the diminished cccDNA formation in, and hence the viral infection of, the knockout cells could be effectively rescued by ectopic expression of POLK. These studies revealed that POLK is a crucial host factor required for cccDNA formation during a de novo HBV infection and suggest that POLK may be a potential target for developing antivirals against HBV.

  12. DnaB gene product-independence of DNA polymerase III-directed repair synthesis in Escherichia coli K-12

    International Nuclear Information System (INIS)

    Billen, D.; Hellermann, G.R.


    An investigation has been carried out into the role of dnaB gene product in X-ray-induced repair synthesis carried out by DNA polymerase III in toluene-treated Escherichia coli K-12. A polAl polBlOO dnaB mutant deficient in both DNA polymerase I and II activities was used, and it was shown that the level of X-ray-induced, ATP-dependent, non-conservative DNA synthesis was, unlike semi-conservative DNA synthesis, unaffected by a temperature shift from 30 0 to 42 0 C. The dnaB gene product was not therefore necessary for DNA polymerase III-directed repair synthesis, which occurred in the absence of replicative synthesis. (U.K.)

  13. Multiplex single-molecule interaction profiling of DNA barcoded proteins (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.


    In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

  14. DNA polymerase III of Escherichia coli is required for UV and ethyl methanesulfonate mutagenesis

    Energy Technology Data Exchange (ETDEWEB)

    Hagensee, M.E.; Timme, T.L.; Bryan, S.K.; Moses, R.E.


    Strains of Escherichia coli possessing the pcbA1 mutation, a functional DNA polymerase I, and a temperature-sensitive mutation in DNA polymerase III can survive at the restrictive temperature (43 degrees C) for DNA polymerase III. The mutation rate of the bacterial genome of such strains after exposure to either UV light or ethyl methanesulfonate was measured by its rifampicin resistance or amino acid requirements. In addition, Weigle mutagenesis of preirradiated lambda phage was also measured. In all cases, no increase in mutagenesis was noted at the restrictive temperature for DNA polymerase III. Introduction of a cloned DNA polymerase III gene returned the mutation rate of the bacterial genome as well as the Weigle mutagenesis to normal at 43 degrees C. Using a recA-lacZ fusion, the SOS response after UV irradiation was measured and found to be normal at the restrictive and permissive temperature for DNA polymerase III, as was induction of lambda prophage. Recombination was also normal at either temperature. Our studies demonstrate that a functional DNA polymerase III is strictly required for mutagenesis at a step other than SOS induction.

  15. DNA-psoralen interaction: a single molecule experiment. (United States)

    Rocha, M S; Viana, N B; Mesquita, O N


    By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

  16. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction


    Harmey, Judith H.; Harmey, Matthew A.


    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  17. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  18. Expression of human DNA polymerase β in Escherichia coli and characterization of the recombinant enzyme

    International Nuclear Information System (INIS)

    Abbotts, J.; SenGupta, D.N.; Zmudzka, B.; Widen, S.G.; Notario, V.; Wilson, S.H.


    The coding region of a human β-polymerase cDNA, predicting a 335 amino acid protein, was subcloned in the Escherichia coli expression plasmid pRC23. After induction of transformed cells, the crude soluble extract was found to contain a new protein immunoreactive with β-polymerase antibody and corresponding in size to the protein deduced from the cDNA. This protein was purified in a yield of 1-2 mg/50 g of cells. The recombinant protein had about the same DNA polymerase specific activity as β-polymerase purified from mammalian tissues, and template-primer specificity and immunological properties of the recombinant polymerase were similar to those of natural β-polymerases. The purified enzyme was free of nuclease activity. The authors studied detailed catalytic properties of the recombinant β-polymerase using defined template-primer systems. The results indicate that this β-polymerase is essentially identical with natural β-polymerases. The recombinant enzyme is distributive in mode of synthesis and is capable of detecting changes in the integrity of the single-stranded template, such as methylated bases and a double-stranded region. The enzyme recognizes a template region four to seven bases downstream of the primer 3' end and utilizes alternative primers if this downstream template region is double stranded. The enzyme is unable to synthesize past methylated bases N 3 -methyl-dT or O 6 -methyl-dG

  19. DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli

    International Nuclear Information System (INIS)

    Dorson, J.W.; Moses, R.E.


    DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair

  20. Analysis of DNA polymerase activity in Petunia protoplasts treated with clastogenic agents

    International Nuclear Information System (INIS)

    Benediktsson, I.; Spampinato, C.P.; Andreo, C.S.; Schieder, O.


    Clastogenic agents, i.e. agents that can induce chromosome or DNA breakage, have been shown to enhance the role of direct gene transfer to protoplasts. The effect was analysed at the enzymatic level using protoplast homogenates as well as intact protoplasts. For that purpose existing procedures were modified to enable measurement of DNA polymerase in vivo. In the system used, external DNA was able to enter the cells without the addition of membrane-permeabilizing compounds. When comparing total DNA polymerase activity of protoplasts irradiated with X-rays or UV-light with that of untreated cells we did not observe significant differences. Incubation of protoplasts with high doses of bleomycin affected total DNA polymerase activity negatively. but dideoxythymidine triphosphate-sensitive activity was not influenced. We conclude that the DNA strand-breaks induced by low doses of X-rays. UV-light or bleomycin do not increase the total or the repair-DNA polymerase activity and. therefore. that the increase in the transformation rates after DNA strand-breaking is not preceded by enhanced DNA polymerase activity. (author)

  1. Fixing the model for transcription: the DNA moves, not the polymerase. (United States)

    Papantonis, Argyris; Cook, Peter R


    The traditional model for transcription sees active polymerases tracking along their templates. An alternative (controversial) model has active enzymes immobilized in "factories." Recent evidence supports the idea that the DNA moves, not the polymerase, and points to alternative explanations of how regulatory motifs like enhancers and silencers work.

  2. Extraction of ultrashort DNA molecules from herbarium specimens. (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A


    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  3. Site-specifically modified oligodeoxyribonucleotides as templates for Escherichia coli DNA polymerase I

    International Nuclear Information System (INIS)

    O'Connor, D.; Stoehrer, G.


    Oligodeoxyribonucleotides with site-specific modifications have been used as substrates for Escherichia coli DNA polymerase I holoenzyme and Klenow fragment. Modifications included the bulky guanine-8-aminofluorene adduct and a guanine oxidation product resembling the product of photosensitized DNA oxidation. By a combination of primers and nick-mers, conditions of single-strand-directed DNA synthesis and nick-translation could be created. The results show that the polymerase can bypass both types of lesions. Bypass occurs on a single-stranded template but is facilitated on a nicked, double-stranded template. Only purines, with guanine more favored than adenine, are incorporated across both lesions. The results indicate that site-specifically modified oligonucleotides can be sensitive probes for the action of polymerases on damaged templates. They also suggest a function for polymerase I, in its nick-translation capacity, during DNA repair and mutagenesis

  4. Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I (United States)

    National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...

  5. Backbone assignment of the little finger domain of a Y-family DNA polymerase. (United States)

    Ma, Dejian; Fowler, Jason D; Suo, Zucai


    Sulfolobus solfataricus DNA polymerase IV (Dpo4), a prototype Y-family DNA polymerase, contains a unique little finger domain besides a catalytic core. Here, we report the chemical shift assignments for the backbone nitrogens, α and β carbons, and amide protons of the little finger domain of Dpo4. This work and our published backbone assignment for the catalytic core provide the basis for investigating the conformational dynamics of Dpo4 during catalysis using solution NMR spectroscopy.

  6. Study of the activity of DNA polymerases β and λ using 5-formyluridine containing DNA substrates

    Directory of Open Access Journals (Sweden)

    Lavrik O. I.


    Full Text Available Aim. To investigate the TLS-activity of human DNA polymerases β and λ (pols β and λ using 5-formyluridine (5-foU containing DNA duplexes which are imitating the intermediates during replication of the leading DNA strand, and to study the influence of replication factors hRPA and hPCNA on this activity. Methods. The EMSA and the methods of enzyme’s kinetics were used. Results. The capability of pols β and λ to catalyze DNA synthesis across 5-foU was investigated and the kinetic characteristics of this process in the presence and in the absence of protein factors hRPA and hPCNA were evaluated. Conclusions. It was shown that: (i both proteins are able to catalyze TLS on used DNA substrates regardless of the reaction conditions, however, pol λ was more accurate enzyme; (ii hRPA can stimulate the efficacy of the nonmutagenic TLS catalyzed by pol at the nucleotide incorporation directly opposite of 5-foU, at the same time it doesn’t influence the incorporation efficacy if the damage displaced into the duplex; (iii hPCNA doesn’t influence the efficacy of TLS catalyzed by both enzymes.

  7. Both DNA Polymerases δ and ε Contact Active and Stalled Replication Forks Differently (United States)

    Yu, Chuanhe; Gan, Haiyun


    ABSTRACT Three DNA polymerases, polymerases α, δ, and ε (Pol α, Pol δ, and Pol ε), are responsible for eukaryotic genome duplication. When DNA replication stress is encountered, DNA synthesis stalls until the stress is ameliorated. However, it is not known whether there is a difference in the association of each polymerase with active and stalled replication forks. Here, we show that each DNA polymerase has a distinct pattern of association with active and stalled replication forks. Pol α is enriched at extending Okazaki fragments of active and stalled forks. In contrast, although Pol δ contacts the nascent lagging strands of active and stalled forks, it binds to only the matured (and not elongating) Okazaki fragments of stalled forks. Pol ε has greater contact with the nascent single-stranded DNA (ssDNA) of the leading strand on active forks than on stalled forks. We propose that the configuration of DNA polymerases at stalled forks facilitates the resumption of DNA synthesis after stress removal. PMID:28784720

  8. Mitochondrial DNA polymerase from embryos of Drosophila melanogaster: purification, subunit structure, and partial characterization

    International Nuclear Information System (INIS)

    Wernette, C.M.; Kaguni, L.S.


    The mitochondrial DNA polymerase has been purified to near-homogeneity from early embryos of Drosophila melanogaster. Sodium dodecyl sulfate gel electrophoresis of the highly purified enzyme reveals two polypeptides with molecular masses of 125,000 and 35,000 daltons, in a ratio of 1:1. The enzyme has a sedimentation coefficient of 7.6 S and a stokes radius of 51 A. Taken together, the data suggest that the D. melanogaster DNA polymerase γ is a heterodimer. DNA polymerase activity gel analysis has allowed the assignment of the DNA polymerization function to the large subunit. The DNA polymerase exhibits a remarkable ability to utilize efficiently a variety of template-primers including gapped DNA, poly(rA).oligo(dT) and singly primed phiX174 DNA. Both the crude and the highly purified enzymes are stimulated by KCl, and inhibited by dideoxythymidine triphosphate and by N-ethylmaleimide. Thus, the catalytic properties of the near-homogeneous Drosophila enzyme are consistent with those of DNA polymerase γ as partially purified from several vertebrates

  9. The beta subunit modulates bypass and termination at UV lesions during in vitro replication with DNA polymerase III holoenzyme of Escherichia coli

    International Nuclear Information System (INIS)

    Shavitt, O.; Livneh, Z.


    The cycling time of DNA polymerase III holoenzyme during replication of UV-irradiated single-stranded (ss) DNA was longer than with unirradiated DNA (8 versus 3 min, respectively), most likely due to slow dissociation from lesion-terminated nascent DNA strands. Initiation of elongation on primed ssDNA was not significantly inhibited by the presence of UV lesions as indicated by the identical distribution of replication products synthesized at early and late reaction times and by the identical duration of the initial synthesis bursts on both unirradiated and UV-irradiated DNA templates. When replication was performed with DNA polymerase III* supplemented with increasing quantities of purified beta 2 subunit, the cycling time on UV-irradiated DNA decreased from 14.8 min at 1.7 nM beta 2 down to 6 min at 170 nM beta 2, a concentration in which beta 2 was in large excess over the polymerase. In parallel to the reduction in cycling time, also the bypass frequency of cyclobutane-photodimers decreased with increasing beta 2 concentration, and at 170 nM beta 2, bypass of photodimers was essentially eliminated. It has been shown that polymerase complexes with more than one beta 2 per polymerase molecule were formed at high beta 2 concentrations. It is plausible that polymerase complexes obtained under high beta 2 concentration dissociate from lesion-terminated primers faster than polymerase complexes formed at a low beta 2 concentration. This is expected to favor termination over bypass at pyrimidine photodimers and thus decrease their bypass frequency. These results suggest that the beta 2 subunit might act as a sensor for obstacles to replication caused by DNA damage, and that it terminates elongation at these sites by promoting dissociation. The intracellular concentration of beta 2 was estimated to be 250 nM

  10. Global conformational dynamics of a Y-family DNA polymerase during catalysis.

    Directory of Open Access Journals (Sweden)

    Cuiling Xu


    Full Text Available Replicative DNA polymerases are stalled by damaged DNA while the newly discovered Y-family DNA polymerases are recruited to rescue these stalled replication forks, thereby enhancing cell survival. The Y-family DNA polymerases, characterized by low fidelity and processivity, are able to bypass different classes of DNA lesions. A variety of kinetic and structural studies have established a minimal reaction pathway common to all DNA polymerases, although the conformational intermediates are not well defined. Furthermore, the identification of the rate-limiting step of nucleotide incorporation catalyzed by any DNA polymerase has been a matter of long debate. By monitoring time-dependent fluorescence resonance energy transfer (FRET signal changes at multiple sites in each domain and DNA during catalysis, we present here a real-time picture of the global conformational transitions of a model Y-family enzyme: DNA polymerase IV (Dpo4 from Sulfolobus solfataricus. Our results provide evidence for a hypothetical DNA translocation event followed by a rapid protein conformational change prior to catalysis and a subsequent slow, post-chemistry protein conformational change. Surprisingly, the DNA translocation step was induced by the binding of a correct nucleotide. Moreover, we have determined the directions, rates, and activation energy barriers of the protein conformational transitions, which indicated that the four domains of Dpo4 moved in a synchronized manner. These results showed conclusively that a pre-chemistry conformational change associated with domain movements was too fast to be the rate-limiting step. Rather, the rearrangement of active site residues limited the rate of correct nucleotide incorporation. Collectively, the conformational dynamics of Dpo4 offer insights into how the inter-domain movements are related to enzymatic function and their concerted interactions with other proteins at the replication fork.

  11. The essential DNA polymerases δ and ε are involved in repair of UV-damaged DNA in the yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Halas, A.; Policinska, Z.; Baranowska, H.; Jachymczyk, W.J.


    We have studied the ability of yeast DNA polymerases to carry out repair of lesions caused by UV irradiation in Saccharomyces cerevisiae. By the analysis of postirradiation relative molecular mass changes in cellular DNA of different DNA polymerases mutant strains, it was established that mutations in DNA polymerases δ and ε showed accumulation of single-strand breaks indicating defective repair. Mutations in other DNA polymerase genes exhibited no defects in DNA repair. Thus, the data obtained suggest that DNA polymerases δ and ε are both necessary for DNA replication and for repair of lesions caused by UV irradiation. The results are discussed in the light of current concepts concerning the specificity of DNA polymerases in DNA repair. (author)

  12. Interferon antagonist NSs of La Crosse virus triggers a DNA damage response-like degradation of transcribing RNA polymerase II. (United States)

    Verbruggen, Paul; Ruf, Marius; Blakqori, Gjon; Överby, Anna K; Heidemann, Martin; Eick, Dirk; Weber, Friedemann


    La Crosse encephalitis virus (LACV) is a mosquito-borne member of the negative-strand RNA virus family Bunyaviridae. We have previously shown that the virulence factor NSs of LACV is an efficient inhibitor of the antiviral type I interferon system. A recombinant virus unable to express NSs (rLACVdelNSs) strongly induced interferon transcription, whereas the corresponding wt virus (rLACV) suppressed it. Here, we show that interferon induction by rLACVdelNSs mainly occurs through the signaling pathway leading from the pattern recognition receptor RIG-I to the transcription factor IRF-3. NSs expressed by rLACV, however, acts downstream of IRF-3 by specifically blocking RNA polymerase II-dependent transcription. Further investigations revealed that NSs induces proteasomal degradation of the mammalian RNA polymerase II subunit RPB1. NSs thereby selectively targets RPB1 molecules of elongating RNA polymerase II complexes, the so-called IIo form. This phenotype has similarities to the cellular DNA damage response, and NSs was indeed found to transactivate the DNA damage response gene pak6. Moreover, NSs expressed by rLACV boosted serine 139 phosphorylation of histone H2A.X, one of the earliest cellular reactions to damaged DNA. However, other DNA damage response markers such as up-regulation and serine 15 phosphorylation of p53 or serine 1524 phosphorylation of BRCA1 were not triggered by LACV infection. Collectively, our data indicate that the strong suppression of interferon induction by LACV NSs is based on a shutdown of RNA polymerase II transcription and that NSs achieves this by exploiting parts of the cellular DNA damage response pathway to degrade IIo-borne RPB1 subunits.

  13. Amplified Detection of the Aptamer-Vanillin Complex with the Use of Bsm DNA Polymerase. (United States)

    Andrianova, Mariia; Komarova, Natalia; Grudtsov, Vitaliy; Kuznetsov, Evgeniy; Kuznetsov, Alexander


    The electrochemical detection of interactions between aptamers and low-molecular-weight targets often lacks sensitivity. Signal amplification improves the detection of the aptamer-analyte complex; Bsm DNA polymerase was used to amplify the signal from the interaction of vanillin and its aptamer named Van_74 on an ion-sensitive field-effect transistor (ISFET)-based biosensor. The aptamer was immobilized on the ISFET sensitive surface. A short DNA probe was hybridized with the aptamer and dissociated from it upon vanillin addition. A free probe interacted with a special DNA molecular beacon initiated the Bsm DNA polymerase reaction that was detected by ISFET. A buffer solution suitable for both aptamer action and Bsm DNA polymerase activity was determined. The ISFET was shown to detect the Bsm DNA polymerase reaction under the selected conditions. Vanillin at different concentrations (1 × 10 -6 -1 × 10 -8 M) was detected using the biosensor with signal amplification. The developed detection system allowed for the determination of vanillin, starting at a 10 -8 M concentration. Application of the Bsm DNA polymerase resulted in a 15.5 times lower LoD when compared to the biosensor without signal amplification (10.1007/s00604-017-2586-4).

  14. Amplified Detection of the Aptamer–Vanillin Complex with the Use of Bsm DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Mariia Andrianova


    Full Text Available The electrochemical detection of interactions between aptamers and low-molecular-weight targets often lacks sensitivity. Signal amplification improves the detection of the aptamer-analyte complex; Bsm DNA polymerase was used to amplify the signal from the interaction of vanillin and its aptamer named Van_74 on an ion-sensitive field-effect transistor (ISFET-based biosensor. The aptamer was immobilized on the ISFET sensitive surface. A short DNA probe was hybridized with the aptamer and dissociated from it upon vanillin addition. A free probe interacted with a special DNA molecular beacon initiated the Bsm DNA polymerase reaction that was detected by ISFET. A buffer solution suitable for both aptamer action and Bsm DNA polymerase activity was determined. The ISFET was shown to detect the Bsm DNA polymerase reaction under the selected conditions. Vanillin at different concentrations (1 × 10−6–1 × 10−8 M was detected using the biosensor with signal amplification. The developed detection system allowed for the determination of vanillin, starting at a 10−8 M concentration. Application of the Bsm DNA polymerase resulted in a 15.5 times lower LoD when compared to the biosensor without signal amplification (10.1007/s00604-017-2586-4.

  15. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.


    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus

  16. Probing Conformational Changes of Human DNA Polymerase λ Using Mass Spectrometry-Based Protein Footprinting (United States)

    Fowler, Jason D.; Brown, Jessica A.; Kvaratskhelia, Mamuka; Suo, Zucai


    SUMMARY Crystallographic studies of the C-terminal, DNA polymerase β-like domain of human DNA polymerase lambda (fPolλ) suggested that the catalytic cycle might not involve a large protein domain rearrangement as observed with several replicative DNA polymerases and DNA polymerase β. To examine solution-phase protein conformation changes in fPolλ, which also contains a breast cancer susceptibility gene 1 C-terminal domain and a Proline-rich domain at its N-terminus, we used a mass spectrometry - based protein footprinting approach. In parallel experiments, surface accessibility maps for Arg residues were compared for the free fPolλ versus the binary complex of enzyme•gapped DNA and the ternary complex of enzyme•gapped DNA•dNTP. These experiments suggested that fPolλ does not undergo major conformational changes during the catalysis in the solution phase. Furthermore, the mass spectrometry-based protein footprinting experiments revealed that active site residue R386 was shielded from the surface only in the presence of both a gapped DNA substrate and an incoming nucleotide dNTP. Site-directed mutagenesis and pre-steady state kinetic studies confirmed the importance of R386 for the enzyme activity, and indicated the key role for its guanidino group in stabilizing the negative charges of an incoming nucleotide and the leaving pyrophosphate product. We suggest that such interactions could be shared by and important for catalytic functions of other DNA polymerases. PMID:19467241

  17. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA (United States)

    Dimitrov, Valentin V.


    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  18. The 3'-to-5' exonuclease activity of vaccinia virus DNA polymerase is essential and plays a role in promoting virus genetic recombination. (United States)

    Gammon, Don B; Evans, David H


    Poxviruses are subjected to extraordinarily high levels of genetic recombination during infection, although the enzymes catalyzing these reactions have never been identified. However, it is clear that virus-encoded DNA polymerases play some unknown yet critical role in virus recombination. Using a novel, antiviral-drug-based strategy to dissect recombination and replication reactions, we now show that the 3'-to-5' proofreading exonuclease activity of the viral DNA polymerase plays a key role in promoting recombination reactions. Linear DNA substrates were prepared containing the dCMP analog cidofovir (CDV) incorporated into the 3' ends of the molecules. The drug blocked the formation of concatemeric recombinant molecules in vitro in a process that was catalyzed by the proofreading activity of vaccinia virus DNA polymerase. Recombinant formation was also blocked when CDV-containing recombination substrates were transfected into cells infected with wild-type vaccinia virus. These inhibitory effects could be overcome if CDV-containing substrates were transfected into cells infected with CDV-resistant (CDV(r)) viruses, but only when resistance was linked to an A314T substitution mutation mapping within the 3'-to-5' exonuclease domain of the viral polymerase. Viruses encoding a CDV(r) mutation in the polymerase domain still exhibited a CDV-induced recombination deficiency. The A314T substitution also enhanced the enzyme's capacity to excise CDV molecules from the 3' ends of duplex DNA and to recombine these DNAs in vitro, as judged from experiments using purified mutant DNA polymerase. The 3'-to-5' exonuclease activity appears to be an essential virus function, and our results suggest that this might be because poxviruses use it to promote genetic exchange.

  19. Comparison of checkpoint responses triggered by DNA polymerase inhibition versus DNA damaging agents

    International Nuclear Information System (INIS)

    Liu, J.-S.; Kuo, S.-R.; Melendy, Thomas


    To better understand the different cellular responses to replication fork pausing versus blockage, early DNA damage response markers were compared after treatment of cultured mammalian cells with agents that either inhibit DNA polymerase activity (hydroxyurea (HU) or aphidicolin) or selectively induce S-phase DNA damage responses (the DNA alkylating agents, methyl methanesulfonate (MMS) and adozelesin). These agents were compared for their relative abilities to induce phosphorylation of Chk1, H2AX, and replication protein A (RPA), and intra-nuclear focalization of γ-H2AX and RPA. Treatment by aphidicolin and HU resulted in phosphorylation of Chk1, while HU, but not aphidicolin, induced focalization of γ-H2AX and RPA. Surprisingly, pre-treatment with aphidicolin to stop replication fork progression, did not abrogate HU-induced γ-H2AX and RPA focalization. This suggests that HU may act on the replication fork machinery directly, such that fork progression is not required to trigger these responses. The DNA-damaging fork-blocking agents, adozelesin and MMS, both induced phosphorylation and focalization of H2AX and RPA. Unlike adozelesin and HU, the pattern of MMS-induced RPA focalization did not match the BUdR incorporation pattern and was not blocked by aphidicolin, suggesting that MMS-induced damage is not replication fork-dependent. In support of this, MMS was the only reagent used that did not induce phosphorylation of Chk1. These results indicate that induction of DNA damage checkpoint responses due to adozelesin is both replication fork and fork progression dependent, induction by HU is replication fork dependent but progression independent, while induction by MMS is independent of both replication forks and fork progression

  20. Comparison of checkpoint responses triggered by DNA polymerase inhibition versus DNA damaging agents

    Energy Technology Data Exchange (ETDEWEB)

    Liu, J.-S.; Kuo, S.-R.; Melendy, Thomas


    To better understand the different cellular responses to replication fork pausing versus blockage, early DNA damage response markers were compared after treatment of cultured mammalian cells with agents that either inhibit DNA polymerase activity (hydroxyurea (HU) or aphidicolin) or selectively induce S-phase DNA damage responses (the DNA alkylating agents, methyl methanesulfonate (MMS) and adozelesin). These agents were compared for their relative abilities to induce phosphorylation of Chk1, H2AX, and replication protein A (RPA), and intra-nuclear focalization of {gamma}-H2AX and RPA. Treatment by aphidicolin and HU resulted in phosphorylation of Chk1, while HU, but not aphidicolin, induced focalization of {gamma}-H2AX and RPA. Surprisingly, pre-treatment with aphidicolin to stop replication fork progression, did not abrogate HU-induced {gamma}-H2AX and RPA focalization. This suggests that HU may act on the replication fork machinery directly, such that fork progression is not required to trigger these responses. The DNA-damaging fork-blocking agents, adozelesin and MMS, both induced phosphorylation and focalization of H2AX and RPA. Unlike adozelesin and HU, the pattern of MMS-induced RPA focalization did not match the BUdR incorporation pattern and was not blocked by aphidicolin, suggesting that MMS-induced damage is not replication fork-dependent. In support of this, MMS was the only reagent used that did not induce phosphorylation of Chk1. These results indicate that induction of DNA damage checkpoint responses due to adozelesin is both replication fork and fork progression dependent, induction by HU is replication fork dependent but progression independent, while induction by MMS is independent of both replication forks and fork progression.

  1. Polymerase study: Improved detection of Salmonella and Campylobacter through the optimized use of DNA polymerases in diagnostic real-time PCR

    DEFF Research Database (Denmark)

    Søndergaard, Mette Sofie Rousing; Löfström, Charlotta; Al-Habib, Zahra Fares Sayer

    DNA extractions and intermediate or bad with the crude extractions, while TaKaRa ExTaq HS only performed well with the purest extractions of fecal samples and intermediate with semi-automated magnetic beads based extracted fecal samples. In conclusion, our data shows that exchanging the DNA polymerase......Diagnostic analyses of foodborne pathogens are increasingly based on molecular methods such as PCR, which can improve the sensitivity and reduce the analysis time. The core of PCR is the enzyme performing the reaction: the DNA polymerase. Changing the polymerase can influence the sensitivity...... commercially available polymerases and four master mixes in two validated PCR assays, for Campylobacter and Salmonella, respectively, to develop more sensitive, robust and cost effective assays. The polymerases were screened on purified DNA and the five best performing, for each PCR assay, were then applied...

  2. Effects of DNA polymerase inhibitors on replicative and repair DNA synthesis in ultraviolet-irradiated HeLa cells

    International Nuclear Information System (INIS)

    Morita, T.; Nakamura, H.; Tsutsui, Y.; Nishiyama, Y.; Yoshida, S.


    Aphidicolin specifically inhibits eukaryotic DNA polymerase α, while 2',3'-dideoxythymidine 5'-triphosphate (d 2 TTP) inhibits DNA polymerase ν and ν but not α. 1-ν-D-Arabinofuranosylcytosine 5'-triphosphate (araCTP) inhibits both DNA polymerase α and ν although to a different extent. Here we measured the effects of these inhibitors on repair DNA synthesis of U.V.-irradiated HeLa cells by two different methods. Firstly, aphidicolin, 1-ν-D-arabinofuranosylcytosine (araC, a precursor of araCTP) and 2',3'-dideoxythimidine (d 2 Thd, a precursor of d 2 TTP) were added directly to the culture medium. In this case, aphidicolin and araC strongly inhibited replicative DNA synthesis of HeLa cells, and they also inhibited repair synthesis after U.V.-irradiation but to a much lesser extent. In contrast, high concentrations of d 2 Thd inhibited repair DNA synthesis to a higher extent than replicative DNA synthesis. Secondly, the active form of inhibitor, d 2 TTP, was microinjected directly into cytoplasm or nuclei or U.V.-irradiated HeLa cells. Microinjection of d 2 TTP effectively inhibited repair synthesis. The microinjection of d 2 TTP, into either cytoplasm or nucleus, strongly inhibited replicative synthesis. These results might indicate that multiple DNA polymerases are involved in repair synthesis as well as in replicative synthesis

  3. Flexible double-headed cytosine-linked 2'-deoxycytidine nucleotides. Synthesis, polymerase incorporation to DNA and interaction with DNA methyltransferases

    Czech Academy of Sciences Publication Activity Database

    Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal


    Roč. 24, č. 6 (2016), s. 1268-1276 ISSN 0968-0896 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * pyrimidines * DNA methyltransferases * DNA polymerases Subject RIV: CC - Organic Chemistry Impact factor: 2.930, year: 2016

  4. Arabidopsis DNA polymerase lambda mutant is mildly sensitive to DNA double strand breaks but defective in integration of a transgene

    Czech Academy of Sciences Publication Activity Database

    Furukawa, T.; Angelis, Karel; Britt, A.B.


    Roč. 6, MAY 27 (2015) ISSN 1664-462X R&D Projects: GA ČR GA13-06595S Institutional support: RVO:61389030 Keywords : DNA polymerase * DNA repair * Non homologous end joining Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.495, year: 2015

  5. Mechanism of Error-Free DNA Replication Past Lucidin-Derived DNA Damage by Human DNA Polymerase κ. (United States)

    Yockey, Oliver P; Jha, Vikash; Ghodke, Pratibha P; Xu, Tianzuo; Xu, Wenyan; Ling, Hong; Pradeepkumar, P I; Zhao, Linlin


    DNA damage impinges on genetic information flow and has significant implications in human disease and aging. Lucidin-3-O-primeveroside (LuP) is an anthraquinone derivative present in madder root, which has been used as a coloring agent and food additive. LuP can be metabolically converted to genotoxic compound lucidin, which subsequently forms lucidin-specific N 2 -2'-deoxyguanosine (N 2 -dG) and N 6 -2'-deoxyadenosine (N 6 -dA) DNA adducts. Lucidin is mutagenic and carcinogenic in rodents but has low carcinogenic risks in humans. To understand the molecular mechanism of low carcinogenicity of lucidin in humans, we performed DNA replication assays using site-specifically modified oligodeoxynucleotides containing a structural analogue (LdG) of lucidin-N 2 -dG DNA adduct and determined the crystal structures of DNA polymerase (pol) κ in complex with LdG-bearing DNA and an incoming nucleotide. We examined four human pols (pol η, pol ι, pol κ, and Rev1) in their efficiency and accuracy during DNA replication with LdG; these pols are key players in translesion DNA synthesis. Our results demonstrate that pol κ efficiently and accurately replicates past the LdG adduct, whereas DNA replication by pol η, pol ι is compromised to different extents. Rev1 retains its ability to incorporate dCTP opposite the lesion albeit with decreased efficiency. Two ternary crystal structures of pol κ illustrate that the LdG adduct is accommodated by pol κ at the enzyme active site during insertion and postlesion-extension steps. The unique open active site of pol κ allows the adducted DNA to adopt a standard B-form for accurate DNA replication. Collectively, these biochemical and structural data provide mechanistic insights into the low carcinogenic risk of lucidin in humans.

  6. Two DNA polymerase sliding clamps from the thermophilic archaeon Sulfolobus solfataricus. (United States)

    De Felice, M; Sensen, C W; Charlebois, R L; Rossi, M; Pisani, F M


    Herein, we report the identification and characterization of two DNA polymerase processivity factors from the thermoacidophilic archaeon Sulfolobus solfataricus. They, referred to as 039p (244 amino acid residues, 27 kDa) and 048p (249 amino acid residues, 27 kDa), present significant primary structure similarity to eukaryotic proliferating cell nuclear antigen (PCNA). We demonstrate that both 039p and 048p form oligomers in solution and are able to substantially activate the synthetic activity of the single-subunit family B DNA polymerase from S. solfataricus (Sso DNA pol B1) on poly(dA)-oligo(dT) as a primer-template. This stimulatory effect is the result of enhanced DNA polymerase processivity, as indicated by the analysis of the elongation products on polyacrylamide gels. Activation of Sso DNA pol B1 synthetic activity was also observed on linear primed single-stranded M13 mp18 DNA as a template. By immunoblot analysis using specific rabbit antisera, 039p and 048p were both detected in the logarithmic and stationary phases of S. solfataricus growth curve. This is the first report of the identification and biochemical characterization of two distinct DNA polymerase processivity factors from the same organism. The significance of these findings for the understanding of the DNA replication process in Archaea is discussed. Copyright 1999 Academic Press.

  7. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    NARCIS (Netherlands)

    Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.


    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an

  8. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati. (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y


    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  9. Direct squencing from the minimal number of DNA molecules needed to fill a 454 picotiterplate.

    Directory of Open Access Journals (Sweden)

    Mária Džunková

    Full Text Available The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA, mostly by multiple displacement amplification (MDA based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS, which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli fs 24 from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA.

  10. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.


    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein

  11. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction. (United States)

    Focke, Felix; Haase, Ilka; Fischer, Markus


    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  12. Preparation of Phi29 DNA polymerase free of amplifiable DNA using ethidium monoazide, an ultraviolet-free light-emitting diode lamp and trehalose.

    Directory of Open Access Journals (Sweden)

    Hirokazu Takahashi

    Full Text Available We previously reported that multiply-primed rolling circle amplification (MRPCA using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3'-5' exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents.

  13. SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation (United States)

    Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.


    Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578

  14. Quantifying DNA melting transitions using single-molecule force spectroscopy

    International Nuclear Information System (INIS)

    Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J


    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  15. Quantifying DNA melting transitions using single-molecule force spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail:


    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  16. Involvement of specialized DNA polymerases Pol II, Pol IV and DnaE2 in DNA replication in the absence of Pol I in Pseudomonas putida

    International Nuclear Information System (INIS)

    Sidorenko, Julia; Jatsenko, Tatjana; Saumaa, Signe; Teras, Riho; Tark-Dame, Mariliis; Horak, Rita; Kivisaar, Maia


    The majority of bacteria possess a different set of specialized DNA polymerases than those identified in the most common model organism Escherichia coli. Here, we have studied the ability of specialized DNA polymerases to substitute Pol I in DNA replication in Pseudomonas putida. Our results revealed that P. putida Pol I-deficient cells have severe growth defects in LB medium, which is accompanied by filamentous cell morphology. However, growth of Pol I-deficient bacteria on solid rich medium can be restored by reduction of reactive oxygen species in cells. Also, mutants with improved growth emerge rapidly. Similarly to the initial Pol I-deficient P. putida, its adapted derivatives express a moderate mutator phenotype, which indicates that DNA replication carried out in the absence of Pol I is erroneous both in the original Pol I-deficient bacteria and the adapted derivatives. Analysis of the spectra of spontaneous Rif r mutations in P. putida strains lacking different DNA polymerases revealed that the presence of specialized DNA polymerases Pol II and Pol IV influences the frequency of certain base substitutions in Pol I-proficient and Pol I-deficient backgrounds in opposite ways. Involvement of another specialized DNA polymerase DnaE2 in DNA replication in Pol I-deficient bacteria is stimulated by UV irradiation of bacteria, implying that DnaE2-provided translesion synthesis partially substitutes the absence of Pol I in cells containing heavily damaged DNA.

  17. Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase. (United States)

    Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J


    DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression. (United States)

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa


    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.

  19. Effects of coordination of diammineplatinum(II) with DNA on the activities of Escherichia coli DNA polymerase I

    International Nuclear Information System (INIS)

    Bernges, F.; Holler, E.


    The effects of the reaction of cis- and trans-diamminedichloroplatinum(II) with DNA have been measured with regard to DNA synthesis, 3'-5' exonuclease (proofreading), and 5'-3' exonuclease (repair) activities of Escherichia coli DNA polymerase I. Both isomers inhibit DNA synthetic activity of the polymerase through an increase in K/sub m/ values and a decrease in V/sub max/ values for platinated DNA but not for the nucleoside 5'-triphosphates as the varied substrates. The inhibition is a consequence of lowered binding affinity between platinated DNA and DNA polymerase, and of a platination-induced separation of template and primer strands. Strand separation enhances initial rates of 3'-5' excision of [ 3 H]dCMP from platinated DNA (proofreading), while total excision levels of nucleotides are decreased. In contrast to proofreading activity, the 5'-3' exonuclease activity (repair) discriminates between DNA which had reacted with cis- and with trans-diamminedichloroplatinum(II). While both initial rates and total excision are inhibited for the cis isomer, they are almost not affected for the trans isomer. This differential effect could explain why bacterial growth inhibition requires much higher concentrations of trans- than cis-diamminedichloroplatinum(II)

  20. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis (United States)

    Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai


    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

  1. The dnaN gene codes for the beta subunit of DNA polymerase III holoenzyme of escherichia coli. (United States)

    Burgers, P M; Kornberg, A; Sakakibara, Y


    An Escherichia coli mutant, dnaN59, stops DNA synthesis promptly upon a shift to a high temperature; the wild-type dnaN gene carried in a transducing phage encodes a polypeptide of about 41,000 daltons [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553; Yuasa, S. & Sakakibara, Y. (1980) Mol. Gen. Genet. 180, 267-273]. We now find that the product of dnaN gene is the beta subunit of DNA polymerase III holoenzyme, the principal DNA synthetic multipolypeptide complex in E. coli. The conclusion is based on the following observations: (i) Extracts from dnaN59 cells were defective in phage phi X174 and G4 DNA synthesis after the mutant cells had been exposed to the increased temperature. (ii) The enzymatic defect was overcome by addition of purified beta subunit but not by other subunits of DNA polymerase III holoenzyme or by other replication proteins required for phi X174 DNA synthesis. (iii) Partially purified beta subunit from the dnaN mutant, unlike that from the wild type, was inactive in reconstituting the holoenzyme when mixed with the other purified subunits. (iv) Increased dosage of the dnaN gene provided by a plasmid carrying the gene raised cellular levels of the beta subunit 5- to 6-fold.

  2. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru


    as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...

  3. In Silico Screening Hepatitis B Virus DNA Polymerase Inhibitors from Medicinal Plants

    Directory of Open Access Journals (Sweden)

    Mokhtar Nosrati


    Full Text Available Abstract Background: Hepatitis B virus infection (HBV is a significant global health problem and is a major cause of morbidity and mortality worldwide. Therefore, currently, introducing novel anti Hepatitis B drugs is taken into consideration. This study was planned to in silico screening novel Hepatitis B virus DNA polymerase inhibitors from two medicinal plants Terminalis chebula and Caesalpinia sappan. Materials and Methods: This is a descriptive-analytic study. In the study, three-dimensional structure of the Hepatitis B virus DNA polymerase was predicted using homology modeling method. A set of phytochemicals from mentioned plants were retrieved from Pubchem database in SDF format. In silico screening was carried out using molecular docking between mentioned phytochemicals and modeled polymerase by iGemdock 2.1 software. Results: Results of the study confirmed that all evaluated ligands have appropriate interactions to the polymerase with least toxicity and without genotoxicity potential. Results also showed that most interactions occur in reverse transcriptase domain which located in 354-694 area in the amino acid sequence of tested polymerase. Analysis of energy and amino acids involved in ligand-polymerase interaction revealed that Terchebin, Chebulinic Acid and Terflavin A have more effective interaction with the polymerase in compared to other ligands. Conclusion: Based on the results it can be concluded that evaluated compounds could be good candidates for in vitro and in vivo research in order to develop novel anti- Hepatitis B drugs.

  4. Effect of neonatal undernutrition on various forms of DNA-dependent DNA polymerases in cerebellum and liver of rat

    International Nuclear Information System (INIS)

    Baksi, K.; Kumar, A.


    Effect of neonatal undernutrition on the two forms of DNA polymerases obtained by DEAF-cellulose column chromatography of the solubilized nuclei and the high speed supernatant fractions of cerebellum and liver of rats has been studied. The form of DNA polymerase eluting with 0.1 M potassium phosphate buffer (pH 7.5) was significantly reduced, whereas that eluting with 0.3 M buffer (pH 7.5) was devoid of neonatal undernutrition effect. The properties of the separated DNA polymerases, both from cerebellum and liver, of control and undernourished groups were also studied. [Me- 3 H]thymidine-5--'triphosphate has been used in the study. (author)

  5. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction (United States)

    Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka


    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

  6. DNA analysis by single molecule stretching in nanofluidic biochips

    DEFF Research Database (Denmark)

    Abad, E.; Juarros, A.; Retolaza, A.


    Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...

  7. Structure of a preternary complex involving a prokaryotic NHEJ DNA polymerase. (United States)

    Brissett, Nigel C; Martin, Maria J; Pitcher, Robert S; Bianchi, Julie; Juarez, Raquel; Green, Andrew J; Fox, Gavin C; Blanco, Luis; Doherty, Aidan J


    In many prokaryotes, a specific DNA primase/polymerase (PolDom) is required for nonhomologous end joining (NHEJ) repair of DNA double-strand breaks (DSBs). Here, we report the crystal structure of a catalytically active conformation of Mycobacterium tuberculosis PolDom, consisting of a polymerase bound to a DNA end with a 3' overhang, two metal ions, and an incoming nucleotide but, significantly, lacking a primer strand. This structure represents a polymerase:DNA complex in a preternary intermediate state. This polymerase complex occurs in solution, stabilizing the enzyme on DNA ends and promoting nucleotide extension of short incoming termini. We also demonstrate that the invariant Arg(220), contained in a conserved loop (loop 2), plays an essential role in catalysis by regulating binding of a second metal ion in the active site. We propose that this NHEJ intermediate facilitates extension reactions involving critically short or noncomplementary DNA ends, thus promoting break repair and minimizing sequence loss during DSB repair. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. The role of DNA polymerase I in liquid holding recovery of UV-irradiated Escherichia coli

    International Nuclear Information System (INIS)

    Tang, M.-S.; Patrick, M.H.


    Excision of cyclobutyl dipyrimidines from, and accumulation of strand interruptions in, DNA of different strains of E.coli K12 were determined during liquid holding recovery after UV irradiation. The extent of Pyr Pyr excision was the same (20 to 25%) for both a polA mutant (E.coli P3478) and its parental wild type strain (E.coli W3110); however, single strand interruptions accumulated during liquid holding of polA cells, but not in the parental strain. In contrast, excision was greatly reduced in a mutant (KMBL 1789) which is defective in the 5' → 3' exonucleolytic function of DNA polymerase I. These data suggest that excision and resynthesis during liquid holding are carried out primarily, if not entirely, by DNA polymerase I. It is further concluded that excision alone is both a necessary and sufficient condition to elicit liquid holding recovery, and that this excision requires a functional polymerase I 5' → 3' exonuclease. (author)

  9. Transient expression and activity of human DNA polymerase iota in loach embryos. (United States)

    Makarova, Irina V; Kazakov, Andrey A; Makarova, Alena V; Khaidarova, Nella V; Kozikova, Larisa V; Nenasheva, Valentina V; Gening, Leonid V; Tarantul, Vyacheslav Z; Andreeva, Ludmila E


    Human DNA polymerase iota (Pol ι) is a Y-family DNA polymerase with unusual biochemical properties and not fully understood functions. Pol ι preferentially incorporates dGTP opposite template thymine. This property can be used to monitor Pol ι activity in the presence of other DNA polymerases, e.g. in cell extracts of tissues and tumors. We have now confirmed the specificity and sensitivity of the method of Pol ι activity detection in cell extracts using an animal model of loach Misgurnus fossilis embryos transiently expressing human Pol ι. The overexpression of Pol ι was shown to be accompanied by an increase in abnormalities in development and the frequency of pycnotic nuclei in fish embryos. Further analysis of fish embryos with constitutive or regulated Pol ι expression may provide insights into Pol ι functions in vertebrate animals.

  10. Role of DNA polymerase I in liquid holding recovery of uv-irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Tang, M S; Patrick, M H [Texas Univ., Dallas (USA)


    Excision of cyclobutyl dipyrimidines from, and accumulation of strand interruptions in DNA of different strains of E.coli K12 were determined during liquid holding recovery after uv irradiation. The extent of Pyr <> Pyr excision was the same (20 to 25%) for both a polA mutant (E.coli P3478) and its parental wild type strain (E.coli W3110); however, single strand interruptions accumulated during liquid holding of polA cells, but not in the parental strain. In contrast, excision was greatly reduced in a mutant (KMBL 1789) which is defective in the 5' ..-->.. 3' exonucleolytic function of DNA polymerase I. These data suggest that excision and resynthesis during liquid holding are carried out primarily, if not entirely, by DNA polymerase I. It is further concluded that excision alone is both a necessary and sufficient condition to elicit liquid holding recovery, and that this excision requires a functional polymerase I 5' ..-->.. 3' exonuclease.

  11. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    Energy Technology Data Exchange (ETDEWEB)

    Yoshimura, Akari, E-mail: [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan); Kobayashi, Yume [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan); Tada, Shusuke [Department of Medical Biochemistry, Faculty of Pharmaceutical Sciences, Toho University, 2-2-1 Miyama, Funabashi-shi, Chiba 274-8510 (Japan); Seki, Masayuki [Department of Biochemistry, Tohoku Pharmaceutical University, 4-4-1 Komatsushima, Aoba-ku, Sendai-shi, Miyagi 981-8558 (Japan); Enomoto, Takemi [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan)


    Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

  12. Archaeal DNA Polymerase-B as a DNA Template Guardian: Links between Polymerases and Base/Alternative Excision Repair Enzymes in Handling the Deaminated Bases Uracil and Hypoxanthine

    Directory of Open Access Journals (Sweden)

    Javier Abellón-Ruiz


    Full Text Available In Archaea repair of uracil and hypoxanthine, which arise by deamination of cytosine and adenine, respectively, is initiated by three enzymes: Uracil-DNA-glycosylase (UDG, which recognises uracil; Endonuclease V (EndoV, which recognises hypoxanthine; and Endonuclease Q (EndoQ, (which recognises both uracil and hypoxanthine. Two archaeal DNA polymerases, Pol-B and Pol-D, are inhibited by deaminated bases in template strands, a feature unique to this domain. Thus the three repair enzymes and the two polymerases show overlapping specificity for uracil and hypoxanthine. Here it is demonstrated that binding of Pol-D to primer-templates containing deaminated bases inhibits the activity of UDG, EndoV, and EndoQ. Similarly Pol-B almost completely turns off EndoQ, extending earlier work that demonstrated that Pol-B reduces catalysis by UDG and EndoV. Pol-B was observed to be a more potent inhibitor of the enzymes compared to Pol-D. Although Pol-D is directly inhibited by template strand uracil, the presence of Pol-B further suppresses any residual activity of Pol-D, to near-zero levels. The results are compatible with Pol-D acting as the replicative polymerase and Pol-B functioning primarily as a guardian preventing deaminated base-induced DNA mutations.

  13. Nuclear DNA polymerase beta from Leishmania infantum. Cloning, molecular analysis and developmental regulation (United States)

    Taladriz, Soraya; Hanke, Tobias; Ramiro, María J.; García-Díaz, Miguel; Lacoba, Mario García de; Blanco, Luis; Larraga, Vicente


    We have identified a novel polymerase beta (Pol β)-like enzyme from Leishmania infantum, a parasite protozoon causing disease in humans. This protein, named Li Pol β, shows a nuclear localization that contrasts with the mitochondrial localization of Pol β from Crithidia fasciculata, a closely related parasite, the only polymerase β described so far in Trypanosomatidae. Li Pol β, that belongs to the DNA polymerase X family, displays an evolutionarily conserved Pol β-type DNA polymerase core, in which most of the key residues involved in DNA binding, nucleotide binding, dRPase and polymerization catalysis are conserved. In agreement with this, Li Pol β, overproduced in Escherichia coli, displayed intrinsic DNA polymerase activity. Cell synchronization experiments showed a correlation between both Li Pol β mRNA and protein levels along the parasite cell cycle. Analysis of these parameters at the different growth phases of the parasite, from the proliferative (non-infective) logarithmic phase to the non-dividing (highly infectious) stationary phase, showed high levels of Li Pol β at the infective phase of the parasite. The data suggest a role of Li Pol β in base excision repair in L.infantum, a parasite usually affected by oxygen stress environments into the macrophage host cells. PMID:11557814

  14. Roles of Saccharomyces cerevisiae DNA polymerases Poleta and Polzeta in response to irradiation by simulated sunlight. (United States)

    Kozmin, Stanislav G; Pavlov, Youri I; Kunkel, Thomas A; Sage, Evelyne


    Sunlight causes lesions in DNA that if unrepaired and inaccurately replicated by DNA polymerases yield mutations that result in skin cancer in humans. Two enzymes involved in translesion synthesis (TLS) of UV-induced photolesions are DNA polymerase eta (Poleta) and polymerase zeta (Polzeta), encoded by the RAD30A and REV3 genes, respectively. Previous studies have investigated the TLS roles of these polymerases in human and yeast cells irradiated with monochromatic, short wavelength UVC radiation (254 nm). However, less is known about cellular responses to solar radiation, which is of higher and mixed wavelengths (310-1100 nm) and produces a different spectrum of DNA lesions, including Dewar photoproducts and oxidative lesions. Here we report on the comparative cytotoxic and mutagenic effects of simulated sunlight (SSL) and UVC radiation on yeast wild-type, rad30Delta, rev3Delta and rev3Delta rad30Delta strains. The results with SSL support several previous interpretations on the roles of these two polymerases in TLS of photodimers and (6-4) photoproducts derived from studies with UVC. They further suggest that Poleta participates in the non-mutagenic bypass of SSL-dependent cytosine-containing Dewar photoproducts and 8-oxoguanine, while Polzeta is mainly responsible for the mutagenic bypass of all types of Dewar photoproducts. They also suggest that in the absence of Polzeta, Poleta contributes to UVC- and SSL-induced mutagenesis, possibly by the bypass of photodimers containing deaminated cytosine.

  15. Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

    Directory of Open Access Journals (Sweden)

    Greta Zubaite


    Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.

  16. Role of DNA polymerase α in chromosomal aberration production by ionizing radiation

    International Nuclear Information System (INIS)

    Bender, M.A.


    Aphidicolin is a tetracyclic diterpinoid fungal antibiotic which inhibits DNA synthesis in eukaryotic cells by interfering specifically with DNA polymerase α, apparently by binding to and inactivating the DNA-polymerase α complex. We have shown that aphidicolin, like other inhibitors of DNA synthesis, both induces chromosomal aberrations in human peripheral lymphocytes, and, as a post-treatment, interacts synergistically with x rays to produce greatly enhanced aberration yields. The present experiments explore the effects of aphidicolin in human lymphocytes in the post-DNA-synthetic G 2 phase of the cell cycle. These experiments utilized labeling with tritiated thymidine to positively identify cells in the S phase at the time of treatment, and used serial colcemid collections and fixations to determine aberration yields over as much of the G 2 phase as feasible. Because DNA polymerase α is the only DNA synthetic or repair enzyme known to be affected by aphidicolin, we infer that this enzyme is directly involved in the repair of DNA lesions which can result in visible chromosomal aberrations. (DT)

  17. Ionizing radiation sensitivity of DNA polymerase lambda-deficient cells.

    NARCIS (Netherlands)

    Vermeulen, C.; Bertocci, B.; Begg, A.C.; Vens, C.


    Ionizing radiation induces a diverse spectrum of DNA lesions, including strand breaks and oxidized bases. In mammalian cells, ionizing radiation-induced lesions are targets of non-homologous end joining, homologous recombination, and base excision repair. In vitro assays show a potential involvement

  18. An AP endonuclease 1-DNA polymerase beta complex: theoretical prediction of interacting surfaces.

    Directory of Open Access Journals (Sweden)

    Alexej Abyzov


    Full Text Available Abasic (AP sites in DNA arise through both endogenous and exogenous mechanisms. Since AP sites can prevent replication and transcription, the cell contains systems for their identification and repair. AP endonuclease (APEX1 cleaves the phosphodiester backbone 5' to the AP site. The cleavage, a key step in the base excision repair pathway, is followed by nucleotide insertion and removal of the downstream deoxyribose moiety, performed most often by DNA polymerase beta (pol-beta. While yeast two-hybrid studies and electrophoretic mobility shift assays provide evidence for interaction of APEX1 and pol-beta, the specifics remain obscure. We describe a theoretical study designed to predict detailed interacting surfaces between APEX1 and pol-beta based on published co-crystal structures of each enzyme bound to DNA. Several potentially interacting complexes were identified by sliding the protein molecules along DNA: two with pol-beta located downstream of APEX1 (3' to the damaged site and three with pol-beta located upstream of APEX1 (5' to the damaged site. Molecular dynamics (MD simulations, ensuring geometrical complementarity of interfaces, enabled us to predict interacting residues and calculate binding energies, which in two cases were sufficient (approximately -10.0 kcal/mol to form a stable complex and in one case a weakly interacting complex. Analysis of interface behavior during MD simulation and visual inspection of interfaces allowed us to conclude that complexes with pol-beta at the 3'-side of APEX1 are those most likely to occur in vivo. Additional multiple sequence analyses of APEX1 and pol-beta in related organisms identified a set of correlated mutations of specific residues at the predicted interfaces. Based on these results, we propose that pol-beta in the open or closed conformation interacts and makes a stable interface with APEX1 bound to a cleaved abasic site on the 3' side. The method described here can be used for analysis in

  19. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan


    Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

  20. How to read and write mechanical information in DNA molecules (United States)

    Schiessel, Helmut

    In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

  1. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett


    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  2. Dynamics of termination during in vitro replication of ultraviolet-irradiated DNA with DNA polymerase III holoenzyme of Escherichia coli

    International Nuclear Information System (INIS)

    Shwartz, H.; Livneh, Z.


    During in vitro replication of UV-irradiated single-stranded DNA with Escherichia coli DNA polymerase III holoenzyme termination frequently occurs at pyrimidine photodimers. The termination stage is dynamic and characterized by at least three different events: repeated dissociation-reinitiation cycles of the polymerase at the blocked termini; extensive hydrolysis of ATP to ADP and inorganic phosphate; turnover of dNTPs into dNMP. The reinitiation events are nonproductive and are not followed by further elongation. The turnover of dNTPs into dNMPs is likely to result from repeated cycles of insertion of dNMP residues opposite the blocking lesions followed by their excision by the 3'----5' exonucleolytic activity of the polymerase. Although all dNTPs are turned over, there is a preference for dATP, indicating that DNA polymerase III holoenzyme has a preference for inserting a dAMP residue opposite blocking pyrimidine photodimers. We suggest that the inability of the polymerase to bypass photodimers during termination is due to the formation of defective initiation-like complexes with reduced stability at the blocked termini

  3. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction. (United States)

    Guthrie, J N; Moriarty, D J; Blackall, L L


    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  4. Quantitative Analysis of the Mutagenic Potential of 1-Aminopyrene-DNA Adduct Bypass Catalyzed by Y-Family DNA Polymerases (United States)

    Sherrer, Shanen M.; Taggart, David J.; Pack, Lindsey R.; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai


    N- (deoxyguanosin-8-yl)-1-aminopyrene (dGAP) is the predominant nitro polyaromatic hydrocarbon product generated from the air pollutant 1-nitropyrene reacting with DNA. Previous studies have shown that dGAP induces genetic mutations in bacterial and mammalian cells. One potential source of these mutations is the error-prone bypass of dGAP lesions catalyzed by the low-fidelity Y-family DNA polymerases. To provide a comparative analysis of the mutagenic potential of the translesion DNA synthesis (TLS) of dGAP, we employed short oligonucleotide sequencing assays (SOSAs) with the model Y-family DNA polymerase from Sulfolobus solfataricus, DNA Polymerase IV (Dpo4), and the human Y-family DNA polymerases eta (hPolη), kappa (hPolκ), and iota (hPolι). Relative to undamaged DNA, all four enzymes generated far more mutations (base deletions, insertions, and substitutions) with a DNA template containing a site-specifically placed dGAP. Opposite dGAP and at an immediate downstream template position, the most frequent mutations made by the three human enzymes were base deletions and the most frequent base substitutions were dAs for all enzymes. Based on the SOSA data, Dpo4 was the least error-prone Y-family DNA polymerase among the four enzymes during the TLS of dGAP. Among the three human Y-family enzymes, hPolκ made the fewest mutations at all template positions except opposite the lesion site. hPolκ was significantly less error-prone than hPolι and hPolη during the extension of dGAP bypass products. Interestingly, the most frequent mutations created by hPolι at all template positions were base deletions. Although hRev1, the fourth human Y-family enzyme, could not extend dGAP bypass products in our standing start assays, it preferentially incorporated dCTP opposite the bulky lesion. Collectively, these mutagenic profiles suggest that hPolkk and hRev1 are the most suitable human Y-family DNA polymerases to perform TLS of dGAP in humans. PMID:22917544

  5. Kinetic Analysis of the Bypass of a Bulky DNA Lesion Catalyzed by Human Y-family DNA Polymerases (United States)

    Sherrer, Shanen M.; Sanman, Laura E.; Xia, Cynthia X.; Bolin, Eric R.; Malik, Chanchal K.; Efthimiopoulos, Georgia; Basu, Ashis K.; Suo, Zucai


    1-Nitropyrene (1-NP), a mutagen and potential carcinogen, is the most abundant nitro polyaromatic hydrocarbon in diesel exhaust, which reacts with DNA to form predominantly N-(deoxyguanosin-8-yl)-1-aminopyrene (dGAP). If not repaired, this DNA lesion is presumably bypassed in vivo by any of human Y-family DNA polymerases kappa (hPolκ), iota (hPolτ), eta (hPolη), and Rev1 (hRev1). Our running start assays demonstrated that each of these enzymes was indeed capable of traversing a site-specifically placed dGAP on a synthetic DNA template but hRev1 was stopped after lesion bypass. The time required to bypass 50% of the dGAP sites (t50bypass ) encountered by hPolη, hPolκ and hPolτ was determined to be 2.5 s, 4.1 s, and 106.5 s, respectively. The efficiency order of catalyzing translesion synthesis of dGAP (hPolη > hPolκ > hPolτ >> hRev1) is the same as the order for these human Y-family enzymes to elongate undamaged DNA. Although hPolη bypassed dGAP efficiently, replication by both hPolκ and hPolτ was strongly stalled at the lesion site and at a site immediately downstream from dGAP. By employing pre-steady state kinetic methods, a kinetic basis was established for polymerase pausing at these DNA template sites. Besides efficiency of bypass, the fidelity of those low-fidelity polymerases at these pause sites was also significantly decreased. Thus, if the translesion DNA synthesis of dGAP in vivo is catalyzed by a human Y-family DNA polymerase, e.g. hPolη, the process is certainly mutagenic. PMID:22324639

  6. A single molecule DNA flow stretching microscope for undergraduates

    NARCIS (Netherlands)

    Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.


    The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no

  7. Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions (United States)

    Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory


    The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

  8. Automation of a single-DNA molecule stretching device

    DEFF Research Database (Denmark)

    Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels


    We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...

  9. DNA molecules and human therapeutics | Danquah | African Journal ...

    African Journals Online (AJOL)

    Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...

  10. Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van


    We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The

  11. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman


    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  12. Engineered split in Pfu DNA polymerase fingers domain improves incorporation of nucleotide γ-phosphate derivative (United States)

    Hansen, Connie J.; Wu, Lydia; Fox, Jeffrey D.; Arezi, Bahram; Hogrefe, Holly H.


    Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (−1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure. PMID:21062827

  13. Engineered split in Pfu DNA polymerase fingers domain improves incorporation of nucleotide gamma-phosphate derivative. (United States)

    Hansen, Connie J; Wu, Lydia; Fox, Jeffrey D; Arezi, Bahram; Hogrefe, Holly H


    Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (-1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure.

  14. The Chilo iridescent virus DNA polymerase promoter contains an essential AAAAT motif

    NARCIS (Netherlands)

    Nalcacioglu, R.; Ince, I.A.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.


    The delayed-early DNA polymerase promoter of Chilo iridescent virus (CIV), officially known as Invertebrate iridescent virus, was fine mapped by constructing a series of increasing deletions and by introducing point mutations. The effects of these mutations were examined in a luciferase reporter

  15. Localized Cerebral Energy Failure in DNA Polymerase Gamma-Associated Encephalopathy Syndromes (United States)

    Tzoulis, Charalampos; Neckelmann, Gesche; Mork, Sverre J.; Engelsen, Bernt E.; Viscomi, Carlo; Moen, Gunnar; Ersland, Lars; Zeviani, Massimo; Bindoff, Laurence A.


    Mutations in the catalytic subunit of the mitochondrial DNA-polymerase gamma cause a wide spectrum of clinical disease ranging from infantile hepato-encephalopathy to juvenile/adult-onset spinocerebellar ataxia and late onset progressive external ophthalmoplegia. Several of these syndromes are associated with an encephalopathy that…

  16. Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II

    NARCIS (Netherlands)

    B. Steurer (Barbara); J.A. Marteijn (Jurgen)


    textabstractThe faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The

  17. Synthesis of Hydrazone-Modified Nucleotides and Their Polymerase Incorporation onto DNA for Redox Labeling

    Czech Academy of Sciences Publication Activity Database

    Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal


    Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry

  18. Absence of ultraviolet-inducible DNA polymerase I-like activity in Escherichia coli strains harbouring R plasmids

    International Nuclear Information System (INIS)

    Upton, C.; Pinney, R.J.


    No DNA polymerase I-like activity was found associated with the ultraviolet (u.v.)-protecting plasmids R205, R46 or pKM101 in either uninduced or u.v.-induced wild-type or DNA polymerase I-deficient strains of Escherichia coli. Nor was any plasmid-associated polymerase activity detectable in similar systems containing u.v.-irradiated DNA as template. However, plasmids R205, R46 and pKM 101 still increased survival and mutagenesis of the polymerase I-deficient E. coli strain after u.v. irradiation. (author)

  19. DNA polymerases beta and lambda mediate overlapping and independent roles in base excision repair in mouse embryonic fibroblasts.

    Directory of Open Access Journals (Sweden)

    Elena K Braithwaite


    Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.

  20. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong


    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  1. Primer-Independent DNA Synthesis by a Family B DNA Polymerase from Self-Replicating Mobile Genetic Elements

    Directory of Open Access Journals (Sweden)

    Modesto Redrejo-Rodríguez


    Full Text Available Family B DNA polymerases (PolBs play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB, that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance.

  2. Inhibition of poly(ADP-ribose)polymerase-1 and DNA repair by uranium

    Energy Technology Data Exchange (ETDEWEB)

    Cooper, Karen L.; Dashner, Erica J. [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States); Tsosie, Ranalda [Department of Chemistry and Biochemistry, University of Montana, Missoula, MT 59812 (United States); Cho, Young Mi [Department of Food and Nutrition, College of Human Ecology, Hanyang University, Seoul 133-791 (Korea, Republic of); Lewis, Johnnye [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States); Community Environmental Health Program, University of New Mexico Health Sciences Center College of Pharmacy, Albuquerque, NM 87131 (United States); Hudson, Laurie G., E-mail: [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States)


    Uranium has radiological and non-radiological effects within biological systems and there is increasing evidence for genotoxic and carcinogenic properties attributable to uranium through its heavy metal properties. In this study, we report that low concentrations of uranium (as uranyl acetate; < 10 μM) is not cytotoxic to human embryonic kidney cells or normal human keratinocytes; however, uranium exacerbates DNA damage and cytotoxicity induced by hydrogen peroxide, suggesting that uranium may inhibit DNA repair processes. Concentrations of uranyl acetate in the low micromolar range inhibited the zinc finger DNA repair protein poly(ADP-ribose) polymerase (PARP)-1 and caused zinc loss from PARP-1 protein. Uranyl acetate exposure also led to zinc loss from the zinc finger DNA repair proteins Xeroderma Pigmentosum, Complementation Group A (XPA) and aprataxin (APTX). In keeping with the observed inhibition of zinc finger function of DNA repair proteins, exposure to uranyl acetate enhanced retention of induced DNA damage. Co-incubation of uranyl acetate with zinc largely overcame the impact of uranium on PARP-1 activity and DNA damage. These findings present evidence that low concentrations of uranium can inhibit DNA repair through disruption of zinc finger domains of specific target DNA repair proteins. This may provide a mechanistic basis to account for the published observations that uranium exposure is associated with DNA repair deficiency in exposed human populations. - Highlights: • Low micromolar concentration of uranium inhibits polymerase-1 (PARP-1) activity. • Uranium causes zinc loss from multiple DNA repair proteins. • Uranium enhances retention of DNA damage caused by ultraviolet radiation. • Zinc reverses the effects of uranium on PARP activity and DNA damage repair.

  3. A method for filling in the cohesive ends of double-stranded DNA using Pfu DNA polymerase. (United States)

    Yang, Shaohui; Li, Xin; Ding, Dongfeng; Hou, Jianhua; Jin, Zhaoxia; Yu, Xinchun; Bo, Tao; Li, Weidong; Li, Minggang


    The present paper reports a highly efficient method of making blunt ends from cohesive ends of double-stranded DNA. Klenow fragment and Pfu DNA polymerases were used to fill in the cohesive ends. Since the transformation efficiency can directly reflect the filling-in efficiency, similar ligation and transformation conditions were used, and the filling-in efficiency was compared with the corresponding transformation efficiency. The results indicate that the filling-in efficiency of Pfu DNA polymerase was 1.96 times that of Klenow fragment and its efficiency was markedly higher than that of Klenow fragment (P<0.01). The optimization experiments on reaction conditions indicate, when the pH is 8.5 and the temperature is 74 degrees C, that the filling-in efficiency was highest upon using a buffer containing 3 mM MgSO4 and 300 microM dNTP.

  4. Highly parallel translation of DNA sequences into small molecules.

    Directory of Open Access Journals (Sweden)

    Rebecca M Weisinger

    Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

  5. Exonuclease of human DNA polymerase gamma disengages its strand displacement function. (United States)

    He, Quan; Shumate, Christie K; White, Mark A; Molineux, Ian J; Yin, Y Whitney


    Pol γ, the only DNA polymerase found in human mitochondria, functions in both mtDNA repair and replication. During mtDNA base-excision repair, gaps are created after damaged base excision. Here we show that Pol γ efficiently gap-fills except when the gap is only a single nucleotide. Although wild-type Pol γ has very limited ability for strand displacement DNA synthesis, exo(-) (3'-5' exonuclease-deficient) Pol γ has significantly high activity and rapidly unwinds downstream DNA, synthesizing DNA at a rate comparable to that of the wild-type enzyme on a primer-template. The catalytic subunit Pol γA alone, even when exo(-), is unable to synthesize by strand displacement, making this the only known reaction of Pol γ holoenzyme that has an absolute requirement for the accessory subunit Pol γB. © 2013. Published by Elsevier B.V.

  6. A new building block for DNA network formation by self-assembly and polymerase chain reaction. (United States)

    Bußkamp, Holger; Keller, Sascha; Robotta, Marta; Drescher, Malte; Marx, Andreas


    The predictability of DNA self-assembly is exploited in many nanotechnological approaches. Inspired by naturally existing self-assembled DNA architectures, branched DNA has been developed that allows self-assembly to predesigned architectures with dimensions on the nanometer scale. DNA is an attractive material for generation of nanostructures due to a plethora of enzymes which modify DNA with high accuracy, providing a toolbox for many different manipulations to construct nanometer scaled objects. We present a straightforward synthesis of a rigid DNA branching building block successfully used for the generation of DNA networks by self-assembly and network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel electrophoresis, atomic force microscopy, dynamic light scattering, and electron paramagnetic resonance spectroscopy. The findings indicate that rather rigid DNA networks were formed. This presents a new bottom-up approach for DNA material formation and might find applications like in the generation of functional hydrogels.

  7. Two Family B DNA Polymerases From Aeropyrum pernix, Based on Revised Translational Frames

    Directory of Open Access Journals (Sweden)

    Katsuya Daimon


    Full Text Available Living organisms are divided into three domains, Bacteria, Eukarya, and Archaea. Comparative studies in the three domains have provided useful information to understand the evolution of the DNA replication machinery. DNA polymerase is the central enzyme of DNA replication. The presence of multiple family B DNA polymerases is unique in Crenarchaeota, as compared with other archaeal phyla, which have a single enzyme each for family B (PolB and family D (PolD. We analyzed PolB1 and PolB3 in the hyperthermophilic crenarchaeon, Aeropyrum pernix, and found that they are larger proteins than those predicted from the coding regions in our previous study and from public database annotations. The recombinant larger PolBs exhibited the same DNA polymerase activities as previously reported. However, the larger PolB3 showed remarkably higher thermostability, which made this enzyme applicable to PCR. In addition, the high tolerance to salt and heparin suggests that PolB3 will be useful for amplification from the samples with contaminants, and therefore it has a great potential for diagnostic use in the medical and environmental field.

  8. Lesion Orientation of O4-Alkylthymidine Influences Replication by Human DNA Polymerase η. (United States)

    O'Flaherty, D K; Patra, A; Su, Y; Guengerich, F P; Egli, M; Wilds, C J


    DNA lesions that elude repair may undergo translesion synthesis catalyzed by Y-family DNA polymerases. O 4 -Alkylthymidines, persistent adducts that can result from carcinogenic agents, may be encountered by DNA polymerases. The influence of lesion orientation around the C4- O 4 bond on processing by human DNA polymerase η (hPol η ) was studied for oligonucleotides containing O 4 -methylthymidine, O 4 -ethylthymidine, and analogs restricting the O 4 -methylene group in an anti -orientation. Primer extension assays revealed that the O 4 -alkyl orientation influences hPol η bypass. Crystal structures of hPol η •DNA•dNTP ternary complexes with O 4 -methyl- or O 4 -ethylthymidine in the template strand showed the nucleobase of the former lodged near the ceiling of the active site, with the syn - O 4 -methyl group engaged in extensive hydrophobic interactions. This unique arrangement for O 4 -methylthymidine with hPol η , inaccessible for the other analogs due to steric/conformational restriction, is consistent with differences observed for nucleotide incorporation and supports the concept that lesion conformation influences extension across DNA damage. Together, these results provide mechanistic insights on the mutagenicity of O 4 MedT and O 4 EtdT when acted upon by hPol η .

  9. Replication slippage of the thermophilic DNA polymerases B and D from the Euryarchaeota Pyrococcus abyssi

    Directory of Open Access Journals (Sweden)

    Melissa G. eCastillo-Lizardo


    Full Text Available Replication slippage or slipped-strand mispairing involves the misalignment of DNA strands during the replication of repeated DNA sequences, and can lead to genetic rearrangements such as microsatellite instability. Here, we show that PolB and PolD replicative DNA polymerases from the archaeal model Pyrococcus abyssi (Pab slip in vitro during replication of a single-stranded DNA template carrying a hairpin structure and short direct repeats. We find that this occurs in both their wild-type (exo+ and exonuclease deficient (exo- forms. The slippage behavior of PabPolB and PabPolD, probably due to limited strand displacement activity, resembles that observed for the high fidelity Pyrococcus furiosus (Pfu DNA polymerase. The presence of PabPCNA inhibited PabPolB and PabPolD slippage. We propose a model whereby PabPCNA stimulates strand displacement activity and polymerase progression through the hairpin, thus permitting the error-free replication of repetitive sequences.

  10. Studying DNA looping by single-molecule FRET. (United States)

    Le, Tung T; Kim, Harold D


    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

  11. Mechanistic Investigation of the Bypass of a Bulky Aromatic DNA Adduct Catalyzed by a Y-family DNA Polymerase (United States)

    Gadkari, Varun V.; Tokarsky, E. John; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai


    3-Nitrobenzanthrone (3-NBA), a nitropolyaromatic hydrocarbon (NitroPAH) pollutant in diesel exhaust, is a potent mutagen and carcinogen. After metabolic activation, the primary metabolites of 3-NBA react with DNA to form dG and dA adducts. One of the three major adducts identified is N-(2’-deoxyguanosin-8-yl)-3-aminobenzanthrone (dGC8-N-ABA). This bulky adduct likely stalls replicative DNA polymerases but can be traversed by lesion bypass polymerases in vivo. Here, we employed running start assays to show that a site-specifically placed dGC8-N-ABA is bypassed in vitro by Sulfolobus solfataricus DNA polymerase IV (Dpo4), a model Y-family DNA polymerase. However, the nucleotide incorporation rate of Dpo4 was significantly reduced opposite both the lesion and the template position immediately downstream from the lesion site, leading to two strong pause sites. To investigate the kinetic effect of dGC8-N-ABA on polymerization, we utilized pre-steady-state kinetic methods to determine the kinetic parameters for individual nucleotide incorporations upstream, opposite, and downstream from the dGC8-N-ABA lesion. Relative to the replication of the corresponding undamaged DNA template, both nucleotide incorporation efficiency and fidelity of Dpo4 were considerably decreased during dGC8-N-ABA lesion bypass and the subsequent extension step. The lower nucleotide incorporation efficiency caused by the lesion is a result of a significantly reduced dNTP incorporation rate constant and modestly weaker dNTP binding affinity. At both pause sites, nucleotide incorporation followed biphasic kinetics with a fast and a slow phase and their rates varied with nucleotide concentration. In contrast, only the fast phase was observed with undamaged DNA. A kinetic mechanism was proposed for the bypass of dGC8-N-ABA bypass catalyzed by Dpo4. PMID:25048879

  12. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid


    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  13. A structural role for the PHP domain in E. coli DNA polymerase III. (United States)

    Barros, Tiago; Guenther, Joel; Kelch, Brian; Anaya, Jordan; Prabhakar, Arjun; O'Donnell, Mike; Kuriyan, John; Lamers, Meindert H


    In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase.

  14. RNA polymerase II transcriptional fidelity control and its functional interplay with DNA modifications (United States)

    Xu, Liang; Wang, Wei; Chong, Jenny; Shin, Ji Hyun; Xu, Jun; Wang, Dong


    Accurate genetic information transfer is essential for life. As a key enzyme involved in the first step of gene expression, RNA polymerase II (Pol II) must maintain high transcriptional fidelity while it reads along DNA template and synthesizes RNA transcript in a stepwise manner during transcription elongation. DNA lesions or modifications may lead to significant changes in transcriptional fidelity or transcription elongation dynamics. In this review, we will summarize recent progress towards understanding the molecular basis of RNA Pol II transcriptional fidelity control and impacts of DNA lesions and modifications on Pol II transcription elongation. PMID:26392149

  15. Developing DNA nanotechnology using single-molecule fluorescence. (United States)

    Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal


    CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

  16. Nucleotide-mimetic synthetic ligands for DNA-recognizing enzymes One-step purification of Pfu DNA polymerase. (United States)

    Melissis, S; Labrou, N E; Clonis, Y D


    The commercial availability of DNA polymerases has revolutionized molecular biotechnology and certain sectors of the bio-industry. Therefore, the development of affinity adsorbents for purification of DNA polymerases is of academic interest and practical importance. In the present study we describe the design, synthesis and evaluation of a combinatorial library of novel affinity ligands for the purification of DNA polymerases (Pols). Pyrococcus furiosus DNA polymerase (Pfu Pol) was employed as a proof-of-principle example. Affinity ligand design was based on mimicking the natural interactions between deoxynucleoside-triphosphates (dNTPs) and the B-motif, a conserved structural moiety found in Pol-I and Pol-II family of enzymes. Solid-phase 'structure-guided' combinatorial chemistry was used to construct a library of 26 variants of the B-motif-binding 'lead' ligand X-Trz-Y (X is a purine derivative and Y is an aliphatic/aromatic sulphonate or phosphonate derivative) using 1,3,5-triazine (Trz) as the scaffold for assembly. The 'lead' ligand showed complementarity against a Lys and a Tyr residue of the polymerase B-motif. The ligand library was screened for its ability to bind and purify Pfu Pol from Escherichia coli extract. One immobilized ligand (oABSAd), bearing 9-aminoethyladenine (AEAd) and sulfanilic acid (oABS) linked on the triazine scaffold, displayed the highest purifying ability and binding capacity (0,55 mg Pfu Pol/g wet gel). Adsorption equilibrium studies with this affinity ligand and Pfu Pol determined a dissociation constant (K(D)) of 83 nM for the respective complex. The oABSAd affinity adsorbent was exploited in the development of a facile Pfu Pol purification protocol, affording homogeneous enzyme (>99% purity) in a single chromatography step. Quality control tests showed that Pfu Pol purified on the B-motif-complementing ligand is free of nucleic acids and contaminating nuclease activities, therefore, suitable for experimental use.

  17. Distinct co-evolution patterns of genes associated to DNA polymerase III DnaE and PolC

    Directory of Open Access Journals (Sweden)

    Engelen Stefan


    Full Text Available Abstract Background Bacterial genomes displaying a strong bias between the leading and the lagging strand of DNA replication encode two DNA polymerases III, DnaE and PolC, rather than a single one. Replication is a highly unsymmetrical process, and the presence of two polymerases is therefore not unexpected. Using comparative genomics, we explored whether other processes have evolved in parallel with each polymerase. Results Extending previous in silico heuristics for the analysis of gene co-evolution, we analyzed the function of genes clustering with dnaE and polC. Clusters were highly informative. DnaE co-evolves with the ribosome, the transcription machinery, the core of intermediary metabolism enzymes. It is also connected to the energy-saving enzyme necessary for RNA degradation, polynucleotide phosphorylase. Most of the proteins of this co-evolving set belong to the persistent set in bacterial proteomes, that is fairly ubiquitously distributed. In contrast, PolC co-evolves with RNA degradation enzymes that are present only in the A+T-rich Firmicutes clade, suggesting at least two origins for the degradosome. Conclusion DNA replication involves two machineries, DnaE and PolC. DnaE co-evolves with the core functions of bacterial life. In contrast PolC co-evolves with a set of RNA degradation enzymes that does not derive from the degradosome identified in gamma-Proteobacteria. This suggests that at least two independent RNA degradation pathways existed in the progenote community at the end of the RNA genome world.

  18. Structural basis for the binding and incorporation of nucleotide analogs with L-stereochemistry by human DNA polymerase λ


    Vyas, Rajan; Zahurancik, Walter J.; Suo, Zucai


    DNA polymerases are known to select against L-nucleotides, the enantiomers of natural D-nucleotides. However, the structural basis for D-stereoselectivity of a DNA polymerase has not been established, although two L-nucleoside analogs, lamivudine and emtricitabine, have been widely used as anti-HIV and anti-hepatitis B drugs. Here, we report ternary crystal structures of human DNA polymerase λ in complex with DNA and L-deoxycytidine 5′-triphosphate, or its analogs (the triphosphates of lamivu...

  19. Pyrovanadolysis, a Pyrophosphorolysis-like Reaction Mediated by Pyrovanadate, Mn2+, and DNA Polymerase of Bacteriophage T7

    NARCIS (Netherlands)

    Akabayov, Barak; Kulczyk, Arkadiusz W.; Akabayov, Sabine R.; Theile, Christopher; McLaughlin, Larry W.; Beauchamp, Benjamin; van Oijen, Antoine M.; Richardson, Charles C.


    DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PPi). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry

  20. Whole Blood PCR Amplification with Pfu DNA Polymerase and Its Application in Single-Nucleotide Polymorphism Analysis. (United States)

    Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping


    Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.

  1. Hydrogen-Bonding Capability of a Templating Difluorotoluene Nucleotide Residue in an RB69 DNA Polymerase Ternary Complex

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Shuangluo; Konigsberg, William H.; Wang, Jimin (Yale)


    Results obtained using 2,4-difluorotoluene nucleobase (dF) as a nonpolar thymine isostere by Kool and colleagues challenged the Watson-Crick dogma that hydrogen bonds between complementary bases are an absolute requirement for accurate DNA replication. Here, we report crystal structure of an RB69 DNA polymerase L561A/S565G/Y567A triple mutant ternary complex with a templating dF opposite dTTP at 1.8 {angstrom}-resolution. In this structure, direct hydrogen bonds were observed between: (i) dF and the incoming dTTP, (ii) dF and residue G568 of the polymerase, and (iii) dF and ordered water molecules surrounding the nascent base pair. Therefore, this structure provides evidence that a templating dF can form novel hydrogen bonds with the incoming dTTP and with the enzyme that differ from those formed with a templating dT.

  2. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S


    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  3. Trans-Lesion DNA Polymerases May Be Involved in Yeast Meiosis (United States)

    Arbel-Eden, Ayelet; Joseph-Strauss, Daphna; Masika, Hagit; Printzental, Oxana; Rachi, Eléanor; Simchen, Giora


    Trans-lesion DNA polymerases (TLSPs) enable bypass of DNA lesions during replication and are also induced under stress conditions. Being only weakly dependent on their template during replication, TLSPs introduce mutations into DNA. The low processivity of these enzymes ensures that they fall off their template after a few bases are synthesized and are then replaced by the more accurate replicative polymerase. We find that the three TLSPs of budding yeast Saccharomyces cerevisiae Rev1, PolZeta (Rev3 and Rev7), and Rad30 are induced during meiosis at a time when DNA double-strand breaks (DSBs) are formed and homologous chromosomes recombine. Strains deleted for one or any combination of the three TLSPs undergo normal meiosis. However, in the triple-deletion mutant, there is a reduction in both allelic and ectopic recombination. We suggest that trans-lesion polymerases are involved in the processing of meiotic double-strand breaks that lead to mutations. In support of this notion, we report significant yeast two-hybrid (Y2H) associations in meiosis-arrested cells between the TLSPs and DSB proteins Rev1-Spo11, Rev1-Mei4, and Rev7-Rec114, as well as between Rev1 and Rad30. We suggest that the involvement of TLSPs in processing of meiotic DSBs could be responsible for the considerably higher frequency of mutations reported during meiosis compared with that found in mitotically dividing cells, and therefore may contribute to faster evolutionary divergence than previously assumed. PMID:23550131

  4. Data of self-made Taq DNA polymerase prepared for screening purposes

    Directory of Open Access Journals (Sweden)

    E.V. Konovalova


    Full Text Available DNA analysis is a key procedure in genetic engineering. Nowadays the analysis is often done by PCR with Taq DNA polymerase. Although the last enzyme price is quite low, demand for numerous analyses results in much money expenditure which are not affordable for many laboratories. In a meanwhile, many screening tasks do not require the highly purified enzyme. Taking into account the enzyme unique properties it makes possible to marginally simplify its production without resorting to costly or lengthy techniques such as column chromatography and/or dialysis. Here the data of routine usage of Taq DNA polymerase prepared according to the protocol developed in our laboratory is presented. The protocol takes only several hours to realize and does not need qualified personnel or expensive equipment. Yet it gives the enzyme preparation suitable for most screening purposes. The isolated Taq DNA polymerase stock can be stored as ammonium sulfate suspension in a refrigerator for prolonged period, not less than 6 months. The working enzyme solution is prepared from the stock suspension on demand, not more than once in a month and can be stored also in a refrigerator.

  5. Engineering of DNA polymerase I from Thermus thermophilus using compartmentalized self-replication. (United States)

    Aye, Seaim Lwin; Fujiwara, Kei; Ueki, Asuka; Doi, Nobuhide


    Although compartmentalized self-replication (CSR) and compartmentalized partnered replication (CPR) are powerful tools for directed evolution of proteins and gene circuits, limitations remain in the emulsion PCR process with the wild-type Taq DNA polymerase used so far, including long run times, low amounts of product, and false negative results due to inhibitors. In this study, we developed a high-efficiency mutant of DNA polymerase I from Thermus thermophilus HB27 (Tth pol) suited for CSR and CPR. We modified the wild-type Tth pol by (i) deletion of the N-terminal 5' to 3' exonuclease domain, (ii) fusion with the DNA-binding protein Sso7d, (iii) introduction of four known effective point mutations from other DNA polymerase mutants, and (iv) codon optimization to reduce the GC content. Consequently, we obtained a mutant that provides higher product yields than the conventional Taq pol without decreased fidelity. Next, we performed four rounds of CSR selection with a randomly mutated library of this modified Tth pol and obtained mutants that provide higher product yields in fewer cycles of emulsion PCR than the parent Tth pol as well as the conventional Taq pol. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. (United States)

    Ririe, K M; Rasmussen, R P; Wittwer, C T


    A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

  7. Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II. (United States)

    Steurer, Barbara; Marteijn, Jurgen A


    The faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The stalling of RNAP2 on a transcription-blocking lesion triggers a series of highly regulated events, including RNAP2 processing to make the lesion accessible for DNA repair, R-loop-mediated DNA damage signaling, and the initiation of transcription-coupled DNA repair. The correct execution and coordination of these processes is vital for resuming transcription following the successful repair of transcription-blocking lesions. Here, we outline recent insights into the molecular consequences of RNAP2 stalling on transcription-blocking DNA lesions and how these lesions are resolved to restore mRNA synthesis. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  8. Inhibition of poly(ADP-ribose)polymerase-1 and DNA repair by uranium. (United States)

    Cooper, Karen L; Dashner, Erica J; Tsosie, Ranalda; Cho, Young Mi; Lewis, Johnnye; Hudson, Laurie G


    Uranium has radiological and non-radiological effects within biological systems and there is increasing evidence for genotoxic and carcinogenic properties attributable to uranium through its heavy metal properties. In this study, we report that low concentrations of uranium (as uranyl acetate; uranium exacerbates DNA damage and cytotoxicity induced by hydrogen peroxide, suggesting that uranium may inhibit DNA repair processes. Concentrations of uranyl acetate in the low micromolar range inhibited the zinc finger DNA repair protein poly(ADP-ribose) polymerase (PARP)-1 and caused zinc loss from PARP-1 protein. Uranyl acetate exposure also led to zinc loss from the zinc finger DNA repair proteins Xeroderma Pigmentosum, Complementation Group A (XPA) and aprataxin (APTX). In keeping with the observed inhibition of zinc finger function of DNA repair proteins, exposure to uranyl acetate enhanced retention of induced DNA damage. Co-incubation of uranyl acetate with zinc largely overcame the impact of uranium on PARP-1 activity and DNA damage. These findings present evidence that low concentrations of uranium can inhibit DNA repair through disruption of zinc finger domains of specific target DNA repair proteins. This may provide a mechanistic basis to account for the published observations that uranium exposure is associated with DNA repair deficiency in exposed human populations. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond

    Directory of Open Access Journals (Sweden)

    David eDavidson


    Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA

  10. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds (United States)

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.


    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  11. Construction, Expression, and Characterization of Recombinant Pfu DNA Polymerase in Escherichia coli. (United States)

    Zheng, Wenjun; Wang, Qingsong; Bi, Qun


    Pfu DNA polymerase (Pfu) is a DNA polymerase isolated from the hyperthermophilic archaeon Pyrococcus furiosus. With its excellent thermostability and high fidelity, Pfu is well known as one of the enzymes widely used in the polymerase chain reaction. In this study, the recombinant plasmid pLysS His6-tagged Pfu-pET28a was constructed. His-tagged Pfu was expressed in Escherichia coli BL21 (DE3) competent cells and then successfully purified with the ÄKTAprime plus compact one-step purification system by Ni(2+) chelating affinity chromatography after optimization of the purification conditions. The authenticity of the purified Pfu was further confirmed by peptide mass fingerprinting. A bio-assay indicated that its activity in the polymerase chain reaction was equivalent to that of commercial Pfu and its isoelectric point was found to be between 6.85 and 7.35. These results will be useful for further studies on Pfu and its wide application in the future.

  12. New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III. (United States)

    Lama, Lodoe; Seidl, Christine I; Ryan, Kevin


    Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3' end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells.

  13. New lupane triterpenoids from Solidago canadensis that inhibit the lyase activity of DNA polymerase beta. (United States)

    Chaturvedula, V S Prakash; Zhou, Bing-Nan; Gao, Zhijie; Thomas, Shannon J; Hecht, Sidney M; Kingston, David G I


    Bioassay-directed fractionation of a methyl ethyl ketone extract of Solidago canadensis L. (Asteraceae), using an assay to detect the lyase activity of DNA polymerase beta, resulted in the isolation of the four new lupane triterpenoids 1-4 and the seven known compounds lupeol, lupeyl acetate, ursolic acid, cycloartenol, cycloartenyl palmitate, alpha-amyrin acetate, and stigmasterol. The structures of the new compounds were established as 3beta-(3R-acetoxyhexadecanoyloxy)-lup-20(29)-ene (1), 3beta-(3-ketohexadecanoyloxy)-lup-20(29)-ene (2), 3beta-(3R-acetoxyhexadecanoyloxy)-29-nor-lupan-20-one (3), and 3beta-(3-hetohexadecanoyloxy)-29-nor-lupan-20-one (4), respectively, on the basis of extensive 1D and 2D NMR spectroscopic interpretation and chemical modification studies. All 11 compounds were inhibitory to the lyase activity of DNA polymerase beta.

  14. Inhibitory effects of vitamin K3 on DNA polymerase and angiogenesis. (United States)

    Matsubara, Kiminori; Kayashima, Tomoko; Mori, Masaharu; Yoshida, Hiromi; Mizushina, Yoshiyuki


    Vitamins play essential roles in cellular reactions and maintain human health. Recent studies have revealed that some vitamins including D3, B6 and K2 and their derivatives have an anti-cancer effect. As a mechanism, their inhibitory effect on cancer-related angiogenesis has been demonstrated. Vitamin K2 (menaquinones) has an anti-cancer effect in particular for hepatic cancer and inhibits angiogenesis. In the current study, we demonstrated that sole vitamin K3 (menadione) selectively inhibits the in vitro activity of eukaryotic DNA polymerase gamma, which is a mitochondrial DNA polymerase, and suppresses angiogenesis in a rat aortic ring model. The anti-angiogenic effect of vitamin K3 has been shown in angiogenesis models using human umbilical vein endothelial cells (HUVECs) with regard to HUVEC growth, tube formation on reconstituted basement membrane and chemotaxis. These results suggest that vitamin K3 may be a potential anti-cancer agent like vitamin K2.

  15. Single-molecule mechanics of protein-labelled DNA handles

    Directory of Open Access Journals (Sweden)

    Vivek S. Jadhav


    Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular

  16. Functional Analysis of Cancer-Associated DNA Polymerase ε Variants in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Stephanie R. Barbari


    Full Text Available DNA replication fidelity relies on base selectivity of the replicative DNA polymerases, exonucleolytic proofreading, and postreplicative DNA mismatch repair (MMR. Ultramutated human cancers without MMR defects carry alterations in the exonuclease domain of DNA polymerase ε (Polε. They have been hypothesized to result from defective proofreading. However, modeling of the most common variant, Polε-P286R, in yeast produced an unexpectedly strong mutator effect that exceeded the effect of proofreading deficiency by two orders of magnitude and indicated the involvement of other infidelity factors. The in vivo consequences of many additional Polε mutations reported in cancers remain poorly understood. Here, we genetically characterized 13 cancer-associated Polε variants in the yeast system. Only variants directly altering the DNA binding cleft in the exonuclease domain elevated the mutation rate. Among these, frequently recurring variants were stronger mutators than rare variants, in agreement with the idea that mutator phenotype has a causative role in tumorigenesis. In nearly all cases, the mutator effects exceeded those of an exonuclease-null allele, suggesting that mechanisms distinct from loss of proofreading may drive the genome instability in most ultramutated tumors. All mutator alleles were semidominant, supporting the view that heterozygosity for the polymerase mutations is sufficient for tumor development. In contrast to the DNA binding cleft alterations, peripherally located variants, including a highly recurrent V411L, did not significantly elevate mutagenesis. Finally, the analysis of Polε variants found in MMR-deficient tumors suggested that the majority cause no mutator phenotype alone but some can synergize with MMR deficiency to increase the mutation rate.

  17. Cooperation of terminal deoxynucleotidyl transferase with DNA polymerase α in the replication of ultraviolet-irradiated DNA

    International Nuclear Information System (INIS)

    Yoshida, S.; Masaki, S.; Nakamura, H.; Morita, T.


    The amount of DNA synthesis in vitro with the ultraviolet-irradiated poly(dT).oligo(rA) template initiators catalysed by DNA polymerase α (Masaki, S. and Yoshida, S., Biochim. Biophys. Acta 521, 74-88) decreased with the dose of ultraviolet-irradiation. The ultraviolet irradiation to the template, however, did not affect the rate of incorporation of incorrect deoxynucleotides into the newly synthesized poly(dA). The addition of terminal deoxynucleotidyl transferase to this system enhanced the DNA synthesis to a level which is comparable to that of the control and it concomitantly increased the incorporation of the mismatched deoxynucleotide into the newly synthesized poly(dA) strands. On the other hand, with an unirradiated template initiator, the misincorporation was only slightly enhanced by the addition of terminal deoxynucleotidyl transferase. The sizes of newly synthesized DNA measured by the sedimentation velocities were found to be smaller with the ultraviolet-irradiated templates but they increased to the control level with the addition of terminal deoxynucleotidyl transferase to the systems. These results suggest that terminal deoxynucleotidyl transferase can help DNA polymerase α to bypass thymine dimers in vitro by the formation of mismatched regions at the positions opposite to pyrimidine dimers on the template. (Auth.)

  18. Crystal structure of Pfu, the high fidelity DNA polymerase from Pyrococcus furiosus. (United States)

    Kim, Suhng Wook; Kim, Dong-Uk; Kim, Jin Kwang; Kang, Lin-Woo; Cho, Hyun-Soo


    We have determined a 2.6A resolution crystal structure of Pfu DNA polymerase, the most commonly used high fidelity PCR enzyme, from Pyrococcus furiosus. Although the structures of Pfu and KOD1 are highly similar, the structure of Pfu elucidates the electron density of the interface between the exonuclease and thumb domains, which has not been previously observed in the KOD1 structure. The interaction of these two domains is known to coordinate the proofreading and polymerization activity of DNA polymerases, especially via H147 that is present within the loop (residues 144-158) of the exonuclease domain. In our structure of Pfu, however, E148 rather than H147 is located at better position to interact with the thumb domain. In addition, the structural analysis of Pfu and KOD1 shows that both the Y-GG/A and beta-hairpin motifs of Pfu are found to differ with that of KOD1, and may explain differences in processivity. This information enables us to better understand the mechanisms of polymerization and proofreading of DNA polymerases.

  19. Fission yeast shelterin regulates DNA polymerases and Rad3(ATR kinase to limit telomere extension.

    Directory of Open Access Journals (Sweden)

    Ya-Ting Chang


    Full Text Available Studies in fission yeast have previously identified evolutionarily conserved shelterin and Stn1-Ten1 complexes, and established Rad3(ATR/Tel1(ATM-dependent phosphorylation of the shelterin subunit Ccq1 at Thr93 as the critical post-translational modification for telomerase recruitment to telomeres. Furthermore, shelterin subunits Poz1, Rap1 and Taz1 have been identified as negative regulators of Thr93 phosphorylation and telomerase recruitment. However, it remained unclear how telomere maintenance is dynamically regulated during the cell cycle. Thus, we investigated how loss of Poz1, Rap1 and Taz1 affects cell cycle regulation of Ccq1 Thr93 phosphorylation and telomere association of telomerase (Trt1(TERT, DNA polymerases, Replication Protein A (RPA complex, Rad3(ATR-Rad26(ATRIP checkpoint kinase complex, Tel1(ATM kinase, shelterin subunits (Tpz1, Ccq1 and Poz1 and Stn1. We further investigated how telomere shortening, caused by trt1Δ or catalytically dead Trt1-D743A, affects cell cycle-regulated telomere association of telomerase and DNA polymerases. These analyses established that fission yeast shelterin maintains telomere length homeostasis by coordinating the differential arrival of leading (Polε and lagging (Polα strand DNA polymerases at telomeres to modulate Rad3(ATR association, Ccq1 Thr93 phosphorylation and telomerase recruitment.

  20. Engineering of a DNA Polymerase for Direct m6 A Sequencing. (United States)

    Aschenbrenner, Joos; Werner, Stephan; Marchand, Virginie; Adam, Martina; Motorin, Yuri; Helm, Mark; Marx, Andreas


    Methods for the detection of RNA modifications are of fundamental importance for advancing epitranscriptomics. N 6 -methyladenosine (m 6 A) is the most abundant RNA modification in mammalian mRNA and is involved in the regulation of gene expression. Current detection techniques are laborious and rely on antibody-based enrichment of m 6 A-containing RNA prior to sequencing, since m 6 A modifications are generally "erased" during reverse transcription (RT). To overcome the drawbacks associated with indirect detection, we aimed to generate novel DNA polymerase variants for direct m 6 A sequencing. Therefore, we developed a screen to evolve an RT-active KlenTaq DNA polymerase variant that sets a mark for N 6 -methylation. We identified a mutant that exhibits increased misincorporation opposite m 6 A compared to unmodified A. Application of the generated DNA polymerase in next-generation sequencing allowed the identification of m 6 A sites directly from the sequencing data of untreated RNA samples. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  1. DNA polymerase η mutational signatures are found in a variety of different types of cancer. (United States)

    Rogozin, Igor B; Goncearenco, Alexander; Lada, Artem G; De, Subhajyoti; Yurchenko, Vyacheslav; Nudelman, German; Panchenko, Anna R; Cooper, David N; Pavlov, Youri I


    DNA polymerase (pol) η is a specialized error-prone polymerase with at least two quite different and contrasting cellular roles: to mitigate the genetic consequences of solar UV irradiation, and promote somatic hypermutation in the variable regions of immunoglobulin genes. Misregulation and mistargeting of pol η can compromise genome integrity. We explored whether the mutational signature of pol η could be found in datasets of human somatic mutations derived from normal and cancer cells. A substantial excess of single and tandem somatic mutations within known pol η mutable motifs was noted in skin cancer as well as in many other types of human cancer, suggesting that somatic mutations in A:T bases generated by DNA polymerase η are a common feature of tumorigenesis. Another peculiarity of pol ηmutational signatures, mutations in YCG motifs, led us to speculate that error-prone DNA synthesis opposite methylated CpG dinucleotides by misregulated pol η in tumors might constitute an additional mechanism of cytosine demethylation in this hypermutable dinucleotide.

  2. Hamster endogenous retrovirus (HaER) - distinct properties of structural proteins and DNA polymerase

    International Nuclear Information System (INIS)

    Goldschmied-Reouven, A.; Yaniv, A.


    The structural proteins as well as some features of the RNA-dependent DNA polymerase of the hamster endogenous retrovirus (HaER) were examined. The polypeptide pattern of this virus is substantially different from that of other known retroviruses in containing major polypeptides with molecular weights of 68000, 59000, 27000, 24000 daltons. Double antibody competitive radioimmunoassays showed that the HaER particles do not share any detectable antigenic relatedness with the murine viruses' p30, but manifest a considerable relatedness with the feline leukemia virus p27 and a slight cross-reactivity with the rat virus major protein. The RNA-dependent DNA polymerase of HaER virus has a molecular size of approximately 73000 daltons and in contrast to other mammalian retroviruses shows no significant preference for Mn 2+ over Mg 2+ . Apart from the lack of antigenic relatedness between the HaER virus proteins and the p30 protein of murine viruses, there is also no antigenic relatedness between HaER and murine viruses insofar as their DNA polymerase is concerned. (Author)

  3. Structural basis for the suppression of skin cancers by DNA polymerase [eta

    Energy Technology Data Exchange (ETDEWEB)

    Silverstein, Timothy D.; Johnson, Robert E.; Jain, Rinku; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K. (Texas-MED); (Mount Sinai Hospital)


    DNA polymerase {eta} (Pol{eta}) is unique among eukaryotic polymerases in its proficient ability for error-free replication through ultraviolet-induced cyclobutane pyrimidine dimers, and inactivation of Pol{eta} (also known as POLH) in humans causes the variant form of xeroderma pigmentosum (XPV). We present the crystal structures of Saccharomyces cerevisiae Pol{eta} (also known as RAD30) in ternary complex with a cis-syn thymine-thymine (T-T) dimer and with undamaged DNA. The structures reveal that the ability of Pol{eta} to replicate efficiently through the ultraviolet-induced lesion derives from a simple and yet elegant mechanism, wherein the two Ts of the T-T dimer are accommodated in an active site cleft that is much more open than in other polymerases. We also show by structural, biochemical and genetic analysis that the two Ts are maintained in a stable configuration in the active site via interactions with Gln55, Arg73 and Met74. Together, these features define the basis for Pol{eta}'s action on ultraviolet-damaged DNA that is crucial in suppressing the mutagenic and carcinogenic consequences of sun exposure, thereby reducing the incidence of skin cancers in humans.

  4. Single Molecule Screening of Disease DNA Without Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)


    The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

  5. Analysis of DNA interactions using single-molecule force spectroscopy. (United States)

    Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert


    Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

  6. DNA replication at the single-molecule level

    NARCIS (Netherlands)

    Stratmann, S.A.; Oijen, A.M. van


    A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or

  7. Multiplex single-molecule interaction profiling of DNA-barcoded proteins. (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M


    In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

  8. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes


    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  9. Assessing the contribution of the herpes simplex virus DNA polymerase to spontaneous mutations

    Directory of Open Access Journals (Sweden)

    Leary Jeffry J


    Full Text Available Abstract Background The thymidine kinase (tk mutagenesis assay is often utilized to determine the frequency of herpes simplex virus (HSV replication-mediated mutations. Using this assay, clinical and laboratory HSV-2 isolates were shown to have a 10- to 80-fold higher frequency of spontaneous mutations compared to HSV-1. Methods A panel of HSV-1 and HSV-2, along with polymerase-recombinant viruses expressing type 2 polymerase (Pol within a type 1 genome, were evaluated using the tk and non-HSV DNA mutagenesis assays to measure HSV replication-dependent errors and determine whether the higher mutation frequency of HSV-2 is a distinct property of type 2 polymerases. Results Although HSV-2 have mutation frequencies higher than HSV-1 in the tk assay, these errors are assay-specific. In fact, wild type HSV-1 and the antimutator HSV-1 PAAr5 exhibited a 2–4 fold higher frequency than HSV-2 in the non-HSV DNA mutatagenesis assay. Furthermore, regardless of assay, HSV-1 recombinants expressing HSV-2 Pol had error rates similar to HSV-1, whereas the high mutator virus, HSV-2 6757, consistently showed signficant errors. Additionally, plasmid DNA containing the HSV-2 tk gene, but not type 1 tk or LacZ DNA, was shown to form an anisomorphic DNA stucture. Conclusions This study suggests that the Pol is not solely responsible for the virus-type specific differences in mutation frequency. Accordingly, it is possible that (a mutations may be modulated by other viral polypeptides cooperating with Pol, and (b the localized secondary structure of the viral genome may partially account for the apparently enhanced error frequency of HSV-2.

  10. Voltage dependency of transmission probability of aperiodic DNA molecule (United States)

    Wiliyanti, V.; Yudiarsah, E.


    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  11. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation. (United States)

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw


    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  12. The role of DNA polymerase ζ in translesion synthesis across bulky DNA adducts and cross-links in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Tetsuya, E-mail: [Division of Genetics and Mutagenesis, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Grúz, Petr; Honma, Masamitsu [Division of Genetics and Mutagenesis, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Adachi, Noritaka [Graduate School of Nanobioscience, Yokohama City University, 22-2 Seto, Kanazawa-ku, Yokohama 236-0027 (Japan); Nohmi, Takehiko [Division of Genetics and Mutagenesis, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan)


    Highlights: • Human cells knockout (KO) and expressing catalytically dead (CD) variant of DNA polymerase ζ (Pol ζ) have been established by gene targeting techniques with Nalm-6 cells. • Both Pol ζ KO and CD cells displayed prolonged cell cycle and higher incidence of micronucleus formation than the wild-type cells in the absence of exogenous genotoxic treatments. • Pol ζ protects human cells from genotoxic stresses that induce bulky DNA lesions and cross-links. • Pol ζ plays quite limited roles in protection against strand-breaks in DNA. - Abstract: Translesion DNA synthesis (TLS) is a cellular defense mechanism against genotoxins. Defects or mutations in specialized DNA polymerases (Pols) involved in TLS are believed to result in hypersensitivity to various genotoxic stresses. Here, DNA polymerase ζ (Pol ζ)-deficient (KO: knockout) and Pol ζ catalytically dead (CD) human cells were established and their sensitivity towards cytotoxic activities of various genotoxins was examined. The CD cells were engineered by altering the DNA sequence encoding two amino acids essential for the catalytic activity of Pol ζ, i.e., D2781 and D2783, to alanines. Both Pol ζ KO and CD cells displayed a prolonged cell cycle and higher incidence of micronuclei formation than the wild-type (WT) cells in the absence of exogenous genotoxic treatments, and the order of abnormality was CD > KO > WT cells. Both KO and CD cells exhibited higher sensitivity towards the killing effects of benzo[a]pyrene diol epoxide, mitomycin C, potassium bromate, N-methyl-N′-nitro-N-nitrosoguanidine, and ultraviolet C irradiation than WT cells, and there were no differences between the sensitivities of KO and CD cells. Interestingly, neither KO nor CD cells were sensitive to the cytotoxic effects of hydrogen peroxide. Since KO and CD cells displayed similar sensitivities to the genotoxins, we employed only KO cells to further examine their sensitivity to other genotoxic agents. KO cells were

  13. The role of DNA polymerase ζ in translesion synthesis across bulky DNA adducts and cross-links in human cells

    International Nuclear Information System (INIS)

    Suzuki, Tetsuya; Grúz, Petr; Honma, Masamitsu; Adachi, Noritaka; Nohmi, Takehiko


    Highlights: • Human cells knockout (KO) and expressing catalytically dead (CD) variant of DNA polymerase ζ (Pol ζ) have been established by gene targeting techniques with Nalm-6 cells. • Both Pol ζ KO and CD cells displayed prolonged cell cycle and higher incidence of micronucleus formation than the wild-type cells in the absence of exogenous genotoxic treatments. • Pol ζ protects human cells from genotoxic stresses that induce bulky DNA lesions and cross-links. • Pol ζ plays quite limited roles in protection against strand-breaks in DNA. - Abstract: Translesion DNA synthesis (TLS) is a cellular defense mechanism against genotoxins. Defects or mutations in specialized DNA polymerases (Pols) involved in TLS are believed to result in hypersensitivity to various genotoxic stresses. Here, DNA polymerase ζ (Pol ζ)-deficient (KO: knockout) and Pol ζ catalytically dead (CD) human cells were established and their sensitivity towards cytotoxic activities of various genotoxins was examined. The CD cells were engineered by altering the DNA sequence encoding two amino acids essential for the catalytic activity of Pol ζ, i.e., D2781 and D2783, to alanines. Both Pol ζ KO and CD cells displayed a prolonged cell cycle and higher incidence of micronuclei formation than the wild-type (WT) cells in the absence of exogenous genotoxic treatments, and the order of abnormality was CD > KO > WT cells. Both KO and CD cells exhibited higher sensitivity towards the killing effects of benzo[a]pyrene diol epoxide, mitomycin C, potassium bromate, N-methyl-N′-nitro-N-nitrosoguanidine, and ultraviolet C irradiation than WT cells, and there were no differences between the sensitivities of KO and CD cells. Interestingly, neither KO nor CD cells were sensitive to the cytotoxic effects of hydrogen peroxide. Since KO and CD cells displayed similar sensitivities to the genotoxins, we employed only KO cells to further examine their sensitivity to other genotoxic agents. KO cells were

  14. Mechanistic Basis for the Bypass of a Bulky DNA Adduct Catalyzed by a Y-Family DNA Polymerase (United States)

    Vyas, Rajan; Efthimiopoulos, Georgia; Tokarsky, E. John; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai


    1-Nitropyrene (1-NP), an environmental pollutant, induces DNA damage in vivo and is considered to be carcinogenic. The DNA adducts formed by the 1-NP metabolites stall replicative DNA polymerases but are presumably bypassed by error-prone Y-family DNA polymerases at the expense of replication fidelity and efficiency in vivo. Our running start assays confirmed that a site-specifically placed 8-(deoxyguanosin-N2-yl)-1-aminopyrene (dG1,8), one of the DNA adducts derived from 1-NP, can be bypassed by Sulfolobus solfataricus DNA polymerase IV (Dpo4), although this representative Y-family enzyme was paused strongly by the lesion. Pre-steady-state kinetic assays were employed to determine the low nucleotide incorporation fidelity and establish a minimal kinetic mechanism for the dG1,8 bypass by Dpo4. To reveal a structural basis for dCTP incorporation opposite dG1,8, we solved the crystal structures of the complexes of Dpo4 and DNA containing a templating dG1,8 lesion in the absence or presence of dCTP. The Dpo4·DNA-dG1,8 binary structure shows that the aminopyrene moiety of the lesion stacks against the primer/template junction pair, while its dG moiety projected into the cleft between the Finger and Little Finger domains of Dpo4. In the Dpo4·DNA-dG1,8·dCTP ternary structure, the aminopyrene moiety of the dG1,8 lesion, is sandwiched between the nascent and junction base pairs, while its base is present in the major groove. Moreover, dCTP forms a Watson–Crick base pair with dG, two nucleotides upstream from the dG1,8 site, creating a complex for “-2” frameshift mutation. Mechanistically, these crystal structures provide additional insight into the aforementioned minimal kinetic mechanism. PMID:26327169

  15. Compartmentalized self-replication (CSR) selection of Thermococcus litoralis Sh1B DNA polymerase for diminished uracil binding. (United States)

    Tubeleviciute, Agne; Skirgaila, Remigijus


    The thermostable archaeal DNA polymerase Sh1B from Thermococcus litoralis has a typical uracil-binding pocket, which in nature plays an essential role in preventing the accumulation of mutations caused by cytosine deamination to uracil and subsequent G-C base pair transition to A-T during the genomic DNA replication. The uracil-binding pocket recognizes and binds uracil base in a template strand trapping the polymerase. Since DNA replication stops, the repair systems have a chance to correct the promutagenic event. Archaeal family B DNA polymerases are employed in various PCR applications. Contrary to nature, in PCR the uracil-binding property of archaeal polymerases is disadvantageous and results in decreased DNA amplification yields and lowered sensitivity. Furthermore, in diagnostics qPCR, RT-qPCR and end-point PCR are performed using dNTP mixtures, where dTTP is partially or fully replaced by dUTP. Uracil-DNA glycosylase treatment and subsequent heating of the samples is used to degrade the DNA containing uracil and prevent carryover contamination, which is the main concern in diagnostic laboratories. A thermostable archaeal DNA polymerase with the abolished uracil binding would be a highly desirable and commercially interesting product. An attempt to disable uracil binding in DNA polymerase Sh1B from T. litoralis by generating site-specific mutants did not yield satisfactory results. However, a combination of random mutagenesis of the whole polymerase gene and compartmentalized self-replication was successfully used to select variants of thermostable Sh1B polymerase capable of performing PCR with dUTP instead of dTTP.

  16. Two distinct modes of RecA action are required for DNA polymerase V-catalyzed translesion synthesis. (United States)

    Pham, Phuong; Seitz, Erica M; Saveliev, Sergei; Shen, Xuan; Woodgate, Roger; Cox, Michael M; Goodman, Myron F


    SOS mutagenesis in Escherichia coli requires DNA polymerase V (pol V) and RecA protein to copy damaged DNA templates. Here we show that two distinct biochemical modes for RecA protein are necessary for pol V-catalyzed translesion synthesis. One RecA mode is characterized by a strong stimulation in nucleotide incorporation either directly opposite a lesion or at undamaged template sites, but by the absence of lesion bypass. A separate RecA mode is necessary for translesion synthesis. The RecA1730 mutant protein, which was identified on the basis of its inability to promote pol V (UmuD'(2)C)-dependent UV-mutagenesis, appears proficient for the first mode of RecA action but is deficient in the second mode. Data are presented suggesting that the two RecA modes are "nonfilamentous". That is, contrary to current models for SOS mutagenesis, formation of a RecA nucleoprotein filament may not be required for copying damaged DNA templates. Instead, SOS mutagenesis occurs when pol V interacts with two RecA molecules, first at a 3' primer end, upstream of a template lesion, where RecA mode 1 stimulates pol V activity, and subsequently at a site immediately downstream of the lesion, where RecA mode 2 cocatalyzes lesion bypass. We posit that in vivo assembly of a RecA nucleoprotein filament may be required principally to target pol V to a site of DNA damage and to stabilize the pol V-RecA interaction at the lesion. However, it is only a RecA molecule located at the 3' filament tip, proximal to a damaged template base, that is directly responsible for translesion synthesis.

  17. Identification of an Unfolding Intermediate for a DNA Lesion Bypass Polymerase (United States)

    Sherrer, Shanen M.; Maxwell, Brian A.; Pack, Lindsey R.; Fiala, Kevin A.; Fowler, Jason D.; Zhang, Jun; Suo, Zucai


    Sulfolobus solfataricusDNA Polymerase IV (Dpo4), a prototype Y-family DNA polymerase, has been well characterized biochemically and biophysically at 37 °C or lower temperatures. However, the physiological temperature of the hyperthermophile S. solfataricus is approximately 80 °C. With such a large discrepancy in temperature, the in vivo relevance of these in vitro studies of Dpo4 has been questioned. Here, we employed circular dichroism spectroscopy and fluorescence-based thermal scanning to investigate the secondary structural changes of Dpo4 over a temperature range from 26 to 119 °C. Dpo4 was shown to display a high melting temperature characteristic of hyperthermophiles. Unexpectedly, the Little Finger domain of Dpo4, which is only found in the Y-family DNA polymerases, was shown to be more thermostable than the polymerase core. More interestingly, Dpo4 exhibited a three-state cooperative unfolding profile with an unfolding intermediate. The linker region between the Little Finger and Thumb domains of Dpo4 was found to be a source of structural instability. Through site-directed mutagenesis, the interactions between the residues in the linker region and the Palm domain were identified to play a critical role in the formation of the unfolding intermediate. Notably, the secondary structure of Dpo4 was not altered when the temperature was increased from 26 to 87.5 °C. Thus, in addition to providing structural insights into the thermal stability and an unfolding intermediate of Dpo4, our work also validated the relevance of the in vitro studies of Dpo4 performed at temperatures significantly lower than 80 °C. PMID:22667759

  18. Single-molecule studies of DNA transcription using atomic force microscopy

    International Nuclear Information System (INIS)

    Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer


    Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)

  19. Modulation of trinucleotide repeat instability by DNA polymerase β polymorphic variant R137Q.

    Directory of Open Access Journals (Sweden)

    Yaou Ren

    Full Text Available Trinucleotide repeat (TNR instability is associated with human neurodegenerative diseases and cancer. Recent studies have pointed out that DNA base excision repair (BER mediated by DNA polymerase β (pol β plays a crucial role in governing somatic TNR instability in a damage-location dependent manner. It has been shown that the activities and function of BER enzymes and cofactors can be modulated by their polymorphic variations. This could alter the function of BER in regulating TNR instability. However, the roles of BER polymorphism in modulating TNR instability remain to be elucidated. A previous study has shown that a pol β polymorphic variant, polβR137Q is associated with cancer due to its impaired polymerase activity and its deficiency in interacting with a BER cofactor, proliferating cell nuclear antigen (PCNA. In this study, we have studied the effect of the pol βR137Q variant on TNR instability. We showed that pol βR137Q exhibited weak DNA synthesis activity to cause TNR deletion during BER. We demonstrated that similar to wild-type pol β, the weak DNA synthesis activity of pol βR137Q allowed it to skip over a small loop formed on the template strand, thereby facilitating TNR deletion during BER. Our results further suggest that carriers with pol βR137Q polymorphic variant may not exhibit an elevated risk of developing human diseases that are associated with TNR instability.

  20. DNA polymerase iota (Pol ι) promotes invasion and metastasis of esophageal squamous cell carcinoma. (United States)

    Zou, Shitao; Shang, Zeng-Fu; Liu, Biao; Zhang, Shuyu; Wu, Jinchang; Huang, Min; Ding, Wei-Qun; Zhou, Jundong


    DNA polymerase iota (Pol ι) is an error-prone DNA polymerase involved in translesion DNA synthesis (TLS) that contributes to the accumulation of DNA mutations. We recently showed that Pol ι is overexpressed in human esophageal squamous cell cancer (ESCC) tissues which promotes ESCC' progression. The present study was aimed at investigating the molecular mechanisms by which Pol ι enhances the invasiveness and metastasis of ESCC cells. We found that the expression of Pol ι is significantly higher in ESCCs with lymph node metastasis compared to those without lymph node metastasis. Kaplan-Meier analysis revealed an inverse correlation between Pol ι expression and patient prognosis. The expression levels of matrix metalloproteinase-2 (MMP-2) and matrix metalloproteinase-9 (MMP-9), two essential regulators of cells' invasiveness, were positively associated with Pol ι expression in ESCC tissues. Ectopic expression of Pol ι enhanced the motility and invasiveness of ESCC cells as evaluated by wound-healing and transwell assays, respectively. A xenograft nude mouse model showed that Pol ι promotes the colonization of ESCC cells in the liver, lung and kidney. Signaling pathway analysis identified the JNK-AP-1 cascade as a mediator of the Pol ι-induced increase in the expression of MMP-2/9 and enhancement of ESCC progression. These data demonstrate the underlying mechanism by which Pol ι promotes ESCC progression, suggesting that Pol ι is a potential novel prognostic biomarker and therapeutic target for ESCC.

  1. Single Molecule Study of DNA Organization and Recombination (United States)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

  2. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W


    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  3. Fidelity and Mutational Spectrum of Pfu DNA Polymerase on a Human Mitochondrial DNA Sequence (United States)

    André, Paulo; Kim, Andrea; Khrapko, Konstantin; Thilly, William G.


    The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10−6 must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or “PCR noise”. Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 × 10−7, and five of its more frequent mutations (hot spots) consisted of three transversions (GC → TA, AT → TA, and AT → CG), one transition (AT → GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be

  4. Dideoxynucleoside triphosphate-sensitive DNA polymerase from rice is involved in base excision repair and immunologically similar to mammalian DNA pol beta. (United States)

    Sarkar, Sailendra Nath; Bakshi, Sankar; Mokkapati, Sanath K; Roy, Sujit; Sengupta, Dibyendu N


    A single polypeptide with ddNTP-sensitive DNA polymerase activity was purified to near homogeneity from the shoot tips of rice seedlings and analysis of the preparations by SDS-PAGE followed by silver staining showed a polypeptide of 67 kDa size. The DNA polymerase activity was found to be inhibitory by ddNTP in both in vitro DNA polymerase activity assay and activity gel analysis. Aphidicolin, an inhibitor of other types of DNA polymerases, had no effect on plant enzyme. The 67 kDa rice DNA polymerase was found to be recognized by the polyclonal antibody (purified IgG) made against rat DNA polymerase beta (pol beta) both in solution and also on Western blot. The recognition was found to be very specific as the activity of Klenow enzyme was unaffected by the antibody. The ability of rice nuclear extract to correct G:U mismatch of oligo-duplex was observed when oligo-duplex with 32P-labeled lower strand containing U (at 22nd position) was used as substrate. Differential appearance of bands at 21-mer, 22-mer, and 51-mer position in presence of dCTP was visible only with G:U mismatch oligo-duplex, but not with G:C oligo-duplex. While ddCTP or polyclonal antibody against rat-DNA pol beta inhibits base excision repair (BER), aphidicolin had no effect. These results for the first time clearly demonstrate the ability of rice nuclear extract to run BER and the involvement of ddNTP-sensitive pol beta type DNA polymerase. Immunological similarity of the ddNTP-sensitive DNA polymerase beta of rice and rat and its involvement in BER revealed the conservation of structure and function of ddNTP-sensitive DNA pol beta in plant and animal.

  5. The generation of radiolabeled DNA and RNA probes with polymerase chain reaction

    International Nuclear Information System (INIS)

    Schowalter, D.B.; Sommer, S.S.


    By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence

  6. RNA polymerase gate loop guides the nontemplate DNA strand in transcription complexes. (United States)

    NandyMazumdar, Monali; Nedialkov, Yuri; Svetlov, Dmitri; Sevostyanova, Anastasia; Belogurov, Georgiy A; Artsimovitch, Irina


    Upon RNA polymerase (RNAP) binding to a promoter, the σ factor initiates DNA strand separation and captures the melted nontemplate DNA, whereas the core enzyme establishes interactions with the duplex DNA in front of the active site that stabilize initiation complexes and persist throughout elongation. Among many core RNAP elements that participate in these interactions, the β' clamp domain plays the most prominent role. In this work, we investigate the role of the β gate loop, a conserved and essential structural element that lies across the DNA channel from the clamp, in transcription regulation. The gate loop was proposed to control DNA loading during initiation and to interact with NusG-like proteins to lock RNAP in a closed, processive state during elongation. We show that the removal of the gate loop has large effects on promoter complexes, trapping an unstable intermediate in which the RNAP contacts with the nontemplate strand discriminator region and the downstream duplex DNA are not yet fully established. We find that although RNAP lacking the gate loop displays moderate defects in pausing, transcript cleavage, and termination, it is fully responsive to the transcription elongation factor NusG. Together with the structural data, our results support a model in which the gate loop, acting in concert with initiation or elongation factors, guides the nontemplate DNA in transcription complexes, thereby modulating their regulatory properties.

  7. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction. (United States)

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid


    Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  8. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Samira Mohammadi


    Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  9. Limited ability of DNA polymerase kappa to suppress benzo[a]pyrene-induced genotoxicity in vivo. (United States)

    Masumura, Kenichi; Toyoda-Hokaiwado, Naomi; Niimi, Naoko; Grúz, Petr; Wada, Naoko A; Takeiri, Akira; Jishage, Kou-Ichi; Mishima, Masayuki; Nohmi, Takehiko


    DNA polymerase kappa (Polk) is a specialized DNA polymerase involved in translesion DNA synthesis. To understand the protective roles against genotoxins in vivo, we established inactivated Polk knock-in gpt delta (inactivated Polk KI) mice that possessed reporter genes for mutations and expressed inactive Polk. In this study, we examined genotoxicity of benzo[a]pyrene (BP) to determine whether Polk actually suppressed BP-induced genotoxicity as predicted by biochemistry and in vitro cell culture studies. Seven-week-old inactivated Polk KI and wild-type (WT) mice were treated with BP at doses of 5, 15, or 50 mg/(kg·day) for three consecutive days by intragastric gavage, and mutations in the colon and micronucleus formation in the peripheral blood were examined. Surprisingly, no differences were observed in the frequencies of mutations and micronucleus formation at 5 or 50 mg/kg doses. Inactivated Polk KI mice exhibited approximately two times higher gpt mutant frequency than did WT mice only at the 15 mg/kg dose. The frequency of micronucleus formation was slightly higher in inactivated Polk KI than in WT mice at the same dose, but it was statistically insignificant. The results suggest that Polk has a limited ability to suppress BP-induced genotoxicity in the colon and bone marrow and also that the roles of specialized DNA polymerases in mutagenesis and carcinogenesis should be examined not only by in vitro assays but also by in vivo mouse studies. We also report the spontaneous mutagenesis in inactivated Polk KI mice at young and old ages. Environ. Mol. Mutagen. 58:644-653, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  10. Inhibition of DNA glycosylases via small molecule purine analogs.

    Directory of Open Access Journals (Sweden)

    Aaron C Jacobs

    Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.

  11. Structural and kinetic insights into binding and incorporation of L-nucleotide analogs by a Y-family DNA polymerase


    Gaur, Vineet; Vyas, Rajan; Fowler, Jason D.; Efthimiopoulos, Georgia; Feng, Joy Y.; Suo, Zucai


    Considering that all natural nucleotides (D-dNTPs) and the building blocks (D-dNMPs) of DNA chains possess D-stereochemistry, DNA polymerases and reverse transcriptases (RTs) likely possess strongD-stereoselectivity by preferably binding and incorporating D-dNTPs over unnatural L-dNTPs during DNA synthesis. Surprisingly, a structural basis for the discrimination against L-dNTPs by DNA polymerases or RTs has not been established although L-deoxycytidine analogs (lamivudine and emtricitabine) a...

  12. DNA polymerase-beta is expressed early in neurons of Alzheimer's disease brain and is loaded into DNA replication forks in neurons challenged with beta-amyloid

    NARCIS (Netherlands)

    Copani, Agata; Hoozemans, Jeroen J. M.; Caraci, Filippo; Calafiore, Marco; van Haastert, Elise S.; Veerhuis, Robert; Rozemuller, Annemieke J. M.; Aronica, Eleonora; Sortino, Maria Angela; Nicoletti, Ferdinando


    Cultured neurons exposed to synthetic beta-amyloid (Abeta) fragments reenter the cell cycle and initiate a pathway of DNA replication that involves the repair enzyme DNA polymerase-beta (DNA pol-beta) before undergoing apoptotic death. In this study, by performing coimmunoprecipitation experiments

  13. Overproduction of the poly(ADP-ribose)polymerase DNA-binding domain blocks alkylation-induced DNA repair synthesis in mammalian cells.

    NARCIS (Netherlands)

    M. Molinete; W. Vermeulen (Wim); A. Bürkle; J. Mé nissier-de Murcia; J.H. Küpper; J.H.J. Hoeijmakers (Jan); G. de Murcia


    textabstractThe zinc-finger DNA-binding domain (DBD) of poly (ADP-ribose) polymerase (PARP, EC specifically recognizes DNA strand breaks induced by various DNA-damaging agents in eukaryotes. This, in turn, triggers the synthesis of polymers of ADP-ribose linked to nuclear proteins during

  14. The Effects of Magnesium Ions on the Enzymatic Synthesis of Ligand-Bearing Artificial DNA by Template-Independent Polymerase

    Directory of Open Access Journals (Sweden)

    Yusuke Takezawa


    Full Text Available A metal-mediated base pair, composed of two ligand-bearing nucleotides and a bridging metal ion, is one of the most promising components for developing DNA-based functional molecules. We have recently reported an enzymatic method to synthesize hydroxypyridone (H-type ligand-bearing artificial DNA strands. Terminal deoxynucleotidyl transferase (TdT, a template-independent DNA polymerase, was found to oligomerize H nucleotides to afford ligand-bearing DNAs, which were subsequently hybridized through copper-mediated base pairing (H–CuII–H. In this study, we investigated the effects of a metal cofactor, MgII ion, on the TdT-catalyzed polymerization of H nucleotides. At a high MgII concentration (10 mM, the reaction was halted after several H nucleotides were appended. In contrast, at lower MgII concentrations, H nucleotides were further appended to the H-tailed product to afford longer ligand-bearing DNA strands. An electrophoresis mobility shift assay revealed that the binding affinity of TdT to the H-tailed DNAs depends on the MgII concentration. In the presence of excess MgII ions, TdT did not bind to the H-tailed strands; thus, further elongation was impeded. This is possibly because the interaction with MgII ions caused folding of the H-tailed strands into unfavorable secondary structures. This finding provides an insight into the enzymatic synthesis of longer ligand-bearing DNA strands.

  15. Single-molecule denaturation mapping of DNA in nanofluidic channels

    DEFF Research Database (Denmark)

    Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli


    Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

  16. DNA polymerase η modulates replication fork progression and DNA damage responses in platinum-treated human cells (United States)

    Sokol, Anna M.; Cruet-Hennequart, Séverine; Pasero, Philippe; Carty, Michael P.


    Human cells lacking DNA polymerase η (polη) are sensitive to platinum-based cancer chemotherapeutic agents. Using DNA combing to directly investigate the role of polη in bypass of platinum-induced DNA lesions in vivo, we demonstrate that nascent DNA strands are up to 39% shorter in human cells lacking polη than in cells expressing polη. This provides the first direct evidence that polη modulates replication fork progression in vivo following cisplatin and carboplatin treatment. Severe replication inhibition in individual platinum-treated polη-deficient cells correlates with enhanced phosphorylation of the RPA2 subunit of replication protein A on serines 4 and 8, as determined using EdU labelling and immunofluorescence, consistent with formation of DNA strand breaks at arrested forks in the absence of polη. Polη-mediated bypass of platinum-induced DNA lesions may therefore represent one mechanism by which cancer cells can tolerate platinum-based chemotherapy.

  17. The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

    International Nuclear Information System (INIS)

    Shen Zigang; Huang Yibo; Li Bin; Zhang Yi


    Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

  18. Competitive fitness during feast and famine: how SOS DNA polymerases influence physiology and evolution in Escherichia coli. (United States)

    Corzett, Christopher H; Goodman, Myron F; Finkel, Steven E


    Escherichia coli DNA polymerases (Pol) II, IV, and V serve dual roles by facilitating efficient translesion DNA synthesis while simultaneously introducing genetic variation that can promote adaptive evolution. Here we show that these alternative polymerases are induced as cells transition from exponential to long-term stationary-phase growth in the absence of induction of the SOS regulon by external agents that damage DNA. By monitoring the relative fitness of isogenic mutant strains expressing only one alternative polymerase over time, spanning hours to weeks, we establish distinct growth phase-dependent hierarchies of polymerase mutant strain competitiveness. Pol II confers a significant physiological advantage by facilitating efficient replication and creating genetic diversity during periods of rapid growth. Pol IV and Pol V make the largest contributions to evolutionary fitness during long-term stationary phase. Consistent with their roles providing both a physiological and an adaptive advantage during stationary phase, the expression patterns of all three SOS polymerases change during the transition from log phase to long-term stationary phase. Compared to the alternative polymerases, Pol III transcription dominates during mid-exponential phase; however, its abundance decreases to SOS induction by exogenous agents and indicate that cell populations require appropriate expression of all three alternative DNA polymerases during exponential, stationary, and long-term stationary phases to attain optimal fitness and undergo adaptive evolution.

  19. Isothermal Recombinase Polymerase amplification (RPA) of Schistosoma haematobium DNA and oligochromatographic lateral flow detection. (United States)

    Rosser, A; Rollinson, D; Forrest, M; Webster, B L


    Accurate diagnosis of urogenital schistosomiasis is vital for surveillance/control programs. Amplification of schistosome DNA in urine by PCR is sensitive and specific but requires infrastructure, financial resources and skilled personnel, often not available in endemic areas. Recombinase Polymerase Amplification (RPA) is an isothermal DNA amplification/detection technology that is simple, rapid, portable and needs few resources. Here a Schistosoma haematobium RPA assay was developed and adapted so that DNA amplicons could be detected using oligochromatographic Lateral Flow (LF) strips. The assay successfully amplified S. haematobium DNA at 30-45 °C in 10 mins and was sensitive to a lower limit of 100 fg of DNA. The assay was also successful with the addition of crude urine, up to 5% of the total reaction volume. Cross amplification occurred with other schistosome species but not with other common urine microorganisms. The LF-RPA assay developed here can amplify and detect low levels of S. haematobium DNA. Reactions are rapid, require low temperatures and positive reactions are interpreted using lateral flow strips, reducing the need for infrastructure and resources. This together with an ability to withstand inhibitors within urine makes RPA a promising technology for further development as a molecular diagnostic tool for urogenital schistosomiasis.

  20. Structures of RNA Polymerase Closed and Intermediate Complexes Reveal Mechanisms of DNA Opening and Transcription Initiation. (United States)

    Glyde, Robert; Ye, Fuzhou; Darbari, Vidya Chandran; Zhang, Nan; Buck, Martin; Zhang, Xiaodong


    Gene transcription is carried out by RNA polymerases (RNAPs). For transcription to occur, the closed promoter complex (RPc), where DNA is double stranded, must isomerize into an open promoter complex (RPo), where the DNA is melted out into a transcription bubble and the single-stranded template DNA is delivered to the RNAP active site. Using a bacterial RNAP containing the alternative σ 54 factor and cryoelectron microscopy, we determined structures of RPc and the activator-bound intermediate complex en route to RPo at 3.8 and 5.8 Å. Our structures show how RNAP-σ 54 interacts with promoter DNA to initiate the DNA distortions required for transcription bubble formation, and how the activator interacts with RPc, leading to significant conformational changes in RNAP and σ 54 that promote RPo formation. We propose that DNA melting is an active process initiated in RPc and that the RNAP conformations of intermediates are significantly different from that of RPc and RPo. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I. (United States)

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A


    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  2. Characterization of a Y-Family DNA Polymerase eta from the Eukaryotic Thermophile Alvinella pompejana (United States)

    Kashiwagi, Sayo; Kuraoka, Isao; Fujiwara, Yoshie; Hitomi, Kenichi; Cheng, Quen J.; Fuss, Jill O.; Shin, David S.; Masutani, Chikahide; Tainer, John A.; Hanaoka, Fumio; Iwai, Shigenori


    Human DNA polymerase η (HsPolη) plays an important role in translesion synthesis (TLS), which allows for replication past DNA damage such as UV-induced cis-syn cyclobutane pyrimidine dimers (CPDs). Here, we characterized ApPolη from the thermophilic worm Alvinella pompejana, which inhabits deep-sea hydrothermal vent chimneys. ApPolη shares sequence homology with HsPolη and contains domains for binding ubiquitin and proliferating cell nuclear antigen. Sun-induced UV does not penetrate Alvinella's environment; however, this novel DNA polymerase catalyzed efficient and accurate TLS past CPD, as well as 7,8-dihydro-8-oxoguanine and isomers of thymine glycol induced by reactive oxygen species. In addition, we found that ApPolη is more thermostable than HsPolη, as expected from its habitat temperature. Moreover, the activity of this enzyme was retained in the presence of a higher concentration of organic solvents. Therefore, ApPolη provides a robust, human-like Polη that is more active after exposure to high temperatures and organic solvents. PMID:20936172

  3. Cell cycle regulation of DNA polymerase beta in rotenone-based Parkinson's disease models.

    Directory of Open Access Journals (Sweden)

    Hongcai Wang

    Full Text Available In Parkinson's disease (PD, neuronal cells undergo mitotic catastrophe and endoreduplication prior to cell death; however, the regulatory mechanisms remain to be defined. In this study, we investigated cell cycle regulation of DNA polymerase β (poly β in rotenone-based dopaminergic cellular and animal models. Incubation with a low concentration (0.25 µM of rotenone for 1.5 to 7 days resulted in a flattened cell body and decreased DNA replication during S phase, whereas a high concentration (2 µM of rotenone exposure resulted in enlarged, multi-nucleated cells and converted the mitotic cycle into endoreduplication. Consistently, DNA poly β, which is mainly involved in DNA repair synthesis, was upregulated to a high level following exposure to 2 µM rotenone. The abrogation of DNA poly β by siRNA transfection or dideoxycytidine (DDC treatment attenuated the rotenone-induced endoreduplication. The cell cycle was reactivated in cyclin D-expressing dopaminergic neurons from the substantia nigra (SN of rats following stereotactic (ST infusion of rotenone. Increased DNA poly β expression was observed in the substantia nigra pars compacta (SNc and the substantia nigra pars reticulate (SNr of rotenone-treated rats. Collectively, in the in vitro model of rotenone-induced mitotic catastrophe, the overexpression of DNA poly β promotes endoreduplication; in the in vivo model, the upregulation of DNA poly β and cell cycle reentry were also observed in the adult rat substantia nigra. Therefore, the cell cycle regulation of DNA poly β may be involved in the pathological processes of PD, which results in the induction of endoreduplication.

  4. Defect of Fe-S cluster binding by DNA polymerase δ in yeast suppresses UV-induced mutagenesis, but enhances DNA polymerase ζ - dependent spontaneous mutagenesis. (United States)

    Stepchenkova, E I; Tarakhovskaya, E R; Siebler, H M; Pavlov, Y I


    Eukaryotic genomes are duplicated by a complex machinery, utilizing high fidelity replicative B-family DNA polymerases (pols) α, δ and ε. Specialized error-prone pol ζ, the fourth B-family member, is recruited when DNA synthesis by the accurate trio is impeded by replication stress or DNA damage. The damage tolerance mechanism dependent on pol ζ prevents DNA/genome instability and cell death at the expense of increased mutation rates. The pol switches occurring during this specialized replication are not fully understood. The loss of pol ζ results in the absence of induced mutagenesis and suppression of spontaneous mutagenesis. Disruption of the Fe-S cluster motif that abolish the interaction of the C-terminal domain (CTD) of the catalytic subunit of pol ζ with its accessory subunits, which are shared with pol δ, leads to a similar defect in induced mutagenesis. Intriguingly, the pol3-13 mutation that affects the Fe-S cluster in the CTD of the catalytic subunit of pol δ also leads to defective induced mutagenesis, suggesting the possibility that Fe-S clusters are essential for the pol switches during replication of damaged DNA. We confirmed that yeast strains with the pol3-13 mutation are UV-sensitive and defective in UV-induced mutagenesis. However, they have increased spontaneous mutation rates. We found that this increase is dependent on functional pol ζ. In the pol3-13 mutant strain with defective pol δ, there is a sharp increase in transversions and complex mutations, which require functional pol ζ, and an increase in the occurrence of large deletions, whose size is controlled by pol ζ. Therefore, the pol3-13 mutation abrogates pol ζ-dependent induced mutagenesis, but allows for pol ζ recruitment for the generation of spontaneous mutations and prevention of larger deletions. These results reveal differential control of the two major types of pol ζ-dependent mutagenesis by the Fe-S cluster present in replicative pol δ. Copyright © 2016

  5. Pyrovanadolysis: a Pyrophosphorolysis-like Reaction Mediated by Pyrovanadate MN2plus and DNA Polymerase of Bacteriophage T7

    Energy Technology Data Exchange (ETDEWEB)

    B Akabayov; A Kulczyk; S Akabayov; C Thiele; L McLaughlin; B Beauchamp; C Richardson


    DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PP{sub i}). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry of the oxygen connecting the two phosphorus atoms of PP{sub i}, a variety of compounds was examined for their ability to carry out a reaction similar to pyrophosphorolysis. We describe a manganese-mediated pyrophosphorolysis-like activity using pyrovanadate (VV) catalyzed by the DNA polymerase of bacteriophage T7. We designate this reaction pyrovanadolysis. X-ray absorption spectroscopy reveals a shorter Mn-V distance of the polymerase-VV complex than the Mn-P distance of the polymerase-PP{sub i} complex. This structural arrangement at the active site accounts for the enzymatic activation by Mn-VV. We propose that the Mn{sup 2+}, larger than Mg{sup 2+}, fits the polymerase active site to mediate binding of VV into the active site of the polymerase. Our results may be the first documentation that vanadium can substitute for phosphorus in biological processes.

  6. Effect of human cell malignancy on activity of DNA polymerase iota. (United States)

    Kazakov, A A; Grishina, E E; Tarantul, V Z; Gening, L V


    An increased level of mutagenesis, partially caused by imbalanced activities of error prone DNA polymerases, is a key symptom of cell malignancy. To clarify the possible role of incorrect DNA polymerase iota (Pol iota) function in increased frequency of mutations in mammalian cells, the activity of this enzyme in extracts of cells of different mouse organs and human eye (melanoma) and eyelid (basal-cell skin carcinoma) tumor cells was studied. Both Mg2+, considered as the main activator of the enzyme reaction of in vivo DNA replication, and Mn2+, that activates homogeneous Pol iota preparations in experiments in vitro more efficiently compared to all other bivalent cations, were used as cofactors of the DNA polymerase reaction in these experiments. In the presence of Mg2+, the enzyme was active only in cell extracts of mouse testicles and brain, whereas in the presence of Mn2+ the activity of Pol iota was found in all studied normal mouse organs. It was found that in cell extracts of both types of malignant tumors (basal-cell carcinoma and melanoma) Pol iota activity was observed in the presence of either Mn2+ or Mg2+. Manganese ions activated Pol iota in both cases, though to a different extent. In the presence of Mn2+ the Pol iota activity in the basal-cell carcinoma exceeded 2.5-fold that in control cells (benign tumors from the same eyelid region). In extracts of melanoma cells in the presence of either cation, the level of the enzyme activity was approximately equal to that in extracts of cells of surrounding tumor-free tissues as well as in eyes removed after traumas. The distinctive feature of tissue malignancy (in basal-cell carcinoma and in melanoma) was the change in DNA synthesis revealed as Mn2+-activated continuation of DNA synthesis after incorrect incorporation of dG opposite dT in the template by Pol iota. Among cell extracts of different normal mouse organs, only those of testicles exhibited a similar feature. This similarity can be explained by

  7. Effects of two different high-fidelity DNA polymerases on genetic analysis of the cyanobacterial community structure in a subtropical deep freshwater reservoir

    DEFF Research Database (Denmark)

    Zhen, Zhuo; Liu, Jingwen; Rensing, Christopher Günther T


    and diversity analysis. In this study, two clone libraries were constructed with two different DNA polymerases, Q5 high-fidelity DNA polymerase and exTaq polymerase, to compare the differences in their capability to accurately reflect the cyanobacterial community structure and diversity in a subtropical deep......-fidelity DNA polymerase. It is noteworthy that so far Q5 high-fidelity DNA polymerase was the first time to be employed in the genetic analysis of cyanobacterial community. And it is for the first time that the cyanobacterial community structure in Dongzhen reservoir was analyzed using molecular methods...

  8. Single molecule DNA detection with an atomic vapor notch filter

    Energy Technology Data Exchange (ETDEWEB)

    Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)


    The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)

  9. Single molecule imaging of RNA polymerase II using atomic force microscopy

    International Nuclear Information System (INIS)

    Rhodin, Thor; Fu Jianhua; Umemura, Kazuo; Gad, Mohammed; Jarvis, Suzi; Ishikawa, Mitsuru


    An atomic force microscopy (AFM) study of the shape, orientation and surface topology of RNA polymerase II supported on silanized freshly cleaved mica was made. The overall aim is to define the molecular topology of RNA polymerase II in appropriate fluids to help clarify the relationship of conformational features to biofunctionality. A Nanoscope III atomic force microscope was used in the tapping mode with oxide-sharpened (8-10 nm) Si 3 N 4 probes in aqueous zinc chloride buffer. The main structural features observed by AFM were compared to those derived from electron-density plots based on X-ray crystallographic studies. The conformational features included a bilobal silhouette with an inverted umbrella-shaped crater connected to a reaction site. These studies provide a starting point for constructing a 3D-AFM profiling analysis of proteins such as RNA polymerase complexes

  10. DNA polymerase hybrids derived from the family-B enzymes of Pyrococcus furiosus and Thermococcus kodakarensis: improving performance in the polymerase chain reaction. (United States)

    Elshawadfy, Ashraf M; Keith, Brian J; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A


    The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the "forked-point" (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the "forked-point" and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms.

  11. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota. (United States)

    Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I


    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  12. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Directory of Open Access Journals (Sweden)

    Alena V Makarova


    Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  13. Overexpressed DNA polymerase iota regulated by JNK/c-Jun contributes to hypermutagenesis in bladder cancer. (United States)

    Yuan, Fang; Xu, Zhigang; Yang, Mingzhen; Wei, Quanfang; Zhang, Yi; Yu, Jin; Zhi, Yi; Liu, Yang; Chen, Zhiwen; Yang, Jin


    Human DNA polymerase iota (pol ι) possesses high error-prone DNA replication features and performs translesion DNA synthesis. It may be specialized and strictly regulated in normal mammalian cells. Dysregulation of pol ι may contribute to the acquisition of a mutator phenotype. However, there are few reports describing the transcription regulatory mechanism of pol ι, and there is controversy regarding its role in carcinogenesis. In this study, we performed the deletion and point-mutation experiment, EMSA, ChIP, RNA interference and western blot assay to prove that c-Jun activated by c-Jun N-terminal kinase (JNK) regulates the transcription of pol ι in normal and cancer cells. Xeroderma pigmentosum group C protein (XPC) and ataxia-telangiectasia mutated related protein (ATR) promote early JNK activation in response to DNA damage and consequently enhance the expression of pol ι, indicating that the novel role of JNK signal pathway is involved in DNA damage response. Furthermore, associated with elevated c-Jun activity, the overexpression of pol ι is positively correlated with the clinical tumor grade in 97 bladder cancer samples and may contribute to the hypermutagenesis. The overexpressed pol ι-involved mutagenesis is dependent on JNK/c-Jun pathway in bladder cancer cells identifying by the special mutation spectra. Our results support the conclusion that dysregulation of pol ι by JNK/c-Jun is involved in carcinogenesis and offer a novel understanding of the role of pol ι or c-Jun in mutagenesis.

  14. Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast

    International Nuclear Information System (INIS)

    Lin, Y.H.; Keil, R.L.


    HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination

  15. A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

    KAUST Repository

    Law, Julie A.


    DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

  16. A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

    KAUST Repository

    Law, Julie A.; Ausí n, Israel; Johnson, Lianna M.; Vashisht, Ajay  A Amar; Zhu, Jian-Kang; Wohlschlegel, James  A A.; Jacobsen, Steven E.


    DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

  17. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet


    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  18. A study on interaction of DNA molecules and carbon nanotubes for an effective ejection of the molecules

    International Nuclear Information System (INIS)

    Wu, N.; Wang, Q.


    The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.

  19. Analysis of UV-induced mutation spectra in Escherichia coli by DNA polymerase {eta} from Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Santiago, Maria Jesus [Departamento de Genetica, Facultad de Ciencias, Edificio Gregor Mendel, Campus Rabanales, Universidad de Cordoba (Spain); Alejandre-Duran, Encarna [Departamento de Genetica, Facultad de Ciencias, Edificio Gregor Mendel, Campus Rabanales, Universidad de Cordoba (Spain); Ruiz-Rubio, Manuel [Departamento de Genetica, Facultad de Ciencias, Edificio Gregor Mendel, Campus Rabanales, Universidad de Cordoba (Spain)]. E-mail:


    DNA polymerase {eta} belongs to the Y-family of DNA polymerases, enzymes that are able to synthesize past template lesions that block replication fork progression. This polymerase accurately bypasses UV-associated cis-syn cyclobutane thymine dimers in vitro and therefore may contributes to resistance against sunlight in vivo, both ameliorating survival and decreasing the level of mutagenesis. We cloned and sequenced a cDNA from Arabidopsis thaliana which encodes a protein containing several sequence motifs characteristics of Pol{eta} homologues, including a highly conserved sequence reported to be present in the active site of the Y-family DNA polymerases. The gene, named AtPOLH, contains 14 exons and 13 introns and is expressed in different plant tissues. A strain from Saccharomyces cerevisiae, deficient in Pol{eta} activity, was transformed with a yeast expression plasmid containing the AtPOLH cDNA. The rate of survival to UV irradiation in the transformed mutant increased to similar values of the wild type yeast strain, showing that AtPOLH encodes a functional protein. In addition, when AtPOLH is expressed in Escherichia coli, a change in the mutational spectra is detected when bacteria are irradiated with UV light. This observation might indicate that AtPOLH could compete with DNA polymerase V and then bypass cyclobutane pyrimidine dimers incorporating two adenylates.

  20. Carborane-linked 2'-deoxyuridine 5'-O-triphosphate as building block for polymerase synthesis of carborane-modified DNA. (United States)

    Balintová, Jana; Simonova, Anna; Białek-Pietras, Magdalena; Olejniczak, Agnieszka; Lesnikowski, Zbigniew J; Hocek, Michal


    5-[(p-Carborane-2-yl)ethynyl]-2'-deoxyuridine 5'-O-triphosphate was synthesized and used as a good substrate in enzymatic construction of carborane-modified DNA or oligonucleotides containing up to 21 carborane moieties in primer extension reactions by DNA polymerases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Involvement of DNA polymerase beta in repair of ionizing radiation damage as measured by in vitro plasmid assays.

    NARCIS (Netherlands)

    Vens, C.; Hofland, I.; Begg, A.C.


    Characteristic of damage introduced in DNA by ionizing radiation is the induction of a wide range of lesions. Single-strand breaks (SSBs) and base damages outnumber double-strand breaks (DSBs). If unrepaired, these lesions can lead to DSBs and increased mutagenesis. XRCC1 and DNA polymerase beta

  2. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    International Nuclear Information System (INIS)

    Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van


    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

  3. RNA-DNA Differences Are Generated in Human Cells within Seconds after RNA Exits Polymerase II

    Directory of Open Access Journals (Sweden)

    Isabel X. Wang


    Full Text Available RNA sequences are expected to be identical to their corresponding DNA sequences. Here, we found all 12 types of RNA-DNA sequence differences (RDDs in nascent RNA. Our results show that RDDs begin to occur in RNA chains ∼55 nt from the RNA polymerase II (Pol II active site. These RDDs occur so soon after transcription that they are incompatible with known deaminase-mediated RNA-editing mechanisms. Moreover, the 55 nt delay in appearance indicates that they do not arise during RNA synthesis by Pol II or as a direct consequence of modified base incorporation. Preliminary data suggest that RDD and R-loop formations may be coupled. These findings identify sequence substitution as an early step in cotranscriptional RNA processing.

  4. Mammalian α-polymerase: cloning of partial complementary DNA and immunobinding of catalytic subunit in crude homogenate protein blots

    International Nuclear Information System (INIS)

    SenGupta, D.N.; Kumar, P.; Zmudzka, B.Z.; Coughlin, S.; Vishwanatha, J.K.; Robey, F.A.; Parrott, C.; Wilson, S.H.


    A new polyclonal antibody against the α-polymerase catalytic polypeptide was prepared by using homogeneous HeLa cellα-polymerase. The antibody neutralized α-polymerase activity and was strong and specific for the α-polymerase catalytic polypeptide (M/sub r/ 183,000) in Western blot analysis of crude extracts of HeLa cells. The antibody was used to screen a cDNA library of newborn rat brain poly(A+) RNA in λgt11. A positive phage was identified and plaque purified. This phage, designated λpolα1.2, also was found to be positive with an antibody against Drosophila α-polymerase. The insert in λpolα1.2 (1183 base pairs) contained a poly(A) sequence at the 3' terminus and a short in-phase open reading frame at the 5' terminus. A synthetic oligopeptide (eight amino acids) corresponding to the open reading frame was used to raise antiserum in rabbits. Antibody affinity purified from this serum was found to be immunoreactive against purified α-polymerase by enzyme-linked immunosorbent assay and was capable of immunoprecipitating α-polymerase. This indicated the λpolα1.2 insert encoded an α-polymerase epitope and suggested that the cDNA corresponded to an α-polymerase mRNA. This was confirmed in hybrid selection experiments using pUC9 containing the cDNA insert and poly(A+) RNA from newborn rat brain; the insert hybridized to mRNA capable of encoding α-polymerase catalytic polypeptides. Northern blot analysis of rat brain poly(A+) RNA revealed that this mRNA is ∼5.4 kilobases

  5. Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy. (United States)

    Hengel, Sarah R; Spies, M Ashley; Spies, Maria


    To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Strand Displacement by DNA Polymerase III Occurs through a τ-ψ-χ Link to Single-stranded DNA-binding Protein Coating the Lagging Strand Template*


    Yuan, Quan; McHenry, Charles S.


    In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of γ-complex to support the reaction in the absence of τ. However, if γ-complex is p...

  7. Mechanism of error-free DNA synthesis across N1-methyl-deoxyadenosine by human DNA polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Jain, Rinku; Choudhury, Jayati Roy; Buku, Angeliki; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.


    N1-methyl-deoxyadenosine (1-MeA) is formed by methylation of deoxyadenosine at the N1 atom. 1-MeA presents a block to replicative DNA polymerases due to its inability to participate in Watson-Crick (W-C) base pairing. Here we determine how human DNA polymerase-ι (Polι) promotes error-free replication across 1-MeA. Steady state kinetic analyses indicate that Polι is ~100 fold more efficient in incorporating the correct nucleotide T versus the incorrect nucleotide C opposite 1-MeA. To understand the basis of this selectivity, we determined ternary structures of Polι bound to template 1-MeA and incoming dTTP or dCTP. In both structures, template 1-MeA rotates to the syn conformation but pairs differently with dTTP versus dCTP. Thus, whereas dTTP partakes in stable Hoogsteen base pairing with 1-MeA, dCTP fails to gain a “foothold” and is largely disordered. Together, our kinetic and structural studies show how Polι maintains discrimination between correct and incorrect incoming nucleotide opposite 1-MeA in preserving genome integrity.

  8. Accessibility of. gamma. -ray induced primer toward DNA polymerase I of Escherichia coli during soaking of barley seed

    Energy Technology Data Exchange (ETDEWEB)

    Yamaguchi, H; Tatara, A; Naito, T [Tokyo Univ. (Japan). Faculty of Agriculture


    After dry barley seeds were irradiated with ..gamma..-rays and soaked for various times, the squashed preparations were made of the first leaf meristems and incubated with E.coli DNA polymerase I with appropriate substrates. The incorporation of nucleotides with DNA polymerase occurred in the cells fixed at late G/sub 1/ after 15 kR and at middle and late G/sub 1/ after 30 kR, respectively. There was an interrelation between the incorporation of nucleotides by DNA polymerase and the chromatin diffusion throughout a nucleus. The observations were interpreted in terms of the accessibility of 3'-0H groups of DNA breaks which accompanies the change of the conformation of chromatin fibres.

  9. Following DNA chain extension and protein conformational changes in crystals of a Y-family DNA polymerase via Raman crystallography. (United States)

    Espinoza-Herrera, Shirly J; Gaur, Vineet; Suo, Zucai; Carey, Paul R


    Y-Family DNA polymerases are known to bypass DNA lesions in vitro and in vivo. Sulfolobus solfataricus DNA polymerase (Dpo4) was chosen as a model Y-family enzyme for investigating the mechanism of DNA synthesis in single crystals. Crystals of Dpo4 in complexes with DNA (the binary complex) in the presence or absence of an incoming nucleotide were analyzed by Raman microscopy. (13)C- and (15)N-labeled d*CTP, or unlabeled dCTP, were soaked into the binary crystals with G as the templating base. In the presence of the catalytic metal ions, Mg(2+) and Mn(2+), nucleotide incorporation was detected by the disappearance of the triphosphate band of dCTP and the retention of *C modes in the crystal following soaking out of noncovalently bound C(or *C)TP. The addition of the second coded base, thymine, was observed by adding cognate dTTP to the crystal following a single d*CTP addition. Adding these two bases caused visible damage to the crystal that was possibly caused by protein and/or DNA conformational change within the crystal. When d*CTP is soaked into the Dpo4 crystal in the absence of Mn(2+) or Mg(2+), the primer extension reaction did not occur; instead, a ternary protein·template·d*CTP complex was formed. In the Raman difference spectra of both binary and ternary complexes, in addition to the modes of d(*C)CTP, features caused by ring modes from the template/primer bases being perturbed and from the DNA backbone appear, as well as features from perturbed peptide and amino acid side chain modes. These effects are more pronounced in the ternary complex than in the binary complex. Using standardized Raman intensities followed as a function of time, the C(*C)TP population in the crystal was maximal at ∼20 min. These remained unchanged in the ternary complex but declined in the binary complexes as chain incorporation occurred.

  10. Helicase and Polymerase Move Together Close to the Fork Junction and Copy DNA in One-Nucleotide Steps

    Directory of Open Access Journals (Sweden)

    Manjula Pandey


    Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.

  11. Pre-Steady-State Kinetic Analysis of Truncated and Full-Length Saccharomyces cerevisiae DNA Polymerase Eta (United States)

    Brown, Jessica A.; Zhang, Likui; Sherrer, Shanen M.; Taylor, John-Stephen; Burgers, Peter M. J.; Suo, Zucai


    Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη), a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers) in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average) than the ground-state binding step (18-fold on average). Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides. PMID:20798853

  12. Pre-Steady-State Kinetic Analysis of Truncated and Full-Length Saccharomyces cerevisiae DNA Polymerase Eta

    Directory of Open Access Journals (Sweden)

    Jessica A. Brown


    Full Text Available Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη, a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average than the ground-state binding step (18-fold on average. Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides.

  13. Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Stephen Duffett


    Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.

  14. Physical manipulation of single-molecule DNA using microbead and its application to analysis of DNA-protein interaction

    International Nuclear Information System (INIS)

    Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira


    We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions

  15. Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA. (United States)

    Fahrimal, Y; Goff, W L; Jasmer, D P


    Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551

  16. C-terminal phenylalanine of bacteriophage T7 single-stranded DNA-binding protein is essential for strand displacement synthesis by T7 DNA polymerase at a nick in DNA. (United States)

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C


    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.

  17. C-terminal Phenylalanine of Bacteriophage T7 Single-stranded DNA-binding Protein Is Essential for Strand Displacement Synthesis by T7 DNA Polymerase at a Nick in DNA* (United States)

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.


    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688

  18. Quantum-Sequencing: Fast electronic single DNA molecule sequencing (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant


    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  19. A uv-sensitive Chinese hamster lung fibroblast cell line (V79/UC) with a possible defect in DNA polymerase activity is deficient in DNA repair

    International Nuclear Information System (INIS)

    Creissen, D.M.; Hill, C.K.


    Studies of repair enzyme activities in a uv-sensitive cell line (V79/UC) derived from Chinese hamster V79 cells have revealed levels of total DNA polymerase that are about 50% of the levels in the parental cell line. There are a number of DNA polymerase inhibitors available which allow us to distinguish between the major forms of DNA polymerase (alpha, beta, gamma, and delta) identified in mammalian cells. Enzyme assays with these inhibitors indicate that the aphidicolin-sensitive DNA polymerase is defective in the V79/UC cell line. This could be either polymerase alpha or delta, or both. The V79/UC cells do not express resistance to aphidicolin in standard toxicity studies. However, when aphidicolin is added postirradiation in survival assays designed to measure the extent of inhibitable repair, V79/UC cells do not respond with the further decrease in survival seen in the parental line. Further evidence of a polymerase-dependent repair defect is evident from alkaline elution data. In this case the V79/UC cells show the appearance of single-strand breaks following uv irradiation in the absence of any added inhibitor. Cells of the V79/M12G parental line, on the other hand, show the appearance of single-strand breaks only when aphidicolin is present

  20. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ (United States)

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai


    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  1. Replication of UV-irradiated single-stranded DNA by DNA polymerase III holoenzyme of Escherichia coli: evidence for bypass of pyrimidine photodimers

    International Nuclear Information System (INIS)

    Livneh, Z.


    Replication of UV-irradiated circular single-stranded phage M13 DNA by Escherichia coli RNA polymerase (EC and DNA polymerase III holoenzyme (EC in the presence of single-stranded DNA binding protein yielded full-length as well as partially replicated products. A similar result was obtained with phage G4 DNA primed with E. coli DNA primase, and phage phi X174 DNA primed with a synthetic oligonucleotide. The fraction of full-length DNA was several orders of magnitude higher than predicted if pyrimidine photodimers were to constitute absolute blocks to DNA replication. Recent models have suggested that pyrimidine photodimers are absolute blocks to DNA replication and that SOS-induced proteins are required to allow their bypass. Our results demonstrate that, under in vitro replication conditions, E. coli DNA polymerase III holoenzyme can insert nucleotides opposite pyrimidine dimers to a significant extent, even in the absence of SOS-induced proteins

  2. Cell proliferation and DNA dependent DNA polymerase estimation in acute lymphoblastic leukaemia during treatment with prednisone and vincristine

    Energy Technology Data Exchange (ETDEWEB)

    Lange Wantzin, G [Rigshospitalet, Copenhagen (Denmark)


    The presence of DNA polymerase and primer-template DNA in lymphoblast nuclei by measuring the in vitro incorporation of /sup 3/H-thymidine-5'-triphosphate (/sup 3/H-TTP) was studied in 10 patients with acute lymphoblastic leukemia. Protein synthesis and various other cytokinetic parameters were also studied. After prednisone (P) administration a marked decrease in /sup 3/H-TTP labelling index (/sup 3/H-TTP LI) was apparent together with an inhibition of /sup 3/H-leucine incorporation (/sup 3/H-LEU LI) into lymphoblasts. A moderate decrease in /sup 3/H-TDR labelling index (/sup 3/H-TDR LI) and a later decrease in mitotic index (MI) were seen. Single cell DNA measurements showed a depletion of /sup 3/H-TDR labelled lymphoblasts in early part of S-phase apparent at 24 h lasting up to 54 h after P administration. Vincristine given as a flash injection later in the study period caused an immediate rise of the MI, at the same time the P induced decline in /sup 3/H-TTP LI, /sup 3/H-TDR LI and /sup 3/H-LEU LI were continued in most patients. P is thought to damage the cells both in and outside the cell cycle. In the cell cycle the effect of P is an arresting effect in G/sub 1/.

  3. Cell proliferation and DNA dependent DNA polymerase estimation in acute lymphoblastic leukaemia during treatment with prednisone and vincristine

    International Nuclear Information System (INIS)

    Lange Wantzin, G.


    The presence of DNA polymerase and primer-template DNA in lymphoblast nuclei by measuring the in vitro incorporation of 3 H-thymidine-5'-triphosphate ( 3 H-TTP) was studied in 10 patients with acute lymphoblastic leukemia. Protein synthesis and various other cytokinetic parameters were also studied. After prednisone (P) administration a marked decrease in 3 H-TTP labelling index ( 3 H-TTP LI) was apparent together with an inhibition of 3 H-leucine incorporation ( 3 H-LEU LI) into lymphoblasts. A moderate decrease in 3 H-TDR labelling index ( 3 H-TDR LI) and a later decrease in mitotic index (MI) were seen. Single cell DNA measurements showed a depletion of 3 H-TDR labelled lymphoblasts in early part of S-phase apparent at 24 h lasting up to 54 h after P administration. Vincristine given as a flash injection later in the study period caused an immediate rise of the MI, at the same time the P induced decline in 3 H-TTP LI, 3 H-TDR LI and 3 H-LEU LI were continued in most patients. P is thought to damage the cells both in and outside the cell cycle. In the cell cycle the effect of P is an arresting effect in G 1 . (author)

  4. A Major Role of DNA Polymerase δ in Replication of Both the Leading and Lagging DNA Strands. (United States)

    Johnson, Robert E; Klassen, Roland; Prakash, Louise; Prakash, Satya


    Genetic studies with S. cerevisiae Polδ (pol3-L612M) and Polε (pol2-M644G) mutant alleles, each of which display a higher rate for the generation of a specific mismatch, have led to the conclusion that Polε is the primary leading strand replicase and that Polδ is restricted to replicating the lagging strand template. Contrary to this widely accepted view, here we show that Polδ plays a major role in the replication of both DNA strands, and that the paucity of pol3-L612M-generated errors on the leading strand results from their more proficient removal. Thus, the apparent lack of Polδ contribution to leading strand replication is due to differential mismatch removal rather than differential mismatch generation. Altogether, our genetic studies with Pol3 and Pol2 mutator alleles support the conclusion that Polδ, and not Polε, is the major DNA polymerase for carrying out both leading and lagging DNA synthesis. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. DNA Polymerases ImuC and DinB Are Involved in DNA Alkylation Damage Tolerance in Pseudomonas aeruginosa and Pseudomonas putida. (United States)

    Jatsenko, Tatjana; Sidorenko, Julia; Saumaa, Signe; Kivisaar, Maia


    Translesion DNA synthesis (TLS), facilitated by low-fidelity polymerases, is an important DNA damage tolerance mechanism. Here, we investigated the role and biological function of TLS polymerase ImuC (former DnaE2), generally present in bacteria lacking DNA polymerase V, and TLS polymerase DinB in response to DNA alkylation damage in Pseudomonas aeruginosa and P. putida. We found that TLS DNA polymerases ImuC and DinB ensured a protective role against N- and O-methylation induced by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) in both P. aeruginosa and P. putida. DinB also appeared to be important for the survival of P. aeruginosa and rapidly growing P. putida cells in the presence of methyl methanesulfonate (MMS). The role of ImuC in protection against MMS-induced damage was uncovered under DinB-deficient conditions. Apart from this, both ImuC and DinB were critical for the survival of bacteria with impaired base excision repair (BER) functions upon alkylation damage, lacking DNA glycosylases AlkA and/or Tag. Here, the increased sensitivity of imuCdinB double deficient strains in comparison to single mutants suggested that the specificity of alkylated DNA lesion bypass of DinB and ImuC might also be different. Moreover, our results demonstrated that mutagenesis induced by MMS in pseudomonads was largely ImuC-dependent. Unexpectedly, we discovered that the growth temperature of bacteria affected the efficiency of DinB and ImuC in ensuring cell survival upon alkylation damage. Taken together, the results of our study disclosed the involvement of ImuC in DNA alkylation damage tolerance, especially at low temperatures, and its possible contribution to the adaptation of pseudomonads upon DNA alkylation damage via increased mutagenesis.

  6. Dynamic conformational change regulates the protein-DNA recognition: an investigation on binding of a Y-family polymerase to its target DNA.

    Directory of Open Access Journals (Sweden)

    Xiakun Chu


    Full Text Available Protein-DNA recognition is a central biological process that governs the life of cells. A protein will often undergo a conformational transition to form the functional complex with its target DNA. The protein conformational dynamics are expected to contribute to the stability and specificity of DNA recognition and therefore may control the functional activity of the protein-DNA complex. Understanding how the conformational dynamics influences the protein-DNA recognition is still challenging. Here, we developed a two-basin structure-based model to explore functional dynamics in Sulfolobus solfataricus DNA Y-family polymerase IV (DPO4 during its binding to DNA. With explicit consideration of non-specific and specific interactions between DPO4 and DNA, we found that DPO4-DNA recognition is comprised of first 3D diffusion, then a short-range adjustment sliding on DNA and finally specific binding. Interestingly, we found that DPO4 is under a conformational equilibrium between multiple states during the binding process and the distributions of the conformations vary at different binding stages. By modulating the strength of the electrostatic interactions, the flexibility of the linker, and the conformational dynamics in DPO4, we drew a clear picture on how DPO4 dynamically regulates the DNA recognition. We argue that the unique features of flexibility and conformational dynamics in DPO4-DNA recognition have direct implications for low-fidelity translesion DNA synthesis, most of which is found to be accomplished by the Y-family DNA polymerases. Our results help complete the description of the DNA synthesis process for the Y-family polymerases. Furthermore, the methods developed here can be widely applied for future investigations on how various proteins recognize and bind specific DNA substrates.

  7. Increased DNA damage in progression of COPD: a response by poly(ADP-ribose polymerase-1.

    Directory of Open Access Journals (Sweden)

    Ingrid Oit-Wiscombe

    Full Text Available Chronic oxidative stress (OS, a major mechanism of chronic obstructive pulmonary disease (COPD, may cause significant damage to DNA. Poly(ADP-ribose polymerase (PARP-1 is rapidly activated by OS-induced DNA lesions. However, the degree of DNA damage along with the evolution of COPD is unclear. In peripheral blood mononuclear cells of non-smoking individuals, non-obstructive smokers, patients with COPD of all stages and those with COPD exacerbation, we evaluated DNA damage, PARP activity and PARP-1 mRNA expression using Comet Assay IV, biotinylated-NAD incorporation assay and qRT-PCR, respectively and subjected results to ordinal logistic regression modelling. Adjusted for demographics, smoking-related parameters and lung function, novel comet parameters, tail length/cell length ratio and tail migration/cell length ratio, showed the greatest increase along the study groups corresponding to the evolution of COPD [odds ratio (OR 7.88, 95% CI 4.26-14.57; p<0.001 and OR 3.91, 95% CI 2.69-5.66; p<0.001, respectively]. Analogously, PARP activity increased significantly over the groups (OR = 1.01; 95%; p<0.001. An antioxidant tetrapeptide UPF17 significantly reduced the PARP-1 mRNA expression in COPD, compared to that in non-obstructive individuals (p = 0.040. Tail length/cell length and tail migration/cell length ratios provide novel progression-sensitive tools for assessment of DNA damage. However, it remains to be elucidated whether inhibition of an elevated PARP-1 activity has a safe enough potential to break the vicious cycle of the development and progression of COPD.

  8. Mechanisms by which herpes simplex virus DNA polymerase limits translesion synthesis through abasic sites. (United States)

    Zhu, Yali; Song, Liping; Stroud, Jason; Parris, Deborah S


    Results suggest a high probability that abasic (AP) sites occur at least once per herpes simplex virus type 1 (HSV-1) genome. The parameters that control the ability of HSV-1 DNA polymerase (pol) to engage in AP translesion synthesis (TLS) were examined because AP lesions could influence the completion and fidelity of viral DNA synthesis. Pre-steady-state kinetic experiments demonstrated that wildtype (WT) and exonuclease-deficient (exo-) pol could incorporate opposite an AP lesion, but full TLS required absence of exo function. Virtually all of the WT pol was bound at the exo site to AP-containing primer-templates (P/Ts) at equilibrium, and the pre-steady-state rate of excision by WT pol was higher on AP-containing than on matched DNA. However, several factors influencing polymerization work synergistically with exo activity to prevent HSV-1 pol from engaging in TLS. Although the pre-steady-state catalytic rate constant for insertion of dATP opposite a T or AP site was similar, ground-state-binding affinity of dATP for insertion opposite an AP site was reduced 3-9-fold. Single-turnover running-start experiments demonstrated a reduced proportion of P/Ts extended to the AP site compared to the preceding site during processive synthesis by WT or exo- pol. Only the exo- pol engaged in TLS, though inefficiently and without burst kinetics, suggesting a much slower rate-limiting step for extension beyond the AP site.

  9. Poly(ADP-ribose) polymerase-1 inhibits ATM kinase activity in DNA damage response

    International Nuclear Information System (INIS)

    Watanabe, Fumiaki; Fukazawa, Hidesuke; Masutani, Mitsuko; Suzuki, Hiroshi; Teraoka, Hirobumi; Mizutani, Shuki; Uehara, Yoshimasa


    DNA double-strand breaks (DSB) mobilize DNA-repair machinery and cell cycle checkpoint by activating the ataxia-telangiectasia (A-T) mutated (ATM). Here we show that ATM kinase activity is inhibited by poly(ADP-ribose) polymerase-1 (PARP-1) in vitro. It was shown by biochemical fractionation procedure that PARP-1 as well as ATM increases at chromatin level after induction of DSB with neocarzinostatin (NCS). Phosphorylation of histone H2AX on serine 139 and p53 on serine 15 in Parp-1 knockout (Parp-1 -/- ) mouse embryonic fibroblasts (MEF) was significantly induced by NCS treatment compared with MEF derived from wild-type (Parp-1 +/+ ) mouse. NCS-induced phosphorylation of histone H2AX on serine 139 in Parp-1 -/- embryonic stem cell (ES) clones was also higher than that in Parp-1 +/+ ES clone. Furthermore, in vitro, PARP-1 inhibited phosphorylation of p53 on serine 15 and 32 P-incorporation into p53 by ATM in a DNA-dependent manner. These results suggest that PARP-1 negatively regulates ATM kinase activity in response to DSB

  10. Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

    International Nuclear Information System (INIS)

    Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.


    The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

  11. Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences


    The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

  12. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema. (United States)

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal


    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  13. Characterization of Recombinant Thermococcus kodakaraensis (KOD) DNA Polymerases Produced Using Silkworm-Baculovirus Expression Vector System

    KAUST Repository

    Yamashita, Mami; Xu, Jian; Morokuma, Daisuke; Hirata, Kazuma; Hino, Masato; Mon, Hiroaki; Takahashi, Masateru; Hamdan, Samir; Sakashita, Kosuke; Iiyama, Kazuhiro; Banno, Yutaka; Kusakabe, Takahiro; Lee, Jae Man


    The KOD DNA polymerase from Thermococcus kodakarensis (Tkod-Pol) has been preferred for PCR due to its rapid elongation rate, extreme thermostability and outstanding fidelity. Here in this study, we utilized silkworm-baculovirus expression vector system (silkworm-BEVS) to express the recombinant Tkod-Pol (rKOD) with N-terminal (rKOD-N) or C-terminal (rKOD-C) tandem fusion tags. By using BEVS, we produced functional rKODs with satisfactory yields, about 1.1 mg/larva for rKOD-N and 0.25 mg/larva for rKOD-C, respectively. Interestingly, we found that rKOD-C shows higher thermostability at 95 °C than that of rKOD-N, while that rKOD-N is significantly unstable after exposing to long period of heat-shock. We also assessed the polymerase activity as well as the fidelity of purified rKODs under various conditions. Compared with commercially available rKOD, which is expressed in E. coli expression system, rKOD-C exhibited almost the same PCR performance as the commercial rKOD did, while rKOD-N did lower performance. Taken together, our results suggested that silkworm-BEVS can be used to express and purify efficient rKOD in a commercial way.

  14. Characterization of Recombinant Thermococcus kodakaraensis (KOD) DNA Polymerases Produced Using Silkworm-Baculovirus Expression Vector System

    KAUST Repository

    Yamashita, Mami


    The KOD DNA polymerase from Thermococcus kodakarensis (Tkod-Pol) has been preferred for PCR due to its rapid elongation rate, extreme thermostability and outstanding fidelity. Here in this study, we utilized silkworm-baculovirus expression vector system (silkworm-BEVS) to express the recombinant Tkod-Pol (rKOD) with N-terminal (rKOD-N) or C-terminal (rKOD-C) tandem fusion tags. By using BEVS, we produced functional rKODs with satisfactory yields, about 1.1 mg/larva for rKOD-N and 0.25 mg/larva for rKOD-C, respectively. Interestingly, we found that rKOD-C shows higher thermostability at 95 °C than that of rKOD-N, while that rKOD-N is significantly unstable after exposing to long period of heat-shock. We also assessed the polymerase activity as well as the fidelity of purified rKODs under various conditions. Compared with commercially available rKOD, which is expressed in E. coli expression system, rKOD-C exhibited almost the same PCR performance as the commercial rKOD did, while rKOD-N did lower performance. Taken together, our results suggested that silkworm-BEVS can be used to express and purify efficient rKOD in a commercial way.

  15. The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

    International Nuclear Information System (INIS)

    Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S


    Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

  16. CMG helicase and DNA polymerase ε form a functional 15-subunit holoenzyme for eukaryotic leading-strand DNA replication. (United States)

    Langston, Lance D; Zhang, Dan; Yurieva, Olga; Georgescu, Roxana E; Finkelstein, Jeff; Yao, Nina Y; Indiani, Chiara; O'Donnell, Mike E


    DNA replication in eukaryotes is asymmetric, with separate DNA polymerases (Pol) dedicated to bulk synthesis of the leading and lagging strands. Pol α/primase initiates primers on both strands that are extended by Pol ε on the leading strand and by Pol δ on the lagging strand. The CMG (Cdc45-MCM-GINS) helicase surrounds the leading strand and is proposed to recruit Pol ε for leading-strand synthesis, but to date a direct interaction between CMG and Pol ε has not been demonstrated. While purifying CMG helicase overexpressed in yeast, we detected a functional complex between CMG and native Pol ε. Using pure CMG and Pol ε, we reconstituted a stable 15-subunit CMG-Pol ε complex and showed that it is a functional polymerase-helicase on a model replication fork in vitro. On its own, the Pol2 catalytic subunit of Pol ε is inefficient in CMG-dependent replication, but addition of the Dpb2 protein subunit of Pol ε, known to bind the Psf1 protein subunit of CMG, allows stable synthesis with CMG. Dpb2 does not affect Pol δ function with CMG, and thus we propose that the connection between Dpb2 and CMG helps to stabilize Pol ε on the leading strand as part of a 15-subunit leading-strand holoenzyme we refer to as CMGE. Direct binding between Pol ε and CMG provides an explanation for specific targeting of Pol ε to the leading strand and provides clear mechanistic evidence for how strand asymmetry is maintained in eukaryotes.

  17. A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems

    Directory of Open Access Journals (Sweden)

    Elisa Morganti


    Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.

  18. Mechanism of replication of ultraviolet-irradiated single-stranded DNA by DNA polymerase III holoenzyme of Escherichia coli. Implications for SOS mutagenesis

    International Nuclear Information System (INIS)

    Livneh, Z.


    Replication of UV-irradiated oligodeoxynucleotide-primed single-stranded phi X174 DNA with Escherichia coli DNA polymerase III holoenzyme in the presence of single-stranded DNA-binding protein was investigated. The extent of initiation of replication on the primed single-stranded DNA was not altered by the presence of UV-induced lesions in the DNA. The elongation step exhibited similar kinetics when either unirradiated or UV-irradiated templates were used. Inhibition of the 3'----5' proofreading exonucleolytic activity of the polymerase by dGMP or by a mutD mutation did not increase bypass of pyrimidine photodimers, and neither did purified RecA protein influence the extent of photodimer bypass as judged by the fraction of full length DNA synthesized. Single-stranded DNA-binding protein stimulated bypass since in its absence the fraction of full length DNA decreased 5-fold. Termination of replication at putative pyrimidine dimers involved dissociation of the polymerase from the DNA, which could then reinitiate replication at other available primer templates. Based on these observations a model for SOS-induced UV mutagenesis is proposed

  19. Interlaboratory Reproducibility of Droplet Digital Polymerase Chain Reaction Using a New DNA Reference Material Format. (United States)

    Pinheiro, Leonardo B; O'Brien, Helen; Druce, Julian; Do, Hongdo; Kay, Pippa; Daniels, Marissa; You, Jingjing; Burke, Daniel; Griffiths, Kate; Emslie, Kerry R


    Use of droplet digital PCR technology (ddPCR) is expanding rapidly in the diversity of applications and number of users around the world. Access to relatively simple and affordable commercial ddPCR technology has attracted wide interest in use of this technology as a molecular diagnostic tool. For ddPCR to effectively transition to a molecular diagnostic setting requires processes for method validation and verification and demonstration of reproducible instrument performance. In this study, we describe the development and characterization of a DNA reference material (NMI NA008 High GC reference material) comprising a challenging methylated GC-rich DNA template under a novel 96-well microplate format. A scalable process using high precision acoustic dispensing technology was validated to produce the DNA reference material with a certified reference value expressed in amount of DNA molecules per well. An interlaboratory study, conducted using blinded NA008 High GC reference material to assess reproducibility among seven independent laboratories demonstrated less than 4.5% reproducibility relative standard deviation. With the exclusion of one laboratory, laboratories had appropriate technical competency, fully functional instrumentation, and suitable reagents to perform accurate ddPCR based DNA quantification measurements at the time of the study. The study results confirmed that NA008 High GC reference material is fit for the purpose of being used for quality control of ddPCR systems, consumables, instrumentation, and workflow.

  20. Human DNA polymerase delta double-mutant D316A;E318A interferes with DNA mismatch repair in vitro

    DEFF Research Database (Denmark)

    Liu, Dekang; Frederiksen, Jane H.; Liberti, Sascha Emilie


    DNA mismatch repair (MMR) is a highly-conserved DNA repair mechanism, whose primary role is to remove DNA replication errors preventing them from manifesting as mutations, thereby increasing the overall genome stability. Defects in MMR are associated with increased cancer risk in humans and other...... organisms. Here, we characterize the interaction between MMR and a proofreading-deficient allele of the human replicative DNA polymerase delta, PolδD316A;E318A, which has a higher capacity for strand displacement DNA synthesis than wild type Polδ. Human cell lines overexpressing PolδD316A;E318A display...

  1. Multisubunit DNA-Dependent RNA Polymerases from Vaccinia Virus and Other Nucleocytoplasmic Large-DNA Viruses: Impressions from the Age of Structure. (United States)

    Mirzakhanyan, Yeva; Gershon, Paul D


    The past 17 years have been marked by a revolution in our understanding of cellular multisubunit DNA-dependent RNA polymerases (MSDDRPs) at the structural level. A parallel development over the past 15 years has been the emerging story of the giant viruses, which encode MSDDRPs. Here we link the two in an attempt to understand the specialization of multisubunit RNA polymerases in the domain of life encompassing the large nucleocytoplasmic DNA viruses (NCLDV), a superclade that includes the giant viruses and the biochemically well-characterized poxvirus vaccinia virus. The first half of this review surveys the recently determined structural biology of cellular RNA polymerases for a microbiology readership. The second half discusses a reannotation of MSDDRP subunits from NCLDV families and the apparent specialization of these enzymes by virus family and by subunit with regard to subunit or domain loss, subunit dissociability, endogenous control of polymerase arrest, and the elimination/customization of regulatory interactions that would confer higher-order cellular control. Some themes are apparent in linking subunit function to structure in the viral world: as with cellular RNA polymerases I and III and unlike cellular RNA polymerase II, the viral enzymes seem to opt for speed and processivity and seem to have eliminated domains associated with higher-order regulation. The adoption/loss of viral RNA polymerase proofreading functions may have played a part in matching intrinsic mutability to genome size. Copyright © 2017 American Society for Microbiology.

  2. NSC666715 and Its Analogs Inhibit Strand-Displacement Activity of DNA Polymerase β and Potentiate Temozolomide-Induced DNA Damage, Senescence and Apoptosis in Colorectal Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Aruna S Jaiswal

    Full Text Available Recently approved chemotherapeutic agents to treat colorectal cancer (CRC have made some impact; however, there is an urgent need for newer targeted agents and strategies to circumvent CRC growth and metastasis. CRC frequently exhibits natural resistance to chemotherapy and those who do respond initially later acquire drug resistance. A mechanism to potentially sensitize CRC cells is by blocking the DNA polymerase β (Pol-β activity. Temozolomide (TMZ, an alkylating agent, and other DNA-interacting agents exert DNA damage primarily repaired by a Pol-β-directed base excision repair (BER pathway. In previous studies, we used structure-based molecular docking of Pol-β and identified a potent small molecule inhibitor (NSC666715. In the present study, we have determined the mechanism by which NSC666715 and its analogs block Fen1-induced strand-displacement activity of Pol-β-directed LP-BER, cause apurinic/apyrimidinic (AP site accumulation and induce S-phase cell cycle arrest. Induction of S-phase cell cycle arrest leads to senescence and apoptosis of CRC cells through the p53/p21 pathway. Our initial findings also show a 10-fold reduction of the IC50 of TMZ when combined with NSC666715. These results provide a guide for the development of a target-defined strategy for CRC chemotherapy that will be based on the mechanisms of action of NSC666715 and TMZ. This combination strategy can be used as a framework to further reduce the TMZ dosages and resistance in CRC patients.

  3. Mutagenesis by alkylating agents: coding properties for DNA polymerase of poly (dC) template containing 3-methylcytosine

    Energy Technology Data Exchange (ETDEWEB)

    Boiteux, S.; Laval, J. (Institut Gustave-Roussy, 94 - Villejuif (France))

    After treatment of poly(dC) by the simple alkylating agent (/sup 3/H)dimethylsulfate, 90 percent of the radioactivity cochromatographed with 3-methylcytosine and 10 percent with 5-methylcytosine which is the normally occurring methylated base. In order to study the influence of 3-methylcytosine on DNA replication, untreated and MDS-treated poly(dC) were used as templates for E. coli DNA polymerase I. The alkylation of poly(dC) inhibits DNA chain elongation, and does not induce any mispairing under high fidelity conditions. The alteration of DNA polymerase I fidelity by manganese ions allows some replication of 3-methylcytosine which mispairs with either dAMP or dTMP. Our results suggest that 3-methylcytosine could be responsible, at least partially, for killing and the mutagenesis observed after cell treatment by alkylating agents.

  4. Translesion synthesis DNA polymerases promote error-free replication through the minor-groove DNA adduct 3-deaza-3-methyladenine. (United States)

    Yoon, Jung-Hoon; Roy Choudhury, Jayati; Park, Jeseong; Prakash, Satya; Prakash, Louise


    N3-Methyladenine (3-MeA) is formed in DNA by reaction with S -adenosylmethionine, the reactive methyl donor, and by reaction with alkylating agents. 3-MeA protrudes into the DNA minor groove and strongly blocks synthesis by replicative DNA polymerases (Pols). However, the mechanisms for replicating through this lesion in human cells remain unidentified. Here we analyzed the roles of translesion synthesis (TLS) Pols in the replication of 3-MeA-damaged DNA in human cells. Because 3-MeA has a short half-life in vitro , we used the stable 3-deaza analog, 3-deaza-3-methyladenine (3-dMeA), which blocks the DNA minor groove similarly to 3-MeA. We found that replication through the 3-dMeA adduct is mediated via three different pathways, dependent upon Polι/Polκ, Polθ, and Polζ. As inferred from biochemical studies, in the Polι/Polκ pathway, Polι inserts a nucleotide (nt) opposite 3-dMeA and Polκ extends synthesis from the inserted nt. In the Polθ pathway, Polθ carries out both the insertion and extension steps of TLS opposite 3-dMeA, and in the Polζ pathway, Polζ extends synthesis following nt insertion by an as yet unidentified Pol. Steady-state kinetic analyses indicated that Polι and Polθ insert the correct nt T opposite 3-dMeA with a much reduced catalytic efficiency and that both Pols exhibit a high propensity for inserting a wrong nt opposite this adduct. However, despite their low fidelity of synthesis opposite 3-dMeA, TLS opposite this lesion replicates DNA in a highly error-free manner in human cells. We discuss the implications of these observations for TLS mechanisms in human cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Only one ATP-binding DnaX subunit is required for initiation complex formation by the Escherichia coli DNA polymerase III holoenzyme. (United States)

    Wieczorek, Anna; Downey, Christopher D; Dallmann, H Garry; McHenry, Charles S


    The DnaX complex (DnaX(3)δδ'χ psi) within the Escherichia coli DNA polymerase III holoenzyme serves to load the dimeric sliding clamp processivity factor, β(2), onto DNA. The complex contains three DnaX subunits, which occur in two forms: τ and the shorter γ, produced by translational frameshifting. Ten forms of E. coli DnaX complex containing all possible combinations of wild-type or a Walker A motif K51E variant τ or γ have been reconstituted and rigorously purified. DnaX complexes containing three DnaX K51E subunits do not bind ATP. Comparison of their ability to support formation of initiation complexes, as measured by processive replication by the DNA polymerase III holoenzyme, indicates a minimal requirement for one ATP-binding DnaX subunit. DnaX complexes containing two mutant DnaX subunits support DNA synthesis at about two-thirds the level of their wild-type counterparts. β(2) binding (determined functionally) is diminished 12-30-fold for DnaX complexes containing two K51E subunits, suggesting that multiple ATPs must be bound to place the DnaX complex into a conformation with maximal affinity for β(2). DNA synthesis activity can be restored by increased concentrations of β(2). In contrast, severe defects in ATP hydrolysis are observed upon introduction of a single K51E DnaX subunit. Thus, ATP binding, hydrolysis, and the ability to form initiation complexes are not tightly coupled. These results suggest that although ATP hydrolysis likely enhances β(2) loading, it is not absolutely required in a mechanistic sense for formation of functional initiation complexes.

  6. Crystal structure of DNA polymerase III β sliding clamp from Mycobacterium tuberculosis. (United States)

    Gui, Wen-Jun; Lin, Shi-Qiang; Chen, Yuan-Yuan; Zhang, Xian-En; Bi, Li-Jun; Jiang, Tao


    The sliding clamp is a key component of DNA polymerase III (Pol III) required for genome replication. It is known to function with diverse DNA repair proteins and cell cycle-control proteins, making it a potential drug target. To extend our understanding of the structure/function relationship of the sliding clamp, we solved the crystal structure of the sliding clamp from Mycobacterium tuberculosis (M. tuberculosis), a human pathogen that causes most cases of tuberculosis (TB). The sliding clamp from M. tuberculosis forms a ring-shaped head-to-tail dimer with three domains per subunit. Each domain contains two α helices in the inner ring that lie against two β sheets in the outer ring. Previous studies have indicated that many Escherichia coli clamp-binding proteins have a conserved LF sequence, which is critical for binding to the hydrophobic region of the sliding clamp. Here, we analyzed the binding affinities of the M. tuberculosis sliding clamp and peptides derived from the α and δ subunits of Pol III, which indicated that the LF motif also plays an important role in the binding of the α and δ subunits to the sliding clamp of M. tuberculosis. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Anti-tumor effects of dehydroaltenusin, a specific inhibitor of mammalian DNA polymerase α

    International Nuclear Information System (INIS)

    Maeda, Naoki; Kokai, Yasuo; Ohtani, Seiji; Sahara, Hiroeki; Kuriyama, Isoko; Kamisuki, Shinji; Takahashi, Shunya; Sakaguchi, Kengo; Sugawara, Fumio; Yoshida, Hiromi; Sato, Noriyuki; Mizushina, Yoshiyuki


    In the screening of selective inhibitors of eukaryotic DNA polymerases (pols), dehydroaltenusin was found to be an inhibitor of pol α from a fungus (Alternaria tennuis). We succeeded in chemically synthesizing dehydroaltenusin, and the compound inhibited only mammalian pol α with IC 50 value of 0.5 μM, and did not influence the activities of other replicative pols such as pols δ and ε, but also showed no effect on pol α activity from another vertebrate, fish, or from a plant species. Dehydroaltenusin also had no influence on the other pols and DNA metabolic enzymes tested. The compound also inhibited the proliferation of human cancer cells with LD 50 values of 38.0-44.4 μM. In an in vivo anti-tumor assay on nude mice bearing solid tumors of HeLa cells, dehydroaltenusin was shown to be a promising suppressor of solid tumors. Histopathological examination revealed that increased tumor necrosis and decreased mitotic index were apparently detected by the compound in vivo. Therefore, dehydroaltenusin could be of interest as not only a mammalian pol α-specific inhibitor, but also as a candidate drug for anti-cancer treatment

  8. Modulation of Pleurodeles waltl DNA polymerase mu expression by extreme conditions encountered during spaceflight.

    Directory of Open Access Journals (Sweden)

    Véronique Schenten

    Full Text Available DNA polymerase µ is involved in DNA repair, V(DJ recombination and likely somatic hypermutation of immunoglobulin genes. Our previous studies demonstrated that spaceflight conditions affect immunoglobulin gene expression and somatic hypermutation frequency. Consequently, we questioned whether Polμ expression could also be affected. To address this question, we characterized Polμ of the Iberian ribbed newt Pleurodeles waltl and exposed embryos of that species to spaceflight conditions or to environmental modifications corresponding to those encountered in the International Space Station. We noted a robust expression of Polμ mRNA during early ontogenesis and in the testis, suggesting that Polμ is involved in genomic stability. Full-length Polμ transcripts are 8-9 times more abundant in P. waltl than in humans and mice, thereby providing an explanation for the somatic hypermutation predilection of G and C bases in amphibians. Polμ transcription decreases after 10 days of development in space and radiation seem primarily involved in this down-regulation. However, space radiation, alone or in combination with a perturbation of the circadian rhythm, did not affect Polμ protein levels and did not induce protein oxidation, showing the limited impact of radiation encountered during a 10-day stay in the International Space Station.

  9. Development of an efficient process intensification strategy for enhancing Pfu DNA polymerase production in recombinant Escherichia coli. (United States)

    Hu, Jian-Hua; Wang, Feng; Liu, Chun-Zhao


    An efficient induction strategy that consisted of multiple additions of small doses of isopropyl-β-D-thiogalactopyranoside (IPTG) in the early cell growth phase was developed for enhancing Pfu DNA polymerase production in Escherichia coli. In comparison to the most commonly used method of a single induction of 1 mM IPTG, the promising induction strategy resulted in an increase in the Pfu activity of 13.5% in shake flasks, while simultaneously decreasing the dose of IPTG by nearly half. An analysis of the intracellular IPTG concentrations indicated that the cells need to maintain an optimum intracellular IPTG concentration after 6 h for efficient Pfu DNA polymerase production. A significant increase in the Pfu DNA polymerase activity of 31.5% under the controlled dissolved oxygen concentration of 30% in a 5 L fermentor was achieved using the multiple IPTG induction strategy in comparison with the single IPTG induction. The induction strategy using multiple inputs of IPTG also avoided over accumulation of IPTG and reduced the cost of Pfu DNA polymerase production.

  10. Atomic Structure and Nonhomologous End-Joining Function of the Polymerase Component of Bacterial DNA Ligase D

    Energy Technology Data Exchange (ETDEWEB)

    Zhu,H.; Nandakumar, J.; Aniukwu, J.; Wang, L.; Glickman, M.; Lima, C.; Shuman, S.


    DNA ligase D (LigD) is a large polyfunctional protein that participates in a recently discovered pathway of nonhomologous end-joining in bacteria. LigD consists of an ATP-dependent ligase domain fused to a polymerase domain (Pol) and a phosphoesterase module. The Pol activity is remarkable for its dependence on manganese, its ability to perform templated and nontemplated primer extension reactions, and its preference for adding ribonucleotides to blunt DNA ends. Here we report the 1.5- Angstroms crystal structure of the Pol domain of Pseudomonas LigD and its complexes with manganese and ATP-dATP substrates, which reveal a minimized polymerase with a two-metal mechanism and a fold similar to that of archaeal DNA primase. Mutational analysis highlights the functionally relevant atomic contacts in the active site. Although distinct nucleoside conformations and contacts for ATP versus dATP are observed in the cocrystals, the functional analysis suggests that the ATP-binding mode is the productive conformation for dNMP and rNMP incorporation. We find that a mutation of Mycobacterium LigD that uniquely ablates the polymerase activity results in increased fidelity of blunt-end double-strand break repair in vivo by virtue of eliminating nucleotide insertions at the recombination junctions. Thus, LigD Pol is a direct catalyst of mutagenic nonhomologous end-joining in vivo. Our studies underscore a previously uncharacterized role for the primase-like polymerase family in DNA repair.

  11. Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates

    Czech Academy of Sciences Publication Activity Database

    Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla


    Roč. 26, č. 2 (2016), s. 288-291 ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016

  12. Binding of Mn-deoxyribonucleoside Triphosphates to the Active Site of the DNA Polymerase of Bacteriophage T7

    Energy Technology Data Exchange (ETDEWEB)

    B Akabayov; C Richardson


    Divalent metal ions are crucial as cofactors for a variety of intracellular enzymatic activities. Mg{sup 2+}, as an example, mediates binding of deoxyribonucleoside 5'-triphosphates followed by their hydrolysis in the active site of DNA polymerase. It is difficult to study the binding of Mg{sup 2+} to an active site because Mg{sup 2+} is spectroscopically silent and Mg{sup 2+} binds with low affinity to the active site of an enzyme. Therefore, we substituted Mg{sup 2+} with Mn{sup 2+}:Mn{sup 2+} that is not only visible spectroscopically but also provides full activity of the DNA polymerase of bacteriophage T7. In order to demonstrate that the majority of Mn{sup 2+} is bound to the enzyme, we have applied site-directed titration analysis of T7 DNA polymerase using X-ray near edge spectroscopy. Here we show how X-ray near edge spectroscopy can be used to distinguish between signal originating from Mn{sup 2+} that is free in solution and Mn{sup 2+} bound to the active site of T7 DNA polymerase. This method can be applied to other enzymes that use divalent metal ions as a cofactor.

  13. Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA. (United States)

    Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian


    Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  14. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads


    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...

  15. Bypass of a 5',8-cyclopurine-2'-deoxynucleoside by DNA polymerase β during DNA replication and base excision repair leads to nucleotide misinsertions and DNA strand breaks. (United States)

    Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E; Terzidis, Michael A; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan


    5',8-Cyclopurine-2'-deoxynucleosides including 5',8-cyclo-dA (cdA) and 5',8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5',8-cyclopurine-2'-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5'R-cdA, but inefficiently bypassed a 5'S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5',8-cyclopurine-2'-deoxynucleoside. Moreover, we found that bypass of a 5'S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5',8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Production of DNA polymerase by recombinant pET-17b/Pfu-Pol ...

    African Journals Online (AJOL)

    Although this enzyme has been produced worldwide, there is no reported cloning or production of polymerases in Egypt. In the current work, plasmid coding Pfu polymerase enzyme (pET-17b/Pfu-Pol) was transformed into E. coli Top10. The plasmid coding Pfu- polymerase was confirmed by restriction analysis using HindIII ...

  17. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    International Nuclear Information System (INIS)

    Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie


    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  18. Potent host-directed small-molecule inhibitors of myxovirus RNA-dependent RNA-polymerases.

    Directory of Open Access Journals (Sweden)

    Stefanie A Krumm

    Full Text Available Therapeutic targeting of host cell factors required for virus replication rather than of pathogen components opens new perspectives to counteract virus infections. Anticipated advantages of this approach include a heightened barrier against the development of viral resistance and a broadened pathogen target spectrum. Myxoviruses are predominantly associated with acute disease and thus are particularly attractive for this approach since treatment time can be kept limited. To identify inhibitor candidates, we have analyzed hit compounds that emerged from a large-scale high-throughput screen for their ability to block replication of members of both the orthomyxovirus and paramyxovirus families. This has returned a compound class with broad anti-viral activity including potent inhibition of different influenza virus and paramyxovirus strains. After hit-to-lead chemistry, inhibitory concentrations are in the nanomolar range in the context of immortalized cell lines and human PBMCs. The compound shows high metabolic stability when exposed to human S-9 hepatocyte subcellular fractions. Antiviral activity is host-cell species specific and most pronounced in cells of higher mammalian origin, supporting a host-cell target. While the compound induces a temporary cell cycle arrest, host mRNA and protein biosynthesis are largely unaffected and treated cells maintain full metabolic activity. Viral replication is blocked at a post-entry step and resembles the inhibition profile of a known inhibitor of viral RNA-dependent RNA-polymerase (RdRp activity. Direct assessment of RdRp activity in the presence of the reagent reveals strong inhibition both in the context of viral infection and in reporter-based minireplicon assays. In toto, we have identified a compound class with broad viral target range that blocks host factors required for viral RdRp activity. Viral adaptation attempts did not induce resistance after prolonged exposure, in contrast to rapid

  19. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads


    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...

  20. Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery

    International Nuclear Information System (INIS)

    Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong


    Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity

  1. Double-stranded DNA translocase activity of transcription factor TFIIH and the mechanism of RNA polymerase II open complex formation. (United States)

    Fishburn, James; Tomko, Eric; Galburt, Eric; Hahn, Steven


    Formation of the RNA polymerase II (Pol II) open complex (OC) requires DNA unwinding mediated by the transcription factor TFIIH helicase-related subunit XPB/Ssl2. Because XPB/Ssl2 binds DNA downstream from the location of DNA unwinding, it cannot function using a conventional helicase mechanism. Here we show that yeast TFIIH contains an Ssl2-dependent double-stranded DNA translocase activity. Ssl2 tracks along one DNA strand in the 5' → 3' direction, implying it uses the nontemplate promoter strand to reel downstream DNA into the Pol II cleft, creating torsional strain and leading to DNA unwinding. Analysis of the Ssl2 and DNA-dependent ATPase activity of TFIIH suggests that Ssl2 has a processivity of approximately one DNA turn, consistent with the length of DNA unwound during transcription initiation. Our results can explain why maintaining the OC requires continuous ATP hydrolysis and the function of TFIIH in promoter escape. Our results also suggest that XPB/Ssl2 uses this translocase mechanism during DNA repair rather than physically wedging open damaged DNA.

  2. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation. (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F


    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation* (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.


    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  4. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha; Hamdan, Samir; Richardson, Charles C.


    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha


    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules


    Buyukdagli, Sahin


    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

  7. Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

    International Nuclear Information System (INIS)

    Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.


    Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

  8. Studying DNA Looping by Single-Molecule FRET


    Le, Tung T.; Kim, Harold D.


    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...

  9. Roles of Saccharomyces cerevisiae DNA polymerases Polη and Polζ in response to irradiation by simulated sunlight (United States)

    Kozmin, Stanislav G.; Pavlov, Youri I.; Kunkel, Thomas A.; Sage, Evelyne


    Sunlight causes lesions in DNA that if unrepaired and inaccurately replicated by DNA polymerases yield mutations that result in skin cancer in humans. Two enzymes involved in translesion synthesis (TLS) of UV-induced photolesions are DNA polymerase η (Polη) and polymerase ζ (Polζ), encoded by the RAD30A and REV3 genes, respectively. Previous studies have investigated the TLS roles of these polymerases in human and yeast cells irradiated with monochromatic, short wavelength UVC radiation (254 nm). However, less is known about cellular responses to solar radiation, which is of higher and mixed wavelengths (310–1100 nm) and produces a different spectrum of DNA lesions, including Dewar photoproducts and oxidative lesions. Here we report on the comparative cytotoxic and mutagenic effects of simulated sunlight (SSL) and UVC radiation on yeast wild-type, rad30Δ, rev3Δ and rev3Δ rad30Δ strains. The results with SSL support several previous interpretations on the roles of these two polymerases in TLS of photodimers and (6–4) photoproducts derived from studies with UVC. They further suggest that Polη participates in the non-mutagenic bypass of SSL-dependent cytosine-containing Dewar photoproducts and 8-oxoguanine, while Polζ is mainly responsible for the mutagenic bypass of all types of Dewar photoproducts. They also suggest that in the absence of Polζ, Polη contributes to UVC- and SSL-induced mutagenesis, possibly by the bypass of photodimers containing deaminated cytosine. PMID:12888515

  10. Proliferating cell nuclear antigen binds DNA polymerase-β and mediates 1-methyl-4-phenylpyridinium-induced neuronal death.

    Directory of Open Access Journals (Sweden)

    Zhentao Zhang

    Full Text Available The mechanisms leading to dopaminergic neuronal loss in the substantia nigra of patients with Parkinson disease (PD remain poorly understood. We recently reported that aberrant DNA replication mediated by DNA polymerase-β (DNA pol-β plays a causal role in the death of postmitotic neurons in an in vitro model of PD. In the present study, we show that both proliferating cell nuclear antigen (PCNA and DNA pol-β are required for MPP(+-induced neuronal death. PCNA binds to the catalytic domain of DNA pol-β in MPP(+-treated neurons and in post-mortem brain tissues of PD patients. The PCNA-DNA pol-β complex is loaded into DNA replication forks and mediates DNA replication in postmitotic neurons. The aberrant DNA replication mediated by the PCNA-DNA pol-β complex induces p53-dependent neuronal cell death. Our results indicate that the interaction of PCNA and DNA pol-β contributes to neuronal death in PD.

  11. Inhibitory effect of tocotrienol on eukaryotic DNA polymerase λ and angiogenesis

    International Nuclear Information System (INIS)

    Mizushina, Yoshiyuki; Nakagawa, Kiyotaka; Shibata, Akira; Awata, Yasutoshi; Kuriyama, Isoko; Shimazaki, Noriko; Koiwai, Osamu; Uchiyama, Yukinobu; Sakaguchi, Kengo; Miyazawa, Teruo; Yoshida, Hiromi


    Tocotrienols, vitamin E compounds that have an unsaturated side chain with three double bonds, selectively inhibited the activity of mammalian DNA polymerase λ (pol λ) in vitro. These compounds did not influence the activities of replicative pols such as α, δ, and ε, or even the activity of pol β which is thought to have a very similar three-dimensional structure to the pol β-like region of pol λ. Since δ-tocotrienol had the strongest inhibitory effect among the four (α- to δ-) tocotrienols, the isomer's structure might be an important factor in the inhibition of pol λ. The inhibitory effect of δ-tocotrienol on both intact pol λ (residues 1-575) and a truncated pol λ lacking the N-terminal BRCA1 C-terminus (BRCT) domain (residues 133-575, del-1 pol λ) was dose-dependent, with 50% inhibition observed at a concentration of 18.4 and 90.1 μM, respectively. However, del-2 pol λ (residues 245-575) containing the C-terminal pol β-like region was unaffected. Tocotrienols also inhibited the proliferation of and formation of tubes by bovine aortic endothelial cells, with δ-tocotrienol having the greatest effect. These results indicated that tocotrienols targeted both pol λ and angiogenesis as anti-cancer agents. The relationship between the inhibition of pol λ and anti-angiogenesis by δ-tocotrienol was discussed

  12. Enrichment of deleterious variants of mitochondrial DNA polymerase gene (POLG1) in bipolar disorder. (United States)

    Kasahara, Takaoki; Ishiwata, Mizuho; Kakiuchi, Chihiro; Fuke, Satoshi; Iwata, Nakao; Ozaki, Norio; Kunugi, Hiroshi; Minabe, Yoshio; Nakamura, Kazuhiko; Iwata, Yasuhide; Fujii, Kumiko; Kanba, Shigenobu; Ujike, Hiroshi; Kusumi, Ichiro; Kataoka, Muneko; Matoba, Nana; Takata, Atsushi; Iwamoto, Kazuya; Yoshikawa, Takeo; Kato, Tadafumi


    Rare missense variants, which likely account for a substantial portion of the genetic 'dark matter' for a common complex disease, are challenging because the impacts of variants on disease development are difficult to substantiate. This study aimed to examine the impacts of amino acid substitution variants in the POLG1 found in bipolar disorder, as an example and proof of concept, in three different modalities of assessment: in silico predictions, in vitro biochemical assays, and clinical evaluation. We then tested whether deleterious variants in POLG1 contributed to the genetics of bipolar disorder. We searched for variants in the POLG1 gene in 796 Japanese patients with bipolar disorder and 767 controls and comprehensively investigated all 23 identified variants in the three modalities of assessment. POLG1 encodes mitochondrial DNA polymerase and is one of the causative genes for a Mendelian-inheritance mitochondrial disease, which is occasionally accompanied by mood disorders. The healthy control data from the Tohoku Medical Megabank Organization were also employed. Although the frequency of carriers of deleterious variants varied from one method to another, every assessment achieved the same conclusion that deleterious POLG1 variants were significantly enriched in the variants identified in patients with bipolar disorder compared to those in controls. Together with mitochondrial dysfunction in bipolar disorder, the present results suggested deleterious POLG1 variants as a credible risk for the multifactorial disease. © 2016 The Authors. Psychiatry and Clinical Neurosciences published by John Wiley & Sons Australia, Ltd on behalf of Japanese Society of Psychiatry and Neurology.

  13. Influence of major-groove chemical modifications of DNA on transcription by bacterial RNA polymerases. (United States)

    Raindlová, Veronika; Janoušková, Martina; Slavíčková, Michaela; Perlíková, Pavla; Boháčová, Soňa; Milisavljevič, Nemanja; Šanderová, Hana; Benda, Martin; Barvík, Ivan; Krásný, Libor; Hocek, Michal


    DNA templates containing a set of base modifications in the major groove (5-substituted pyrimidines or 7-substituted 7-deazapurines bearing H, methyl, vinyl, ethynyl or phenyl groups) were prepared by PCR using the corresponding base-modified 2'-deoxyribonucleoside triphosphates (dNTPs). The modified templates were used in an in vitro transcription assay using RNA polymerase from Bacillus subtilis and Escherichia coli Some modified nucleobases bearing smaller modifications (H, Me in 7-deazapurines) were perfectly tolerated by both enzymes, whereas bulky modifications (Ph at any nucleobase) and, surprisingly, uracil blocked transcription. Some middle-sized modifications (vinyl or ethynyl) were partly tolerated mostly by the E. colienzyme. In all cases where the transcription proceeded, full length RNA product with correct sequence was obtained indicating that the modifications of the template are not mutagenic and the inhibition is probably at the stage of initiation. The results are promising for the development of bioorthogonal reactions for artificial chemical switching of the transcription. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Strand displacement by DNA polymerase III occurs through a tau-psi-chi link to single-stranded DNA-binding protein coating the lagging strand template. (United States)

    Yuan, Quan; McHenry, Charles S


    In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of gamma-complex to support the reaction in the absence of tau. However, if gamma-complex is present to load beta(2), a truncated tau protein containing only domains III-V will suffice. This truncated protein is sufficient to bind both the alpha subunit of DNA polymerase (Pol) III and chipsi. This is reminiscent of the minimal requirements for Pol III to replicate short single-stranded DNA-binding protein (SSB)-coated templates where tau is only required to serve as a scaffold to hold Pol III and chi in the same complex (Glover, B., and McHenry, C. (1998) J. Biol. Chem. 273, 23476-23484). We propose a model in which strand displacement by DNA polymerase III holoenzyme depends upon a Pol III-tau-psi-chi-SSB binding network, where SSB is bound to the displaced strand, stabilizing the Pol III-template interaction. The same interaction network is probably important for stabilizing the leading strand polymerase interactions with authentic replication forks. The specificity constant (k(cat)/K(m)) for the strand displacement reaction is approximately 300-fold less favorable than reactions on single-stranded templates and proceeds with a slower rate (150 nucleotides/s) and only moderate processivity (approximately 300 nucleotides). PriA, the initiator of replication restart on collapsed or misassembled replication forks, blocks the strand displacement reaction, even if added to an ongoing reaction.

  15. Alternative splicing at exon 2 results in the loss of the catalytic activity of mouse DNA polymerase iota in vitro. (United States)

    Kazachenko, Konstantin Y; Miropolskaya, Nataliya A; Gening, Leonid V; Tarantul, Vyacheslav Z; Makarova, Alena V


    Y-family DNA polymerase iota (Pol ι) possesses both DNA polymerase and dRP lyase activities and was suggested to be involved in DNA translesion synthesis and base excision repair in mammals. The 129 strain of mice and its derivatives have a natural nonsense codon mutation in the second exon of the Pol ι gene resulting in truncation of the Pol ι protein. These mice were widely used as a Pol ι-null model for in vivo studies of the Pol ι function. However whether 129-derived strains of mice are fully deficient in the Pol ι functions was a subject of discussion since Pol ι mRNA undergoes alternative splicing at exon 2. Here we report purification of mouse Pol ι lacking the region encoded by exon 2, which includes several conserved residues involved in catalysis. We show that the deletion abrogates both the DNA polymerase and dRP lyase activities of Pol ι in the presence of either Mg 2+ or Mn 2+ ions. Thus, 129-derived strains of mice express catalytically inactive alternatively spliced Pol ι variant, whose cellular functions, if any exist, remain to be established. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Metabolic consequences of DNA damage: The role of poly (ADP-ribose) polymerase as mediator of the suicide response

    International Nuclear Information System (INIS)

    Berger, N.A.; Berger, S.J.


    Recent studies show that DNA damage can produce rapid alterations in steady state levels of deoxynucleoside triphosphate pools, for example, MNNG or uv-irradiation cause rapid increases in dATP and dTTP pools without significant changes in dGTP or dCTP pools. In vitro, studies with purified eukaryotic DNA polymerases show that the frequency of nucleotide misincorporation was affected by alterations in relative concentrations of the deoxynucleoside triphosphates. Thus the alterations in dNTP pool sizes that occur consequent to DNA damage may contribute to an increased mutagenic frequency. Poly(ADP-ribose) polymerase mediated suicide mechanism may participate in the toxicity of adenosine deaminase deficiency and severe combined immune deficiency disease in humans. Individuals with this disease suffer severe lymphopenia due to the toxic effects of deoxyadenosine. The lymphocytotoxic effect of adenosine deaminase deficiency can be simulated in lymphocyte cell lines from normal individuals by incubating them with the adenosine deaminase inhibitor, deoxycoformycin. Incubation of such leukocytes with deoxycoformycin and deoxyadenosine results in the gradual accumulation of DNA strand breaks and the depletion of NAD + leading to cell death over a period of several days. This depletion of NAD and loss of cell viability were effectively blocked by nicotinamide or 3-amino benzamide. Thus, persistent activation of poly(ADP-ribose) polymerase by unrepaired or recurrent DNA strand breaks may activate the suicide mechanism of cell death. This study provides a basis for the interesting suggestion that treatment with nicotinamide could block the persistent activity of poly(ADP-ribose) polymerase and may help preserve lymphocyte function in patients with adenosine deaminase deficiency. 16 refs., 3 figs., 2 tabs

  17. dNTP pool levels modulate mutator phenotypes of error-prone DNA polymerase ε variants. (United States)

    Williams, Lindsey N; Marjavaara, Lisette; Knowels, Gary M; Schultz, Eric M; Fox, Edward J; Chabes, Andrei; Herr, Alan J


    Mutator phenotypes create genetic diversity that fuels tumor evolution. DNA polymerase (Pol) ε mediates leading strand DNA replication. Proofreading defects in this enzyme drive a number of human malignancies. Here, using budding yeast, we show that mutator variants of Pol ε depend on damage uninducible (Dun)1, an S-phase checkpoint kinase that maintains dNTP levels during a normal cell cycle and up-regulates dNTP synthesis upon checkpoint activation. Deletion of DUN1 (dun1Δ) suppresses the mutator phenotype of pol2-4 (encoding Pol ε proofreading deficiency) and is synthetically lethal with pol2-M644G (encoding altered Pol ε base selectivity). Although pol2-4 cells cycle normally, pol2-M644G cells progress slowly through S-phase. The pol2-M644G cells tolerate deletions of mediator of the replication checkpoint (MRC) 1 (mrc1Δ) and radiation sensitive (Rad) 9 (rad9Δ), which encode mediators of checkpoint responses to replication stress and DNA damage, respectively. The pol2-M644G mutator phenotype is partially suppressed by mrc1Δ but not rad9Δ; neither deletion suppresses the pol2-4 mutator phenotype. Thus, checkpoint activation augments the Dun1 effect on replication fidelity but is not required for it. Deletions of genes encoding key Dun1 targets that negatively regulate dNTP synthesis, suppress the dun1Δ pol2-M644G synthetic lethality and restore the mutator phenotype of pol2-4 in dun1Δ cells. DUN1 pol2-M644G cells have constitutively high dNTP levels, consistent with checkpoint activation. In contrast, pol2-4 and POL2 cells have similar dNTP levels, which decline in the absence of Dun1 and rise in the absence of the negative regulators of dNTP synthesis. Thus, dNTP pool levels correlate with Pol ε mutator severity, suggesting that treatments targeting dNTP pools could modulate mutator phenotypes for therapy.

  18. MMS exposure promotes increased MtDNA mutagenesis in the presence of replication-defective disease-associated DNA polymerase γ variants. (United States)

    Stumpf, Jeffrey D; Copeland, William C


    Mitochondrial DNA (mtDNA) encodes proteins essential for ATP production. Mutant variants of the mtDNA polymerase cause mutagenesis that contributes to aging, genetic diseases, and sensitivity to environmental agents. We interrogated mtDNA replication in Saccharomyces cerevisiae strains with disease-associated mutations affecting conserved regions of the mtDNA polymerase, Mip1, in the presence of the wild type Mip1. Mutant frequency arising from mtDNA base substitutions that confer erythromycin resistance and deletions between 21-nucleotide direct repeats was determined. Previously, increased mutagenesis was observed in strains encoding mutant variants that were insufficient to maintain mtDNA and that were not expected to reduce polymerase fidelity or exonuclease proofreading. Increased mutagenesis could be explained by mutant variants stalling the replication fork, thereby predisposing the template DNA to irreparable damage that is bypassed with poor fidelity. This hypothesis suggests that the exogenous base-alkylating agent, methyl methanesulfonate (MMS), would further increase mtDNA mutagenesis. Mitochondrial mutagenesis associated with MMS exposure was increased up to 30-fold in mip1 mutants containing disease-associated alterations that affect polymerase activity. Disrupting exonuclease activity of mutant variants was not associated with increased spontaneous mutagenesis compared with exonuclease-proficient alleles, suggesting that most or all of the mtDNA was replicated by wild type Mip1. A novel subset of C to G transversions was responsible for about half of the mutants arising after MMS exposure implicating error-prone bypass of methylated cytosines as the predominant mutational mechanism. Exposure to MMS does not disrupt exonuclease activity that suppresses deletions between 21-nucleotide direct repeats, suggesting the MMS-induce mutagenesis is not explained by inactivated exonuclease activity. Further, trace amounts of CdCl2 inhibit mtDNA replication but

  19. Structures of an Apo and a Binary Complex of an Evolved Archeal B Family DNA Polymerase Capable of Synthesising Highly Cy-Dye Labelled DNA (United States)

    Wynne, Samantha A.; Pinheiro, Vitor B.; Holliger, Philipp; Leslie, Andrew G. W.


    Thermophilic DNA polymerases of the polB family are of great importance in biotechnological applications including high-fidelity PCR. Of particular interest is the relative promiscuity of engineered versions of the exo- form of polymerases from the Thermo- and Pyrococcales families towards non-canonical substrates, which enables key advances in Next-generation sequencing. Despite this there is a paucity of structural information to guide further engineering of this group of polymerases. Here we report two structures, of the apo form and of a binary complex of a previously described variant (E10) of Pyrococcus furiosus (Pfu) polymerase with an ability to fully replace dCTP with Cyanine dye-labeled dCTP (Cy3-dCTP or Cy5-dCTP) in PCR and synthesise highly fluorescent “CyDNA” densely decorated with cyanine dye heterocycles. The apo form of Pfu-E10 closely matches reported apo form structures of wild-type Pfu. In contrast, the binary complex (in the replicative state with a duplex DNA oligonucleotide) reveals a closing movement of the thumb domain, increasing the contact surface with the nascent DNA duplex strand. Modelling based on the binary complex suggests how bulky fluorophores may be accommodated during processive synthesis and has aided the identification of residues important for the synthesis of unnatural nucleic acid polymers. PMID:23940661

  20. Injection molded nanofluidic chips: Fabrication method and functional tests using single-molecule DNA experiments

    DEFF Research Database (Denmark)

    Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders


    We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....

  1. Reduction of postreplication DNA repair in two Escherichia coli mutants with temperature-sensitive polymerase III activity: implications for the postreplication repair pathway

    International Nuclear Information System (INIS)

    Johnson, R.C.


    Daughter strand gaps are secondary lesions caused by interrupted DNA synthesis in the proximity of uv-induced pyrimidine dimers. The relative roles of DNA recombination and de novo DNA synthesis in filling such gaps have not been clarified, although both are required for complete closure. In this study, the Escherichia coli E486 and E511 dnaE(Ts) mutants, in which DNA polymerase I but not DNA polymerase III is active at 43 0 C, were examined. Both mutants demonstrated reduced gap closure in comparison with the progenitor strain at the nonpermissive temperature. These results and those of previous studies support the hypothesis that both DNA polymerase I and DNA polymerase III contribute to gap closure, suggesting a cooperative effort in the repair of each gap. Benzoylated, naphthoylated diethylaminoethyl-cellulose chromatography analysis for persistence of single-strand DNA in the absence of DNA polymerase III activity suggested that de novo DNA synthesis initiates the filling of daughter strand gaps

  2. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant. (United States)

    Xia, Shuangluo; Konigsberg, William H


    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  3. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules. (United States)

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo


    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  4. A nucleotide-analogue-induced gain of function corrects the error-prone nature of human DNA polymerase iota. (United States)

    Ketkar, Amit; Zafar, Maroof K; Banerjee, Surajit; Marquez, Victor E; Egli, Martin; Eoff, Robert L


    Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2'-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2'-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle, which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base-stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase.

  5. A nucleotide analogue induced gain of function corrects the error-prone nature of human DNA polymerase iota (United States)

    Ketkar, Amit; Zafar, Maroof K.; Banerjee, Surajit; Marquez, Victor E.; Egli, Martin; Eoff, Robert L


    Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2′-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2′-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle (χ), which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase. PMID:22632140

  6. Carborane-linked 2'-deoxyuridine 5'-O-triphosphate as building block for polymerase synthesis of carborane-modified DNA

    Czech Academy of Sciences Publication Activity Database

    Balintová, Jana; Simonova, Anna; Bialek-Pietras, M.; Olejniczak, A.; Lesnikowski, Z. J.; Hocek, Michal


    Roč. 27, č. 21 (2017), s. 4786-4788 ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Grant - others:AV ČR(CZ) AP1501 Program:Akademická prémie - Praemium Academiae Institutional support: RVO:61388963 Keywords : nucleotides * nucleoside triphosphates * carboranes * DNA polymerase * oligonucleotides Subject RIV: CC - Organic Chemistry OBOR OECD: Organic chemistry Impact factor: 2.454, year: 2016

  7. Thermophoretic forces on DNA measured with a single-molecule spring balance

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe


    We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...

  8. The spontaneous replication error and the mismatch discrimination mechanisms of human DNA polymerase β (United States)

    Koag, Myong-Chul; Nam, Kwangho; Lee, Seongmin


    To provide molecular-level insights into the spontaneous replication error and the mismatch discrimination mechanisms of human DNA polymerase β (polβ), we report four crystal structures of polβ complexed with dG•dTTP and dA•dCTP mismatches in the presence of Mg2+ or Mn2+. The Mg2+-bound ground-state structures show that the dA•dCTP-Mg2+ complex adopts an ‘intermediate’ protein conformation while the dG•dTTP-Mg2+ complex adopts an open protein conformation. The Mn2+-bound ‘pre-chemistry-state’ structures show that the dA•dCTP-Mn2+ complex is structurally very similar to the dA•dCTP-Mg2+ complex, whereas the dG•dTTP-Mn2+ complex undergoes a large-scale conformational change to adopt a Watson–Crick-like dG•dTTP base pair and a closed protein conformation. These structural differences, together with our molecular dynamics simulation studies, suggest that polβ increases replication fidelity via a two-stage mismatch discrimination mechanism, where one is in the ground state and the other in the closed conformation state. In the closed conformation state, polβ appears to allow only a Watson–Crick-like conformation for purine•pyrimidine base pairs, thereby discriminating the mismatched base pairs based on their ability to form the Watson–Crick-like conformation. Overall, the present studies provide new insights into the spontaneous replication error and the replication fidelity mechanisms of polβ. PMID:25200079

  9. Influence of inhibitors of poly(ADP-ribose) polymerase on DNA repair, chromosomal alterations, and mutations

    Energy Technology Data Exchange (ETDEWEB)

    Natarajan, A.T.; van Zeeland, A.A.; Zwanenburg, T.S.


    The influence of inhibitors of poly(ADP-ribose) polymerase such as 3-aminobenzamide (3AB) and benzamide (B) on the spontaneously occurring as well as mutagen induced chromosomal aberrations, sister chromatid exchanges (SCEs) and point mutations has been studied. In addition, the influence of 3AB on DNA repair was measured following treatment with physical and chemical mutagens. Post treatment of X-irradiated mammalian cells with 3AB increases the frequencies of induced chromosomal aberrations by a factor of 2 to 3. 3AB, when present in the medium containing bromodeoxyuridine(BrdUrd) during two cell cycles, increases the frequencies of SCEs in Chinese hamster ovary cells (CHO) in a concentration dependent manner leading to about a 10-fold increase at 10 mM concentration. The extent of increase in the frequencies of SCEs due to 1 mM 3AB in several human cell lines has been studied, including those derived from patients suffering from genetic diseases such as ataxia telangiectasia (A-T), Fanconi's anemia (FA), and Huntington's chorea. None of these syndromes showed any increased response when compared to normal cells. 3AB, however, increased the frequencies of spontaneously occurring chromosomal aberrations in A-T and FA cells. 3AB does not influence the frequencies of SCEs induced by UV or mitomycin C (MMC) in CHO cells. However, it increases the frequencies of SCEs induced by ethyl methanesulfonate (EMS) and methyl methanesulfonate (MMS). Under the conditions in which 3AB increases the frequencies of spontaneously occurring as well as induced SCEs, it does not increase the frequencies of point mutations in hypoxanthine-guanine phosphoribosyltransferase (HGPRT) locus. 3AB does not influence the amount of repair replication following dimethylsulphate (DMS) treatment of human fibroblasts, or UV irradiated human lymphocytes.

  10. Comparison of the kinetic parameters of the truncated catalytic subunit and holoenzyme of human DNA polymerase ε (United States)

    Zahurancik, Walter J.; Baranovskiy, Andrey G.; Tahirov, Tahir H.; Suo, Zucai


    Numerous genetic studies have provided compelling evidence to establish DNA polymerase ε (Polε) as the primary DNA polymerase responsible for leading strand synthesis during eukaryotic nuclear genome replication. Polε is a heterotetramer consisting of a large catalytic subunit that contains the conserved polymerase core domain as well as a 3′ → 5′ exonuclease domain common to many replicative polymerases. In addition, Polε possesses three small subunits that lack a known catalytic activity but associate with components involved in a variety of DNA replication and maintenance processes. Previous enzymatic characterization of the Polε heterotetramer from budding yeast suggested that the small subunits slightly enhance DNA synthesis by Polε in vitro. However, similar studies of the human Polε heterote-tramer (hPolε) have been limited by the difficulty of obtaining hPolε in quantities suitable for thorough investigation of its catalytic activity. Utilization of a baculovirus expression system for overexpression and purification of hPolε from insect host cells has allowed for isolation of greater amounts of active hPolε, thus enabling a more detailed kinetic comparison between hPolε and an active N-terminal fragment of the hPolε catalytic subunit (p261N), which is readily overexpressed in Escherichia coli. Here, we report the first pre-steady-state studies of fully-assembled hPolε. We observe that the small subunits increase DNA binding by hPolε relative to p261N, but do not increase processivity during DNA synthesis on a single-stranded M13 template. Interestingly, the 3′ → 5′ exonuclease activity of hPolε is reduced relative to p261N on matched and mismatched DNA substrates, indicating that the presence of the small subunits may regulate the proofreading activity of hPolε and sway hPolε toward DNA synthesis rather than proofreading. PMID:25684708

  11. A novel small molecule inhibitor of influenza A viruses that targets polymerase function and indirectly induces interferon.

    Directory of Open Access Journals (Sweden)

    Mila Brum Ortigoza

    Full Text Available Influenza viruses continue to pose a major public health threat worldwide and options for antiviral therapy are limited by the emergence of drug-resistant virus strains. The antiviral cytokine, interferon (IFN is an essential mediator of the innate immune response and influenza viruses, like many viruses, have evolved strategies to evade this response, resulting in increased replication and enhanced pathogenicity. A cell-based assay that monitors IFN production was developed and applied in a high-throughput compound screen to identify molecules that restore the IFN response to influenza virus infected cells. We report the identification of compound ASN2, which induces IFN only in the presence of influenza virus infection. ASN2 preferentially inhibits the growth of influenza A viruses, including the 1918 H1N1, 1968 H3N2 and 2009 H1N1 pandemic strains and avian H5N1 virus. In vivo, ASN2 partially protects mice challenged with a lethal dose of influenza A virus. Surprisingly, we found that the antiviral activity of ASN2 is not dependent on IFN production and signaling. Rather, its IFN-inducing property appears to be an indirect effect resulting from ASN2-mediated inhibition of viral polymerase function, and subsequent loss of the expression of the viral IFN antagonist, NS1. Moreover, we identified a single amino acid mutation at position 499 of the influenza virus PB1 protein that confers resistance to ASN2, suggesting that PB1 is the direct target. This two-pronged antiviral mechanism, consisting of direct inhibition of virus replication and simultaneous activation of the host innate immune response, is a unique property not previously described for any single antiviral molecule.

  12. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea

    KAUST Repository

    Takahashi, Masateru; Takahashi, Etsuko; Joudeh, Luay I.; Marini, Monica; Das, Gobind; Elshenawy, Mohamed; Akal, Anastassja; Sakashita, Kosuke; Alam, Intikhab; Tehseen, Muhammad; Sobhy, Mohamed Abdelmaboud; Stingl, Ulrich; Merzaban, Jasmeen; Di Fabrizio, Enzo M.; Hamdan, Samir


    The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein’s surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.—Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

  13. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea. (United States)

    Takahashi, Masateru; Takahashi, Etsuko; Joudeh, Luay I; Marini, Monica; Das, Gobind; Elshenawy, Mohamed M; Akal, Anastassja; Sakashita, Kosuke; Alam, Intikhab; Tehseen, Muhammad; Sobhy, Mohamed A; Stingl, Ulrich; Merzaban, Jasmeen S; Di Fabrizio, Enzo; Hamdan, Samir M


    The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein's surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.-Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

  14. Putative DNA-dependent RNA polymerase in Mitochondrial Plasmid of Paramecium caudatum Stock GT704

    Directory of Open Access Journals (Sweden)

    Trina Ekawati Tallei


    Full Text Available Mitochondria of Paramecium caudatum stock GT704 has a set of four kinds of linear plasmids with sizes of 8.2, 4.1, 2.8 and 1.4 kb. The plasmids of 8.2 and 2.8 kb exist as dimers consisting of 4.1- and 1.4-kb monomers, respectively. The plasmid 2.8 kb, designated as pGT704-2.8, contains an open reading frame encodes for putative DNA-dependent RNA polymerase (RNAP. This study reveals that this RNAP belongs to superfamily of DNA/RNA polymerase and family of T7/T3 single chain RNA polymerase and those of mitochondrial plasmid of fungi belonging to Basidiomycota and Ascomycota. It is suggested that RNAP of pGT704-2.8 can perform transcription without transcription factor as promoter recognition. Given that only two motifs were found, it could not be ascertained whether this RNAP has a full function independently or integrated with mtDNA in carrying out its function.

  15. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea

    KAUST Repository

    Takahashi, Masateru


    The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein’s surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.—Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

  16. DNA polymerase inhibitors and heat alter fixation of postirradiation sublethal damage in L5178Y-S cells

    International Nuclear Information System (INIS)

    Kapiszewska, M.; Szumiel, I.; Lange, C.S.


    We have used the inhibitor of DNA polymerase alpha, aphidicolin (apc) (0.5 μg/ml for 1 h), or that of DNA polymerase beta, dideoxythymidine triphosphate (ddTTP) (5 μg/ml), as well as heat (15 min at 43 deg C) to examine fixation of sublethal damage (SLD) induced by X-rays in L5178Y-S (LY-S) cells. This cell line has the unique property of responding to split X-ray doses at 37 deg C by decreased survival. This effect was partly abolished by heating the cells before irradiation with the second dose; the protection was most pronounced when the cells were heated 30-120 min. after the first dose of radiation. Since similar changes in postirradiation survival occurred when ddTTP was applied, we suggest that heat induces a loss of polymerase beta activity. Apc gave a smaller protective effect. We interpreted these results as suggesting that mismatching takes place during DNA semiconservative replication or repair; inhibition of replication results in survival increase, by preventing misrepair. A proper timing of treatment with the inhibitors or heat is essential to obtain the sparing effect, i.e. to prevent SLD fixation. 27 refs., 3 figs., 1 tab. (author)

  17. A molecular biological study on the identification of the molecular species of DNA polymerases for repairing radiation-damaged DNA and the factors modifying the mutation rate

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Koichi; Inoue, Shuji [National Inst. of Health and Nutrition, Tokyo (Japan)


    Aiming at prevention and treatment of radiation damages, the authors have been investigating DNA damages by X-ray and its repairing mechanism, however, the molecular species of DNA polymerase which mediate the repairing could not been identified by biochemical methods using various inhibitors because of their low specificity. Therefore, in this study, anti-sense oligonucleotides for DNA polymerase {alpha}, {delta} and {epsilon} were obtained by chemical synthesis and transduced into human fibroblast cell, NB1RGB by three methods; endocytotic method, electroporation method and lipofection method. For the first method, the addition of those peptides into the cell culture at 5 {mu}M inhibited the polymerase activity by up to 30% and it was economically difficult to use at higher concentrations than it. For the electroporation method, different conditions were tested in the respects of initial potential, time constant and buffer, but the uptake of thimidine was scarcely decreased in the surviving cells, suggesting that the surviving rate would be short in the cells electroporated with those anti-sense peptides. For the lipofection method, among several cationic lipids tested, lipofectamine significantly enlarged the decrease of thymidine uptake by anti-sense {delta}, however it was considered that its application to DNA repairing is difficult because lipofectamine is strongly cytotoxic. Therefore, construction of a vector which allows to express anti-sense RNA in those cells is undertaken. (M.N.)

  18. A molecular biological study on the identification of the molecular species of DNA polymerases for repairing radiation-damaged DNA and the factors modifying the mutation rate

    International Nuclear Information System (INIS)

    Yamada, Koichi; Inoue, Shuji


    Aiming at prevention and treatment of radiation damages, the authors have been investigating DNA damages by X-ray and its repairing mechanism, however, the molecular species of DNA polymerase which mediate the repairing could not been identified by biochemical methods using various inhibitors because of their low specificity. Therefore, in this study, anti-sense oligonucleotides for DNA polymerase α, δ and ε were obtained by chemical synthesis and transduced into human fibroblast cell, NB1RGB by three methods; endocytotic method, electroporation method and lipofection method. For the first method, the addition of those peptides into the cell culture at 5 μM inhibited the polymerase activity by up to 30% and it was economically difficult to use at higher concentrations than it. For the electroporation method, different conditions were tested in the respects of initial potential, time constant and buffer, but the uptake of thimidine was scarcely decreased in the surviving cells, suggesting that the surviving rate would be short in the cells electroporated with those anti-sense peptides. For the lipofection method, among several cationic lipids tested, lipofectamine significantly enlarged the decrease of thymidine uptake by anti-sense δ, however it was considered that its application to DNA repairing is difficult because lipofectamine is strongly cytotoxic. Therefore, construction of a vector which allows to express anti-sense RNA in those cells is undertaken. (M.N.)

  19. Structural insight into dynamic bypass of the major cisplatin-DNA adduct by Y-family polymerase Dpo4

    Energy Technology Data Exchange (ETDEWEB)

    Wong, Jimson H.Y.; Brown, Jessica A.; Suo, Zucai; Blum, Paul; Nohmi, Takehiko; Ling, Hong (OSU); (NINA-Japan); (UNL); (UWO)


    Y-family DNA polymerases bypass Pt-GG, the cisplatin-DNA double-base lesion, contributing to the cisplatin resistance in tumour cells. To reveal the mechanism, we determined three structures of the Y-family DNA polymerase, Dpo4, in complex with Pt-GG DNA. The crystallographic snapshots show three stages of lesion bypass: the nucleotide insertions opposite the 3{prime}G (first insertion) and 5{prime}G (second insertion) of Pt-GG, and the primer extension beyond the lesion site. We observed a dynamic process, in which the lesion was converted from an open and angular conformation at the first insertion to a depressed and nearly parallel conformation at the subsequent reaction stages to fit into the active site of Dpo4. The DNA translocation-coupled conformational change may account for additional inhibition on the second insertion reaction. The structures illustrate that Pt-GG disturbs the replicating base pair in the active site, which reduces the catalytic efficiency and fidelity. The in vivo relevance of Dpo4-mediated Pt-GG bypass was addressed by a dpo-4 knockout strain of Sulfolobus solfataricus, which exhibits enhanced sensitivity to cisplatin and proteomic alterations consistent with genomic stress.

  20. DNA origami as biocompatible surface to match single-molecule and ensemble experiments (United States)

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip


    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

  1. Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters. (United States)

    Yadav, Hemendra; Sharma, Pulkit


    Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp.) Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B. (United States)

    Chénard, Caroline; Wirth, Jennifer F; Suttle, Curtis A


    Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. Filamentous cyanobacteria belonging to the genus Nostoc are widespread and ecologically important in freshwater, yet little is known about the genomic content of their viruses. Here we report the first genomic analysis of cyanophages infecting

  3. The elastic theory of a single DNA molecule

    Indian Academy of Sciences (India)

    methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.

  4. The Crystal Structure of PF-8, the DNA Polymerase Accessory Subunit from Kaposi's Sarcoma-Associated Herpesvirus

    Energy Technology Data Exchange (ETDEWEB)

    Baltz, Jennifer L.; Filman, David J.; Ciustea, Mihai; Silverman, Janice Elaine Y.; Lautenschlager, Catherine L.; Coen, Donald M.; Ricciardi, Robert P.; Hogle, James M.; (UPENN)


    Kaposi's sarcoma-associated herpesvirus is an emerging pathogen whose mechanism of replication is poorly understood. PF-8, the presumed processivity factor of Kaposi's sarcoma-associated herpesvirus DNA polymerase, acts in combination with the catalytic subunit, Pol-8, to synthesize viral DNA. We have solved the crystal structure of residues 1 to 304 of PF-8 at a resolution of 2.8 {angstrom}. This structure reveals that each monomer of PF-8 shares a fold common to processivity factors. Like human cytomegalovirus UL44, PF-8 forms a head-to-head dimer in the form of a C clamp, with its concave face containing a number of basic residues that are predicted to be important for DNA binding. However, there are several differences with related proteins, especially in loops that extend from each monomer into the center of the C clamp and in the loops that connect the two subdomains of each protein, which may be important for determining PF-8's mode of binding to DNA and to Pol-8. Using the crystal structures of PF-8, the herpes simplex virus catalytic subunit, and RB69 bacteriophage DNA polymerase in complex with DNA and initial experiments testing the effects of inhibition of PF-8-stimulated DNA synthesis by peptides derived from Pol-8, we suggest a model for how PF-8 might form a ternary complex with Pol-8 and DNA. The structure and the model suggest interesting similarities and differences in how PF-8 functions relative to structurally similar proteins.

  5. Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET


    Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William


    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...

  6. A Single-Molecule Barcoding System using Nanoslits for DNA Analysis (United States)

    Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

    Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

  7. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep (United States)

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon


    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  8. Dynamics of translocation and substrate binding in individual complexes formed with active site mutants of {phi}29 DNA polymerase. (United States)

    Dahl, Joseph M; Wang, Hongyun; Lázaro, José M; Salas, Margarita; Lieberman, Kate R


    The Φ29 DNA polymerase (DNAP) is a processive B-family replicative DNAP. Fluctuations between the pre-translocation and post-translocation states can be quantified from ionic current traces, when individual Φ29 DNAP-DNA complexes are held atop a nanopore in an electric field. Based upon crystal structures of the Φ29 DNAP-DNA binary complex and the Φ29 DNAP-DNA-dNTP ternary complex, residues Tyr-226 and Tyr-390 in the polymerase active site were implicated in the structural basis of translocation. Here, we have examined the dynamics of translocation and substrate binding in complexes formed with the Y226F and Y390F mutants. The Y226F mutation diminished the forward and reverse rates of translocation, increased the affinity for dNTP in the post-translocation state by decreasing the dNTP dissociation rate, and increased the affinity for pyrophosphate in the pre-translocation state. The Y390F mutation significantly decreased the affinity for dNTP in the post-translocation state by decreasing the association rate ∼2-fold and increasing the dissociation rate ∼10-fold, implicating this as a mechanism by which this mutation impedes DNA synthesis. The Y390F dissociation rate increase is suppressed when complexes are examined in the presence of Mn(2+) rather than Mg(2+). The same effects of the Y226F or Y390F mutations were observed in the background of the D12A/D66A mutations, located in the exonuclease active site, ∼30 Å from the polymerase active site. Although translocation rates were unaffected in the D12A/D66A mutant, these exonuclease site mutations caused a decrease in the dNTP dissociation rate, suggesting that they perturb Φ29 DNAP interdomain architecture.

  9. Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses

    International Nuclear Information System (INIS)

    Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.


    DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses

  10. Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

    Directory of Open Access Journals (Sweden)

    Marijn T J van Loenhout

    Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

  11. Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging. (United States)

    Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C


    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

  12. Single Molecule Atomic Force Microscopy Studies of Photosensitized Singlet Oxygen Behavior on a DNA Origami Template

    DEFF Research Database (Denmark)

    Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru


    DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....

  13. Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments

    International Nuclear Information System (INIS)

    Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.


    We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics

  14. How to determine local stretching and tension in a flow-stretched DNA molecule

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders


    We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....

  15. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

    International Nuclear Information System (INIS)

    Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.


    Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

  16. Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction. (United States)

    Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton


    A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.

  17. Yield of DNA strand breaks and their relationship to DNA polymerase I-dependent repair synthesis and ligation following x-ray exposure of toluene-treated Escherichia coli

    International Nuclear Information System (INIS)

    Billen, D.


    In Escherichia coli made permeable to nucleotides by toluene treatment, a DNA polymerase I-directed repair synthesis is observed. This is an exaggerated repair synthesis which can be abruptly terminated by the addition of the DNA ligase cofactor, nicotinamide adenine dinucleotide. This communication describes experiments which bear on the relationship between measurable strand breaks, DNA polymerase I-directed, exaggerated repair synthesis, and strand-break repair

  18. Characterization of Mycobacterium smegmatis PolD2 and PolD1 as RNA/DNA polymerases homologous to the POL domain of bacterial DNA ligase D. (United States)

    Zhu, Hui; Bhattarai, Hitesh; Yan, Han-Guang; Shuman, Stewart; Glickman, Michael S


    Mycobacteria exploit nonhomologous end-joining (NHEJ) to repair DNA double-strand breaks. The core NHEJ machinery comprises the homodimeric DNA end-binding protein Ku and DNA ligase D (LigD), a modular enzyme composed of a C-terminal ATP-dependent ligase domain (LIG), a central 3'-phosphoesterase domain (PE), and an N-terminal polymerase domain (POL). LigD POL is proficient at adding templated and nontemplated deoxynucleotides and ribonucleotides to DNA ends in vitro and is the catalyst in vivo of unfaithful NHEJ events involving nontemplated single-nucleotide additions to blunt DSB ends. Here, we identify two mycobacterial proteins, PolD1 and PolD2, as stand-alone homologues of the LigD POL domain. Biochemical characterization of PolD1 and PolD2 shows that they resemble LigD POL in their monomeric quaternary structures, their ability to add templated and nontemplated nucleotides to primer-templates and blunt ends, and their preference for rNTPs versus dNTPs. Deletion of polD1, polD2, or both from a Mycobacterium smegmatis strain carrying an inactivating mutation in LigD POL failed to reveal a role for PolD1 or PolD2 in templated nucleotide additions during NHEJ of 5'-overhang DSBs or in clastogen resistance. Whereas our results document the existence and characteristics of new stand-alone members of the LigD POL family of RNA/DNA polymerases, they imply that other polymerases can perform fill-in synthesis during mycobacterial NHEJ.

  19. Pre-Steady State Kinetic Investigation of the Incorporation of Anti-Hepatitis B Nucleotide Analogs Catalyzed by Non-Canonical Human DNA Polymerases (United States)

    Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai


    Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702

  20. One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip. (United States)

    Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu


    A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

  1. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp. Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B

    Directory of Open Access Journals (Sweden)

    Caroline Chénard


    Full Text Available Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages.

  2. Error-prone bypass of O6-methylguanine by DNA polymerase of Pseudomonas aeruginosa phage PaP1. (United States)

    Gu, Shiling; Xiong, Jingyuan; Shi, Ying; You, Jia; Zou, Zhenyu; Liu, Xiaoying; Zhang, Huidong


    O 6 -Methylguanine (O 6 -MeG) is highly mutagenic and is commonly found in DNA exposed to methylating agents, generally leads to G:C to A:T mutagenesis. To study DNA replication encountering O 6 -MeG by the DNA polymerase (gp90) of P. aeruginosa phage PaP1, we analyzed steady-state and pre-steady-state kinetics of nucleotide incorporation opposite O 6 -MeG by gp90 exo - . O 6 -MeG partially inhibited full-length extension by gp90 exo - . O 6 -MeG greatly reduces dNTP incorporation efficiency, resulting in 67-fold preferential error-prone incorporation of dTTP than dCTP. Gp90 exo - extends beyond T:O 6 -MeG 2-fold more efficiently than C:O 6 -MeG. Incorporation of dCTP opposite G and incorporation of dCTP or dTTP opposite O 6 -MeG show fast burst phases. The pre-steady-state incorporation efficiency (k pol /K d,dNTP ) is decreased in the order of dCTP:G>dTTP:O 6 -MeG>dCTP:O 6 -MeG. The presence of O 6 -MeG at template does not affect the binding affinity of polymerase to DNA but it weakened their binding in the presence of dCTP and Mg 2+ . Misincorporation of dTTP opposite O 6 -MeG further weakens the binding affinity of polymerase to DNA. The priority of dTTP incorporation opposite O 6 -MeG is originated from the fact that dTTP can induce a faster conformational change step and a faster chemical step than dCTP. This study reveals that gp90 bypasses O 6 -MeG in an error-prone manner and provides further understanding in DNA replication encountering mutagenic alkylation DNA damage for P. aeruginosa phage PaP1. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules (United States)

    Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

    DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

  4. Structural relationships among the multiple forms of DNA-dependent RNA polymerase II from cultured parsley cells

    International Nuclear Information System (INIS)

    Link, G.; Bogorad, L.; Kidd, G.H.; Richter, G.


    DNA-dependent RNA polymerase II (or B) was purified from cultured parsley cells, and its molecular structure was examined in detail. Upon centrifugation through glycerol gradients, RNA polymerase II sediments as a single band with an apparent sedimentation constant of 15S. No contamination with RNA polymerases I or III could be detected when the activity of purified RNA polymerase II was assayed in the presence of high concentrations of α-amanitin. Analysis of purified RNA polymerase II be nondenaturing and denaturing polyacrylamide gel electrophoresis revealed that this enzyme exists in multiple forms. They were designated II(O), II(A), and II(B). It is suggested that each form has a subunit of Mr = 140000 as well as smaller polypeptides in common. They differ, however, in the molecular weights of their largest subunits which is 220000 in form II(O), 200000 in form II(A), and 180000 in form II(B). These large subunits were labelled with 125 I, digested with trypsin, and tryptic digests were compared by two-dimensional analysis on thin-layer plates (Elder et al. (1977) J. Biol. Chem. 252, 6510-6515). Fingerprints of tryptic digests from the polypeptides with Mr = 220000, Mr = 200000, and Mr = 180000 were similar. It is, therefore, suggested that these subunits are stucturally related. A tryptic digest was also produced from the subunit with Mr = 140000. Its fingerprint was found to yield a considerably different distribution of peptides as compared to those from the three large subunits. (orig.) [de

  5. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases (United States)

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef


    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  6. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.


    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  7. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev


    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory

  8. Altered Hematopoiesis in Mice Lacking DNA Polymerase μ Is Due to Inefficient Double-Strand Break Repair (United States)

    Lucas, Daniel; Escudero, Beatriz; Ligos, José Manuel; Segovia, Jose Carlos; Estrada, Juan Camilo; Terrados, Gloria; Blanco, Luis; Samper, Enrique; Bernad, Antonio


    Polymerase mu (Polμ) is an error-prone, DNA-directed DNA polymerase that participates in non-homologous end-joining (NHEJ) repair. In vivo, Polμ deficiency results in impaired Vκ-Jκ recombination and altered somatic hypermutation and centroblast development. In Polμ−/− mice, hematopoietic development was defective in several peripheral and bone marrow (BM) cell populations, with about a 40% decrease in BM cell number that affected several hematopoietic lineages. Hematopoietic progenitors were reduced both in number and in expansion potential. The observed phenotype correlates with a reduced efficiency in DNA double-strand break (DSB) repair in hematopoietic tissue. Whole-body γ-irradiation revealed that Polμ also plays a role in DSB repair in non-hematopoietic tissues. Our results show that Polμ function is required for physiological hematopoietic development with an important role in maintaining early progenitor cell homeostasis and genetic stability in hematopoietic and non-hematopoietic tissues. PMID:19229323

  9. Viewing Human DNA Polymerase β Faithfully and Unfaithfully Bypass an Oxidative Lesion by Time-Dependent Crystallography (United States)

    Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; Suo, Zucai


    One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2′-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5′-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5′-triphosphate (dATP). Here, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg2+ appeared during the process of phosphodiester bond formation and was located between the reacting α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3′-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion. PMID:25825995

  10. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir


    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  11. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark


    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  12. Probe Microscopic Studies of DNA Molecules on Carbon Nanotubes

    Directory of Open Access Journals (Sweden)

    Kazuo Umemura


    Full Text Available Hybrids of DNA and carbon nanotubes (CNTs are promising nanobioconjugates for nanobiosensors, carriers for drug delivery, and other biological applications. In this review, nanoscopic characterization of DNA-CNT hybrids, in particular, characterization by scanning probe microscopy (SPM, is summarized. In many studies, topographical imaging by atomic force microscopy has been performed. However, some researchers have demonstrated advanced SPM operations in order to maximize its unique and valuable functions. Such sophisticated approaches are attractive and will have a significant impact on future studies of DNA-CNT hybrids.

  13. DNA-Based Single-Molecule Electronics: From Concept to Function. (United States)

    Wang, Kun


    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  14. DNA-Based Single-Molecule Electronics: From Concept to Function (United States)


    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  15. Effects of Environmental Factors and Metallic Electrodes on AC Electrical Conduction Through DNA Molecule. (United States)

    Abdalla, S; Obaid, A; Al-Marzouki, F M


    Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA moleculeDNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a

  16. The involvement of topoisomerases and DNA polymerase I in the mechanism of induced thermal and radiation resistance in yeast

    International Nuclear Information System (INIS)

    Boreham, D.R.; Trivedi, A.; Weinberger, P.; Mitchel, R.E.


    Either an ionizing radiation exposure or a heat shock is capable of inducing both thermal tolerance and radiation resistance in yeast. Yeast mutants, deficient in topoisomerase I, in topoisomerase II, or in DNA polymerase I, were used to investigate the mechanism of these inducible resistances. The absence of either or both topoisomerase activities did not prevent induction of either heat or radiation resistance. However, if both topoisomerase I and II activities were absent, the sensitivity of yeast to become thermally tolerant (in response to a heat stress) was markedly increased. The absence of only topoisomerase I activity (top1) resulted in the constitutive expression of increased radiation resistance equivalent to that induced by a heat shock in wild-type cells, and the topoisomerase I-deficient cells were not further inducible by heat. This heat-inducible component of radiation resistance (or its equivalent constitutive expression in top1 cells) was, in turn, only a portion of the full response inducible by radiation. The absence of polymerase I activity had no detectable effect on either response. Our results indicate that the actual systems that confer resistance to heat or radiation are independent of either topoisomerase activity or DNA polymerase function, but suggest that topoisomerases may have a regulatory role during the signaling of these mechanisms. The results of our experiments imply that maintenance of correct DNA topology prevents induction of the heat-shock response, and that heat-shock induction of a component of the full radiation resistance in yeast may be the consequence of topoisomerase I inactivation

  17. Transition-state destabilization reveals how human DNA polymerase β proceeds across the chemically unstable lesion N7-methylguanine (United States)

    Ouzon-Shubeita, Hala; Lee, Seongmin


    N7-Methyl-2′-deoxyguanosine (m7dG) is the predominant lesion formed by methylating agents. A systematic investigation on the effect of m7dG on DNA replication has been difficult due to the chemical instability of m7dG. To gain insights into the m7dG effect, we employed a 2′-fluorine-mediated transition-state destabilzation strategy. Specifically, we determined kinetic parameters for dCTP insertion opposite a chemically stable m7dG analogue, 2′-fluoro-m7dG (Fm7dG), by human DNA polymerase β (polβ) and solved three X-ray structures of polβ in complex with the templating Fm7dG paired with incoming dCTP or dTTP analogues. The kinetic studies reveal that the templating Fm7dG slows polβ catalysis ∼300-fold, suggesting that m7dG in genomic DNA may impede replication by some DNA polymerases. The structural analysis reveals that Fm7dG forms a canonical Watson–Crick base pair with dCTP, but metal ion coordination is suboptimal for catalysis in the polβ-Fm7dG:dCTP complex, which partially explains the slow insertion of dCTP opposite Fm7dG by polβ. In addition, the polβ-Fm7dG:dTTP structure shows open protein conformations and staggered base pair conformations, indicating that N7-methylation of dG does not promote a promutagenic replication. Overall, the first systematic studies on the effect of m7dG on DNA replication reveal that polβ catalysis across m7dG is slow, yet highly accurate. PMID:24966350

  18. Alkylsulfanylphenyl derivatives of cytosine and 7-deazaadenine nucleosides, nucleotides and nucleoside triphosphates. Synthesis, polymerase incorporation to DNA and electrochemical study

    Czech Academy of Sciences Publication Activity Database

    Macíčková-Cahová, Hana; Pohl, Radek; Horáková Brázdilová, Petra; Havran, Luděk; Špaček, Jan; Fojta, Miroslav; Hocek, Michal


    Roč. 17, č. 21 (2011), s. 5833-5841 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06035; GA MŠk LC512; GA ČR GA203/09/0317; GA AV ČR(CZ) IAA400040901 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA polymerases * electrochemistry * nucleosides * nucleotides * organosulfur compounds Subject RIV: CC - Organic Chemistry Impact factor: 5.925, year: 2011

  19. Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation (United States)

    Zhang, Yuning; Reisner, Walter


    Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

  20. Animal DNA identification in food products and animal feed by real time polymerase chain reaction method

    Directory of Open Access Journals (Sweden)

    Людмила Мар’янівна Іщенко


    Full Text Available Approbation of diagnostic tests for species identification of beef, pork and chicken by real time polymerase chain reaction method was done. Meat food, including heat treated and animal feed, was used for research. The fact of inconsistencies was revealed for product composition of some meat products that is marked by manufacturer 

  1. Single-molecule analysis of DNA replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel

    The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the

  2. Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation. (United States)

    Izanloo, Cobra


    An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

  3. Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules

    International Nuclear Information System (INIS)

    Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.


    The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage

  4. Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates

    DEFF Research Database (Denmark)

    Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru


    Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...

  5. Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA

    Czech Academy of Sciences Publication Activity Database

    Hanzálek, Petr; Kypr, Jaroslav


    Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001

  6. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.


    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  7. Real-time single-molecule observation of rolling-circle DNA replication

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van


    We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities

  8. See me, feel me: methods to concurrently visualize and manipulate single DNA molecules and associated proteins

    NARCIS (Netherlands)

    van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.


    Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of

  9. Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy (United States)

    Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto


    DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

  10. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species. (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E


    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  11. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe


    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.

  12. Babesia bovis and B. bigemina DNA detected in cattle and ticks from Zimbabwe by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    I. Smeenk


    Full Text Available From blood collected from 94 cattle at 12 locations in the eastern and northeastern areas of Zimbabwe, DNA was extracted and analysed by polymerase chain reaction with primers previously reported to be specific for Babesia bigemina and Babesia bovis. Overall, DNA of Babesia bigemina was detected in the blood of 33/94 (35 % cattle and DNA from B. bovis was detected in 27/58 (47 % of cattle. The prevalence of DNA of B. bigemina was significantly higher in young animals (<2 years (23/46 than in animals over 2 years of age (10/48; (chi2 = 8.77; P < 0.01 %. Although tick sampling was not thorough, Boophilus decoloratus could be collected at 7/9 sites sampled and Boophilus microplus at 4/9 sites. Of the 20 B. decoloratus allowed to oviposit before PCR analysis, 1 (5 % contained DNA that could be amplified with primers for B. bigemina while 12 (60 % were positive with primers for B. bovis. Of the B. microplus allowed to oviposit, 11/16 (69 % were positive for B. bovis DNAby PCR and 2/16 (12 % were positive for B. bigemina.

  13. Roles of POLD4, smallest subunit of DNA polymerase {delta}, in nuclear structures and genomic stability of human cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Qin Miao [Division of Molecular Carcinogenesis, Center for Neurological Diseases and Cancer, Nagoya University Graduate School of Medicine, Nagoya (Japan); Akashi, Tomohiro [Division of Molecular Mycology and Medicine, Center for Neurological Diseases and Cancer, Nagoya University Graduate School of Medicine, Nagoya (Japan); Masuda, Yuji; Kamiya, Kenji [Research Institute for Radiation Biology and Medicine, Hiroshima University, Hiroshima 734-8553 (Japan); Takahashi, Takashi [Division of Molecular Carcinogenesis, Center for Neurological Diseases and Cancer, Nagoya University Graduate School of Medicine, Nagoya (Japan); Suzuki, Motoshi, E-mail: [Division of Molecular Carcinogenesis, Center for Neurological Diseases and Cancer, Nagoya University Graduate School of Medicine, Nagoya (Japan)


    Mammalian DNA polymerase {delta} (pol {delta}) is essential for DNA replication, though the functions of this smallest subunit of POLD4 have been elusive. We investigated pol {delta} activities in vitro and found that it was less active in the absence of POLD4, irrespective of the presence of the accessory protein PCNA. shRNA-mediated reduction of POLD4 resulted in a marked decrease in colony formation activity by Calu6, ACC-LC-319, and PC-10 cells. We also found that POLD4 reduction was associated with an increased population of karyomere-like cells, which may be an indication of DNA replication stress and/or DNA damage. The karyomere-like cells retained an ability to progress through the cell cycle, suggesting that POLD4 reduction induces modest genomic instability, while allowing cells to grow until DNA damage reaches an intolerant level. Our results indicate that POLD4 is required for the in vitro pol {delta} activity, and that it functions in cell proliferation and maintenance of genomic stability of human cells.

  14. Roles of POLD4, smallest subunit of DNA polymerase δ, in nuclear structures and genomic stability of human cells

    International Nuclear Information System (INIS)

    Huang, Qin Miao; Akashi, Tomohiro; Masuda, Yuji; Kamiya, Kenji; Takahashi, Takashi; Suzuki, Motoshi


    Mammalian DNA polymerase δ (pol δ) is essential for DNA replication, though the functions of this smallest subunit of POLD4 have been elusive. We investigated pol δ activities in vitro and found that it was less active in the absence of POLD4, irrespective of the presence of the accessory protein PCNA. shRNA-mediated reduction of POLD4 resulted in a marked decrease in colony formation activity by Calu6, ACC-LC-319, and PC-10 cells. We also found that POLD4 reduction was associated with an increased population of karyomere-like cells, which may be an indication of DNA replication stress and/or DNA damage. The karyomere-like cells retained an ability to progress through the cell cycle, suggesting that POLD4 reduction induces modest genomic instability, while allowing cells to grow until DNA damage reaches an intolerant level. Our results indicate that POLD4 is required for the in vitro pol δ activity, and that it functions in cell proliferation and maintenance of genomic stability of human cells.

  15. Comparison of real-time and quantitative polymerase chain reaction assays in detection of cytomegalovirus DNA in clinical specimens

    International Nuclear Information System (INIS)

    Gokahmetoglu, S.; Deniz, E.


    To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)

  16. An RNA polymerase II-and AGO4-associated protein acts in RNA-directed DNA methylation

    KAUST Repository

    Gao, Zhihuan


    DNA methylation is an important epigenetic mark in many eukaryotes. In plants, 24-nucleotide small interfering RNAs (siRNAs) bound to the effector protein, Argonaute 4 (AGO4), can direct de novo DNA methylation by the methyltransferase DRM2 (refs 2, 4-6). Here we report a new regulator of RNA-directed DNA methylation (RdDM) in Arabidopsis: RDM1. Loss-of-function mutations in the RDM1 gene impair the accumulation of 24-nucleotide siRNAs, reduce DNA methylation, and release transcriptional gene silencing at RdDM target loci. RDM1 encodes a small protein that seems to bind single-stranded methyl DNA, and associates and co-localizes with RNA polymerase II (Pol II, also known as NRPB), AGO4 and DRM2 in the nucleus. Our results indicate that RDM1 is a component of the RdDM effector complex and may have a role in linking siRNA production with pre-existing or de novo cytosine methylation. Our results also indicate that, although RDM1 and Pol V (also known as NRPE) may function together at some RdDM target sites in the peri-nucleolar siRNA processing centre, Pol II rather than Pol V is associated with the RdDM effector complex at target sites in the nucleoplasm. © 2010 Macmillan Publishers Limited. All rights reserved.

  17. Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3'-5' exonuclease activity. (United States)

    Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji


    The X-family DNA polymerases (PolXs) comprise a highly conserved DNA polymerase family found in all kingdoms. Mammalian PolXs are known to be involved in several DNA-processing pathways including repair, but the cellular functions of bacterial PolXs are less known. Many bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain at their C-termini in addition to a PolX core (POLXc) domain, and possess 3'-5' exonuclease activity. Although both domains are highly conserved in bacteria, their molecular functions, especially for a PHP domain, are unknown. We found Thermus thermophilus HB8 PolX (ttPolX) has Mg(2+)/Mn(2+)-dependent DNA/RNA polymerase, Mn(2+)-dependent 3'-5' exonuclease and DNA-binding activities. We identified the domains of ttPolX by limited proteolysis and characterized their biochemical activities. The POLXc domain was responsible for the polymerase and DNA-binding activities but exonuclease activity was not detected for either domain. However, the POLXc and PHP domains interacted with each other and a mixture of the two domains had Mn(2+)-dependent 3'-5' exonuclease activity. Moreover, site-directed mutagenesis revealed catalytically important residues in the PHP domain for the 3'-5' exonuclease activity. Our findings provide a molecular insight into the functional domain organization of bacterial PolXs, especially the requirement of the PHP domain for 3'-5' exonuclease activity.

  18. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.


    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  19. A 3D-DNA Molecule Made of PlayMais (United States)

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl


    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  20. Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems

    CERN Document Server

    Williams, Mark C


    This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...

  1. Are There Mutator Polymerases?

    Directory of Open Access Journals (Sweden)

    Miguel Garcia-Diaz


    Full Text Available DNA polymerases are involved in different cellular events, including genome replication and DNA repair. In the last few years, a large number of novel DNA polymerases have been discovered, and the biochemical analysis of their properties has revealed a long list of intriguing features. Some of these polymerases have a very low fidelity and have been suggested to play mutator roles in different processes, like translesion synthesis or somatic hypermutation. The current view of these processes is reviewed, and the current understanding of DNA polymerases and their role as mutator enzymes is discussed.

  2. DNA polymerase I is crucial for the repair of potentially lethal damage caused by the indirect effects of X irradiation in Escherichia coli

    International Nuclear Information System (INIS)

    Billen, D.


    The radiosensitivity of an Escherichia coli mutant deficient in DNA polymerase I was measured in the presence of OH radical scavengers. The extreme X-ray sensitivity of the mutant could be abolished by OH radical scavengers if a sufficiently high level of radioprotector was present. There was a direct correlation between the OH radical scavenging activity of the chemicals tested (NO 2 - , n-butanol, glycerol, t-amyl alcohol, and t-butanol) and their protective ability. The author interprets the data as showing that the indirect actions of X rays (primarily OH radicals) result in major damage to the bacterial DNA which in large part consists of potentially lethal lesions. This potentially lethal damage is repaired through an enzymatic pathway requiring DNA polymerase I. I. In the mutant lacking DNA polymerase I, these potentially lethal lesions are expressed as cell lethality

  3. Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET. (United States)

    Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W


    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Separation and Characterization of DNA Molecules and Intermolecular Interactions in Pressure-Driven Micro Flow (United States)

    Friedrich, Sarah; Wang, Tza-Huei

    Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.

  5. Electrochemical single-molecule conductivity of duplex and quadruplex DNA

    DEFF Research Database (Denmark)

    Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens


    Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redo...

  6. DNA minor groove binding of small molecules: Experimental and ...

    Indian Academy of Sciences (India)


    Abstract. Eight indole derivatives were studied for their DNA binding ability using fluorescence quenching and molecular docking methods. These indole compounds have structural moieties similar as in few indole alkaloids. Experimental and theoretical studies have suggested that indole derivatives bind in the minor ...

  7. Radioprotection of DNA molecule by oxido-reduction's coenzymes

    International Nuclear Information System (INIS)

    Araos, M.S.; Fernandez, M.; Tomicic, I.; Toha, J.C.


    The radio protective action of respiratory coenzymes on DNA-water solutions is studied after irradiation with a 60 Co source. Coenzymes were used separately or in mixtures of their oxidized and reduced forms. The dose relative factor (DRF) values evaluated by uv absorbancy measurements of DNA damage were high: 18.03 for the (NAD-FAD-quinone) mixture (a respiratory chain model); 14.91 for (quinone-hydroquinone) mixtures; 14.46 for quinone; 14.27 for hydroquinone; 12.49 for FAD; 7.21 for the (NAD-NADH) mixture; 6.48 for NADH and 3.79 for NAD. No parallelism was found between the DNA coenzymes strong interactions and their protective action, performed by overcoming the indirect radiation damage. Besides, uv irradiation studies give no support to protection through direct energy transfer processes from excited DNA to coenzymes. The high efficiency of the mixtures of oxidized-reduced respiratory coenzymes is discussed in terms of simultaneous and equivalent trapping of recombinable radicals. The high tolerance of these protectors in living cells is emphasized. (author)

  8. Morse potential in DNA molecule – An experiment proposal

    Indian Academy of Sciences (India)


    Jul 27, 2012 ... We rely on the helicoidal Peyrard-Bishop model for DNA dynamics. Interaction between nucleotides at a same site belonging to different strands is modelled by a Morse potential energy. This potential depends on two parameters that are different for AT and CG pairs, which is a possible source for ...

  9. The role of the PHP domain associated with DNA polymerase X from Thermus thermophilus HB8 in base excision repair. (United States)

    Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji


    Base excision repair (BER) is one of the most commonly used DNA repair pathways involved in genome stability. X-family DNA polymerases (PolXs) play critical roles in BER, especially in filling single-nucleotide gaps. In addition to a polymerase core domain, bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain with phosphoesterase activity which is also required for BER. However, the role of the PHP domain of PolX in bacterial BER remains unresolved. We found that the PHP domain of Thermus thermophilus HB8 PolX (ttPolX) functions as two types of phosphoesterase in BER, including a 3'-phosphatase and an apurinic/apyrimidinic (AP) endonuclease. Experiments using T. thermophilus HB8 cell lysates revealed that the majority of the 3'-phosphatase and AP endonuclease activities are attributable to the another phosphoesterase in T. thermophilus HB8, endonuclease IV (ttEndoIV). However, ttPolX possesses significant 3'-phosphatase activity in ΔttendoIV cell lysate, indicating possible complementation. Our experiments also reveal that there are only two enzymes that display the 3'-phosphatase activity in the T. thermophilus HB8 cell, ttPolX and ttEndoIV. Furthermore, phenotypic analysis of ΔttpolX, ΔttendoIV, and ΔttpolX/ΔttendoIV using hydrogen peroxide and sodium nitrite supports the hypothesis that ttPolX functions as a backup for ttEndoIV in BER. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Directory of Open Access Journals (Sweden)

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  11. Conjugation of Organic Molecules to DNA and Their Application in DNA Nanotechnology

    DEFF Research Database (Denmark)

    Olsen, Eva Maria


    Denne PhD afhandling præsenterer fire kapitler, som omhandler det videnskabelige område DNA nanoteknologi. Kapitel 1 er en general introduktion til DNA nanoteknologi, som først beskriver opbygningen af DNA og efter flere underkapitler slutter med en gennemgang af nogle fantastiske dynamiske DNA s...

  12. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments. (United States)

    Stigter, Dirk


    Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in